WO2008153568A1 - Chorionic villus derived cells - Google Patents

Chorionic villus derived cells Download PDF


Publication number
WO2008153568A1 PCT/US2007/071150 US2007071150W WO2008153568A1 WO 2008153568 A1 WO2008153568 A1 WO 2008153568A1 US 2007071150 W US2007071150 W US 2007071150W WO 2008153568 A1 WO2008153568 A1 WO 2008153568A1
Prior art keywords
homo sapiens
Prior art date
Application number
Other languages
French (fr)
Alireza Rezania
Original Assignee
Lifescan, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lifescan, Inc. filed Critical Lifescan, Inc.
Priority to PCT/US2007/071150 priority Critical patent/WO2008153568A1/en
Publication of WO2008153568A1 publication Critical patent/WO2008153568A1/en



    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues ; Not used, see subgroups
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0605Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues ; Not used, see subgroups
    • C12N5/0602Vertebrate cells
    • C12N5/0676Pancreatic cells
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/38Hormones with nuclear receptors
    • C12N2501/385Hormones with nuclear receptors of the family of the retinoic acid recptor, e.g. RAR, RXR; Peroxisome proliferator-activated receptor [PPAR]
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells


This invention relates to an expandable population of chorionic villus-derived cells that can be differentiated into a β-cell lineage. This invention also provides methods for isolating and expanding such chorionic villus-derived cells, as well as related methods and compositions for utilizing such cells in the therapeutic treatment of diabetes.



[0001] This application claims the benefit of U.S. Provisional application 60/804597, filed June 13, 2006.


[0002] This invention relates to an expandable population of chorionic villus-derived cells that can be differentiated into a β-cell lineage. This invention also provides methods for isolating and expanding such chorionic villus-derived cells, as well as related methods and compositions for utilizing such cells in the therapeutic treatment of diabetes.


[0003] Loss of organ function can result from congenital defects, injury or disease. One example of a disease causing loss of organ function is diabetes mellitus, or diabetes. Most cases of diabetes fall into two clinical types: Type 1, also known as juvenile onset diabetes, or insulin dependent diabetes mellitus (IDDM), and Type 2, also known as adult-onset diabetes. Each type has a different prognosis, treatment, and cause. Both types are characterized by the patient's inability to regulate their blood glucose levels. As a consequence, blood glucose levels rise to high values because glucose cannot enter cells to meet metabolic demands. This inability to properly metabolize blood sugar causes a complex series of early and late-stage symptomologies, beginning with, for example, hyperglycemia, abnormal hunger, thirst, polyuria, and glycouria, and then escalating to, for example, neuropathy, macro-vascular disease, and micro-vascular disease.

[0004] A common method of treatment of Type 1 diabetes involves the exogenous administration of insulin, typically by injection with either a syringe or a pump. This method does not completely normalize blood glucose levels and is often associated with an increased risk of hypoglycemia. More effective glycemic control can be achieved if the function of the pancreas can be restored or rejuvenated via transplantation or cell-based therapies.

[0005] There are many transplantation therapies currently used to treat diabetes: One such treatment involves transplanting isolated islets of Langerhans into the diabetic patient. One of the main hurdles to human islet transplantation has been the lack of sufficient number of islets to treat the large number of diabetic patients. One possible solution to the shortage of islets is the generation of islets from alternate cellular sources.

[0006] It has been documented that progenitor cells derived from adult tissues are capable of differentiation into a pancreatic β-cell phenotype. See, for example, WO2004/087885 A2, Hess et al. (Nature Biotechnology 21, 763 - 770, 2003), and Ianus et al. (J. Clin. Invest. I l l: 843-850, 2003), which report the capacity of adult bone marrow-derived cells (mesenchymal and hematopoetic cells) to differentiate into cells having characteristics of a pancreatic β-cell in vitro, or secrete trophic factors that help regenerate a damaged pancreas in vivo.

[0007] Among other sources of progenitor cells that can be differentiated into pancreatic cells include rodent liver oval stem cells (WO03/033697) and postpartum placenta (U.S. Published Application 2004/0161419 Al).

[0008] The endocrine cells of the islets of Langerhans, including β-cells, are constantly turning over by processes of apoptosis and the proliferation of new islet cells (neogenesis). As such, the pancreas is thought to be a source of progenitor cells that are capable of differentiating into pancreatic hormone producing cells. There are three distinct tissue types, isolated from a pancreas, that are a potential source of pancreatic progenitor cells: an islet rich fraction, a ductal cell rich fraction, and an acinar cell rich fraction.

[0009] Isolation of progenitor cells or partially differentiated cells from crude pancreatic tissue extracts may be achieved using antibodies raised against cell surface markers. For example, U.S. Published Application 2004/0241761 discloses isolation of murine cells that expressed ErbB2, ErbB3, ErbB4, Msx- 2, PDX-I and insulin.

[0010] Gershengorn et a {Science 306: 2261-2264, 2004) teach the production of proliferating cells that were able to form islet-like cell aggregates. The cells were derived from a heterogeneous population of adherent cells that emerged from the culture of isolated human pancreatic islets in vitro. The isolated islets of Langerhans were initially seeded onto tissue culture dishes and cultured in medium containing 10% serum. Fibroblast-like cells were observed to migrate out of the cultured islets and form a monolayer. These cells expressed Nestin, smooth muscle actin and vimentin.

[0011] Pancreatic progenitor cells may also arise from the culture of pancreatic islet and ductal tissue that has been dissociated into single cells, as disclosed by Seaberg et a {Nature Biotechnology 22: 1115 - 1124, 2004). The murine progenitor cells disclosed by Seaberg et a expressed Nestin during proliferation.

[0012] U.S. Published Application 2003/0082155 discloses methods to isolate and identify a population of cells from the islets of Langerhans of human pancreas, which have the functional and molecular characteristics of stem cells. In particular, these cells were characterized by one or more of Nestin-positive staining, Nestin gene expression, GLP-lR-positive staining, GLP- IR gene expression, ABCG2 positive staining, ABCG2 gene expression, Oct3/4 positive staining, Oct3/4 gene expression, latrophilin (type 2) positive staining, latrophilin (type 2) gene expression, Hes-1 positive staining, Hes-1 gene expression, Integrin subunits α6 and βl positive staining, Integrin subunits α6 and βl gene expression, c-kit positive staining, c-kit gene expression, MDR-I positive staining, MDR-I gene expression, SST-R, 2, 3, 4 positive staining, SST-R, 2, 3, 4 gene expression, SUR-I positive staining, SUR-I gene expression, Kir 6.2 positive staining, Kir 6.2 gene expression, CD34 negative staining, CD45 negative staining, CD 133 negative staining, MHC class I negative staining, MHC class II negative staining, cytokeratin-19 negative staining, long-term proliferation in culture, and the ability to differentiate into pseudo-islets in culture.

[0013] In another approach, as disclosed in U.S. Patent 5,834,308, U.S. Patent

6,001,647 and U.S. Patent 6,703,017, crude preparations of islet cultures from NOD mice may be used to establish epithelial-like cultures, which can be maintained in growing cultures for greater than 1 year and which appear to demonstrate the ability to differentiate into islet-like clusters, capable of secreting insulin.

[0014] Islet-like structures may be generated from fractions of digested human pancreata enriched for ductal tissue, as disclosed in Bonner-Weir et al. (Proc Nat Acad Sci 97: 7999-8004, 2000) and U.S. Patent 6,815,203 Bl. Islet-like clusters disclosed in these publications stained positive for cytokeratin- 19 and showed immunoreactivity for insulin.

[0015] WO2004/011621 discloses the generation of insulin negative adherent cells from human pancreatic ductal fragments.

[0016] WO03/102134 discloses the generation of an epithelial cell positive for cytokeratin- 19 from an acinar fraction of a human pancreatic digest. The cells generated are capable of limited expansion and differentiate into an insulin- producing cell in the presence of an induction media.

[0017] U.S. Published Application 2004/015805 Al reports that a subset of human pancreatic stem cells may be isolated using ligands to the cell surface marker CD56 (also known as NCAM). These cells can differentiate into insulin producing cells and insulin producing aggregates.

[0018] It has been documented that progenitor cells, derived from fetal or embryonic tissues, have the potential to differentiate into a pancreatic hormone-producing cell. See, for example, U.S. Patent 6,436,704, WO03/062405, WO02/092756 and EP 0 363 125 A2, which report the potential of human fetal and embryonic derived cells to differentiate into a β-cell lineage. [0019] Human Embryonic Stem cells (hES) are derived from the inner cell mass of the blastocyst, the earliest stage of embryonic development of the fertilized egg. The blastocyst is a pre-implantation stage of the embryo, a stage before the embryo would implant in the uterine wall. When cultured on an inactivated feeder layer of cells according to conditions described by Thompson and colleagues (Thomson, et al (Proc. Natl. Acad. ScL U.S.A. 92: 7844-7848, 1995); Thomson, et al. (Science 282:1145-1147, 1998), Marshall, et al, (Methods MoI. Biol. 158:11-18, 2001), the inner layer cells of the blastocyst may be grown in vitro indefinitely in an undifferentiated state. Properly propagated hES cells have unlimited potential to double while maintaining their pluiripotency; namely their capacity of differentiating into the three layers of the embryo, Ectoderm (Ec), Mesoderm (Me) and Endoderm (En). When grown as pluripotent hES, the cells maintain a euploid karyotype and are not prone to senescence.

[0020] Human embryonic stem cells display a distinct group of cell surface antigens, SSEA-3, SSEA-4, TRA-2-54 (alkaline phosphatase), TRA-1-60 and TRA-I- 81 , in addition to expressing specific transcription factors OCT-4, NANOG, SOX-2, FGF-4 and REX-I (Henderson, et al, (Stem Cells 20:329-337, 2002), Draper, et al, (J. Anat. 200:249-258, 2002), Mitsui et al, (Cell 113:631-642, 2003), Chambers et al, (Cell 113:643-655, 2003).

[0021] It is important to note from these publications, however, that human embryonic cells often require a feeder layer for expansion and maintenance of pluripotency or combination of a complex extracellular matrix, such as, for example, MATRIGEL™, plus conditioned media. These conditions do not allow the facile scale up of cells and an eventual cell therapy for treating diabetes.

[0022] Researchers have found that non-embryonic types of stem cells ("adult stem cells") are not as capable of differentiating into many different tissue types, as are embryonic stem cells, so embryonic stem cells still have many advantages over the use of adult stem cells. However, one obstacle with the isolation of embryonic stem cells is that the cells are derived from embryos at the "blastocyst" stage. Human embryonic stem cell research is encumbered by an emotionally charged political and ethics debate and is likely to remain so for years to come.

[0023] Additionally, human embryonic stem cells (hES) have been found to be tumorigenic when injected into immunologically impaired animals, i.e. in the context of post-natal tissues, whereas adult stem cells are not. The tumorigenic attributes of hES cells are not frequently addressed, though this issue may burden their use in replacement cell therapy in the future. The political, moral and ethical issues around hES cells and their tumorigenic properties, as well as the perceived difficulties of expanding undifferentiated adult stem cells in culture, while maintaining a genetically normal genome, are major barriers in the development of human cell replacement therapy.

[0024] Pluripotent or multipotent stem cells have been isolated from chorionic villus, and amniotic fluid. Many amniotic and placental cells share a common origin, namely the inner cell mass of the morula, which gives rise to the embryo itself, the yolk sac, the mesenchymal core of the chorionic villi, the chorion and the amnion (Crane & Cheung, Prena tal Diagnosis 8: 119-129, 1988). Embryonic and fetal cells from all three germ layers have long been identified in the amniotic fluid (Milunsky, Genetic Disorder of the Fetus. New York: Plenum Press, 75-84, 1979; Hoehn & SaIk, Methods in Cell Biology 26, 11-34, 1982; Gosden, British Medical Bulletin 39, 348-354, 1983; Prusa et al, Human Reproduction 18, 1489-1493, 2003). Thus, amniotic fluid may provide the least invasive access to embryonic-like and fetal-like stem cells.

[0025] Amniotic fluid derived cells have been routinely used for detecting chromosomal abnormality of the fetus. Amniotic fluid is typically sampled during the 2nd trimester (16 to 22 weeks of gestation). Previous art clearly demonstrates presence of three sub-population with distinct cell morphologies: "fibroblastic" (F), "amniotic fluid" (AF) cells, and "epithelial" (E) cells. The F and AF cells rapidly expand whereas the E cells display a much slower growth curve and have poor clonal efficiency.

[0026] For example, Chang and Jones (Prenatal Diagnosis 8: 367-378, 1988) disclose methods to isolate and culture cells from human chorionic villus samples.

[0027] In another example, a cell line has been established from human placentae at the first trimester of normal pregnancy. The cell line was obtained by culture of purified cytotrophoblast cells in serum- free medium supplemented with epidermal growth factor, insulin, dexamethasone and 0.1% bovine serum albumin. The cells were positive to cytokeratin 18, GnRH, neuropeptide Y, neurotensin, leucine-enkephalin, dopamine and 5-hydroxytryptamine (Rong- Hao et al, Human Reproduction 11: 1328-1333, 1996)).

[0028] In another example, PCT application WO2003/042405 discloses isolation of c- Kit positive stem cells from chorionic villus, amniotic fluid and placenta (Cell 1, Table I).

[0029] In another example, U.S. Published Application 2005/0054093 discloses the isolation of stem cells from amniotic fluid. These cells express stage-specific embryonic antigen 3 (SSEA3), stage-specific embryonic antigen 4 (SSEA4), Tral-60, Tral-81, Tra2-54, Oct-4, HLA class I, CD13, CD44 CD49b and CD105 (Cell 2, Table I).

[0030] In another example, fetal cells have been isolated from amniotic fluid (in't

Anker et al, Blood 102, 1548-1549, 2003). The cells disclosed were positive for expression of the following markers: CD44, CD73, CD90, CD105, CD106, HLA-A, B, & C. The cells were negative for expression of the following markers: c-Kit (CDl 17), CDl 1, CD31, CD34, CD45 and HLA-D (Cell 3, Table I).

[0031] A population of mesenchymal stem cells isolated from amniotic fluid has also been reported in a publication to Tsai et al (Tsai et al, Human Reproduction 19, 1450-1456, 2004). The cells disclosed were positive for expression of the following markers: CD29, CD44, CD73, CD90, HLA-A, B, & C. The cells were also positive for the embryonic transcription factor Oct-4. The cells were negative for expression of the following markers: c-Kit (CDl 17), CD34 and HLA-D (Cell 4, Table I).

[0032] US Patent Application 11/420895 disclose several populations of amniotic fluid derived cells. Application No. 11/420895 states: "The present inventors have identified and isolated a population of amniotic fluid-derived cells that is highly proliferative, and displays embryonic cell-like characteristics, and may express at least one of the following markers: HNF-I beta, HNF-3 beta, SOX- 17, or GATA 6. In particular, the amniotic fluid-derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CDl 17, Oct-4 or Tra2-54." (Cell 5, Table I). 11/420895 further states: "The present inventors have also identified and isolated populations of amniotic fluid- derived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express at least one of following markers: HNF-3 beta, SOX- 17, GATA-4, CDl 17, Oct-4 or Tra2-54. In particular, the amniotic fluid derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CDl 17, Oct-4 or Tra2-54." (Cell 6, Table I). Application No. 11/420895 further states: "The present inventors have also identified and isolated populations of amniotic fluid derived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express cytokeratin and at least one of following markers: HNF-3 beta, SOX-17, GATA-4, CDl 17, Oct-4 or Tra2-54. In particular, the amniotic fluid-derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CDl 17, Oct-4 or Tra2-54." (Cell 7, Table I).

[0033] Co expression of HNF-I beta, HNF-3 beta (also known as FOXa2), SOX-17, and GATA-6 is regarded as the key step to define the formation of definitive endoderm during gastrulation. Thus, expression of these markers may be key in the generation of a pancreatic β-cell population, or a population of pancreatic hormone-producing cells, or a gut hormone producing cell from an amniotic fluid-derived or a chorionic villus -derived cell.


[0034] In one embodiment, the present invention provides a method for isolating mammalian chorionic villus-derived cells. According to the present invention, chorionic villus derived cells are obtained from chorionic villus samples of about 11 to about 14 weeks gestation.

[0035] In one embodiment, the cultures are left undisturbed for at least 5 to 10 days under hypoxic conditions (3% 02). Alternatively, the cultures are left undisturbed for at least 5 to 10 days under normoxic conditions (approximately 20% O2).

[0036] In one embodiment, the cultured chorionic villus-derived cells are isolated as single cells, and clonally expanded.

[0037] The chorionic villus-derived cells isolated according to the methods of the present invention can be contacted, for example, with an agent (such as an antibody) that specifically recognizes a protein marker expressed by chorionic villus cells, to identify and select chorionic villus -derived cells, thereby obtaining a substantially pure population of chorionic villus -derived cells, i.e., wherein a recognized protein marker is expressed in at least 50% of the cell population.

[0038] In one embodiment, the resulting chorionic villus-derived cell population is substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.

[0039] In one embodiment, the resulting chorionic villus-derived cell population is substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA-3, TRA 1-81, TRA 1-60, TRA2-54, C-Met, E-cadherin, EPCAM, or CXCR4.

[0040] In one embodiment, the resulting chorionic villus-derived cell population is substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.

[0041] In one embodiment, the resulting chorionic villus-derived cell population is substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF-lbeta, HNF-3beta, Oct-4, Nanog, Sox- 2, or CDX-2.

[0042] The chorionic villus-derived cells isolated and expanded according to the present invention can be induced to differentiate into cells of the β cell lineage under appropriate in vitro or in vivo conditions. Accordingly, the chorionic villus-derived cells selected and expanded according to the present invention, as well as the differentiated cells derived from the chorionic villus-derived cells, are useful for treating Type 1 and 2 diabetes.


[0043] Figure 1 shows three distinct morphologies of cells isolated from chorionic villus sample at passage 1. Panel a) shows Stromal (S) morphology cells, panel b) shows epithelial (E) morphology cells, and panel c) shows giant trophoblast (T) morphology cells.

[0044] Figure 2 depicts the expression of cell surface markers on clone CVSPN003 A-Stromal morphology at P2 derived from chorionic villus. Panel a) depicts the forward and side scatter plot for the cell sample tested. Panel b) depicts the isotype control. The markers tested for are indicated on panels c-j.

[0045] Figure 3 depicts the expression of cell surface markers on clone CVSPNOOl F- Epithelial- like morphology at P2 derived from chorionic villus. Panel a) depicts the forward and side scatter plot for the cell sample tested. Panel b) depicts the isotype control. The markers tested for are indicated on panels c-q. [0046] Figure 4 depicts immunofluoresence images of the chorionic villus -derived cells of the present invention. The markers tested for are indicated on panels a-e.

[0047] Figure 5 depicts the expansion potential of a clonally expanded chorionic villus-derived cell with stromal-cell morphology (•) and a clonally expanded chorionic villus-derived cell with epithelial-like morphology (A) derived from 12 weeks of gestation and cultured in AMNIOMAX™ medium.

[0048] Figure 6 depicts the scatter plot gene expression profiles between the different chorionic villus-derived cell types, a) CVPNOOlF vs. CVPN003A. b) CVPN005D vs. CVPN003A. c) CVPNOOlF vs. CVPN005D. The Pearson correlation coefficient for each plot is also listed.


[0049] For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections that describe or illustrate certain features, embodiments or applications of the present invention.

[0050] The present invention is directed to methods for isolating a chorionic villus- derived cell population that is highly proliferative, and displays embryonic - like characteristics.


[0051] "Basic defined cell culture medium" is meant a serum free or serum containing, chemically defined cell growth medium. Such medium includes, but is not limited to, Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL- 1066, RPMI 1640, M 199 medium, Ham's FlO nutrient medium, KNOCKOUT™ DMEM, Advanced DMEM, MCDB based media such as MCDB -151, -153, -201, and -302 (Sigma, MO), and DMEM/F12. These and other useful media are available from GIBCO, Grand Island, New York, U.S.A., for example. A number of these media are reviewed in Methods in Enzymology, Volume LVIII, "Cell Culture," pp. 62- 72, edited by William B. Jakoby and Ira H. Pastan, published by Academic Press Inc.

[0052] "β-cell lineage" refer to cells with positive gene expression for the transcription factor PDX-I and at least one of the following transcription factors: NGN-3, Nkx2.2, Nkxό.l, NeuroD, IsI-I, HNF-3 beta, MAFA, Pax4, and Pax6. Characteristics of cells of the β-cell lineage are well known to those skilled in the art, and additional characteristics of the beta cell lineage continue to be identified. These transcription factors are well established in prior art for identification of endocrine cells (Nature Reviews Genetics, Vol3, 524-632, 2002).

[0053] "CD9" is also referred to as "Motility-related protein- 1 (MRP-I)" and is a transmembrane glycoprotein that has been implicated in cell adhesion, motility, proliferation, and differentiation.

[0054] "CDlO" is also referred to as "Common Acute Lymphocytic Leukemia Antigen (CALLA)". CDlO is a cell surface enzyme with neutral metalloendopeptidase activity and it is expressed in lymphoblastic, Burkitt's, and follicular germinal center lymphomas and in patients with chronic myelocytic leukemia. It is also expressed on the surface of normal early lymphoid progenitor cells, immature B Cells within adult bone marrow and germinal center B Cells within lymphoid tissue. CDlO is also present on breast myoepithelial cells, bile canaliculi, fibroblasts, brush border of kidney and gut epithelial cells.

[0055] "CD44" is also referred to as "Hermes antigen" and is the main cell surface receptor for hyaluronan. This CD is primarily expressed in most cell types, except for tissues/cells such as hepatocytes, some epithelial cells, and cardiac muscle. [0056] "CD49f ' is also referred to as "a6 integrin" and "VLA-6," and associates with integrin subunit beta 1 to bind laminin. CD49f is expressed primarily on epithelial cells, trophoblasts, platelets, and monocytes.

[0057] "CD73" is also referred to as "ecto-5'-nucleotidase" and is primarily expressed on a subset of-B and T cells, bone marrow stromal cells, various epithelial cells, fibroblasts, and endothelial cells.

[0058] "CD90" is also referred to as "Thy-1" and is primarily expressed on hematopoietic stem cells, connective tissue cells, and various fibroblastic and stromal cells.

[0059] "c-Kit" or "CDl 17" refer to a cell surface receptor tyrosine kinase having a sequence disclosed in Genbank Accession No. X06182, or a naturally occurring variant sequence thereof (e.g., allelic variant).

[0060] "Differentiated cells," when used in connection with cells isolated from chorionic villus, are meant a population of chorionic villus-derived cells that are substantially positive for the expression of PDX-I, or insulin.

[0061] "EPCAM" " is also referred to as "Epithelial Cell Adhesion Molecule" is broadly expressed on cells of epithelial origin and epithelial derived tumor cells.

[0062] "Expandable population" refers to the ability of an isolated cell population to be propagated through at least 50 or more cell divisions in a cell culture system.

[0063] "GATA-4" and "GATA-6" are members of the GATA transcription factor family. This family of transcription factors are induced by TGF β signaling and contribute to the maintenance of early endoderm markers, Soxl7α and FTNF-I beta, and the later marker HNF-3 beta.

[0064] "Hes-1", also known as "hairy/enhancer of split- 1" is a transcription factor that may influence cell fate determination. [0065] "HNF- 1 alpha", "HNF- 1 beta" and "HNF-3 beta" belong to the hepatic nuclear factor family of transcription factors, which is characterized by a highly conserved DNA binding domain and two short carboxy-terminal domains.

[0066] The term "hypoxic" refers to oxygen levels less than normal atmospheric levels.

[0067] "Markers" as used herein, are nucleic acid or polypeptide molecules that are differentially expressed in a cell of interest. In this context, differential expression means an increased level of the marker for a positive marker, and a decreased level for a negative marker. The detectable level of the marker nucleic acid or polypeptide is sufficiently higher or lower in the cells of interest, compared to other cells, such that the cell of interest can be identified and distinguished from other cells, using any of a variety of methods known in the art.

[0068] "Musashi-1" is a member of a subfamily of RNA binding proteins that are highly conserved across species. Musashi-1 expression is highly enriched in proliferative cells within the developing central nervous system, and may be a stem cell marker in intestinal cells.

[0069] The term "normoxia" refers to atmospheric oxygen levels of about 20% or greater.

[0070] "Oct-4" is a member of the POU-domain transcription factor family. The relationship of Oct-4 to pluripotent stem cells is indicated by its tightly restricted expression to undifferentiated pluripotent stem cells. Upon differentiation to somatic lineages, the expression of Oct-4 disappears rapidly.

[0071] "Pancreatic islet-like structure" refers to a three-dimensional clusters of cells derived by practicing the methods of the invention, which has the appearance of a pancreatic islet. The cells in a pancreatic islet-like structure express at least the PDX-I gene and one hormone selected from the list glucagon, somatostatin, or insulin.

[0072] A "progenitor cell" refers to a cell that is derived from a stem cell by differentiation and is capable of further differentiation to more mature cell types. Progenitor cells typically have more restricted proliferation capacity as compared to stem cells.

[0073] "Pharmaceutical carrier" refers to a biodegradable or non-degradable porous or nonporous matrix that can act as a carrier for transplantation of mammalian cells.

[0074] "Rex-1" is a developmentally regulated acidic zinc finger gene (Zfp-42). Rex- 1 message level is high in embryonic stem cells and reduced upon induction of differentiation. Rex-1 mRNA is present in the inner cell mass (ICM) of blastocyst, polar trophoblast of the blastocysts and later in the ectoplacental cone and extraembryonic ectoderm of the egg cylinder (trophoblast-derived tissues), but its abundance is much reduced in the embryonic ectoderm, which is directly descended from the ICM.

[0075] "SOX- 17" is a transcription factor, which is implicated in the formation of endoderm during embryogenesis.

[0076] "SSEA-I" (Stage Specific Embryonic Antigen-1) is a glycolipid surface antigen present on the surface of murine teratocarcinoma stem cells (EC), murine and human embryonic germ cells (EG), and murine embryonic stem cells (ES).

[0077] "SSEA-3" (Stage Specific Embryonic Antigen-3) is a glycolipid surface antigen present on the surface of human teratocarcinoma stem cells (EC), human embryonic germ cells (EG), and human embryonic stem cells (ES).

[0078] "SSEA-4" (Stage Specific Embryonic Antigen-4) is a glycolipid surface antigen present on the surface of human teratocarcinoma stem cells (EC), human embryonic germ cells (EG), and human embryonic stem cells (ES). [0079] A "stem cell" as used herein refers to an undifferentiated cell that is capable of extensive propagation and capable of differentiation to other cell types.

[0080] The term "substantially negative," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is not present or expressed in at least about 70%, alternatively about 80%, alternatively about 90%, of the total cell population.

[0081] The term "substantially positive," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is present or expressed in at least about 50%, alternatively at least about 60%, and alternatively at least about 70%, of the total cell population.

[0082] "TRA 1-60" is a keratin sulfate related antigen that is expressed on the surface of human teratocarcinoma stem cells (EC), human embryonic germ cells (EG), and human embryonic stem cells (ES).

[0083] "TRA 1-81" is a keratin sulfate related antigen that is expressed on the surface of human teratocarcinoma stem cells (EC), human embryonic germ cells (EG), and human embryonic stem cells (ES).

[0084] "TRA2-49" is an alkaline phosphatase isozyme expressed on the surface of human teratocarcinoma stem cells (EC), and human embryonic stem cells (ES).

[0085] "Transplantation" as used herein, can include the steps of introducing a cell or a population of cells or tissue into a mammal such as a human patient. "Transplantation" may also include incorporating cells or tissue into a pharmaceutical carrier, and implanting the carrier in a mammal such as a human patient. [0086] "Undifferentiated cells," when used in connection with cells isolated from chorionic villus, are meant a population of chorionic villus-derived cells that are substantially negative for the expression of PDX-I, or insulin.

Isolation of Chorionic Villus-Derived Cells

[0087] In one aspect of the present invention, chorionic villus-derived cells are isolated by a multi-stage method, which essentially involves:

a) Isolating a chorionic villus sample, b) Obtaining cells from the chorionic villus sample, and c) Culturing the cells in growth medium,

[0088] In an alternate aspect of the present invention, chorionic villus-derived cells are isolated by a multi-stage method, which essentially involves:

a) Isolating a chorionic villus sample, b) Obtaining cells from the chorionic villus sample, c) Culturing the cells in growth medium, d) Isolating distinct colonies, e) Culturing the isolated colonies in growth media, f) Serial dilution cloning and identifying single cells that give rise to proliferating colonies, and g) Culturing the clones in growth media.

[0089] In an alternate aspect of the present invention, chorionic villus-derived cells are isolated by a multi-stage method, which essentially involves:

a) Isolating a chorionic villus sample, b) Disrupting the chorionic villus sample, c) Obtaining cells from the disrupted sample, d) Culturing the cells in growth medium, e) Leaving the culture undisturbed for about 5 to 10 days without any media changes, f) Isolating distinct colonies, g) Culturing the isolated colonies in growth media, h) Serial dilution cloning and identifying single cells that give rise to proliferating colonies, and i) Culturing the clones in growth media.

[0090] In one embodiment, the disruption of the chorionic villus samples is achieved by enzymatic digestion. Enzymes suitable for enzymatic digestion of the chorionic villus sample include, for example, trypsin, collagenase, or TrypleE EXPRESS (Invitrogen). Alternatively, the disruption of the chorionic villus samples is achieved by mechanical dissociation.

[0091] The culture plates may be pre-coated with agents such as, for example, fibronectin, vitronectin, laminin, collagen, gelatin, thrombospondin, placenta extracts, MATRIGEL™, tenascin, human serum, or combinations thereof.

[0092] If desirable, the chorionic villus sample may be exposed, for example, to an agent (such as an antibody) that specifically recognizes a protein marker expressed by chorionic villus cells, to identify and select chorionic villus- derived cells, thereby obtaining a substantially pure population of chorionic villus-derived cells.

[0093] Chorionic villus-derived cells may be cultured in AMNIOMAX™ complete medium (Invitrogen). Alternatively, the cells may be cultured in Chang B/C medium (Irvine Scientific). Alternatively, the cells may be cultured in low glucose DMEM, supplemented with insulin-transferrin-selenium-X (ITS-X, Invitrogen, CA), 2% fetal bovine serum (FBS), 1% penicillin/streptomycin (P/S) + 25 ng/ml bFGF. Alternatively, the cells may be cultured in, DM- KNOCKOUT™ media (Invitrogen, CA), supplemented with 20% KNOCKOUT™ serum replacement (Invitrogen, CA), 10 ng/ml bFGF. Alternatively, the cells may be cultured in Williams' medium E supplemented with 2% defined FBS, 2mM L-glutamine, ITS, 55 μM 2- mercaptoethanol, 10ng/ml EGF, 4ng/ml bFGF, and 4ng/ml dexamethasone. Alternatively, the cells may be cultured in 1:1 DMEM-LG/MCDB 201, 2% FBS, ITSX, β- meercaptoethanol 55 μM, 100 μM ascorbic acid-2-phosphate, 4ng/ml bFGF, 10ng/ml EGF, and 4ng/ml dexamethasone. Alternatively, the cells may be cultured in low glucose DMEM, supplemented with 20% FBS. Alternatively, the cell may be cultured in low glucose DMEM, supplemented with 5% FBS. The cells may also be cultured in low glucose DMEM/MCDB 201 medium (1:1), supplemented with 2% defined FBS, ITSX, InM dexamethasone, 100 mM ascorbic acid 2-phosphate, lOng/ml EGF, lOng/ml PDGF-bb and 100 mM 2-mercaptoethanol. The media may be supplemented with bFGF, at concentrations from about 5 ng/ml to about 100 ng/ml. Alternatively, the cells may be cultured in 20% KNOCKOUT™ serum replacement + 80% KNOCKOUT™ DMEM, supplemented with 1 mM L-glutamine, 1% nonessential amino acids and 0.1 mM 2-mercaptoethanol. The medium may be conditioned overnight, on human or murine embryonic fibroblasts, human bone marrow derived stromal cells, or human placenta derived cells. The media may be supplemented with 4 ng/ml bFGF. Alternatively, the cells may be cultured in high glucose DMEM, supplemented with 20% defined FBS with 0.1 mM 2- mercaptoethanol.

[0094] During culture in growth media, the cells may be cultured under hypoxic or, alternatively, under normoxic conditions. Under hypoxic conditions, oxygen levels are lower than 20%, alternatively lower than 10%, alternatively lower than 5%, but more than 1%.

[0095] Preferably, the culture should be maintained in the growth media undisturbed for about 5 to 14 days without any media changes, at which point the cells will have typically become adherent to the culture substrate used. Subsequently, the cells may be sub-cultured.

[0096] Subculture can be achieved with any of the enzymatic solutions well known to those skilled in the art. An example of an enzymatic solution suitable for use in the present invention is TrypLE EXPRESS™ (Invitrogen, Ca).

[0097] Furthermore, the chorionic villus-derived cells may be expanded by culturing in a defined growth media containing agent(s) that stimulate the proliferation of the cells of the present invention. These factors may include, for example, nicotinamide, members of TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -4, 6, -7, -11, -12, and -13), serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP- 1 and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, testosterone, estrogen, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF- α, forskolin, Na- Butyrate, activin, betacellulin, noggin, neuron growth factor, nodal, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), bovine pituitary extract, islet neogenesis- associated protein (INGAP), proteasome inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, GSK-3 beta inhibitors, or combinations thereof. Alternatively, the chorionic villusderived cells may be expanded by culturing in conditioned media. By "conditioned media" is meant that a population of cells is grown in a basic defined cell culture medium and contributes soluble factors to the medium. In one such use, the cells are removed from the medium, while the soluble factors the cells produce remain. This medium is then used to nourish a different population of cells.

[0098] In certain embodiments, the chorionic villus-derived cells are cultured on standard tissue culture plates. Alternatively, the culture plates may be coated with extracellular matrix proteins, such as, for example, MATRIGEL ®, growth factor reduced MATRIGEL ®, laminin, collagen, gelatin, tenascin, fibronectin, vitronectin, thrombospondin, placenta extracts, human serum, or combinations thereof.

Characterization of The Isolated Chorionic villus-Derived Cells

[0099] Methods for assessing expression of protein and nucleic acid markers in cultured or isolated cells are standard in the art. These include quantitative reverse transcriptase polymerase chain reaction (RT-PCR), Northern blots, in situ hybridization (see, e.g., Current Protocols in Molecular Biology (Ausubel et al, eds. 2001 supplement)), and immunoassays, such as immunohistochemical analysis of sectioned material, Western blotting, and for markers that are accessible in intact cells, flow cytometry analysis (FACS) (see, e.g., Harlow and Lane, Using Antibodies: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press (1998)).

[0100] Examples of antibodies useful for detecting certain protein markers are listed in Table II. It should be noted that other antibodies directed to the same markers that are recognized by the antibodies listed in Table II are available, or can be readily developed. Such other antibodies can also be employed for assessing expression of markers in the cells isolated in accordance with the present invention.

[0101] Characteristics of cells of the β-cell lineage are well known to those skilled in the art, and additional characteristics of the β-cell lineage continue to be identified. These characteristics can be used to confirm that the chorionic villus-derived cells isolated in accordance with the present invention have differentiated to acquire the properties characteristic of the β-cell lineage, β- cell lineage specific characteristics include the expression of one or more transcription factors such as, for example, PDX-I (pancreatic and duodenal homeobox gene-1), NGN-3 (neurogenin-3), Hlxb9, Nkx6, IsIl, Pax6, NeuroD, Hnfla, Hnf6, Hnf3 Beta, and Mafa, among others. These transcription factors are well established in the art for identification of endocrine cells. See, e.g., Edlund (Nature Reviews Genetics 3: 524-632 (2002)).

[0102] Chorionic villus-derived cells of the present invention may be expanded for more than 50 population doublings, while maintaining the potential to differentiate into definitive endoderm, or cells with characteristics of a pancreatic β- cell lineage. Differentiation Of Chorionic Villus-Derived Cells

[0103] In one aspect, the present invention provides compositions capable of differentiating the expanded chorionic villus-derived cells of this invention into cells bearing markers characteristic of the β— cell lineage.

[0104] In another aspect, the present invention provides compositions capable of differentiating the expanded chorionic villus-derived cells of this invention into cells bearing markers characteristic of definitive endoderm.

[0105] A basic defined culture medium, when supplied with one or more components, that support the growth of chorionic villus-derived cells, supplemented with differentiation-inducing amounts of one or more growth factors, is referred to as an "induction medium." In accordance with the present invention, the induction medium contains less than or equal to 20% serum. In one embodiment, fetal calf serum may be used. Alternatively, fetal bovine serum may be replaced by serum from any mammal, or by albumin, bovine albumin or other compounds that permit or enhance differentiation of chorionic villus- derived cells to the β cell lineage. Alternatively, the induction medium may be conditioned medium.

[0106] Factors appropriate for use in the induction medium may include, for example, nicotinamide, members of TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -4, 6, -7, -11, -12, and -13), serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-I and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na-Butyrate, activin, betacellulin, ITS, noggin, neurite growth factor, nodal, valporic acid, trichostatin A, sodium butyrate, hepatocyte growth factor (HGF), sphingosine- 1, Wnt proteins such as Wnt-1, -3, -3a, 07a, and -8, keratinocyte growth factor (KGF), Dickkopf protein family, bovine pituitary extract, islet neogenesis associated protein (INGAP), Indian hedgehog, sonic hedgehog, proteasome inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, or combinations thereof.

[0107] In one aspect of the present invention, a combination of growth factors and chemical agents, including bFGF, Activin-A, FGF5, N2 and B27 supplements (Gibco, CA), steroid alkaloid such as, for example, cyclopamine (EMD, CA) that inhibits sonic hedgehog signaling, and a proteasome inhibitor such as, for example MG132 (EMD, CA), is supplied to a basic defined medium to support differentiation of chorionic villus-derived cells into a β-cell lineage. In one aspect, the cells are cultured in an induction media composed of DMEM (low glucose, 5.5 mM) containing 10 micromolar MG-132 for 1-2 days, followed by additional incubation for 3-7 days in an induction media supplemented with IX B27 (Gibco, CA) and IX N2 (Gibco, CA) and further supplemented with Cyclopamine (10 μM; EMD, CA), bFGF (20 ng/ml; R&D Systems, MN), Activin A (20 nM; R&D Systems, MN) or FGF5 (20 ng/ml; R&D Systems, MN) for an additional five days.

[0108] The combination and concentrations of growth factors, the length of culture, and other culture conditions can be optimized by those skilled in the art to achieve effective differentiation by, e.g., monitoring the percentage of cells that have differentiated into cells characteristic of the β-cell lineage. The one or more growth factors may be added in an amount sufficient to induce the differentiation of the chorionic villus-derived cells of the present invention into cells bearing markers of a β-cell lineage over a time period of about one to four weeks.

Therapeutic Use of The Cells of The Present Invention.

[0109] In one aspect, the present invention provides a method for treating a patient suffering from, or at risk of developing Typel diabetes. This method involves isolating and culturing chorionic villus-derived cells, expanding the isolated population of cells, differentiating the cultured cells in vitro into a β-cell lineage, and implanting the differentiated cells either directly into a patient or inserted into a pharmaceutical carrier which is then implanted into the patient. If appropriate, the patient can be further treated with pharmaceutical agents or bioactives that facilitate the survival and function of the transplanted cells. These agents may include, for example, insulin, members of the TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -3, - 4, -5, -6, -7, -11, -12, and -13), fibroblast growth factors-1 and -2, platelet- derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, -15), vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, glucagon like peptide-I (GLP-I) and II, GLP-I and 2 mimetibody, Exendin-4, retinoic acid, parathyroid hormone, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729.

In yet another aspect, this invention provides a method for treating a patient suffering from, or at risk of developing Type 2 diabetes. This method involves isolating and culturing chorionic villus-derived cells, expanding the isolated population of cells, differentiating the cultured cells in vitro into a β- cell lineage, and implanting the differentiated cells either directly into a patient or inserted into a pharmaceutical carrier which is then implanted into the patient. If appropriate, the patient can be further treated with pharmaceutical agents or bioactives that facilitate the survival and function of the transplanted cells. These agents may include, for example, insulin, members of the TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -3, - 4, -5, -6, -7, -11, -12, and -13), fibroblast growth factors-1 and -2, platelet- derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, -15), vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, glucagon like peptide-I (GLP-I) and II, GLP-I and 2 mimetibody, Exendin-4, retinoic acid, parathyroid hormone, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729.

[0111] In yet another embodiment, the chorionic villus-derived cells of the present invention may be cryopreserved using commercially available medium containing DMSO (dimethylsulfoxide) or glycerol. The banked and frozen cells may be stored in the vapor phase of a liquid nitrogen storage tank until needed.

[0112] In yet another embodiment, the chorionic villus-derived cells of the present invention may be transplanted with mature islets of the same or different animal species to enhance the survival of the chorionic villus-derived cells or to induce further differentiation of the chorionic villus-derived cells into a pancreatic β cell lineage.

[0113] The source of chorionic villus from which the cells are isolated may be autologous in relation to the patient undergoing the therapeutic treatment. Alternatively, the source may be allogeneic, or xenogeneic. Cells to be administered to a patient may also be genetically modified to enhance proliferation and/or differentiation or prevent or lessen the risk of immune rejection. Alternatively, the chorionic villus-derived cells obtained in accordance with the present invention can be used to modulate the recipient's immune response, prior to transplantation of differentiated cells prepared in accordance with the present invention. See, for example, U.S. Patent 6,328,960, and U.S. Patent 6,281,012.

[0114] The chorionic villus-derived cells of the present invention may be differentiated into an insulin-producing cell prior to transplantation into a recipient. In a specific embodiment, the chorionic villus-derived cells of the present invention are fully differentiated into β-cells, prior to transplantation into a recipient. Alternatively, the chorionic villus-derived cells of the present invention may be transplanted into a recipient in an undifferentiated or partially differentiated state. Further differentiation may take place in the recipient.

[0115] The chorionic villus-derived cells of the present invention may be genetically modified. For example, the cells may be engineered to over-express markers characteristic of a cell of a β-cell lineage, such as, for example, PDX-I or insulin. The cells may be engineered to over express with any suitable gene of interest. Furthermore, the cells may be engineered to over express markers characteristic of an intestinal cell, such as MATH- 1. Alternatively, the cells of the present invention can be differentiated into a GIP expressing cell population and further modified with an insulin gene under control of the GIP promoter to become glucose responsive and insulin-producing cell population. Techniques useful to genetically modify the chorionic villus-derived cells of the present invention can be found, for example, in standard textbooks and reviews in cell biology. Methods in molecular genetics and genetic engineering are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd Ed. (Sambrook et al, 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); the series Methods in Enzymology (Academic Press, Inc.); Gene Transfer Vectors for Mammalian Cells (I. M. Miller &M. P. Calos, eds. , 1987); Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Edition (F. M. Ausubel et al., eds., 1987 &1995); and Recombinant DNA Methodology II (R. Wu ed. , Academic Press 1995).

[0116] The nucleic acid molecule, encoding the gene of interest may be stably integrated into the genome of the host chorionic villus-derived cell, or the nucleic acid molecule may be present as an extrachromosomal molecule, such as a vector or plasmid. Such an extrachromosomal molecule may be auto- replicating. The term "transfection," as used herein, refers to a process for introducing heterologous nucleic acid into the host chorionic villus-derived cell. [0117] The cells, undifferentiated or otherwise, may be used as dispersed cells or formed into clusters that may be infused into the hepatic portal vein. Alternatively, the cells may be provided in biocompatible degradable polymeric supports, porous non-degradable devices or encapsulated to protect from host immune response. The cells may be implanted into an appropriate site in a recipient. The implantation sites include, for example, the liver, natural pancreas, renal subcapsular space, omentum, peritoneum, subserosal space, intestine, stomach, or a subcutaneous pocket.

[0118] To enhance further differentiation, survival or activity of implanted cells, additional factors, such as growth factors, antioxidants or anti-inflammatory agents, can be administered before, simultaneously with, or after the administration of the cells. In certain embodiments, growth factors are utilized to differentiate the administered cells in vivo. These factors can be secreted by endogenous cells and exposed to the administered chorionic villus- derived cells in situ. Implanted chorionic villus-derived cells can be induced to differentiate by any combination of endogenous and exogenously administered growth factors known in the art.

[0119] The amount of cells used in implantation depends on a number of factors including the patient's condition and response to the therapy, and can be determined by one skilled in the art.

[0120] In one aspect, this invention provides a method for treating a patient suffering from, or at risk of developing diabetes. The method includes isolating and culturing chorionic villus-derived cells according to the present invention, expanding the isolated population of cells, differentiating in vitro the cultured chorionic villus-derived cells into a β-cell lineage, and incorporating the cells into a three-dimensional support. The cells can be maintained in vitro on this support prior to implantation into the patient. Alternatively, the support containing the cells can be directly implanted in the patient without additional in vitro culturing. The support can optionally be incorporated with at least one pharmaceutical agent that facilitates the survival and function of the transplanted cells.

[0121] Support materials suitable for use for purposes of the present invention include tissue templates, conduits, barriers, and reservoirs useful for tissue repair. In particular, synthetic and natural materials in the form of foams, sponges, gels, hydrogels, textiles, and nonwoven structures, which have been used in vitro and in vivo to reconstruct or regenerate biological tissue, as well as to deliver chemotactic agents for inducing tissue growth, are suitable for use in practicing the methods of the present invention. See, e.g., the materials disclosed in U.S. Patent 5,770,417, U.S. Patent 6,022,743, U.S. Patent 5,567,612, U.S. Patent 5,759,830, U.S. Patent 6,626,950, U.S. Patent 6,534,084, U.S. Patent 6,306,424, U.S. Patent 6,365,149, U.S. Patent 6,599,323, U.S. Patent 6,656,488, and U.S. Patent 6,333,029. Exemplary polymers suitable for use in the present invention are disclosed in U.S. Published Application 2004/0062753 Al and U.S. Patent 4,557,264.

[0122] To form a support incorporated with a pharmaceutical agent, the pharmaceutical agent can be mixed with the polymer solution prior to forming the support. Alternatively, a pharmaceutical agent could be coated onto a fabricated support, preferably in the presence of a pharmaceutical carrier. The pharmaceutical agent may be present as a liquid, a finely divided solid, or any other appropriate physical form. Alternatively, excipients may be added to the support to alter the release rate of the pharmaceutical agent. In an alternate embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-inflammatory compound, such as, for example compounds disclosed in U.S. Patent 6,509,369.

[0123] In one embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-apoptotic compound, such as, for example, compounds disclosed in U.S. Patent 6,793,945. [0124] In another embodiment, the support is incorporated with at least one pharmaceutical compound that is an inhibitor of fibrosis, such as, for example, compounds disclosed in U.S. Patent 6,331,298.

[0125] In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is capable of enhancing angiogenesis, such as, for example, compounds disclosed in U.S. Published Application 2004/0220393 and U.S. Published Application 2004/0209901.

[0126] In still another embodiment, the support is incorporated with at least one pharmaceutical compound that is an immunosuppressive compound, such as, for example, compounds disclosed in U.S. Published Application 2004/0171623.

[0127] In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is a growth factor, such as, for example, members of the TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -3, -4, -5, -6, -7, -11, -12, and -13), fibroblast growth factors- 1 and -2, platelet-derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, -15), vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, hypoxia inducible factor 1 -alpha, glucagon like peptide-I (GLP-I), GLP-I and GLP-2 mimetibody, and II, Exendin-4, nodal, noggin, NGF, retinoic acid, parathyroid hormone, tenascin- C, tropoelastin, thrombin-derived peptides, cathelicidins, defensins, laminin, biological peptides containing cell- and heparin-binding domains of adhesive extracellular matrix proteins such as fibronectin and vitronectin, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729.

[0128] The incorporation of the cells of the present invention into a scaffold can be achieved by the simple depositing of cells onto the scaffold. Cells can enter into the scaffold by simple diffusion (J. Pediatr. Surg. 23 (1 Pt 2): 3-9 (1988)). Several other approaches have been developed to enhance the efficiency of cell seeding. For example, spinner flasks have been used in seeding of chondrocytes onto polyglycolic acid scaffolds (Biotechnol. Prog. 14(2): 193- 202 (1998)). Another approach for seeding cells is the use of centrifugation, which yields minimum stress to the seeded cells and enhances seeding efficiency. For example, Yang et al. developed a cell seeding method (J. Biomed. Mater. Res. 55(3): 379-86 (2001)), referred to as Centrifugational Cell Immobilization (CCI).

[0129] The present invention is further illustrated, but not limited by, the following examples.


Example 1

Establishment of Human Chorionic Villus-Derived Cell Lines

[0130] Human chorionic villus samples (CVS) used to isolate the cells of the present invention was taken from samples taken from routine CVS performed at 11-14 weeks of gestation for fetal karyotyping. The CVS sample was centrifuged for 7 minutes at 400 x g and the supernatant removed. The resulting cell pellet was resuspended in an enzymatic solution containing 0.25% Trypsin (Sigma, MO, USA) and 10 IU/ml DNAse I (Invitrogen, CA) at 37° C for 30 mins. Enzymatic digestion was blocked with the addition of DMEM:F12 (Invitrogen) + 10 % FBS. The cell suspension was spun at 300 x g for 5 mins, the supernatant aspirated and the cell pellet resuspended in growth media. Two growth media used in this invention are Amniomax™ (Invitrogen) or Chang D (Irvine Scientific, CA). The cell suspension was passed through a 100-micron nylon sieve to remove undigested villous fragments. The resulting pass through was plated on tissue culture treated plates (TCPS) or flasks. The cultures were left undisturbed for at least 5-10 days under hypoxic conditions (3% O2) or normoxia conditions (20% O2). The cultures were fed with the same growth media and cultured until the cultures reached 70-80% confluency. Cells at this stage were referred to as "PO". In some cultures, colonies of cells were isolated by a cloning ring and sub cultured into a different culture plate. Distinct colonies were present with morphologies characteristic of stromal (S), epithelial, and giant trophoblasts cells (T) (Figure 1 panels a-c). Cells were released from PO culture by using TrypLE Express™ (Invitrogen) and seeded into TCPS flaks/dishes/plates at various densities (50-10,000 cell/cm2). Some of the PO cells were used for serial dilution cloning. The population doubling time of the fastest growing cells was approximately 24 hrs at early passages. Cells were typically split at approximately 70% confluency and reseeded at 100-10000 cells/cm2.

Example 2

Fluorescence-Activated Cell Sorting (FACS) Analysis

Adhered cells were removed from culture plates by five-minute incubation with the TRYPLE™ express solution (Gibco, CA). Released cells were resuspended in DMEM supplemented with 10% FBS and recovered by centrifugation, followed by washing and resuspending the cells in a staining buffer consisting of 2% BSA, 0.05% sodium azide (Sigma, MO) in PBS. If appropriate, the cells were Fc-receptor blocked using a 0.1% γ-globulin (Sigma) solution for 15 min. Aliquots (approximately 1 x 105 cells) were incubated with either phycoerythirin (PE) or allophycocyanin (APC) conjugated monoclonal antibodies (5 μl antibody per 1 x 106 cells), as indicated in Table H-A, or with an unconjugated primary antibody. Controls included appropriate isotype matched antibodies, non-stained cells, and cells only stained with secondary conjugated antibody. All incubations with antibodies were performed for 30 mins at 4°C, after which the cells were washed with the staining buffer. Samples that were stained with unconjugated primary antibodies were incubated for additional 30 mins at 4°C with secondary conjugated PE or -APC labeled antibodies. See Table H-B for a list of secondary antibodies used. Washed cells were pelleted and resuspended in the staining buffer and the cell surface molecules were identified by using a FACS Array (BD Biosciences) by collecting at least 10,000 events.

[0132] Table III A summarizes FACS analysis for various chorionic villus-derived cell clones or whole cultures. Representative FACS dot plots are shown in Figures 2-3. The majority of the analyzed chorionic villus-derived cell samples were substantially positive for SSEA-4, alpha 2, alpha 5, alpha 6 integrin, CD 105, CD90, CD44, and CD73 and substantially negative for CDl 17, SSEA-3, Tral-60, Tra-181, Tra2-54, Ecadherin, CXCR4, c-Met, EPCAM, and CD56.

Example 3

Immunostaining of Undifferentiated Cells

[0133] Cells cultured according to Example 1, were seeded into glass bottom 35 mm microwell dishes (Matek Corp, MA) in various growth media at 10000 cell/cm2. Following three days in culture, the cells were fixed for 10 mins with 4% paraformaldheyde, followed by two rinses in the PBS, and addition of a permeabilization buffer containing 0.5% Triton-X (Sigma) for 5 mins at room temperature (RT) followed by additional three rinses with PBS. The fixed and permeabilized cells were blocked with either 1% bovine serum albumin (BSA) or 4% sera from the species where the secondary antibody was raised in (Goat, donkey, or rabbit). Control samples included reactions with the primary antibody omitted or where the primary antibody was replaced with corresponding immunoglobulins at the same concentration as the primary antibodies. Stained samples were rinsed with a PROLONG® antifade reagent (Invitrogen, CA) containing diamidino-2-phenylindole, dihydrochloride (DAPI) to counter stain the nucleus. Images were acquired using a Nikon Confocal Eclipse C-I inverted microscope (Nikon, Japan) and a 10-60X objective (Figure 4).

[0134] Table III B summarizes the expression of intracellular proteins for various chorionic villus-derived cell clones or whole cultures. Example 4

PCR Analysis Of Chorionic Villus-Derived Cells

[0135] RNA was extracted from cells cultured in the growth media. Total RNA from human pancreas, liver, brain, gut (Ambion, INC.) NTERA cells (human embryonic carcinoma cells line, ATCC), HEK293 cells (ATCC), and human airway epithelia cells (Cambrex) were used as positive controls. Bone marrow derived mesenchymal cells (Cambrex, MD) were used as negative controls for the expression of key genes involved in pancreatic development.

[0136] RNA extraction, purification, and cDNA synthesis. RNA samples were purified through its binding to a silica-gel membrane (Rneasy Mini Kit, Qiagen, CA) in the presence of an ethanol-containing, high-salt buffer; while contaminants were washed away. The RNA was further purified while bound to the column by treatment with DNase I (Qiagen, CA) for 15 min. High- quality RNA was then eluted in water. Yield and purity were assessed by A260 and A280 readings on the spectrophotometer. cDNA copies were made from purified RNA using an ABI (ABI, CA) high capacity cDNA archive kit.

[0137] Real-time PCR amplification and quantitative analysis. Unless otherwise stated, all reagents were purchased from Applied Biosystems. Real-time PCR reactions were performed using the ABI PRISM® 7000 Sequence Detection System. TAQMAN® UNIVERSAL PCR MASTER MIX® (ABI, CA) was used with 20 ng of reverse transcribed RNA in a total reaction volume of 20 μl. Each cDNA sample was run in duplicate to correct for pipetting errors. Primers and FAM-labeled TAQMAN®probes were used at concentrations of 200 nM. The level of expression of each target gene was normalized using the pre-developed Applied Biosystem's 18S ribosomal RNA or human glyceraldehydes-3 -phosphate dehydrogenase (GAPDH) endogenous control kit. Primers and probes were either designed using ABI PRISM PRIMER EXPRESS™ software or used pre-developed ABI gene analysis kit. For each gene, either one of the primers or the probe were designed to be exon- boundary spanning. This eliminated the possibility of the primers/probe binding to any genomic DNA present. The primer and probe sets are listed as following Nkx2.2 (Hs00159616), Pdx-1 (Hs00426216), Nkx6.1 (Hs00232355), Ngn3 (Hs00360700), Pax4 (Hs00173014), Pax6 (Hs00240871), Insulin (Hs00355773), Glu2 (Hs00165775), glucagon (HsOO 174967), IsI-I (HsOO 158126), somatostatin (HsOO 174949), FoxA2 (HNF 3-beta) (Hs00232764), HlxB9 (Hs00232128), GATA-4 (Hs00171403), HNFlβ (Hs00172123), Musashi Homolog 1 (Msi-1) (Hs00159291), Hes-1 (Hs00172878), Neurotensin (NTS) (Hs00175048), Cholecystokinin (Hs00174937), AFP (Hs00173490), Secretin (Hs00360814), GIP (Hs00175030), GFAP (Hs00157674), MAP2 (Hs00159041), Olig2 (Hs0037782), Oct-4 (CGACCATCTGCCGCTTTGAG (SEQ ID NO: 1) and CCCCCTGTCCCCCATTCCTA (SEQ ID NO: 2)); Rex-1 (CAGATCCTAAACAGCTCGCAGAAT (SEQID NO: 3), and GCGTACGCAAATTAAACTCCAGA(SEQ ID NO: 4); Soxl7 TGGCGCAGCAGATACCA (SEQ ID NO:5), AGCGCCTTCCACGACTTG (SEQID NO:6) and CCAGCATCTTGCTCAACTCGGCG (SEQ ID NO:7); ABCG-2 GTTTATCCGTGGTGTGTCTGG (SEQ ID NO: 8) and CTGAGCTATAGAGGCCTGGG (SEQ ID NO: 9); SOX2 ATGCACCGCTACGACGTGA (SEQ ID NO: 10) and CTTTTGCACCCCTCCCATTT (SEQ ID NO: 11). The remaining primers were designed by using the PRIMERS program (ABI, CA) and are listed in Table III C. After an initial 50°C for 2 min, and 95°C for 10 min, samples were cycled 40 times in two stages - a denaturation step at 95°C for 15 sec, followed by an annealing/extension step at 60°C for 1 min. Data analysis was carried out using GENEAMP®7000 Sequence Detection System software. For each primer/probe set, a Ct value was determined as the cycle number at which the fluorescence intensity reached a specific value in the middle of the exponential region of amplification. Relative gene expression levels were calculated using the comparative Ct method. Briefly, for each cDNA sample, the endogenous control Ct value was subtracted from the gene of interest Ct to give the delta Ct value (ΔCt). The normalized amount of target was calculated as 2-ΔCt, assuming amplification to be 100% efficiency. Final data were expressed relative to a calibrator sample. The comparative Ct method is only valid if target and endogenous control amplification efficiencies are approximately equal. Preliminary validation experiments were therefore performed for each primer/probe set by amplifying serially diluted cDNA samples and determining the ΔCt values. These ΔCt values should remain constant across the range of dilutions if amplification efficiencies are equal (Table III C).

Example 5

Expansion Potential of CVS Cells

[0138] Figure 5 depicts the expansion potential of a clonally expanded chorionic villus-derived cell with stromal-cell morphology and a clonally expanded chorionic villus-derived cell with epithelial-like morphology derived from 12 weeks of gestation and cultured in Amniomax™.

Example 6

Microarray Analysis of Chorionic Villus-Derived Cells with Stromal or

Epithelial Morphology

[0139] Total RNA was isolated from passage 5-7 clonally expanded chorionic villus- derived cells with either stromal, or epithelial-like morphology, using an RNeasy mini kit (Qiagen). The sample preparation, hybridization, and image analysis was performed according to the CodeLink™ System (GE Healthcare, Amersham Biosciences, NJ). Codelink™ Human Whole Genome arrays were used. It is comprised of approximately 55 000 30-mer probes designed to conserved exons across the transcripts of targeted genes. The chip contains approximately 45000 unique Unigene IDs. Following normalization and a log transformation, data analysis was performed using OmniViz® software (MA) and GENESIFTER (VizXLabs, WA). The variance stabilizing transformation along with cross sample normalization was applied to the log transformed array dataset. The variability within each cell line and among the different cell lines was compared using the Pearson correlation coefficient. For all the samples analyzed, the correlation coefficient within a cell line was higher as compared to those between the lines. Variance in gene expression profiles between the different cell types along with the correlation coefficient between the lines are depicted in Figure 6. Significant differences in gene expression between the cell types were evaluated using analysis of variance and an F-test with adjusted P-value (Benjamini and Hochberg correction) of =< 0.05. Tables IV A-C list the genes that are differentially expressed at least 5-fold between the various cell types.

Example 7

Differentiation of Cells into Endodermal Lineage

[0140] Cells from the cell line CVS003 Clone A and B at passage 2-4 were seeded at 2x105 cells/cm2 in a 12 well plate and cultured with DMEM medium supplemented with 0.1% FBS and growth factors, which includes 1 μM Cyclopamine (EMD, CA), 10 ng/ml bFGF (R&D Systems, MN), 20 ng/ml EGF (R&D Systems, MN), 20 ng/ml BMP4-7 (R&D Systems, MN), 50-100 ng/ml Activin A (R&D Systems, MN), 20 ng/ml FGF4 (R&D Systems, MN), 10 μM all-trans retinoic acid (Sigma, MO), 20 ng/ml FGFlO (R&D Systems, MN), IX N2 supplement (Invitrogen), IX B27 supplement (Invitrogen) and 1 μM γ-secretase inhibitor (Sigma, MO) for 5-10 days. Cultures were fed every other day. Cells treated by all-trans retinoic acid plus FGFlO showed up- regulation of alpha-PDX-1.

[0141] Publications cited throughout this document are hereby incorporated by reference in their entirety. Although the various aspects of the invention have been illustrated above by reference to examples and preferred embodiments, it will be appreciated that the scope of the invention is defined not by the foregoing description but by the following claims properly construed under principles of patent law.

Figure imgf000038_0001
Figure imgf000039_0001

Figure imgf000040_0001
Figure imgf000041_0001

Figure imgf000042_0001

Figure imgf000043_0001
Figure imgf000044_0001

Figure imgf000045_0001

Figure imgf000046_0001

Figure imgf000047_0001


Gene Identifier Gene Name Fold change Direction adj. p- CVPN003 vs value CVPN001 F

NM 001008 Homo sapiens ribosomal protein S4, 722.62 Up 5.67E-04

Y-linked 1 (RPS4Y1 ), mRNA NM 138963 Homo sapiens ribosomal protein S4, 631.07 Up 1 .07E-04

Y-linked 2 (RPS4Y2), mRNA NM 004653 Homo sapiens Smcy homolog, Y- 123.95 Up 8.39E-05 linked (mouse) (SMCY), mRNA Y10255 H. sapiens mRNA for mammary- 1 1 1.91 Up 1 .33E-04 derived growth inhibitor (MDGI) H70730 yu69e10.M Weizmann Olfactory 104.4 Up 1 .99E-04

Epithelium Homo sapiens cDNA clone

IMAGE:239082 5, mRNA sequence NM_014893 Homo sapiens neuroligin 4, Y-linked 82.8 Up 1 .49E-04

(NLGN4Y), mRNA NM 004660 Homo sapiens DEAD (Asp-Glu-Ala- 82.65 Up 2.07E-04

Asp) box polypeptide 3, Y-linked

(DDX3Y), mRNA NM 001977 Homo sapiens glutamyl 58.47 Up 1 .54E-04 aminopeptidase (aminopeptidase A)

(ENPEP), mRNA NM 001864 Homo sapiens cytochrome c oxidase 55.34 Up 2.20E-04 subunit Vila polypeptide 1 (muscle)

(COX7A1 ), mRNA NM 153267 Homo sapiens MAM domain 39.37 Up 4.77E-04 containing 2 (MAMDC2), mRNA NM 182847 Homo sapiens amiloride-sensitive 38.25 Up 1 .43E-04 cation channel 4, pituitary (ACCN4), transcript variant 2, mRNA NM 003385 Homo sapiens visinin-like 1 (VSNL1 ), 34.94 Up 1 .22E-03 mRNA NM 153026 Homo sapiens prickle-like 1 34.21 Up 2.36E-04

(Drosophila) (PRICKLE1 ), mRNA NM 005532 Homo sapiens interferon, alpha- 31.76 Up 4.46E-04 inducible protein 27 (IFI27), transcript variant a, mRNA NM 000609 Homo sapiens chemokine (C-X-C 31.35 Up 1 .80E-03 motif) ligand 12 (stromal cell-derived factor I ) (CXCL 12), mRNA NM_015441 Homo sapiens olfactomedin-like 2B 31.19 Up 1 .38E-04

(OLFML2B), mRNA NM 004840 Homo sapiens Rac/Cdc42 guanine 30.92 Up 1 .73E-04 nucleotide exchange factor (GEF) 6

(ARHGEF6), mRNA NM 00341 1 Homo sapiens zinc finger protein, Y- 29.76 Up 1 .72E-03 linked (ZFY), mRNA NM 052960 Homo sapiens retinol binding protein 28.23 Up 1 .64E-04

7, cellular (RBP7), mRNA BM083808 imageqc_6_2000/sjp216bdff41 .x1 26.43 Up 1.68E-04 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:3523891 3, mRNA sequence

NM 001541 Homo sapiens heat shock 27kDa 26.38 Up 1 .37E-04 protein 2 (HSPB2), mRNA

NM 002998 Homo sapiens syndecan 2 (heparan 25.56 Up 4.23E-04 sulfate proteoglycan 1 , cell surface- associated, fibroglycan) (SDC2), mRNA

NM 001885 Homo sapiens crystallin, alpha B 25.52 Up 4.94E-04 (CRYAB), mRNA

NMJ 84087 Homo sapiens tripartite motif- 24.16 Up 7.78E-04 containing 55 (TRIM55), transcript variant 4, mRNA

BC035656 Homo sapiens hypothetical protein 23.29 Up 1 .08E-03 LOC285835, mRNA (cDNA clone IMAGE:5588650), partial cds

NM 004681 Homo sapiens eukaryotic translation 22.22 Up 3.65E-04 initiation factor 1A, Y-linked (EIF1AY), mRNA

F24802 HSPD11400 HM3 Homo sapiens 21.58 Up 1 .08E-03 cDNA clone S4000019H08, mRNA sequence

NM 030915 Homo sapiens likely ortholog of mouse 20.16 Up 4.00E-04 limb-bud and heart gene (LBH), mRNA

BC037842 Homo sapiens cDNA clone 19.87 Up 6.47E-04 IMAGE:4814672, partial cds

N95448 zb81 e11 .s1 18.98 Up 4.16E-05

Soares senescent fibroblasts NbHSF Homo sapiens cDNA clone IMAGE:310028 3, mRNA sequence

BX648643 Homo sapiens mRNA; cDNA 18.98 Up 1 .17E-03 DKFZp686O17106 (from clone DKFZp686O17106)

N32748 yw91 aO1.s1 18.91 Up 1 .17E-03

Soares_placenta_8to9weeks_2NbHP8 to9W Homo sapiens cDNA clone IMAGE:259560 3, mRNA sequence

NM_018950 Homo sapiens major histocompatibility 18.26 Up 2.32E-03 complex, class I, F (HLA-F), mRNA

BM542398 AGENCOU RT_6436663 18.24 Up 1 .71 E-03

NIH MGC 72 Homo sapiens cDNA clone IMAGE:5539574 5, mRNA sequence

NM 014596 Homo sapiens zinc ribbon domain 18.2 Up 3.17E-02 containing, 1 (ZNRD1 ), transcript variant b, mRNA

AI183970 qd69fO2.x1 Soares testis NHT Homo 17.49 Up 9.01 E-04 sapiens cDNA clone IMAGE:1734747 3, mRNA sequence

NM 001977 Homo sapiens glutamyl 17.46 Up 1 .64E-03 aminopeptidase (aminopeptidase A) (ENPEP), mRNA

NMJ 38970 Homo sapiens neurexin 3 (NRXN3), 17.37 Up 4.64E-03 transcript variant beta, mRNA

AL080103 Homo sapiens mRNA; cDNA 16.52 Up 1 .49E-04 DKFZp564N2216 (from clone DKFZp564N2216) NM 000186 Homo sapiens complement factor H 15.63 Up 2.83E-03

(CFH), mRNA NM 000955 Homo sapiens prostaglandin E 15.31 Up 1 .33E-04 receptor 1 (subtype EP1 ), 42kDa

(PTGER1 ), mRNA NM 032576 Homo sapiens chromosome Y open 15.25 Up 1 .26E-03 reading frame 15B (CYorf15B), mRNA BQ01 1545 UI-1 -BC1 p-asi-a-02-0-Ul.s1 15.18 Up 1 .08E-03

NCI CGAP PI3 Homo sapiens cDNA clone UI-1 -BC1 p-asi-a-02-0-UI 3, mRNA sequence NM 021637 Homo sapiens transmembrane protein 14.84 Up 1 .43E-04

35 (TMEM35), mRNA NM 001505 Homo sapiens G protein-coupled 14.55 Up 1 .64E-04 receptor 30 (GPR30), mRNA NM_004221 Homo sapiens natural killer cell 14.49 Up 2.36E-04 transcript 4 (NK4), mRNA BM993234 UI-H-DT0-aty-n-22-0-Ul.s1 14.23 Up 3.68E-03

NCI CGAP DTO Homo sapiens cDNA clone IMAGE:5866197 3, mRNA sequence NM 015345 Homo sapiens dishevelled associated 14.14 Up 1 .85E-04 activator of morphogenesis 2

(DAAM2), mRNA BX1 18843 BX1 18843 NCI CGAP GC6 Homo 13.88 Up 4.46E-04 sapiens cDNA clone

IMAGp998B055534 ;

IMAGE:2236708, mRNA sequence NM 002462 Homo sapiens myxovirus (influenza 13.86 Up 4.82E-04 virus) resistance 1 , interferon-inducible protein p78 (mouse) (MX1 ), mRNA NM 033255 Homo sapiens epithelial stromal 13.74 Up 4.10E-04 interaction 1 (breast) (EPST11 ), mRNA BM678934 UI-E-EO0-ahx-f-05-0-Ul.s1 UI-E-EOO 13.72 Up 1 .75E-03

Homo sapiens cDNA clone UI-E-EOO- ahx-f-05-O-UI 3, mRNA sequence W93585 zd95gO1 .s1 13.56 Up 1 .13E-03

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:357264 3, mRNA sequence NM 024579 Homo sapiens hypothetical protein 13.16 Up 3.18E-04

FLJ23221 (FLJ23221 ), mRNA NM 017912 Homo sapiens hect domain and RLD 6 13.1 Up 1 .10E-03

(HERC6), mRNA NM 033285 Homo sapiens tumor protein p53 12.93 Up 2.06E-04 inducible nuclear protein 1

(TP53INP1 ), mRNA NM 019891 Homo sapiens ERO1-like beta (S. 12.81 Up 2.73E-03 cerevisiae) (ER01 LB), mRNA BE378852 601237381 F1 NIH_MGC_44 Homo 12.8 Up 1 .13E-03 sapiens cDNA clone I MAG E: 3609140

5, mRNA sequence AI028737 ov92h07.x1 Soares testis NHT Homo 12.61 Up 1 .40E-03 sapiens cDNA clone I MAGE: 1644829

3, mRNA sequence NM 203370 Homo sapiens similar to RIKEN cDNA 12.56 Up 2.36E-04 6530418L21 (LOC3891 19), mRNA CA31 1652 UI-CF-FN0-afd-b-22-0-Ul.s1 UI-CF- 12.28 Up 1 .05E-03

FNO Homo sapiens cDNA clone Ul-

CF-FN0-afd-b-22-0-UI 3, mRNA sequence AA195328 zr34fO8.s1 Soares_NhHMPu_S1 12.1 Up 3.36E-03

Homo sapiens cDNA clone

IMAGE:665319 3, mRNA sequence BC029048 Homo sapiens cDNA clone 12.09 Up 1 .36E-03

IMAGE:5184198, partial cds BQ924832 AGENCOURT 8840265 12.05 Up 1 .43E-04

Lupski_sciatic_nerve Homo sapiens cDNA clone IMAGE:6205036 5, mRNA sequence NM 000396 Homo sapiens cathepsin K 1 1.98 Up 2.24E-03

(pycnodysostosis) (CTSK), mRNA NM 198270 Homo sapiens Nance-Horan 1 1.87 Up 1 .45E-03 syndrome (congenital cataracts and dental anomalies) (NHS), mRNA NM 000557 Homo sapiens growth differentiation 11 .6 Up 2.50E-02 factor 5 (cartilage-derived morphogenetic protein-1 ) (GDF5), mRNA T47364 yb13a10.r1 Stratagene placenta 1 1.54 Up 3.18E-02

(#937225) Homo sapiens cDNA clone

IMAGE:71034 5, mRNA sequence NM 001765 Homo sapiens CD1 C antigen, c 1 1.12 Up 8.61 E-05 polypeptide (CD1 C), mRNA NM 080874 Homo sapiens ankyrin repeat and 11 Up 1 .51 E-03

SOCS box-containing 5 (ASB5), mRNA NM 003287 Homo sapiens tumor protein D52-like 10.8 Up 9.18E-04

1 (TPD52L1 ), transcript variant 1 , mRNA NM 017947 Homo sapiens molybdenum cofactor 10.7 Up 3.53E-04 sulfurase (MOCOS), mRNA NM_014585 Homo sapiens solute carrier family 40 10.45 Up 2.36E-04

(iron-regulated transporter), member 1

(SLC40A1 ), mRNA NM 052890 Homo sapiens peptidoglycan 10.44 Up 1 .47E-03 recognition protein 2 (PGLYRP2), mRNA NM_015865 Homo sapiens solute carrier family 14 10.37 Up 1 .38E-04

(urea transporter), member 1 (Kidd blood group) (SLC14A1 ), mRNA BG436244 602508665F1 NIH MGC 79 Homo 10.25 Up 1 .61 E-03 sapiens cDNA clone IMAGE:4605617

5, mRNA sequence NM 002800 Homo sapiens proteasome (prosome, 10.2 Up 1 .85E-04 macropain) subunit, beta type, 9 (large multifunctional protease 2) (PSMB9), transcript variant 1 , mRNA NM 000023 Homo sapiens sarcoglycan, alpha 10.15 Up 1 .06E-04

(5OkDa dystrophin-associated glycoprotein) (SGCA), mRNA AK095726 Homo sapiens cDNA FLJ38407 fis, 9.96 Up 3.04E-03 clone FEBRA2008859 NM 198474 Homo sapiens olfactomedin-like 1 9.85 Up 2.69E-03 (0LFML1 ), mRNA

H79930 yu10h08.r1 Soares fetal liver spleen 9.77 Up 8.93E-04

1 NFLS Homo sapiens cDNA clone IMAGE:233439 5 similar to gb:M57710 GALECTIN-3 (HUMAN);, mRNA sequence

NM 004934 Homo sapiens cadhehn 18, type 2 9.74 Up 9.94E-05 (CDH18), mRNA

BM998432 U I-H-DT1 -awc-p-06-O-U I .s1 9.7 Up 1 .05E-03

NCI CGAP DT1 Homo sapiens cDNA clone IMAGE:5887733 3, mRNA sequence

CD356352 AGENCOURT 14250785 9.63 Up 5.95E-04

NIH MGC 187 Homo sapiens cDNA clone IMAGE:30404140 5, mRNA sequence

CD357395 AGENCOURT 14254689 9.61 Up 1 .91 E-03

NIH MGC 187 Homo sapiens cDNA clone IMAGE:30402102 5, mRNA sequence

NM 016246 Homo sapiens 9.61 Up 3.40E-03 dehydrogenase/reductase (SDR family) member 10 (DHRS10), mRNA

NM 001870 Homo sapiens carboxypeptidase A3 9.52 Up 3.95E-04 (mast cell) (CPA3), mRNA

N40495 yw74f12.r1 9.42 Up 3.33E-04

Soares_placenta_8to9weeks_2NbHP8 to9W Homo sapiens cDNA clone IMAGE:257999 5 similar to contains AIu repetitive element;, mRNA sequence

NM 001957 Homo sapiens endothehn receptor 9.41 Up 3.99E-04 type A (EDNRA), mRNA

NM 03221 1 Homo sapiens lysyl oxidase-like 4 9.4 Up 2.10E-04

(L0XL4), mRNA

NM_002421 Homo sapiens matrix 9.39 Up 1 .95E-02 metalloproteinase 1 (interstitial collagenase) (MMP1 ), mRNA

NM 006561 Homo sapiens CUG triplet repeat, 9.36 Up 1 .06E-03

RNA binding protein 2 (CUGBP2), mRNA

AF131813 Homo sapiens clone 24970 mRNA 9.34 Up 1 .07E-04 sequence

NM_024833 Homo sapiens hypothetical protein 9.28 Up 2.07E-03

FLJ23506 (FLJ23506), mRNA

NM_007250 Homo sapiens Kruppel-like factor 8 9.08 Up 1 .13E-03

(KLF8), mRNA

NM_021094 Homo sapiens solute carrier organic 8.95 Up 2.66E-04 anion transporter family, member 1A2

(SLCO1 A2), transcript variant 2, mRNA

F22640 HSPD07486 HM3 Homo sapiens 8.89 Up 4.46E-04 cDNA clone 097-X1 -10, mRNA sequence

NA 8.8 Up 1 .88E-03

BM712072 UI-E-DW1 -ahc-b-1 1 -0-UI.M UI-E-DW1 8.78 Up 4.05E-03 Homo sapiens cDNA clone UI-E-DW1- ahc-b-1 1-O-UI 5, mRNA sequence NM_144617 Homo sapiens heat shock protein, 8.74 Up 9.18E-04 alpha-crystallin-related, B6 (HSPB6), mRNA NM_147189 Homo sapiens hypothetical protein 8.71 Up 2.68E-03

MGC39325 (MGC39325), mRNA NM 024812 Homo sapiens brain and acute 8.68 Up 3.18E-04 leukemia, cytoplasmic (BAALC), mRNA NM_022168 Homo sapiens interferon induced with 8.67 Up 3.03E-04 helicase C domain 1 (IFIH1 ), mRNA BU620793 UI-H-FL1 -bfx-d-10-0-Ul.s1 8.55 Up 1 .73E-03

NCI CGAP FL1 Homo sapiens cDNA clone UI-H-FL1 -bfx-d-10-0-UI 3, mRNA sequence NM 016157 Homo sapiens trophinin (TRO), 8.53 Up 1 .19E-03 transcript variant 3, mRNA AI831055 wj62cO8.x1 NCI_CGAP_Lu19 Homo 8.5 Up 1 .21 E-03 sapiens cDNA clone IMAGE:2407406

3 similar to gb:J03890_rna1


PRECURSOR (HUMAN);, mRNA sequence NM 004785 Homo sapiens solute carrier family 9 8.47 Up 4.46E-04

(sodium/hydrogen exchanger), isoform

3 regulator 2 (SLC9A3R2), mRNA NM_144664 Homo sapiens hypothetical protein 8.47 Up 2.31 E-03

MGC33371 (MGC33371 ), mRNA NM 006307 Homo sapiens sushi-repeat-containing 8.39 Up 1 .33E-04 protein, X-linked (SRPX), mRNA BX109290 BX109290 NCI_CGAP_Br2 Homo 8.38 Up 3.43E-04 sapiens cDNA clone

IMAGp998A244082 ;

IMAGE:1609631 , mRNA sequence NM 138966 Homo sapiens neuropilin (NRP) and 8.37 Up 1 .18E-02 tolloid (TLL)-like 1 (NETO1 ), transcript variant 3, mRNA AI336238 qt45aO5.x1 8.24 Up 1 .85E-03

Soares_fetal_lung_NbHL19W Homo sapiens cDNA clone IMAGE:1950896

3, mRNA sequence W26490 30c8 Human retina cDNA randomly 8.2 Up 9.08E-04 primed sublibrary Homo sapiens cDNA, mRNA sequence NM 032291 Homo sapiens hypothetical protein 8.17 Up 1 .64E-04

DKFZp761 D221 (DKFZp761 D221 ), mRNA

NA 8.14 Up 4.23E-04 AI654895 wb52bO8.x1 NCI_CGAP_GC6 Homo 8.12 Up 1 .24E-03 sapiens cDNA clone IMAGE:2309271

3, mRNA sequence NM 152703 Homo sapiens chromosome 7 open 8.03 Up 9.08E-04 reading frame 6 (C7orf6), mRNA BX108022 BX108022 Soares placenta Nb2HP 7.86 Up 3.77E-03

Homo sapiens cDNA clone IMAGp998K17194 ; IMAGE:136072, mRNA sequence BG208581 RST28084 Athersys RAGE Library 7.82 Up 2.85E-03

Homo sapiens cDNA, mRNA sequence AW270928 xsO6cO5.x1 NCI_CGAP_Kid11 Homo 7.8 Up 3.15E-03 sapiens cDNA clone IMAGE:2768840

3, mRNA sequence NM 006288 Homo sapiens Thy-1 cell surface 7.77 Up 1.49E-04 antigen (THY1 ), mRNA BX538226 Homo sapiens mRNA; cDNA 7.76 Up 1.41 E-03

DKFZp686E1944 (from clone

DKFZp686E1944) BF791632 602251768F1 NIH MGC 84 Homo 7.72 Up 9.33E-04 sapiens cDNA clone IMAGE:4344232

5, mRNA sequence NM 173554 Homo sapiens chromosome 10 open 7.65 Up 3.89E-03 reading frame 107 (C10orf107), mRNA AK000271 Homo sapiens cDNA FLJ20264 fis, 7.65 Up 1.21 E-03 clone COLF7912 NM_031442 Homo sapiens transmembrane 4 7.63 Up 2.13E-03 superfamily member 10 (TM4SF10), mRNA AW196419 xm33cO6.x1 NCI_CGAP_GC6 Homo 7.63 Up 1.51 E-03 sapiens cDNA clone IMAGE:2685994

3, mRNA sequence AI86781 1 wb39aO5.x1 NCI CGAP GC6 Homo 7.62 Up 6.21 E-04 sapiens cDNA clone IMAGE:2308016

3, mRNA sequence AW137001 UI-H-BI1 -acu-c-05-0-Ul.s1 7.61 Up 2.13E-03

NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2715632 3, mRNA sequence NM 016108 Homo sapiens androgen-induced 1 7.58 Up 3.51 E-04

(AIG1 ), mRNA NM 001710 Homo sapiens B-factor, properdin 7.56 Up 2.24E-04

(BF), mRNA AK056155 Homo sapiens cDNA FLJ31593 fis, 7.52 Up 2.35E-03 clone NT2RI2002481 NM 016599 Homo sapiens myozenin 2 (MYOZ2), 7.51 Up 1.57E-03 mRNA NM 004933 Homo sapiens cadherin 15, M- 7.48 Up 1.62E-03 cadherin (myotubule) (CDH15), mRNA NM 024759 Homo sapiens hypothetical protein 7.47 Up 9.29E-04

FLJ13955 (FLJ13955), mRNA AW205180 UI-H-BI1 -aeo-c-02-0-Ul.s1 7.45 Up 7.52E-03

NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2719874 3, mRNA sequence AB028949 Homo sapiens mRNA for KIAA1026 7.45 Up 1.68E-04 protein, partial cds NM 003706 Homo sapiens phospholipase A2, 7.35 Up 1.50E-03 group IVC (cytosolic, calcium- independent) (PLA2G4C), mRNA NM 003528 Homo sapiens histone 2, H2be 7.33 Up 2.56E-04

(HIST2H2BE), mRNA AW897912 RC3-NN0064-090500-021 -fO3 7.31 Up 3.41 E-04 NN0064 Homo sapiens cDNA, mRNA sequence BC050602 Homo sapiens histone 1 , H2ac, mRNA 7.31 Up 4.84E-04

(cDNA clone MGC:60051

IMAGE:6526471 ), complete cds AI400012 tg85aO6.x1 Soares_NhHMPu_S1 7.28 Up 3.74E-03

Homo sapiens cDNA clone

IMAGE:21 15538 3 similar to contains

L1 .b3 L1 repetitive element ;, mRNA sequence

NM 018009 Homo sapiens TAP binding protein- 7.24 Up 3.58E-04 like (TAPBPL), mRNA NM 001740 Homo sapiens calbindin 2, 29kDa 7.24 Up 2.94E-03

(calretinin) (CALB2), transcript variant

CALB2, mRNA NM 000231 Homo sapiens sarcoglycan, gamma 7.22 Up 5.82E-04

(35kDa dystrophin-associated glycoprotein) (SGCG), mRNA AJ606316 Homo sapiens mRNA for non-coding 7.22 Up 3.13E-03 transcript, polyA signal, clone 78-E/P5 BF509573 UI-H-BI4-apf-b-1 1 -0-Ul.s1 7.21 Up 2.07E-03

NCI_CGAP_Sub8 Homo sapiens cDNA clone I MAG E: 3086949 3, mRNA sequence AI686890 tp90h02.x1 NCI_CGAP_Ut3 Homo 7.18 Up 3.70E-03 sapiens cDNA clone IMAGE:220661 1

3, mRNA sequence BG461588 RST44458 Athersys RAGE Library 7.15 Up 1 .57E-03

Homo sapiens cDNA, mRNA sequence NM 005576 Homo sapiens lysyl oxidase-like 1 7.13 Up 2.06E-04

(L0XL1 ), mRNA CA31 1586 UI-CF-FN0-afd-d-09-0-Ul.s1 UI-CF- 7.1 1 Up 5.63E-03

FNO Homo sapiens cDNA clone Ul-

CF-FN0-afd-d-09-0-UI 3, mRNA sequence NM 033132 Homo sapiens Zic family member 5 7.09 Up 2.78E-03

(odd-paired homolog, Drosophila)

(ZIC5), mRNA AI677721 wd33gO8.x1 Soares NFL T GBC SI 7.07 Up 2.36E-03

Homo sapiens cDNA clone

IMAGE:2329982 3, mRNA sequence CB957775 AGENCOURTJ 3667086 6.98 Up 4.62E-03

NIH MGC 184 Homo sapiens cDNA clone IMAGE:30353345 5, mRNA sequence AK097239 Homo sapiens cDNA FLJ39920 fis, 6.97 Up 9.17E-03 clone SPLEN2020166 BE670922 7e43bO4.x1 NCI_CGAP_Lu24 Homo 6.94 Up 3.06E-03 sapiens cDNA clone IMAGE:3285199

3, mRNA sequence AK129550 Homo sapiens cDNA FLJ26039 fis, 6.91 Up 1 .39E-03 clone PRS00963 CK299101 UI-E-EJ1-ajq-m-1 1 -0-Ul.s1 UI-E-EJ1 6.9 Up 4.76E-03

Homo sapiens cDNA clone UI-E-EJ1 - ajq-m-1 1 -O-UI 3, mRNA sequence AI378375 tc78dO3.x1 Soares NhHMPu S1 6.84 UD 4.34E-03 Homo sapiens cDNA clone

IMAGE:2070725 3, mRNA sequence BU619160 UI-H-FH1 -bfn-g-07-0-Ul.s1 6.83 Up 5.56E-03

NCI CGAP FH1 Homo sapiens cDNA clone UI-H-FH1 -bfn-g-07-0-UI 3, mRNA sequence BQ021661 UI-H-DH1-axg-p-14-0-Ul.s1 6.8 Up 1.87E-03

NCI CGAP DH1 Homo sapiens cDNA clone IMAGE:5828605 3, mRNA sequence NM 006033 Homo sapiens lipase, endothelial 6.78 Up 8.88E-05

(LIPG), mRNA AL832916 Homo sapiens mRNA; cDNA 6.77 Up 1.20E-03

DKFZp762IO915 (from clone

DKFZp762IO915) NM 020379 Homo sapiens mannosidase, alpha, 6.73 Up 9.98E-04 class 1 C, member 1 (MAN1 C1 ), mRNA

NMJ 84087 Homo sapiens tripartite motif- 6.69 Up 2.68E-04 containing 55 (TRIM55), transcript variant 4, mRNA BC042431 Homo sapiens, clone 6.68 Up 2.21 E-03

IMAGE:4821 137, mRNA NM 005086 Homo sapiens sarcospan (Kras 6.67 Up 1.61 E-03 oncogene-associated gene) (SSPN), mRNA BT007074 Homo sapiens glycoprotein 6.64 Up 1.48E-02

(transmembrane) nmb mRNA, complete cds NMJ 52737 Homo sapiens hypothetical protein 6.64 Up 8.79E-03

MGC33993 (MGC33993), mRNA BC014560 Homo sapiens Ly6/neurotoxin 1 , 6.62 Up 4.26E-03 mRNA (cDNA clone IMAGE:4053310) AI733342 op98b10.x5 NCI_CGAP_Lu5 Homo 6.61 Up 1.07E-03 sapiens cDNA clone I MAGE: 1584859

3 similar to contains element OFR

OFR repetitive element ;, mRNA sequence NM 002448 Homo sapiens msh homeo box 6.6 Up 2.05E-03 homolog 1 (Drosophila) (MSX1 ), mRNA AL833381 Homo sapiens mRNA; cDNA 6.6 Up 7.23E-04

DKFZp667L2214 (from clone

DKFZp667L2214) BG413373 7o37g03.x1 NCI_CGAP_Kid1 1 Homo 6.59 Up 1.72E-03 sapiens cDNA clone IMAGE:3576388

3 similar to SW:CGD2_HUMAN


;, mRNA sequence W51873 zc45bO5.r1 6.55 Up 6.09E-03

Soares senescent fibroblasts NbHSF

Homo sapiens cDNA clone

IMAGE:325233 5, mRNA sequence NM 001884 Homo sapiens hyaluronan and 6.52 Up 3.58E-03 proteoglycan link protein 1 (HAPLN 1 ), mRNA NM 015170 Homo sapiens sulfatase 1 (SULF1 ), 6.51 Up 2.21 E-03 mRNA BM929354 U I-E-E J 1 -aje-o- 19-0-U I . r1 UI-E-EJ1 6.49 Up 1 .26E-03

Homo sapiens cDNA clone UI-E-EJ1 - aje-o-19-O-UI 5, mRNA sequence NM_174901 Homo sapiens family with sequence 6.48 Up 2.37E-03 similarity 9, member C (FAM9C), mRNA NM 006558 Homo sapiens KH domain containing, 6.46 Up 1 .79E-03

RNA binding, signal transduction associated 3 (KHDRBS3), mRNA NM 007281 Homo sapiens scrapie responsive 6.44 Up 9.08E-04 protein 1 (SCRG1 ), mRNA NM 145867 Homo sapiens leukotriene C4 6.38 Up 4.73E-04 synthase (LTC4S), transcript variant 1 , mRNA BC040697 Homo sapiens cDNA clone 6.36 Up 4.05E-03

IMAGE:6023106, partial cds AF1 19903 Homo sapiens PRO2834 mRNA, 6.35 Up 4.46E-04 complete cds W52990 zcO2eO9.r1 6.3 Up 8.61 E-05

Soares parathyroid tumor NbHPA

Homo sapiens cDNA clone

IMAGE:321 160 5, mRNA sequence NM 015192 Homo sapiens phospholipase C, beta 6.26 Up 2.53E-02

1 (phosphoinositide-specific) (PLCB1 ), transcript variant 1 , mRNA AK098759 Homo sapiens cDNA FLJ25893 fis, 6.26 Up 4.38E-03 clone CBR03492 N71963 yz95eO3.s1 Soares melanocyte 6.22 Up 1 .64E-03

2NbHM Homo sapiens cDNA clone

IMAGE:290812 3 similar to contains

AIu repetitive element;, mRNA sequence NM_152431 Homo sapiens piwi-like 4 (Drosophila) 6.21 Up 6.30E-03

(PIWIL4), mRNA NM 004102 Homo sapiens fatty acid binding 6.17 Up 3.38E-02 protein 3, muscle and heart

(mammary-derived growth inhibitor)

(FABP3), mRNA AL137383 Homo sapiens mRNA; cDNA 6.16 Up 1 .90E-03

DKFZp434L1626 (from clone

DKFZp434L1626) W38393 zb15cO7.r1 6.14 Up 1 .80E-02

Soares_fetal_lung_NbHL19W Homo sapiens cDNA clone I M AG E: 302124 5, mRNA sequence BM679106 UI-E-EO0-ahy-i-17-0-Ul.s1 UI-E-EOO 6.12 Up 1 .94E-02

Homo sapiens cDNA clone UI-E-EOO- ahy-i-17-O-UI 3, mRNA sequence NM 198270 Homo sapiens Nance-Horan 6.1 Up 6.21 E-04 syndrome (congenital cataracts and dental anomalies) (NHS), mRNA AL049274 Homo sapiens mRNA; cDNA 6.1 Up 1 .07E-02

DKFZp564H203 (from clone

DKFZp564H203) NM 152775 Homo sapiens hypothetical protein 6.08 Up 3.70E-03

MGC33607 (MGC33607), mRNA T91391 yd53eO5.s1 Soares fetal liver spleen 6.07 Up 2.68E-03

1 NFLS Homo sapiens cDNA clone

IMAGE:11 1968 3, mRNA sequence NM 006820 Homo sapiens interferon-induced 6.05 Up 3.68E-04 protein 44 (IFI44L), mRNA NM 145313 Homo sapiens RasGEF domain family, 6.04 Up 1.76E-03 member 1 A (RASGEF1A), mRNA NM 024877 Homo sapiens hypothetical protein 6.04 Up 3.89E-03

FLJ13265 (FLJ13265), mRNA AI311296 ta48d10.x2 NCI_CGAP_Lu25 Homo 6.04 Up 1.92E-03 sapiens cDNA clone IMAGE:2047315

3, mRNA sequence AK021543 Homo sapiens cDNA FLJ11481 fis, 6.02 Up 4.83E-03 clone HEMBA1001803 W58469 zd25bO2.r1 6.01 Up 1.40E-03

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:341643 5, mRNA sequence NM 017523 Homo sapiens XIAP associated factor- 5.99 Up 1.64E-03

1 (HSXIAPAF1 ), transcript variant 1 , mRNA AI168819 ox67d02.s1 Soares_NhHMPu_S1 5.97 Up 3.08E-03

Homo sapiens cDNA clone

IMAGE:1661379 3, mRNA sequence NM 015364 Homo sapiens lymphocyte antigen 96 5.94 Up 6.56E-03

(LY96), mRNA NM 004349 Homo sapiens core-binding factor, runt 5.93 Up 1.43E-04 domain, alpha subunit 2; translocated to, 1 ; cyclin D-related (CBFA2T1 ), transcript variant 1 , mRNA NM 016522 Homo sapiens neurotrimin (HNT), 5.89 Up 4.23E-04 mRNA BX538309 Homo sapiens mRNA; cDNA 5.88 Up 3.88E-03

DKFZp686C09130 (from clone

DKFZp686C09130) AI088183 oz97g01 .x1 5.87 Up 3.83E-03

Soares parathyroid tumor NbHPA

Homo sapiens cDNA clone

IMAGE:1683312 3, mRNA sequence NM 020152 Homo sapiens chromosome 21 open 5.86 Up 7.25E-04 reading frame 7 (C21 orf7), mRNA NM 005893 Homo sapiens calicin (CCIN), mRNA 5.86 Up 6.21 E-04 AA022953 ze72hO7.s1 5.83 Up 8.68E-03

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:364573 3, mRNA sequence BC039369 Homo sapiens, clone 5.82 Up 2.86E-03

IMAGE:5271073, mRNA, partial cds BE326984 hr68d12.x1 NCI_CGAP_Kid1 1 Homo 5.82 Up 3.21 E-03 sapiens cDNA clone IMAGE:3133655

3, mRNA sequence NM 024043 Homo sapiens hypothetical protein 5.8 Up 1.12E-03

MGC3101 (MGC3101 ), mRNA AI681044 tx43gO1 .x1 NCI_CGAP_Lu24 Homo 5.8 Up 3.66E-03 sapiens cDNA clone IMAGE:2272368

3, mRNA sequence BG759321 60271 1825F1 NIH MGC 48 Homo 5.8 UD 5.90E-04 sapiens cDNA clone IMAGE:4852110

5, mRNA sequence AA370555 EST82216 Prostate gland I Homo 5.78 Up 2.10E-04 sapiens cDNA 5 end, mRNA sequence NM 182765 Homo sapiens HECT domain 5.77 Up 3.04E-03 containing 2 (HECTD2), transcript variant 1 , mRNA NM 005025 Homo sapiens serine (or cysteine) 5.73 Up 3.99E-03 proteinase inhibitor, clade I

(neuroserpin), member 1 (SERPINI1 ), mRNA NM 018334 Homo sapiens leucine rich repeat 5.73 Up 6.40E-03 neuronal 3 (LRRN3), mRNA NM 024924 Homo sapiens hypothetical protein 5.67 Up 8.04E-03

FLJ12985 (FLJ12985), mRNA NM 199254 Homo sapiens transmembrane 5.66 Up 4.76E-03 phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 3, mRNA J05158 Homo sapiens carboxypeptidase N 5.66 Up 2.54E-03 precursor (CPN2) mRNA, complete cds NM 024514 Homo sapiens cytochrome P450, 5.65 Up 2.66E-03 family 2, subfamily R, polypeptide 1

(CYP2R1 ), mRNA N28812 yx71 b12.r1 Soares melanocyte 5.63 Up 4.51 E-04

2NbHM Homo sapiens cDNA clone

IMAGE:267167 5, mRNA sequence AW294138 U I-H-B l2-ahg-f-04-0-U I .s 1 5.62 Up 1 .05E-03

NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2726910 3, mRNA sequence BF675806 602083723F1 NIH MGC 83 Homo 5.6 Up 5.91 E-03 sapiens cDNA clone IMAGE:4248004

5, mRNA sequence NM 017881 Homo sapiens chromosome 9 open 5.59 Up 1 .32E-03 reading frame 95 (C9orf95), mRNA NM 004490 Homo sapiens growth factor receptor- 5.58 Up 8.81 E-03 bound protein 14 (GRB14), mRNA BX360820 BX360820 Homo sapiens PLACENTA 5.56 Up 1 .69E-02

COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI075YD12 5-

PRIME, mRNA sequence AA010870 ze21fO4.s1 5.55 Up 1 .43E-04

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:359647 3, mRNA sequence BF436915 7p66aO1 .x1 NCI_CGAP_Pr28 Homo 5.53 Up 1 .61 E-03 sapiens cDNA clone IMAGE:3650592

3 similar to contains AIu repetitive element;, mRNA sequence AB020689 Homo sapiens mRNA for KIAA0882 5.5 Up 7.89E-03 protein, partial cds AK021543 Homo sapiens cDNA FLJ11481 fis, 5.5 Up 4.38E-03 clone HEMBA1001803 NM 001463 Homo sapiens frizzled-related protein 5.49 Up 2.54E-03

(FRZB), mRNA AA844724 ai70g04.s1 Soares testis NHT Homo 5.48 Up 2.00E-03 sapiens cDNA clone IMAGE: 1376214

3, mRNA sequence NM 020873 Homo sapiens leucine rich repeat 5.48 Up 2.81 E-03 neuronal 1 (LRRN1 ), mRNA NM 207127 Homo sapiens polyamine oxidase 5.47 Up 1.45E-03

(exo-N4-amino) (PAOX), transcript variant 4, mRNA NM 014181 Homo sapiens HSPC159 protein 5.47 Up 2.08E-03

(HSPC159), mRNA NM 018650 Homo sapiens MAP/microtubule 5.46 Up 1.46E-03 affinity-regulating kinase 1 (MARK1 ), mRNA AK097878 Homo sapiens cDNA FLJ40559 fis, 5.45 Up 4.21 E-03 clone THYMU2002910 BF594228 7nO9h12.x1 NCI_CGAP_Brn23 Homo 5.41 Up 2.23E-03 sapiens cDNA clone IMAGE:3564167

3, mRNA sequence NM 007005 Homo sapiens transducin-like 5.41 Up 4.65E-03 enhancer of split 4 (E(sp1 ) homolog,

Drosophila) (TLE4), mRNA AK055468 Homo sapiens cDNA FLJ30906 fis, 5.4 Up 1.45E-03 clone FEBRA2006055 AK024261 Homo sapiens cDNA FLJ14199 fis, 5.39 Up 1.50E-03 clone NT2RP3002713 AA555266 nlO8fO7.s1 NCI_CGAP_Pr11 Homo 5.38 Up 4.53E-04 sapiens cDNA clone IMAGE:1029733, mRNA sequence CA442876 UI-H-DP0-avr-p-22-0-Ul.s1 5.34 Up 3.78E-03

NCI CGAP FSI Homo sapiens cDNA clone UI-H-DP0-avr-p-22-0-UI 3, mRNA sequence AA937084 oc1 1 e12.s1 NCI CGAP GCB1 Homo 5.34 Up 5.71 E-03 sapiens cDNA clone IMAGE:1340590

3, mRNA sequence BQ357950 PM0-HT0335-250700-012-bO2 5.34 Up 9.99E-03

HT0335 Homo sapiens cDNA, mRNA sequence NM 152665 Homo sapiens hypothetical protein 5.33 Up 7.49E-03

FLJ40873 (FLJ40873), mRNA NM 020962 Homo sapiens likely ortholog of mouse 5.31 Up 5.59E-03 neighbor of Punc E1 1 (NOPE), mRNA AW021686 df26h11 .y1 Morton Fetal Cochlea 5.3 Up 6.44E-04

Homo sapiens cDNA clone

IMAGE:2484717 5, mRNA sequence AI821533 zt34cO8.x5 Soares ovary tumor 5.3 Up 2.49E-03

NbHOT Homo sapiens cDNA clone

IMAGE:724238 3, mRNA sequence NM 003543 Homo sapiens histone 1 , H4h 5.27 Up 2.36E-03

(HIST1 H4H), mRNA NM 194431 Homo sapiens ribonuclease, RNase A 5.27 Up 3.25E-03 family, 4 (RNASE4), transcript variant

3, mRNA AI955713 wt37fO1 .x1 NCI_CGAP_Pan1 Homo 5.27 Up 1.85E-03 sapiens cDNA clone IMAGE:2509657

3, mRNA sequence NM 198879 Homo sapiens hypothetical protein 5.26 Up 4.74E-04 MGC9913 (MGC9913), mRNA BU621565 UI-H-FL1 -bga-o-06-0-Ul.s1 5.26 Up 3.83E-03

NCI CGAP FL1 Homo sapiens cDNA clone UI-H-FL1 -bga-o-06-0-UI 3, mRNA sequence W94546 zeO4bO5.s1 5.26 Up 1 .19E-02

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:357969 3, mRNA sequence N29918 yy12g1 1 .s1 Soares melanocyte 5.26 Up 5.85E-03

2NbHM Homo sapiens cDNA clone

IMAGE:271076 3, mRNA sequence NM 004717 Homo sapiens diacylglycerol kinase, 5.23 Up 1 .28E-04 iota (DGKI), mRNA CD107875 AGENCOURT 14016730 5.23 Up 9.17E-03

NIH MGC 179 Homo sapiens cDNA clone IMAGE:30364970 5, mRNA sequence AI972433 wr39fO9.x1 NCI_CGAP_Pr28 Homo 5.23 Up 8.36E-04 sapiens cDNA clone IMAGE:2490089

3, mRNA sequence NM_003494 Homo sapiens dysferlin, limb girdle 5.22 Up 8.33E-03 muscular dystrophy 2B (autosomal recessive) (DYSF), mRNA NM 001747 Homo sapiens capping protein (actin 5.21 Up 4.40E-03 filament), gelsolin-like (CAPG), mRNA NM 000892 Homo sapiens kallikrein B, plasma 5.21 Up 2.38E-03

(Fletcher factor) 1 (KLKB1 ), mRNA BX097069 BX097069 Soares infant brain 1 NIB 5.21 Up 3.40E-03

Homo sapiens cDNA clone

IMAGp998P04275 ; IMAGE:47426, mRNA sequence BM976317 UI-CF-EN1 -acz-c-18-0-Ul.s1 UI-CF- 5.21 Up 6.03E-03

EN1 Homo sapiens cDNA clone Ul-

CF-EN1 -acz-c-18-0-UI 3, mRNA sequence NM 024508 Homo sapiens zinc finger, BED 5.21 Up 9.89E-03 domain containing 2 (ZBED2), mRNA

NA 5.19 Up 3.32E-04 NM 181785 Homo sapiens hypothetical protein 5.19 Up 1 .86E-03

LOC283537 (LOC283537), mRNA NM 030594 Homo sapiens cytoplasmic 5.19 Up 8.06E-04 polyadenylation element binding protein 1 (CPEB1 ), mRNA BU625054 U I-H-FG1 -bgl-l-16-0-Ul.s1 5.18 Up 1 .75E-02

NCI CGAP FG1 Homo sapiens cDNA clone U I-H-FG1 -bgl-l-16-0-U I 3, mRNA sequence R62137 yi20a07.s1 Soares placenta Nb2HP 5.18 Up 3.70E-03

Homo sapiens cDNA clone

IMAGE:139764 3, mRNA sequence NM 152381 Homo sapiens cardiomyopathy 5.16 Up 2.67E-04 associated 3 (CMYA3), mRNA BF508259 UI-H-BI4-aqa-c-12-0-Ul.s1 5.15 Up 5.50E-03

NCI_CGAP_Sub8 Homo sapiens cDNA clone IMAGE:3089278 3, mRNA sequence BQ549626 ik89c1 1.x1 Human insulinoma Homo 5.13 Up 3.32E-03 sapiens cDNA clone IMAGE:6027645

3, mRNA sequence NM 032452 Homo sapiens junctophilin 4 (JPH4), 5.12Up 4.61 E-03 mRNA AL831995 Homo sapiens mRNA; cDNA 5.1 Up 1.97E-02

DKFZp451 J163 (from clone

DKFZp451 J163) NM 138786 Homo sapiens hypothetical protein 5.09 Up 8.36E-04

BC014339 (L0C1 16441 ), mRNA NM 004254 Homo sapiens solute carrier family 22 5.09 Up 2.80E-02

(organic anion transporter), member 8

(SLC22A8), mRNA NM 003597 Homo sapiens TGFB inducible early 5.09 Up 4.00E-04 growth response 2 (TIEG2), mRNA AL133596 Homo sapiens mRNA; cDNA 5.08 Up 3.77E-03

DKFZp434E232 (from clone

DKFZp434E232) AK128050 Homo sapiens cDNA FLJ46170 fis, 5.08 Up 1.92E-04 clone TESTI4003404 NM 032957 Homo sapiens regulator of telomere 5.06 Up 3.77E-03 elongation helicase 1 (RTEL1 ), transcript variant 2, mRNA AW262683 xq93cO6.x1 NCI_CGAP_Brn53 Homo 5.05 Up 5.82E-03 sapiens cDNA clone IMAGE:2758186

3, mRNA sequence NM_032148 Homo sapiens solute carrier family 41 , 5.03 Up 6.72E-04 member 2 (SLC41A2), mRNA BF432898 7n28cO6.x1 NCI_CGAP_Lu24 Homo 5.03 Up 1.32E-03 sapiens cDNA clone IMAGE:3565834

3, mRNA sequence NM 000247 Homo sapiens MHC class I 5.03 Up 3.65E-04 polypeptide-related sequence A

(MICA), mRNA NM 022134 Homo sapiens galactose-3-O- 5.01 Up 2.96E-03 sulfotransferase 2 (GAL3ST2), mRNA NM 016229 Homo sapiens cytochrome b5 5.01 Up 3.65E-04 reductase b5R.2 (CYB5R2), transcript variant 1 , mRNA D52654 HUM084D02B Clontech human fetal 326.09 Down 1.07E-04 brain polyA+ mRNA (#6535) Homo sapiens cDNA clone GEN-084D02 5, mRNA sequence NM 019018 Homo sapiens hypothetical protein 124.79 Down 5.94E-04

FLJ1 1 127 (FLJ1 1 127), mRNA NM 198389 Homo sapiens lung type-l cell 1 18.49 Down 3.57E-05 membrane-associated glycoprotein

(T1A-2), transcript variant 2, mRNA NM 007332 Homo sapiens transient receptor 100.66 Down 4.53E-04 potential cation channel, subfamily A, member 1 (TRPA1 ), mRNA BE044800 hn31 aO4.x1 NCI_CGAP_Thy7 Homo 83.86 Down 4.23E-04 sapiens cDNA clone IMAGE:3023694

3, mRNA sequence NM 000716 Homo sapiens complement 78.88 Down 9.18E-05 component 4 binding protein, beta

(C4BPB), mRNA NM 016292 Homo sapiens TNF receptor- 77.43 Down 8.39E-05 associated protein 1 (TRAP1 ), mRNA NM 033120 Homo sapiens naked cuticle homolog 74.2 Down 1.33E-04

2 (Drosophila) (NKD2), mRNA NM 002928 Homo sapiens regulator of G-protein 71.64 Down 4.42E-04 signalling 16 (RGS16), mRNA AI9701 15 wq89dO3.x1 NCI_CGAP_GC6 Homo 58.23 Down 6.61 E-04 sapiens cDNA clone IMAGE:2479205

3, mRNA sequence NM 021 192 Homo sapiens homeo box D1 1 55.23 Down 1.47E-04

(HOXD11 ), mRNA BX648323 Homo sapiens mRNA; cDNA 54.48 Down 1.54E-04

DKFZp686K10163 (from clone

DKFZp686K10163) H09780 ymO1gO8.s1 Soares infant brain 1 NIB 52.74 Down 3.68E-04

Homo sapiens cDNA clone

IMAGE:46473 3, mRNA sequence AA071361 zm61aO3.M Stratagene fibroblast 51.96 Down 4.00E-04

(#937212) Homo sapiens cDNA clone

IMAGE:530092 5 similar to gb:U00001

PROTEIN CDC27HS (HUMAN);, mRNA sequence NM 015419 Homo sapiens adlican 48.52 Down 1.17E-03

(DKFZp564l1922), mRNA AF075054 Homo sapiens full length insert cDNA 45.25 Down 2.36E-04

YO27G01 NM 018330 Homo sapiens KIAA1598 (KIAA1598), 34.94 Down 2.52E-04 mRNA BX5381 1 1 Homo sapiens mRNA; cDNA 34.09 Down 9.03E-05

DKFZp686B02156 (from clone

DKFZp686B02156) NM 000574 Homo sapiens decay accelerating 33.26 Down 6.81 E-05 factor for complement (CD55, Cramer blood group system) (DAF), mRNA NM 002543 Homo sapiens oxidised low density 32.91 Down 2.09E-04 lipoprotein (lectin-like) receptor 1

(0LR1 ), mRNA AF279780 Homo sapiens clone N1 1 NTera2D1 32.48 Down 4.23E-04 teratocarcinoma mRNA NM 002165 Homo sapiens inhibitor of DNA binding 32.47 Down 3.27E-03

1 , dominant negative helix-loop-helix protein (ID1 ), transcript variant 1 , mRNA NM 004093 Homo sapiens ephrin-B2 (EFNB2), 32.18 Down 6.08E-04 mRNA BX106791 BX106791 31 Down 1.68E-04

Soares pregnant uterus NbHPU

Homo sapiens cDNA clone

IMAGp998M201 156 ; IMAGE:486331 , mRNA sequence NM 139314 Homo sapiens angiopoietin-like 4 30.92 Down 5.74E-04

(ANGPTL4), transcript variant 1 , mRNA BX647459 Homo sapiens mRNA; cDNA 29.77 Down 6.28E-04

DKFZp686A131 10 (from clone

DKFZp686A131 10) AK026784 Homo sapiens cDNA: FLJ23131 fis, 29.72 Down 1 .38E-04 clone LNG08502 NM 025095 Homo sapiens hypothetical protein 29.61 Down 2.09E-04

FLJ23558 (FLJ23558), mRNA AW468775 hd27hO3.x1 Soares_NFL_T_GBC_S1 28.82 Down 2.42E-04

Homo sapiens cDNA clone

IMAGE:2910773 3, mRNA sequence AV758461 AV758461 BM Homo sapiens cDNA 28.48 Down 1 .12E-03 clone BMFASG08 5, mRNA sequence NM 003979 Homo sapiens G protein-coupled 27.53 Down 1 .24E-03 receptor, family C, group 5, member A

(GPCR5A), mRNA AW293498 UI-H-BI2-ahq-a-01 -0-Ul.s1 26.91 Down 4.70E-04

NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2727456 3, mRNA sequence NM_005733 Homo sapiens kinesin family member 26.74 Down 2.21 E-02

2OA (KIF20A), mRNA BC005107 Homo sapiens chromosome 21 open 26.6 Down 6.29E-04 reading frame 105, mRNA (cDNA clone IMAGE:3840937), partial cds BE464407 hx89gO5.x1 NCI_CGAP_Kid1 1 Homo 26.35 Down 1 .47E-04 sapiens cDNA clone IMAGE:3195032

3, mRNA sequence NM 006722 Homo sapiens microphthalmia- 25.39 Down 1 .07E-04 associated transcription factor (MITF), transcript variant 3, mRNA BC045698 Homo sapiens, clone 24.88 Down 1 .00E-03

IMAGE:530271 1 , mRNA NM 001049 Homo sapiens somatostatin receptor 1 24.56 Down 2.36E-04

(SSTR1 ), mRNA AA757156 ah55hO2.s1 Soares testis NHT Homo 24.37 Down 9.09E-04 sapiens cDNA clone 1309587 3, mRNA sequence NM 006722 Homo sapiens microphthalmia- 23.87 Down 3.35E-04 associated transcription factor (MITF), transcript variant 3, mRNA NM 004117 Homo sapiens FK506 binding protein 23.43 Down 3.70E-03

5 (FKBP5), mRNA NM 012342 Homo sapiens BMP and activin 23.09 Down 1.24E-02 membrane-bound inhibitor homolog

(Xenopus laevis) (BAMBI), mRNA NM 001337 Homo sapiens chemokine (C-X3-C 22.72 Down 8.97E-04 motif) receptor 1 (CX3CR1 ), mRNA AA553336 nk61 e11 .s1 NCI_CGAP_Sch1 Homo 21.92 Down 8.39E-05 sapiens cDNA clone IMAGE:1018028

3, mRNA sequence AI003843 Ot66b07.s1 Soares testis NHT Homo 21.53 Down 8.88E-05 sapiens cDNA clone IMAGE:1621717

3, mRNA sequence NM 001766 Homo sapiens CD1 D antigen, d 20.73 Down 2.92E-04 polypeptide (CD1 D), mRNA NM 000961 Homo sapiens prostaglandin I2 20.31 Down 1.28E-04

(prostacyclin) synthase (PTGIS), mRNA NM 001325 Homo sapiens cleavage stimulation 20.22 Down 2.54E-02 factor, 3 pre-RNA, subunit 2, 64kDa

(CSTF2), mRNA NM 007193 Homo sapiens annexin A10 20.21 Down 1 .84E-04

(ANXA10), mRNA NM 198074 Homo sapiens olfactory receptor, 19.94 Down 9.75E-04 family 2, subfamily C, member 3

(OR2C3), mRNA NM 000963 Homo sapiens prostaglandin- 19.67 Down 6.21 E-04 endoperoxide synthase 2

(prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA R61470 yh15d12.r1 Soares infant brain 1 NIB 19.22 Down 9.94E-05

Homo sapiens cDNA clone

I MAG E: 37984 5, mRNA sequence NM 030949 Homo sapiens protein phosphatase 1 , 19.07 Down 2.13E-05 regulatory (inhibitor) subunit 14C

(PPP1 R14C), mRNA NM 181353 Homo sapiens inhibitor of DNA binding 18.79 Down 3.49E-04

1 , dominant negative helix-loop-helix protein (ID1 ), transcript variant 2, mRNA BG912905 602807494F1 NCI_CGAP_Brn67 18.66 Down 3.68E-04

Homo sapiens cDNA clone

IMAGE:4939558 5, mRNA sequence NM 031476 Homo sapiens hypothetical protein 18.55 Down 1.14E-03

DKFZp434B044 (DKFZP434B044), mRNA X02851 Human mRNA for interleukin-1 18.46 Down 2.36E-04 precursor (pre IL-1 ) NM 020808 Homo sapiens signal-induced 18.32 Down 2.13E-05 proliferation-associated 1 like 2

(SIPA1 L2), mRNA

NA 18.19 Down 5.23E-05 AA705451 zj90h09.s1 18.15 Down 8.74E-04

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGE:462209 3, mRNA sequence NM_007317 Homo sapiens kinesin family member 18.15 Down 1.37E-02

22 (KIF22), mRNA NM 031920 Homo sapiens ARG99 protein 18.07 Down 1.28E-04

(ARG99), mRNA NM 001379 Homo sapiens DNA (cytosine-5-)- 18 Down 5.63E-03 methyltransferase 1 (DNMT1 ), mRNA NM 001734 Homo sapiens complement 17.09 Down 1.36E-04 component 1 , s subcomponent (C1 S), transcript variant 1 , mRNA AB032981 Homo sapiens mRNA for KIAA1155 16.9 Down 4.23E-04 protein, partial cds BQ027910 UI-H-CO0-arf-d-03-0-Ul.s1 16.88 Down 1.34E-04

NCI_CGAP_Sub9 Homo sapiens cDNA clone IM AG E :3106204 3, mRNA sequence AI693058 wd36a12.x1 Soares_NFL_T_GBC_S1 16.51 Down 8.74E-04

Homo sapiens cDNA clone

IMAGE:2330206 3, mRNA sequence W39159 zb35dO6.r1 16.51 Down 1.57E-03

Soares parathyroid tumor NbHPA

Homo sapiens cDNA clone

IMAGE:305579 5, mRNA sequence NM 019058 Homo sapiens DNA-damage-inducible 16.46 Down 5.06E-02 transcript 4 (DDIT4), mRNA CD723798 oj26f04.y1 Human lacrimal gland, 16.38 Down 1 .17E-03 unamplified: oj Homo sapiens cDNA clone oj26f04 5, mRNA sequence AI823969 wj29aO3.x1 NCI_CGAP_Kid12 Homo 16.1 Down 1 .07E-04 sapiens cDNA clone IMAGE:2404204

3, mRNA sequence CD724015 Oj29c06.y1 Human lacrimal gland, 15.6 Down 6.21 E-03 unamplified: oj Homo sapiens cDNA clone oj29c06 5, mRNA sequence NM 006438 Homo sapiens collectin sub-family 15.6 Down 8.61 E-05 member 10 (C-type lectin)

(COLEC10), mRNA NM 024336 Homo sapiens iroquois homeobox 15.3 Down 7.21 E-04 protein 3 (IRX3), mRNA NM 004566 Homo sapiens 6-phosphofructo-2- 15.12 Down 4.89E-03 kinase/fructose-2,6-biphosphatase 3

(PFKFB3), mRNA NM 004960 Homo sapiens fusion (involved in 15.08 Down 1 .29E-02 t(12;16) in malignant liposarcoma)

(FUS), mRNA NM 012152 Homo sapiens endothelial 15.07 Down 5.45E-03 differentiation, lysophosphatidic acid

G-protein-coupled receptor, 7 (EDG7), mRNA BX647655 Homo sapiens mRNA; cDNA 15 Down 1.47E-04

DKFZp451A21 1 (from clone

DKFZp451A21 1 ) BC036223 Homo sapiens, clone 14.95 Down 2.42E-03

IMAGE:5272183, mRNA BC030663 Homo sapiens, clone 14.91 Down 1.18E-02

IMAGE:5262826, mRNA NM 001854 Homo sapiens collagen, type Xl, alpha 14.87 Down 2.02E-04

1 (COL1 1A1 ), transcript variant A, mRNA NM 002627 Homo sapiens phosphofructokinase, 14.81 Down 2.71 E-02 platelet (PFKP), mRNA NM 005257 Homo sapiens GATA binding protein 6 14.79 Down 1.75E-02

(GATA6), mRNA NM_001523 Homo sapiens hyaluronan synthase 1 14.69 Down 2.19E-04

(HAS1 ), mRNA AI792974 on13gO7.y5 NCI_CGAP_Lu5 Homo 14.52 Down 7.78E-04 sapiens cDNA clone I MAGE: 1556604

5 similar to contains L1.t3 L1 repetitive element ;, mRNA sequence BG620681 602619569F1 NIH_MGC_79 Homo 14.28 Down 8.72E-04 sapiens cDNA clone IMAGE:4733273

5, mRNA sequence NM 005195 Homo sapiens CCAAT/enhancer 14.14 Down 1 .69E-02 binding protein (C/EBP), delta

(CEBPD), mRNA NM 004237 Homo sapiens thyroid hormone 14.04 Down 3.32E-02 receptor interactor 13 (TRIP13), mRNA NM 002153 Homo sapiens hydroxysteroid (17- 13.94 Down 3.08E-04 beta) dehydrogenase 2 (HSD 17B2), mRNA NM 001946 Homo sapiens dual specificity 13.9 Down 3.67E-03 phosphatase 6 (DUSP6), transcript variant 1 , mRNA NM 002148 Homo sapiens homeo box D10 13.84 Down 6.18E-04

(HOXD10), mRNA AV705892 AV705892 ADB Homo sapiens cDNA 13.81 Down 1.06E-03 clone ADBACD06 5, mRNA sequence NM 030622 Homo sapiens cytochrome P450, 13.67 Down 2.36E-03 family 2, subfamily S, polypeptide 1

(CYP2S1 ), mRNA NM 004336 Homo sapiens BUB1 budding 13.61 Down 2.08E-02 uninhibited by benzimidazoles 1 homolog (yeast) (BUB1 ), mRNA BC036918 Homo sapiens, clone 13.58 Down 3.25E-03

IMAGE:5200551 , mRNA NM 002616 Homo sapiens period homolog 1 13.56 Down 3.52E-03

(Drosophila) (PER1 ), mRNA NM 005573 Homo sapiens lamin B1 (LMNB1 ), 13.45 Down 4.92E-03 mRNA NM 001760 Homo sapiens cyclin D3 (CCND3), 13.43 Down 1.07E-02 mRNA NM_013282 Homo sapiens ubiquitin-like, 13.35 Down 5.40E-03 containing PHD and RING finger domains, 1 (UHRF1 ), mRNA AW134980 UI-H-BI1 -abt-a-09-0-Ul.s1 13.24 Down 1.85E-03

NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2712857 3, mRNA sequence NM 000651 Homo sapiens complement 13.19 Down 1.71 E-03 component (3b/4b) receptor 1 , including Knops blood group system

(CR1 ), transcript variant S, mRNA NM 005915 Homo sapiens MCM6 13.15 Down 2.71 E-02 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe)

(S. cerevisiae) (MCM6), mRNA AI215024 qg66e1 1.x1 Soares testis NHT Homo 13.1 Down 1 .38E-04 sapiens cDNA clone IMAGE: 1840172

3, mRNA sequence NM_004516 Homo sapiens interleukin enhancer 13.1 Down 1 .08E-02 binding factor 3, 9OkDa (ILF3), transcript variant 2, mRNA NM 014109 Homo sapiens ATPase family, AAA 13.09 Down 1 .14E-02 domain containing 2 (ATAD2), mRNA BE550347 7a22dO8.x1 NCI CGAP GC6 Homo 13.08 Down 3.65E-04 sapiens cDNA clone I M AG E: 3219471

3 similar to contains L1.t3 L1 repetitive element ;, mRNA sequence BX537697 Homo sapiens mRNA; cDNA 13.06 Down 1 .81 E-03

DKFZp686D0853 (from clone

DKFZp686D0853) NM 021205 Homo sapiens ras homolog gene 13.01 Down 1 .38E-04 family, member U (RHOU), mRNA CB267221 1006127 Human Fat Cell 5-Stretch 12.9 Down 3.95E-02

Plus cDNA Library Homo sapiens cDNA 5, mRNA sequence NM 003920 Homo sapiens timeless homolog 12.89 Down 3.32E-03

(Drosophila) (TIMELESS), mRNA NM 175057 Homo sapiens trace amine receptor 3 12.8 Down 1 .40E-03

(TRAR3), mRNA BG539635 602567579F1 NIH MGC 77 Homo 12.76 Down 3.10E-04 sapiens cDNA clone IMAGE:4692283

5, mRNA sequence NM 012112 Homo sapiens TPX2, microtubule- 12.72 Down 2.13E-02 associated protein homolog (Xenopus laevis) (TPX2), mRNA BF514910 UI-H-BW1 -anp-a-1 1 -0-Ul.s1 12.71 Down 1.61 E-03

NCI_CGAP_Sub7 Homo sapiens cDNA clone IMAGE:3083036 3, mRNA sequence AK128288 Homo sapiens cDNA FLJ46426 fis, 12.58 Down 1.38E-04 clone THYMU3013897 NM 004169 Homo sapiens serine 12.53 Down 2.86E-02 hydroxymethyltransferase 1 (soluble)

(SHMT1 ), transcript variant 1 , mRNA AK097298 Homo sapiens cDNA FLJ39979 fis, 12.51 Down 2.15E-04 clone SPLEN2030397 NM 181353 Homo sapiens inhibitor of DNA binding 12.47 Down 1.68E-04

1 , dominant negative helix-loop-helix protein (ID1 ), transcript variant 2, mRNA BU569968 AGENCOURTJ 0399836 12.17 Down 2.94E-03

NIH MGC 82 Homo sapiens cDNA clone IMAGE:6618060 5, mRNA sequence AW274434 xs62cO3.x1 NCI_CGAP_Kid11 Homo 12.17 Down 9.75E-04 sapiens cDNA clone IMAGE:2774212

3 similar to gb:X5641 1_rna1


CLASS Il Pl CHAIN (HUMAN);, mRNA sequence NM 172069 Homo sapiens pleckstrin homology 12.17 Down 2.04E-03 domain containing, family H (with

MyTH4 domain) member 2

(PLEKHH2), mRNA NM 005607 Homo sapiens PTK2 protein tyrosine 12.07 Down 2.35E-02 kinase 2 (PTK2), transcript variant 2, mRNA NM 002852 Homo sapiens pentaxin-related gene, 12.04 Down 5.22E-02 rapidly induced by IL-1 beta (PTX3), mRNA NM 033082 Homo sapiens cytokine induced 1 1.95 Down 2.65E-04 protein 29 kDa (CIP29), mRNA NM 182767 Homo sapiens solute carrier family 6 11 .9 Down 7.78E-04

(neurotransmitter transporter), member 15 (SLC6A15), mRNA NM 003292 Homo sapiens translocated promoter 1 1.84 Down 2.23E-02 region (to activated MET oncogene)

(TPR), mRNA NM 004417 Homo sapiens dual specificity 1 1.83 Down 1 .73E-02 phosphatase 1 (DUSP1 ), mRNA AK023526 Homo sapiens cDNA FLJ 13464 fis, 1 1.65 Down 3.30E-03 clone PLACE 1003478 NM 015261 Homo sapiens KIAA0056 protein 11.61 Down 6.15E-03

(KIAA0056), mRNA NM 024906 Homo sapiens stearoyl-CoA 11.58 Down 4.48E-04 desaturase 4 (SCD4), mRNA NM 006819 Homo sapiens stress-induced- 11.53 Down 2.25E-02 phosphoprotein 1 (Hsp70/Hsp90- organizing protein) (STIP1 ), mRNA NM 002967 Homo sapiens scaffold attachment 11.52 Down 8.41 E-03 factor B (SAFB), mRNA NM 003244 Homo sapiens TGFB-induced factor 11.49 Down 5.67E-02

(TALE family homeobox) (TGIF), transcript variant 4, mRNA AK027091 Homo sapiens cDNA: FLJ23438 fis, 11.46 Down 2.19E-04 clone HRC13275 NM 012291 Homo sapiens extra spindle poles like 11.31 Down 2.53E-02

1 (S. cerevisiae) (ESPL1 ), mRNA NM_005712 Homo sapiens HERV-H LTR- 11.19 Down 2.21 E-03 associating 1 (HHLA1 ), mRNA AI417237 tg76eO4.x1 Soares_NhHMPu_S1 11.18 Down 8.61 E-05

Homo sapiens cDNA clone

IMAGE:21 14718 3, mRNA sequence NM 017817 Homo sapiens RAB20, member RAS 11.1 Down 4.60E-03 oncogene family (RAB20), mRNA NM 000676 Homo sapiens adenosine A2b 11.09 Down 1.31 E-03 receptor (ADORA2B), mRNA NM 033661 Homo sapiens WD repeat domain 4 11.07 Down 1.48E-02

(WDR4), transcript variant 2, mRNA NM 005458 Homo sapiens G protein-coupled 11.05 Down 8.61 E-05 receptor 51 (GPR51 ), mRNA NM 003914 Homo sapiens cyclin A1 (CCNA1 ), 11 Down 4.10E-04 mRNA AI768129 wg81 eO1.x1 10.98 Down 2.91 E-03


Homo sapiens cDNA clone

IMAGE:2371512 3, mRNA sequence D62676 HUM313C12B Clontech human aorta 10.94 Down 8.61 E-05 polyA+ mRNA (#6572) Homo sapiens cDNA clone GEN-313C12 5, mRNA sequence AW297235 UI-H-BW0-aji-a-05-0-Ul.s1 10.93 Down 2.04E-03

NCI CGAP Sub6 Homo sapiens cDNA clone IMAGE:2731688 3, mRNA sequence NM 174900 Homo sapiens zinc finger protein 42 10.87 Down 1.52E-04

(ZFP42), mRNA NM 005245 Homo sapiens FAT tumor suppressor 10.85 Down 2.68E-02 homolog 1 (Drosophila) (FAT), mRNA BX1 16041 BX1 16041 10.84 Down 2.68E-03

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGp998A091007 ; IMAGE:428816, mRNA sequence NM 015160 Homo sapiens peptidase 10.82 Down 5.37E-02

(mitochondrial processing) alpha

(PMPCA), nuclear gene encoding mitochondrial protein, mRNA AA738254 nx13bO2.s1 NCI CGAP GC3 Homo 10.74 Down 1 .38E-04 sapiens cDNA clone IMAGE:1255947

3, mRNA sequence BI828460 603078228F1 NIH MGC 119 Homo 10.72 Down 2.04E-03 sapiens cDNA clone IMAG E :5169846

5, mRNA sequence AA199830 zq75hO1 .r1 Stratagene hNT neuron 10.71 Down 1.05E-03

(#937233) Homo sapiens cDNA clone

IMAGE:647473 5, mRNA sequence NM_014501 Homo sapiens ubiquitin-conjugating 10.7 Down 2.90E-02 enzyme E2S (UBE2S), mRNA L40522 Homo sapiens (clone OL1 ) mRNA 10.69 Down 2.20E-03 fragment BE789623 601481574F1 NIH_MGC_68 Homo 10.64 Down 1.04E-03 sapiens cDNA clone IMAGE:3884107

5, mRNA sequence NM 015341 Homo sapiens barren homolog 10.56 Down 1.21 E-02

(Drosophila) (BRRN1 ), mRNA NM 024669 Homo sapiens hypothetical protein 10.53 Down 8.61 E-05

FLJ1 1795 (FLJ1 1795), mRNA BX394270 BX394270 Homo sapiens 10.49 Down 1.90E-03


NORMALIZED Homo sapiens cDNA clone CS0DC012YB18 5-PRIME, mRNA sequence NM 033518 Homo sapiens solute carrier family 38, 10.39 Down 7.31 E-04 member 5 (SLC38A5), mRNA NM 004749 Homo sapiens transforming growth 10.38 Down 2.50E-02 factor beta regulator 4 (TBRG4), transcript variant 1 , mRNA BI256889 602974985F1 NIH_MGC_12 Homo 10.33 Down 8.22E-04 sapiens cDNA clone IMAGE:5114229

5, mRNA sequence AK126699 Homo sapiens cDNA FLJ44745 fis, 10.33 Down 1.25E-03 clone BRACE3028360 NM_201402 Homo sapiens deubiquitinating 10.31 Down 2.28E-03 enzyme 3 (DUB3), mRNA NM 000905 Homo sapiens neuropeptide Y (NPY), 10.3 Down 1.16E-04 mRNA H92824 yt90d10.s1 10.28 Down 6.58E-03

Soares_pineal_gland_N3HPG Homo sapiens cDNA clone IMAGE:231571 3 similar to SP:MRS4_YEAST P23500


PROTEIN ;, mRNA sequence NM 006738 Homo sapiens A kinase (PRKA) 10.27 Down 5.40E-03 anchor protein 13 (AKAP13), transcript variant 1 , mRNA NM 002449 Homo sapiens msh homeo box 10.25 Down 1 .07E-04 homolog 2 (Drosophila) (MSX2), mRNA CB045230 NISC_gc09b10.x1 NCI CGAP Coi 7 10.24 Down 9.31 E-04

Homo sapiens cDNA clone

IMAGE:3218250 3, mRNA sequence AW105170 xd81d10.x1 Soares_NFL_T_GBC_S1 10.23 Down 3.14E-03

Homo sapiens cDNA clone

IMAGE:2604019 3, mRNA sequence NM 002482 Homo sapiens nuclear autoantigenic 10.21 Down 7.78E-04 sperm protein (histone-binding)

(NASP), transcript variant 2, mRNA NM 004247 Homo sapiens U5 snRNP-specific 10.19 Down 9.38E-03 protein, 116 kD (U5-1 16KD), mRNA NM 032485 Homo sapiens MCM8 10.13 Down 9.17E-03 minichromosome maintenance deficient 8 (S. cerevisiae) (MCM8), transcript variant 1 , mRNA NM 001798 Homo sapiens cyclin-dependent 10.07 Down 3.25E-02 kinase 2 (CDK2), transcript variant 1 , mRNA BI497235 df133hO3.y1 Morton Fetal Cochlea 10.03 Down 2.14E-03

Homo sapiens cDNA clone

IMAGE:2538076 5, mRNA sequence AI762202 wi54b12.x1 NCI_CGAP_Co16 Homo 10.01 Down 1.85E-03 sapiens cDNA clone IMAGE:2394047

3, mRNA sequence NM 145792 Homo sapiens microsomal glutathione 10 Down 1.45E-04

S-transferase 1 (MGST1 ), transcript variant 1 a, mRNA NM 022068 Homo sapiens family with sequence 9.99 Down 1.21 E-03 similarity 38, member B (FAM38B), mRNA NM 006203 Homo sapiens phosphodiesterase 4D, 9.99 Down 5.57E-04 cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) (PDE4D), mRNA NM 005607 Homo sapiens PTK2 protein tyrosine 9.97 Down 2.07E-02 kinase 2 (PTK2), transcript variant 2, mRNA AA810126 Od13d02.s1 NCI CGAP GCB1 Homo 9.97 Down 2.09E-03 sapiens cDNA clone IMAGE:136781 1

3 similar to TR:Q06835 Q06835


;, mRNA sequence

AF462446 Homo sapiens unknown mRNA 9.86 Down 1.34E-03 NM 002570 Homo sapiens proprotein convertase 9.78 Down 1.43E-04 subtilisin/kexin type 6 (PCSK6), transcript variant 1 , mRNA NM_174912 Homo sapiens hypothetical protein 9.76 Down 7.21 E-04

FLJ31204 (FLJ31204), mRNA NM 003046 Homo sapiens solute carrier family 7 9.75 Down 3.14E-04

(cationic amino acid transporter, y+ system), member 2 (SLC7A2), mRNA NM 173608 Homo sapiens chromosome 14 open 9.69 Down 4.61 E-02 reading frame 80 (C14orf80), mRNA NM 002284 Homo sapiens keratin, hair, basic, 6 9.67 Down 9.18E-05

(monilethrix) (KRTHB6), mRNA NM 006904 Homo sapiens protein kinase, DNA- 9.67 Down 9.05E-03 activated, catalytic polypeptide

(PRKDC), mRNA NM 006027 Homo sapiens exonuclease 1 (EXO1 ), 9.67 Down 1.79E-02 transcript variant 1 , mRNA NM 018286 Homo sapiens hypothetical protein 9.65 Down 2.55E-03

FLJ10970 (FLJ10970), mRNA NM 031304 Homo sapiens hypothetical protein 9.64 Down 2.26E-02

MGC4293 (MGC4293), mRNA NM 003286 Homo sapiens topoisomerase (DNA) I 9.61 Down 2.40E-02

(TOP1 ), mRNA NM 182920 Homo sapiens a disintegrin-like and 9.57 Down 6.49E-04 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9

(ADAMTS9), transcript variant 1 , mRNA NM 005654 Homo sapiens nuclear receptor 9.56 Down 3.26E-03 subfamily 2, group F, member 1

(NR2F1 ), mRNA AF231919 Homo sapiens chromosome 21 9.56 Down 1.87E-02

C21orf108 mRNA, partial cds NM_004523 Homo sapiens kinesin family member 9.51 Down 1.61 E-02

11 (KIF1 1 ), mRNA BX398693 BX398693 Homo sapiens PLACENTA 9.51 Down 1.02E-03

COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI062YJ20 3-PRIME, mRNA sequence AI288404 qv89bO1 .x1 NCI_CGAP_Ut2 Homo 9.49 Down 4.45E-03 sapiens cDNA clone IMAGE:1988713

3, mRNA sequence NM 178039 Homo sapiens Rab6-interacting 9.45 Down 1.01 E-03 protein 2 (ELKS), transcript variant delta, mRNA NM 032986 Homo sapiens Sec23 homolog B (S. 9.41 Down 3.72E-02 cerevisiae) (SEC23B), transcript variant 3, mRNA BI257441 602967789F1 NIH_MGC_12 Homo 9.4 Down 2.00E-03 sapiens cDNA clone IMAGE:5107127

5, mRNA sequence BX647339 Homo sapiens mRNA; cDNA 9.38 Down 4.26E-03

DKFZp779L1016 (from clone

DKFZp779L1016) NM 005826 Homo sapiens heterogeneous nuclear 9.36 Down 3.53E-02 ribonucleoprotein R (HNRPR), mRNA NM 032737 Homo sapiens lamin B2 (LMNB2), 9.28 Down 8.41 E-03 mRNA AW968578 EST380654 MAGE resequences, 9.22 Down 3.35E-04

MAGJ Homo sapiens cDNA, mRNA sequence NM 007086 Homo sapiens WD repeat and HMG- 9.21 Down 1.54E-02 box DNA binding protein 1 (WDHD1 ), transcript variant 1 , mRNA NM 003576 Homo sapiens serine/threonine kinase 9.17 Down 2.39E-02

24 (STE20 homolog, yeast) (STK24), mRNA AW612572 hhO5bO5.x1 NCI_CGAP_Kid1 1 Homo 9.16 Down 2.21 E-04 sapiens cDNA clone IMAGE:2954193

3, mRNA sequence NM 181332 Homo sapiens neuroligin 4, X-linked 9.15 Down 2.23E-04

(NLGN4X), transcript variant 2, mRNA NM 016343 Homo sapiens centromere protein F, 9.14 Down 7.22E-03

350/400ka (mitosin) (CENPF), mRNA D87455 Homo sapiens mRNA for KIAA0266 9.1 Down 1.63E-03 gene, partial cds NM 015595 Homo sapiens Src homology 3 9.1 Down 9.91 E-05 domain-containing guanine nucleotide exchange factor (SGEF), mRNA NM 001400 Homo sapiens endothelial 9.08 Down 3.03E-03 differentiation, sphingolipid G-protein- coupled receptor, 1 (EDG1 ), mRNA NM 130435 Homo sapiens protein tyrosine 9.07 Down 2.13E-05 phosphatase, receptor type, E

(PTPRE), transcript variant 2, mRNA NM 006748 Homo sapiens Src-like-adaptor (SLA), 9 Down 1 .38E-04 mRNA NM 014590 Homo sapiens endogenous retroviral 8.97 Down 8.25E-04 family W, env(C7), member 1

(syncytin) (ERVWE1 ), mRNA NM 001993 Homo sapiens coagulation factor III 8.89 Down 1 .08E-02

(thromboplastin, tissue factor) (F3), mRNA NM 000138 Homo sapiens fibrillin 1 (Marfan 8.89 Down 3.63E-02 syndrome) (FBN1 ), mRNA BX102689 BX102689 NCI_CGAP_Pr28 Homo 8.86 Down 8.36E-04 sapiens cDNA clone

IMAGp998N035163 ;

IMAGE:2094530, mRNA sequence NM 002540 Homo sapiens outer dense fiber of 8.82 Down 1 .23E-02 sperm tails 2 (ODF2), transcript variant

1 , mRNA NM 022073 Homo sapiens egl nine homolog 3 (C. 8.81 Down 9.08E-04 elegans) (EGLN3), mRNA AW241714 xn74bO7.x1 Soares_NFL_T_GBC_S1 8.71 Down 2.13E-05

Homo sapiens cDNA clone

IMAGE:2700181 3, mRNA sequence NM 004958 Homo sapiens FK506 binding protein 8.7 Down 3.25E-02

12-rapamycin associated protein 1

(FRAP1 ), mRNA NM 000104 Homo sapiens cytochrome P450, 8.69 Down 5.05E-03 family 1 , subfamily B, polypeptide 1

(CYP1 B1 ), mRNA AI807813 wf50h08.x1 Soares_NFL_T_GBC_S1 8.67 Down 1.92E-04

Homo sapiens cDNA clone

IMAGE:2359071 3, mRNA sequence X94453 H. sapiens mRNA for pyrroline 5- 8.56 Down 3.07E-02 carboxylate synthetase

NM 005381 Homo sapiens nucleolin (NCL), mRNA 8.54 Down 1.69E-02 NM 020765 Homo sapiens retinoblastoma- 8.54 Down 2.81 E-03 associated factor 600 (RBAF600), mRNA BX089010 BX089010 Soares testis NHT Homo 8.52 Down 1.92E-03 sapiens cDNA clone

IMAGp998L133476 ; IMAGE:1377180, mRNA sequence NM 173508 Homo sapiens solute carrier family 35, 8.5 Down 1 .58E-04 member F3 (SLC35F3), mRNA AL832858 Homo sapiens mRNA; cDNA 8.5 Down 9.08E-04

DKFZp667A182 (from clone

DKFZp667A182) NM 001034 Homo sapiens ribonucleotide 8.48 Down 8.95E-03 reductase M2 polypeptide (RRM2), mRNA NM 005842 Homo sapiens sprouty homolog 2 8.46 Down 9.40E-03 (Drosophila) (SPRY2), mRNA NM 004207 Homo sapiens solute carrier family 16 8.44 Down 1.97E-02

(monocarboxylic acid transporters), member 3 (SLC16A3), mRNA NM 033084 Homo sapiens Fanconi anemia, 8.41 Down 6.16E-03 complementation group D2 (FANCD2), mRNA AK026981 Homo sapiens cDNA: FLJ23328 fis, 8.39 Down 9.17E-03 clone HEP12645 NM 006445 Homo sapiens PRP8 pre-mRNA 8.39 Down 2.26E-02 processing factor 8 homolog (yeast)

(PRPF8), mRNA NM 004153 Homo sapiens origin recognition 8.37 Down 3.98E-03 complex, subunit 1 -like (yeast)

(ORC1 L), mRNA NM 000289 Homo sapiens phosphofructokinase, 8.29 Down 2.77E-02 muscle (PFKM), mRNA NM 016147 Homo sapiens protein phosphatase 8.28 Down 1.28E-02 methylesterase-1 (PME-1 ), mRNA AA012915 ze27cO1 .s1 Soares retina N2b4HR 8.24 Down 3.61 E-03

Homo sapiens cDNA clone

IMAGE:360192 3, mRNA sequence NM 198597 Homo sapiens SEC24 related gene 8.21 Down 2.88E-02 family, member C (S. cerevisiae)

(SEC24C), transcript variant 2, mRNA NM 020158 Homo sapiens exosome component 5 8.2 Down 6.85E-04

(EXOSC5), mRNA NM 016128 Homo sapiens coatomer protein 8.18 Down 3.50E-02 complex, subunit gamma (COPG), mRNA NM 014354 Homo sapiens chromosome 6 open 8.17 Down 1.43E-04 reading frame 54 (C6orf54), mRNA NM 032298 Homo sapiens synaptotagmin III 8.15 Down 1.32E-03

(SYT3), mRNA BX108769 BX108769 Soares fetal liver spleen 8.15 Down 2.86E-03

1 NFLS Homo sapiens cDNA clone

IMAGp998F0297 ; IMAGE:115201 , mRNA sequence NM 018265 Homo sapiens hypothetical protein 8.13 Down 1.38E-04

FLJ10901 (FLJ10901 ), mRNA AK094159 Homo sapiens cDNA FLJ36840 fis, 8.1 Down 1.48E-03 clone ASTRO201 1461 NM 018410 Homo sapiens hypothetical protein 8.08 Down 9.53E-03

DKFZp762E1312 (DKFZp762E1312), mRNA AL574011 AL57401 1 Homo sapiens PLACENTA 8.07 Down 1.89E-03

COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI053YJ04 3-PRIME, mRNA sequence NM 033305 Homo sapiens vacuolar protein sorting 8.06 Down 7.88E-03

13A (yeast) (VPS13A), transcript variant A, mRNA BC041482 Homo sapiens, clone 8.04 Down 1.65E-03

IMAGE:5403381 , mRNA NM_007279 Homo sapiens U2 (RNU2) small 8.04 Down 1.26E-02 nuclear RNA auxiliary factor 2

(U2AF2), mRNA BE350271 ht12dO7.x1 NCI_CGAP_Kid13 Homo 8.02 Down 3.90E-04 sapiens cDNA clone IMAGE:3146509

3, mRNA sequence BU790302 in49dO4.y1 HR85 islet Homo sapiens 8.02 Down 3.27E-03 cDNA clone IMAGE:6125598 5, mRNA sequence BU684045 UI-CF-ENO-acn-h-17-O-Ul.si UI-CF- 8.01 Down 7.70E-03

ENO Homo sapiens cDNA clone Ul-

CF-EN0-acn-h-17-0-UI 3, mRNA sequence AI797677 we90c07.x1 Soares NFL T GBC SI 8.01 Down 3.88E-03

Homo sapiens cDNA clone

IMAGE:2348364 3, mRNA sequence NM 198569 Homo sapiens G protein-coupled 7.99 Down 1.36E-02 receptor 126 (GPR126), mRNA NM 007147 Homo sapiens zinc finger protein 175 7.99 Down 4.28E-03

(ZNF175), mRNA NM 013975 Homo sapiens ligase III, DNA, ATP- 7.99 Down 3.55E-02 dependent (LIG3), transcript variant alpha, mRNA NM 020444 Homo sapiens KIAA1 191 protein 7.99 Down 4.89E-02

(KIAA1 191 ), mRNA AA195265 zr36hO4.s1 Soares_NhHMPu_S1 7.96 Down 1.64E-03

Homo sapiens cDNA clone

IMAGE:665527 3, mRNA sequence NM 000254 Homo sapiens 5- 7.95 Down 8.45E-03 methyltetrahydrofolate-homocysteine methyltransferase (MTR), mRNA NM 018249 Homo sapiens CDK5 regulatory 7.93 Down 1.24E-02 subunit associated protein 2

(CDK5RAP2), mRNA AI337136 qx83bO7.x1 NCI_CGAP_GC6 Homo 7.92 Down 1.12E-03 sapiens cDNA clone IMAGE:2009077

3, mRNA sequence AI216469 qh07h10.x1 Soares NFL T GBC SI 7.91 Down 2.52E-04

Homo sapiens cDNA clone

IMAGE:1844035 3, mRNA sequence NM_014331 Homo sapiens solute carrier family 7, 7.9 Down 3.04E-02

(cationic amino acid transporter, y+ system) member 1 1 (SLC7A1 1 ), mRNA NM 006306 Homo sapiens SMC1 structural 7.89 Down 4.64E-03 maintenance of chromosomes 1 -like 1

(yeast) (SMC1 L1 ), mRNA BX648964 Homo sapiens mRNA; cDNA 7.89 Down 2.50E-04

DKFZp686J0156 (from clone

DKFZp686J0156) NM 001490 Homo sapiens glucosaminyl (N-acetyl) 7.88 Down 7.89E-03 transferase 1 , core 2 (beta-1 ,6-N- acetylglucosaminyltransferase)

(GCNT1 ), mRNA NM 020223 Homo sapiens family with sequence 7.88 Down 3.00E-02 similarity 20, member C (FAM20C), mRNA AL110252 Homo sapiens mRNA; cDNA 7.86 Down 1.62E-02

DKFZp566A1046 (from clone

DKFZp566A1046) NM 006486 Homo sapiens fibulin 1 (FBLN1 ), 7.84 Down 2.32E-02 transcript variant D, mRNA

NM 018057 Homo sapiens solute carrier family 6 7.77 Down 7.38E-04 (neurotransmitter transporter), member 15 (SLC6A15), mRNA

NM 025085 Homo sapiens transcriptional 7.74 Down 2.71 E-02 coactivator tubedown-100 (TBDN100), transcript variant 2, mRNA

AK022346 Homo sapiens cDNA FLJ 12284 fis, 7.74 Down 9.05E-04 clone MAMMA1001757

NM 006319 Homo sapiens CDP-diacylglycerol- 7.73 Down 4.52E-02 inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) (CDIPT), transcript variant 1 , mRNA

NM 020414 Homo sapiens DEAD (Asp-Glu-Ala- 7.73 Down 5.58E-02 Asp) box polypeptide 24 (DDX24), mRNA

BQ186835 UI-E-EJ1-ajy-a-22-0-Ul.r1 UI-E-EJ1 7.72 Down 2.42E-02

Homo sapiens cDNA clone UI-E-EJ1 - ajy-a-22-O-U I 5, mRNA sequence

NM 133330 Homo sapiens Wolf-Hirschhorn 7.71 Down 9.94E-03 syndrome candidate 1 (WHSC1 ), transcript variant 1 , mRNA

NM 003579 Homo sapiens RAD54-like (S. 7.68 Down 2.46E-02 cerevisiae) (RAD54L), mRNA

NM 024755 Homo sapiens hypothetical protein 7.67 Down 2.37E-02 FLJ13213 (FLJ13213), mRNA

NM 000188 Homo sapiens hexokinase 1 (HK1 ), 7.67 Down 1.54E-02 nuclear gene encoding mitochondrial protein, transcript variant 1 , mRNA

NM 017933 Homo sapiens hypothetical protein 7.65 Down 1.93E-03 FLJ20701 (FLJ20701 ), mRNA

BU661543 cl73d12.z1 Hembase; Erythroid 7.63 Down 1.63E-03

Precursor Cells (LCB:cl library) Homo sapiens cDNA clone cl73d12 5, mRNA sequence

W30842 zb78dO5.r1 7.61 Down 3.74E-02

Soares senescent fibroblasts NbHSF Homo sapiens cDNA clone IMAGE:309705 5, mRNA sequence

NM 018948 Homo sapiens mitogen-inducible gene 7.59 Down 5.91 E-03 6 (MIG-6), mRNA

BX102707 BX102707 NCI_CGAP_GC6 Homo 7.58 Down 6.86E-04 sapiens cDNA clone IMAGp998K165725 ; IMAGE:2310279, mRNA sequence

NM 003128 Homo sapiens spectrin, beta, non- 7.58 Down 2.84E-02 erythrocytic 1 (SPTBN 1 ), transcript variant 1 , mRNA

N58802 yv76h10.s1 Soares fetal liver spleen 7.58 Down 1.37E-03

1 NFLS Homo sapiens cDNA clone IMAGE:248707 3, mRNA sequence

NM 003051 Homo sapiens solute carrier family 16 7.56 Down 2.74E-02 (monocarboxylic acid transporters), member 1 (SLC16A1 ), mRNA

NM 000358 Homo sapiens transforming growth 7.52 Down 2.80E-02 factor, beta-induced, 68kDa (TGFBI), mRNA NM 005426 Homo sapiens tumor protein p53 7.52 Down 3.51 E-02 binding protein, 2 (TP53BP2), mRNA NM 000807 Homo sapiens gamma-aminobutyhc 7.51 Down 1.38E-04 acid (GABA) A receptor, alpha 2

(GABRA2), mRNA NM 152759 Homo sapiens hypothetical protein 7.5 Down 2.13E-05

MGC35140 (MGC35140), mRNA NM 002185 Homo sapiens interleukin 7 receptor 7.47 Down 6.86E-04

(IL7R), mRNA BG186651 RST5624 Athersys RAGE Library 7.46 Down 4.77E-02

Homo sapiens cDNA, mRNA sequence NM 001781 Homo sapiens CD69 antigen (p60, 7.46 Down 4.46E-04 early T-cell activation antigen) (CD69), mRNA AA723061 zg83cO2.s1 7.45 Down 2.64E-03

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:399938 3, mRNA sequence BQ027842 U l-H-COO-are-c-06-O-U I .s1 7.45 Down 2.09E-03

NCI_CGAP_Sub9 Homo sapiens cDNA clone IMAGE:3106161 3, mRNA sequence NM 021076 Homo sapiens neurofilament, heavy 7.42 Down 1.12E-03 polypeptide 20OkDa (NEFH), mRNA NM 019088 Homo sapiens hypothetical protein 7.42 Down 3.24E-02

F23149 1 (PD2), mRNA NM 013235 Homo sapiens nuclear RNase III 7.41 Down 2.56E-02

Drosha (RNASE3L), mRNA NM 020338 Homo sapiens retinoic acid induced 17 7.4 Down 2.53E-02

(RAM 7), mRNA NM 000926 Homo sapiens progesterone receptor 7.4 Down 2.79E-03

(PGR), mRNA NM 004091 Homo sapiens E2F transcription factor 7.39 Down 2.63E-03

2 (E2F2), mRNA NM_001423 Homo sapiens epithelial membrane 7.38 Down 5.45E-02 protein 1 (EMP1 ), mRNA BQ439091 AGENCOURT 7761579 7.37 Down 5.73E-03

NIH MGC 70 Homo sapiens cDNA clone IMAGE:6020085 5, mRNA sequence NM_018685 Homo sapiens anillin, actin binding 7.35 Down 1.47E-02 protein (scraps homolog, Drosophila)

(ANLN), mRNA NM 004587 Homo sapiens ribosome binding 7.34 Down 1.42E-02 protein 1 homolog 18OkDa (dog)

(RRBP1 ), mRNA N91 161 zb12bO5.s1 7.33 Down 8.61 E-05

Soares_fetal_lung_NbHL19W Homo sapiens cDNA clone I M AG E: 301809 3, mRNA sequence NM 172020 Homo sapiens POM121 membrane 7.33 Down 1.18E-02 glycoprotein (rat) (POM121 ), mRNA NM 024680 Homo sapiens FLJ2331 1 protein 7.32 Down 2.36E-03

(FLJ2331 1 ), mRNA AW976500 EST388609 MAGE resequences, 7.31 Down 1.26E-03 MAGN Homo sapiens cDNA, mRNA sequence NM 000018 Homo sapiens acyl-Coenzyme A 7.31 Down 4.93E-02 dehydrogenase, very long chain

(ACADVL), nuclear gene encoding mitochondrial protein, mRNA NM 000693 Homo sapiens aldehyde 7.31 Down 1.33E-04 dehydrogenase 1 family, member A3


NM 003018 Homo sapiens surfactant, pulmonary- 7.3 Down 2.34E-03 associated protein C (SFTPC), mRNA NM 015548 Homo sapiens dystonin (DST), 7.28 Down 3.43E-02 transcript variant 1 eA, mRNA NM_014437 Homo sapiens solute carrier family 39 7.27 Down 3.02E-02

(zinc transporter), member 1

(SLC39A1 ), mRNA AI921931 wn86g12.x1 NCI_CGAP_Ut1 Homo 7.26 Down 1.39E-03 sapiens cDNA clone IMAGE:2452774

3 similar to WP:C03B1.10 CE0391 1 ;, mRNA sequence AA004803 zh96cO2.s1 7.24 Down 1.01 E-03

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGE:429122 3, mRNA sequence NM 025150 Homo sapiens threonyl-tRNA 7.23 Down 2.40E-02 synthetase-like 1 (TARSL1 ), mRNA NM_153690 Homo sapiens family with sequence 7.23 Down 2.39E-03 similarity 43, member A (FAM43A), mRNA AW139383 UI-H-BI1 -adq-b-07-0-Ul.s1 7.22 Down 1 .07E-04

NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2717532 3, mRNA sequence NM 181825 Homo sapiens neurofibromin 2 7.22 Down 1 .07E-02

(bilateral acoustic neuroma) (NF2), transcript variant 12, mRNA NM 145012 Homo sapiens chromosome 10 open 7.21 Down 5.46E-02 reading frame 9 (C10orf9), mRNA NM 002755 Homo sapiens mitogen-activated 7.2 Down 4.22E-02 protein kinase kinase 1 (MAP2K1 ), mRNA NM 014865 Homo sapiens chromosome 7.19 Down 1 .80E-02 condensation-related SMC-associated protein 1 (CNAP1 ), mRNA BC045666 Homo sapiens tumor protein p53 7.19 Down 3.59E-03 inducible protein 11 , mRNA (cDNA clone IMAGE:5298525), containing frame-shift errors AK075234 Homo sapiens cDNA FLJ90753 fis, 7.17 Down 3.09E-04 clone PLACE3000213, weakly similar to COMPLEMENT RECEPTOR TYPE

2 PRECURSOR NM 005452 Homo sapiens chromosome 6 open 7.17 Down 5.66E-02 reading frame 11 (C6orf1 1 ), mRNA NM 0191 13 Homo sapiens fibroblast growth factor 7.17 Down 3.50E-03

21 (FGF21 ), mRNA NM 004481 Homo sapiens UDP-N-acetyl-alpha-D- 7.16 Down 3.15E-02 galactosamine:polypeptide N- acetylgalactosaminyltransferase 2

(GalNAc-T2) (GALNT2), mRNA NM 003198 Homo sapiens transcription elongation 7.15 Down 3.46E-02 factor B (SIII), polypeptide 3 (1 1 OkDa, elongin A) (TCEB3), mRNA NM 018281 Homo sapiens hypothetical protein 7.11 Down 1.18E-02

FLJ10948 (FLJ10948), mRNA NM 015213 Homo sapiens RAB6 interacting 7.1 Down 5.53E-02 protein 1 (RAB6IP1 ), mRNA NM 001452 Homo sapiens forkhead box F2 7.09 Down 1.42E-02

(FOXF2), mRNA AW836534 PM3-LT0032-301299-005-a09 LT0032 7.08 Down 2.42E-02

Homo sapiens cDNA, mRNA sequence NM 024568 Homo sapiens chromodomain helicase 7.06 Down 5.47E-02

DNA binding protein 1 -like (CHD1 L), mRNA D86978 Human mRNA for KIAA0225 gene, 7.06 Down 1.94E-02 partial cds D44740 HUMSUPY153 Human brain cDNA 7.04 Down 2.77E-02

Homo sapiens cDNA clone 175-00, mRNA sequence AK000942 Homo sapiens cDNA FLJ 10080 fis, 7.04 Down 2.42E-03 clone HEMBA1001987 AU 130874 AU 130874 NT2RP3 Homo sapiens 7.02 Down 4.86E-03 cDNA clone NT2RP3001589 5, mRNA sequence BU608856 UI-CF-FN0-aeq-b-12-0-Ul.s1 UI-CF- 7.02 Down 2.04E-03

FNO Homo sapiens cDNA clone Ul-

CF-FN0-aeq-b-12-0-UI 3, mRNA sequence NM 003594 Homo sapiens transcription 7 Down 9.23E-03 termination factor, RNA polymerase Il

(TTF2), mRNA NM 004155 Homo sapiens serine (or cysteine) 6.99 Down 1.45E-04 proteinase inhibitor, clade B

(ovalbumin), member 9 (SERPINB9), mRNA NM 007223 Homo sapiens putative G protein 6.99 Down 8.84E-03 coupled receptor (GPR), mRNA BF431867 nab76bO5.x1 6.98 Down 8.39E-04


Homo sapiens cDNA clone

IMAGE:3273560 3, mRNA sequence BC03541 1 Homo sapiens, clone 6.98 Down 2.01 E-03

IMAGE:4824349, mRNA N31746 yy16e1 1 .s1 Soares melanocyte 6.97 Down 2.05E-03

2NbHM Homo sapiens cDNA clone

IMAGE:271436 3, mRNA sequence NM 020385 Homo sapiens XPMC2 prevents 6.96 Down 3.99E-02 mitotic catastrophe 2 homolog

(Xenopus laevis) (XPMC2H), mRNA NM 02301 1 Homo sapiens UPF3 regulator of 6.94 Down 2.86E-02 nonsense transcripts homolog A

(yeast) (UPF3A), transcript variant 1 , mRNA AK095844 Homo sapiens cDNA FLJ38525 fis, 6.92 Down 5.51 E-03 clone HCHON2000851 NM 021 149 Homo sapiens coactosin-like 1 6.89 Down 3.72E-02

(Dictyostelium) (C0TL1 ), mRNA NM 130435 Homo sapiens protein tyrosine 6.89 Down 8.61 E-05 phosphatase, receptor type, E

(PTPRE), transcript variant 2, mRNA NM 001067 Homo sapiens topoisomerase (DNA) Il 6.88 Down 3.97E-02 alpha 17OkDa (TOP2A), mRNA NM 015378 Homo sapiens vacuolar protein sorting 6.87 Down 1.94E-02

13D (yeast) (VPS13D), transcript variant 1 , mRNA BG547079 602573878F1 NIH_MGC_77 Homo 6.85 Down 1.84E-02 sapiens cDNA clone IMAGE:4702218

5, mRNA sequence

NM 001278 Homo sapiens conserved helix-loop- 6.84 Down 4.87E-02 helix ubiquitous kinase (CHUK), mRNA NM 018719 Homo sapiens transcription factor 6.83 Down 9.94E-03

RAM2 (RAM2), mRNA NM 198395 Homo sapiens Ras-GTPase-activating 6.82 Down 4.54E-02 protein SH3-domain-binding protein

(G3BP), transcript variant 2, mRNA NM 003276 Homo sapiens thymopoietin (TMPO), 6.8 Down 2.57E-02 mRNA BC035599 Homo sapiens, clone 6.8 Down 5.59E-02

IMAGE:3871970, mRNA, partial cds NM_017755 Homo sapiens NOL1/NOP2/Sun 6.78 Down 3.70E-02 domain family, member 2 (NSUN2), mRNA XM 303046 Homo sapiens hypothetical gene 6.77 Down 1.15E-03 supported by D16477 (LOC349437), mRNA NM_003487 Homo sapiens TAF15 RNA 6.76 Down 3.71 E-02 polymerase II, TATA box binding protein (TBP)-associated factor,

68kDa (TAF15), transcript variant 2, mRNA BQ050227 AGENCOURT_7051066 6.76 Down 7.38E-04

NIH MGC 71 Homo sapiens cDNA clone IMAGE:5784119 5, mRNA sequence NM 139075 Homo sapiens two pore segment 6.75 Down 9.49E-04 channel 2 (TPCN2), mRNA BM510409 ij41 bO9.y1 Human insulinoma Homo 6.74 Down 1.93E-04 sapiens cDNA clone IMAGE:5633249

5, mRNA sequence NM 053044 Homo sapiens serine protease HTRA3 6.74 Down 4.57E-04

(HTRA3), mRNA AY271826 Homo sapiens ZYG-11 A early 6.72 Down 6.45E-04 embryogenesis protein mRNA, complete cds W92052 zh48gO4.s1 6.72 Down 3.18E-04

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGE:415350 3, mRNA sequence AI188023 qe14aO9.x1 Soares testis NHT Homo 6.71 Down 2.49E-03 sapiens cDNA clone I MAGE: 1738936

3, mRNA sequence NM 001369 Homo sapiens dynein, axonemal, 6.7 Down 4.76E-03 heavy polypeptide 5 (DNAH5), mRNA NM 174924 Homo sapiens hypothetical protein 6.69 Down 1.85E-03

LOC204474 (LOC204474), mRNA NM 145060 Homo sapiens chromosome 18 open 6.69 Down 2.84E-02 reading frame 24 (C18orf24), mRNA

NA 6.68 Down 2.31 E-03 NM 012426 Homo sapiens splicing factor 3b, 6.67 Down 1.32E-02 subunit 3, 13OkDa (SF3B3), mRNA NM_015221 Homo sapiens dynamin binding 6.66 Down 8.10E-03 protein (DNMBP), mRNA NM 003664 Homo sapiens adaptor-related protein 6.65 Down 4.48E-02 complex 3, beta 1 subunit (AP3B1 ), mRNA NM_014640 Homo sapiens tubulin tyrosine ligase- 6.64 Down 2.25E-02 like family, member 4 (TTLL4), mRNA NM 002993 Homo sapiens chemokine (C-X-C 6.63 Down 1.54E-03 motif) ligand 6 (granulocyte chemotactic protein 2) (CXCL6), mRNA BQ723042 AGENCOURT_8109275 6.63 Down 8.88E-05

Lupski_sympathetic_trunk Homo sapiens cDNA clone IMAGE:6189569

5, mRNA sequence NM 004121 Homo sapiens gamma- 6.6 Down 2.33E-02 glutamyltransferase-like activity 1

(GGTLA1 ), mRNA NM 001361 Homo sapiens dihydroorotate 6.59 Down 3.31 E-02 dehydrogenase (DHODH), nuclear gene encoding mitochondrial protein, mRNA NM 016556 Homo sapiens GT198, complete ORF 6.59 Down 1.84E-02

(HUMGT198A), mRNA NM 006080 Homo sapiens sema domain, 6.59 Down 1.64E-02 immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

3A (SEMA3A), mRNA NM 005147 Homo sapiens DnaJ (Hsp40) homolog, 6.59 Down 1.58E-02 subfamily A, member 3 (DNAJA3), mRNA NM 015263 Homo sapiens rabconnectin-3 (RC3), 6.58 Down 4.14E-02 mRNA NM 033290 Homo sapiens midline 1 (Opitz/BBB 6.58 Down 1.42E-02 syndrome) (MIDI ), transcript variant 3, mRNA NM 004731 Homo sapiens solute carrier family 16 6.58 Down 3.46E-03

(monocarboxylic acid transporters), member 7 (SLC16A7), mRNA NM 006475 Homo sapiens periostin, osteoblast 6.58 Down 4.46E-04 specific factor (POSTN), mRNA NM 000956 Homo sapiens prostaglandin E 6.57 Down 1.38E-03 receptor 2 (subtype EP2), 53kDa

(PTGER2), mRNA AW605154 QV0-DT0020-200100-094-C12 6.53 Down 2.71 E-02

DT0020 Homo sapiens cDNA, mRNA sequence NM 001216 Homo sapiens carbonic anhydrase IX 6.53 Down 1.64E-03

(CA9), mRNA AL832779 Homo sapiens mRNA; cDNA 6.53 Down 1.25E-03

DKFZp686H157 (from clone

DKFZp686H157) NM 021224 Homo sapiens zinc finger protein 462 6.52 Down 2.19E-02

(ZNF462), mRNA AI694344 wd45f1 1.x1 Soares NFL T GBC SI 6.5 Down 4.67E-03

Homo sapiens cDNA clone

IMAGE:2331 1 17 3 similar to contains

MER13.b1 MER13 repetitive element

;, mRNA sequence AK056033 Homo sapiens cDNA FLJ31471 fis, 6.48 Down 1.21 E-02 clone NT2NE2001435 AA602964 no97c02.s1 NCI_CGAP_Pr2 Homo 6.48 Down 6.70E-03 sapiens cDNA clone IMAGE:1 114754, mRNA sequence NM 021078 Homo sapiens GCN5 general control 6.46 Down 1.28E-02 of amino-acid synthesis 5-like 2

(yeast) (GCN5L2), mRNA NM 007027 Homo sapiens topoisomerase (DNA) Il 6.44 Down 1.30E-02 binding protein 1 (TOPBP1 ), mRNA NM 015120 Homo sapiens Alstrom syndrome 1 6.44 Down 3.89E-03

(ALMS1 ), mRNA NM 199440 Homo sapiens heat shock 6OkDa 6.44 Down 2.20E-02 protein 1 (chaperonin) (HSPD1 ), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA NM 018288 Homo sapiens PHD finger protein 10 6.43 Down 9.25E-03

(PHF10), transcript variant 1 , mRNA NM 153022 Homo sapiens hypothetical protein 6.42 Down 2.36E-04

FLJ31 166 (FLJ31 166), mRNA NM 004673 Homo sapiens angiopoietin-like 1 6.41 Down 4.82E-04

(ANGPTL1 ), mRNA NM 030793 Homo sapiens F-box protein 38 6.39 Down 3.96E-02

(FBXO38), transcript variant 1 , mRNA NM 021240 Homo sapiens doublesex and mab-3 6.39 Down 5.22E-03 related transcription factor 3 (DMRT3), mRNA NM 000393 Homo sapiens collagen, type V, alpha 6.38 Down 4.85E-02

2 (COL5A2), mRNA NM 006297 Homo sapiens X-ray repair 6.38 Down 1.99E-02 complementing defective repair in Chinese hamster cells 1 (XRCC1 ), mRNA

NM 133334 Homo sapiens Wolf-Hirschhorn 6.37 Down 9.17E-03 syndrome candidate 1 (WHSC1 ), transcript variant 7, mRNA

NM 00121 1 Homo sapiens BUB1 budding 6.36 Down 9.55E-03 uninhibited by benzimidazoles 1 homolog beta (yeast) (BUB1 B), mRNA

AW150944 xg42eO9.x1 NCI_CGAP_Ut1 Homo 6.35 Down 1 .24E-03 sapiens cDNA clone IMAGE:2630248

3 similar to contains L1.b1 L1 repetitive element ;, mRNA sequence

AK093202 Homo sapiens cDNA FLJ35883 fis, 6.34 Down 1 .62E-03 clone TESTI2008929 NM 018077 Homo sapiens RNA binding motif 6.33 Down 1.72E-02 protein 28 (RBM28), mRNA NM_018454 Homo sapiens nucleolar and spindle 6.33 Down 3.51 E-02 associated protein 1 (NUSAP1 ), mRNA

NM 002856 Homo sapiens poliovirus receptor- 6.33 Down 9.05E-03 related 2 (herpesvirus entry mediator

B) (PVRL2), mRNA NM 007029 Homo sapiens stathmin-like 2 6.31 Down 9.17E-03

(STMN2), mRNA NM 017991 Homo sapiens hypothetical protein 6.3 Down 2.47E-02

FLJ10081 (FLJ10081 ), mRNA NM 019592 Homo sapiens ring finger protein 20 6.29 Down 1.81 E-02

(RNF20), mRNA NM 015658 Homo sapiens DKFZP564C186 6.29 Down 3.71 E-02 protein (DKFZP564C186), mRNA CB043973 NISC_gcO1 gO9.x1 NCI CGAP Coi 7 6.28 Down 2.32E-03

Homo sapiens cDNA clone

IMAGE:3217720 3, mRNA sequence NM 145294 Homo sapiens similar to RIKEN cDNA 6.27 Down 3.83E-02

3230401 M21 [Mus musculus]

(LOC197336), mRNA NM 004560 Homo sapiens receptor tyrosine 6.27 Down 4.55E-04 kinase-like orphan receptor 2 (ROR2), mRNA BC042089 Homo sapiens, clone 6.27 Down 1.66E-03

IMAGE:5760997, mRNA NM 015229 Homo sapiens KIAA0664 protein 6.26 Down 1.37E-02

(KIAA0664), mRNA NM 003504 Homo sapiens CDC45 cell division 6.26 Down 1.71 E-03 cycle 45-like (S. cerevisiae) (CDC45L), mRNA NM 001218 Homo sapiens carbonic anhydrase XII 6.26 Down 4.14E-02

(CA12), transcript variant 1 , mRNA AA057634 zl94aO6.s1 Stratagene corneal stroma 6.25 Down 2.68E-03

(#937222) Homo sapiens cDNA clone

IMAGE:512242 3, mRNA sequence AI452683 tj56c10.x1 6.25 Down 9.17E-03


Homo sapiens cDNA clone

IMAGE:2145522 3, mRNA sequence NM 002883 Homo sapiens Ran GTPase activating 6.24 Down 2.78E-02 protein 1 (RANGAP1 ), mRNA NM 0031 19 Homo sapiens spastic paraplegia 7, 6.23 Down 5.05E-02 paraplegin (pure and complicated autosomal recessive) (SPG7), nuclear gene encoding mitochondrial protein, transcript variant 1 , mRNA BX098552 BX098552 NCI_CGAP_Co3 Homo 6.23 Down 4.22E-03 sapiens cDNA clone

IMAGp998M222187 ; IMAGE:882237, mRNA sequence NM 003937 Homo sapiens kynureninase (L- 6.23 Down 6.29E-04 kynurenine hydrolase) (KYNU), mRNA AW612504 hhO3cO1 .x1 NCI_CGAP_Kid1 1 Homo 6.23 Down 4.82E-04 sapiens cDNA clone IMAGE:2954016 3, mRNA sequence NM 004563 Homo sapiens phosphoenolpyruvate 6.22 Down 2.37E-02 carboxykinase 2 (mitochondrial)

(PCK2), mRNA NM 005207 Homo sapiens v-crk sarcoma virus 6.22 Down 2.32E-02

CT10 oncogene homolog (avian)-like

(CRKL), mRNA CN480539 UI-H-FH1-bfe-f-18-0-Ul.s1 6.2 Down 2.04E-03

NCI CGAP FH1 Homo sapiens cDNA clone UI-H-FH1 -bfe-f-18-0-UI 3, mRNA sequence AI669586 tw34bO4.x1 NCI_CGAP_Ut1 Homo 6.2 Down 8.61 E-05 sapiens cDNA clone IMAGE:2261551

3, mRNA sequence AW292004 U I-H-B l2-agt-g-04-0-U I .s 1 6.19 Down 7.36E-03

NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2725447 3, mRNA sequence BX1 18713 BX1 18713 Soares_NFL_T_GBC_S1 6.19 Down 4.69E-04

Homo sapiens cDNA clone

IMAGp998O143710 ;

IMAGE:1467109, mRNA sequence AI873444 wf83bO4.x1 Soares_NFL_T_GBC_S1 6.18 Down 3.40E-03

Homo sapiens cDNA clone

IMAGE:2362159 3, mRNA sequence NM 012316 Homo sapiens karyophehn alpha 6 6.18 Down 1 .40E-02

(importin alpha 7) (KPNA6), mRNA AI376773 te58f10.x1 Soares NFL T GBC SI 6.16 Down 2.96E-03

Homo sapiens cDNA clone

IMAGE:2090923 3 similar to contains element MER32 repetitive element ;, mRNA sequence AI766299 wh71 c10.x1 NCI CGAP Kidi 1 Homo 6.14 Down 6.25E-03 sapiens cDNA clone IMAGE:2386194

3, mRNA sequence NM 003056 Homo sapiens solute carrier family 19 6.14 Down 1 .59E-02

(folate transporter), member 1

(SLC19A1 ), transcript variant 1 , mRNA BQ376061 PM2-TN0025-270800-002-C01 6.13 Down 1.12E-03

TN0025 Homo sapiens cDNA, mRNA sequence AA812812 ai80a03.s1 Soares testis NHT Homo 6.13 Down 4.24E-03 sapiens cDNA clone 1377100 3, mRNA sequence NM 001255 Homo sapiens CDC20 cell division 6.13 Down 2.44E-02 cycle 20 homolog (S. cerevisiae)

(CDC20), mRNA AB018297 Homo sapiens mRNA for KIAA0754 6.12 Down 4.65E-03 protein, partial cds AK002005 Homo sapiens cDNA FLJ11 143 fis, 6.12 Down 2.07E-04 clone PLACE 1006598 AB033029 Homo sapiens mRNA for KIAA1203 6.11 Down 1.35E-02 protein, partial cds AL832050 Homo sapiens mRNA; cDNA 6.11 Down 1.08E-03

DKFZp313J2410 (from clone

DKFZp313J2410) NM 003360 Homo sapiens UDP 6.1 1 Down 4.38E-03 glycosyltransferase 8 (UDP-galactose ceramide galactosyltransferase)

(UGT8), mRNA NM 002631 Homo sapiens phosphogluconate 6.1 Down 4.03E-02 dehydrogenase (PGD), mRNA AL832370 Homo sapiens mRNA; cDNA 6.1 Down 2.18E-02

DKFZp451 B137 (from clone

DKFZp451 B137) NM 003155 Homo sapiens stanniocalcin 1 (STC1 ), 6.09 Down 1.30E-02 mRNA NM 007355 Homo sapiens heat shock 9OkDa 6.09 Down 1.35E-02 protein 1 , beta (HSPCB), mRNA NM_004856 Homo sapiens kinesin family member 6.07 Down 1.01 E-02

23 (KIF23), transcript variant 2, mRNA BM049879 603624349F1 NIH MGC 40 Homo 6.07 Down 9.34E-03 sapiens cDNA clone I MAG E: 5450029

5, mRNA sequence CD703226 EST19367 human nasopharynx Homo 6.06 Down 1.87E-02 sapiens cDNA, mRNA sequence NM 003791 Homo sapiens membrane-bound 6.06 Down 5.43E-02 transcription factor protease, site 1

(MBTPS1 ), transcript variant 1 , mRNA M85500 EST02016 Fetal brain, Stratagene 6.06 Down 5.13E-04

(cat#936206) Homo sapiens cDNA clone HFBCJ03, mRNA sequence NM 017491 Homo sapiens WD repeat domain 1 6.04 Down 5.35E-02

(WDR1 ), transcript variant 1 , mRNA AA609790 ae62aO2.s1 Stratagene lung 6.03 Down 2.68E-03 carcinoma 937218 Homo sapiens cDNA clone IMAGE:951434 3, mRNA sequence CA31 1343 UI-CF-FN0-aff-b-19-0-Ul.s1 UI-CF- 6.03 Down 9.96E-05

FNO Homo sapiens cDNA clone Ul-

CF-FN0-aff-b-19-0-UI 3, mRNA sequence NM_002184 Homo sapiens interleukin 6 signal 6.01 Down 6.37E-03 transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 1 , mRNA XM_098422 Homo sapiens LOC153727 6.01 Down 3.98E-03

(LOC153727), mRNA NM 012334 Homo sapiens myosin X (MYO10), 5.98 Down 1.40E-02 mRNA AF041210 Homo sapiens midline 1 fetal kidney 5.97 Down 4.40E-02 isoform 3 (MIDI ) mRNA, partial cds AL710395 DKFZp686A046_r1 686 (synonym: 5.97 Down 1.08E-02 hlcc3) Homo sapiens cDNA clone

DKFZp686A046 5, mRNA sequence CB163567 K-EST0224464 L17N670205n1 Homo 5.97 Down 4.06E-03 sapiens cDNA clone L17N670205n1-

32-G12 5, mRNA sequence T64957 yd1 1cO1 .s1 Soares fetal liver spleen 5.97 Down 1.63E-03

1 NFLS Homo sapiens cDNA clone

IMAGE:66816 3, mRNA sequence X64643 H.sapiens c6.1A mRNA 5.96 Down 4.03E-02

NM 005434 Homo sapiens BENE protein (BENE), 5.96 Down 1.80E-02 mRNA T79158 yd70t>08.s1 Soares fetal liver spleen 5.95 Down 2.38E-05

1 NFLS Homo sapiens cDNA clone IMAGE:113559 3, mRNA sequence

AK098498 Homo sapiens cDNA FLJ25632 fis, 5.94 Down 1.71E-03 clone STM03991

AI798224 we85cO9.x1 Soares_NFL_T_GBC_S1 5.93 Down 4.06E-03

Homo sapiens cDNA clone IMAGE:2347888 3, mRNA sequence

AK024522 Homo sapiens cDNA: FLJ20869 fis, 5.91 Down 1.43E-03 clone ADKA02377

NM 002605 Homo sapiens phosphodiesterase 8A 5.91 Down 5.05E-02 (PDE8A), transcript variant 1 , mRNA

AW248516 2820632.3prime NIH_MGC_7 Homo 5.91 Down 1.03E-02 sapiens cDNA clone IMAGE:2820632 3, mRNA sequence

NM 013384 Homo sapiens LAG1 longevity 5.9 Down 4.27E-02 assurance homolog 2 (S. cerevisiae) (LASS2), transcript variant 3, mRNA

BX096173 BX096173 Soares_testis_NHT Homo 5.89 Down 1.61 E-03 sapiens cDNA clone IMAGp998F151793 ; IMAGE:730766, mRNA sequence

NM 016252 Homo sapiens baculoviral IAP repeat- 5.88 Down 4.14E-02 containing 6 (apollon) (BIRC6), mRNA

NM 000059 Homo sapiens breast cancer 2, early 5.87 Down 8.39E-04 onset (BRCA2), mRNA

W95518 zeO7b11 .M 5.87 Down 8.39E-04

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:358269 5 similar to contains AIu repetitive element;contains element PTR5 repetitive element ;, mRNA sequence

NM 005078 Homo sapiens transducin-like 5.87 Down 1.97E-02 enhancer of split 3 (E(sp1 ) homolog, Drosophila) (TLE3), mRNA

NM 018945 Homo sapiens phosphodiesterase 7B 5.86 Down 3.50E-03 (PDE7B), mRNA

NM 020210 Homo sapiens sema domain, 5.85 Down 2.43E-02 immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B (SEMA4B), transcript variant 1 , mRNA

AI972618 wr41 bO4.x1 NCI_CGAP_Pr28 Homo 5.85 Down 1.43E-04 sapiens cDNA clone IMAGE:2490223 3, mRNA sequence

BF435310 nab37hO7.x1 5.85 Down 1.11 E-03


Homo sapiens cDNA clone

I MAG E: 3268093 3, mRNA sequence

NM 031844 Homo sapiens heterogeneous nuclear 5.83 Down 1.14E-02 ribonucleoprotein U (scaffold attachment factor A) (HNRPU), transcript variant 1 , mRNA

NM 005786 Homo sapiens serologically defined 5.83 Down 9.26E-03 colon cancer antigen 33 (SDCCAG33), mRNA NM 004877 Homo sapiens glia maturation factor, 5.83 Down 6.86E-04 gamma (GMFG), mRNA NM 030813 Homo sapiens suppressor of 5.8 Down 5.58E-02 potassium transport defect 3 (SKD3), mRNA NM 181782 Homo sapiens nuclear receptor 5.8 Down 7.19E-03 coactivator 7 (NCOA7), mRNA NM 005524 Homo sapiens hairy and enhancer of 5.79 Down 4.38E-03 split 1 , (Drosophila) (HES1 ), mRNA BU684610 UI-CF-EN1 -act-e-20-0-Ul.s1 UI-CF- 5.79 Down 4.61 E-04

EN1 Homo sapiens cDNA clone Ul-

CF-EN1 -act-e-20-0-UI 3, mRNA sequence NM 015640 Homo sapiens PAI-1 mRNA-binding 5.79 Down 2.23E-02 protein (PAI-RBP1 ), mRNA NM 004953 Homo sapiens eukaryotic translation 5.78 Down 2.58E-02 initiation factor 4 gamma, 1 (EIF4G1 ), transcript variant 5, mRNA AL577862 AL577862 Homo sapiens HELA 5.77 Down 5.72E-03

CELLS COT 25-NORMALIZED Homo sapiens cDNA clone CS0DK007YM05

3-PRIME, mRNA sequence R14261 yf79dO5.r1 Soares infant brain 1 NIB 5.77 Down 1.68E-04

Homo sapiens cDNA clone

IMAGE:28642 5, mRNA sequence NM 004741 Homo sapiens nucleolar and coiled- 5.75 Down 1.61 E-03 body phosphoprotein 1 (NOLC1 ), mRNA NM 006290 Homo sapiens tumor necrosis factor, 5.75 Down 3.77E-03 alpha-induced protein 3 (TNFAIP3), mRNA NM 003146 Homo sapiens structure specific 5.74 Down 1.20E-02 recognition protein 1 (SSRP1 ), mRNA NM 024516 Homo sapiens hypothetical protein 5.74 Down 1.61 E-02

MGC4606 (MGC4606), mRNA NM 002922 Homo sapiens regulator of G-protein 5.73 Down 3.89E-03 signalling 1 (RGS1 ), mRNA NM 031407 Homo sapiens upstream regulatory 5.73 Down 2.57E-02 element binding protein 1 (UREB1 ), mRNA AW604329 PM1-CT0247-180100-009-d08 5.72 Down 2.93E-03

CT0247 Homo sapiens cDNA, mRNA sequence AA053713 zf53fO5.s1 Soares retina N2b4HR 5.72 Down 1.08E-03

Homo sapiens cDNA clone

IMAGE:380673 3, mRNA sequence NM 017770 Homo sapiens elongation of very long 5.72 Down 1.02E-02 chain fatty acids (FEN1/Elo2,

SUR4/Elo3, yeast)-like 2 (ELOVL2), mRNA NM 005777 Homo sapiens RNA binding motif 5.72 Down 2.68E-02 protein 6 (RBM6), mRNA NM 024883 Homo sapiens hypothetical protein 5.71 Down 1.64E-04

FLJ22202 (FLJ22202), mRNA NM 022740 Homo sapiens homeodomain 5.71 Down 5.82E-03 interacting protein kinase 2 (HIPK2), mRNA NM 001386 Homo sapiens dihydropyrimidinase- 5.71 Down 2.83E-02 like 2 (DPYSL2), mRNA BQ350534 RC1 -HT0256-120400-019-dO6 5.71 Down 1 .26E-02

HT0256 Homo sapiens cDNA, mRNA sequence NM_031991 Homo sapiens polypyrimidine tract 5.7 Down 1 .19E-02 binding protein 1 (PTBP1 ), transcript variant 3, mRNA NM 000093 Homo sapiens collagen, type V, alpha 5.68 Down 5.42E-02

1 (COL5A1 ), mRNA NM 016328 Homo sapiens GTF2I repeat domain 5.67 Down 3.24E-02 containing 1 (GTF2IRD1 ), transcript variant 1 , mRNA NM 000597 Homo sapiens insulin-like growth 5.66 Down 1 .07E-03 factor binding protein 2, 36kDa

(IGFBP2), mRNA AM 51 176 qc87h11 .x1 5.66 Down 2.81 E-03

Soares pregnant uterus NbHPU

Homo sapiens cDNA clone

IMAGE:1721253 3, mRNA sequence NM_015308 Homo sapiens formin binding protein 4 5.66 Down 2.40E-02

(FNBP4), mRNA NM 004753 Homo sapiens 5.65 Down 8.11 E-04 dehydrogenase/reductase (SDR family) member 3 (DHRS3), mRNA AL358312 Homo sapiens EST from clone 5.65 Down 2.09E-03

938081 , full insert NM 002844 Homo sapiens protein tyrosine 5.64 Down 5.40E-02 phosphatase, receptor type, K

(PTPRK), mRNA NM 012267 Homo sapiens hsp70-interacting 5.63 Down 2.89E-02 protein (HSPBP1 ), mRNA NM 005993 Homo sapiens tubulin-specific 5.61 Down 2.53E-02 chaperone d (TBCD), mRNA NM 000601 Homo sapiens hepatocyte growth 5.59 Down 1.52E-04 factor (hepapoietin A; scatter factor)

(HGF), mRNA NM 006459 Homo sapiens SPFH domain family, 5.59 Down 2.74E-02 member 1 (SPFH1 ), mRNA AF075067 Homo sapiens full length insert cDNA 5.59 Down 9.53E-03

YQ03C01 AK023803 Homo sapiens cDNA FLJ13741 fis, 5.58 Down 3.63E-02 clone PLACE3000208 NM 018369 Homo sapiens DEP domain containing 5.56 Down 5.72E-03

1 B (DEPDCI B), mRNA BX104084 BX104084 Soares testis NHT Homo 5.55 Down 2.56E-03 sapiens cDNA clone

IMAGp998N184411 ;

IMAGE:1736273, mRNA sequence BX091276 BX091276 Soares fetal liver spleen 5.55 Down 1.02E-03

1 NFLS Homo sapiens cDNA clone

IMAGp998l12133 ; IMAGE: 128723, mRNA sequence NM 018179 Homo sapiens activating transcription 5.53 Down 4.29E-02 factor 7 interacting protein (ATF7IP), mRNA NM_004172 Homo sapiens solute carrier family 1 5.52 Down 1.45E-03 (glial high affinity glutamate transporter), member 3 (SLC1A3), mRNA NM 015024 Homo sapiens exportin 7 (XPO7), 5.52 Down 2.16E-02 mRNA NM 005194 Homo sapiens CCAAT/enhancer 5.51 Down 3.96E-02 binding protein (C/EBP), beta

(CEBPB), mRNA AW661854 hi79cO7.x1 Soares NFL T GBC SI 5.51 Down 2.36E-04

Homo sapiens cDNA clone

IMAGE:2978508 3 similar to

TR:Q14264 Q14264 ENVELOPE

PROTEIN. ;, mRNA sequence NM 003331 Homo sapiens tyrosine kinase 2 5.51 Down 4.17E-02

(TYK2), mRNA BX1 19702 BX1 19702 5.49 Down 1 .41 E-02

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGp998K031092 ; I M AG E :461690, mRNA sequence BC006384 Homo sapiens, clone 5.47 Down 1.05E-03

IMAGE:41 10919, mRNA NM 002291 Homo sapiens laminin, beta 1 5.47 Down 3.85E-02

(LAMB1 ), mRNA NM 024335 Homo sapiens iroquois homeobox 5.47 Down 5.60E-03 protein 6 (IRX6), mRNA NM 003709 Homo sapiens Kruppel-like factor 7 5.47 Down 3.06E-03

(ubiquitous) (KLF7), mRNA NM 007068 Homo sapiens DMC1 dosage 5.46 Down 3.14E-02 suppressor of mck1 homolog, meiosis- specific homologous recombination

(yeast) (D MC 1 ), mRNA NM_0151 13 Homo sapiens zinc finger, ZZ type with 5.46 Down 9.25E-03

EF hand domain 1 (ZZEF1 ), mRNA AI733620 an30a05.x5 Gessler Wilms tumor 5.46 Down 8.93E-04

Homo sapiens cDNA clone

I MAGE: 1700144 3, mRNA sequence NM 032204 Homo sapiens activating signal 5.46 Down 1 .48E-02 cointegrator 1 complex subunit 2

(ASCC2), mRNA BM930959 UI-E-EJ0-aip-c-08-0-Ul.r1 UI-E-EJO 5.45 Down 5.66E-02

Homo sapiens cDNA clone UI-E-EJO- aip-c-08-O-UI 5, mRNA sequence NM 005243 Homo sapiens Ewing sarcoma 5.45 Down 1 .48E-02 breakpoint region 1 (EWSR1 ), transcript variant EWS, mRNA NM 014390 Homo sapiens staphylococcal 5.43 Down 5.21 E-02 nuclease domain containing 1 (SND1 ), mRNA NM 001 114 Homo sapiens adenylate cyclase 7 5.43 Down 2.40E-02

(ADCY7), mRNA CD238798 FNPBEG1 1 FNP Homo sapiens 5.43 Down 1.55E-03 cDNA, mRNA sequence NM 005163 Homo sapiens v-akt murine thymoma 5.43 Down 2.38E-02 viral oncogene homolog 1 (AKT1 ), mRNA NM 018023 Homo sapiens YEATS domain 5.43 Down 3.28E-03 containing 2 (YEATS2), mRNA NM 001657 Homo sapiens amphiregulin 5.43 Down 2.61 E-03

(schwannoma-derived growth factor)

(AREG), mRNA NM 005384 Homo sapiens nuclear factor, 5.42 Down 1.37E-02 interleukin 3 regulated (NFIL3), mRNA AL079909 DKFZp586H2217_r1 586 (synonym: 5.42 Down 9.62E-04 hutel ) Homo sapiens cDNA clone

DKFZp586H2217 5, mRNA sequence BC051025 Homo sapiens KIAA0194 protein, 5.41 Down 3.97E-02 mRNA (cDNA clone IMAGE:4914524), partial cds AW131438 xf63eO6.x1 NCI_CGAP_Gas4 Homo 5.41 Down 2.65E-03 sapiens cDNA clone IMAGE:2622754

3, mRNA sequence NM 003376 Homo sapiens vascular endothelial 5.41 Down 1.65E-03 growth factor (VEGF), mRNA L19314 Human HRY gene, complete cds 5.4 Down 1.76E-02

NM 007063 Homo sapiens TBC1 domain family, 5.4 Down 6.26E-04 member 8 (with GRAM domain)

(TBC1 D8), mRNA NM 005862 Homo sapiens stromal antigen 1 5.4 Down 3.76E-02

(STAG1 ), mRNA BX456461 BX456461 Homo sapiens THYMUS 5.39 Down 4.85E-03

Homo sapiens cDNA clone

CS0CAP002YC09 5-PRIME, mRNA sequence NM_014847 Homo sapiens ubiquitin associated 5.39 Down 2.63E-02 protein 2-like (UBAP2L), mRNA NM 006863 Homo sapiens leukocyte 5.39 Down 2.12E-03 immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1 ), mRNA NM 019613 Homo sapiens WDR45-like 5.38 Down 4.22E-02

(WDR45L), mRNA AW293909 UI-H-BW0-ain-g-12-0-Ul.s1 5.37 Down 1.27E-03

NCI_CGAP_Sub6 Homo sapiens cDNA clone IMAGE:2730047 3, mRNA sequence NM 012310 Homo sapiens kinesin family member 5.37 Down 3.90E-03

4A (KIF4A), mRNA NM 004572 Homo sapiens plakophilin 2 (PKP2), 5.37 Down 1.52E-04 transcript variant 2b, mRNA NM 014977 Homo sapiens apoptotic chromatin 5.36 Down 4.64E-03 condensation inducer 1 (ACIN1 ), mRNA NM 024769 Homo sapiens adipocyte-specific 5.36 Down 3.29E-02 adhesion molecule (ASAM), mRNA NM 002648 Homo sapiens pim-1 oncogene 5.35 Down 2.69E-02

(PIM1 ), mRNA NM 005689 Homo sapiens ATP-binding cassette, 5.35 Down 9.35E-03 sub-family B (MDR/TAP), member 6

(ABCB6), nuclear gene encoding mitochondrial protein, mRNA NM 001086 Homo sapiens arylacetamide 5.34 Down 1.56E-03 deacetylase (esterase) (AADAC), mRNA XM 298604 Homo sapiens LOC345191 5.34 Down 6.87E-03

(LOC345191 ), mRNA NM 002804 Homo sapiens proteasome (prosome, 5.34 Down 1.61 E-02 macropain) 26S subunit, ATPase, 3

(PSMC3), mRNA NM 021953 Homo sapiens forkhead box M1 5.32 Down 2.07E-03

(FOXM1 ), transcript variant 2, mRNA AI692536 wd73eO8.x1 NCI_CGAP_Lu24 Homo 5.32 Down 1.60E-03 sapiens cDNA clone IMAGE:2337254

3 similar to contains MER10.t2 MER10

MER10 repetitive element ;, mRNA sequence NM 016223 Homo sapiens protein kinase C and 5.31 Down 2.49E-02 casein kinase substrate in neurons 3

(PACS I N 3), mRNA NM_181718 Homo sapiens hypothetical protein 5.31 Down 1.51 E-02

LOC253982 (LOC253982), mRNA BQ013066 UI-1 -BC1 p-ayk-g-12-0-Ul.s1 5.31 Down 8.28E-04

NCI CGAP PI3 Homo sapiens cDNA clone UI-1 -BC1 p-ayk-g-12-0-UI 3, mRNA sequence NM 000189 Homo sapiens hexokinase 2 (HK2), 5.3 Down 3.71 E-02 mRNA AW152368 xg63eO3.x1 NCI_CGAP_Ut4 Homo 5.3 Down 4.00E-04 sapiens cDNA clone IMAGE:2633020

3 similar to contains AIu repetitive element;, mRNA sequence BC016020 Homo sapiens, Similar to LINE 5.3 Down 4.61 E-03 retrotransposable element 1 , clone

IMAGE:4720177, mRNA NM 015662 Homo sapiens selective LIM binding 5.3 Down 3.23E-02 factor, rat homolog (SLB), mRNA NM_001456 Homo sapiens filamin A, alpha (actin 5.29 Down 2.61 E-02 binding protein 280) (FLNA), mRNA AK021992 Homo sapiens cDNA FLJ11930 fis, 5.29 Down 7.05E-04 clone HEMBB1000441 NM 018128 Homo sapiens hypothetical protein 5.29 Down 2.22E-02

FLJ10534 (FLJ10534), mRNA NM 030798 Homo sapiens Williams-Beuren 5.29 Down 2.62E-02 syndrome chromosome region 16

(WBSCR16), transcript variant 1 , mRNA NM 017876 Homo sapiens ring finger protein 126 5.29 Down 1.59E-02

(RNF126), transcript variant 1 , mRNA NM 006148 Homo sapiens LIM and SH3 protein 1 5.28 Down 1.58E-02

(LASP1 ), mRNA NM 198436 Homo sapiens serine/threonine kinase 5.28 Down 1.94E-02

6 (STK6), transcript variant 5, mRNA AI744669 wgO2e1 1.x1 5.27 Down 5.85E-03


Homo sapiens cDNA clone

IMAGE:2363948 3 similar to contains

L1 .b1 L1 repetitive element ;, mRNA sequence NM 020745 Homo sapiens alanyl-tRNA synthetase 5.27 Down 9.53E-03 like (AARSL), mRNA NM 015022 Homo sapiens PDZ domain containing 5.26 Down 4.46E-04 3 (PDZK3), transcript variant 2, mRNA BM462600 AGENCOU RT_6426368 5.26 Down 1.45E-03

NIH MGC 71 Homo sapiens cDNA clone IMAGE:5518314 5, mRNA sequence AA180849 zp35gO5.r1 Stratagene muscle 937209 5.25 Down 4.92E-03

Homo sapiens cDNA clone

IMAGE:61 1480 5, mRNA sequence NM 145802 Homo sapiens septin 6 (SEPT6), 5.25 Down 4.46E-02 transcript variant V, mRNA NM 004703 Homo sapiens rabaptin, RAB GTPase 5.24 Down 4.60E-02 binding effector protein 1 (RABEP1 ), mRNA NM 017784 Homo sapiens oxysterol binding 5.24 Down 2.61 E-02 protein-like 10 (OSBPL10), mRNA NM 005892 Homo sapiens formin-like 1 (FMNL1 ), 5.24 Down 9.06E-04 mRNA NM 006659 Homo sapiens tubulin, gamma 5.24 Down 5.08E-02 complex associated protein 2

(TUBGCP2), mRNA AW451654 UI-H-BI3-alj-e-09-0-Ul.s1 5.24 Down 4.40E-03

NCI CGAP Sub6 Homo sapiens cDNA clone IMAGE:2736881 3, mRNA sequence NM 002691 Homo sapiens polymerase (DNA 5.23 Down 8.22E-04 directed), delta 1 , catalytic subunit

125kDa (POLD1 ), mRNA NM 015465 Homo sapiens gem (nuclear organelle) 5.23 Down 3.92E-02 associated protein 5 (GEMIN5), mRNA BI041633 PM0-NT0314-260301 -002-f05 NT0314 5.23 Down 2.10E-03

Homo sapiens cDNA, mRNA sequence BC040441 Homo sapiens pleckstrin homology 5.22 Down 5.28E-02 domain containing, family M (with RUN domain) member 2, mRNA (cDNA clone IMAGE:5590182), partial cds BX1 17246 BX1 17246 Soares NFL T GBC SI 5.21 Down 3.70E-03

Homo sapiens cDNA clone

IMAGp998K124513 ;

I MAGE: 1844867, mRNA sequence NM 002466 Homo sapiens v-myb myeloblastosis 5.2 Down 2.04E-03 viral oncogene homolog (avian)-like 2

(MYBL2), mRNA NM 007305 Homo sapiens breast cancer 1 , early 5.2 Down 4.23E-04 onset (BRCA1 ), transcript variant

BRCA1-delta9-10-11 b, mRNA AA504323 aa61 eO2.s1 NCI_CGAP_GCB1 Homo 5.19 Down 8.74E-04 sapiens cDNA clone IMAGE:825434 3 similar to contains MER12.t2 MER12 repetitive element ;, mRNA sequence AK092662 Homo sapiens cDNA FLJ35343 fis, 5.18 Down 8.00E-03 clone PROST2015932 NM 005841 Homo sapiens sprouty homolog 1 , 5.18 Down 2.41 E-02 antagonist of FGF signaling

(Drosophila) (SPRY1 ), transcript variant 1 , mRNA NM 017994 Homo sapiens hypothetical protein 5.17 Down 4.93E-02 FLJ10099 (FLJ10099), mRNA

NM 001499 Homo sapiens GLE1 RNA export 5.17 Down 2.46E-02 mediator-like (yeast) (GLE1 L), transcript variant 2, mRNA

NM 000062 Homo sapiens serine (or cysteine) 5.16 Down 3.57E-02 proteinase inhibitor, clade G (C1 inhibitor), member 1 , (angioedema, hereditary) (SERPING1 ), mRNA

NM 001430 Homo sapiens endothelial PAS 5.16 Down 5.33E-03 domain protein 1 (EPAS1 ), mRNA

NM 001337 Homo sapiens chemokine (C-X3-C 5.14 Down 7.49E-03 motif) receptor 1 (CX3CR1 ), mRNA

AA682863 zj15g10.s1 5.14 Down 7.42E-03

Soares_fetal_liver_spleen_1 NFLS_S1 Homo sapiens cDNA clone IMAGE:450402 3 similar to contains AIu repetitive element;contains element L1 repetitive element ;, mRNA sequence

AL831859 Homo sapiens mRNA; cDNA 5.13 Down 3.18E-03 DKFZp761 F0317 (from clone DKFZp761 F0317)

AW593242 hg1 1 eO5.x1 Soares_NFL_T_GBC_S1 5.13 Down 1.22E-03 Homo sapiens cDNA clone IMAGE:2945312 3 similar to contains MER19.t2 MER19 repetitive element ;, mRNA sequence

NM 003234 Homo sapiens transferrin receptor 5.12 Down 4.50E-02 (p90, CD71 ) (TFRC), mRNA

NM 032551 Homo sapiens G protein-coupled 5.12 Down 2.69E-03 receptor 54 (GPR54), mRNA

AK091 167 Homo sapiens cDNA FLJ33848 fis, 5.1 Down 3.36E-03 clone CTONG2005567

NM 020825 Homo sapiens Crm, cramped-like 5.1 Down 5.37E-02 (Drosophila) (CRAMP1 L), mRNA

NM 052870 Homo sapiens sorting nexin 5.1 Down 4.84E-03 associated golgi protein 1 (SNAG1 ), mRNA

NM 002808 Homo sapiens proteasome (prosome, 5.09 Down 3.85E-02 macropain) 26S subunit, non-ATPase,

2 (PSMD2), mRNA

AW440909 heO5hO5.x1 NCI_CGAP_CML1 Homo 5.09 Down 1.88E-03 sapiens cDNA clone IMAGE:2918169

3 similar to contains OFR.ti OFR repetitive element ;, mRNA sequence

T93545 ye14eO5.r1 Stratagene lung (#937210) 5.07 Down 2.91 E-03

Homo sapiens cDNA clone IMAGE:117728 5 similar to contains LTR7 repetitive element ;, mRNA sequence

AI685948 tu38gO6.x1 NCI_CGAP_Pr28 Homo 5.06 Down 1.51 E-03 sapiens cDNA clone IMAGE:2253370 3 similar to contains AIu repetitive element;, mRNA sequence

AK095053 Homo sapiens cDNA FLJ37734 fis, 5.06 Down 3.25E-04 clone BRHIP2020842

AI148006 qg62e10.s1 Soares testis NHT Homo 5.06 Down 1.22E-03 sapiens cDNA clone IMAGE:1839786

3, mRNA sequence NM 024745 Homo sapiens SHC SH2-domain 5.06 Down 1.08E-03 binding protein 1 (SHCBP1 ), mRNA NM 002737 Homo sapiens protein kinase C, alpha 5.05 Down 5.60E-03

(PRKCA), mRNA BG766048 602738427F1 NIH_MGC_49 Homo 5.04 Down 8.47E-03 sapiens cDNA clone IMAGE:4863726

5, mRNA sequence NM 001480 Homo sapiens galanin receptor 1 5.04 Down 7.51 E-03

(GALR1 ), mRNA NM_013281 Homo sapiens fibronectin leucine rich 5.03 Down 1.97E-02 transmembrane protein 3 (FLRT3), transcript variant 1 , mRNA NM 003940 Homo sapiens ubiquitin specific 5.03 Down 3.41 E-02 protease 13 (isopeptidase T-3)

(USP13), mRNA NM 014753 Homo sapiens BMS1 -like, ribosome 5.02 Down 1.48E-02 assembly protein (yeast) (BMS1 L), mRNA NM 032582 Homo sapiens ubiquitin specific 5.02 Down 2.68E-02 protease 32 (USP32), mRNA NM 003971 Homo sapiens sperm associated 5.02 Down 1.20E-02 antigen 9 (SPAG9), transcript variant

1 , mRNA NM 002895 Homo sapiens retinoblastoma-like 1 5.01 Down 7.14E-04

(p107) (RBL1 ), transcript variant 1 , mRNA NM 005348 Homo sapiens heat shock 9OkDa 5 Down 3.55E-02 protein 1 , alpha (HSPCA), mRNA


Gene Gene Name Fold change of Direction adj. p- Identifier CVPN005 D vs value CVPN001 F

AW02215 df33f10.y1 Morton Fetal Cochlea 682.77 Up 2.48E-05 8 Homo sapiens cDNA clone

IMAGE:2485386 5, mRNA sequence NM 1389 Homo sapiens ribosomal protein S4, 269.64 Up 6.35E-05 63 Y-linked 2 (RPS4Y2), mRNA

NM_1445 Homo sapiens hypothetical protein 203.45 Up 9.33E-06 94 FLJ32942 (FLJ32942), mRNA

BX089554 BX089554 Soares placenta Nb2HP 173.29 Up 7.77E-06

Homo sapiens cDNA clone

IMAGp998P07210 ; IMAGE:142326, mRNA sequence NM 0132 Homo sapiens DnaJ (Hsp40) homolog, 158.33 Up 7.77E-06

38 subfamily D, member 1 (DNAJD1 ), mRNA

NM 0010 Homo sapiens ribosomal protein S4, 157.97 Up 6.84E-04 08 Y-linked 1 (RPS4Y1 ), mRNA

W93585 zd95gO1 .s1 155.05 Up 1.24E-04

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:357264 3, mRNA sequence

NM 0328 Homo sapiens hypothetical protein 148.08 Up 5.48E-05 58 FLJ14904 (FLJ14904), mRNA

BC047643 Homo sapiens, clone 140.41 Up 9.27E-06

IMAGE:4825594, mRNA BC029048 Homo sapiens cDNA clone 139.56 Up 1.07E-04

IMAGE:5184198, partial cds NM 0060 Homo sapiens lipase, endothelial 136.07 Up 4.19E-07 33 (LIPG), mRNA

NM_0183 Homo sapiens multiple C2-domains 131 .81 Up 1.88E-04 49 with two transmembrane regions 2

(MCTP2), mRNA NM 0334 Homo sapiens chromosome 9 open 105.5 Up 5.75E-05

39 reading frame 26 (NF-HEV) (C9orf26), mRNA

NM 2071 Homo sapiens bromodomain, testis- 93.74 Up 1.07E-04 89 specific (BRDT), transcript variant 1 , mRNA AI742318 wg50e09.x1 92.06 Up 3.52E-05

Soares N S F F8 9 W OT P A P S 1 Homo sapiens cDNA clone IMAGE:2368552 3 similar to contains 0FR.t2 OFR repetitive element ;, mRNA sequence

NM 1827 Homo sapiens hypothetical protein 88.35 Up 5.74E-05 98 FLJ39155 (FLJ39155), transcript variant 2, mRNA NM_0148 Homo sapiens neuroligin 4, Y-linked 78.35 Up 1.63E-05

93 (NLGN4Y), mRNA

H70730 yu69e10.r1 Weizmann Olfactory 75.64 Up 1.39E-04

Epithelium Homo sapiens cDNA clone IMAGE:239082 5, mRNA sequence

NM 0162 Homo sapiens TP53TG3 protein 72.04 Up 2.54E-04

12 (TP53TG3), mRNA

NM 0046 Homo sapiens Smcy homolog, Y- 72.04 Up 2.48E-05

53 linked (mouse) (SMCY), mRNA NM 0324 Homo sapiens protein kinase (cAMP- 62.34 Up 9.86E-05 71 dependent, catalytic) inhibitor beta

(PKIB), transcript variant 3, mRNA NM 0046 Homo sapiens DEAD (Asp-Glu-Ala- 60.72 Up 1.22E-04 60 Asp) box polypeptide 3, Y-linked


NM 0068 Homo sapiens homeo box C9 53.46 Up 4.67E-05 97 (HOXC9), mRNA

NM 0019 Homo sapiens dipeptidylpeptidase 4 46.86 Up 2.98E-05 35 (CD26, adenosine deaminase complexing protein 2) (DPP4), mRNA NM 0018 Homo sapiens hyaluronan and 46.78 Up 3.26E-04

84 proteoglycan link protein 1 (HAPLN1 ), mRNA

BC066972 Homo sapiens similar to casein kinase 45.64 Up 2.87E-05 I alpha, mRNA (cDNA clone IMAGE:4829576), partial cds

NM 0224 Homo sapiens SRY (sex determining 42.14 Up 3.00E-04

54 region Y)-box 17 (SOX17), mRNA NM 0314 Homo sapiens coiled-coil domain 39.67 Up 1.63E-05

55 containing 3 (CCDC3), mRNA NM 0336 Homo sapiens collagen, type IV, alpha 38.16 Up 1.24E-04 41 6 (COL4A6), transcript variant B, mRNA NM 0033 Homo sapiens visinin-like 1 (VSNL1 ), 37.05 Up 8.33E-04

85 mRNA

NM 0024 Homo sapiens myxovirus (influenza 36.49 Up 1.35E-04 62 virus) resistance 1 , interferon-inducible protein p78 (mouse) (MX1 ), mRNA AL833276 Homo sapiens mRNA; cDNA 35.75 Up 2.50E-04

DKFZp451 D088 (from clone

DKFZp451 D088)

NM 0018 Homo sapiens collagen, type IV, alpha 34.41 Up 9.02E-05 47 6 (COL4A6), transcript variant A, mRNA CA416106 UI-H-FE0-bbs-f-17-0-Ul.s1 34.36 Up 2.72E-04

NCI CGAP FEO Homo sapiens cDNA clone UI-H-FE0-bbs-f-17-0-UI 3, mRNA sequence BU620793 UI-H-FL1 -bfx-d-10-0-Ul.s1 34.33 Up 2.45E-04

NCI CGAP FL1 Homo sapiens cDNA clone UI-H-FL1 -bfx-d-10-0-UI 3, mRNA sequence BX1 18843 BX1 18843 NCI CGAP GC6 Homo 33.56 Up 9.73E-05 sapiens cDNA clone

IMAGp998B055534 ;

IMAGE:2236708, mRNA sequence AK091731 Homo sapiens cDNA FLJ34412 fis, 32.93 UD 1.88E-04 clone HEART2002432

NM 0307 Homo sapiens collectin sub-family 32.51 Up 8.01 E-05 81 member 12 (C0LEC12), transcript variant II, mRNA

NM 1735 Homo sapiens abhydrolase domain 31 .85 Up 1.02E-04 67 containing 7 (ABHD7), mRNA

N34332 yy52h12.s1 30.61 Up 4.67E-05


Homo sapiens cDNA clone

IMAGE:277223 3, mRNA sequence BG46158 RST44458 Athersys RAGE Library 29.94 Up 1.88E-04 8 Homo sapiens cDNA, mRNA sequence AK000776 Homo sapiens cDNA FLJ20769 fis, 29.87 Up 4.00E-05 clone COL06674 AF055376 Homo sapiens short form transcription 29.53 Up 5.36E-05 factor C-MAF (c-maf) mRNA, complete cds

NM_1526 Homo sapiens tripartite motif- 29.28 Up 1.03E-04 20 containing 60 (TRIM60), mRNA

BC052289 Homo sapiens carboxypeptidase A4, 28.88 Up 7.73E-05 mRNA (cDNA clone MGC:59749

I MAG E :6106874), complete cds NM 0159 Homo sapiens galanin (GAL), mRNA 28.65 Up 2.18E-04 73 BC039369 Homo sapiens, clone 28.49 Up 2.73E-04

IMAGE:5271073, mRNA, partial cds NM 0012 Homo sapiens bone morphogenetic 27.99 Up 6.80E-05 02 protein 4 (BMP4), transcript variant 1 , mRNA BU727096 UI-E-CRO-ach-e-12-O-Ul.si UI-E-CRO 27.94 Up 2.94E-04

Homo sapiens cDNA clone UI-E-CRO- ach-e-12-O-UI 3, mRNA sequence BC037842 Homo sapiens cDNA clone 26.53 Up 2.54E-04

IMAGE:4814672, partial cds CA442876 UI-H-DP0-avr-p-22-0-Ul.s1 26.41 Up 3.88E-04

NCI CGAP FSI Homo sapiens cDNA clone UI-H-DP0-avr-p-22-0-UI 3, mRNA sequence

NM _0034 Homo sapiens zinc finger protein, Y- 26.14 Up 1.33E-03

11 linked (ZFY), mRNA

NM _0215 Homo sapiens ICEBERG caspase-1 25.64 Up 5.19E-05

71 inhibitor (ICEBERG), mRNA

NM _0150 Homo sapiens paternally expressed 24.84 Up 6.62E-05

68 10 (PEGI O), mRNA

NM 0186 Homo sapiens DEAD (Asp-Glu-Ala- 24.77 Up 2.46E-03

65 Asp) box polypeptide 43 (DDX43), mRNA

NM _1994 Homo sapiens zinc finger protein 334 24.47 Up 3.25E-05

41 (ZNF334), transcript variant 2, mRNA AK091766 Homo sapiens cDNA FLJ34447 fis, 24.06 Up 2.48E-05 clone HLUNG2002059 NM 1534 Homo sapiens paired-like 23.92 Up 7.25E-03 27 homeodomain transcription factor 2

(PITX2), transcript variant 1 , mRNA AK096536 Homo sapiens cDNA FLJ39217 fis, 22.52 UD 1.45E-04 clone OCBBF2006639, moderately similar to ZINC FINGER PROTEIN 84 NM 0019 Homo sapiens glutamyl 22.44 Up 1.63E-04 77 aminopeptidase (aminopeptidase A)

(ENPEP), mRNA AI469032 ti70a01 .x1 NCI CGAP Kidi 1 Homo 21 .96 Up 4.18E-04 sapiens cDNA clone IMAGE:2137320

3, mRNA sequence AW29105 U I-H-B l2-agc-b-04-0-U I .s 1 21 .26 Up 6.29E-04 7 NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2723670 3, mRNA sequence

NM 0057 Homo sapiens uronyl-2- 20 Up 1 .81 E-04 15 sulfotransferase (UST), mRNA

NM 0026 Homo sapiens paired-like 19.69 Up 7.77E-06 53 homeodomain transcription factor 1

(PITX1 ), mRNA AB037838 Homo sapiens mRNA for KIAA1417 19.64 Up 2.80E-03 protein, partial cds

NM 0144 Homo sapiens PDZ and LIM domain 3 19.46 Up 3.42E-03 76 (PDLIM3), mRNA

NM 0046 Homo sapiens eukaryotic translation 19.2 Up 2.22E-04 81 initiation factor 1A, Y-linked (EIF1AY), mRNA

NM 2034 Homo sapiens LAG1 longevity 19.07 Up 1.88E-04 63 assurance homolog 6 (S. cerevisiae)

(LASS6), mRNA NM 0024 Homo sapiens mesoderm specific 18.9 Up 9.96E-05

02 transcript homolog (mouse) (MEST), transcript variant 1 , mRNA

BQ00084 U I-H-DH 1 -axj-a-04-O-U I .s 1 18.78 Up 6.87E-05

3 NCI CGAP DH1 Homo sapiens cDNA clone IMAGE:5829387 3, mRNA sequence

BX648643 Homo sapiens mRNA; cDNA 18.75 Up 7.15E-04

DKFZp686O17106 (from clone


NM 0037 Homo sapiens vesicle-associated 18.38 Up 1.71 E-02 61 membrane protein 8 (endobrevin)

(VAM P8), mRNA N95448 zb81 e11 .s1 18.32 Up 7.76E-05

Soares senescent fibroblasts NbHSF

Homo sapiens cDNA clone

IMAGE:310028 3, mRNA sequence NM_1840 Homo sapiens tripartite motif- 18.17 Up 6.57E-04 87 containing 55 (TRIM55), transcript variant 4, mRNA AI831847 wi52fO4.x1 NCI_CGAP_Co16 Homo 17.93 Up 6.31 E-04 sapiens cDNA clone IMAGE:2393887

3, mRNA sequence

NM_0004 Homo sapiens laminin, alpha 2 17.73 Up 3.47E-04 26 (merosin, congenital muscular dystrophy) (LAM A2), mRNA NM 0064 Homo sapiens interferon-induced 17.64 Up 3.58E-04 17 protein 44 (IFI44), mRNA

NM 0161 Homo sapiens trophinin (TRO), 17.6 Up 3.16E-04 57 transcript variant 3, mRNA

BX089554 BX089554 Soares placenta Nb2HP 17.6 Up 2.62E-04 Homo sapiens cDNA clone

IMAGp998P07210 ; IMAGE:142326, mRNA sequence

NM_0332 Homo sapiens epithelial stromal 17.53 Up 2.12E-04 55 interaction 1 (breast) (EPSTI1 ), mRNA

BQ35795 PM0-HT0335-250700-012-bO2 17.14 Up 1.57E-03 0 HT0335 Homo sapiens cDNA, mRNA sequence AK126297 Homo sapiens cDNA FLJ44317 fis, 16.89 Up 3.88E-04 clone TRACH3000586

NM_1446 Homo sapiens hypothetical protein 16.77 Up 1.22E-03 64 MGC33371 (MGC33371 ), mRNA

NM 0009 Homo sapiens prostaglandin- 16.54 Up 4.18E-04 63 endoperoxide synthase 2

(prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA NM 0051 Homo sapiens heparan sulfate 16.5 Up 1.42E-04 14 (glucosamine) 3-0-sulfotransferase 1

(HS3ST1 ), mRNA

BG1 1801 602351269F1 NIH MGC 90 Homo 16.21 Up 8.24E-04 9 sapiens cDNA clone IMAGE:4446065

5, mRNA sequence

NM 0209 Homo sapiens ankyrin 3, node of 16.05 Up 1.96E-05 87 Ranvier (ankyrin G) (ANK3), transcript variant 1 , mRNA

NM 0055 Homo sapiens interferon, alpha- 15.88 Up 4.76E-04 32 inducible protein 27 (IFI27), transcript variant a, mRNA AI201230 qf70e03.x1 Soares testis NHT Homo 15.62 Up 5.99E-04 sapiens cDNA clone IMAGE: 1755388

3, mRNA sequence BC065252 Homo sapiens cDNA clone 15.6 Up 3.63E-04

I MAG E :6139955, partial cds NM 0048 Homo sapiens Rac/Cdc42 guanine 15.32 Up 2.54E-04 40 nucleotide exchange factor (GEF) 6

(ARHGEF6), mRNA BC0331 16 Homo sapiens chromodomain helicase 14.89 Up 8.22E-04

DNA binding protein 7, mRNA (cDNA clone IMAGE:3352674), partial cds BC042431 Homo sapiens, clone 14.74 Up 5.92E-04

IMAGE:4821 137, mRNA BC036004 Homo sapiens, clone 14.67 Up 4.70E-05

IMAGE:4730399, mRNA

NM 0007 Homo sapiens bradykinin receptor B1 14.61 Up 4.01 E-04

10 " (BDKRB1 ), mRNA

NM 0025 Homo sapiens neurotensin receptor 1 14.61 Up 1.76E-03

31 " (high affinity) (NTSR1 ), mRNA

BC007901 Homo sapiens hypothetical protein 14.44 Up 2.12E-04

BC007901 , mRNA (cDNA clone

I MAG E :4139786), partial cds

NM 0179 Homo sapiens molybdenum cofactor 14.39 Up 1.26E-04

47 " sulfurase (MOCOS), mRNA AK095573 Homo sapiens cDNA FLJ38254 fis, 14.31 Up 4.1 1 E-04 clone FCBBF3000847 AK092371 Homo sapiens cDNA FLJ35052 fis, 14.17 Up 2.74E-04 clone OCBBF2018234, highly similar to GUANINE NUCLEOTIDE-BINDING PROTEIN G(I)/G(S)/G(O) GAMMA-2

SUBUNIT (G GAMMA-I) NM 0169 Homo sapiens F11 receptor (F11 R), 14.17Up 5.34E-04 46 transcript variant 1 , mRNA

AI978851 wr60e12.x1 NCI CGAP UtI Homo 13.81 Up 9.86E-05 sapiens cDNA clone IMAGE:2492110

3 similar to gb:X16663


SPECIFIC PROTEIN (HUMAN);, mRNA sequence AA558468 nk39cO6.s1 NCI CGAP GC2 Homo 13.72Up 9.66E-06 sapiens cDNA clone IMAGE:1015882

3 similar to TR:G927300 G927300 Y


OY11.1 DNASEQUENCE. ;, mRNA sequence

NM 0025 Homo sapiens neurotrophin 3 (NTF3), 13.68Up 4.21 E-05 27 mRNA

NM 0009 Homo sapiens prostaglandin F 13.66Up 3.75E-03 59 receptor (FP) (PTGFR), mRNA

NM 1452 Homo sapiens DNA-damage-inducible 13.64Up 5.10E-04 44 transcript 4-like (DDIT4L), mRNA

NM 0049 Homo sapiens cAMP responsive 13.6Up 3.38E-03 04 element binding protein 5 (CREB5), mRNA

NM 0055 Homo sapiens nuclear factor I/B 13.45Up 9.27E-06 96 (NFIB), mRNA

BX089820 BX089820 NCI_CGAP_GC4 Homo 13.42Up 6.84E-04 sapiens cDNA clone


IMAGE:1519353, mRNA sequence BX109483 BX109483 NCI_CGAP_Ov23 Homo 13.41 Up 2.48E-04 sapiens cDNA clone

IMAGp998C165481 ;

IMAGE:2216391, mRNA sequence AA740671 ob01h05.s1 NCI_CGAP_Kid3 Homo 13.31 Up 2.73E-04 sapiens cDNA clone IMAGE:1322457

3, mRNA sequence

NM 0029 Homo sapiens regulator of G-protein 13.26Up 3.83E-03 22 signalling 1 (RGS1), mRNA

NM 0044 Homo sapiens EPH receptor B2 13.04Up 1.31E-03 42 (EPHB2), transcript variant 2, mRNA

BM54239 AGENCOURT_6436663 13.03Up 1.31E-03 8 NIH MGC 72 Homo sapiens cDNA clone IMAGE:55395745, mRNA sequence

BM99189 UI-H-DF1-auk-h-02-0-Ul.s1 12.88Up 6.10E-04 0 NCI CGAP DF1 Homo sapiens cDNA clone IMAGE:58706413, mRNA sequence AA641603 nr20g01.s1 NCI_CGAP_Pr2 Homo 12.66Up 2.97E-03 sapiens cDNA clone IMAGE:1168560 similar to contains AIu repetitive element;, mRNA sequence BC033668 Homo sapiens hypothetical protein 12.54 UD 4.98E-05

FLJ10312, mRNA (cDNA clone

MGC:44937 IMAGE:5167033), complete cds

BC062792 Homo sapiens cDNA clone 12.52Up 1.77E-04 IMAGE:4807322, partial cds BX119520 BX119520 NCI_CGAP_Pr28 Homo 12.38Up 2.94E-04 sapiens cDNA clone IMAGp998N245757 ; IMAGE:2321495, mRNA sequence

BC042049 Homo sapiens hypothetical protein 12.37Up 2.62E-04 LOC339975, mRNA (cDNA clone IMAGE:5548761), partial cds

NM 0325 Homo sapiens par-6 partitioning 12.17Up 1.07E-04 10 defective 6 homolog gamma (C. elegans) (PARD6G), mRNA

BC036241 Homo sapiens, clone 12.1 Up 1.11E-03 IMAGE:5299049, mRNA, partial cds

BG38932 602413981 F1 NIH_MGC_92 Homo 11.88Up 1.26E-03 8 sapiens cDNA clone IMAGE:4522269 5, mRNA sequence

NM_0033 Homo sapiens transient receptor 11.71 Up 2.50E-04 05 potential cation channel, subfamily C, member 3 (TRPC3), mRNA

BF515657 UI-H-BW1-anu-e-05-0-Ul.s1 11.66Up 5.10E-04 NCI_CGAP_Sub7 Homo sapiens cDNA clone IMAGE:30836013, mRNA sequence

BC000975 Homo sapiens, clone 11.64 Up 3.49E-04 IMAGE:3448306, mRNA, partial cds AA994330 ou33h05.s1 Soares NFL T GBC SI 11.55Up 4.29E-04 Homo sapiens cDNA clone IMAGE:16281213, mRNA sequence

NM 0183 Homo sapiens chondroitin betai ,4 N- 11.36Up 9.59E-05 71 acetylgalactosaminyltransferase (ChGn), mRNA

R41565 yf88eO1.s1 Soares infant brain 1NIB 11.29Up 7.19E-04 Homo sapiens cDNA clone IMAGE:295313, mRNA sequence

NM 0306 Homo sapiens cytoplasmic 11.18Up 9.56E-04

27 " polyadenylation element binding protein 4 (CPEB4), mRNA

NM _0143 Homo sapiens immunoglobulin 11.16Up 8.52E-06

33 superfamily, member 4 (IGSF4), mRNA

NM 0065 Homo sapiens solute carrier family 12 11.12Up 3.97E-04

98 " (potassium/chloride transporters), member 7 (SLC12A7), mRNA

NM 0169 Homo sapiens F11 receptor (F11 R), 11.09Up 7.77E-06

46 " transcript variant 1 , mRNA

N29918 yy12g11.s1 Soares melanocyte 10.97Up 2.43E-03 2NbHM Homo sapiens cDNA clone IMAGE:2710763, mRNA sequence

NM _0019 Homo sapiens desmoglein 2 (DSG2), 10.86Up 3.75E-03

43 mRNA

NM _0065 Homo sapiens IGF-II mRNA-binding 10.83Up 2.38E-04

47 protein 3 (IMP-3), mRNA

BQ92483 AGENCOURT_8840265 10.79Up 7.66E-05

2 Lupski_sciatic_nerve Homo sapiens cDNA clone IMAGE:62050365, mRNA sequence

NM 0226 Homo sapiens homeo box C8 10.73 Up 1.71 E-03

58 (HOXC8), mRNA

NM 0024 Homo sapiens necdin homolog 10.65 Up 1.88E-04

87 (mouse) (NDN), mRNA

NM 0331 Homo sapiens scinderin (SCIN), 10.42 Up 1.25E-02

28 mRNA

NM 0176 Homo sapiens chromosome 20 open 10.34 Up 1.75E-03

71 reading frame 42 (C20orf42), mRNA

W69644 zd45f10.r1 10.33 Up 1.44E-04

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:343627 5, mRNA sequence

AK024865 Homo sapiens cDNA: FLJ21212 fis, 10.31 Up 1.77E-03 clone COL00502

NM 0166 Homo sapiens dapper homolog 1 , 10.12 Up 2.17E-04

51 antagonist of beta-catenin (xenopus)

(DACT1 ), mRNA

AB046799 Homo sapiens mRNA for KIAA1579 10.09 Up 2.94E-04 protein, partial cds

NM_1829 Homo sapiens a disintegrin-like and 10.01 Up 3.30E-04

20 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 1 , mRNA

BC040697 Homo sapiens cDNA clone 9.94 Up 8.83E-04 IMAGE:6023106, partial cds

NM 0808 Homo sapiens ankyrin repeat and 9.87 Up 1.17E-03

74 " SOCS box-containing 5 (ASB5), mRNA

NM 1988 Homo sapiens hypothetical protein 9.78 Up 1.OOE-04

79 " MGC9913 (MGC9913), mRNA

NM 0065 Homo sapiens IGF-II mRNA-binding 9.72 Up 2.32E-04

47 " protein 3 (IMP-3), mRNA

NM 0328 Homo sapiens cingulin-like 1 9.5 Up 1 .37E-03

66 " (CGNL1 ), mRNA

NM 0305 Homo sapiens cytoplasmic 9.49 Up 2.72E-04

94 " polyadenylation element binding protein 1 (CPEB1 ), mRNA

AI355761 qt94a11 .x1 NCI_CGAP_Co14 Homo 9.39 UD 3.78E-03 sapiens cDNA clone IMAGE: 1962908 3 similar to gb:X74929 KERATIN, TYPE Il CYTOSKELETAL 8 (HUMAN);, mRNA sequence

BF509573 UI-H-BI4-apf-b-11 -0-Ul.s1 9.35 Up 8.1 1 E-04

NCI_CGAP_Sub8 Homo sapiens cDNA clone IMAGE:3086949 3, mRNA sequence

NM 0053 Homo sapiens histone 1 , H1 d 9.35 Up 5.38E-03

20 (HIST1 H1 D), mRNA

BX538226 Homo sapiens mRNA; cDNA 9.27 Up 5.85E-04 DKFZp686E1944 (from clone DKFZp686E1944)

BX647876 Homo sapiens mRNA; cDNA 9.16 Up 2.86E-03 DKFZp313A1525 (from clone DKFZp313A1525)

NM 2034 Homo sapiens similar to RIKEN cDNA 9.15 Up 4.56E-05 11 2600017H02 (LOC92162), mRNA

AI831055 wj62cO8.x1 NCI_CGAP_Lu19 Homo 9.1 Up 6.84E-04 sapiens cDNA clone IMAGE:2407406 3 similar to gb:J03890_rna1 PULMONARY SURFACTANT- ASSOCIATED PROTEIN C PRECURSOR (HUMAN);, mRNA sequence

BX647313 Homo sapiens mRNA; cDNA 9Up 1.23E-03 DKFZp686N1593 (from clone DKFZp686N1593)

NM_1984 Homo sapiens olfactomedin-like 1 8.97 Up 2.49E-03

74 (0LFML1 ), mRNA

NM 0056 Homo sapiens claudin 1 1 8.95 Up 1.05E-02

02 (oligodendrocyte transmembrane protein) (CLDN1 1 ), mRNA

NM_0015 Homo sapiens interleukin 18 8.86 Up 1.27E-02

62 (interferon-gamma-inducing factor)

(IL18), mRNA AB023217 Homo sapiens mRNA for KIAA1000 8.77 Up 1.53E-04 protein, partial cds

BQ00340 UI-H-EI1 -azd-j-23-O-U I .s1 8.76 Up 2.09E-04 1 NCI CGAP EI1 Homo sapiens cDNA clone IMAGE:5847286 3, mRNA sequence AI559193 tq42hO1 .x1 NCI CGAP UtI Homo 8.75 Up 2.47E-03 sapiens cDNA clone IMAGE:221 1505

3, mRNA sequence BX380007 BX380007 Homo sapiens PLACENTA 8.67 Up 7.72E-03

COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI042YD07 5-

PRIME, mRNA sequence BG46213 RST45147 Athersys RAGE Library 8.61 Up 1.51E-03

3 Homo sapiens cDNA, mRNA sequence

NM 0163 Homo sapiens hect domain and RLD 5 8.59 Up 1.89E-03 23 (HERC5), mRNA

BC045828 Homo sapiens zinc finger protein 608, 8.44 Up 2.51E-04 mRNA (cDNA clone IMAGE:5262896), partial cds

NM 0048 Homo sapiens G protein-coupled 8.43 Up 3.18E-05 85 receptor 74 (GPR74), mRNA

NM 0244 Homo sapiens phospholipase A2, 8.43 Up 4.63E-02 20 group IVA (cytosolic, calcium- dependent) (PLA2G4A), mRNA NM 0325 Homo sapiens chromosome Y open 8.36 Up 1.74E-03 76 reading frame 15B (CYorf15B), mRNA

T47364 yb13a10.r1 Stratagene placenta 8.35 Up 4.28E-02

(#937225) Homo sapiens cDNA clone IMAGE:71034 5, mRNA sequence D29453 HUMNK566 Human epidermal 8.34 Up 1.31E-03 keratinocyte Homo sapiens cDNA clone 566, mRNA sequence BQ02371 UI-1-BB1 p-auy-b-08-0-Ul.s1 8.32 Up 9.93E-04 3 NCI CGAP PI6 Homo sapiens cDNA clone UI-1 -BB1 p-auy-b-08-0-UI 3, mRNA sequence NM 0019 Homo sapiens glutamyl 8.31 Up 2.71E-03

77 aminopeptidase (aminopeptidase A)


NM 0141 Homo sapiens HSPC159 protein 8.29 Up 1.26E-03 81 (HSPC159), mRNA

BE072907 RC2-BT0548-200300-013-gO6 8.27 Up 2.95E-03

BT0548 Homo sapiens cDNA, mRNA sequence NM 0053 Homo sapiens G protein-coupled 8.11 Up 2.30E-03

02 receptor 37 (endothelin receptor type B-like) (GPR37), mRNA

NM_1384 Homo sapiens potassium channel 8.01 Up 6.17E-05 44 tetramerisation domain containing 12

(KCTD12), mRNA BQ02558 UI-1-BB1 p-axx-d-08-0-Ul.s1 7.99 Up 6.78E-04

3 NCI CGAP PI6 Homo sapiens cDNA clone UI-1 -BB1 p-axx-d-08-0-UI 3, mRNA sequence

AK002008 Homo sapiens cDNA FLJ1 1146 fis, 7.97 Up 1.86E-03 clone PLACE1006673

NM_1527 Homo sapiens hypothetical protein 7.96 Up 1.61E-03 75 MGC33607 (MGC33607), mRNA

AI654895 wb52bO8.x1 NCI_CGAP_GC6 Homo 7.96 Up 6.29E-04 sapiens cDNA clone IMAGE:2309271

3, mRNA sequence

NM 0006 Homo sapiens angiotensin Il receptor, 7.95 Up 1.63E-05 85 type 1 (AGTR1 ), transcript variant 1 , mRNA

NM 0049 Homo sapiens cadherin 15, M- 7.93 Up 5.19E-04 33 cadherin (myotubule) (CDH 15), mRNA

NM 1453 Homo sapiens RasGEF domain family, 7.83 Up 7.62E-04 13 member 1A (RASGEF1A), mRNA

AA258323 zr59fO7.s1 Soares NhHMPu SI 7.76 Up 2.62E-03

Homo sapiens cDNA clone

IMAGE:667717 3, mRNA sequence AI887544 wmO6h1 1 .x1 NCI_CGAP_Ut4 Homo 7.75 Up 2.73E-04 sapiens cDNA clone IMAGE:2435205

3, mRNA sequence

NM_0529 Homo sapiens retinol binding protein 7.74 Up 2.82E-04 60 7, cellular (RBP7), mRNA

CA31 1652 UI-CF-FN0-afd-b-22-0-Ul.s1 UI-CF- 7.63 Up 9.90E-04

FNO Homo sapiens cDNA clone Ul-

CF-FN0-afd-b-22-0-UI 3, mRNA sequence AI686890 tp90h02.x1 NCI_CGAP_Ut3 Homo 7.62 Up 2.59E-03 sapiens cDNA clone IMAGE:2206611

3, mRNA sequence

NM 0063 Homo sapiens nuclear DNA-binding 7.53 Up 3.90E-04 33 protein (C1 D), transcript variant 1 , mRNA

NM 0068 Homo sapiens interferon-induced 7.51 Up 1.64E-04 20 protein 44 (IFI44L), mRNA

H97329 EST48b105 WATM 1 Homo sapiens 7.49 Up 1.54E-03 cDNA clone 48b105, mRNA sequence H89053 yw24cO6.r1 Morton Fetal Cochlea 7.43 Up 5.08E-03

Homo sapiens cDNA clone

IMAGE:253162 5, mRNA sequence AI818724 wk91 dO3.x1 NCI CGAP Lu 19 Homo 7.38 Up 1.29E-03 sapiens cDNA clone IMAGE:2422757 3, mRNA sequence

NM_0014 Homo sapiens fatty acid binding 7.33 Up 2.45E-04

44 protein 5 (psoriasis-associated) (FABP5), mRNA

AB095935 Homo sapiens mRNA for KIAA2015 7.29 Up 8.91 E-04 protein

NM 0032 Homo sapiens tumor protein D52-like 7.27 Up 1.16E-03

87 1 (TPD52L1 ), transcript variant 1 , mRNA

NM 0042 Homo sapiens Kruppel-like factor 4 7.26 Up 4.84E-04

35 (gut) (KLF4), mRNA

NM 0025 Homo sapiens natriuretic peptide 7.2 Up 2.86E-03

21 precursor B (NPPB), mRNA

NM 0056 Homo sapiens claudin 1 1 7.17 Up 1.96E-05

02 (oligodendrocyte transmembrane protein) (CLDN1 1 ), mRNA

NM 0153 Homo sapiens lymphocyte antigen 96 7.14 Up 2.86E-03

64 (LY96), mRNA

NM 0051 Homo sapiens annexin A3 (ANXA3), 7.14 Up 7.59E-04

39 mRNA

AI289329 qw28cO9.x1 NCI_CGAP_Ut4 Homo 7.13 Up 5.33E-03 sapiens cDNA clone IMAGE: 1992400 3 similar to contains L1.b2 L1 repetitive element ;, mRNA sequence

AA436084 zuO3aO2.r1 Soares testis NHT Homo 7.09 UD 3.82E-03 sapiens cDNA clone IMAGE:730730 5 similar to contains element PTR5 PTR5 repetitive element ;, mRNA sequence

NM 1832 Homo sapiens inversin (INVS), 7.04 Up 7.75E-04

45 transcript variant 2, mRNA

NM 0165 Homo sapiens Mst3 and SOK1 -related 7.04 Up 2.54E-04 42 kinase (MST4), mRNA

NM 0022 Homo sapiens potassium voltage- 7.01 Up 3.24E-02 52 gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), mRNA

NM 0182 Homo sapiens hypothetical protein 6.92 Up 3.75E-03 86 FLJ10970 (FLJ10970), mRNA

BX088936 BX088936 Soares testis NHT Homo 6.87 Up 1.75E-03 sapiens cDNA clone

I MAG p998G 123255 ;

IMAGE:1292195, mRNA sequence AM 68819 ox67d02.s1 Soares NhHMPu SI 6.83 Up 2.04E-03

Homo sapiens cDNA clone

IMAGE:1661379 3, mRNA sequence BC008580 Homo sapiens, clone 6.79 Up 4.80E-04

I MAG E :4179986, mRNA, partial cds AB067499 Homo sapiens mRNA for KIAA1912 6.79 Up 1.86E-02 protein, partial cds

NM 0325 Homo sapiens par-6 partitioning 6.78 Up 3.75E-03 10 defective 6 homolog gamma (C. elegans) (PARD6G), mRNA NM_1985 Homo sapiens gap junction protein, 6.75 UD 9.59E-05 68 beta 7 (GJ B7), mRNA NM 0056 Homo sapiens sialyltransferase 8D 6.69 Up 5.28E-05 68 (alpha-2, 8-polysialyltransferase)

(SIAT8D), transcript variant 1 , mRNA BF360505 QV0-OT0030-070300-148-dO6 6.65 Up 3.62E-03

OT0030 Homo sapiens cDNA, mRNA sequence AI640484 wa27fO1 .x1 NCI CGAP Kidi 1 Homo 6.62 Up 4.04E-03 sapiens cDNA clone IMAGE:2299321

3, mRNA sequence AJ606316 Homo sapiens mRNA for non-coding 6.6Up 2.59E-03 transcript, polyA signal, clone 78-E/P5 AK095726 Homo sapiens cDNA FLJ38407 fis, 6.59 Up 3.36E-03 clone FEBRA2008859 BQ01 154 UI-1-BC1 p-asi-a-02-0-Ul.s1 6.56 Up 9.54E-04 5 NCI CGAP PI3 Homo sapiens cDNA clone UI-1 -BC1 p-asi-a-02-0-UI 3, mRNA sequence

AW29167 UI-H-BI2-agn-g-09-0-Ul.s1 6.52 Up 2.58E-04 5 NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2725049 3, mRNA sequence J05158 Homo sapiens carboxypeptidase N 6.49 Up 1.01E-03 precursor (CPN2) mRNA, complete cds AF519622 Homo sapiens noncoding mRNA 6.48 Up 1.20E-02 sequence

NM 0019 Homo sapiens fibulin 2 (FBLN2), 6.47 Up 5.93E-03 98 transcript variant 2, mRNA

N55080 yv43cO3.s1 Soares fetal liver spleen 6.46 Up 3.24E-03

1 NFLS Homo sapiens cDNA clone

IMAGE:245476 3, mRNA sequence R38647 yc88gO6.s1 Soares infant brain 1 NIB 6.45 Up 4.08E-03

Homo sapiens cDNA clone

IMAGE:23005 3, mRNA sequence AW27092 xsO6cO5.x1 NCI CGAP Kidi 1 Homo 6.45 Up 3.22E-03 8 sapiens cDNA clone IMAGE:2768840

3, mRNA sequence D30877 HUML1 130 Human fetal lung Homo 6.34 Up 5.08E-04 sapiens cDNA 5, mRNA sequence N25267 yx74hO1 .s1 Soares melanocyte 6.3Up 1.77E-04

2NbHM Homo sapiens cDNA clone

IMAGE:267505 3, mRNA sequence AW20772 UI-H-BI2-age-g-01 -0-Ul.s1 6.29 Up 1.97E-02 3 NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2724264 3, mRNA sequence

NM 0060 Homo sapiens UDP-Gal:betaGlcNAc 6.27 Up 6.28E-04 57 beta 1 ,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 1 , mRNA W51873 zc45bO5.r1 6.27 Up 5.31E-03

Soares senescent fibroblasts NbHSF

Homo sapiens cDNA clone

IMAGE:325233 5, mRNA sequence NM_1992 Homo sapiens transmembrane 6.26 UD 1.59E-03 54 phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 3, mRNA

NM _0034 Homo sapiens zinc finger protein 154 6.25 Up 8.13E-04

44 (pHZ-92) (ZNF154), mRNA

NM _0053 Homo sapiens v-maf 6.24 Up 6.99E-03

60 musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), mRNA

NM _1524 Homo sapiens zinc finger protein 560 6.24 Up 4.29E-04

76 (ZNF560), mRNA

NM _1387 Homo sapiens hypothetical protein 6.21 Up 8.40E-05

86 BC014339 (LOC1 16441 ), mRNA

NM _0026 Homo sapiens plastin 1 (I isoform) 6.18 Up 2.39E-02

70 (PLS1 ), mRNA

NM _0210 Homo sapiens solute carrier organic 6.17 Up 1.45E-04

94 anion transporter family, member 1A2 (SLCO1 A2), transcript variant 2, mRNA

AW05162 wx28dO9.x1 NCI_CGAP_Kid11 Homo 6.16 UD 1.31 E-03

8 sapiens cDNA clone IMAGE:2544977 3 similar to contains AIu repetitive element;contains MER32.t2 MER32 repetitive element ;, mRNA sequence

BQ02582 UI-1-BB1 p-aye-f-10-0-Ul.s1 6.15 Up 1.03E-03

1 NCI CGAP PI6 Homo sapiens cDNA clone UI-1 -BB1 p-aye-f-10-0-UI 3, mRNA sequence

BU626144 UI-H-FG1-bgq-i-08-0-Ul.s1 6.12 Up 1.03E-02 NCI CGAP FG1 Homo sapiens cDNA clone UI-H-FG1 -bgq-i-08-0-UI 3, mRNA sequence

F22640 HSPD07486 HM3 Homo sapiens 6.1 Up 3.48E-04 cDNA clone 097-X1 -10, mRNA sequence

NM 1840 Homo sapiens tripartite motif- 6.09 Up 4.98E-05 87 containing 55 (TRIM55), transcript variant 4, mRNA

NM 0071 Homo sapiens annexin A10 6.08 Up 3.60E-04 93 " (ANXA10), mRNA

BU601128 AGENCOURT 10018270 6.08 Up 4.06E-02

NIH MGC 142 Homo sapiens cDNA clone IMAGE:6495000 5, mRNA sequence

NM 1532 Homo sapiens chromosome 10 open 6.07 Up 6.13E-03

56 reading frame 47 (C10orf47), mRNA

NM _0049 Homo sapiens cadherin 18, type 2 6.06 Up 5.70E-05

34 (CDH 18), mRNA

NM _0018 Homo sapiens clusterin (complement 6.06 Up 3.47E-04

31 lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)

(CLU), transcript variant 1 , mRNA

NM 0037 Homo sapiens aldo-keto reductase 6.05 Up 1.69E-02

39 family 1 , member C3 (3-alpha hydroxysteroid dehydrogenase, type

II) (AKR1 C3), mRNA

NM 0000 Homo sapiens sarcoglycan, alpha 6.04 Up 5.74E-05

23 (5OkDa dystrophin-associated glycoprotein) (SGCA), mRNA NM 0319 Homo sapiens cell division cycle 6.03 Up 5.75E-05 42 associated 7 (CDCA7), transcript variant 1 , mRNA

NM_0132 Homo sapiens fibronectin leucine rich 5.98 Up 1.11E-02 81 transmembrane protein 3 (FLRT3), transcript variant 1 , mRNA NM_1749 Homo sapiens family with sequence 5.98 Up 1.90E-03

01 similarity 9, member C (FAM9C), mRNA

AA489079 aa54hO5.s1 NCI CGAP GCB1 Homo 5.85 Up 1.12E-02 sapiens cDNA clone IMAGE:824793 3, mRNA sequence AF1 19903 Homo sapiens PRO2834 mRNA, 5.83 Up 2.67E-04 complete cds

AW26268 xq93cO6.x1 NCI_CGAP_Brn53 Homo 5.82 Up 4.07E-03 3 sapiens cDNA clone IMAGE:2758186

3, mRNA sequence AL079999 DKFZp586P2018_r1 586 (synonym: 5.82 Up 4.48E-02 hutel ) Homo sapiens cDNA clone

DKFZp586P2018 5, mRNA sequence NM 0208 Homo sapiens leucine rich repeat 5.8Up 1.73E-03 73 neuronal 1 (LRRN 1 ), mRNA

NM 0029 Homo sapiens chemokine (C-X-C 5.78 Up 8.88E-04 93 motif) ligand 6 (granulocyte chemotactic protein 2) (CXCL6), mRNA W76003 zd58gO7.r1 5.75 Up 3.82E-02

Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone I MAG E: 344892 5, mRNA sequence BM98864 UI-H-DH0-arx-p-21 -0-Ul.s1 5.72 Up 6.84E-04

2 NCI CGAP DHO Homo sapiens cDNA clone IMAGE:5855492 3, mRNA sequence

AI797677 we90c07.x1 Soares_NFL_T_GBC_S1 5.71 Up 3.75E-03 Homo sapiens cDNA clone IMAGE:2348364 3, mRNA sequence

BC039676 Homo sapiens, clone 5.64 Up 1.61E-03

IMAGE:5173389, mRNA

AA252080 zr63fO6.s1 Soares NhHMPu SI 5.58 Up 5.83E-03 Homo sapiens cDNA clone IMAGE:668099 3, mRNA sequence

NM 0165 Homo sapiens myozenin 2 (MYOZ2), 5.57 Up 1.09E-03

99 mRNA

NM 0038 Homo sapiens synaptojanin 2 5.57 Up 7.19E-04

98 (SYNJ2), mRNA

BM71993 UI-E-EJ0-ahu-a-10-0-Ul.r1 UI-E-EJO 5.57 Up 9.02E-03

7 Homo sapiens cDNA clone UI-E-EJO- ahu-a-10-O-UI 5, mRNA sequence

NM 0004 Homo sapiens alkaline phosphatase, 5.55 Up 1.62E-03

78 liver/bone/kidney (ALPL), mRNA

BX1 14015 BX1 14015 NCI_CGAP_Kid1 1 Homo 5.54 Up 4.71E-03 sapiens cDNA clone IMAGp998F195692 ; IMAGE:2297490, mRNA sequence

AW61229 hg95bO4.x1 NCI CGAP Kidi 1 Homo 5.5 UD 1.43E-04 2 sapiens cDNA clone IMAGE:2953327

3, mRNA sequence

NM 0155 Homo sapiens leucine-hch repeats 5.5Up 5.90E-04 41 and immunoglobulin-like domains 1

(LRIG1 ), mRNA

NM 1525 Homo sapiens SH3 domain containing 5.5Up 2.35E-04 50 ring finger 2 (SH3RF2), mRNA

NM 0019 Homo sapiens enolase 3, (beta, 5.47 Up 5.50E-05 76 muscle) (EN03), transcript variant 1 , mRNA NM 0203 Homo sapiens ankyrin repeat domain 5.46 Up 6.62E-05

49 2 (stretch responsive muscle) (ANKRD2), mRNA

NM 0216 Homo sapiens potassium 5.45 Up 1.77E-03

14 intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 1 , mRNA

NM 0807 Homo sapiens suppressor of hairy 5.44 Up 2.22E-02

64 wing homolog 2 (Drosophila)


W92001 zh47e11 .s1 5.43 Up 4.08E-03

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

I MAG E :415244 3, mRNA sequence

AK000271 Homo sapiens cDNA FLJ20264 fis, 5.41 Up 1.44E-03 clone COLF7912

NM 0072 Homo sapiens Kruppel-like factor 8 5.39 Up 1.69E-03

50 (KLF8), mRNA

NM_0143 Homo sapiens immunoglobulin 5.37 Up 1.97E-02 33 superfamily, member 4 (IGSF4), mRNA

NM 0006 Homo sapiens interleukin 13 receptor, 5.36 Up 1.02E-03 40 alpha 2 (IL13RA2), mRNA

T85180 yd47dO6.s1 Soares fetal liver spleen 5.36 Up 4.67E-05 1 NFLS Homo sapiens cDNA clone IMAGE:1 1 1371 3 similar to contains AIu repetitive element;contains LTR8 repetitive element ;, mRNA sequence BX537539 Homo sapiens mRNA; cDNA 5.35 Up 3.31 E-03 DKFZp686A1 130 (from clone DKFZp686A1 130)

AI400012 tg85aO6.x1 Soares NhHMPu SI 5.32 Up 5.05E-03 Homo sapiens cDNA clone IMAGE:2115538 3 similar to contains L1.b3 L1 repetitive element ;, mRNA sequence

BG35457 CDCA6 Cell division cycle associated 5.29 Up 7 .65E-04 9 gene 6 Human cDNA expression libraries Homo sapiens cDNA clone 407614, mRNA sequence NM 1452 Homo sapiens zinc finger protein 626 5.29 Up 1 .16E-03 97 (ZNF626), mRNA

BX360820 BX360820 Homo sapiens PLACENTA 5.28 Up 1 .62E-02 COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI075YD12 5- PRIME, mRNA sequence BF038828 601462026F1 NIH MGC 66 Homo 5.26 Up 1.45E-04 sapiens cDNA clone IMAGE:3865303

5, mRNA sequence

NM 0155 Homo sapiens SET binding protein 1 5.25 Up 3.90E-04 59 (SETBP1 ), mRNA

AW46738 he10d12.x1 NCI_CGAP_CML1 Homo 5.25 Up 6.71 E-03 5 sapiens cDNA clone IMAGE:2918615

3, mRNA sequence

BG20606 RST25498 Athersys RAGE Library 5.24 Up 1.70E-03 3 Homo sapiens cDNA, mRNA sequence

NM 0121 Homo sapiens grancalcin, EF-hand 5.23 Up 1.70E-03 98 calcium binding protein (GCA), mRNA

BC040632 Homo sapiens, clone 5.22 Up 4.64E-04

IMAGE:5759975, mRNA BC036938 Homo sapiens, clone 5.22 Up 1.1 1 E-03

IMAGE:5404753, mRNA AK092379 Homo sapiens cDNA FLJ35060 fis, 5.21 Up 2.05E-03 clone OCBBF2018828 AW13989 UI-H-BI1 -aee-a-12-0-Ul.s1 5.2 Up 1 .88E-04 1 NCI_CGAP_Sub3 Homo sapiens cDNA clone I M AG E :2719006 3, mRNA sequence

NM 0024 Homo sapiens msh homeo box 5.19 Up 2.36E-03 48 homolog 1 (Drosophila) (MSX1 ), mRNA

NM 0065 Homo sapiens CUG triplet repeat, 5.19 Up 1.02E-03 61 RNA binding protein 2 (CUGBP2), mRNA

NM_1736 Homo sapiens hypothetical protein 5.18 Up 3.22E-04 24 FLJ40504 (FLJ40504), mRNA

BU536871 AGENCOURTJ0224340 5.18 Up 2.59E-03

NIH MGC 141 Homo sapiens cDNA clone IMAGE:6565454 5, mRNA sequence

NM 0177 Homo sapiens ribonuclease P 25kDa 5.17 Up 7.25E-03 93 subunit (RPP25), mRNA

NM 0006 Homo sapiens chemokine (C-X-C 5.16 Up 1.48E-02 09 motif) ligand 12 (stromal cell-derived factor 1 ) (CXCL12), mRNA AA677830 zi13a10.s1 5.14 Up 5.1 1 E-04

Soares_fetal_liver_spleen_1 NFLS_S1

Homo sapiens cDNA clone

IMAGE:430650 3, mRNA sequence NM 0329 Homo sapiens RAS-like, estrogen- 5.14 Up 4.34E-03 18 regulated, growth inhibitor (RERG), mRNA NM_1471 Homo sapiens hypothetical protein 5.13 Up 5.24E-03

89 MGC39325 (MGC39325), mRNA AK024927 Homo sapiens cDNA: FLJ21274 fis, 5.08 Up 3.49E-03 clone COL01781 AI668681 zb57dO6.x5 5.04 Up 9.1 1 E-04

Soares_fetal_lung_NbHL19W Homo sapiens cDNA clone IMAGE:307691 3, mRNA sequence NM 0044 Homo sapiens growth factor receptor- 5.03 UD 9.09E-03

90 bound protein 14 (GRB14), mRNA NM 0072 Homo sapiens SP140 nuclear body 5.03 Up 3.26E-04 37 protein (SP140), transcript variant 1 , mRNA

D52654 HUM084D02B Clontech human fetal 149.25 Down 5.50E-05 brain polyA+ mRNA (#6535) Homo sapiens cDNA clone GEN-084D02 5, mRNA sequence

H09780 ymO1 gO8.s1 Soares infant brain 1 NIB 136.05 Down 1.12E-04 Homo sapiens cDNA clone IMAGE:46473 3, mRNA sequence

NM 021 1 Homo sapiens homeo box D1 1 131 .47 Down 5.74E-05

92 (HOXD1 1 ) mRNA

NM _0190 Homo sapiens hypothetical protein 118.63 Down 3.30E-04

18 FLJ1 1 127 (FLJ11 127), mRNA

NM _0050 Homo sapiens tumor necrosis factor 102.53 Down 1.39E-05

92 (ligand) superfamily, member 18 (TNFSF18), mRNA

NM 0037 Homo sapiens UDP-Gal:betaGlcNAc 97.51 Down 7.77E-06

83 beta 1 ,3-galactosyltransferase, polypeptide 2 (B3GALT2), mRNA

NM _0121 Homo sapiens beta-site APP-cleaving 97.46 Down 1.03E-04

05 enzyme 2 (BACE2), transcript variant a, mRNA

H 15096 ym29e1 1.r1 Soares infant brain 1 NIB 74.92 Down 1.42E-04 Homo sapiens cDNA clone IMAGE:49250 5, mRNA sequence

NM 1304 Homo sapiens protein tyrosine 71 .19 Down 1.19E-05

35 phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA

NM _0021 Homo sapiens inhibin, beta B (activin 64.13 Down 4.86E-05

93 AB beta polypeptide) (INHBB), mRNA

NM _0024 Homo sapiens matrix 62.68 Down 4.56E-05

22 metalloproteinase 3 (stromelysin 1 , progelatinase) (MMP3), mRNA

NM 0048 Homo sapiens glia maturation factor, 60.82 Down 2.69E-05

77 gamma (GMFG), mRNA

NM _1735 Homo sapiens solute carrier family 35, 60.19 Down 1.64E-05

08 member F3 (SLC35F3), mRNA

NM _0054 Homo sapiens synuclein, alpha 59.24 Down 1.96E-05

60 interacting protein (synphilin) (SNCAIP), mRNA

NM 0032 Homo sapiens transcription factor AP- 59.03 Down 6.78E-04

22 2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mRNA

R61470 yh15d12.r1 Soares infant brain 1 NIB 58.7 Down 1.63E-05 Homo sapiens cDNA clone IMAGE:37984 5, mRNA sequence

NM 0140 Homo sapiens response gene to 57.67 Down 4.98E-05

59 " complement 32 (RGC32), mRNA

NM _0142 Homo sapiens potassium channel, 56.13 Down 1.03E-04

17 subfamily K, member 2 (KCNK2), mRNA

NM 0027 Homo sapiens protease, serine, 1 1 51 .13 Down 3.26E-05

75 " (IGF binding) (PRSS11 ), mRNA

NM 001 1 Homo sapiens angiopoietin 2 50.9 Down 6.08E-05

47 " (ANGPT2), mRNA

NM 0053 Homo sapiens neurofilament 3 47.69 Down 9.27E-06 82 (15OkDa medium) (NEF3), mRNA

NM _0335 Homo sapiens solute carrier family 38, 47.39 Down 2.51 E-04

18 member 5 (SLC38A5), mRNA

NM _0314 Homo sapiens transmembrane 4 46.71 Down 2.41 E-04

42 superfamily member 10 (TM4SF10), mRNA

NM 0248 Homo sapiens hypothetical protein 45.59 Down 2.62E-05

83 " FLJ22202 (FLJ22202), mRNA

BQ02035 U l-H-ED0-axk-p-07-0-U I .s 1 45.57 Down 6.35E-05

7 NCI CGAP EDO Homo sapiens cDNA clone IMAGE:5830134 3, mRNA sequence

NM 0021 Homo sapiens homeo box D10 44.82 Down 1.63E-05

48 " (HOXD10), mRNA

NM 0239 Homo sapiens hypothetical protein 44.51 Down 1.21 E-04

42 " MGC3036 (MGC3036), mRNA

NM 0151 Homo sapiens sulfatase 1 (SULF1 ), 42.89 Down 2.49E-04

70 " mRNA

BC070085 Homo sapiens colony stimulating 41 .65 Down 7.77E-06 factor 2 receptor, beta, low-affinity

(granulocyte-macrophage), mRNA

(cDNA clone MGC:87425

IMAGE:30344148), complete cds

NM 0008 Homo sapiens 5-hydroxytryptamine 41 .64 Down 7.77E-06

66 " (serotonin) receptor 1 F (HTR1 F), mRNA

NM _0059 Homo sapiens matrix 39.9 Down 1.02E-03

40 metalloproteinase 1 1 (stromelysin 3)

(MMP11 ), mRNA

NM 0212 Homo sapiens netrin 4 (NTN4), mRNA 37.74 Down 5.64E-03

29 "

NM 0021 Homo sapiens homeo box B5 37.45 Down 1.81 E-04

47 " (HOXB5), mRNA

BM98833 UI-H-DH0-asd-f-10-0-Ul.s1 37.42 Down 4.09E-04

8 NCI CGAP DHO Homo sapiens cDNA clone IMAGE:5857545 3, mRNA sequence

NM _2058 Homo sapiens HWKM1940 37.2 Down 1.86E-04

55 (UNQ1940), mRNA

NM _0023 Homo sapiens actin binding LIM 35.28 Down 1.96E-05

13 protein 1 (ABLIM1 ), transcript variant

1 , mRNA

NM 0191 Homo sapiens homeo box A5 32.99 Down 3.29E-05

02 " (HOXA5), mRNA

BE464407 hx89gO5.x1 NCI_CGAP_Kid1 1 Homo 32.53 Down 4.56E-05 sapiens cDNA clone IMAGE:3195032

3, mRNA sequence

NM 0248 Homo sapiens hypothetical protein 32.36 Down 4.98E-05

06 " FLJ23554 (FLJ23554), transcript variant 1 , mRNA

NM _0070 Homo sapiens a disintegrin-like and 30.29 Down 2.42E-03

38 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5

(aggrecanase-2) (ADAMTS5), mRNA

NM _0044 Homo sapiens guanine nucleotide 29.84 Down 3.23E-05

85 binding protein (G protein), gamma 4

(GNG4), mRNA NM 0021 Homo sapiens homeo box B5 29.72 Down 2.45E-04 47 (H0XB5), mRNA

NM 0025 Homo sapiens serine (or cysteine) 29.08 Down 4.71E-04 75 proteinase inhibitor, clade B

(ovalbumin), member 2 (SERPINB2), mRNA

NM_0014 Homo sapiens gastrulation brain 28.88 Down 1.39E-05 85 homeo box 2 (GBX2), mRNA

NM 0154 Homo sapiens adlican 28.34 Down 6.54E-03 19 (DKFZp564l1922), mRNA

AI288404 qv89bO1 .x1 NCI_CGAP_Ut2 Homo 27.94 Down 1.06E-03 sapiens cDNA clone IMAGE: 1988713

3, mRNA sequence AA977908 oq62c08.s1 NCI CGAP Kidθ Homo 27.64 Down 1.36E-04 sapiens cDNA clone IMAGE: 1590926

3 similar to gb:X17360_rna1


(HUMAN);, mRNA sequence AK023647 Homo sapiens cDNA FLJ13585 fis, 27.41 Down 4.98E-05 clone PLACE1009150 NM 0067 Homo sapiens microphthalmia- 27.13 Down 3.25E-05 22 associated transcription factor (MITF), transcript variant 3, mRNA NM 0528 Homo sapiens protein kinase 26.89 Down 6.73E-06 62 substrate MK2S4 (MK2S4), mRNA

NM 0009 Homo sapiens prostaglandin- 26.26 Down 7.20E-03 62 endoperoxide synthase 1

(prostaglandin G/H synthase and cyclooxygenase) (PTGS1 ), transcript variant 1 , mRNA

NM 0005 Homo sapiens renin (REN), mRNA 25.21 Down 1.42E-04 37 NM_1450 Homo sapiens sushi domain 24.45 Down 4.70E-05

06 containing 3 (SUSD3), mRNA CB135276 K-EST0187371 L5HLK1 Homo 23.55 Down 4.58E-05 sapiens cDNA clone L5HLK1-32-B12

5, mRNA sequence AK058012 Homo sapiens cDNA FLJ25283 fis, 23.25 Down 5.19E-05 clone STM06716 AA555266 nlO8fO7.s1 NCI CGAP Pr11 Homo 22.87 Down 1.07E-04 sapiens cDNA clone IMAGE:1029733, mRNA sequence

NM 0179 Homo sapiens hypothetical protein 22.44 Down 3.10E-04 16 FLJ20643 (FLJ20643), mRNA

AW04464 wy78eO9.x1 22.13 Down 1.88E-04

7 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:2554696 3, mRNA sequence

NM 0161 Homo sapiens protein phosphatase 22.12 Down 4.94E-03 47 methylesterase-1 (PME-1 ), mRNA

NM 0017 Homo sapiens brain-specific 21.16 Down 6.73E-06 04 angiogenesis inhibitor 3 (BAI3), mRNA

NM 0028 Homo sapiens retinoic acid receptor 19.84 Down 2.74E-03 89 responder (tazarotene induced) 2


NM 0017 Homo sapiens cadherin 4, type 1 , R- 19.8 Down 3.52E-05 94 cadherin (retinal) (CDH4), mRNA NM 0047 Homo sapiens solute carrier family 16 19.55 Down 5.54E-04

31 " (monocarboxylic acid transporters), member 7 (SLC16A7), mRNA

NM _0051 Homo sapiens actin, alpha, cardiac 18.77 Down 1.81E-04

59 muscle (ACTC), mRNA

AI422199 tf58dO4.x1 NCI_CGAP_Brn23 Homo 18.26 Down 2.51E-04 sapiens cDNA clone IMAGE:2103463 3, mRNA sequence

NM 0049 Homo sapiens potassium inwardly- 18.04 Down 2.90E-05

82 " rectifying channel, subfamily J, member 8 (KCNJ8), mRNA

BG62270 602647476F1 NIH MGC 79 Homo 17.73 Down 1.96E-05

7 sapiens cDNA clone IMAGE:4768963 5, mRNA sequence

NM _0210 Homo sapiens keratin, hair, acidic, 4 17.69 Down 2.10E-05

13 (KRTHA4), mRNA

NM _0067 Homo sapiens microphthalmia- 17.67 Down 1.09E-04

22 associated transcription factor (MITF), transcript variant 3, mRNA

NM 0032 Homo sapiens thrombospondin 2 17.35 Down 6.77E-05

47 " (THBS2), mRNA

NM _0245 Homo sapiens homeo box D1 17.01 Down 5.19E-05

01 (HOXD1 ), mRNA

NM _0018 Homo sapiens collagen, type Xl, alpha 16.96 Down 9.81 E-05

54 1 (COL1 1A1 ), transcript variant A, mRNA

NM 0026 Homo sapiens phospholamban (PLN), 16.91 Down 4.40E-04

67 " mRNA

BQ18310 U l-H-EUO-azs-c-22-O-U I .s 1 16.24 Down 5.19E-04

8 NCI CGAP CaM Homo sapiens cDNA clone IMAGE:5852877 3, mRNA sequence

NM 0319 Homo sapiens keratin associated 16.19 Down 1.45E-04

57 " protein 1 -5 (KRTAP1-5), mRNA

BX648323 Homo sapiens mRNA; cDNA 15.58 Down 9.86E-05 DKFZp686K10163 (from clone DKFZp686K10163)

NM 0014 Homo sapiens fatty acid binding 15.56 Down 1.81 E-04

42 " protein 4, adipocyte (FABP4), mRNA

NM 1450 Homo sapiens BXMAS2-10 (BXMAS2- 15.25 Down 6.87E-05

16 " 10), mRNA

NM 0021 Homo sapiens major histocompatibility 15.13 Down 2.96E-03

21 " complex, class II, DP beta 1 (HLA- DPB1 ), mRNA

BC044843 Homo sapiens hypothetical protein 15 Down 1 .12E-04 LOC339535, mRNA (cDNA clone IMAGE:5186761 ), partial cds

NM 0219 Homo sapiens glutamate receptor, 14.96 Down 3.24E-03

56 " ionotropic, kainate 2 (GRIK2), transcript variant 1 , mRNA

NM 0014 Homo sapiens forkhead box C1 14.95 Down 4.01E-04

53 " (FOXC1 ), mRNA

NM 0040 Homo sapiens empty spiracles 14.89 Down 1.04E-04

98 " homolog 2 (Drosophila) (EMX2), mRNA

NM _0157 Homo sapiens putative lymphocyte 14.57 Down 1.77E-02

14 G0/G1 switch gene (G0S2), mRNA AK075234 Homo sapiens cDNA FLJ90753 fis, 14.24 Down 5.75E-05 clone PLACE3000213, weakly similar to COMPLEMENT RECEPTOR TYPE


NM 0014 Homo sapiens endothelial 14.2 Down 1.46E-03 00 differentiation, sphingolipid G-protein- coupled receptor, 1 (EDG1 ), mRNA CA942841 ir64cO8.y1 HR85 islet Homo sapiens 13.99 Down 2.95E-03 cDNA clone IMAGE:6607287 5, mRNA sequence

NM 0058 Homo sapiens receptor (calcitonin) 13.94 Down 2.79E-04 55 activity modifying protein 1 (RAMP1 ), mRNA AI270582 qu89e12.x1 NCI_CGAP_Gas4 Homo 13.92 Down 9.86E-05 sapiens cDNA clone IMAGE:1979278

3, mRNA sequence NM 0154 Homo sapiens regeneration 13.57 Down 5.22E-02 30 associated muscle protease

(DKFZP586H2123), transcript variant

1 , mRNA CB267221 1006127 Human Fat Cell 5-Stretch 13.46 Down 4.07E-02

Plus cDNA Library Homo sapiens cDNA 5, mRNA sequence

NM 0145 Homo sapiens UDP-N-acetyl-alpha-D- 13.3 Down 1.66E-03 68 galactosamine:polypeptide N- acetylgalactosaminyltransferase 5

(GalNAc-T5) (GALNT5), mRNA AI493349 tg70f04.x1 Soares_NhHMPu_S1 12.95 Down 9.86E-05

Homo sapiens cDNA clone

IMAGE:2114143 3, mRNA sequence NM 0182 Homo sapiens guanylate binding 12.74 Down 1.42E-04 84 protein 3 (GBP3), mRNA

BC018891 Homo sapiens FERM domain 12.7 Down 2.10E-05 containing 4A, mRNA (cDNA clone

IMAGE:3954440), partial cds NM 0176 Homo sapiens betaine-homocysteine 12.44 Down 1.07E-04 14 methyltransferase 2 (BHMT2), mRNA

X02851 Human mRNA for interleukin-1 12.28 Down 2.93E-04 precursor (pre IL-1 ) AK055518 Homo sapiens cDNA FLJ30956 fis, 12.24 Down 1.73E-05 clone HCASM2000202 BX648964 Homo sapiens mRNA; cDNA 12.16 Down 1.96E-05

DKFZp686J0156 (from clone


Y09980 H.sapiens HOXD3 gene 12.1 Down 9.66E-06 AI306848 qw70c01 .x1 NCI_CGAP_Ov33 Homo 12.09 Down 3.24E-04 sapiens cDNA clone IMAGE:1996416

3, mRNA sequence

NM 0133 Homo sapiens gremlin 1 homolog, 12.09 Down 2.60E-02 72 cysteine knot superfamily (Xenopus laevis) (GREM1 ), mRNA

NM_0189 Homo sapiens major histocompatibility 12.07 Down 2.97E-03 50 complex, class I, F (HLA-F), mRNA

NM 0144 Homo sapiens ribosomal protein S6 11.85 Down 4.56E-04 96 kinase, 9OkDa, polypeptide 6

(RPS6KA6), mRNA NM 0008 Homo sapiens 5-hydroxytryptamine 11.82 Down 3.60E-04 67 (serotonin) receptor 2B (HTR2B), mRNA AI685948 tu38gO6.x1 NCI_CGAP_Pr28 Homo 11.77 Down 1 .07E-04 sapiens cDNA clone IMAGE:2253370

3 similar to contains AIu repetitive element;, mRNA sequence NM 0120 Homo sapiens adenylate kinase 5 11.39 Down 9 .56E-04 93 (AK5), transcript variant 2, mRNA

AK125608 Homo sapiens cDNA FLJ43620 fis, 11.34 Down 1 .93E-02 clone SPLEN2021701 , highly similar to HLA CLASS I


2 ALPHA CHAIN PRECURSOR AK026301 Homo sapiens cDNA: FLJ22648 fis, 11.33 Down 4.70E-05 clone HSI07329 AA740724 ny98cO7.s1 NCI CGAP GCB1 Homo 11.27 Down 3.23E-05 sapiens cDNA clone IMAGE: 1286316

3, mRNA sequence

NM 0195 Homo sapiens homeo box D8 11.11 Down 5.19E-05 58 (HOXD8), mRNA

BC041412 Homo sapiens heat shock 7OkDa 10.9 Down 9.39E-03 protein 12A, mRNA (cDNA clone

IMAGE:5285193), partial cds BE297167 601 177587F1 NIH_MGC_17 Homo 10.86 Down 4.09E-04 sapiens cDNA clone IMAGE:3532989

5, mRNA sequence

BM71 171 UI-E-CL1 -afb-d-04-0-UI.M UI-E-CL1 10.81 Down 3.64E-04 8 Homo sapiens cDNA clone UI-E-CL1- afb-d-04-O-U I 5, mRNA sequence NM_0014 Homo sapiens epithelial membrane 10.71 Down 4.26E-02 23 protein 1 (EMP1 ), mRNA

NM 0176 Homo sapiens asporin (LRR class 1 ) 10.68 Down 5.18E-04 80 (ASPN), mRNA

NM_0183 Homo sapiens KIAA1598 (KIAA1598), 10.64 Down 4.64E-04 30 mRNA

CD72379 Oj26f04.y1 Human lacrimal gland, 10.61 Down 1.63E-03 8 unamplified: oj Homo sapiens cDNA clone oj26f04 5, mRNA sequence NM 0252 Homo sapiens EF hand domain 10.57 Down 1.24E-04 02 containing 1 (EFHD1 ), mRNA

NM 0007 Homo sapiens glycoprotein hormones, 10.55 Down 5.19E-05

35 alpha polypeptide (CGA), mRNA BF871 1 19 CM0-ET0121 -31 1000-658-h12 10.45 Down 3.93E-02

ET0121 Homo sapiens cDNA, mRNA sequence NM 0070 Homo sapiens endothelial cell-specific 10.34 Down 4.98E-05

36 molecule 1 (ESM1 ), mRNA NM 0059 Homo sapiens sine oculis homeobox 10.34 Down 2.04E-04 82 homolog 1 (Drosophila) (SIX1 ), mRNA AL8331 19 Homo sapiens mRNA; cDNA 10.33 Down 1.58E-04

DKFZp313A2432 (from clone


NM 0248 Homo sapiens TAF7-like RNA 10.19 Down 1.59E-03 85 polymerase II, TATA box binding protein (TBP)-associated factor,

5OkDa (TAF7L), mRNA BC035599 Homo sapiens, clone 10.18 Down 3.44E-02 IMAGE:3871970, mRNA, partial cds

NM _0026 Homo sapiens phosphodiesterase 4B, 10.15 Down 8.49E-04 00 cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila) (PDE4B), mRNA

NM _0335 Homo sapiens major histocompatibility 10.13 Down 3.94E-05 54 complex, class II, DP alpha 1 (HLA-

DPA1 ), mRNA

NM 1304 Homo sapiens protein tyrosine 10 Down 1 .12E-04 35 " phosphatase, receptor type, E

(PTPRE), transcript variant 2, mRNA

AU 61980 Homo sapiens mRNA; cDNA 9.93 Down 1.14E-04

DKFZp761 H1023 (from clone

DKFZp761 H1023)

NM 1523 Homo sapiens carnitine 9.91 Down 2.83E-02 59 " palmitoyltransferase 1 C (CPT1 C), mRNA

NM _1536 Homo sapiens family with sequence 9.84 Down 7.76E-05 90 similarity 43, member A (FAM43A), mRNA

NM _0022 Homo sapiens laminin, alpha 4 9.74 Down 1.93E-04 90 (LAMA4), mRNA NM _1522 Homo sapiens gap junction protein, chi 9.73 Down 1.19E-04 19 1 , 31 .9kDa (connexin 31.9) (GJC1 ), mRNA

NM 0032 Homo sapiens transcription factor AP- 9.62 Down 1.33E-03 22 " 2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mRNA

NM 0069 Homo sapiens pregnancy specific 9.55 Down 1.44E-04 05 beta-1 -glycoprotein 1 (PSG1 ), mRNA NM 0001 Homo sapiens fucosidase, alpha-L- 1 , 9.54 Down 6.93E-04 47 tissue (FUCA1 ), mRNA BG53827 602566746F1 NIH MGC 77 Homo 9.42 Down 2.19E-04 6 sapiens cDNA clone IMAGE:4691459

5, mRNA sequence

NM _1815 Homo sapiens phosphoinositide-3- 9.4 Down 6.78E-03 23 kinase, regulatory subunit 1 (p85 alpha) (PIK3R1 ), transcript variant 1 , mRNA

NM _0038 Homo sapiens WNT1 inducible 9.34 Down 1.36E-03 82 signaling pathway protein 1 (WISP1 ), transcript variant 1 , mRNA

NM 0122 Homo sapiens muscle RAS oncogene 9.2 Down 3.26E-04 19 " homolog (MRAS), mRNA NM _0017 Homo sapiens complement 9.18 Down 2.18E-03 34 component 1 , s subcomponent (C1 S), transcript variant 1 , mRNA

AK123807 Homo sapiens cDNA FLJ41813 fis, 9.16 Down 1.39E-04 clone NT2RI201 1450

NM 0201 Homo sapiens methylcrotonoyl- 9.13 Down 2.89E-02 66 " Coenzyme A carboxylase 1 (alpha)

(MCCC1 ), mRNA

AL 137698 Homo sapiens mRNA; cDNA 9.12 Down 2.20E-04

DKFZp434C1915 (from clone

DKFZp434C1915); partial cds

W38393 zb15cO7.M 9.08 Down 1.88E-03

Soares_fetal_lung_NbHL19W Homo sapiens cDNA clone I MAG E: 302124 5, mRNA sequence

NM 0226 Homo sapiens extracellular matrix 9.06 Down 1.92E-02 64 protein 1 (ECM1 ), transcript variant 2, mRNA NM 0042 Homo sapiens guanine nucleotide 9 Down 2.42E-03

97 binding protein (G protein), alpha 14 (GNA14), mRNA

NM_1446 Homo sapiens hypothetical protein 8.96 Down 2.51E-05

98 FLJ25124 (FLJ25124), mRNA NM 0070 Homo sapiens TBC1 domain family, 8.95 Down 1.87E-04 63 member 8 (with GRAM domain)

(TBC1 D8), mRNA

BM70273 UI-E-CK1-afh-j-02-0-Ul.r1 UI-E-CK1 8.93 Down 5.80E-05 4 Homo sapiens cDNA clone UI-E-CK1 - afh-j-02-O-UI 5, mRNA sequence NM 1452 Homo sapiens zinc finger protein 563 8.84 Down 1.37E-04 76 (ZNF563), mRNA

AB018270 Homo sapiens mRNA for KIAA0727 8.83 Down 3.83E-03 protein, partial cds

AW83984 RC1 -LT0074-030500-016-d01 LT0074 8.78 Down 4.09E-02 4 Homo sapiens cDNA, mRNA sequence

NM 0161 Homo sapiens transient receptor 8.77 Down 3.30E-04 79 potential cation channel, subfamily C, member 4 (TRPC4), mRNA NM_0224 Homo sapiens thiamin 8.76 Down 1.28E-03 45 pyrophosphokinase 1 (TPK1 ), mRNA

NM 0031 Homo sapiens signal transducer and 8.56 Down 4.84E-04 52 activator of transcription 5A (STAT5A), mRNA H49355 yq18d12.s1 Soares fetal liver spleen 8.56 Down 3.53E-03

1 NFLS Homo sapiens cDNA clone

IMAGE:274222 3, mRNA sequence

NM 0251 Homo sapiens lymphocyte alpha- 8.5 Down 1.68E-03

44 " kinase (LAK), mRNA

NM _0169 Homo sapiens NADPH oxidase 4 8.47 Down 2.48E-03

31 (NOX4), mRNA

NM _1393 Homo sapiens angiopoietin-like 4 8.46 Down 5.11E-03

14 (ANGPTL4), transcript variant 1 , mRNA

AW24851 2820632.3prime NIH MGC 7 Homo 8.42 Down 6.78E-03

6 sapiens cDNA clone IMAGE:2820632

3, mRNA sequence

NM _0029 Homo sapiens regulator of G-protein 8.39 Down 1.29E-04

24 signalling 7 (RGS7), mRNA AL833547 Homo sapiens mRNA; cDNA 8.38 Down 1.38E-03

DKFZp686M023 (from clone

DKFZp686M023) BX640643 Homo sapiens mRNA; cDNA 8.37 Down 2.74E-04

DKFZp686O24114 (from clone

DKFZp686O241 14) BF696790 602125323F1 NIH MGC 56 Homo 8.32 Down 2.73E-03 sapiens cDNA clone IMAGE:4282540

5, mRNA sequence

NM_1457 Homo sapiens microsomal glutathione 8.3 Down 8.33E-05 92 S-transferase 1 (MGST1 ), transcript variant 1a, mRNA

NM _0165 Homo sapiens neurothmin (HNT), 8.29 Down 2.25E-02

22 mRNA

NM _0005 Homo sapiens decay accelerating 8.26 Down 5.04E-05

74 factor for complement (CD55, Cramer blood group system) (DAF), mRNA

CA437861 UI-H-DH0-aur-k-12-0-Ul.s1 8.25 Down 7.76E-05 NCI CGAP DHO Homo sapiens cDNA clone UI-H-DH0-aur-k-12-0-UI 3, mRNA sequence

NM 0052 Homo sapiens FAT tumor suppressor 8.19 Down 4.19E-02

45 " homolog 1 (Drosophila) (FAT), mRNA

NM 1387 Homo sapiens synaptotagmin-like 5 8.18 Down 3.61 E-03

80 " (SYTL5), mRNA

NM 0188 Homo sapiens transmembrane protein 8.13 Down 5.19E-05

36 " SHREW1 (SHREW1 ), mRNA

NM 0143 Homo sapiens lysosomal-associated 8.07 Down 6.90E-04

98 " membrane protein 3 (LAMP3), mRNA

NM _0121 Homo sapiens dimethylarginine 8.02 Down 1.01 E-02

37 dimethylaminohydrolase 1 (DDAH1 ), mRNA

NM 0018 Homo sapiens clathrin, light 8.01 Down 5.15E-02

34 " polypeptide (Lcb) (CLTB), transcript variant nonbrain, mRNA

NM _0022 Homo sapiens KiSS-1 metastasis- 8 Down 1.98E-03

56 suppressor (KISS1 ), mRNA

NM _0024 Homo sapiens carcinoembryonic 7.98 Down 8.26E-04

83 antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) (CEACAM6), mRNA

BF086707 CM4-GN0081 -160900-316-c1 1 7.94 Down 9.93E-04 GN0081 Homo sapiens cDNA, mRNA sequence

NM _1735 Homo sapiens hypothetical protein 7.88 Down 5.44E-02

46 MGC35097 (MGC35097), mRNA

CA314488 U l-CF-FNO-af h-i-09-O-U I .s 1 U I-CF- 7.85 Down 1.56E-04 FNO Homo sapiens cDNA clone Ul- CF-FN0-afh-i-09-0-UI 3, mRNA sequence

NM _0038 Homo sapiens harakiri, BCL2 7.71 Down 1.88E-04

06 interacting protein (contains only BH3 domain) (HRK), mRNA

NM 0038 Homo sapiens sialyltransferase 9 7.59 Down 1.46E-02

96 " (CMP-NeuAc:lactosylceramide alpha- 2,3-sialyltransferase; GM3 synthase) (SIAT9), mRNA

NM _0202 Homo sapiens family with sequence 7.57 Down 3.01E-02

23 similarity 20, member C (FAM20C), mRNA

NM 0150 Homo sapiens GTPase activating 7.57 Down 3.72E-03

85 " Rap/RanGAP domain-like 4 (GARNL4), mRNA

NM _0045 Homo sapiens phosphoenolpyruvate 7.56 Down 3.44E-02

63 carboxykinase 2 (mitochondrial) (PCK2), mRNA

NM 0064 Homo sapiens periostin, osteoblast 7.55 Down 1.81E-04

75 " specific factor (POSTN), mRNA NM 0067 Homo sapiens Src-like-adaptor (SLA), 7.55 Down 1.42E-04

48 " mRNA

NM 0178 Homo sapiens tetratricopeptide repeat 7.5 Down 1.88E-02

68 " domain 12 (TTC12), mRNA

NM 1780 Homo sapiens Rab6-interacting 7.49 Down 6.84E-04

39 " protein 2 (ELKS), transcript variant delta, mRNA

BX640893 Homo sapiens mRNA; cDNA 7.49 Down 6.08E-05 DKFZp686P15248 (from clone DKFZp686P15248)

NM 0007 Homo sapiens cytochrome P450, 7.46 Down 2.39E-02

84 " family 27, subfamily A, polypeptide 1 (CYP27A1 ), nuclear gene encoding mitochondrial protein, mRNA

NM _0208 Homo sapiens dedicator of cytokinesis 7.43 Down 2.28E-02

12 6 (DOCK6), mRNA

NM _0031 Homo sapiens spastic paraplegia 7, 7.41 Down 5.06E-02

19 paraplegin (pure and complicated autosomal recessive) (SPG7), nuclear gene encoding mitochondrial protein, transcript variant 1 , mRNA

NM _0012 Homo sapiens chemokine (C-C motif) 7.38 Down 2.41 E-04

95 receptor 1 (CCR1 ), mRNA

NM _0033 Homo sapiens uridine phosphorylase 7.37 Down 3.92E-02

64 1 (UPP1 ), transcript variant 1 , mRNA

NM _0184 Homo sapiens brain expressed, X- 7.36 Down 4.56E-05

76 linked 1 (BEX1 ), mRNA

NM _0164 Homo sapiens CXXC finger 5 7.35 Down 8.22E-04

63 (CXXC5), mRNA

BX647371 Homo sapiens mRNA; cDNA 7.32 Down 4.18E-02 DKFZp686B161 1 1 (from clone DKFZp686B161 1 1 )

AA297912 EST1 13641 T-cell lymphoma Homo 7.31 Down 2.08E-02 sapiens cDNA 5 end, mRNA sequence

AK023104 Homo sapiens cDNA FLJ13042 fis, 7.31 Down 1.60E-03 clone NT2RP3001318

NM _0033 Homo sapiens uridine phosphorylase 7.25 Down 2.39E-02

64 1 (UPP1 ), transcript variant 1 , mRNA

NM _0320 Homo sapiens elastin microfibril 7.15 Down 1.07E-04

48 interfaced (EMILIN2), mRNA

NM _021 1 Homo sapiens coactosin-like 1 7.14 Down 4.47E-02

49 (Dictyostelium) (COTL1 ), mRNA

NM _0036 Homo sapiens aldo-keto reductase 7.12 Down 4.83E-02

89 family 7, member A2 (aflatoxin aldehyde reductase) (AKR7A2), mRNA

NM _0201 Homo sapiens chromosome 8 open 7.11 Down 6.92E-04

30 reading frame 4 (C8orf4), mRNA

AL 137349 Homo sapiens mRNA; cDNA 7.1 Down 7.64E-04 DKFZp434A0225 (from clone DKFZp434A0225)

NM _0045 Homo sapiens sparc/osteonectin, 7.06 Down 1.73E-03

98 cwcv and kazal-like domains proteoglycan (testican) (SPOCK), mRNA

NM _0123 Homo sapiens leucine zipper, down- 7.04 Down 2.75E-04

17 regulated in cancer 1 (LDOC1 ), mRNA NM 1445 Homo sapiens kidney predominant 7.03 Down 1.04E-04

80 " protein NCU-G1 (MGC31963), mRNA

NM 0063 Homo sapiens fibulin 5 (FBLN5), 7.02 Down 3.63E-03

29 " mRNA

NM 0018 Homo sapiens creatine kinase, 7 Down 1.36E-03

25 " mitochondrial 2 (sarcomeric) (CKMT2), nuclear gene encoding mitochondrial protein, mRNA

NM 0058 Homo sapiens Down syndrome critical 7 Down 4.1 1 E-04

22 " region gene 1 -like 1 (DSCR1 L1 ), mRNA

NM 0021 Homo sapiens interleukin 7 receptor 6.94 Down 4.21 E-04

85 " (IL7R), mRNA

NM 0191 Homo sapiens protocadherin beta 9 6.92 Down 1.76E-03

19 " (PCDHB9), mRNA

NM 0023 Homo sapiens leptin receptor (LEPR), 6.92 Down 3.50E-03

03 " transcript variant 1 , mRNA

NM 0165 Homo sapiens solute carrier family 15, 6.9 Down 2.06E-02

82 " member 3 (SLC15A3), mRNA

NM 0161 Homo sapiens protein phosphatase 6.9 Down 1.OOE-04

47 " methylesterase-1 (PME-1 ), mRNA

NM _0177 Homo sapiens signal-transducing 6.89 Down 2.96E-03

20 adaptor protein-2 (STAP2), mRNA

BU624020 UI-H-FG1 -bgh-h-24-0-Ul.s1 6.84 Down 1.31 E-03

NCI CGAP FG1 Homo sapiens cDNA clone UI-H-FG1 -bgh-h-24-0-UI 3, mRNA sequence

NM _0121 Homo sapiens calcium-binding 6.81 Down 3.51 E-04

89 tyrosine-(Y)-phosphorylation regulated

(fibrousheathin 2) (CABYR), transcript variant 1 , mRNA

NM _0024 Homo sapiens nuclear autoantigenic 6.77 Down 1.03E-02

82 sperm protein (histone-binding)

(NASP), transcript variant 2, mRNA

NM 0065 Homo sapiens v-rel 6.74 Down 2.38E-02

09 " reticuloendotheliosis viral oncogene homolog B, nuclear factor of kappa light polypeptide gene enhancer in B- cells 3 (avian) (RELB), mRNA

NM 0181 Homo sapiens nudix (nucleoside 6.74 Down 2.56E-04

59 " diphosphate linked moiety X)-type motif 11 (NUDT1 1 ), mRNA

NM _0017 Homo sapiens cyclin D3 (CCND3), 6.7 Down 4.91 E-02

60 mRNA

NM _0327 Homo sapiens chromosome 9 open 6.69 Down 2.15E-03

28 reading frame 67 (C9orf67), mRNA

NM _0158 Homo sapiens stathmin-like 3 6.67 Down 6.04E-03

94 (STMN3), mRNA

NM 0010 Homo sapiens CD36 antigen (collagen 6.6 Down 1.OOE-04

01547 type I receptor, thrombospondin receptor) (CD36), transcript variant 2, mRNA

NM 0034 Homo sapiens dysferlin, limb girdle 6.59 Down 4.67E-03

94 " muscular dystrophy 2B (autosomal recessive) (DYSF), mRNA

NM _0039 Homo sapiens G protein-coupled 6.58 Down 7.86E-03

79 receptor, family C, group 5, member A (GPCR5A), mRNA

NM _0324 Homo sapiens BH-protocadherin 6.55 Down 5.87E-04

57 (brain-heart) (PCDH7), transcript variant c, mRNA

NM 0028 Homo sapiens retinol binding protein 6.51 Down 8.19E-04

99 " 1 , cellular (RBP1 ), mRNA

NM 0323 Homo sapiens chromosome 9 open 6.5 Down 2.62E-02

42 " reading frame 125 (C9orf125), mRNA

AK021754 Homo sapiens cDNA FLJ1 1692 fis, 6.49 Down 4.71 E-04 clone HEMBA1004983

NM 0032 Homo sapiens tetranectin 6.47 Down 9.13E-04

78 " (plasminogen binding protein) (TNA), mRNA

BE708875 QV2-HT0577-160500-220-a01 6.47 Down 2.62E-02

HT0577 Homo sapiens cDNA, mRNA sequence

BE7351 15 601566084F1 NIH MGC 21 Homo 6.47 Down 1.37E-03 sapiens cDNA clone IMAGE:3840837

5, mRNA sequence

NM_0018 Homo sapiens carboxypeptidase M 6.44 Down 2.55E-03

74 (CPM), transcript variant 1 , mRNA

AI216469 qh07h10.x1 Soares NFL T GBC SI 6.43 Down 2.57E-04

Homo sapiens cDNA clone

IMAGE:1844035 3, mRNA sequence

H99504 yx25gO5.s1 Soares melanocyte 6.43 Down 2.71 E-03

2NbHM Homo sapiens cDNA clone

IMAGE:262808 3, mRNA sequence

NM 0004 Homo sapiens glycoprotein Ib 6.43 Down 2.94E-04 07 (platelet), beta polypeptide (GP1 BB), mRNA

AI809789 wf77e10.x1 Soares NFL T GBC SI 6.43 Down 7.22E-04

Homo sapiens cDNA clone

IMAGE:2361642 3, mRNA sequence

W45350 zc81 hO8.s1 Pancreatic Islet Homo 6.42 Down 1.18E-04 sapiens cDNA clone IMAGE:328767 3 similar to contains AIu repetitive element;, mRNA sequence

AL833254 Homo sapiens mRNA; cDNA 6.41 Down 5.24E-03

DKFZp761 K2120 (from clone

DKFZp761 K2120)

AK096481 Homo sapiens cDNA FLJ39162 fis, 6.37 Down 7.62E-04 clone OCBBF2002376

NM 0025 Homo sapiens phosphodiesterase 2A, 6.35 Down 5.10E-04 99 cGMP-stimulated (PDE2A), mRNA

NM_0006 Homo sapiens aldehyde 6.35 Down 1.96E-05 93 dehydrogenase 1 family, member A3


NM 0149 Homo sapiens neuroligin 1 (NLGN1 ), 6.33 Down 1.31 E-03

32 mRNA

NM 0055 Homo sapiens laminin, alpha 5 6.3 Down 1.45E-03

60 (LAMA5), mRNA

AW66566 hjO5dO2.x1 Soares NFL T GBC SI 6.29 Down 4.07E-04

5 Homo sapiens cDNA clone

IMAGE:2980899 3, mRNA sequence

AI679537 tu64cO9.x1 NCI_CGAP_Gas4 Homo 6.28 Down 4.98E-05 sapiens cDNA clone IMAGE:2255824

3, mRNA sequence BQ42892 AGENCOURT 7905828 6.27 Down 8.33E-05

I NIH MGC 82 Homo sapiens cDNA clone IMAGE:6104882 5, mRNA sequence

NM 0206 Homo sapiens rhomboid, veinlet-like 7 6.23 Down 4.57E-02 84 (Drosophila) (RHBDL7), mRNA

NM 0062 Homo sapiens tumor necrosis factor, 6.23 Down 2.86E-03 91 alpha-induced protein 2 (TNFAIP2), mRNA

NM 0008 Homo sapiens 5-hydroxytryptamine 6.18 Down 1.12E-04 63 (serotonin) receptor 1 B (HTR1 B), mRNA AI905628 CM-BT094-050299-147 BT094 Homo 6.15 Down 2.55E-03 sapiens cDNA, mRNA sequence R44402 yg37aO1.s1 Soares infant brain 1 NIB 6.12 Down 5.19E-04

Homo sapiens cDNA clone

IMAGE:34639 3 similar to contains

MER35 repetitive element ;, mRNA sequence BC035066 Homo sapiens, clone 6.11 Down 2.37E-03

IMAGE:5259543, mRNA NM 1707 Homo sapiens unc-5 homolog B (C. 6.1 Down 1.51E-02 44 elegans) (UNC5B), mRNA

CA448068 U I-H-ED 1 -ayj-g-05-O-U I .s 1 6.09 Down 1.33E-05

NCI CGAP ED1 Homo sapiens cDNA clone UI-H-ED1 -ayj-g-05-0-UI 3, mRNA sequence

NM 0219 Homo sapiens sphingosine kinase 1 6.06 Down 4.43E-02 72 (SPHK1 ), mRNA

AL832178 Homo sapiens mRNA; cDNA 6.06 Down 6.11E-03

DKFZp686M1316 (from clone


NM 0178 Homo sapiens Ras interacting protein 6.02 Down 9.71 E-05 05 1 (RASIP1 ), mRNA

BF342356 602013147F1 NCI_CGAP_Brn64 6.02 Down 1.62E-03

Homo sapiens cDNA clone

I MAG E :4148938 5, mRNA sequence BC042561 Homo sapiens, clone 6.01 Down 2.49E-04

IMAGE:4819341 , mRNA NM 0067 Homo sapiens indolethylamine N- 5.99 Down 1.86E-04 74 methyltransferase (INMT), mRNA

BX486208 DKFZp686J07250_r1 686 (synonym: 5.98 Down 8.09E-04 hlcc3) Homo sapiens cDNA clone

DKFZp686J07250 5, mRNA sequence NM 0230 Homo sapiens UPF3 regulator of 5.98 Down 5.38E-02

I 1 nonsense transcripts homolog A (yeast) (UPF3A), transcript variant 1 , mRNA

NM 0031 Homo sapiens stanniocalcin 1 (STC1 ), 5.97 Down 1.56E-02

55 mRNA

AL706653 DKFZp686E1543_r1 686 (synonym: 5.95 Down 4.01 E-04 hlcc3) Homo sapiens cDNA clone DKFZp686E1543 5, mRNA sequence

NM 0072 Homo sapiens kelch-like 2, Mayven 5.95 Down 4.55E-02

46 (Drosophila) (KLHL2), mRNA

NM 0054 Homo sapiens noggin (NOG), mRNA 5.95 Down 2.84E-02

50 NM 0013 Homo sapiens docking protein 1 , 5.92 Down 5.10E-02 81 62kDa (downstream of tyrosine kinase

1 ) (DOK1 ), mRNA

NM_0013 Homo sapiens disabled homolog 2, 5.89 Down 1.79E-02 43 mitogen-responsive phosphoprotein

(Drosophila) (DAB2), mRNA

NM 0040 Homo sapiens cathepsin S (CTSS), 5.85 Down 6.82E-03

79 mRNA

BF109843 7l70a07.x1 5.85 Down 7.58E-04


Homo sapiens cDNA clone

IMAGE:3526572 3, mRNA sequence

NM_0190 Homo sapiens protocadherin 18 5.82 Down 1.73E-02

35 (PCDH18), mRNA

NM_0053 Homo sapiens hyaluronan synthase 2 5.79 Down 2.96E-02

28 (HAS2), mRNA

BC021714 Homo sapiens PTPRF interacting 5.77 Down 4.86E-02 protein, binding protein 2 (liprin beta

2), mRNA (cDNA clone MGC:26737

IMAGE:4826610), complete cds

NM_0009 Homo sapiens matrix GIa protein 5.72 Down 1.73E-05 00 (MGP), mRNA

NM_0036 Homo sapiens protease, serine, 12 5.72 Down 8.66E-04 19 (neurotrypsin, motopsin) (PRSS12), mRNA

R14261 yf79dO5.r1 Soares infant brain 1 NIB 5.7 Down 5.79E-04

Homo sapiens cDNA clone

IMAGE:28642 5, mRNA sequence

NM 0055 Homo sapiens laminin, alpha 1 5.68 Down 7.73E-03

59 " (LAMA1 ), mRNA

NM 0324 Homo sapiens PTEN induced putative 5.62 Down 2.38E-02

09 " kinase 1 (PINK1 ), mRNA

NM 0042 Homo sapiens phosphatidylinositol 5.62 Down 4.56E-05

04 " glycan, class Q (PIGQ), transcript variant 2, mRNA

NM 0044 Homo sapiens forkhead box E1 5.59 Down 5.47E-04

73 " (thyroid transcription factor 2)

(FOXE1 ), mRNA

NM _0055 Homo sapiens hydroxysteroid (1 1- 5.58 Down 2.41 E-03

25 beta) dehydrogenase 1 (HSD1 1 B1 ), transcript variant 1 , mRNA

NM 0184 Homo sapiens F-box protein 6 5.58 Down 1.89E-02

38 " (FBXO6), mRNA

AW45006 Ul-H-B l3-akw-a-07-0-U I .s 1 5.54 Down 1.32E-03

8 NCI CGAP Subδ Homo sapiens cDNA clone IMAGE:2735532 3, mRNA sequence

NM 0203 Homo sapiens retinoic acid induced 17 5.54 Down 4.18E-02

38 " (RAM 7), mRNA

NM _1784 Homo sapiens late cornified envelope 5.54 Down 2.54E-04

28 2A (LCE2A), mRNA

NM _0003 Homo sapiens cathepsin K 5.51 Down 3.51 E-04

96 (pycnodysostosis) (CTSK), mRNA

NM _0122 Homo sapiens midline 2 (MID2), 5.44 Down 7.12E-03

16 transcript variant 1 , mRNA

NM _0181 Homo sapiens hedgehog 5.43 Down 5.47E-02

94 acyltransferase (HHAT), mRNA AI094001 qa28aO3.s1 Soares NhHMPu SI 5.4 Down 6.62E-05 Homo sapiens cDNA clone IMAGE: 1688044 3, mRNA sequence NM 0013 Homo sapiens diacylglycerol kinase, 5.38 Down 5.34E-02 45 alpha 8OkDa (DGKA), transcript variant 3, mRNA

BC013982 Homo sapiens kelch repeat and BTB 5.37 Down 1.47E-03 (POZ) domain containing 9, mRNA (cDNA clone IMAGE:3139043), partial cds

NM 0145 Homo sapiens tropomodulin 2 5.37 Down 3.65E-03 48 (neuronal) (TMOD2), mRNA

NM 0335 Homo sapiens beta-casein-like protein 5.35 Down 4.44E-03 04 (BCLP), mRNA

NM 0245 Homo sapiens hypothetical protein 5.34 Down 9.53E-03 63 FLJ14054 (FLJ14054), mRNA

H53728 yu38gO9.s1 Soares ovary tumor 5.33 Down 5.43E-04

NbHOT Homo sapiens cDNA clone

IMAGE:236128 3, mRNA sequence

NM 0060 Homo sapiens Cbp/p300-interacting 5.3 Down 1.96E-02

79 transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), mRNA

NM_1449 Homo sapiens cadherin-like 24 5.28 Down 5.25E-03

85 (CDH24), mRNA

NM 0181 Homo sapiens anthrax toxin receptor 1 5.28 Down 7.71 E-03

53 (ANTXR1 ), transcript variant 3, mRNA

BX1 16071 BX1 16071 5.28 Down 1.37E-03

Soares pregnant uterus NbHPU Homo sapiens cDNA clone IMAGp998L201 165 ; IMAGE:489763, mRNA sequence AK093903 Homo sapiens cDNA FLJ36584 fis, 5.26 Down 1.26E-02 clone TRACH2013450 NM 0059 Homo sapiens mitogen-activated 5.26 Down 2.95E-03 23 protein kinase kinase kinase 5

(MAP3K5), mRNA

NM 0229 Homo sapiens NDRG family member 5.26 Down 6.35E-05 10 4 (NDRG4), mRNA

CA414847 UI-H-EZ0-bar-b-22-0-Ul.s1 5.25 Down 6.08E-05

NCI CGAP ChI Homo sapiens cDNA clone UI-H-EZ0-bar-b-22-0-UI 3, mRNA sequence

NM 0063 Homo sapiens heat shock 27kDa 5.25 Down 4.21 E-04 08 protein 3 (HSPB3), mRNA

NM_0145 Homo sapiens solute carrier family 2, 5.23 Down 1.49E-03

80 (facilitated glucose transporter) member 8 (SLC2A8), mRNA

NM 0024 Homo sapiens matrix 5.21 Down 7.77E-06

26 metalloproteinase 12 (macrophage elastase) (MMP12), mRNA

N36786 yy34eO8.s1 Soares melanocyte 5.2 Down 5.21E-03

2NbHM Homo sapiens cDNA clone IMAGE:273158 3 similar to contains element MSR1 repetitive element ;, mRNA sequence

NM OOOO Homo sapiens adrenergic, beta-2-, 5.18 Down 2.86E-03 24 receptor, surface (ADRB2), mRNA

NM _0025 Homo sapiens olfactory receptor, 5.16 Down 3.30E-04

50 family 3, subfamily A, member 1

(OR3A1 ), mRNA

NM 0252 Homo sapiens pre-B-cell leukemia 5.16 Down 1.58E-03

45 " transcription factor 4 (PBX4), mRNA

NM 1529 Homo sapiens sperm antigen 5.15 Down 3.45E-04

04 " HCMOGT-1 (HCMOGT-1 ), mRNA

AK074181 Homo sapiens mRNA for FLJ00254 5.15 Down 3.92E-04 protein

NM 0153 Homo sapiens neural proliferation, 5.14 Down 2.65E-04

92 " differentiation and control, 1 (NPDC1 ), mRNA

NM _0043 Homo sapiens collagen, type XII, 5.14 Down 1.03E-02

70 alpha 1 (COL12A1 ), transcript variant long, mRNA

NM 0020 Homo sapiens glypican 1 (GPC1 ), 5.1 Down 2.09E-02

81 " mRNA

NM _1527 Homo sapiens hypothetical protein 5.1 Down 1.20E-02

37 MGC33993 (MGC33993), mRNA

NM _0051 Homo sapiens CCAAT/enhancer 5.1 Down 5.01 E-02

94 binding protein (C/EBP), beta


BF51121 1 UI-H-BI4-aoi-e-11 -0-Ul.s1 5.1 Down 4.03E-04

NCI_CGAP_Sub8 Homo sapiens cDNA clone IMAGE:3085148 3, mRNA sequence

NM 0210 Homo sapiens calcium channel, 5.09 Down 2.73E-03

98 " voltage-dependent, alpha 1 H subunit

(CACNA1 H), transcript variant 1 , mRNA

NM 0161 Homo sapiens cerebral endothelial cell 5.09 Down 4.67E-02

74 " adhesion molecule 1 (CEECAM1 ), mRNA

NM 1758 Homo sapiens hypothetical protein 5.08 Down 1.48E-02

94 " FLJ33996 (FLJ33996), mRNA

NM 0061 Homo sapiens neurofilament, light 5.07 Down 4.67E-03

58 " polypeptide 68kDa (NEFL), mRNA

AI963999 wt87gO7.x1 NCI CGAP GC6 Homo 5.06 Down 1.79E-02 sapiens cDNA clone IMAGE:2514492

3, mRNA sequence

NM _0164 Homo sapiens CXXC finger 5 5.06 Down 5.14E-03

63 (CXXC5), mRNA

NM _0141 Homo sapiens FXYD domain 5.05 Down 4.29E-04

64 containing ion transport regulator 5

(FXYD5), transcript variant 2, mRNA

NM _0032 Homo sapiens intercellular adhesion 5.05 Down 7.50E-05

59 molecule 5, telencephalin (ICAM5), mRNA

NM 1828 Homo sapiens Rab 5.05 Down 5.13E-02

36 " geranylgeranyltransferase, alpha subunit (RABGGTA), transcript variant

1 , mRNA

NM 0212 Homo sapiens tumor protein p53 5.05 Down 2.22E-02

02 " inducible nuclear protein 2

(TP53INP2), mRNA

NM 0006 Homo sapiens bradykinin receptor B2 5.05 Down 3.80E-04 23 (BDKRB2), mRNA

NM 0041 Homo sapiens Fc fragment of IgE, 5.05 Down 9.41 E-04

06 high affinity I, receptor for; gamma polypeptide (FCER1 G), mRNA

NM 0140 Homo sapiens low density lipoprotein 5.04 Down 2.79E-02

45 receptor-related protein 10 (LRP10), mRNA

NM 0190 Homo sapiens roundabout homolog 4, 5.04 Down 6.43E-03

55 magic roundabout (Drosophila)


NM 0151 Homo sapiens ankyrin repeat domain 5.02 Down 2.21 E-02

58 15 (ANKRD15), transcript variant 1 , mRNA AK126467 Homo sapiens cDNA FLJ44503 fis, 5.01 Down 1.59E-03 clone UTERU3001158

NM 0180 Homo sapiens armadillo repeat 5.01 Down 4.71 E-04

76 containing 4 (ARMC4), mRNA


Gene Gene Name Average Direction adj. p- Identifier fold value change of CVPN003



NM 0314 Homo sapiens transmembrane 4 superfamily member 356.65 Up 2.12E-06

42 " 10 (TM4SF10), mRNA

NM _0151 Homo sapiens sulfatase 1 (SULF1 ), mRNA 279.25 Up 5.34E-06


NM _0189 Homo sapiens major histocompatibility complex, class 220.37 Up 8.64E-06

50 I, F (HLA-F), mRNA

NM _0018 Homo sapiens cytochrome c oxidase subunit Vila 143.55 Up 1 .35E-05

64 polypeptide 1 (muscle) (COX7A1 ), mRNA

AA555266 nlO8fO7.s1 NCI CGAP Pr1 1 Homo sapiens cDNA 123.14 Up 9.58E-06 clone IMAGE:1029733, mRNA sequence

NM _0037 Homo sapiens UDP-Gal:betaGlcNAc beta 1 ,3- 120.58 Up 2.91 E-06

83 galactosyltransferase, polypeptide 2 (B3GALT2), mRNA

NM _2058 Homo sapiens HWKM1940 (UNQ1940), mRNA 1 1 1 .2 Up 1.15E-05


NM _0121 Homo sapiens beta-site APP-cleaving enzyme 2 101.56 Up 1 .22E-05

05 (BACE2), transcript variant a, mRNA

BM98833 UI-H-DH0-asd-f-10-0-Ul.s1 NCI_CGAP_DH0 Homo 93.31 Up 9.57E-06

8 sapiens cDNA clone IMAGE:5857545 3, mRNA sequence

NM 0024 Homo sapiens matrix metalloproteinase 3 86.78 Up 4.29E-06

22 " (stromelysin 1 , progelatinase) (MMP3), mRNA

BM08380 imageqc_6_2000/sjp216bdff41 .x1 82.18 Up 1.13E-05

8 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:3523891 3, mRNA sequence

NM 0309 Homo sapiens likely ortholog of mouse limb-bud and 81 .29 Up 2.91 E-06

15 " heart gene (LBH), mRNA

NM 1389 Homo sapiens neurexin 3 (NRXN3), transcript variant 77.85 Up 1.65E-05

70 " beta, mRNA

NM 0142 Homo sapiens potassium channel, subfamily K, 75.03 Up 1.06E-04

17 " member 2 (KCNK2), mRNA

NM 1532 Homo sapiens MAM domain containing 2 (MAMDC2), 75 Up 3.97E-06

67 " mRNA

NM 0003 Homo sapiens cathepsin K (pycnodysostosis) 66.04 Up 1.39E-04

96 " (CTSK), mRNA

NM 0018 Homo sapiens crystallin, alpha B (CRYAB), mRNA 65.54 Up 5.90E-05

85 "

NM _0014 Homo sapiens fatty acid binding protein 4, adipocyte 62.57 Up 1.15E-05

42 (FABP4), mRNA

BQ02035 UI-H-ED0-axk-p-07-0-Ul.s1 NCI_CGAP_ED0 Homo 62.53 Up 1.08E-05

7 sapiens cDNA clone IMAGE:5830134 3, mRNA sequence

NM 0027 Homo sapiens protease, serine, 1 1 (IGF binding) 62.08 UD 2.89E-06

75 " (PRSS11 ), mRNA NM 0032 Homo sapiens transcription factor AP-2 gamma 61 .89 Up 1.58E-04 22 (activating enhancer binding protein 2 gamma)


NM_0054 Homo sapiens synuclein, alpha interacting protein 57.99 Up 3.80E-06 60 (synphilin) (SNCAIP), mRNA

N39736 yx92gO4.r1 Soares melanocyte 2NbHM Homo 56.99 Up 1.17E-05 sapiens cDNA clone IMAGE:269238 5 similar to gb:S45630 ALPHA CRYSTALLIN B CHAIN

(HUMAN);, mRNA sequence NM 0248 Homo sapiens hypothetical protein FLJ23554 56.22 Up 8.64E-06

06 (FLJ23554), transcript variant 1 , mRNA W38393 zb15cO7.r1 Soares_fetal_lung_NbHL19W Homo 55.72 Up 2.40E-05 sapiens cDNA clone IMAGE:302124 5, mRNA sequence NM 0021 Homo sapiens inhibin, beta B (activin AB beta 53.05 Up 2.13E-05

93 polypeptide) (INHBB), mRNA

NM 0154 Homo sapiens olfactomedin-like 2B (OLFML2B), 51 .61 Up 7.73E-06

41 mRNA

NM_0053 Homo sapiens neurofilament 3 (15OkDa medium) 49.62 Up 2.88E-06

82 (NEF3), mRNA

NM 0015 Homo sapiens heat shock 27kDa protein 2 (HSPB2), 48.83 Up 8.64E-06

41 mRNA

NM 0008 Homo sapiens 5-hydroxytryptamine (serotonin) 48.69 Up 4.58E-06

66 receptor 1 F (HTR1 F), mRNA

BC035656 Homo sapiens hypothetical protein LOC285835, 48.66 Up 4.28E-05 mRNA (cDNA clone IMAGE:5588650), partial cds NM_0059 Homo sapiens matrix metalloproteinase 1 1 45.65 Up 3.16E-04 40 (stromelysin 3) (MMP1 1 ), mRNA

NM 0050 Homo sapiens tumor necrosis factor (ligand) 42.54 Up 2.29E-05 92 superfamily, member 18 (TNFSF18), mRNA

AA977908 oq62c08.s1 NCI_CGAP_Kid6 Homo sapiens cDNA 41 .83 Up 4.01 E-05 clone IMAGE:1590926 3 similar to gb:X17360_rna1

HOMEOBOX PROTEIN HOX-D4 (HUMAN);, mRNA sequence AI306848 qw70c01 .x1 NCI_CGAP_Ov33 Homo sapiens cDNA 41.4 Up 5.75E-05 clone IMAGE:1996416 3, mRNA sequence Y10255 H.sapiens mRNA for mammary-derived growth 39.19 Up 4.38E-05 inhibitor (MDGI) BC070085 Homo sapiens colony stimulating factor 2 receptor, 35.64 Up 7.89E-06 beta, low-affinity (granulocyte-macrophage), mRNA

(cDNA clone MGC:87425 IMAGE:30344148), complete cds

NM_1828 Homo sapiens amiloride-sensitive cation channel 4, 35.54 Up 8.77E-05 47 pituitary (ACCN4), transcript variant 2, mRNA

BF871 1 19 CM0-ET0121 -31 1000-658-h12 ET0121 Homo 34.78 Up 1.04E-05 sapiens cDNA, mRNA sequence NM_0034 Homo sapiens dysferlin, limb girdle muscular 34.4 Up 2.05E-05

94 dystrophy 2B (autosomal recessive) (DYSF), mRNA NM_0042 Homo sapiens natural killer cell transcript 4 (NK4), 33.95 Up 2.86E-05 21 mRNA

NM 1527 Homo sapiens hypothetical protein MGC33993 33.88 Up 2.14E-05

37 (MGC33993), mRNA

AW04464 wy78eO9.x1 Soares_NSF_F8_9W_OT_PA_P_S1 33.59 Up 1.90E-05

7 Homo sapiens cDNA clone IMAGE:2554696 3, mRNA sequence

AI422199 tf58dO4.x1 NCI_CGAP_Brn23 Homo sapiens cDNA 32.3 UD 1 .49E-05 clone IMAGE:2103463 3, mRNA sequence AF131813 Homo sapiens clone 24970 mRNA sequence 31.56 Up 2.89E-06

H 15096 ym29e1 1.r1 Soares infant brain 1 NIB Homo sapiens 30.77 Up 1.48E-04 cDNA clone IMAGE:49250 5, mRNA sequence

NM _0009 Homo sapiens prostaglandin-endoperoxide synthase 30.72 Up 5.45E-05

62 1 (prostaglandin G/H synthase and cyclooxygenase)

(PTGS1 ), transcript variant 1 , mRNA

NM 0008 Homo sapiens 5-hydroxytryptamine (serotonin) 30.64 Up 8.50E-05

67 " receptor 2B (HTR2B), mRNA

F24802 HSPD11400 HM3 Homo sapiens cDNA clone 30.52 Up 4.58E-06

S4000019H08, mRNA sequence

NM 0323 Homo sapiens chromosome 9 open reading frame 30.39 Up 7.72E-05

42 " 125 (C9orf125), mRNA

NM 1530 Homo sapiens prickle-like 1 (Drosophila) 30.34 Up 1.75E-05

26 " (PRICKLE1 ), mRNA

NM 0018 Homo sapiens carboxypeptidase M (CPM), transcript 30.26 Up 7.72E-05

74 " variant 1 , mRNA

NM 0051 Homo sapiens actin, alpha, cardiac muscle (ACTC), 29.68 Up 3.80E-06

59 " mRNA

NM _0029 Homo sapiens syndecan 2 (heparan sulfate 27.28 Up 3.09E-05

98 proteoglycan 1 , cell surface-associated, fibroglycan)

(SDC2), mRNA

NM 0322 Homo sapiens hypothetical protein DKFZp761 D221 27.16 Up 2.89E-06

91 " (DKFZp761 D221 ), mRNA

NM 0058 Homo sapiens receptor (calcitonin) activity modifying 27 Up 3.09E-05

55 " protein 1 (RAMP1 ), mRNA

NM 0026 Homo sapiens phospholamban (PLN), mRNA 26.43 Up 2.84E-05

67 "

NM _0021 Homo sapiens homeo box B5 (HOXB5), mRNA 26.07 Up 6.48E-05


NM _0528 Homo sapiens protein kinase substrate MK2S4 25.87 Up 3.80E-06

62 (MK2S4), mRNA

NM _1522 Homo sapiens gap junction protein, chi 1 , 31.9kDa 24.78 Up 1.74E-04

19 (connexin 31 .9) (GJC1 ), mRNA

NM _0049 Homo sapiens potassium inwardly-rectifying channel, 24.74 Up 1.15E-05

82 subfamily J, member 8 (KCNJ8), mRNA

AK023647 Homo sapiens cDNA FLJ13585 fis, clone 24.08 Up 2.92E-05

PLACE 1009150

NM _0145 Homo sapiens zinc ribbon domain containing, 1 23.89 Up 9.89E-06

96 (ZNRD1 ), transcript variant b, mRNA

NM _0245 Homo sapiens hypothetical protein FLJ23221 23.55 Up 1.94E-05

79 (FLJ23221 ), mRNA

NM 0179 Homo sapiens hypothetical protein FLJ20643 23.52 Up 1.32E-03

16 " (FLJ20643), mRNA

NM 1450 Homo sapiens sushi domain containing 3 (SUSD3), 23.46 Up 2.65E-06

06 " mRNA

AK056155 Homo sapiens cDNA FLJ31593 fis, clone 22.85 Up 2.29E-05

NT2R 12002481

AI244755 qj97gO9.x1 NCI_CGAP_Kid3 Homo sapiens cDNA 22.71 Up 7.08E-06 clone IMAGE:1867456 3 similar to gb:M30496


ISOZYME L3 (HUMAN);, mRNA sequence

NM 0019 Homo sapiens endothelin receptor type A (EDNRA), 22.1 1 Up 2.84E-05

57 " mRNA

NM 0143 Homo sapiens lysosomal-associated membrane 22.06 Up 5.71 E-05

98 " protein 3 (LAMP3), mRNA

CA414847 UI-H-EZ0-bar-b-22-0-Ul.s1 NCI CGAP ChI Homo 21 .97 Up 1.75E-05 sapiens cDNA clone UI-H-EZ0-bar-b-22-0-UI 3, mRNA sequence

NM _0153 Homo sapiens dishevelled associated activator of 21 .93 Up 7.73E-06

45 morphogenesis 2 (DAAM2), mRNA

AK026301 Homo sapiens cDNA: FLJ22648 fis, clone HSI07329 21.72 Up 9.58E-06

NM _0021 Homo sapiens homeo box B5 (HOXB5), mRNA 21.17 Up 1 .54E-04


BX486208 DKFZp686J07250_r1 686 (synonym: hlcc3) Homo 20.95 Up 3.76E-05 sapiens cDNA clone DKFZp686J07250 5, mRNA sequence

NM 0183 Homo sapiens leucine rich repeat neuronal 3 20.71 Up 7.75E-05

34 " (LRRN3), mRNA

NM 0017 Homo sapiens biglycan (BGN), mRNA 20.66 Up 1.68E-04

11 "

BG62270 602647476F1 NIH_MGC_79 Homo sapiens cDNA 20.62 Up 2.78E-05

7 clone IMAGE:4768963 5, mRNA sequence

NM _0005 Homo sapiens renin (REN), mRNA 20.42 Up 1.93E-05


NM _0224 Homo sapiens thiamin pyrophosphokinase 1 (TPK1 ), 20.25 Up 2.07E-05

45 mRNA

NM _0017 Homo sapiens brain-specific angiogenesis inhibitor 3 20.23 Up 2.65E-06

04 (BAI3), mRNA

NM _0070 Homo sapiens a disintegrin-like and metalloprotease 20.06 Up 3.53E-05

38 (reprolysin type) with thrombospondin type 1 motif, 5

(aggrecanase-2) (ADAMTS5), mRNA

NM 0028 Homo sapiens retinol binding protein 1 , cellular 19.99 Up 4.35E-05

99 " (RBP1 ), mRNA

BCO 14560 Homo sapiens Ly6/neurotoxin 1 , mRNA (cDNA clone 19.84 Up 3.56E-05


NM _0191 Homo sapiens homeo box A5 (HOXA5), mRNA 19.59 Up 3.17E-05


NM _0014 Homo sapiens gastrulation brain homeo box 2 19.4 Up 1 .04E-05

85 (GBX2), mRNA

NM _0145 Homo sapiens UDP-N-acetyl-alpha-D- 19.26 Up 1.97E-04

68 galactosamine:polypeptide N- acetylgalactosaminyltransferase 5 (GalNAc-T5)


NM _0025 Homo sapiens phosphodiesterase 2A, cGMP- 19.18 Up 3.20E-05

99 stimulated (PDE2A), mRNA

NM _0041 Homo sapiens solute carrier family 1 (glial high affinity 18.84 Up 1.78E-05

71 glutamate transporter), member 2 (SLC1 A2), mRNA

AK023104 Homo sapiens cDNA FLJ13042 fis, clone 18.77 Up 2.06E-05


Al 183970 qd69fO2.x1 Soares testis NHT Homo sapiens cDNA 18.73 Up 2.79E-05 clone IMAGE:1734747 3, mRNA sequence

NM 0162 Homo sapiens dehydrogenase/reductase (SDR 18.6 Up 2.33E-04

46 " family) member 10 (DHRS10), mRNA

CB135276 K-EST0187371 L5HLK1 Homo sapiens cDNA clone 18.49 Up 2.1 1 E-05

L5HLK1-32-B12 5, mRNA sequence

NM 0158 Homo sapiens solute carrier family 14 (urea 18.46 Up 2.07E-05

65 " transporter), member 1 (Kidd blood group)

(SLC14A1 ), mRNA

AW29683 UI-H-BI2-ahz-a-10-0-Ul.s1 NCI_CGAP_Sub4 Homo 18.44 Up 2.84E-05

4 sapiens cDNA clone IMAGE:2728243 3, mRNA sequence

NM _0528 Homo sapiens peptidoglycan recognition protein 2 18.43 Up 1.46E-05

90 (PGLYRP2), mRNA

NM 0322 Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA 18.39 Up 1.17E-05 11

NM 0245 Homo sapiens homeo box D1 (HOXD1 ), mRNA 18.12 Up 1.79E-05


BM71 192 UI-E-CLI -afc-m-16-O-UI.M UI-E-CL1 Homo sapiens 18.07 Up 4.24E-05

3 cDNA clone UI-E-CLI -afc-m-16-O-UI 5, mRNA sequence

AB028949 Homo sapiens mRNA for KIAA1026 protein, partial 17.52 Up 1.22E-05 cds

AW20518 UI-H-BI1 -aeo-c-02-0-Ul.s1 NCI_CGAP_Sub3 Homo 17.34 Up 1.54E-04

0 sapiens cDNA clone I MAG E :2719874 3, mRNA sequence

NM _0181 Homo sapiens nudix (nucleoside diphosphate linked 17.19 Up 9.89E-06

59 moiety X)-type motif 1 1 (NUDT1 1 ), mRNA

NM _0248 Homo sapiens brain and acute leukemia, cytoplasmic 17.18 Up 1.95E-05

12 (BAALC), mRNA

NM 1758 Homo sapiens hypothetical protein FLJ33996 17.18 Up 1.29E-04

94 " (FLJ33996), mRNA

NM 0007 Homo sapiens cytochrome P450, family 27, subfamily 16.6 Up 4.72E-05

84 " A, polypeptide 1 (CYP27A1 ), nuclear gene encoding mitochondrial protein, mRNA

NM _0063 Homo sapiens interferon, gamma-inducible protein 30 16.44 Up 1.63E-05

32 (IFI30), mRNA

NM _0140 Homo sapiens response gene to complement 32 16.39 Up 8.13E-05

59 (RGC32), mRNA

NM _0005 Homo sapiens coagulation factor X (F10), mRNA 16.39 Up 9.53E-05


NM _0212 Homo sapiens netrin 4 (NTN4), mRNA 16.31 Up 2.13E-03


AI493349 tg70f04.x1 Soares NhHMPu SI Homo sapiens 16.23 Up 3.08E-05 cDNA clone IMAGE:21 14143 3, mRNA sequence

NM 1450 Homo sapiens BXMAS2-10 (BXMAS2-10), mRNA 16.13 Up 2.98E-05

16 "

NM 0142 Homo sapiens a disintegrin-like and metalloprotease 16.08 Up 7.96E-06

44 " (reprolysin type) with thrombospondin type 1 motif, 2

(ADAMTS2), transcript variant 1 , mRNA

N47877 yy95hO9.s1 Soares_multiple_sclerosis_2NbHMSP 15.92 Up 1.32E-05

Homo sapiens cDNA clone IMAGE:281345 3, mRNA sequence

ABO 18270 Homo sapiens mRNA for KIAA0727 protein, partial 15.84 Up 2.73E-04 cds

NM 0227 Homo sapiens elongation of very long chain fatty 15.82 Up 1.75E-05 26 acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4


NM_0024 Homo sapiens matrix metalloproteinase 1 (interstitial 15.74 Up 5.47E-05

21 collagenase) (MMP1 ), mRNA

NM 0037 Homo sapiens phospholipase A2, group IVC 15.55 Up 1.93E-05

06 (cytosolic, calcium-independent) (PLA2G4C), mRNA

BQ71696 AGENCOURT 8241241 Lupski sympathetic trunk 15.47 Up 2.13E-05

5 Homo sapiens cDNA clone I MAG E :6187020 5, mRNA sequence

NM_0165 Homo sapiens neurotrimin (HNT), mRNA 15.44 Up 7.02E-05


CA942841 ir64cO8.y1 HR85 islet Homo sapiens cDNA clone 15.39 Up 5.34E-06 IMAGE:6607287 5, mRNA sequence

NM 0175 Homo sapiens XIAP associated factor-1 15.29 Up 1.05E-04

23 (HSXIAPAF1 ), transcript variant 1 , mRNA

AA740724 ny98cO7.s1 NCI CGAP GCB1 Homo sapiens cDNA 15.16 Up 1.75E-05 clone I MAGE: 1286316 3, mRNA sequence NM 0017 Homo sapiens calbindin 2, 29kDa (calretinin) 15.1 1 Up 1.16E-05 40 (CALB2), transcript variant CALB2, mRNA

NM 0165 Homo sapiens neurotrimin (HNT), mRNA 15.1 Up 3.55E-05 22

NM 0144 Homo sapiens ribosomal protein S6 kinase, 9OkDa, 15.06 Up 2.58E-05 96 polypeptide 6 (RPS6KA6), mRNA

AW89791 RC3-NN0064-090500-021 -f03 NN0064 Homo 15.02 Up 4.35E-05 2 sapiens cDNA, mRNA sequence

NM_0161 Homo sapiens transient receptor potential cation 14.97 Up 2.07E-05 79 channel, subfamily C, member 4 (TRPC4), mRNA

AK095156 Homo sapiens cDNA FLJ37837 fis, clone 14.87 Up 1.93E-05


BQ18310 UI-H-EU0-azs-c-22-0-Ul.s1 NCI_CGAP_Car1 Homo 14.83 Up 1.21 E-04 8 sapiens cDNA clone IMAGE:5852877 3, mRNA sequence

NM_1983 Homo sapiens calcium channel, voltage-dependent, 14.65 Up 2.91 E-06 83 alpha 1 G subunit (CACNA1 G), transcript variant 6, mRNA AK024261 Homo sapiens cDNA FLJ14199 fis, clone 14.61 Up 7.84E-05


AK058012 Homo sapiens cDNA FLJ25283 fis, clone STM06716 14.46 Up 1.48E-05 NM 1389 Homo sapiens neuropilin (NRP) and tolloid (TLL)-like 14.45 Up 2.42E-04 66 1 (NETO1 ), transcript variant 3, mRNA

AK091337 Homo sapiens cDNA FLJ34018 fis, clone 14.29 Up 2.55E-04


NM 0040 Homo sapiens empty spiracles homolog 2 14.26 Up 2.22E-05 98 (Drosophila) (EMX2), mRNA

BX640893 Homo sapiens mRNA; cDNA DKFZp686P15248 (from 14.18 Up 1.90E-05 clone DKFZp686P15248)

AK074181 Homo sapiens mRNA for FLJ00254 protein 14.09 Up 2.05E-05 NM_1815 Homo sapiens phosphoinositide-3-kinase, regulatory 14.06 Up 4.77E-05 23 subunit 1 (p85 alpha) (PIK3R1 ), transcript variant 1 , mRNA AI270582 qu89e12.x1 NCI_CGAP_Gas4 Homo sapiens cDNA 14 Up 4.38E-05 clone IMAGE:1979278 3, mRNA sequence NM 0329 Homo sapiens regulator of telomere elongation 13.94 Up 5.79E-05 57 helicase 1 (RTEL1 ), transcript variant 2, mRNA

W94546 zeO4bO5.s1 Soares_fetal_heart_NbHH19W Homo 13.92 Up 1.32E-05 sapiens cDNA clone IMAGE:357969 3, mRNA sequence H79930 yu10h08.r1 Soares fetal liver spleen 1 NFLS Homo 13.89 Up 3.80E-05 sapiens cDNA clone IMAGE:233439 5 similar to gb:M57710 GALECTIN-3 (HUMAN);, mRNA sequence

NM 0028 Homo sapiens retinoic acid receptor responder 13.84 Up 4.00E-05 89 (tazarotene induced) 2 (RARRES2), mRNA

NM_0321 Homo sapiens solute carrier family 41 , member 2 13.84 Up 2.07E-05 48 (SLC41A2), mRNA

NM 0327 Homo sapiens chromosome 9 open reading frame 67 13.77 Up 2.22E-05 28 (C9orf67), mRNA

BE378852 601237381 F1 NIH_MGC_44 Homo sapiens cDNA 13.77 Up 2.18E-04 clone IMAGE:3609140 5, mRNA sequence AU 62013 Homo sapiens mRNA; cDNA DKFZp761 P19121 (from 13.65 Up 6.71 E-05 clone DKFZp761 P19121 ); partial cds NM 0210 Homo sapiens keratin, hair, acidic, 4 (KRTHA4), 13.64 Up 1.68E-05 13 mRNA NM_0161 Homo sapiens plasma glutamate carboxypeptidase 13.59 Up 4.45E-04 34 (PGCP), mRNA

AW29413 UI-H-BI2-ahg-f-04-0-Ul.s1 NCI_CGAP_Sub4 Homo 13.58 Up 2.38E-05 8 sapiens cDNA clone IMAGE:2726910 3, mRNA sequence BM92935 UI-E-EJ1 -aje-o-19-0-UI.M UI-E-EJ1 Homo sapiens 13.52 Up 7.98E-05

4 cDNA clone UI-E-EJ1-aje-o-19-0-UI 5, mRNA sequence

NM_2033 Homo sapiens similar to RIKEN cDNA 6530418L21 13.49 Up 3.56E-05

70 (LOC389119), mRNA

NM 0069 Homo sapiens pregnancy specific beta-1 -glycoprotein 13.43 Up 3.93E-05

05 1 (PSG1 ), mRNA

BE7351 15 601566084F1 NIH_MGC_21 Homo sapiens cDNA 13.32 Up 3.09E-05 clone IMAGE:3840837 5, mRNA sequence BU621565 UI-H-FL1 -bga-o-06-0-Ul.s1 NCI_CGAP_FL1 Homo 13.25 Up 2.43E-05 sapiens cDNA clone UI-H-FL1 -bga-o-06-0-UI 3, mRNA sequence

NM 0030 Homo sapiens secretory granule, neuroendocrine 13.24 Up 4.45E-05

20 protein 1 (7B2 protein) (SGNE1 ), mRNA

NM 0042 Homo sapiens phosphatidylinositol glycan, class Q 13.2 Up 6.34E-05

04 (PIGQ), transcript variant 2, mRNA

NM_0047 Homo sapiens diacylglycerol kinase, iota (DGKI), 13.18 Up 4.28E-05

17 mRNA

NM_0332 Homo sapiens tumor protein p53 inducible nuclear 13.1 Up 1 .79E-05

85 protein 1 (TP53INP1 ), mRNA

NM_0059 Homo sapiens sine oculis homeobox homolog 1 12.95 Up 2.45E-05

82 (Drosophila) (SIX1 ), mRNA

NM_0014 Homo sapiens forkhead box C1 (FOXC1 ), mRNA 12.93 Up 1.64E-04


NM_0188 Homo sapiens transmembrane protein SHREW1 12.83 Up 4.72E-05

36 (SHREW1 ), mRNA

NM_001 1 Homo sapiens angiopoietin 2 (ANGPT2), mRNA 12.82 Up 7.84E-05


NM 1721 Homo sapiens potassium voltage-gated channel, 12.75 Up 3.92E-05

60 shaker-related subfamily, beta member 1 (KCNAB1 ), transcript variant 1 , mRNA

NM 1532 Homo sapiens hypothetical protein FLJ37440 12.67 Up 6.55E-05 14 (FLJ37440), mRNA

AA195328 zr34fO8.s1 Soares NhHMPu SI Homo sapiens 12.64 Up 9.31 E-06 cDNA clone IMAGE:665319 3, mRNA sequence AL833547 Homo sapiens mRNA; cDNA DKFZp686M023 (from 12.63 Up 1.04E-05 clone DKFZp686M023)

NM 0176 Homo sapiens asporin (LRR class 1 ) (ASPN), mRNA 12.61 Up 1.17E-05 80 N28812 yx71 b12.r1 Soares melanocyte 2NbHM Homo 12.49 Up 2.84E-05 sapiens cDNA clone IMAGE:267167 5, mRNA sequence BC018891 Homo sapiens FERM domain containing 4A, mRNA 12.42 Up 1.04E-05

(cDNA clone I MAG E: 3954440), partial cds

NM_0035 Homo sapiens histone 2, H2be (HIST2H2BE), mRNA 12.32 Up 7.18E-06


AF269162 Homo sapiens c21orf7 form B mRNA, complete cds 12.29 Up 1 .75E-04

NM_0036 Homo sapiens protease, serine, 12 (neurotrypsin, 12.28 Up 3.43E-05

19 motopsin) (PRSS12), mRNA

NM 0226 Homo sapiens extracellular matrix protein 1 (ECM1 ), 12.1 Up 6.39E-04

64 transcript variant 2, mRNA

NM 0032 Homo sapiens transcription factor AP-2 gamma 1 1.94 Up 4.34E-06 22 (activating enhancer binding protein 2 gamma)


NM 1982 Homo sapiens Nance-Horan syndrome (congenital 11.93Up 2.07E-05 70 cataracts and dental anomalies) (NHS), mRNA

NM_0331 Homo sapiens Zic family member 5 (odd-paired 11.89Up 1.90E-05 32 homolog, Drosophila) (ZIC5), mRNA

D61994 HUM230A04B Clontech human aorta polyA+ mRNA 11.77Up 2.54E-05

(#6572) Homo sapiens cDNA clone GEN-230A045, mRNA sequence

NM 0169 Homo sapiens NADPH oxidase 4 (NOX4), mRNA 11.71 Up 5.75E-06 31 AL137698 Homo sapiens mRNA; cDNA DKFZp434C1915 (from 11.67Up 6.32E-05 clone DKFZp434C1915); partial cds

NM 0065 Homo sapiens KH domain containing, RNA binding, 11.64 Up 2.14E-05 58 signal transduction associated 3 (KHDRBS3), mRNA

NM 1527 Homo sapiens chromosome 7 open reading frame 6 11.6 Up 2.35E-05

03 (C7orf6), mRNA

NM 0060 Homo sapiens tripartite motif-containing 22 (TRIM22), 11.46 Up 3.69E-05

74 mRNA

NM 0028 Homo sapiens proteasome (prosome, macropain) 11.37Up 6.55E-05

00 subunit, beta type, 9 (large multifunctional protease 2) (PSMB9), transcript variant 1, mRNA

BU624020 UI-H-FG1-bgh-h-24-0-Ul.s1 NCI CGAP FG1 Homo 11.36Up 1.04E-05 sapiens cDNA clone UI-H-FG1-bgh-h-24-0-UI 3, mRNA sequence

NM 0067 Homo sapiens macrophage receptor with collagenous 11.31 Up 2.83E-05

70 structure (MARCO), mRNA

NM_0015 Homo sapiens major histocompatibility complex, class 11.22Up 8.18E-05

31 l-related(MRI), mRNA

AK125888 Homo sapiens cDNA FLJ43900 fis, clone 11.2Up 7.25E-05 TESTI4009973

NM 0041 Homo sapiens coagulation factor Il (thrombin) 11.17Up 9.15E-05

01 receptor-like 2 (F2RL2), mRNA

BX647688 Homo sapiens mRNA; cDNA DKFZp779C093 (from 11.12Up 7.60E-06 clone DKFZp779C093) BF104950601822703F1 N IH MGC 75 Homo sapiens cDNA 11.09Up 7.89E-06 clone IMAGE:40454405, mRNA sequence BX104513 BX104513 NCI_CGAP_Co9 Homo sapiens cDNA 11.06Up 3.22E-04 clone IMAGp998B192690 ; IMAGE:1075122, mRNA sequence

Y09980 H.sapiens HOXD3 gene 11.03Up 2.17E-06 BM99323 UI-H-DT0-aty-n-22-0-Ul.s1 NCI_CGAP_DT0 Homo 10.99Up 2.11E-03

4 sapiens cDNA clone IMAGE:58661973, mRNA sequence

BC035066 Homo sapiens, clone IMAGE:5259543, mRNA 10.98Up 2.32E-05 NM 0145 Homo sapiens tropomodulin 2 (neuronal) (TMOD2), 10.96Up 2.32E-05 48 mRNA

BC050602 Homo sapiens histone 1, H2ac, mRNA (cDNA clone 10.94Up 8.18E-05

MGC:60051 IMAGE:6526471), complete cds BF696790602125323F1 N IH_MGC_56 Homo sapiens cDNA 10.9Up 6.78E-05 clone IMAGE:42825405, mRNA sequence BX538309 Homo sapiens mRNA; cDNA DKFZp686C09130 10.78Up 1.15E-05

(from clone DKFZp686C09130) BE297167601177587F1 NIH MGC 17 Homo sapiens cDNA 10.74Up 2.12E-04 clone IMAGE:35329895, mRNA sequence NM 0021 Homo sapiens HLA-G histocompatibility antigen, 10.74Up 6.58E-04 27 class I, G (HLA-G), mRNA NM 0155 Homo sapiens monooxygenase, DBH-like 1 10.67 Up 1.04E-05

29 (MOXD1 ), mRNA

NM 0195 Homo sapiens homeo box D8 (HOXD8), mRNA 10.62 Up 2.35E-05


NM 0248 Homo sapiens hypothetical protein FLJ23506 10.54 Up 9.31 E-06

33 (FLJ23506), mRNA

AL080103 Homo sapiens mRNA; cDNA DKFZp564N2216 (from 10.47 Up 6.32E-05 clone DKFZp564N2216)

NM 0191 Homo sapiens protocadherin beta 9 (PCDHB9), 10.46 Up 6.92E-05 19 mRNA

NM_0048 Homo sapiens glia maturation factor, gamma 10.44 Up 3.15E-05 77 (GMFG), mRNA

NM_0219 Homo sapiens glutamate receptor, ionotropic, kainate 10.39 Up 4.34E-06 56 2 (GRIK2), transcript variant 1 , mRNA

W26490 30c8 Human retina cDNA randomly primed sublibrary 10.39 Up 8.02E-05

Homo sapiens cDNA, mRNA sequence NM 0201 Homo sapiens chromosome 8 open reading frame 4 10.35 Up 2.07E-05

30 (C8orf4), mRNA

AK128050 Homo sapiens cDNA FLJ46170 fis, clone 10.34 Up 3.30E-05

TESTI4003404 AL049443 Homo sapiens mRNA; cDNA DKFZp586N2020 (from 10.26 Up 9.46E-05 clone DKFZp586N2020) AK055518 Homo sapiens cDNA FLJ30956 fis, clone 10.26 Up 1.79E-05


NM 0055 Homo sapiens hydroxysteroid (1 1 -beta) 10.21 Up 5.37E-05 25 dehydrogenase 1 (HSD11 B1 ), transcript variant 1 , mRNA

NM 1942 Homo sapiens cardiomyopathy associated 1 10.16 Up 9.56E-05 93 (CMYA1 ), mRNA

BM99843 UI-H-DT1 -awc-p-06-0-Ul.s1 NCI_CGAP_DT1 Homo 10.13 Up 8.18E-05 2 sapiens cDNA clone IMAGE:5887733 3, mRNA sequence AK001007 Homo sapiens cDNA FLJ10145 fis, clone 9.95 Up 1 .32E-05


NM 0239 Homo sapiens hypothetical protein MGC3036 9.95 Up 2.37E-05 42 (MGC3036), mRNA

NM 0022 Homo sapiens KiSS-1 metastasis-suppressor 9.92 Up 7.64E-04 56 (KISS1 ), mRNA

AW45006 UI-H-BI3-akw-a-07-0-Ul.s1 NCI_CGAP_Sub5 Homo 9.89 Up 6.78E-05 8 sapiens cDNA clone IMAGE:2735532 3, mRNA sequence NM 0047 Homo sapiens solute carrier family 9 9.88 Up 9.56E-05

85 (sodium/hydrogen exchanger), isoform 3 regulator 2 (SLC9A3R2), mRNA

AL8331 19 Homo sapiens mRNA; cDNA DKFZp313A2432 (from 9.86 Up 8.18E-05 clone DKFZp313A2432)

NM_0024 Homo sapiens carcinoembryonic antigen-related cell 9.86 Up 1 .16E-05 83 adhesion molecule 6 (non-specific cross reacting antigen) (CEACAM6), mRNA

NM 0038 Homo sapiens harakiri, BCL2 interacting protein 9.84 Up 2.30E-04 06 (contains only BH3 domain) (HRK), mRNA

NM 0029 Homo sapiens regulator of G-protein signalling 7 9.77 Up 1 .80E-05 24 (RGS7), mRNA

NM 0050 Homo sapiens sarcospan (Kras oncogene-associated 9.69 Up 1 .90E-05

86 gene) (SSPN), mRNA

CD35739 AGENCOURTJ 4254689 NIH_MGC_187 Homo 9.66 Up 1 .14E-04 5 sapiens cDNA clone I MAG E: 30402102 5, mRNA sequence AI088183 oz97g01 .x1 Soares parathyroid tumor NbHPA 9.65 Up 7.48E-05

Homo sapiens cDNA clone IMAGE:1683312 3, mRNA sequence

NM 0055 Homo sapiens hydroxysteroid (1 1 -beta) 9.65 Up 5.30E-05 25 dehydrogenase 1 (HSD11 B1 ), transcript variant 1 , mRNA NM 0319 Homo sapiens C1 q and tumor necrosis factor related 9.64 Up 1 .15E-05

08 protein 2 (C1 QTNF2), mRNA

H49355 yq18d12.s1 Soa res fetal liver spleen 1 NFLS Homo 9.62 Up 1 .63E-04 sapiens cDNA clone IMAGE:274222 3, mRNA sequence

AK025015 Homo sapiens cDNA: FLJ21362 fis, clone COL02886 9.48 Up 6.39E-05 CA437861 UI-H-DH0-aur-k-12-0-Ul.s1 NCI_CGAP_DH0 Homo 9.46 Up 4.46E-05 sapiens cDNA clone UI-H-DH0-aur-k-12-0-UI 3, mRNA sequence

NM 1982 Homo sapiens Nance-Horan syndrome (congenital 9.45 Up 4.72E-04 70 cataracts and dental anomalies) (NHS), mRNA

BC013982 Homo sapiens kelch repeat and BTB (POZ) domain 9.38 Up 4.34E-05 containing 9, mRNA (cDNA clone IMAGE:3139043), partial cds

NM 0002 Homo sapiens MHC class I polypeptide-related 9.29 Up 1 .95E-05 47 sequence A (MICA), mRNA

BX1 17866 BX1 17866 NCI_CGAP_GCB1 Homo sapiens cDNA 9.27 Up 6.72E-04 clone IMAGp998N233105 ; IMAGE:1234774, mRNA sequence

NM 0251 Homo sapiens lymphocyte alpha-kinase (LAK), 9.27 Up 3.53E-05 44 mRNA

NM 0057 Homo sapiens calcitonin receptor-like (CALCRL), 9.27 Up 2.55E-05 95 mRNA

NM 0047 Homo sapiens like-glycosyltransferase (LARGE), 9.22 Up 8.72E-05 37 transcript variant 1 , mRNA

NM 0007 Homo sapiens glycoprotein hormones, alpha 9.2 Up 3.01 E-05 35 polypeptide (CGA), mRNA

NM_0065 Homo sapiens v-rel reticuloendotheliosis viral 9.19 Up 6.16E-05

09 oncogene homolog B, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 (avian) (RELB), mRNA

BM72582 UI-E-EJ0-aig-i-1 1-0-UI.r1 UI-E-EJO Homo sapiens 9.17 Up 4.16E-05 8 cDNA clone UI-E-EJ0-aig-i-1 1 -0-UI 5, mRNA sequence

NM 0023 Homo sapiens leptin receptor (LEPR), transcript 9.14 Up 1 .06E-04 03 variant 1 , mRNA

NM 0023 Homo sapiens actin binding LIM protein 1 (ABLIM1 ), 9.12 Up 5.95E-05 13 transcript variant 1 , mRNA

NM 0017 Homo sapiens CD1 C antigen, c polypeptide (CD1 C), 9.12 Up 1 .78E-05 65 mRNA

NM 0040 Homo sapiens cathepsin S (CTSS), mRNA 9.1 1 Up 6.48E-05 79 AK125453 Homo sapiens cDNA FLJ43464 fis, clone 9.03 Up 8.35E-05


NM 0309 Homo sapiens sialyltransferase 7 ((alpha-N- 9.01 Up 1 .03E-04 65 acetylneuraminyl-2,3-beta-galactosyl-1 ,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E


NM 0023 Homo sapiens lectin, galactoside-binding, soluble, 3 8.98 UD 2.41 E-04 06 (galectin 3) (LGALS3), mRNA N71963 yz95eO3.s1 Soares melanocyte 2NbHM Homo 8.91 Up 1.05E-04 sapiens cDNA clone IMAGE:290812 3 similar to contains AIu repetitive element;, mRNA sequence AK026195 Homo sapiens cDNA: FLJ22542 fis, clone HSI00196 8.77 Up 2.07E-05 BU619160 UI-H-FH1 -bfn-g-07-0-Ul.s1 NCI CGAP FH1 Homo 8.76 Up 1.32E-05 sapiens cDNA clone UI-H-FH1-bfn-g-07-0-UI 3, mRNA sequence AF211 169 Homo sapiens acid fibroblast growth factor-like 8.73 Up 1.05E-04 protein (GLIO703) mRNA, complete cds BC044843 Homo sapiens hypothetical protein LOC339535, 8.71 Up 3.23E-04 mRNA (cDNA clone IMAGE:5186761 ), partial cds CA308234 UI-H-FT1 -bib-p-18-0-Ul.s1 NCI_CGAP_FT1 Homo 8.65 Up 1.69E-05 sapiens cDNA clone UI-H-FT1 -bib-p-18-0-UI 3, mRNA sequence R56121 yg94dO4.s1 Soares infant brain 1 NIB Homo sapiens 8.64 Up 2.45E-05 cDNA clone IMAGE:41388 3, mRNA sequence NM 0161 Homo sapiens androgen-induced 1 (AIG1 ), mRNA 8.63 Up 3.20E-05 08 BF086707 CM4-GN0081 -160900-316-c1 1 GN0081 Homo 8.61 Up 4.09E-04 sapiens cDNA, mRNA sequence H99504 yx25gO5.s1 Soares melanocyte 2NbHM Homo 8.61 Up 9.56E-05 sapiens cDNA clone IMAGE:262808 3, mRNA sequence

NM 0529 Homo sapiens vestibule-1 protein (VEST1 ), mRNA 8.6 Up 1.27E-05 58

NM 0025 Homo sapiens serine (or cysteine) proteinase 8.6 Up 2.45E-05 75 inhibitor, clade B (ovalbumin), member 2

(SERPINB2), mRNA AK096708 Homo sapiens cDNA FLJ39389 fis, clone 8.49 Up 3.14E-04


NM 0048 Homo sapiens PTPL1 -associated RhoGAP 1 8.49 Up 8.99E-05 15 (PARG1 ), mRNA

NM_0150 Homo sapiens NEDD4-like ubiquitin-protein ligase 1 8.47 Up 4.95E-05

52 (NEDL1 ), mRNA

NM 0178 Homo sapiens Ras interacting protein 1 (RASIP1 ), 8.44 Up 9.90E-06

05 mRNA

NM 0327 Homo sapiens chromosome 10 open reading frame 8.38 Up 4.35E-05

09 33 (C10orf33), mRNA

NM_1523 Homo sapiens carnitine palmitoyltransferase 1 C 8.38 Up 6.08E-04

59 (CPT1 C), mRNA

BM71207 UI-E-DW1 -ahc-b-11 -0-Ul.r1 UI-E-DW1 Homo sapiens 8.28 Up 7.07E-05

2 cDNA clone UI-E-DW1 -ahc-b-1 1 -0-UI 5, mRNA sequence NM 0203 Homo sapiens phospholipid scramblase 4 (PLSCR4), 8.25 Up 1.11E-04

53 mRNA

AK096481 Homo sapiens cDNA FLJ39162 fis, clone 8.25 Up 2.79E-04


NM_1446 Homo sapiens heat shock protein, alpha-crystallin- 8.23 Up 1.08E-04 17 related, B6 (HSPB6), mRNA

NM_0044 Homo sapiens forkhead box E1 (thyroid transcription 8.22 Up 9.57E-06 73 factor 2) (FOXE 1 ), mRNA

NM 0179 Homo sapiens Ca2+-dependent activator protein for 8.2 Up 5.53E-05

54 secretion 2 (CADPS2), mRNA

AW19641 xm33cO6.x1 NCI CGAP GC6 Homo sapiens cDNA 8.15Up 1.36E-04 9 clone IMAGE:2685994 3, mRNA sequence

BE670922 7e43bO4.x1 NCI_CGAP_Lu24 Homo sapiens cDNA 8.12Up 1.48E-04 clone IMAGE:3285199 3, mRNA sequence NM 0323 Homo sapiens hypothetical protein MGC15619 8.09 Up 1.52E-04

69 (MGC15619), mRNA

AL832178 Homo sapiens mRNA; cDNA DKFZp686M1316 (from 8.08 Up 2.72E-03 clone DKFZp686M1316)

NM 1384 Homo sapiens acylphosphatase 2, muscle type 8Up 2.32E-05 48 (ACYP2), mRNA

NM 0038 Homo sapiens tumor necrosis factor receptor 7.99 Up 2.68E-04 20 superfamily, member 14 (herpesvirus entry mediator)


NM 0248 Homo sapiens hypothetical protein FLJ22202 7.99 Up 3.15E-05 83 (FLJ22202), mRNA

BF964352 RC5-NN1065-271200-028-C09 1 NN1065 Homo 7.98 Up 5.43E-05 sapiens cDNA, mRNA sequence

NM 1522 Homo sapiens hypothetical protein MGC13024 7.97 Up 4.08E-05 88 (MGC13024), mRNA

CA314488 UI-CF-FN0-afh-i-09-0-Ul.s1 UI-CF-FNO Homo 7.97 Up 9.56E-05 sapiens cDNA clone UI-CF-FNO-afh-i-09-O-UI 3, mRNA sequence

NM 0062 Homo sapiens tumor necrosis factor, alpha-induced 7.91 Up 9.43E-05 91 protein 2 (TNFAIP2), mRNA

NM 1304 Homo sapiens protein tyrosine phosphatase, receptor 7.85 Up 2.07E-05 35 type, E (PTPRE), transcript variant 2, mRNA

BG75932 60271 1825F1 NIH MGC 48 Homo sapiens cDNA 7.82 Up 2.70E-05 1 clone IMAGE:48521 10 5, mRNA sequence

NM_0335 Homo sapiens major histocompatibility complex, class 7.8 Up 2.70E-05 54 II, DP alpha 1 (HLA-DPA1 ), mRNA

BC042561 Homo sapiens, clone IMAGE:4819341 , mRNA 7.79 Up 2.79E-04 W52990 zcO2eO9.r1 Soares parathyroid tumor NbHPA Homo 7.76 Up 1.22E-04 sapiens cDNA clone IMAGE:321 160 5, mRNA sequence

NM_0320 Homo sapiens elastin microfibril interfacer 2 7.76 Up 1.96E-05 48 (EMILIN2), mRNA

NM_1815 Homo sapiens microtubule-associated protein 1 light 7.73 Up 5.30E-04 09 chain 3 alpha (MAPI LC3A), transcript variant 2, mRNA AL161980 Homo sapiens mRNA; cDNA DKFZp761 H1023 (from 7.72 Up 1.93E-05 clone DKFZp761 H1023)

BG43624 602508665F1 NIH_MGC_79 Homo sapiens cDNA 7.7Up 2.80E-05 4 clone IMAGE:4605617 5, mRNA sequence

NM 0063 Homo sapiens heat shock 27kDa protein 3 (HSPB3), 7.66 Up 3.57E-05 08 mRNA

NM_0177 Homo sapiens signal-transducing adaptor protein-2 7.65 Up 6.19E-04 20 (STAP2), mRNA

NM 0154 Homo sapiens regeneration associated muscle 7.64 Up 4.17E-04 30 protease (DKFZP586H2123), transcript variant 1 , mRNA AI378375 tc78dO3.x1 Soares NhHMPu SI Homo sapiens 7.64 Up 9.80E-05 cDNA clone IMAGE:2070725 3, mRNA sequence NM 0176 Homo sapiens betaine-homocysteine 7.56 Up 3.25E-05 14 methyltransferase 2 (BHMT2), mRNA

BX640643 Homo sapiens mRNA; cDNA DKFZp686O241 14 7.55 Up 1.79E-05

(from clone DKFZp686O241 14) BX097069 BX097069 Soares infant brain 1 NIB Homo sapiens 7.53 Up 1.01E-04 cDNA clone IMAGp998P04275 ; IMAGE:47426, mRNA sequence R44402 yg37aO1.s1 Soares infant brain 1 NIB Homo sapiens 7.53 UD 1.45E-04 cDNA clone IMAGE:34639 3 similar to contains MER35 repetitive element ;, mRNA sequence AL833381 Homo sapiens mRNA; cDNA DKFZp667L2214 (from 7.52 Up 1 .75E-04 clone DKFZp667L2214) BX108022 BX108022 Soares placenta Nb2HP Homo sapiens 7.52 Up 4.33E-05 cDNA clone IMAGp998K17194 ; IMAGE:136072, mRNA sequence

NM 0037 Homo sapiens serine (or cysteine) proteinase 7.49 Up 7.07E-05 84 inhibitor, clade B (ovalbumin), member 7

(SERPINB7), mRNA N40495 yw74f12.r1 7.48 Up 8.01 E-05

Soares_placenta_8to9weeks_2NbHP8to9W Homo sapiens cDNA clone IMAGE:257999 5 similar to contains AIu repetitive element;, mRNA sequence

NM _0201 Homo sapiens chromosome 21 open reading frame 7 7.47 Up 1 .19E-04

52 (C21 orf7), mRNA

NM _0152 Homo sapiens neural precursor cell expressed, 7.44 Up 3.49E-05

77 developmentally down-regulated 4-like (NEDD4L), mRNA

NM _0150 Homo sapiens Rho GTPase activating protein 26 7.43 Up 2.42E-04

71 (ARHGAP26), mRNA

NM _1336 Homo sapiens roundabout, axon guidance receptor, 7.38 Up 2.35E-05

31 homolog 1 (Drosophila) (ROBO1 ), transcript variant 2, mRNA

BQ54962 ik89c1 1 .x1 Human insulinoma Homo sapiens cDNA 7.37 Up 2.60E-05

6 clone IMAGE:6027645 3, mRNA sequence AK093972 Homo sapiens cDNA FLJ36653 fis, clone 7.32 Up 1 .06E-04

UTERU2001 176 AI821210 neO8eO5.y5 NCI_CGAP_Co3 Homo sapiens cDNA 7.32 Up 1 .74E-04 clone IMAGE:880640 5, mRNA sequence NM 0041 Homo sapiens Ras-related associated with diabetes 7.31 Up 6.50E-05 65 (RRAD), mRNA

NM 1307 Homo sapiens chromosome 10 open reading frame 7.3 Up 1.08E-04

84 94 (C10orf94), mRNA

AA370555 EST82216 Prostate gland I Homo sapiens cDNA 5 7.27 Up 1 .27E-05 end, mRNA sequence

NM 0032 Homo sapiens thrombospondin 2 (THBS2), mRNA 7.27 Up 5.96E-05 47 AI905628 CM-BT094-050299-147 BT094 Homo sapiens cDNA, 7.27 Up 3.16E-04 mRNA sequence

AK129550 Homo sapiens cDNA FLJ26039 fis, clone PRS00963 7.21 Up 1 .97E-04 NM_0252 Homo sapiens EF hand domain containing 1 7.21 Up 1 .60E-05 02 (EFHD1 ), mRNA

NM_0021 Homo sapiens major histocompatibility complex, class 7.2 Up 2.35E-05 21 II, DP beta 1 (HLA-DPB1 ), mRNA

NM_0528 Homo sapiens elastin microfibril interfacer 3 7.19 Up 6.35E-04 46 (EMILIN3), mRNA

NM 0332 Homo sapiens hypothetical gene supported by 7.17 Up 1 .28E-04 11 AF038182; BC009203 (LOC90355), mRNA

NM 1817 Homo sapiens hypothetical protein LOC283537 7.14 Up 1 .73E-04

85 (LOC283537), mRNA

NM 0150 Homo sapiens GTPase activating Rap/RanGAP 7.13 Up 8.35E-05

85 domain-like 4 (GARNL4), mRNA

BX1 13264 BX1 13264 NCI_CGAP_Kid3 Homo sapiens cDNA 7.11 Up 8.42E-05 clone IMAGp998J144150 ; IMAGE: 1635949, mRNA sequence

NM 0324 Homo sapiens BH-protocadherin (brain-heart) 7.11 UD 9.56E-05 57 (PCDH7), transcript variant c, mRNA AK127072 Homo sapiens cDNA FLJ45129 fis, clone 7.08 Up 1.03E-04

BRAWH3037394 D54580 HUM144G01 B Clontech human fetal brain polyA+ 7.08 Up 7.67E-05 mRNA (#6535) Homo sapiens cDNA clone GEN-

144G01 5, mRNA sequence NM_1735 Homo sapiens solute carrier family 35, member F3 7.08 Up 1.05E-05

08 (SLC35F3), mRNA

NM 0123 Homo sapiens p8 protein (candidate of metastasis 1 ) 7.06 Up 6.90E-04

85 (P8), mRNA

AW96974 EST381820 MAGE resequences, MAGK Homo 7.05 Up 6.89E-05

2 sapiens cDNA, mRNA sequence

BC041856 Homo sapiens, clone IMAGE:5270501 , mRNA 7.05 Up 2.69E-05

NM 0063 Homo sapiens sushi-repeat-containing protein, X- 7.05 Up 2.67E-05

07 linked (SRPX), mRNA

NM 0041 Homo sapiens forkhead-like 18 (Drosophila) 7.03 Up 1.84E-05

18 (FKHL18), mRNA

NM 1784 Homo sapiens late cornified envelope 2A (LCE2A), 7.02 Up 1.68E-04

28 mRNA

NM 0001 Homo sapiens Hermansky-Pudlak syndrome 1 7.01 Up 1.45E-04

95 (HPS1 ), transcript variant 1 , mRNA

NM 0062 Homo sapiens Thy-1 cell surface antigen (THY1 ), 6.96 Up 5.43E-05

88 mRNA

NM 0066 Homo sapiens START domain containing 10 6.92 Up 4.29E-04

45 (STARD10), mRNA

NM 0072 Homo sapiens TP53 activated protein 1 (TP53AP1 ), 6.92 Up 5.78E-05

33 mRNA

NM 0042 Homo sapiens carbohydrate (N-acetylglucosamine-6- 6.91 Up 3.68E-05

67 O) sulfotransferase 2 (CHST2), mRNA

AK098759 Homo sapiens cDNA FLJ25893 fis, clone CBR03492 6.89 Up 1.36E-04

BX1 16071 BX1 16071 Soares pregnant uterus NbHPU Homo 6.89 Up 1.64E-04 sapiens cDNA clone IMAGp998L201 165 ;

IMAGE:489763, mRNA sequence BG03283 602300417F1 NIH_MGC_87 Homo sapiens cDNA 6.88 Up 2.69E-05

9 clone IMAGE:4401700 5, mRNA sequence BC019241 Homo sapiens, clone IMAGE:3826163, mRNA 6.87 Up 1.16E-05 NM 0120 Homo sapiens adenylate kinase 5 (AK5), transcript 6.87 Up 4.79E-05 93 variant 2, mRNA

BF675806 602083723F1 N IH MGC 83 Homo sapiens cDNA 6.87 Up 1.21E-03 clone IMAGE:4248004 5, mRNA sequence NM 0058 Homo sapiens calicin (CCIN), mRNA 6.84 Up 1.48E-05 93

NM_0157 Homo sapiens putative lymphocyte G0/G1 switch 6.81 Up 3.28E-04 14 gene (G0S2), mRNA

NM 0155 Homo sapiens CLIP-170-related protein (CLIPR-59), 6.8 Up 2.04E-04 26 mRNA

NM_0025 Homo sapiens glycoprotein (transmembrane) nmb 6.76 Up 1.75E-05

10 (GPNMB), transcript variant 2, mRNA

NM 0018 Homo sapiens carbamoyl-phosphate synthetase 1 , 6.76 Up 1.54E-04

75 mitochondrial (CPS1 ), mRNA

NM_0143 Homo sapiens tumor necrosis factor, alpha-induced 6.75 Up 7.02E-05

50 protein 8 (TNFAIP8), mRNA

W30761 zb76g12.r1 Soares senescent fibroblasts NbHSF 6.75 Up 1.75E-05

Homo sapiens cDNA clone IMAGE:309574 5, mRNA sequence

NM_1446 Homo sapiens hypothetical protein FLJ25124 6.74 Up 3.09E-05 98 (FLJ25124), mRNA

NM 0012 Homo sapiens chemokine (C-C motif) receptor 1 6.71 Up 1.43E-04 95 (CCR1 ), mRNA BF238843 601904455F1 NIH_MGC_54 Homo sapiens cDNA 6.71 Up 1 .68E-04 clone IMAGE:4132429 5, mRNA sequence

NM_0008 Homo sapiens 5-hydroxytryptamine (serotonin) 6.71 Up 4.79E-05

63 receptor 1 B (HTR1 B), mRNA

BF594228 7nO9h12.x1 NCI_CGAP_Brn23 Homo sapiens cDNA 6.69 Up 1 .02E-04 clone IMAGE:3564167 3, mRNA sequence

AI917390 ts79aO5.x1 NCI CGAP GC6 Homo sapiens cDNA 6.69 Up 7.22E-05 clone IMAGE:2237456 3, mRNA sequence N59839 yz77eO9.s1 Soares_multiple_sclerosis_2NbHMSP 6.67 Up 2.39E-05

Homo sapiens cDNA clone IMAGE:289096 3, mRNA sequence

NM 0070 Homo sapiens endothelial cell-specific molecule 1 6.66 Up 2.98E-05

36 (ESM1 ), mRNA

AI866653 tz52aO7.x1 NCI_CGAP_Brn52 Homo sapiens cDNA 6.62 Up 1 .22E-04 clone IMAGE:2292180 3, mRNA sequence

CD35635 AGENCOURTJ 4250785 NIH MGC 187 Homo 6.58 Up 5.58E-05 2 sapiens cDNA clone I MAG E: 30404140 5, mRNA sequence

BX101362 BX101362 Soares fetal liver spleen 1 NFLS Homo 6.57 Up 1 .30E-03 sapiens cDNA clone IMAGp998P06384 ;

IMAGE:200309, mRNA sequence

NM _0175 Homo sapiens hypothetical protein DKFZp434C0328 6.55 Up 3.68E-05

77 (DKFZp434C0328), mRNA

AW47477 xy06f10.x1 NCI_CGAP_Lym12 Homo sapiens cDNA 6.55 Up 6.78E-05

3 clone IMAGE:2852395 3, mRNA sequence

AI677721 wd33gO8.x1 Soares NFL T GBC SI Homo sapiens 6.54 Up 1 .32E-04 cDNA clone IMAGE:2329982 3, mRNA sequence

NM _0165 Homo sapiens solute carrier family 15, member 3 6.53 Up 8.50E-05

82 (SLC15A3), mRNA

NM 0032 Homo sapiens tetranectin (plasminogen binding 6.53 Up 1 .81 E-04

78 " protein) (TNA), mRNA

NM 0529 Homo sapiens heart alpha-kinase (HAK), mRNA 6.52 Up 2.84E-05

47 "

NM 0029 Homo sapiens S100 calcium binding protein A4 6.52 Up 4.35E-05

61 " (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), transcript variant 1 , mRNA

BU689688 UI-CF-FN0-aet-c-09-0-Ul.s1 UI-CF-FNO Homo 6.52 Up 8.15E-04 sapiens cDNA clone UI-CF-FNO-aet-c-09-O-UI 3, mRNA sequence

NM_0022 Homo sapiens keratin, hair, acidic, 1 (KRTHA1 ), 6.51 Up 3.66E-05 77 mRNA

NM_0001 Homo sapiens complement factor H (CFH), mRNA 6.5 Up 8.02E-05 86 AK021754 Homo sapiens cDNA FLJ1 1692 fis, clone 6.49 Up 2.90E-04


NM_1832 Homo sapiens solute carrier family 22 (organic cation 6.46 Up 1 .15E-05 33 transporter), member 18 (SLC22A18), transcript variant 2, mRNA N32748 yw91 aO1 .s1 6.42 Up 4.79E-05

Soares_placenta_8to9weeks_2NbHP8to9W Homo sapiens cDNA clone IMAGE:259560 3, mRNA sequence W58469 zd25bO2.r1 Soares_fetal_heart_NbHH19W Homo 6.39 UD 1 .22E-04 sapiens cDNA clone IMAGE:341643 5, mRNA sequence NM 0015 Homo sapiens interferon-induced protein with 6.39 Up 1 .90E-05

49 tetratricopeptide repeats 3 (IFIT3), mRNA

NM 0021 Homo sapiens HLA-G histocompatibility antigen, 6.38 Up 2.26E-05

27 class I, G (HLA-G), mRNA

NM 0326 Homo sapiens brain expressed X-linked 2 (BEX2), 6.37 Up 4.66E-05

21 mRNA

NM_0151 Homo sapiens phospholipase C, beta 1 6.37 Up 5.95E-04

92 (phosphoinositide-specific) (PLCB1 ), transcript variant

1 , mRNA

BX647881 Homo sapiens mRNA; cDNA DKFZp3130196 (from 6.36 Up 5.75E-05 clone DKFZp3130196)

AF086106 Homo sapiens full length insert cDNA clone YZ94H06 6.35 Up 1 .15E-05

NM 0044 Homo sapiens guanine nucleotide binding protein (G 6.32 Up 1 .75E-04

85 protein), gamma 4 (GNG4), mRNA

AL137383 Homo sapiens mRNA; cDNA DKFZp434L1626 (from 6.3 Up 2.43E-04 clone DKFZp434L1626)

AL713639 Homo sapiens mRNA; cDNA DKFZp761 L1 121 (from 6.29 Up 3.10E-05 clone DKFZp761 L1121 )

NM_0184 Homo sapiens brain expressed, X-linked 1 (BEX1 ), 6.28 Up 3.49E-05

76 mRNA

NM_0017 Homo sapiens cadherin 4, type 1 , R-cadherin (retinal) 6.24 Up 3.53E-05

94 (CDH4), mRNA

NM_0002 Homo sapiens iduronidase, alpha-L- (IDUA), mRNA 6.24 Up 2.82E-04


CF890942 UI-CF-FN0-afr-b-08-18-Ul.s18 UI-CF-FNO Homo 6.22 Up 5.45E-05 sapiens cDNA clone UI-CF-FN0-afr-b-08-18-UI 3, mRNA sequence

NM_0312 Homo sapiens transcription factor 7-like 1 (T-cell 6.2 Up 7.39E-05

83 specific, HMG-box) (TCF7L1 ), mRNA

AK127315 Homo sapiens cDNA FLJ45384 fis, clone 6.19 Up 3.69E-05


BF509925 UI-H-BI4-aph-c-10-0-Ul.s1 NCI_CGAP_Sub8 Homo 6.19 Up 4.13E-05 sapiens cDNA clone IMAGE:3087355 3, mRNA sequence

AI765020 wh56cO1 .x1 NCI_CGAP_Kid11 Homo sapiens cDNA 6.19 Up 4.57E-04 clone IMAGE:2384736 3, mRNA sequence

AW66566 hjO5dO2.x1 Soares NFL T GBC SI Homo sapiens 6.19 Up 2.18E-04

5 cDNA clone IMAGE:2980899 3, mRNA sequence

NM 0032 Homo sapiens thrombospondin 1 (THBS1 ), mRNA 6.16 Up 3.77E-04


BI830220 603072923F1 NIH MGC 1 19 Homo sapiens cDNA 6.16 Up 5.80E-05 clone IMAGE:5164997 5, mRNA sequence AW38596 CM0-LT0069-301299-144-hO1 LT0069 Homo sapiens 6.15 Up 5.01 E-05 8 cDNA, mRNA sequence

AI86781 1 wb39aO5.x1 NCI CGAP GC6 Homo sapiens cDNA 6.15 Up 1 .68E-04 clone IMAGE:2308016 3, mRNA sequence AK024449 Homo sapiens mRNA for FLJ00041 protein, partial 6.13 Up 3.44E-04 cds

NM 0326 Homo sapiens lysyl oxidase-like 3 (L0XL3), mRNA 6.11 Up 1.05E-04 03 BX538051 Homo sapiens mRNA; cDNA DKFZp686F09156 (from 6.11 Up 6.18E-05 clone DKFZp686F09156)

NM 2033 Homo sapiens CD59 antigen p18-20 (antigen 6.1 Up 4.29E-05 31 identified by monoclonal antibodies 16.3A5, EJ16,

EJ30, EL32 and G344) (CD59), transcript variant 4, mRNA NM_1944 Homo sapiens ribonuclease, RNase A family, 4 6.09 UD 1 .04E-03 31 (RNASE4), transcript variant 3, mRNA AI972433 wr39fO9.x1 NCI_CGAP_Pr28 Homo sapiens cDNA 6.09 Up 1.85E-05 clone IMAGE:2490089 3, mRNA sequence

NM_0006 Homo sapiens chemokine (C-X-C motif) ligand 12 6.07 Up 3.37E-04

09 (stromal cell-derived factor 1 ) (CXCL12), mRNA

NM_0065 Homo sapiens corin, serine protease (CORIN), mRNA 6.06 Up 3.56E-05


NM_0013 Homo sapiens cathepsin O (CTSO), mRNA 6.05 Up 9.89E-06


NM_0133 Homo sapiens thyrotropin-releasing hormone 6.04 Up 2.58E-05

81 degrading ectoenzyme (TRHDE), mRNA

NM_0162 Homo sapiens cytochrome b5 reductase b5R.2 6.03 Up 6.56E-05

29 (CYB5R2), transcript variant 1 , mRNA

NM_0056 Homo sapiens TNF receptor-associated factor 1 6.02 Up 3.38E-05

58 (TRAF1 ), mRNA

NM 0160 Homo sapiens yippee-like 5 (Drosophila) (YPEL5), 6.02 Up 1.65E-05

61 mRNA

AI028737 ov92h07.x1 Soares testis NHT Homo sapiens cDNA 6.01 Up 6.08E-04 clone I MAGE: 1644829 3, mRNA sequence

AI424832 tg37eO6.x1 Soares NFL T GBC SI Homo sapiens 6.01 Up 1.91E-04 cDNA clone IMAGE:21 10978 3, mRNA sequence

NM 1457 Homo sapiens synaptogyrin 1 (SYNGR1 ), transcript 5.99 Up 3.92E-05

31 variant 1 b, mRNA

NM 0008 Homo sapiens glutathione S-transferase M3 (brain) 5.97 Up 4.35E-05

49 (GSTM3), mRNA

NM 0248 Homo sapiens hypothetical protein FLJ13265 5.96 Up 2.87E-04

77 (FLJ13265), mRNA

R45335 yg46a10.s1 Soares infant brain 1 NIB Homo sapiens 5.96 Up 2.49E-04 cDNA clone IMAGE:35529 3, mRNA sequence

NM_0208 Homo sapiens dedicator of cytokinesis 6 (DOCK6), 5.93 Up 5.53E-04

12 mRNA

NM_0239 Homo sapiens HCV NS3-transactivated protein 2 5.93 Up 6.98E-04

27 (NS3TP2), mRNA

BC040326 Homo sapiens hypothetical protein LOC338758, 5.93 Up 2.59E-05 mRNA (cDNA clone IMAGE:4839197), partial cds

NM_0216 Homo sapiens transmembrane protein 35 (TMEM35), 5.9 Up 3.22E-05

37 mRNA

NMJ 334 Homo sapiens KIAA1983 protein (FLJ30681 ), mRNA 5.9 Up 8.82E-05


AK021543 Homo sapiens cDNA FLJ1 1481 fis, clone 5.89 Up 1.01E-03


BM71 171 UI-E-CL1 -afb-d-04-0-Ul.r1 UI-E-CL1 Homo sapiens 5.88 Up 1.03E-04 8 cDNA clone UI-E-CL1 -afb-d-04-0-UI 5, mRNA sequence

NM_0028 Homo sapiens RAP2B, member of RAS oncogene 5.88 Up 1.48E-05

86 family (RAP2B), mRNA

NM_0145 Homo sapiens ras homolog gene family, member D 5.87 Up 2.11E-04

78 (RHOD), mRNA

NM_0190 Homo sapiens roundabout homolog 4, magic 5.86 Up 5.07E-04

55 roundabout (Drosophila) (ROBO4), mRNA

AK127644 Homo sapiens cDNA FLJ45742 fis, clone 5.86 Up 1.91E-04


NM_0178 Homo sapiens dual specificity phosphatase 23 5.83 Up 4.83E-04

23 (DUSP23), mRNA

CA448068 UI-H-ED1 -ayj-g-05-0-Ul.s1 NCI CGAP ED1 Homo 5.81 Up 9.51 E-05 sapiens cDNA clone UI-H-ED1 -ayj-g-05-0-UI 3, mRNA sequence NM 0141 Homo sapiens HSPC047 protein (HSPC047), mRNA 5.81 Up 2.32E-05


NM 0149 Homo sapiens neuroligin 1 (NLGN1 ), mRNA 5.81 Up 1.01 E-03


NM 0038 Homo sapiens myomesin 1 (skelemin) 185kDa 5.8 Up 6.50E-05

03 (MYOM1 ), mRNA

NM_0331 Homo sapiens CG016 (LOC88523), mRNA 5.79 Up 1.75E-05


N25289 yw51 g1 1 .s1 Weizmann Olfactory Epithelium Homo 5.79 Up 2.10E-05 sapiens cDNA clone IMAGE:255812 3 similar to

SP:ZK1098.1 CE00362 ;, mRNA sequence

BC035805 Homo sapiens caspase recruitment domain family, 5.77 Up 1.27E-04 member 9, mRNA (cDNA clone IMAGE:5745585), partial cds

AK097266 Homo sapiens cDNA FLJ39947 fis, clone 5.77 Up 2.53E-04

SPLEN2024232 BF508259 UI-H-BI4-aqa-c-12-0-Ul.s1 NCI_CGAP_Sub8 Homo 5.77 Up 4.79E-05 sapiens cDNA clone IMAGE:3089278 3, mRNA sequence

NM 0033 Homo sapiens tumor necrosis factor (ligand) 5.76 Up 3.57E-05 26 superfamily, member 4 (tax-transcriptionally activated glycoprotein 1 , 34kDa) (TNFSF4), mRNA

BM67893 UI-E-EO0-ahx-f-05-0-Ul.s1 UI-E-EOO Homo sapiens 5.76 Up 1.36E-04

4 cDNA clone UI-E-EO0-ahx-f-05-0-UI 3, mRNA sequence

AI733342 op98b10.x5 NCI CGAP Luδ Homo sapiens cDNA 5.74 Up 1.78E-05 clone IMAGE:1584859 3 similar to contains element

OFR OFR repetitive element ;, mRNA sequence

NM 0122 Homo sapiens integrin beta 1 binding protein 5.74 Up 3.12E-05

78 (melusin) 2 (ITGB1 BP2), mRNA

AI075039 ov13f01 .x1 NCI_CGAP_Kid3 Homo sapiens cDNA 5.73 Up 3.33E-04 clone IMAGE:1637209 3, mRNA sequence

AL833463 Homo sapiens mRNA; cDNA DKFZp686P071 16 (from 5.73 Up 4.28E-04 clone DKFZp686P071 16)

NM 0070 Homo sapiens transducin-like enhancer of split 4 5.72 Up 1.22E-03

05 (E(sp1 ) homolog, Drosophila) (TLE4), mRNA

AI679537 tu64cO9.x1 NCI_CGAP_Gas4 Homo sapiens cDNA 5.72 Up 5.49E-05 clone IMAGE:2255824 3, mRNA sequence

BC014149 Homo sapiens cDNA clone IMAGE:3613441 , partial 5.7 Up 4.29E-06 cds

NMJ 525 Homo sapiens hypothetical protein FLJ23861 5.7 Up 2.20E-05

19 (FLJ23861 ), mRNA

NM_0030 Homo sapiens solute carrier family 22 (organic cation 5.69 Up 1.99E-05

59 transporter), member 4 (SLC22A4), mRNA

NM_0047 Homo sapiens RAB33A, member RAS oncogene 5.69 Up 7.21 E-04

94 family (RAB33A), mRNA

NMJ815 Homo sapiens phosphoinositide-3-kinase, regulatory 5.69 Up 1.43E-04

23 subunit 1 (p85 alpha) (PIK3R1 ), transcript variant 1 , mRNA

H46176 yo14a1 1.s1 Soares adult brain N2b5HB55Y Homo 5.64 Up 2.99E-05 sapiens cDNA clone IMAGE: 177884 3, mRNA sequence

AI955713 wt37fO1 .x1 NCI CGAP Pani Homo sapiens cDNA 5.62 Up 7.29E-04 clone IMAGE:2509657 3, mRNA sequence

AK129550 Homo sapiens cDNA FLJ26039 fis, clone PRS00963 5.61 Up 3.65E-04 AW13700 UI-H-BI1 -acu-c-05-0-Ul.s1 NCI_CGAP_Sub3 Homo 5.6 Up 8.06E-05

1 sapiens cDNA clone I MAG E :2715632 3, mRNA sequence

NM _0159 Homo sapiens family with sequence similarity 26, 5.6 Up 1.55E-04

16 member B (FAM26B), mRNA

NM _1530 Homo sapiens RNA binding motif protein 24 5.59 Up 2.07E-05

20 (RBM24), mRNA

NM _0151 Homo sapiens phospholipase C-like 2 (PLCL2), 5.58 Up 6.24E-04

84 mRNA

NM _0326 Homo sapiens peroxisome proliferative activated 5.57 Up 7.39E-05

44 receptor, alpha (PPARA), transcript variant 7, mRNA BBEE66 66994499:3 7e13e10.x1 NCI_CGAP_Lu24 Homo sapiens cDNA 5.57 Up 1 .52E-04 clone IMAGE:3282378 3, mRNA sequence

NM _0005 Homo sapiens transporter 1 , ATP-binding cassette, 5.57 Up 4.66E-05

93 sub-family B (MDR/TAP) (TAP1 ), mRNA

NM _0070 Homo sapiens transducin-like enhancer of split 4 5.57 Up 7.73E-06

05 (E(sp1 ) homolog, Drosophila) (TLE4), mRNA

W45350 zc81 hO8.s1 Pancreatic Islet Homo sapiens cDNA 5.56 Up 8.86E-05 clone IMAGE:328767 3 similar to contains AIu repetitive element;, mRNA sequence

NM _0180 Homo sapiens TAP binding protein-like (TAPBPL), 5.53 Up 1 .58E-04

09 mRNA BE326984 hr68d12.x1 NCI_CGAP_Kid11 Homo sapiens cDNA 5.52 Up 2.85E-04 clone IMAGE:3133655 3, mRNA sequence BC021714 Homo sapiens PTPRF interacting protein, binding 5.51 Up 4.10E-03 protein 2 (liprin beta 2), mRNA (cDNA clone MGC:26737 IMAGE:4826610), complete cds AY027526 Homo sapiens NYD-SP16 mRNA, complete cds 5.51 Up 2.79E-04 NM 0036 Homo sapiens G protein-coupled receptor 65 5.51 Up 1 .43E-04 08 (GPR65), mRNA

NM 0021 Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme 5.51 Up 6.46E-04 30 A synthase 1 (soluble) (HMGCS1 ), mRNA

NM 0178 Homo sapiens HRAS-like suppressor 2 (HRASLS2), 5.51 Up 2.33E-04 78 mRNA

BF342356 602013147F1 NCI_CGAP_Brn64 Homo sapiens 5.5 Up 1.1 1 E-04 cDNA clone IMAGE:4148938 5, mRNA sequence NM_0141 Homo sapiens FXYD domain containing ion transport 5.49 Up 1 .83E-04 64 regulator 5 (FXYD5), transcript variant 2, mRNA

NM 0055 Homo sapiens interferon-induced protein 35 (IFI35), 5.49 Up 1 .91 E-04 33 mRNA

AW59326 hg1 1 hO3.x1 Soares NFL T GBC SI Homo sapiens 5.49 Up 3.92E-05 6 cDNA clone IMAGE:2945333 3, mRNA sequence

AK097239 Homo sapiens cDNA FLJ39920 fis, clone 5.47 Up 1 .83E-03


NM 0054 Homo sapiens N-acetylated alpha-linked acidic 5.46 Up 5.33E-04 68 dipeptidase-like 1 (NAALADL1 ), mRNA

NM 0144 Homo sapiens gene rich cluster, A gene (GRCA), 5.44 Up 1 .22E-05 49 transcript variant A-1 , mRNA

NM 0166 Homo sapiens chemokine (C-C motif) receptor 10 5.43 Up 9.56E-05 02 (CCR10), mRNA

NM 0121 Homo sapiens calcium-binding tyrosine-(Y)- 5.42 Up 7.21 E-05 89 phosphorylation regulated (fibrousheathin 2)

(CABYR), transcript variant 1 , mRNA AF070565 Homo sapiens clone 24425 mRNA sequence 5.41 Up 1 .93E-04 NM 0055 Homo sapiens glycoprotein A repetitions predominant 5.4 Up 2.60E-05 12 (GARP), mRNA

BE389742 601282904F1 NIH MGC 44 Homo sapiens cDNA 5.4 Up 3.92E-05 clone IMAGE:3604656 5, mRNA sequence NM 0019 Homo sapiens coagulation factor Il (thrombin) 5.4 Up 2.90E-04 92 receptor (F2R), mRNA

NM _1387 Homo sapiens synaptotagmin-like 5 (SYTL5), mRNA 5.4 Up 7.92E-03


NM _1458 Homo sapiens leukotriene C4 synthase (LTC4S), 5.39 Up 5.86E-05

67 transcript variant 1 , mRNA

NM _0043 Homo sapiens cathepsin H (CTSH), transcript variant 5.39 Up 1 .05E-04

90 1 , mRNA

NM _0009 Homo sapiens matrix GIa protein (MGP), mRNA 5.39 Up 1 .15E-05


NM _0063 Homo sapiens fibulin 5 (FBLN5), mRNA 5.38 Up 4.77E-05


NM _2073 Homo sapiens Nck-associated protein 5 (NAP5), 5.38 Up 2.77E-04

63 mRNA

NM _0028 Homo sapiens protein tyrosine phosphatase, receptor 5.37 Up 6.50E-05

37 type, B (PTPRB), mRNA

NM 0227 Homo sapiens hypothetical protein FLJ12476 5.37 Up 1 .15E-05

84 " (FLJ12476), mRNA

NM 0122 Homo sapiens muscle RAS oncogene homolog 5.36 Up 3.23E-04

19 " (MRAS), mRNA

N36786 yy34eO8.s1 Soares melanocyte 2NbHM Homo 5.36 Up 1 .19E-04 sapiens cDNA clone IMAGE:273158 3 similar to contains element MSR1 repetitive element ;, mRNA sequence

NM 1525 Homo sapiens Williams Beuren syndrome 5.36 Up 4.82E-04

59 " chromosome region 27 (WBSCR27), mRNA

NM 0009 Homo sapiens prostaglandin I2 (prostacyclin) receptor 5.35 Up 8.42E-04

60 " (IP) (PTGIR), mRNA

H24359 ym56bO3.s1 Soares infant brain 1 NIB Homo sapiens 5.35 Up 1 .81 E-04 cDNA clone IMAGE:52294 3, mRNA sequence

NM _0132 Homo sapiens serum/glucocorticoid regulated kinase- 5.35 Up 2.95E-05

57 like (SGKL), transcript variant 1 , mRNA

NM _0140 Homo sapiens melanoma antigen, family H, 1 5.33 Up 5.93E-05

61 (MAGEH 1 ), mRNA

NM _0123 Homo sapiens leucine zipper, down-regulated in 5.33 Up 1 .81 E-04

17 cancer 1 (LDOC1 ), mRNA

NM _0053 Homo sapiens myosin IA (MYO1A), mRNA 5.32 Up 3.57E-05


BF109843 7l70a07.x1 Soares_NSF_F8_9W_OT_PA_P_S1 5.31 Up 2.51 E-04

Homo sapiens cDNA clone IMAGE:3526572 3, mRNA sequence

NM 0228 Homo sapiens fibronectin type III domain containing 4 5.31 Up 1 .66E-04

23 " (FNDC4), mRNA

NM 1384 Homo sapiens dehydrogenase/reductase (SDR 5.31 Up 2.59E-05

52 " family) member 1 (DHRS1 ), mRNA

AK131532 Homo sapiens cDNA FLJ16761 fis, clone 5.31 Up 1 .89E-04


NM _0307 Homo sapiens intermediate filament protein syncoilin 5.3 Up 2.32E-05


NM _0212 Homo sapiens Ras-related GTP binding D (RRAGD), 5.29 Up 6.74E-04

44 mRNA

AL833254 Homo sapiens mRNA; cDNA DKFZp761 K2120 (from 5.29 Up 6.89E-04 clone DKFZp761 K2120)

NM _0025 Homo sapiens neuronal pentraxin I (NPTX1 ), mRNA 5.28 Up 1.20E-04


NM 0055 Homo sapiens major histocompatibility complex, class 5.28 Up 1 .43E-03

16 " I, E (HLA-E), mRNA

BC041380 Homo sapiens cDNA clone IMAGE:5275203 5.27 Up 1.10E-04 NM 1735 Homo sapiens chromosome 10 open reading frame 5.27 Up 1 .59E-04

54 " 107 (C10orf107), mRNA

NM 0247 Homo sapiens hypothetical protein FLJ13639 5.27 Up 3.58E-05

05 " (FLJ13639), mRNA

R40672 yf79e1 1.s1 Soares infant brain 1 NIB Homo sapiens 5.26 Up 8.72E-05 cDNA clone IMAGE:28343 3, mRNA sequence

NM _0036 Homo sapiens sema domain, immunoglobulin domain 5.26 Up 9.64E-04

12 (Ig), and GPI membrane anchor, (semaphorin) 7A


NM 1389 Homo sapiens neurexin 3 (NRXN3), transcript variant 5.26 Up 1 .49E-05

70 " beta, mRNA

NM 1530 Homo sapiens FYN oncogene related to SRC, FGR, 5.26 Up 2.60E-05

47 " YES (FYN), transcript variant 2, mRNA

NM 021 1 Homo sapiens claudin 1 (CLDN1 ), mRNA 5.25 Up 2.83E-05

01 "

NM 0022 Homo sapiens inter-alpha (globulin) inhibitor H3 5.25 Up 4.48E-05

17 " (ITIH3), mRNA AK090808 Homo sapiens cDNA FLJ33489 fis, clone 5.24 Up 8.29E-05


BC039503 Homo sapiens, clone IMAGE:5557975, mRNA 5.23 Up 1 .64E-04 NM_0024 Homo sapiens matrix metalloproteinase 12 5.23 Up 5.53E-05 26 (macrophage elastase) (MMP12), mRNA

NM OOOO Homo sapiens tumor necrosis factor receptor 5.22 Up 8.35E-05 43 superfamily, member 6 (TNFRSF6), transcript variant

1 , mRNA AK096284 Homo sapiens cDNA FLJ38965 fis, clone 5.21 Up 7.84E-04

NT2RI2000987, highly similar to Lunatic fringe precursor AA993387 ot60f05.s1 Soares testis NHT Homo sapiens cDNA 5.19 Up 9.56E-05 clone IMAGE:1621185 3, mRNA sequence BF573354 602079765F2 NIH MGC 62 Homo sapiens cDNA 5.19 Up 4.1 1 E-05 clone IMAGE:4253872 5, mRNA sequence NM 0154 Homo sapiens target of Nesh-SH3 (TARSH), mRNA 5.18 Up 3.60E-03 29 AA449137 zxO3d12.r1 Soares_total_fetus_Nb2HF8_9w Homo 5.16 Up 1 .68E-04 sapiens cDNA clone IMAGE:785399 5, mRNA sequence

NM_1523 Homo sapiens kelch/ankyrin repeat containing cyclin 5.16 Up 2.66E-04 66 A1 interacting protein (KARCAI ), transcript variant 1 , mRNA

NM_0145 Homo sapiens potassium large conductance calcium- 5.15 Up 7.05E-04 05 activated channel, subfamily M, beta member 4


BG99507 MR4-HT1051 -150201 -001 -a10 HT1051 Homo 5.15 Up 1 .79E-05 4 sapiens cDNA, mRNA sequence

BU734113 UI-E-CK1-agb-a-24-0-Ul.s1 UI-E-CK1 Homo sapiens 5.15 Up 1 .63E-03 cDNA clone UI-E-CK1 -agb-a-24-0-UI 3, mRNA sequence AB032991 Homo sapiens mRNA for KIAA1165 protein, partial 5.14 Up 8.18E-05 cds AK021543 Homo sapiens cDNA FLJ1 1481 fis, clone 5.14 Up 3.81 E-04


NM 0159 Homo sapiens TNN I3 interacting kinase (TNN I3K), 5.13 Up 1 .79E-05 78 mRNA

AW59306 hgO8bO9.x1 Soares NFL T GBC SI Homo sapiens 5.12 Up 1 .95E-05 0 cDNA clone IMAGE:2944985 3, mRNA sequence

NM 1527 Homo sapiens Sad1 and UNC84 domain containing 1 5.12 Up 2.34E-04 82 (SUNC1 ), mRNA

BX108181 BX108181 Soares testis NHT Homo sapiens cDNA 5.11 Up 2.30E-04 clone IMAGp998A194412 ; IMAGE:1736346, mRNA sequence

NM 0012 Homo sapiens cadherin 13, H-cadherin (heart) 5.11 Up 9.85E-04 57 (CDH 13), mRNA

BU686952 UI-CF-DU1 -ado-e-14-0-Ul.s1 UI-CF-DU1 Homo 5.1 Up 8.45E-04 sapiens cDNA clone UI-CF-DU1 -ado-e-14-0-UI 3, mRNA sequence

NM_0210 Homo sapiens calcium channel, voltage-dependent, 5.08 Up 1 .88E-03 98 alpha 1 H subunit (CACNA1 H), transcript variant 1 , mRNA

BQ44867 UI-H-EU1-baj-h-12-0-Ul.s1 NCI CGAP CtI Homo 5.08 Up 7.22E-05 3 sapiens cDNA clone UI-H-EU1 -baj-h-12-0-UI 3, mRNA sequence

NM_0210 Homo sapiens syntrophin, beta 1 (dystrophin- 5.07 Up 1 .31 E-04 21 associated protein A1 , 59kDa, basic component 1 )

(SNTB1 ), mRNA AK097672 Homo sapiens cDNA FLJ40353 fis, clone 5.06 Up 1 .97E-04

TESTI2033520, weakly similar to BILIARY


BG54166 602571235F1 NIH MGC 77 Homo sapiens cDNA 5.05 Up 1 .54E-04 1 clone IMAGE:4695561 5, mRNA sequence

AK095896 Homo sapiens cDNA FLJ38577 fis, clone 5.05 Up 1 .08E-04


NM 0040 Homo sapiens cathepsin S (CTSS), mRNA 5.04 Up 7.68E-05 79

NM 0248 Homo sapiens NIMA (never in mitosis gene a)- 5.04 Up 5.06E-05 00 related kinase 11 (NEK1 1 ), mRNA

NM_0161 Homo sapiens matrix metalloproteinase 17 5.03 Up 1 .36E-03 55 (membrane-inserted) (MMP17), mRNA

BX098772 BX098772 Soares_total_fetus_Nb2HF8_9w Homo 5.02 Up 1 .60E-04 sapiens cDNA clone IMAGp998A192587 ;

IMAGE:1035546, mRNA sequence BC041412 Homo sapiens heat shock 7OkDa protein 12A, mRNA 5.01 Up 4.72E-04

(cDNA clone IMAGE:5285193), partial cds

NM 0044 Homo sapiens echinoderm microtubule associated 5 Up 2.66E-04

34 " protein like 1 (EML1 ), mRNA

AL706653 DKFZp686E1543_r1 686 (synonym: hlcc3) Homo 5 Up 5.40E-04 sapiens cDNA clone DKFZp686E1543 5, mRNA sequence

AW02215 df33f10.y1 Morton Fetal Cochlea Homo sapiens 866.7 Down 2.12E-06

8 cDNA clone IMAGE:2485386 5, mRNA sequence

NM _0334 Homo sapiens chromosome 9 open reading frame 26 388.77 Down 1 .17E-05

39 (NF-HEV) (C9orf26), mRNA

NM 0009 Homo sapiens prostaglandin-endoperoxide synthase 325.32 Down 2.89E-06

63 " 2 (prostaglandin G/H synthase and cyclooxygenase)


NM _0029 Homo sapiens regulator of G-protein signalling 16 236.81 Down 1 .08E-05

28 (RGS16), mRNA

NM _0183 Homo sapiens multiple C2-domains with two 174.25 Down 3.80E-06

49 transmembrane regions 2 (MCTP2), mRNA

NM _1445 Homo sapiens hypothetical protein FLJ32942 133.63 Down 8.64E-06

94 (FLJ32942), mRNA BC005107 Homo sapiens chromosome 21 open reading frame 125 Down 4.34E-06

105, mRNA (cDNA clone IMAGE:3840937), partial cds NM 0071 Homo sapiens annexin A10 (ANXA10), mRNA 122.94 Down 5.34E-06

93 "

NM 1983 Homo sapiens lung type-l cell membrane-associated 115.46 Down 4.58E-06

89 " glycoprotein (T1A-2), transcript variant 2, mRNA

AK091731 Homo sapiens cDNA FLJ34412 fis, clone 107.54 Down 5.34E-06


NM _1829 Homo sapiens a disintegrin-like and metalloprotease 95.83 Down 2.89E-06

20 (reprolysin type) with thrombospondin type 1 motif, 9

(ADAMTS9), transcript variant 1 , mRNA

NM 0007 Homo sapiens complement component 4 binding 94.3 Down 4.34E-06

16 " protein, beta (C4BPB), mRNA

BE044800 hn31 aO4.x1 NCI_CGAP_Thy7 Homo sapiens cDNA 93.13 Down 8.1 1 E-05 clone IMAGE:3023694 3, mRNA sequence

NM 0328 Homo sapiens hypothetical protein FLJ14904 89.37 Down 9.89E-06

58 " (FLJ14904), mRNA

NM 0336 Homo sapiens collagen, type IV, alpha 6 (COL4A6), 85.96 Down 1.15E-05

41 " transcript variant B, mRNA

NM 0331 Homo sapiens naked cuticle homolog 2 (Drosophila) 84.01 Down 1.32E-05

20 " (NKD2), mRNA

NM 0018 Homo sapiens collagen, type IV, alpha 6 (COL4A6), 83.96 Down 1.17E-05

47 " transcript variant A, mRNA

NM _0132 Homo sapiens DnaJ (Hsp40) homolog, subfamily D, 82.14 Down 1.48E-05

38 member 1 (DNAJD1 ), mRNA

NM _0162 Homo sapiens TNF receptor-associated protein 1 82.12 Down 9.67E-06

92 (TRAP1 ), mRNA

NM _0324 Homo sapiens protein kinase (cAMP-dependent, 81 .13 Down 2.65E-06

71 catalytic) inhibitor beta (PKIB), transcript variant 3, mRNA

NM 0182 Homo sapiens hypothetical protein FLJ10970 66.75 Down 4.47E-05

86 " (FLJ10970), mRNA

AK026784 Homo sapiens cDNA: FLJ23131 fis, clone LNG08502 64.15 Down 5.34E-06

BC047643 Homo sapiens, clone IMAGE:4825594, mRNA 64.03 Down 4.34E-06

NM _0121 Homo sapiens endothelial differentiation, 60.5 Down 1 .13E-05

52 lysophosphatidic acid G-protein-coupled receptor, 7

(EDG7), mRNA

NM 0159 Homo sapiens galanin (GAL), mRNA 59.83 Down 4.89E-06

73 "

BX5381 1 1 Homo sapiens mRNA; cDNA DKFZp686B02156 (from 55.84 Down 8.86E-06 clone DKFZp686B02156)

BX089554 BX089554 Soares placenta Nb2HP Homo sapiens 55.76 Down 7.89E-06 cDNA clone IMAGp998P07210 ; IMAGE:142326, mRNA sequence

AI9701 15 wq89dO3.x1 NCI CGAP GC6 Homo sapiens cDNA 53.62 Down 1.27E-04 clone IMAGE:2479205 3, mRNA sequence

NM 0244 Homo sapiens phospholipase A2, group IVA 51 .98 Down 4.30E-06

20 (cytosolic, calcium-dependent) (PLA2G4A), mRNA

NM 0019 Homo sapiens desmoglein 2 (DSG2), mRNA 51 .03 Down 8.74E-05


AF075054 Homo sapiens full length insert cDNA YO27G01 49.7 Down 4.13E-05

NM_0039 Homo sapiens cyclin A1 (CCNA1 ), mRNA 48.25 Down 2.89E-06


AK096536 Homo sapiens cDNA FLJ39217 fis, clone 46.22 Down 2.07E-05 OCBBF2006639, moderately similar to ZINC FINGER PROTEIN 84

AI797677 we90c07.x1 Soares NFL T GBC SI Homo sapiens 45.71 Down 2.99E-05 cDNA clone IMAGE:2348364 3, mRNA sequence NM 0006 Homo sapiens adenosine A2b receptor (ADORA2B), 41.97 Down 1 .17E-05 76 mRNA

NM _0019 Homo sapiens dipeptidylpeptidase 4 (CD26, 40.35 Down 1.35E-05

35 adenosine deaminase complexing protein 2) (DPP4), mRNA

NM 0029 Homo sapiens chemokine (C-X-C motif) ligand 6 38.32 Down 1.62E-05

93 " (granulocyte chemotactic protein 2) (CXCL6), mRNA

NM 1534 Homo sapiens paired-like homeodomain transcription 36.82 Down 1.75E-05

27 " factor 2 (PITX2), transcript variant 1 , mRNA

NM 0144 Homo sapiens PDZ and LIM domain 3 (PDLIM3), 36.34 Down 9.58E-06

76 " mRNA

NM 0068 Homo sapiens homeo box C9 (HOXC9), mRNA 35.33 Down 8.64E-06

97 "

NM 0012 Homo sapiens bone morphogenetic protein 4 (BMP4), 34.95 Down 4.34E-06

02 " transcript variant 1 , mRNA

BX089554 BX089554 Soares placenta Nb2HP Homo sapiens 34.43 Down 1.91 E-04 cDNA clone IMAGp998P07210 ; IMAGE:142326, mRNA sequence

NM 0024 Homo sapiens mesoderm specific transcript homolog 34.42 Down 3.35E-05

02 " (mouse) (MEST), transcript variant 1 , mRNA

NM 0073 Homo sapiens transient receptor potential cation 34.4 Down 1 .17E-05

32 " channel, subfamily A, member 1 (TRPA1 ), mRNA

NM 0044 Homo sapiens EPH receptor B2 (EPHB2), transcript 34.3 Down 3.28E-05

42 " variant 2, mRNA

NM 2071 Homo sapiens bromodomain, testis-specific (BRDT), 34.1 1 Down 1.32E-05

89 " transcript variant 1 , mRNA

NM 0029 Homo sapiens regulator of G-protein signalling 1 33.98 Down 1.97E-04

22 " (RGS1 ), mRNA

NM _1827 Homo sapiens hypothetical protein FLJ39155 33.79 Down 4.21 E-05

98 (FLJ39155), transcript variant 2, mRNA

AA071361 zm61 aO3.M Stratagene fibroblast (#937212) Homo 33.59 Down 1.32E-03 sapiens cDNA clone IMAGE:530092 5 similar to gb:U00001 PROTEIN CDC27HS (HUMAN);, mRNA sequence

AI742318 wg50e09.x1 Soares_NSF_F8_9W_OT_PA_P_S1 33.15 Down 1.82E-05

Homo sapiens cDNA clone IMAGE:2368552 3 similar to contains 0FR.t2 OFR repetitive element ;, mRNA sequence

NM _0033 Homo sapiens transient receptor potential cation 32.55 Down 3.80E-06

05 channel, subfamily C, member 3 (TRPC3), mRNA

NM _0162 Homo sapiens TP53TG3 protein (TP53TG3), mRNA 32.21 Down 4.35E-05


AF279780 Homo sapiens clone N1 1 NTera2D1 teratocarcinoma 32.04 Down 1.23E-04 mRNA

NM 0004 Homo sapiens laminin, alpha 2 (merosin, congenital 31 .89 Down 1.93E-05

26 " muscular dystrophy) (LAMA2), mRNA

NM 0209 Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) 31 .08 Down 1.93E-05

87 " (ANK3), transcript variant 1 , mRNA

AW46877 hd27hO3.x1 Soares NFL T GBC SI Homo sapiens 30.96 Down 7.33E-05

5 cDNA clone IMAGE:2910773 3, mRNA sequence

AA553336 nk61 e11 .s1 NCI CGAP Schi Homo sapiens cDNA 30.87 Down 2.89E-06 clone IMAGE:1018028 3, mRNA sequence

NM 0056 Homo sapiens claudin 1 1 (oligodendrocyte 30.74 Down 2.13E-05

02 " transmembrane protein) (CLDN1 1 ), mRNA

NM _0132 Homo sapiens fibronectin leucine rich transmembrane 30.1 1 Down 5.67E-05

81 protein 3 (FLRT3), transcript variant 1 , mRNA

BX106791 BX106791 Soares pregnant uterus NbHPU Homo 30.03 Down 3.76E-05 sapiens cDNA clone IMAGp998M201 156 ; IMAGE:486331 , mRNA sequence

NM 0015 Homo sapiens hyaluronan synthase 1 (HAS1 ), mRNA 29.94 Down 1.75E-05 23 BC066972 Homo sapiens similar to casein kinase I alpha, mRNA 29.35 Down 1.15E-05

(cDNA clone IMAGE:4829576), partial cds BX537697 Homo sapiens mRNA; cDNA DKFZp686D0853 (from 28.34 Down 2.89E-06 clone DKFZp686D0853)

NM 0007 Homo sapiens bradykinin receptor B1 (BDKRB1 ), 28.17 Down 2.20E-05 10 mRNA

BG1 1801 602351269F1 NIH_MGC_90 Homo sapiens cDNA 28.08 Down 1.04E-05 9 clone IMAGE:4446065 5, mRNA sequence

AB032981 Homo sapiens mRNA for KIAA1155 protein, partial 27.44 Down 6.56E-05 cds AA757156 ah55hO2.s1 Soares testis NHT Homo sapiens cDNA 27.19 Down 2.12E-04 clone 1309587 3, mRNA sequence BC045698 Homo sapiens, clone IMAGE:530271 1 , mRNA 26.78 Down 2.75E-04 NM 0006 Homo sapiens hepatocyte growth factor (hepapoietin 26.76 Down 5.34E-06 01 A; scatter factor) (HGF), mRNA

AB037838 Homo sapiens mRNA for KIAA1417 protein, partial 26.34 Down 2.20E-05 cds AV758461 AV758461 BM Homo sapiens cDNA clone 26.18 Down 2.55E-04

BMFASG08 5, mRNA sequence H89053 yw24cO6.r1 Morton Fetal Cochlea Homo sapiens 26.08 Down 6.93E-05 cDNA clone IMAGE:253162 5, mRNA sequence NM 0019 Homo sapiens fibulin 2 (FBLN2), transcript variant 2, 25.99 Down 7.08E-06 98 mRNA

NM 0037 Homo sapiens vesicle-associated membrane protein 25.96 Down 1.15E-05

61 8 (endobrevin) (VAMP8), mRNA NM 0250 Homo sapiens hypothetical protein FLJ23558 25.36 Down 6.18E-05 95 (FLJ23558), mRNA

NM 0057 Homo sapiens uronyl-2-sulfotransferase (UST), 24.74 Down 1.17E-05

15 mRNA

NM 0065 Homo sapiens solute carrier family 12 24.39 Down 2.32E-05

98 (potassium/chloride transporters), member 7

(SLC12A7), mRNA

NM_0064 Homo sapiens collectin sub-family member 10 (C- 23.57 Down 1.65E-05 38 type lectin) (COLEC10), mRNA

AW29349 UI-H-BI2-ahq-a-01 -0-Ul.s1 NCI_CGAP_Sub4 Homo 22.72 Down 1.26E-04 8 sapiens cDNA clone IMAGE:2727456 3, mRNA sequence D30877 HUML1 130 Human fetal lung Homo sapiens cDNA 5, 22.58 Down 3.09E-05 mRNA sequence AI003843 Ot66b07.s1 Soares testis NHT Homo sapiens cDNA 22.1 Down 1 .39E-05 clone IMAGE:1621717 3, mRNA sequence BC0331 16 Homo sapiens chromodomain helicase DNA binding 22.05 Down 7.75E-05 protein 7, mRNA (cDNA clone IMAGE:3352674), partial cds

NM 0029 Homo sapiens regulator of G-protein signalling 1 21 .91 Down 5.04E-05 22 (RGS1 ), mRNA

T85180 yd47dO6.s1 Soares fetal liver spleen 1 NFLS Homo 21 .89 Down 1.48E-05 sapiens cDNA clone IMAGE:11 1371 3 similar to contains AIu repetitive element;contains LTR8 repetitive element ;, mRNA sequence

NM 0243 Homo sapiens iroquois homeobox protein 3 (IRX3), 21 .83 Down 1.32E-05 36 mRNA

NM_0015 Homo sapiens interleukin 18 (interferon-gamma- 21 .81 Down 3.57E-05

62 inducing factor) (IL18), mRNA NM 0006 Homo sapiens interleukin 13 receptor, alpha 2 21.77 Down 3.41 E-05

40 (IL13RA2), mRNA

NM 0013 Homo sapiens chemokine (C-X3-C motif) receptor 1 21.6 Down 3.14E-04

37 (CX3CR1 ), mRNA

NM_0026 Homo sapiens paired-like homeodomain transcription 21.49 Down 1.15E-05

53 factor 1 (PITX1 ), mRNA

BX647459 Homo sapiens mRNA; cDNA DKFZp686A131 10 (from 20.93 Down 2.18E-04 clone DKFZp686A131 10)

NM 0014 Homo sapiens forkhead box F2 (FOXF2), mRNA 20.8 Down 1.86E-05 52 BF431867 nab76bO5.x1 Soares_NSF_F8_9W_OT_PA_P_S1 20.7 Down 7.02E-05

Homo sapiens cDNA clone IMAGE:3273560 3, mRNA sequence AK023526 Homo sapiens cDNA FLJ13464 fis, clone 20.68 Down 4.13E-05

PLACE 1003478 AK097298 Homo sapiens cDNA FLJ39979 fis, clone 20.51 Down 1.39E-05


AK000776 Homo sapiens cDNA FLJ20769 fis, clone COL06674 20.23 Down 2.07E-05 NM 0180 Homo sapiens solute carrier family 6 20.23 Down 2.32E-05 57 (neurotransmitter transporter), member 15

(SLC6A15), mRNA N34332 yy52h12.s1 Soares_multiple_sclerosis_2NbHMSP 20.21 Down 3.64E-05

Homo sapiens cDNA clone IMAGE:277223 3, mRNA sequence BX105197 BX105197 Soares testis NHT Homo sapiens cDNA 20.17 Down 3.19E-02 clone IMAGp998H1441 10 ; IMAGE:1620541 , mRNA sequence NM 0009 Homo sapiens prostaglandin E receptor 2 (subtype 20.09 Down 1.49E-05

56 EP2), 53kDa (PTGER2), mRNA

NM 0060 Homo sapiens lipase, endothelial (LIPG), mRNA 20.06 Down 6.14E-06


NM 0009 Homo sapiens prostaglandin I2 (prostacyclin) 20.05 Down 2.10E-05

61 synthase (PTGIS), mRNA

AK095573 Homo sapiens cDNA FLJ38254 fis, clone 19.91 Down 1.32E-04

FCBBF3000847 NM 0052 Homo sapiens GATA binding protein 6 (GAT A6), 19.83 Down 4.62E-05

57 mRNA

NM 0309 Homo sapiens protein phosphatase 1 , regulatory 19.79 Down 2.89E-06 49 (inhibitor) subunit 14C (PPP1 R14C), mRNA

NM 1526 Homo sapiens tripartite motif-containing 60 (TRIM60), 19.72 Down 4.34E-06 20 mRNA

AI792974 on13gO7.y5 NCI CGAP Luδ Homo sapiens cDNA 19.65 Down 1.58E-04 clone IMAGE:1556604 5 similar to contains L1 .t3 L1 repetitive element ;, mRNA sequence BX1 19520 BX1 19520 NCI_CGAP_Pr28 Homo sapiens cDNA 19.28 Down 8.64E-06 clone IMAGp998N245757 ; IMAGE:2321495, mRNA sequence BC000975 Homo sapiens, clone IMAGE:3448306, mRNA, partial 19.17 Down 1.06E-04 cds

NM 0150 Homo sapiens paternally expressed 10 (PEG10), 19.15 Down 4.37E-05 68 mRNA

NM 0123 Homo sapiens BMP and activin membrane-bound 19.1 Down 2.08E-04 42 inhibitor homolog (Xenopus laevis) (BAMBI), mRNA

BU727096 UI-E-CR0-ach-e-12-0-Ul.s1 UI-E-CRO Homo sapiens 18.97 Down 3.08E-05 cDNA clone UI-E-CRO-ach-e-12-O-UI 3, mRNA sequence AY271826 Homo sapiens ZYG-11 A early embryogenesis protein 18.1 Down 5.34E-06 mRNA, complete cds AF339768 Homo sapiens clone IMAGE:1 19716, mRNA 17.81 Down 1.91E-04 sequence NM 0186 Homo sapiens DEAD (Asp-Glu-Ala-Asp) box 17.4 Down 7.39E-05

65 polypeptide 43 (DDX43), mRNA

NM 0045 Homo sapiens chemokine (C-C motif) ligand 20 17.37 Down 2.30E-04

91 (CCL20), mRNA

BQ35053 RC1 -HT0256-120400-019-dO6 HT0256 Homo 17.31 Down 1.12E-04

4 sapiens cDNA, mRNA sequence BC030663 Homo sapiens, clone IMAGE:5262826, mRNA 17.24 Down 2.34E-04 BG53963 602567579F1 NIH_MGC_77 Homo sapiens cDNA 17.2 Down 7.22E-05

5 clone IMAGE:4692283 5, mRNA sequence NM 0028 Homo sapiens pentaxin-related gene, rapidly induced 16.99 Down 7.99E-05 52 by IL-1 beta (PTX3), mRNA

NM_1827 Homo sapiens solute carrier family 6 16.84 Down 4.16E-05

67 (neurotransmitter transporter), member 15

(SLC6A15), mRNA

NM_0177 Homo sapiens elongation of very long chain fatty 16.68 Down 4.60E-05 70 acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2

(ELOVL2), mRNA BE550347 7a22dO8.x1 NCI CGAP GC6 Homo sapiens cDNA 16.57 Down 4.20E-05 clone IMAGE:3219471 3 similar to contains L1 .t3 L1 repetitive element ;, mRNA sequence AI693058 wd36a12.x1 Soares NFL T GBC SI Homo sapiens 16.55 Down 2.67E-04 cDNA clone IMAGE:2330206 3, mRNA sequence AK091766 Homo sapiens cDNA FLJ34447 fis, clone 16.5 Down 7.84E-05

HLUNG2002059 AA682863 zj15g10.s1 Soares_fetal_liver_spleen_1 NFLS_S1 16.29 Down 4.28E-05

Homo sapiens cDNA clone IMAGE:450402 3 similar to contains AIu repetitive element;contains element L1 repetitive element ;, mRNA sequence AK126699 Homo sapiens cDNA FLJ44745 fis, clone 16.2 Down 1.33E-04


AB095935 Homo sapiens mRNA for KIAA2015 protein 16.13 Down 2.04E-04 BQ02791 UI-H-CO0-arf-d-03-0-Ul.s1 NCI_CGAP_Sub9 Homo 16.04 Down 2.69E-05 0 sapiens cDNA clone I MAG E :3106204 3, mRNA sequence

NM_0041 Homo sapiens solute carrier family 1 (glial high affinity 15.99 Down 1.18E-05 72 glutamate transporter), member 3 (SLC1A3), mRNA

AW13498 UI-H-BI1 -abt-a-09-0-Ul.s1 NCI_CGAP_Sub3 Homo 15.9 Down 4.07E-04 0 sapiens cDNA clone I MAG E :2712857 3, mRNA sequence NM 0017 Homo sapiens CD1 D antigen, d polypeptide (CD1 D), 15.75 Down 1.91E-04

66 mRNA

BQ02371 UI-1-BB1 p-auy-b-08-0-Ul.s1 NCI_CGAP_PI6 Homo 15.61 Down 6.91 E-05 3 sapiens cDNA clone UI-1 -BB1 p-auy-b-08-0-UI 3, mRNA sequence

BQ00084 UI-H-DH1 -axj-a-04-0-Ul.s1 NCI CGAP DH1 Homo 15.41 Down 1.61E-05 3 sapiens cDNA clone IMAGE:5829387 3, mRNA sequence

NM_0005 Homo sapiens insulin-like growth factor binding 15.37 Down 3.35E-05 99 protein 5 (IGFBP5), mRNA

NM_0212 Homo sapiens ras homolog gene family, member U 15.34 Down 5.25E-06 05 (RHOU), mRNA

NM 0031 Homo sapiens sortilin-related receptor, L(DLR class) 15.1 Down 5.34E-06 05 A repeats-containing (SORL1 ), mRNA

NM_0210 Homo sapiens neurofilament, heavy polypeptide 15.1 Down 6.57E-05 76 20OkDa (NEFH), mRNA

NM 0208 Homo sapiens signal-induced proliferation-associated 15.05 Down 4.58E-06

08 1 like 2 (SIPA1 L2), mRNA

NM 1994 Homo sapiens zinc finger protein 334 (ZNF334), 14.89 Down 2.40E-05

41 transcript variant 2, mRNA

NM 0053 Homo sapiens histone 1 , H1d (HIST1 H1 D), mRNA 14.87 Down 1.62E-03


AW97107 EST383156 MAGE resequences, MAGK Homo 14.85 Down 4.72E-04

0 sapiens cDNA, mRNA sequence

AA705451 zj90h09.s1 Soares fetaljiver spleen i NFLS S1 14.73 Down 9.25E-05

Homo sapiens cDNA clone IMAGE:462209 3, mRNA sequence

BC036918 Homo sapiens, clone IMAGE:5200551 , mRNA 14.72 Down 4.97E-04

NM 0330 Homo sapiens cytokine induced protein 29 kDa 14.56 Down 7.48E-05

82 (CIP29), mRNA

AW27443 xs62cO3.x1 NCI_CGAP_Kid1 1 Homo sapiens cDNA 14.49 Down 1.90E-04

4 clone IMAGE:2774212 3 similar to gb:X5641 1_rna1


(HUMAN);, mRNA sequence

NM 0319 Homo sapiens ARG99 protein (ARG99), mRNA 14.48 Down 4.52E-05


NM 0054 Homo sapiens BENE protein (BENE), mRNA 14.47 Down 8.09E-05


BU536871 AGENCOURTJ 0224340 NIH_MGC_141 Homo 14.42 Down 3.09E-05 sapiens cDNA clone IMAGE:6565454 5, mRNA sequence

NM_1749 Homo sapiens zinc finger protein 42 (ZFP42), mRNA 14.31 Down 2.48E-05


BF514910 UI-H-BW1 -anp-a-1 1 -0-Ul.s1 NCI_CGAP_Sub7 Homo 14.23 Down 5.30E-04 sapiens cDNA clone IMAGE:3083036 3, mRNA sequence

AA738254 nx13bO2.s1 NCI CGAP GC3 Homo sapiens cDNA 14.21 Down 1.49E-05 clone IMAGE:1255947 3, mRNA sequence

NMJ 523 Homo sapiens BTB (POZ) domain containing 1 1 14.12 Down 1.58E-04

22 (BTBD1 1 ), mRNA

NM_0057 Homo sapiens HERV-H LTR-associating 1 (HHLA1 ), 14.07 Down 2.57E-04

12 mRNA

NM_0041 Homo sapiens FK506 binding protein 5 (FKBP5), 13.98 Down 1.99E-03

17 mRNA

AI469032 ti70a01 .x1 NCI_CGAP_Kid1 1 Homo sapiens cDNA 13.95 Down 1.15E-05 clone IMAGE:2137320 3, mRNA sequence

BG20847 RST27977 Athersys RAGE Library Homo sapiens 13.92 Down 2.75E-03

5 cDNA, mRNA sequence

NM 1735 Homo sapiens abhydrolase domain containing 7 13.92 Down 1.75E-05

67 (ABHD7), mRNA

NM 1750 Homo sapiens trace amine receptor 3 (TRAR3), 13.88 Down 3.23E-04

57 mRNA

AV705892 AV705892 ADB Homo sapiens cDNA clone 13.84 Down 3.71 E-04

ADBACD06 5, mRNA sequence

NM 0169 Homo sapiens F1 1 receptor (F1 1 R), transcript variant 13.77 Down 5.45E-05 46 1 , mRNA

CD72401 oj29c06.y1 Human lacrimal gland, unamplified: oj 13.66 Down 1.49E-05 5 Homo sapiens cDNA clone oj29c06 5, mRNA sequence

NM 0010 Homo sapiens somatostatin receptor 1 (SSTR1 ), 13.62 Down 1.29E-04

49 mRNA

BQ00340 UI-H-EI1 -azd-j-23-0-Ul.s1 NCI CGAP EI1 Homo 13.46 Down 3.41 E-05 1 sapiens cDNA clone IMAGE:5847286 3, mRNA sequence

NM 0155 Homo sapiens Src homology 3 domain-containing 13.42 Down 8.84E-06 95 guanine nucleotide exchange factor (SGEF), mRNA

AL834140 Homo sapiens mRNA; cDNA DKFZp434A2029 (from 13.4 Down 5.72E-06 clone DKFZp434A2029)

NM 0006 Homo sapiens complement component (3b/4b) 13.36 Down 7.05E-04 51 receptor 1 , including Knops blood group system

(CR1 ), transcript variant S, mRNA NM 0143 Homo sapiens chromosome 6 open reading frame 54 13.36 Down 8.64E-06

54 (C6orf54), mRNA

AK128288 Homo sapiens cDNA FLJ46426 fis, clone 13.26 Down 1.62E-05


NM_1980 Homo sapiens olfactory receptor, family 2, subfamily 13.16 Down 5.37E-04 74 C, member 3 (OR2C3), mRNA

BU569968 AGENCOURT 10399836 NIH MGC 82 Homo 13.06 Down 7.75E-04 sapiens cDNA clone I MAG E :6618060 5, mRNA sequence AI831847 wi52fO4.x1 NCI CGAP Coi 6 Homo sapiens cDNA 13.04 Down 3.58E-05 clone IMAGE:2393887 3, mRNA sequence BQ02511 UI-1-BB1 p-att-h-01 -0-Ul.s1 NCI CGAP PI6 Homo 13.04 Down 1.02E-04 3 sapiens cDNA clone UI-1 -BB1 p-att-h-01 -0-UI 3, mRNA sequence AI215024 qg66e1 1.x1 Soares testis NHT Homo sapiens cDNA 13.02 Down 2.40E-05 clone IMAGE:1840172 3, mRNA sequence NM_0039 Homo sapiens kynureninase (L-kynurenine hydrolase) 13.01 Down 2.60E-05 37 (KYNU), mRNA

NM_0005 Homo sapiens insulin-like growth factor binding 13 Down 7.68E-04 99 protein 5 (IGFBP5), mRNA

NM 0041 Homo sapiens serine (or cysteine) proteinase 12.87 Down 4.07E-05

55 inhibitor, clade B (ovalbumin), member 9 (SERPINB9), mRNA

BI257441 602967789F1 NIH MGC 12 Homo sapiens cDNA 12.68 Down 7.79E-05 clone IMAGE:5107127 5, mRNA sequence AI559193 tq42hO1.x1 NCI CGAP UtI Homo sapiens cDNA 12.51 Down 2.07E-05 clone IMAGE:221 1505 3, mRNA sequence AK092371 Homo sapiens cDNA FLJ35052 fis, clone 12.47 Down 1.75E-04

OCBBF2018234, highly similar to GUANINE


GAMMA-2 SUBUNIT (G GAMMA-I) BC045828 Homo sapiens zinc finger protein 608, mRNA (cDNA 12.4 Down 1.86E-05 clone IMAGE:5262896), partial cds

NM_0177 Homo sapiens membrane progestin receptor gamma 12.29 Down 4.85E-06 05 (MPRG), mRNA

BE350271 ht12dO7.x1 NCI_CGAP_Kid13 Homo sapiens cDNA 12.17 Down 5.45E-05 clone IMAGE:3146509 3, mRNA sequence NM 0040 Homo sapiens E2F transcription factor 2 (E2F2), 12.13 Down 3.20E-04 91 mRNA

NM 0042 Homo sapiens Kruppel-like factor 4 (gut) (KLF4), 12.13 Down 1.03E-04 35 mRNA

R42627 ygO3cO4.s1 Soares infant brain 1 NIB Homo sapiens 12.09 Down 5.79E-05 cDNA clone IMAGE:31069 3, mRNA sequence NM 0025 Homo sapiens natriuretic peptide precursor B 12.07 Down 4.09E-04 21 (NPPB), mRNA

BC007901 Homo sapiens hypothetical protein BC007901 , mRNA 12.01 Down 5.34E-06

(cDNA clone IMAGE:4139786), partial cds BC052289 Homo sapiens carboxypeptidase A4, mRNA (cDNA 12.01 Down 1.17E-05 clone MGC:59749 I MAG E :6106874), complete cds BG62068 602619569F1 NIH_MGC_79 Homo sapiens cDNA 1 1 .99 Down 3.08E-04

I clone IMAGE:4733273 5, mRNA sequence BM99189 UI-H-DF1 -auk-h-02-0-Ul.s1 NCI_CGAP_DF1 Homo 1 1 .98 Down 6.56E-05 0 sapiens cDNA clone IMAGE:5870641 3, mRNA sequence AL833276 Homo sapiens mRNA; cDNA DKFZp451 D088 (from 1 1 .81 Down 1.22E-05 clone DKFZp451 D088) NM 2034 Homo sapiens similar to RIKEN cDNA 2600017H02 1 1.8 Down 3.80E-06

I I (LOC92162), mRNA

NM 0059 Homo sapiens myosin, heavy polypeptide 10, non- 1 1 .73 Down 7.36E-05 64 muscle (MYH 10), mRNA NM_1720 Homo sapiens pleckstrin homology domain 1 1 .72 Down 9.58E-04 69 containing, family H (with MyTH4 domain) member 2

(PLEKHH2), mRNA BX647313 Homo sapiens mRNA; cDNA DKFZp686N1593 (from 1 1 .72 Down 3.81 E-05 clone DKFZp686N1593) AI355761 qt94a1 1.x1 NCI_CGAP_Co14 Homo sapiens cDNA 1 1 .61 Down 7.22E-05 clone IMAGE:1962908 3 similar to gb:X74929

KERATIN, TYPE Il CYTOSKELETAL 8 (HUMAN);, mRNA sequence BC029048 Homo sapiens cDNA clone IMAGE:5184198, partial 1 1 .54 Down 4.79E-05 cds

NM 0055 Homo sapiens lamin B1 (LMNB1 ), mRNA 1 1.52 Down 3.01 E-04 73

NM 0249 Homo sapiens stearoyl-CoA desaturase 4 (SCD4), 1 1 .52 Down 1.01 E-04 06 mRNA

NM 0215 Homo sapiens ICEBERG caspase-1 inhibitor 1 1 .49 Down 3.55E-05 71 (ICEBERG), mRNA

W93585 zd95gO1 .s1 Soares_fetal_heart_NbHH19W Homo 1 1 .44 Down 1.37E-05 sapiens cDNA clone IMAGE:357264 3, mRNA sequence BF515657 UI-H-BW1 -anu-e-05-0-Ul.s1 NCI_CGAP_Sub7 Homo 1 1 .43 Down 2.80E-04 sapiens cDNA clone IMAGE:3083601 3, mRNA sequence BX394270 BX394270 Homo sapiens NEUROBLASTOMA COT 1 1 .42 Down 5.40E-04

25-NORMALIZED Homo sapiens cDNA clone

CS0DC012YB18 5-PRIME, mRNA sequence NM 0024 Homo sapiens msh homeo box homolog 2 1 1 .38 Down 1.17E-05 49 (Drosophila) (MSX2), mRNA

NM 0065 Homo sapiens IGF-II mRNA-binding protein 1 (IMP- 1 1 .14 Down 9.96E-05 46 1 ), mRNA

AF339810 Homo sapiens clone IMAGE:27725, mRNA sequence 1 1.11 Down 4.38E-04 AK002005 Homo sapiens cDNA FLJ1 1143 fis, clone 1 1 .02 Down 3.15E-05

PLACE 1006598 BX109483 BX109483 NCI_CGAP_Ov23 Homo sapiens cDNA 10.96 Down 1.39E-05 clone IMAGp998C165481 ; IMAGE:2216391 , mRNA sequence

NM_0314 Homo sapiens coiled-coil domain containing 3 10.92 Down 3.80E-06 55 (CCDC3), mRNA

NM 0183 Homo sapiens chondroitin betai ,4 N- 10.92 Down 1.16E-05 71 acetylgalactosaminyltransferase (ChGn), mRNA

BI828460 603078228F1 NIH MGC 1 19 Homo sapiens cDNA 10.91 Down 8.87E-04 clone IMAGE:5169846 5, mRNA sequence NM 0021 Homo sapiens hydroxysteroid (17-beta) 10.77 Down 1.02E-04 53 dehydrogenase 2 (HSD17B2), mRNA

NM 0226 Homo sapiens homeo box C8 (HOXC8), mRNA 10.67 Down 8.57E-04 58

BX1 16041 BX1 16041 Soares_fetal_liver_spleen_1 NFLS S1 10.61 Down 1.39E-03

Homo sapiens cDNA clone IMAGp998A091007 ;

IMAGE:428816, mRNA sequence

AI762202 wi54b12.x1 NCI_CGAP_Co16 Homo sapiens cDNA 10.61 Down 7.60E-04 clone IMAGE:2394047 3, mRNA sequence

NM 0530 Homo sapiens serine protease HTRA3 (HTRA3), 10.49 Down 2.69E-05

44 mRNA

D62676 HUM313C12B Clontech human aorta polyA+ mRNA 10.48 Down 7.08E-06

(#6572) Homo sapiens cDNA clone GEN-313C12 5, mRNA sequence

BQ72304 AGENCOURT 8109275 Lupski sympathetic trunk 10.45 Down 1.16E-05 2 Homo sapiens cDNA clone IMAGE:6189569 5, mRNA sequence

NM 0246 Homo sapiens hypothetical protein FLJ1 1795 10.3 Down 1 .37E-05

69 (FLJ1 1795), mRNA

NM 0022 Homo sapiens keratin 8 (KRT8), mRNA 10.27 Down 4.36E-05


NMJ813 Homo sapiens inhibitor of DNA binding 1 , dominant 10.25 Down 2.59E-04

53 negative helix-loop-helix protein (ID1 ), transcript variant 2, mRNA

R67051 yi30b07.s1 Soares placenta Nb2HP Homo sapiens 10.24 Down 6.87E-04 cDNA clone IMAGE:140725 3, mRNA sequence

NM 0166 Homo sapiens dapper homolog 1 , antagonist of beta- 10.24 Down 9.08E-05

51 " catenin (xenopus) (DACT1 ), mRNA

NM 0178 Homo sapiens RAB20, member RAS oncogene family 10.15 Down 1.08E-04

17 " (RAB20), mRNA

NM 0051 Homo sapiens CCAAT/enhancer binding protein 10.15 Down 4.25E-04

95 " (C/EBP), delta (CEBPD), mRNA

NM 0040 Homo sapiens ephrin-B2 (EFNB2), mRNA 10.11 Down 1.22E-03

93 "

NM 0132 Homo sapiens ubiquitin-like, containing PHD and 10.06 Down 1.18E-02

82 " RING finger domains, 1 (UHRF1 ), mRNA

NM _0123 Homo sapiens monocyte to macrophage 10.05 Down 3.41 E-05

29 differentiation-associated (MMD), mRNA

AW29200 UI-H-BI2-agt-g-04-0-Ul.s1 NCI_CGAP_Sub4 Homo 10.04 Down 7.72E-05

4 sapiens cDNA clone IMAGE:2725447 3, mRNA sequence

NM 0142 Homo sapiens a disintegrin-like and metalloprotease 10.04 Down 1.50E-04

43 " (reprolysin type) with thrombospondin type 1 motif, 3


NM _1813 Homo sapiens neuroligin 4, X-linked (NLGN4X), 9.94 Down 8.86E-06

32 transcript variant 2, mRNA

NM _0065 Homo sapiens IGF-II mRNA-binding protein 3 (IMP- 9.94 Down 4.91 E-06

47 3), mRNA

NM 2014 Homo sapiens deubiquitinating enzyme 3 (DUB3), 9.87 Down 1 .21 E-03

02 " mRNA

NM 0224 Homo sapiens SRY (sex determining region Y)-box 9.86 Down 8.64E-06

54 " 17 (SOX17), mRNA

BM98162 UI-CF-EN1-adi-e-14-0-Ul.s1 UI-CF-EN1 Homo 9.86 Down 1 .55E-04

4 sapiens cDNA clone UI-CF-EN1-adi-e-14-0-UI 3, mRNA sequence

AA810126 Od13d02.s1 NCI CGAP GCB1 Homo sapiens cDNA 9.85 Down 9.41 E-04 clone IMAGE:136781 1 3 similar to TR:Q06835

Q06835 CHROMOSOME XVI COSMID 9513. ;, mRNA sequence

NM 0216 Homo sapiens potassium intermediate/small 9.73 Down 3.15E-05 14 conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 1 , mRNA BF511205 UI-H-BI4-aoi-e-03-0-Ul.s1 NCI_CGAP_Sub8 Homo 9.71 Down 4.38E-05 sapiens cDNA clone IMAGE:3085132 3, mRNA sequence

NM_0307 Homo sapiens collectin sub-family member 12 9.69 Down 2.32E-05 81 (COLEC12), transcript variant II, mRNA

AW29723 UI-H-BW0-aji-a-05-0-Ul.s1 NCI_CGAP_Sub6 Homo 9.6 Down 1.12E-03 5 sapiens cDNA clone IMAGE:2731688 3, mRNA sequence

NM_0000 Homo sapiens Bloom syndrome (BLM), mRNA 9.58 Down 5.43E-05


BX089820 BX089820 NCI_CGAP_GC4 Homo sapiens cDNA 9.57 Down 2.36E-05 clone IMAGp998P103846 ; IMAGE:1519353, mRNA sequence

NM 0188 Homo sapiens EGF-containing fibulin-like 9.53 Down 2.00E-04

94 " extracellular matrix protein 1 (EFEMP1 ), transcript variant 2, mRNA

NM 0322 Homo sapiens synaptotagmin III (SYT3), mRNA 9.52 Down 1.14E-04

98 "

NM 0001 Homo sapiens cytochrome P450, family 1 , subfamily 9.52 Down 1 .05E-04

04 " B, polypeptide 1 (CYP1 B1 ), mRNA

NM 0041 Homo sapiens gamma-glutamyltransferase-like 9.51 Down 2.74E-04

21 " activity 1 (GGTLA1 ), mRNA

BF514016 UI-H-BW1 -amv-f-04-0-Ul.s1 NCI_CGAP_Sub7 Homo 9.48 Down 3.15E-05 sapiens cDNA clone IMAGE:3071359 3, mRNA sequence

NM_0024 Homo sapiens necdin homolog (mouse) (NDN), 9.47 Down 1 .32E-05 87 mRNA

BQ02784 UI-H-COO-are-c-06-O-Ul.si NCI_CGAP_Sub9 Homo 9.45 Down 4.58E-04 2 sapiens cDNA clone IMAGE:3106161 3, mRNA sequence

T92950 ye27c10.s1 Stratagene lung (#937210) Homo sapiens 9.37 Down 1 .43E-03 cDNA clone IMAGE:1 18962 3, mRNA sequence

NM 0176 Homo sapiens chromosome 20 open reading frame 9.34 Down 1 .62E-05

71 42 (C20orf42), mRNA

AA609790 ae62aO2.s1 Stratagene lung carcinoma 937218 9.33 Down 1 .09E-04

Homo sapiens cDNA clone IMAGE:951434 3, mRNA sequence

AA558468 nk39cO6.s1 NCI CGAP GC2 Homo sapiens cDNA 9.31 Down 1 .46E-05 clone IMAGE:1015882 3 similar to TR:G927300


OY11 .1 DNA SEQUENCE. ;, mRNA sequence

AI917709 tt11 b01.x1 NCI CGAP GC6 Homo sapiens cDNA 9.31 Down 2.22E-05 clone IMAGE:2240425 3, mRNA sequence

NM 0227 Homo sapiens homeodomain interacting protein 9.29 Down 7.59E-04

40 " kinase 2 (HIPK2), mRNA

NM 0124 Homo sapiens regulator of G-protein signalling 17 9.27 Down 5.63E-05

19 " (RGS17), mRNA

NM _0248 Homo sapiens hypothetical protein FLJ12735 9.26 Down 6.17E-04

57 (FLJ12735), mRNA

NM _0166 Homo sapiens dapper homolog 1 , antagonist of beta- 9.26 Down 8.72E-05

51 catenin (xenopus) (DACT1 ), mRNA

NM _0070 Homo sapiens stathmin-like 2 (STMN2), mRNA 9.24 Down 1.29E-04


AA608841 af83gO4.s1 Soares testis NHT Homo sapiens cDNA 9.23 Down 2.71 E-04 clone IMAGE:1048662 3, mRNA sequence NM_0021 Homo sapiens inhibitor of DNA binding 1 , dominant 9.22 Down 5.17E-04 65 negative helix-loop-helix protein (ID1 ), transcript variant 1 , mRNA BC062792 Homo sapiens cDNA clone IMAGE:4807322, partial 9.21 Down 8.84E-06 cds BX398693 BX398693 Homo sapiens PLACENTA COT 25- 9.21 Down 3.65E-04

NORMALIZED Homo sapiens cDNA clone

CS0DI062YJ20 3-PRIME, mRNA sequence AA199830 zq75hO1 .r1 Stratagene hNT neuron (#937233) Homo 9.2 Down 4.14E-04 sapiens cDNA clone I MAG E :647473 5, mRNA sequence

NM 0306 Homo sapiens cytoplasmic polyadenylation element 9.19 Down 1.75E-04 27 binding protein 4 (CPEB4), mRNA

NM 0182 Homo sapiens hypothetical protein FLJ10901 9.16 Down 1.58E-05 65 (FLJ10901 ), mRNA

NM 0004 Homo sapiens collagen, type IV, alpha 5 (Alport 9.16 Down 2.29E-04 95 syndrome) (COL4A5), transcript variant 1 , mRNA

AW97650 EST388609 MAGE resequences, MAGN Homo 9.15 Down 2.47E-04 0 sapiens cDNA, mRNA sequence

NM 0165 Homo sapiens Mst3 and SOK1 -related kinase 9.12 Down 8.82E-05 42 (MST4), mRNA

W69644 zd45f10.r1 Soares_fetal_heart_NbHH19W Homo 9.11 Down 6.32E-05 sapiens cDNA clone IMAGE:343627 5, mRNA sequence

NM 0306 Homo sapiens cytochrome P450, family 2, subfamily 9.1 Down 1.02E-04 22 S, polypeptide 1 (CYP2S1 ), mRNA

BG38932 602413981 F1 NIH MGC 92 Homo sapiens cDNA 9.08 Down 8.95E-04 8 clone IMAGE:4522269 5, mRNA sequence

BM66915 UI-E-DW0-agj-p-19-0-Ul.s2 UI-E-DWO Homo sapiens 9.08 Down 1.09E-05 7 cDNA clone UI-E-DW0-agj-p-19-0-UI 3, mRNA sequence AL832779 Homo sapiens mRNA; cDNA DKFZp686H157 (from 9.04 Down 7.72E-05 clone DKFZp686H157) BE789623 601481574F1 NIH_MGC_68 Homo sapiens cDNA 8.98 Down 4.09E-04 clone IMAGE:3884107 5, mRNA sequence BF1 12121 7l40f02.x1 Soares_NSF_F8_9W_OT_PA_P_S1 8.95 Down 1.01E-04

Homo sapiens cDNA clone IMAGE:3524090 3, mRNA sequence AI376773 te58f10.x1 Soares NFL T GBC SI Homo sapiens 8.94 Down 4.47E-05 cDNA clone IMAGE:2090923 3 similar to contains element MER32 repetitive element ;, mRNA sequence BI256889 602974985F1 NIH_MGC_12 Homo sapiens cDNA 8.91 Down 1.97E-04 clone IMAGE:51 14229 5, mRNA sequence NM_0068 Homo sapiens leukocyte immunoglobulin-like 8.89 Down 5.90E-04 63 receptor, subfamily A (with TM domain), member 1


AW10517 xd81 d10.x1 Soares NFL T GBC SI Homo sapiens 8.88 Down 9.56E-05 0 cDNA clone IMAGE:2604019 3, mRNA sequence

AA994330 ou33h05.s1 Soares NFL T GBC SI Homo sapiens 8.87 Down 2.66E-05 cDNA clone IMAGE:1628121 3, mRNA sequence NM_0220 Homo sapiens family with sequence similarity 38, 8.87 Down 5.41 E-04 68 member B (FAM38B), mRNA

BX537704 Homo sapiens mRNA; cDNA DKFZp686H01244 8.86 Down 2.35E-05

(from clone DKFZp686H01244) BC036241 Homo sapiens, clone IMAGE:5299049, mRNA, partial 8.82 Down 1.75E-04 cds NM 0059 Homo sapiens mannosidase, alpha, class 1 A, 8.81 Down 1.34E-03

07 member 1 (MAN1A1 ), mRNA

NM 0009 Homo sapiens neuropeptide Y (NPY), mRNA 8.77 Down 9.53E-06


AI766299 wh71c10.x1 NCI_CGAP_Kid11 Homo sapiens cDNA 8.77 Down 2.50E-03 clone IMAGE:2386194 3, mRNA sequence AI694344 wd45f1 1 .x1 Soares NFL T GBC SI Homo sapiens 8.76 Down 8.20E-04 cDNA clone IMAGE:2331 1 17 3 similar to contains

MER13.b1 MER13 repetitive element ;, mRNA sequence

BQ02585 UI-1-BB1 p-ayf-b-12-0-Ul.s1 NCI_CGAP_PI6 Homo 8.74 Down 3.13E-03 1 sapiens cDNA clone UI-1 -BB1 p-ayf-b-12-0-UI 3, mRNA sequence

NM 0062 Homo sapiens phosphodiesterase 4D, cAMP-specific 8.73 Down 4.20E-05 03 (phosphodiesterase E3 dunce homolog, Drosophila)


BQ18683 UI-E-EJ1 -ajy-a-22-0-Ul.r1 UI-E-EJ1 Homo sapiens 8.73 Down 3.65E-03 5 cDNA clone UI-E-EJ1-ajy-a-22-0-UI 5, mRNA sequence

AF462446 Homo sapiens unknown mRNA 8.72 Down 6.57E-04 NM_0016 Homo sapiens amphiregulin (schwannoma-derived 8.71 Down 8.05E-05 57 growth factor) (AREG), mRNA

NM 0065 Homo sapiens IGF-II mRNA-binding protein 3 (IMP- 8.7 Down 1.48E-05 47 3), mRNA

NM 0251 Homo sapiens chromosome 21 open reading frame 8.69 Down 5.81E-05

43 96 (C21 orf96), mRNA

CB045230 NISC_gc09b10.x1 NCI CGAP Coi 7 Homo sapiens 8.68 Down 2.54E-04 cDNA clone IMAGE:3218250 3, mRNA sequence

AI289329 qw28cO9.x1 NCI_CGAP_Ut4 Homo sapiens cDNA 8.65 Down 1.56E-05 clone I MAGE: 1992400 3 similar to contains L1 .b2 L1 repetitive element ;, mRNA sequence

BQ02582 UI-1-BB1 p-aye-f-10-0-Ul.s1 NCI_CGAP_PI6 Homo 8.55 Down 2.05E-05

1 sapiens cDNA clone UI-1 -BB1 p-aye-f-10-0-UI 3, mRNA sequence

AA723061 zg83cO2.s1 Soares_fetal_heart_NbHH19W Homo 8.55 Down 4.08E-04 sapiens cDNA clone IMAGE:399938 3, mRNA sequence

NM 1749 Homo sapiens hypothetical protein FLJ31204 8.52 Down 2.00E-04

12 (FLJ31204), mRNA

NM_0014 Homo sapiens fatty acid binding protein 5 (psoriasis- 8.52 Down 1.75E-05

44 associated) (FABP5), mRNA

NM 0045 Homo sapiens receptor tyrosine kinase-like orphan 8.51 Down 7.95E-06

60 receptor 2 (ROR2), mRNA

AI417237 tg76eO4.x1 Soares NhHMPu SI Homo sapiens 8.5 Down 1.48E-05 cDNA clone IMAGE:21 14718 3, mRNA sequence BM99176 UI-H-DF1 -auk-i-02-0-Ul.s1 NCI CGAP DF1 Homo 8.48 Down 1.15E-02 3 sapiens cDNA clone IMAGE:5870665 3, mRNA sequence BX102707 BX102707 NCI_CGAP_GC6 Homo sapiens cDNA 8.47 Down 2.56E-04 clone IMAGp998K165725 ; IMAGE:2310279, mRNA sequence BU681670 UI-CF-EC1-abw-a-1 1 -0-Ul.s1 UI-CF-EC1 Homo 8.47 Down 1.64E-04 sapiens cDNA clone UI-CF-EC1 -abw-a-1 1 -0-UI 3, mRNA sequence BQ02401 UI-1-BB1 p-auu-f-02-0-Ul.s1 NCI_CGAP_PI6 Homo 8.44 Down 1.28E-04

8 sapiens cDNA clone UI-1 -BB1 p-auu-f-02-0-UI 3, mRNA sequence BM70364 U I-E-CL 1 -aff-e-02-O-U I . r1 UI-E-CL1 Homo sapiens 8.43 Down 1.79E-05 5 cDNA clone U I-E-CL 1 -aff-e-02-O-U I 5, mRNA sequence

NM OOOO Homo sapiens breast cancer 2, early onset (BRCA2), 8.43 Down 5.45E-05 59 mRNA

AK026981 Homo sapiens cDNA: FLJ23328 fis, clone HEP12645 8.42 Down 5.71 E-03 NM 0025 Homo sapiens oxidised low density lipoprotein (lectin- 8.41 Down 4.45E-04

43 like) receptor 1 (0LR1 ), mRNA

AA812812 ai80a03.s1 Soares testis NHT Homo sapiens cDNA 8.39 Down 3.46E-04 clone 1377100 3, mRNA sequence AA012915 ze27cO1 .s1 Soares retina N2b4HR Homo sapiens 8.36 Down 1.86E-03 cDNA clone I M AG E: 360192 3, mRNA sequence BU608856 UI-CF-FN0-aeq-b-12-0-Ul.s1 UI-CF-FNO Homo 8.36 Down 3.12E-04 sapiens cDNA clone UI-CF-FNO-aeq-b-12-O-UI 3, mRNA sequence AL574011 AL57401 1 Homo sapiens PLACENTA COT 25- 8.33 Down 3.19E-04

NORMALIZED Homo sapiens cDNA clone

CS0DI053YJ04 3-PRIME, mRNA sequence BX647876 Homo sapiens mRNA; cDNA DKFZp313A1525 (from 8.31 Down 1.06E-04 clone DKFZp313A1525) NM_1384 Homo sapiens potassium channel tetramerisation 8.31 Down 6.91E-05

44 domain containing 12 (KCTD12), mRNA NM 0063 Homo sapiens nuclear DNA-binding protein (C1 D), 8.3 Down 2.89E-06 33 transcript variant 1 , mRNA

NM 0189 Homo sapiens phosphodiesterase 7B (PDE7B), 8.26 Down 7.76E-05

45 mRNA

CA416106 UI-H-FE0-bbs-f-17-0-Ul.s1 NCI_CGAP_FEO Homo 8.23 Down 5.52E-05 sapiens cDNA clone UI-H-FE0-bbs-f-17-0-UI 3, mRNA sequence

NM_0025 Homo sapiens neurotensin receptor 1 (high affinity) 8.21 Down 1.75E-05 31 (NTSR1 ), mRNA

AK092078 Homo sapiens cDNA FLJ34759 fis, clone 8.18 Down 2.35E-05

NT2NE2001874 AI972618 wr41 bO4.x1 NCI_CGAP_Pr28 Homo sapiens cDNA 8.12 Down 2.33E-05 clone IMAGE:2490223 3, mRNA sequence BG68002 602626769F1 NCI_CGAP_Skn4 Homo sapiens cDNA 8.09 Down 2.01E-04 9 clone IMAGE:4751705 5, mRNA sequence

AW46743 he17dO5.x1 NCI_CGAP_CML1 Homo sapiens cDNA 8.08 Down 4.17E-04

7 clone IMAGE:2919273 3, mRNA sequence NM 0314 Homo sapiens Ras association (RalGDS/AF-6) 8.05 Down 8.35E-05 37 domain family 5 (RASSF5), transcript variant 4, mRNA AI6881 1 1 wc92g12.x1 NCI_CGAP_Co3 Homo sapiens cDNA 8.04 Down 1.29E-03 clone IMAGE:2326150 3, mRNA sequence AB011540 Homo sapiens mRNA for MEGF7, partial cds 8.04 Down 1.91E-04 AI921931 wn86g12.x1 NCI CGAP UtI Homo sapiens cDNA 7.99 Down 2.30E-04 clone IMAGE:2452774 3 similar to WP:C03B1.10

CE03911 ;, mRNA sequence

NM_0045 Homo sapiens plakophilin 2 (PKP2), transcript variant 7.97 Down 5.25E-05 72 2b, mRNA

AW00526 wv80g06.x1 Soares thymus NHFTh Homo sapiens 7.96 Down 9.40E-05 9 cDNA clone IMAGE:2535898 3, mRNA sequence

NM 0185 Homo sapiens MCM10 minichromosome 7.94 Down 1.03E-04 18 maintenance deficient 10 (S. cerevisiae) (MCM10), transcript variant 2, mRNA AW96857 EST380654 MAGE resequences, MAGJ Homo 7.94 Down 1.36E-05

8 sapiens cDNA, mRNA sequence BX089010 BX089010 Soares testis NHT Homo sapiens cDNA 7.93 Down 8.66E-04 clone IMAGp998L133476 ; IMAGE:1377180, mRNA sequence AK021443 Homo sapiens cDNA FLJ1 1381 fis, clone 7.9 Down 3.57E-05


NM 0190 Homo sapiens DNA-damage-inducible transcript 4 7.85 Down 4.93E-04 58 (DDIT4), mRNA

NM 0033 Homo sapiens UDP glycosyltransferase 8 (UDP- 7.82 Down 8.39E-04 60 galactose ceramide galactosyltransferase) (UGT8), mRNA

NM 0191 Homo sapiens fibroblast growth factor 21 (FGF21 ), 7.8 Down 1.29E-03 13 mRNA

NM 0057 Homo sapiens glypican 6 (GPC6), mRNA 7.79 Down 1.92E-04 08

NM 0042 Homo sapiens Kruppel-like factor 4 (gut) (KLF4), 7.74 Down 2.58E-05 35 mRNA

NM 0017 Homo sapiens CD69 antigen (p60, early T-cell 7.73 Down 5.66E-05 81 activation antigen) (CD69), mRNA

AK094156 Homo sapiens cDNA FLJ36837 fis, clone 7.73 Down 2.60E-04

ASTRO201 1422

NM_1780 Homo sapiens tubulin, beta polypeptide paralog 7.67 Down 4.01E-05 12 (MGC8685), mRNA

BC042049 Homo sapiens hypothetical protein LOC339975, 7.67 Down 7.09E-06 mRNA (cDNA clone IMAGE:5548761 ), partial cds NM 0220 Homo sapiens egl nine homolog 3 (C. elegans) 7.66 Down 3.11E-04 73 (EGLN3), mRNA

NM 0008 Homo sapiens gamma-aminobutyric acid (GABA) A 7.64 Down 3.57E-05 07 receptor, alpha 2 (GABRA2), mRNA

BC041487 Homo sapiens, clone IMAGE:5493056, mRNA 7.64 Down 3.97E-04 AI808757 wf57gO8.x1 Soares NFL T GBC SI Homo sapiens 7.64 Down 1.96E-03 cDNA clone IMAGE:2359742 3, mRNA sequence BU790302 in49dO4.y1 HR85 islet Homo sapiens cDNA clone 7.62 Down 1.86E-03

I MAG E :6125598 5, mRNA sequence

NM 0037 Homo sapiens aldo-keto reductase family 1 , member 7.6 Down 3.41 E-05 39 C3 (3-alpha hydroxysteroid dehydrogenase, type II)

(AKR1 C3), mRNA AA195265 zr36hO4.s1 Soares NhHMPu SI Homo sapiens 7.58 Down 7.52E-04 cDNA clone IMAGE:665527 3, mRNA sequence L40522 Homo sapiens (clone OL1 ) mRNA fragment 7.57 Down 7.48E-05 D29453 HUMNK566 Human epidermal keratinocyte Homo 7.51 Down 4.14E-05 sapiens cDNA clone 566, mRNA sequence NM_1832 Homo sapiens inversin (INVS), transcript variant 2, 7.5 Down 1.57E-03 45 mRNA

AF279782 Homo sapiens clone P1 NTera2D1 teratocarcinoma 7.5 Down 2.13E-05 mRNA BX647339 Homo sapiens mRNA; cDNA DKFZp779L1016 (from 7.49 Down 3.61E-04 clone DKFZp779L1016)

NM_1813 Homo sapiens inhibitor of DNA binding 1 , dominant 7.49 Down 1.06E-04 53 negative helix-loop-helix protein (ID1 ), transcript variant 2, mRNA

NM_0330 Homo sapiens Fanconi anemia, complementation 7.48 Down 7.48E-05 84 group D2 (FANCD2), mRNA

BX1 19298 BX1 19298 Soares_fetal_liver_spleen_1 NFLS_S1 7.48 Down 2.03E-04

Homo sapiens cDNA clone IMAGp998M171055 ;

IMAGE:447544, mRNA sequence BF435310 nab37hO7.x1 Soares_NSF_F8_9W_OT_PA_P_S1 7.44 Down 1.36E-04

Homo sapiens cDNA clone IMAGE:3268093 3, mRNA sequence

NM_0030 Homo sapiens solute carrier family 7 (cationic amino 7.43 Down 1.46E-05 46 acid transporter, y+ system), member 2 (SLC7A2), mRNA AI201230 qf70e03.x1 Soares testis NHT Homo sapiens cDNA 7.4 Down 1.36E-05 clone IMAGE:1755388 3, mRNA sequence BX108769 BX108769 Soa res fetal liver spleen 1 NFLS Homo 7.39 Down 1.59E-03 sapiens cDNA clone IMAGp998F0297 ;

IMAGE:1 15201 , mRNA sequence NM 0056 Homo sapiens claudin 1 1 (oligodendrocyte 7.38 Down 9.67E-06 02 transmembrane protein) (CLDN 1 1 ), mRNA

AK093202 Homo sapiens cDNA FLJ35883 fis, clone 7.3 Down 2.68E-04


AK024865 Homo sapiens cDNA: FLJ21212 fis, clone COL00502 7.3 Down 4.30E-05 BU754257 UI-1-BB1 p-atv-e-09-0-Ul.s1 NCI CGAP PI6 Homo 7.29 Down 4.94E-04 sapiens cDNA clone UI-1 -BB1 p-atv-e-09-0-UI 3, mRNA sequence

NM 0060 Homo sapiens deleted in lymphocytic leukemia, 2 7.25 Down 8.68E-05 21 (DLEU2), mRNA

AB067499 Homo sapiens mRNA for KIAA1912 protein, partial 7.18 Down 9.13E-04 cds

NM 0012 Homo sapiens CDC20 cell division cycle 20 homolog 7.18 Down 5.22E-05 55 (S. cerevisiae) (CDC20), mRNA

AK025173 Homo sapiens cDNA: FLJ21520 fis, clone COL05874 7.17 Down 2.60E-05 AV700621 AV700621 GKC Homo sapiens cDNA clone 7.17 Down 1.43E-04

GKCDKF09 3, mRNA sequence

NM 0169 Homo sapiens F1 1 receptor (F1 1 R), transcript variant 7.17 Down 3.19E-05 46 1 , mRNA

NM_0018 Homo sapiens hyaluronan and proteoglycan link 7.17 Down 1.37E-05 84 protein 1 (HAPLN1 ), mRNA

AW07171 ws54gO3.x1 NCI_CGAP_Brn25 Homo sapiens cDNA 7.17 Down 1.26E-04 6 clone IMAGE:2501044 3, mRNA sequence

BX104084 BX104084 Soares testis NHT Homo sapiens cDNA 7.17 Down 7.39E-04 clone IMAGp998N 18441 1 ; IMAGE:1736273, mRNA sequence

CD70322 EST19367 human nasopharynx Homo sapiens cDNA, 7.17 Down 1.62E-03 6 mRNA sequence

NM 0180 Homo sapiens neuropilin (NRP) and tolloid (TLL)-like 7.17 Down 1.48E-05

92 2 (NETO2), mRNA

NM 0177 Homo sapiens ribonuclease P 25kDa subunit 7.16 Down 8.20E-05

93 (RPP25), mRNA

NM 0331 Homo sapiens scinderin (SCIN), mRNA 7.15 Down 6.48E-05


NM_0176 Homo sapiens leucine rich repeat containing 16 7.14 Down 4.61E-04

40 (LRRC16), mRNA

BX102689 BX102689 NCI_CGAP_Pr28 Homo sapiens cDNA 7.12 Down 3.23E-04 clone IMAGp998N035163 ; IMAGE:2094530, mRNA sequence

CA865586 ir42eO9.x1 HR85 islet Homo sapiens cDNA clone 7.1 Down 2.30E-04 IMAGE:6547889 3, mRNA sequence

NM _1527 Homo sapiens hypothetical protein MGC35140 7.08 Down 2.89E-06

59 (MGC35140), mRNA

AI733620 an30a05.x5 Gessler Wilms tumor Homo sapiens 7.07 Down 1.93E-05 cDNA clone IMAGE:1700144 3, mRNA sequence

NM _0025 Homo sapiens proprotein convertase subtilisin/kexin 7.07 Down 4.35E-05

70 type 6 (PCSK6), transcript variant 1 , mRNA

NM 1525 Homo sapiens SH3 domain containing ring finger 2 7.04 Down 6.66E-05 50 (SH3RF2), mRNA

AI188023 qe14aO9.x1 Soares testis NHT Homo sapiens cDNA 7.02 Down 8.88E-04 clone IMAGE:1738936 3, mRNA sequence NM 0201 Homo sapiens exosome component 5 (EXOSC5), 7 Down 2.29E-04 58 mRNA

NM 0246 Homo sapiens FLJ2331 1 protein (FLJ2331 1 ), mRNA 6.98 Down 4.70E-04 80 AK095844 Homo sapiens cDNA FLJ38525 fis, clone 6.97 Down 3.16E-03


NM 0030 Homo sapiens surfactant, pulmonary-associated 6.95 Down 4.45E-05 18 protein C (SFTPC), mRNA

AI807813 wf50h08.x1 Soares NFL T GBC SI Homo sapiens 6.93 Down 6.29E-05 cDNA clone IMAGE:2359071 3, mRNA sequence AK026470 Homo sapiens cDNA: FLJ22817 fis, clone KAIA3476, 6.93 Down 5.49E-05 highly similar to AF172271 Homo sapiens Traf2 and

NCK interacting kinase splice variant 8 (TNIK) mRNA NM_0145 Homo sapiens endogenous retroviral family W, 6.93 Down 6.44E-04 90 env(C7), member 1 (syncytin) (ERVWE1 ), mRNA

NM 0195 Homo sapiens Rho guanine nucleotide exchange 6.93 Down 6.18E-05 55 factor (GEF) 3 (ARHGEF3), mRNA

AK021992 Homo sapiens cDNA FLJ1 1930 fis, clone 6.92 Down 1.67E-04

HEMBB1000441 AK001099 Homo sapiens cDNA FLJ10237 fis, clone 6.91 Down 2.79E-04

HEMBB1000438 NM_0022 Homo sapiens keratin, hair, basic, 6 (monilethrix) 6.91 Down 8.64E-06

84 (KRTHB6), mRNA

NM 0181 Homo sapiens hypothetical protein FLJ10474 6.9 Down 2.35E-05

04 (FLJ10474), mRNA

N55080 yv43cO3.s1 Soares fetal liver spleen 1 NFLS Homo 6.89 Down 2.48E-04 sapiens cDNA clone IMAGE:245476 3, mRNA sequence

NM 0168 Homo sapiens adducin 3 (gamma) (ADD3), transcript 6.88 Down 4.33E-05 24 variant 1 , mRNA

AW27700 xp59hO1 .x1 NCI_CGAP_Ov39 Homo sapiens cDNA 6.88 Down 3.87E-03 9 clone IMAGE:2744689 3, mRNA sequence

BM51040 ij41 bO9.y1 Human insulinoma Homo sapiens cDNA 6.87 Down 5.55E-05 9 clone IMAGE:5633249 5, mRNA sequence

NM_0025 Homo sapiens pre-B-cell leukemia transcription factor 6.85 Down 3.77E-05

85 1 (PBX1 ), mRNA

R63952 yi22dO1 .s1 Soares placenta Nb2HP Homo sapiens 6.84 Down 3.56E-05 cDNA clone IMAGE: 139969 3, mRNA sequence NM 1384 Homo sapiens shugoshin-like 1 (S. pombe) (SGOL1 ), 6.84 Down 1.17E-04 84 mRNA

NM 0016 Homo sapiens arachidonate 5-lipoxygenase- 6.84 Down 5.61E-05 29 activating protein (ALOX5AP), mRNA

AW61250 hhO3cO1 .x1 NCI CGAP Kidi 1 Homo sapiens cDNA 6.84 Down 9.88E-05 4 clone IMAGE:2954016 3, mRNA sequence

AI051962 ow83g08.x1 Soares_fetal_liver_spleen_1 NFLS_S1 6.82 Down 1.93E-03

Homo sapiens cDNA clone IMAGE:1653470 3 similar to gb:M28983 INTERLEUKIN-1 ALPHA PRECURSOR (HUMAN);, mRNA sequence NM 0054 Homo sapiens G protein-coupled receptor 51 6.81 Down 5.25E-05 58 (GPR51 ), mRNA

NM_0021 Homo sapiens interleukin 6 signal transducer (gp130, 6.8 Down 4.03E-03 84 oncostatin M receptor) (IL6ST), transcript variant 1 , mRNA NM 0153 Homo sapiens barren homolog (Drosophila) 6.8 Down 1.21E-03 41 (BRRN1 ), mRNA

AU130874 AU130874 NT2RP3 Homo sapiens cDNA clone 6.79 Down 2.98E-03

NT2RP3001589 5, mRNA sequence

NM_0045 Homo sapiens kinesin family member 1 1 (KIF11 ), 6.78 Down 1.35E-03 23 mRNA

NM 0319 Homo sapiens cell division cycle associated 7 6.77 Down 2.35E-05

42 (CDCA7), transcript variant 1 , mRNA

AI992077 ws21 eO4.x1 NCI_CGAP_GC6 Homo sapiens cDNA 6.77 Down 4.58E-05 clone IMAGE:2497854 3, mRNA sequence AK129643 Homo sapiens cDNA FLJ26132 fis, clone TMS03580 6.75 Down 4.39E-04 X97198 H. sapiens mRNA for receptor phosphate PCP-2 6.72 Down 9.08E-05 BF055144 7j75eO2.x1 Soares_NSF_F8_9W_OT_PA_P_S1 6.72 Down 1.38E-04

Homo sapiens cDNA clone I MAG E: 3392282 3, mRNA sequence BX091276 BX091276 Soa res fetal liver spleen 1 NFLS Homo 6.71 Down 1.81E-04 sapiens cDNA clone IMAGp998l12133 ;

IMAGE: 128723, mRNA sequence

XM 3030 Homo sapiens hypothetical gene supported by 6.7 Down 5.86E-04 46 D16477 (LOC349437), mRNA

AW83653 PM3-LT0032-301299-005-a09 LT0032 Homo sapiens 6.7 Down 2.32E-03 4 cDNA, mRNA sequence

AL079999 DKFZp586P2018_r1 586 (synonym: hutel ) Homo 6.7 Down 5.63E-04 sapiens cDNA clone DKFZp586P2018 5, mRNA sequence

BM98373 UI-CF-DU1 -aay-c-1 1 -0-Ul.s1 UI-CF-DU1 Homo 6.7 Down 5.00E-04 4 sapiens cDNA clone UI-CF-DU1-aay-c-11 -0-UI 3, mRNA sequence BC044933 Homo sapiens, clone IMAGE:4540326, mRNA, partial 6.7 Down 6.20E-05 cds AA486226 ab35e12.s1 Stratagene HeLa cell s3 937216 Homo 6.69 Down 5.96E-05 sapiens cDNA clone IMAGE:842830 3 similar to contains AIu repetitive element;contains element

MSR1 repetitive element ;, mRNA sequence BC036004 Homo sapiens, clone IMAGE:4730399, mRNA 6.68 Down 3.33E-05 BX648870 Homo sapiens mRNA; cDNA DKFZp686P21238 (from 6.67 Down 1.75E-05 clone DKFZp686P21238)

NM_0005 Homo sapiens insulin-like growth factor binding 6.67 Down 2.11E-05 97 protein 2, 36kDa (IGFBP2), mRNA

BM46260 AGENCOURT 6426368 NIH MGC 71 Homo 6.66 Down 2.96E-04 0 sapiens cDNA clone IMAGE:5518314 5, mRNA sequence BX1 17246 BX1 17246 Soares NFL T GBC SI Homo sapiens 6.64 Down 1.68E-04 cDNA clone IMAGp998K124513 ; IMAGE:1844867, mRNA sequence W92001 zh47e11 .s1 Soares_fetal_liver_spleen_1 NFLS_S1 6.64 Down 2.81E-04

Homo sapiens cDNA clone IMAGE:415244 3, mRNA sequence

NM_0001 Homo sapiens Fanconi anemia, complementation 6.63 Down 1.79E-05 35 group A (FANCA), mRNA

AF055376 Homo sapiens short form transcription factor C-MAF 6.63 Down 9.89E-06

(c-maf) mRNA, complete cds W93709 zd96gO3.s1 Soares_fetal_heart_NbHH19W Homo 6.62 Down 1.95E-03 sapiens cDNA clone IMAGE:357364 3, mRNA sequence AK024522 Homo sapiens cDNA: FLJ20869 fis, clone 6.62 Down 1.07E-04

ADKA02377 W39159 zb35dO6.r1 Soares parathyroid tumor NbHPA Homo 6.61 Down 2.54E-05 sapiens cDNA clone IMAGE:305579 5, mRNA sequence

BU684045 UI-CF-ENO-acn-h-17-O-Ul.si UI-CF-ENO Homo 6.58 Down 6.58E-04 sapiens cDNA clone UI-CF-ENO-acn-h-17-O-UI 3, mRNA sequence

NM_0141 Homo sapiens syntaxin binding protein 6 (amisyn) 6.56 Down 8.64E-06

78 (STXBP6), mRNA

N31746 yy16e11 .s1 Soares melanocyte 2NbHM Homo 6.55 Down 1.01E-03 sapiens cDNA clone I MAG E :271436 3, mRNA sequence

NM_0060 Homo sapiens exonuclease 1 (EXO1 ), transcript 6.55 Down 7.43E-04

27 variant 1 , mRNA

BX538009 Homo sapiens mRNA; cDNA DKFZp686F1546 (from 6.55 Down 1.03E-04 clone DKFZp686F1546)

NM_0163 Homo sapiens centromere protein F, 350/400ka 6.53 Down 4.90E-04

43 (mitosin) (CENPF), mRNA

BF724206 bxO2bO8.x1 Human Iris cDNA (Un-normalized, 6.53 Down 3.20E-04 unamplified): BX Homo sapiens cDNA clone bxO2bO8

3, mRNA sequence

CA440191 UI-H-DT1 -awe-h-18-0-Ul.s1 NCI CGAP DT1 Homo 6.53 Down 9.20E-05 sapiens cDNA clone UI-H-DT1-awe-h-18-0-UI 3, mRNA sequence

AW41865 hd14bO5.x1 Soares NFL T GBC SI Homo sapiens 6.52 Down 2.65E-04

5 cDNA clone IMAGE:2909457 3, mRNA sequence

AW24171 xn74bO7.x1 Soares NFL T GBC SI Homo sapiens 6.52 Down 4.16E-05

4 cDNA clone IMAGE:2700181 3, mRNA sequence

N58802 yv76h10.s1 Soares fetal liver spleen 1 NFLS Homo 6.51 Down 8.32E-04 sapiens cDNA clone IMAGE:248707 3, mRNA sequence

AI669586 tw34bO4.x1 NCI CGAP UtI Homo sapiens cDNA 6.5 Down 4.34E-06 clone IMAGE:2261551 3, mRNA sequence

BG46213 RST45147 Athersys RAGE Library Homo sapiens 6.46 Down 1.04E-05

3 cDNA, mRNA sequence

NM 0203 Homo sapiens AF15q14 protein (AF15Q14), mRNA 6.45 Down 9.64E-04


NM 0202 Homo sapiens kinesin-like 7 (KNSL7), mRNA 6.44 Down 3.25E-05


AK000942 Homo sapiens cDNA FLJ10080 fis, clone 6.42 Down 1.78E-03


AK098498 Homo sapiens cDNA FLJ25632 fis, clone STM03991 6.41 Down 4.39E-04

XM 0984 Homo sapiens L0C153727 (L0C153727), mRNA 6.38 Down 1.78E-03


NM_0023 Homo sapiens leukemia inhibitory factor receptor 6.38 Down 8.51 E-06

10 (LIFR), mRNA

S81734 tissue transglutaminase homologue {alternatively 6.36 Down 2.18E-04 spliced} [human, erythroleukemia cell line HEL

GM06141A, mRNA, 2362 nt]

AW29105 UI-H-BI2-agc-b-04-0-Ul.s1 NCI_CGAP_Sub4 Homo 6.36 Down 6.50E-05

7 sapiens cDNA clone IMAGE:2723670 3, mRNA sequence

AA470089 zt98hO7.s1 Soares testis NHT Homo sapiens cDNA 6.35 Down 6.23E-04 clone IMAGE:730429 3 similar to contains element

DBR repetitive element ;, mRNA sequence

BX1 10046 BX1 10046 Soares testis NHT Homo sapiens cDNA 6.34 Down 2.70E-05 clone IMAGp998A074454 ; IMAGE:1752462, mRNA sequence

AI468353 tg58bO1.x1 NCI_CGAP_Pr28 Homo sapiens cDNA 6.34 Down 7.39E-05 clone IMAGE:21 12937 3, mRNA sequence NM 0013 Homo sapiens dynein, axonemal, heavy polypeptide 5 6.3 Down 3.15E-03 69 (DNAH5), mRNA

AI692536 wd73eO8.x1 NCI_CGAP_Lu24 Homo sapiens cDNA 6.3 Down 2.12E-04 clone IMAGE:2337254 3 similar to contains MER10.t2

MER10 MER10 repetitive element ;, mRNA sequence BC050383 Homo sapiens cDNA clone IMAGE:6042673, 6.29 Down 1.49E-05 containing frame-shift errors NM_0041 Homo sapiens origin recognition complex, subunit 1 - 6.29 Down 1.34E-03

53 like (yeast) (ORC1 L), mRNA

NM 0042 Homo sapiens thyroid hormone receptor interactor 13 6.29 Down 7.55E-04

37 (TRIP13), mRNA

NM 0009 Homo sapiens progesterone receptor (PGR), mRNA 6.27 Down 9.57E-04


BI497235 df133hO3.y1 Morton Fetal Cochlea Homo sapiens 6.26 Down 3.07E-04 cDNA clone IMAGE:2538076 5, mRNA sequence BX647655 Homo sapiens mRNA; cDNA DKFZp451 A21 1 (from 6.26 Down 4.38E-04 clone DKFZp451A211 ) BU584809 6984506H1 BRAIFER05 Homo sapiens cDNA clone 6.25 Down 5.34E-04

6984506 5, mRNA sequence NM 0056 Homo sapiens nuclear receptor subfamily 2, group F, 6.24 Down 7.02E-05

54 member 1 (NR2F1 ), mRNA

NM 0012 Homo sapiens CDC6 cell division cycle 6 homolog (S. 6.23 Down 3.49E-05

54 cerevisiae) (CDC6), mRNA

AI798224 we85cO9.x1 Soares NFL T GBC SI Homo sapiens 6.21 Down 2.00E-03 cDNA clone IMAGE:2347888 3, mRNA sequence NM 0046 Homo sapiens angiopoietin-like 1 (ANGPTL1 ), mRNA 6.2 Down 7.99E-05 73

BQ02342 UI-1-BB1 p-avd-c-05-0-Ul.s1 NCI_CGAP_PI6 Homo 6.2 Down 1.25E-03 3 sapiens cDNA clone UI-1 -BB1 p-avd-c-05-0-UI 3, mRNA sequence

NM 0043 Homo sapiens BUB1 budding uninhibited by 6.2 Down 1.48E-03 36 benzimidazoles 1 homolog (yeast) (BUB1 ), mRNA

BI492991 df32aO4.w1 Morton Fetal Cochlea Homo sapiens 6.2 Down 4.45E-03 cDNA clone IMAGE:2484775 3, mRNA sequence NM 0047 Homo sapiens nucleolar and coiled-body 6.18 Down 7.15E-04 41 phosphoprotein 1 (NOLC1 ), mRNA

AW02226 df36bO8.y1 Morton Fetal Cochlea Homo sapiens 6.17 Down 3.88E-05 7 cDNA clone IMAGE:2485599 5, mRNA sequence

NM 0073 Homo sapiens kinesin family member 22 (KIF22), 6.17 Down 1.33E-02 17 mRNA

BF509423 UI-H-BI4-aoy-e-1 1 -0-Ul.s1 NCI_CGAP_Sub8 Homo 6.17 Down 2.55E-05 sapiens cDNA clone IMAGE:3086684 3, mRNA sequence

BQ05022 AGENCOURT_7051066 NIH_MGC_71 Homo 6.15 Down 1.92E-04 7 sapiens cDNA clone IMAGE:57841 19 5, mRNA sequence AA130987 zo15d03.s1 Stratagene colon (#937204) Homo 6.14 Down 6.55E-05 sapiens cDNA clone IMAGE:586949 3, mRNA sequence

NM 0122 Homo sapiens extra spindle poles like 1 (S. 6.14 Down 1.19E-04 91 cerevisiae) (ESPL1 ), mRNA

CA771 131 io71 b10.x1 HR85 islet Homo sapiens cDNA clone 6.13 Down 2.07E-03

IMAGE:6131682 3, mRNA sequence

BQ01306 UI-1-BC1 p-ayk-g-12-0-Ul.s1 NCI_CGAP_PI3 Homo 6.12 Down 4.52E-05 6 sapiens cDNA clone UI-1 -BC1 p-ayk-g-12-0-UI 3, mRNA sequence NM 0029 Homo sapiens chemokine (C-X-C motif) ligand 5 6.12 Down 3.55E-05

94 (CXCL5), mRNA

NM 0026 Homo sapiens pim-1 oncogene (PIM1 ), mRNA 6.11 Down 1.51E-03


AA492138 ng60h01.s1 NCI_CGAP_Lip2 Homo sapiens cDNA 6.11 Down 3.49E-04 clone IMAGE:939217, mRNA sequence AF072164 Homo sapiens HSFE-1 mRNA, partial cds 6.1 Down 4.79E-05 CB143060 K-EST0196987 L15CKK1 Homo sapiens cDNA clone 6.1 Down 3.62E-04

L15CKK1 -21 -D03 5, mRNA sequence NM 0010 Homo sapiens ribonucleotide reductase M2 6.1 Down 4.07E-04 34 polypeptide (RRM2), mRNA

AA504323 aa61 eO2.s1 NCI CGAP GCB1 Homo sapiens cDNA 6.1 Down 1.88E-04 clone IMAGE:825434 3 similar to contains MER12.t2

MER12 repetitive element ;, mRNA sequence NM 0169 Homo sapiens polymerase (DNA directed), alpha 6.09 Down 1.54E-05 37 (POLA), mRNA

AI337136 qx83bO7.x1 NCI CGAP GC6 Homo sapiens cDNA 6.09 Down 5.14E-04 clone IMAGE:2009077 3, mRNA sequence NM_0143 Homo sapiens immunoglobulin superfamily, member 6.09 Down 2.92E-04 33 4 (IGSF4), mRNA

BC03541 1 Homo sapiens, clone IMAGE:4824349, mRNA 6.08 Down 6.28E-04 BX1 18713 BX1 18713 Soares NFL T GBC SI Homo sapiens 6.08 Down 9.96E-05 cDNA clone IMAGp998O143710 ; IMAGE: 1467109, mRNA sequence BC016020 Homo sapiens, Similar to LINE retrotransposable 6.07 Down 1.37E-03 element 1 , clone IMAGE:4720177, mRNA NM 0026 Homo sapiens period homolog 1 (Drosophila) (PER1 ), 6.06 Down 4.55E-04 16 mRNA

NM 0183 Homo sapiens DEP domain containing 1 B 6.05 Down 1.54E-05 69 (DEPDC1 B), mRNA

AK024994 Homo sapiens cDNA: FLJ21341 fis, clone COL02653 6.05 Down 4.19E-03 N66105 yy65eO6.s1 Soares_multiple_sclerosis_2NbHMSP 6.04 Down 1.35E-04

Homo sapiens cDNA clone IMAGE:278434 3, mRNA sequence

BM96732 ij33d1 1 .y1 Melton Normalized Human Islet 4 N4-HIS 6.03 Down 6.08E-04 9 1 Homo sapiens cDNA clone IMAGE:6136389 5, mRNA sequence

AW29954 xs51 bO1 .x1 NCI CGAP Kidi 1 Homo sapiens cDNA 6.03 Down 3.40E-04 1 clone IMAGE:2773129 3 similar to contains MER2.b3

MER2 repetitive element ;, mRNA sequence AA926774 om68a01.s1 NCI CGAP GC4 Homo sapiens cDNA 6.02 Down 1.05E-03 clone IMAGE:1552296 3, mRNA sequence CA843592 ir49c12.x1 HR85 islet Homo sapiens cDNA clone 6.01 Down 3.78E-05

IMAGE:6548544 3, mRNA sequence NM_0164 Homo sapiens RA-regulated nuclear matrix- 6.01 Down 9.20E-05 48 associated protein (RAMP), mRNA

AL577862 AL577862 Homo sapiens HELA CELLS COT 25- 6 Down 9.27E-04

NORMALIZED Homo sapiens cDNA clone

CS0DK007YM05 3-PRIME, mRNA sequence NM 0070 Homo sapiens DMC1 dosage suppressor of mck1 6 Down 1.26E-04 68 homolog, meiosis-specific homologous recombination

(yeast) (DMC1 ), mRNA AK093256 Homo sapiens cDNA FLJ35937 fis, clone 6 Down 6.48E-05

TESTI201 1480 AK096921 Homo sapiens cDNA FLJ39602 fis, clone 5.98 Down 1.62E-03

SKNSH2005061 AW15094 xg42eO9.x1 NCI CGAP UtI Homo sapiens cDNA 5.98 Down 5.01 E-04 4 clone IMAGE:2630248 3 similar to contains L1 .b1 L1 repetitive element ;, mRNA sequence

BC006384 Homo sapiens, clone IMAGE:4110919, mRNA 5.96 Down 7.48E-05

BQ37606 PM2-TN0025-270800-002-C01 TN0025 Homo 5.95 Down 5.52E-04

1 sapiens cDNA, mRNA sequence

AI744669 wgO2e1 1 .x1 Soares_NSF_F8_9W_OT_PA_P_S1 5.95 Down 1.71E-03

Homo sapiens cDNA clone IMAGE:2363948 3 similar to contains L1 .b1 L1 repetitive element ;, mRNA sequence

AI187950 qe13fO3.x1 Soares testis NHT Homo sapiens cDNA 5.93 Down 6.32E-05 clone IMAGE:1738877 3 similar to gb:M32315 TUMOR NECROSIS FACTOR RECEPTOR 2 PRECURSOR (HUMAN);contains LTR8.t2 LTR8 repetitive element ;, mRNA sequence

AW13143 xf63eO6.x1 NCI_CGAP_Gas4 Homo sapiens cDNA 5.93 Down 5.83E-04

8 clone IMAGE:2622754 3, mRNA sequence

NM 1749 Homo sapiens hypothetical protein LOC204474 5.93 Down 2.43E-04

24 (LOC204474), mRNA

AK000203 Homo sapiens cDNA FLJ20196 fis, clone COLF0944 5.93 Down 1.39E-03

BC009008 Homo sapiens, Similar to hypothetical protein 5.93 Down 3.36E-05 PRO1722, clone IMAGE:3452873, mRNA

AI797163 we27fO9.x1 NCI_CGAP_Lu24 Homo sapiens cDNA 5.91 Down 6.35E-04 clone IMAGE:2342345 3, mRNA sequence

NM_0053 Homo sapiens nuclear factor, interleukin 3 regulated 5.91 Down 1.68E-05

84 (NFIL3), mRNA

BX649158 Homo sapiens mRNA; cDNA DKFZp686E0329 (from 5.91 Down 5.57E-05 clone DKFZp686E0329)

AF019357 AF019357 Human brain frontal cortex Homo sapiens 5.9 Down 1.57E-03 cDNA clone s533, mRNA sequence

BC042089 Homo sapiens, clone IMAGE:5760997, mRNA 5.89 Down 1.03E-03

BC009608 Homo sapiens, clone IMAGE:4294221 , mRNA 5.87 Down 9.94E-04

AW60417 IL3-CT0219-210100-058-F09 CT0219 Homo sapiens 5.86 Down 1.27E-04

1 cDNA, mRNA sequence

BX095195 BX095195 Soares placenta Nb2HP Homo sapiens 5.86 Down 7.05E-04 cDNA clone IMAGp998H 13182 ; IMAGE:131388, mRNA sequence

AI650966 wa96b12.x1 NCI CGAP GC6 Homo sapiens cDNA 5.85 Down 2.64E-04 clone IMAGE:2303999 3, mRNA sequence

AW61257 hhO5bO5.x1 NCI_CGAP_Kid1 1 Homo sapiens cDNA 5.84 Down 5.07E-05

2 clone IMAGE:2954193 3, mRNA sequence NM 0142 Homo sapiens calpain 6 (CAPN6), mRNA 5.84 Down 7.14E-04 89

AW15236 xg63eO3.x1 NCI_CGAP_Ut4 Homo sapiens cDNA 5.83 Down 1.08E-04

8 clone IMAGE:2633020 3 similar to contains AIu repetitive element;, mRNA sequence

N25267 yx74hO1 .s1 Soares melanocyte 2NbHM Homo 5.83 Down 4.35E-05 sapiens cDNA clone IMAGE:267505 3, mRNA sequence

AW45007 UI-H-BI3-akw-b-04-0-Ul.s1 NCI_CGAP_Sub5 Homo 5.83 Down 5.67E-03

6 sapiens cDNA clone IMAGE:2735574 3, mRNA sequence

BM97831 UI-CF-EC1-aeb-f-10-0-Ul.s1 UI-CF-EC1 Homo 5.83 Down 1.06E-03

9 sapiens cDNA clone UI-CF-EC1 -aeb-f-10-0-UI 3, mRNA sequence

NM 0327 Homo sapiens hypothetical protein MGC1 1324 5.81 Down 1.59E-04

17 (MGC1 1324), mRNA

NM 0027 Homo sapiens protein kinase, cAMP-dependent, 5.8 Down 1.67E-04 36 regulatory, type II, beta (PRKAR2B), mRNA AA004803 zh96cO2.s1 Soares_fetal_liver_spleen_1 NFLS S1 5.79 Down 4.90E-04

Homo sapiens cDNA clone IMAGE:429122 3, mRNA sequence

AI872095 wm55bO4.x1 NCI_CGAP_Ut2 Homo sapiens cDNA 5.79 Down 3.13E-04 clone IMAGE:2439823 3 similar to contains AIu repetitive element;, mRNA sequence

AA548677 nkO3eO7.s1 NCI CGAP Pr1 1 Homo sapiens cDNA 5.78 Down 2.65E-04 clone I MAGE: 1000932, mRNA sequence BX1 16347 BX116347 NCI_CGAP_Kid12 Homo sapiens cDNA 5.75 Down 1.40E-04 clone IMAGp998B215967 ; IMAGE:2401844, mRNA sequence

BI495885 df121 d10.w1 Morton Fetal Cochlea Homo sapiens 5.75 Down 7.76E-04 cDNA clone IMAGE:2540202 3, mRNA sequence

NM 0039 Homo sapiens glycogenin 2 (GYG2), mRNA 5.74 Down 3.87E-03


NM 0212 Homo sapiens doublesex and mab-3 related 5.74 Down 2.99E-03

40 transcription factor 3 (DMRT3), mRNA

NM_0152 Homo sapiens KIAA0056 protein (KIAA0056), mRNA 5.74 Down 7.29E-03


AW44489 UI-H-BI3-ajz-d-07-0-Ul.s1 NCI_CGAP_Sub5 Homo 5.73 Down 4.08E-03

9 sapiens cDNA clone IMAGE:2733373 3, mRNA sequence

NM 0141 Homo sapiens HSPC054 protein (HSPC054), mRNA 5.71 Down 1.87E-03


AW13537 UI-H-BI1 -ace-d-07-0-Ul.s1 NCI_CGAP_Sub3 Homo 5.71 Down 1.31E-04

1 sapiens cDNA clone IMAGE:2714148 3, mRNA sequence

NM_0057 Homo sapiens kinesin family member 2OA (KIF20A), 5.71 Down 1.49E-02

33 mRNA

AI768129 wg81eO1 .x1 Soares_NSF_F8_9W_OT_PA_P_S1 5.71 Down 6.48E-05

Homo sapiens cDNA clone IMAGE:2371512 3, mRNA sequence

NM_0012 Homo sapiens BUB1 budding uninhibited by 5.7 Down 2.06E-03

11 benzimidazoles 1 homolog beta (yeast) (BUB1 B), mRNA

AF075067 Homo sapiens full length insert cDNA YQ03C01 5.7 Down 5.80E-03 AA928233 on87b02.s1 Soares NFL T GBC SI Homo sapiens 5.69 Down 1.31E-04 cDNA clone IMAGE:1563627 3, mRNA sequence

NM_0143 Homo sapiens immunoglobulin superfamily, member 5.68 Down 1.13E-05

33 4 (IGSF4), mRNA

AI873444 wf83bO4.x1 Soares NFL T GBC SI Homo sapiens 5.68 Down 2.01 E-03 cDNA clone IMAGE:2362159 3, mRNA sequence

NM_0314 Homo sapiens hypothetical protein DKFZp434B044 5.68 Down 7.05E-05

76 (DKFZP434B044), mRNA

T79158 yd70b08.s1 Soares fetal liver spleen 1 NFLS Homo 5.67 Down 2.45E-05 sapiens cDNA clone IMAGE:113559 3, mRNA sequence

CB043973 NISC_gcO1 gO9.x1 NCI CGAP Coi 7 Homo sapiens 5.67 Down 1.11 E-03 cDNA clone IMAGE:3217720 3, mRNA sequence

NM 0059 Homo sapiens S-phase kinase-associated protein 2 5.67 Down 2.34E-03

83 (p45) (SKP2), transcript variant 1 , mRNA

CD23879 FNPBEG1 1 FNP Homo sapiens cDNA, mRNA 5.65 Down 4.93E-04

8 sequence

AA635788 nr32hO1 .s1 NCI_CGAP_Pr22 Homo sapiens cDNA 5.65 Down 4.39E-03 clone IMAGE:1 169713 3 similar to contains AIu repetitive element;, mRNA sequence NM 0009 Homo sapiens prostaglandin F receptor (FP) 5.64 Down 1.79E-05

59 (PTGFR), mRNA

BE184907 MR1 -HT0707-100500-001 -bO9 HT0707 Homo 5.64 Down 3.97E-04 sapiens cDNA, mRNA sequence

BM971 14 UI-CF-DUI -aar-b-i δ-O-UI^ UI-CF-DUl Homo 5.63 Down 7.22E-05 9 sapiens cDNA clone UI-CF-DU1-aar-b-15-0-UI 3, mRNA sequence M85500 EST02016 Fetal brain, Stratagene (cat#936206) 5.63 Down 6.37E-04

Homo sapiens cDNA clone HFBCJ03, mRNA sequence

AW44090 heO5hO5.x1 N C I C GA P C M L 1 Homo sapiens cDNA 5.61 Down 3.97E-04 9 clone IMAGE:2918169 3 similar to contains OFR.ti

OFR repetitive element ;, mRNA sequence BF838667 RC3-HT0976-251100-012-fO4 HT0976 Homo sapiens 5.58 Down 1.23E-03 cDNA, mRNA sequence

BM97302 UI-CF-EC1-abt-k-08-0-Ul.s1 UI-CF-EC1 Homo 5.57 Down 5.61E-04 3 sapiens cDNA clone UI-CF-EC1-abt-k-08-0-UI 3, mRNA sequence

NM 0140 Homo sapiens PRO0529 protein (PRO0529), mRNA 5.57 Down 1.61E-04 74

NM 1736 Homo sapiens hypothetical protein FLJ40504 5.57 Down 2.83E-05 24 (FLJ40504), mRNA

BC046364 Homo sapiens flavoprotein oxidoreductase MICAL3, 5.55 Down 4.07E-04 mRNA (cDNA clone IMAGE:5737121 ), with apparent retained intron

NM 0071 Homo sapiens zinc finger protein 175 (ZNF175), 5.55 Down 5.96E-05 47 mRNA

NM 0062 Homo sapiens protein kinase C, eta (PRKCH), mRNA 5.55 Down 1.08E-04 55

BM66444 UI-E-CL1 -afa-p-05-0-Ul.s1 UI-E-CL1 Homo sapiens 5.54 Down 1.05E-02 5 cDNA clone UI-E-CL1 -afa-p-05-0-UI 3, mRNA sequence AA483687 ne75eO3.s1 NCI CGAP Ewi Homo sapiens cDNA 5.52 Down 2.90E-05 clone IMAGE:910108, mRNA sequence

AW29804 UI-H-BW0-ajp-e-12-0-Ul.s1 NCI CGAP Subθ Homo 5.52 Down 1.32E-05 7 sapiens cDNA clone IMAGE:2732639 3, mRNA sequence

NM 0010 Homo sapiens arylacetamide deacetylase (esterase) 5.5 Down 4.40E-04 86 (AADAC), mRNA

NM 0045 Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6- 5.5 Down 1.12E-02 66 biphosphatase 3 (PFKFB3), mRNA

AA947258 od86c08.s1 NCI_CGAP_Ov2 Homo sapiens cDNA 5.49 Down 3.54E-04 clone IMAGE:1374830, mRNA sequence NM 0059 Homo sapiens MCM6 minichromosome maintenance 5.48 Down 2.06E-03 15 deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)

(MCM6), mRNA

NM 0055 Homo sapiens SMAD, mothers against DPP homolog 5.47 Down 1.46E-04 85 6 (Drosophila) (SMAD6), mRNA

BQ02627 UI-1-BB1 p-akp-f-06-0-Ul.s2 NCI_CGAP_PI6 Homo 5.47 Down 8.91E-04 9 sapiens cDNA clone UI-1 -BB1 p-akp-f-06-0-UI 3, mRNA sequence

NM_0327 Homo sapiens lamin B2 (LMNB2), mRNA 5.45 Down 1.71E-03 37

BQ44726 UI-H-EU1-bad-n-09-0-Ul.s1 NCI_CGAP_Ct1 Homo 5.45 Down 4.16E-03 8 sapiens cDNA clone UI-H-EU1-bad-n-09-0-UI 3, mRNA sequence BM28539 NcDNA-16 human CD15+ myeloid progenitor cells 5.44 Down 1.83E-04 3 cDNA Library Homo sapiens cDNA 5, mRNA sequence AL390173 Homo sapiens mRNA; cDNA DKFZp547l224 (from 5.44 Down 5.15E-04 clone DKFZp547l224) CA31 1 199 UI-CF-FNO-afc-d-06-O-Ul.si UI-CF-FNO Homo 5.44 Down 6.25E-04 sapiens cDNA clone UI-CF-FNO-afc-d-06-O-UI 3, mRNA sequence

NM 0070 Homo sapiens WD repeat and HMG-box DNA binding 5.43 Down 1.19E-03 86 protein 1 (WDHD1 ), transcript variant 1 , mRNA

NM_0123 Homo sapiens kinesin family member 4A (KIF4A), 5.42 Down 3.04E-04 10 mRNA

NM 0014 Homo sapiens forkhead box F1 (F0XF1 ), mRNA 5.42 Down 1.54E-04 51

NM 0187 Homo sapiens transcription factor RAM2 (RAM2), 5.41 Down 7.08E-03 19 mRNA

NM 0144 Homo sapiens tumor necrosis factor receptor 5.41 Down 1.59E-04 52 superfamily, member 21 (TNFRSF21 ), mRNA

CB160856 K-EST0220612 L18P00L1 n1 Homo sapiens cDNA 5.4 Down 1.01E-04 clone L18POOL1 n1 -33-F12 5, mRNA sequence AL832624 Homo sapiens mRNA; cDNA DKFZp451 B0818 (from 5.4 Down 1.12E-04 clone DKFZp451 B0818) AK094159 Homo sapiens cDNA FLJ36840 fis, clone 5.39 Down 1.49E-05

ASTRO201 1461

BG35457 CDCA6 Cell division cycle associated gene 6 Human 5.38 Down 5.00E-04 9 cDNA expression libraries Homo sapiens cDNA clone

407614, mRNA sequence NM_0246 Homo sapiens solute carrier family 12 5.38 Down 5.78E-05

28 (potassium/chloride transporters), member 8 (SLC12A8), mRNA

NM 0248 Homo sapiens hypothetical protein FLJ22662 5.37 Down 1.08E-04

29 (FLJ22662), mRNA

CB049840 NISC_gj13eO4.x1 NCI_CGAP_Pr28 Homo sapiens 5.37 Down 2.65E-04 cDNA clone IMAGE:3271758 3, mRNA sequence XM_2986 Homo sapiens LOC345191 (LOC345191 ), mRNA 5.37 Down 4.09E-03 04

AW05162 wx28dO9.x1 NCI_CGAP_Kid11 Homo sapiens cDNA 5.36 Down 2.31E-04 8 clone IMAGE:2544977 3 similar to contains AIu repetitive element;contains MER32.t2 MER32 repetitive element ;, mRNA sequence NM_1993 Homo sapiens solute carrier family 43, member 3 5.34 Down 3.44E-05 29 (SLC43A3), mRNA

NM 0030 Homo sapiens solute carrier family 19 (folate 5.34 Down 1.14E-04 56 transporter), member 1 (SLC19A1 ), transcript variant

1 , mRNA

NMJ 736 Homo sapiens rotatin (RTTN), mRNA 5.34 Down 1.01 E-04


BM45991 AGENCOURT_6422278 NIH_MGC_71 Homo 5.33 Down 1.48E-04

1 sapiens cDNA clone IMAGE:5532261 5, mRNA sequence AL110252 Homo sapiens mRNA; cDNA DKFZp566A1046 (from 5.33 Down 1.10E-04 clone DKFZp566A1046)

NM 0178 Homo sapiens NACHT, leucine rich repeat and PYD 5.32 Down 2.07E-05 52 containing 2 (NALP2), mRNA

BX108121 BX108121 Soares testis NHT Homo sapiens cDNA 5.32 Down 5.41E-04 clone IMAGp998B051795 ; I MAG E: 731428, mRNA sequence BU754054 UI-1-BB1 p-atn-c-07-0-Ul.s1 NCI CGAP PI6 Homo 5.31 Down 5.14E-04 sapiens cDNA clone UI-1 -BB1 p-atn-c-07-0-UI 3, mRNA sequence BX096173 BX096173 Soares testis NHT Homo sapiens cDNA 5.31 Down 2.76E-04 clone IMAGp998F151793 ; IMAGE:730766, mRNA sequence AW44943 UI-H-BI3-akj-e-06-0-Ul.s1 NCI_CGAP_Sub5 Homo 5.3 Down 2.24E-04

3 sapiens cDNA clone IMAGE:2734547 3, mRNA sequence

BQ02644 UI-1 -BB0-abo-c-06-0-Ul.s1 NCI_CGAP_PI4 Homo 5.3 Down 1.39E-04 5 sapiens cDNA clone UI-1 -BB0-abo-c-06-0-UI 3, mRNA sequence BI041633 PM0-NT0314-260301 -002-f05 NT0314 Homo sapiens 5.29 Down 7.67E-04 cDNA, mRNA sequence

AW29300 UI-H-BW0-aih-e-07-0-Ul.s1 NCI CGAP Subθ Homo 5.29 Down 5.81E-04 7 sapiens cDNA clone IMAGE:2729197 3, mRNA sequence NM 0148 Homo sapiens chromosome condensation-related 5.28 Down 3.70E-04

65 SMC-associated protein 1 (CNAP1 ), mRNA AA057634 zl94aO6.s1 Stratagene corneal stroma (#937222) 5.27 Down 2.30E-04

Homo sapiens cDNA clone I MAGE :512242 3, mRNA sequence

AL358312 Homo sapiens EST from clone 938081 , full insert 5.27 Down 1.16E-03 NM 0024 Homo sapiens v-myb myeloblastosis viral oncogene 5.26 Down 1.50E-03

66 homolog (avian)-like 2 (MYBL2), mRNA BX648297 Homo sapiens mRNA; cDNA DKFZp686L23125 (from 5.25 Down 4.21E-04 clone DKFZp686L23125) CB163567 K-EST0224464 L17N670205n1 Homo sapiens cDNA 5.24 Down 2.87E-03 clone L17N670205n1-32-G12 5, mRNA sequence N35935 yx94a12.r1 Soares melanocyte 2NbHM Homo 5.24 Down 1.03E-04 sapiens cDNA clone IMAGE:269374 5, mRNA sequence

NM 0321 Homo sapiens GAJ protein (GAJ), mRNA 5.23 Down 2.65E-06 17 AA180849 zp35gO5.r1 Stratagene muscle 937209 Homo sapiens 5.23 Down 2.75E-03 cDNA clone IMAGE:611480 5, mRNA sequence BX103634 BX103634 Soares_NSF_F8_9W_OT_PA_P_S1 5.21 Down 9.31E-06

Homo sapiens cDNA clone IMAGp998O213969 ;

IMAGE:1566572, mRNA sequence BQ00668 UI-H-EI1 -ayz-j-10-0-Ul.s1 NCI CGAP EI1 Homo 5.2 Down 2.70E-04

4 sapiens cDNA clone IMAGE:5845737 3, mRNA sequence

CA310979 UI-CF-FN0-afc-c-21 -0-Ul.s1 UI-CF-FNO Homo 5.2 Down 3.26E-03 sapiens cDNA clone UI-CF-FNO-afc-c-21 -O-UI 3, mRNA sequence AM 51 176 qc87h11 .x1 Soares pregnant uterus NbHPU Homo 5.2 Down 2.52E-03 sapiens cDNA clone IMAGE:1721253 3, mRNA sequence

BG56389 602584707F1 NIH MGC 76 Homo sapiens cDNA 5.19 Down 6.42E-03 2 clone IMAGE:4712617 5, mRNA sequence

AW17307 xj82hO8.x1 Soares NFL T GBC SI Homo sapiens 5.19 Down 2.03E-04 7 cDNA clone IMAGE:2663775 3, mRNA sequence

AL390180 Homo sapiens mRNA; cDNA DKFZp761 L149 (from 5.19 Down 1.14E-04 clone DKFZp761 L149)

NM 0035 Homo sapiens RAD54-like (S. cerevisiae) (RAD54L), 5.18 Down 2.79E-04 79 mRNA

NM 0014 Homo sapiens galanin receptor 1 (GALR1 ), mRNA 5.18 Down 7.95E-05 80 AL079909 DKFZp586H2217_r1 586 (synonym: hutei ) Homo 5.18 Down 3.34E-04 sapiens cDNA clone DKFZp586H2217 5, mRNA sequence

BM67712 UI-E-EO1 -aic-i-19-0-Ul.s1 UI-E-E01 Homo sapiens 5.17 Down 3.07E-03 6 cDNA clone UI-E-EO1-aic-i-19-0-UI 3, mRNA sequence AL831859 Homo sapiens mRNA; cDNA DKFZp761 F0317 (from 5.16 Down 1.59E-03 clone DKFZp761 F0317)

AW02865 wv27gO6.x1 NCI_CGAP_Kid11 Homo sapiens cDNA 5.16 Down 1.87E-03 5 clone IMAGE:2530810 3, mRNA sequence

NM 0246 Homo sapiens MLF1 interacting protein (MLF1 IP), 5.16 Down 9.88E-05 29 mRNA

R38809 yd04c10.s1 Soares infant brain 1 NIB Homo sapiens 5.15 Down 1.60E-04 cDNA clone IMAGE:24676 3 similar to gb:U06641



AK025101 Homo sapiens cDNA: FLJ21448 fis, clone COL04473 5.15 Down 4.98E-03 AW27544 xp37bO7.x1 NCI_CGAP_HN1 1 Homo sapiens cDNA 5.15 Down 6.74E-04 8 clone IMAGE:2742517 3, mRNA sequence

AW45165 UI-H-BI3-alj-e-09-0-Ul.s1 NCI_CGAP_Sub5 Homo 5.14 Down 2.45E-03 4 sapiens cDNA clone IMAGE:2736881 3, mRNA sequence BX104984 BX104984 Soares placenta Nb2HP Homo sapiens 5.14 Down 2.09E-03 cDNA clone IMAGp998G22188 ; IMAGE:133677, mRNA sequence AI637733 tt23fO3.x1 NCI_CGAP_GC6 Homo sapiens cDNA 5.14 Down 1.09E-04 clone IMAGE:2241629 3, mRNA sequence AK002008 Homo sapiens cDNA FLJ 1 1146 fis, clone 5.14 Down 8.95E-05

PLACE 1006673 AI741770 wg22gO4.x1 Soares_NSF_F8_9W_OT_PA_P_S1 5.14 Down 1.21E-03

Homo sapiens cDNA clone IMAGE:2365878 3, mRNA sequence AI651329 wa21 hO7.x1 NCI_CGAP_Kid11 Homo sapiens cDNA 5.14 Down 1.47E-04 clone IMAGE:2298781 3, mRNA sequence NM 0035 Homo sapiens CDC45 cell division cycle 45-like (S. 5.13 Down 1.91E-04 04 cerevisiae) (CDC45L), mRNA

BE671639 7a55aO4.x1 NCI CGAP GC6 Homo sapiens cDNA 5.13 Down 1.50E-03 clone IMAGE:3222606 3, mRNA sequence AK092662 Homo sapiens cDNA FLJ35343 fis, clone 5.13 Down 3.82E-03

PROST2015932 BX098552 BX098552 NCI_CGAP_Co3 Homo sapiens cDNA 5.13 Down 3.74E-03 clone IMAGp998M222187 ; IMAGE:882237, mRNA sequence BI492473 df24fO5.w1 Morton Fetal Cochlea Homo sapiens 5.12 Down 1.59E-04 cDNA clone IMAGE:2484249 3, mRNA sequence NM 0056 Homo sapiens synaptotagmin I (SYT1 ), mRNA 5.11 Down 1.75E-04 39 BX089756 BX089756 Soares fetal liver spleen 1 NFLS Homo 5.1 Down 2.29E-04 sapiens cDNA clone IMAGp998F24463 ;

IMAGE:230423, mRNA sequence

NM 0184 Homo sapiens hypothetical protein DKFZp762E1312 5.1 Down 5.40E-04 10 (DKFZp762E1312), mRNA

NM 0013 Homo sapiens DNA (cytosine-5-)-methyltransferase 1 5.1 Down 5.37E-03 79 (DNMT1 ), mRNA

AF086543 Homo sapiens full length insert cDNA clone ZE10H04 5.1 Down 1.60E-05 AW46821 he34cO1 .x1 NCI_CGAP_CML1 Homo sapiens cDNA 5.1 Down 1.62E-03 5 clone IMAGE:2920896 3, mRNA sequence

NM 0142 Homo sapiens polo-like kinase 4 (Drosophila) (PLK4), 5.08 Down 1.35E-04 64 mRNA

AL710395 DKFZp686A046_r1 686 (synonym: hlcc3) Homo 5.07 Down 1.12E-02 sapiens cDNA clone DKFZp686A046 5, mRNA sequence AA829391 od06c05.s1 NCI CGAP GCB1 Homo sapiens cDNA 5.07 Down 3.29E-03 clone IMAGE:1358408 3 similar to contains AIu repetitive element;contains element MER16 repetitive element ;, mRNA sequence BC065252 Homo sapiens cDNA clone IMAGE:6139955, partial 5.07 Down 6.05E-05 cds

NM 0046 Homo sapiens solute carrier family 16 5.06 Down 1.85E-04 94 (monocarboxylic acid transporters), member 6

(SLC16A6), mRNA

NM 0320 Homo sapiens coiled-coil domain containing 8 5.04 Down 2.79E-04 40 (CCDC8), mRNA

AA418146 zv97cO1 .r1 Soares NhHMPu SI Homo sapiens 5.04 Down 5.34E-04 cDNA clone IMAGE:767712 5 similar to contains

L1.t1 L1 repetitive element ;, mRNA sequence BQ02522 UI-1 -BB1 p-aub-d-10-0-Ul.s1 NCI_CGAP_PI6 Homo 5.04 Down 2.24E-04 3 sapiens cDNA clone UI-1 -BB1 p-aub-d-10-0-UI 3, mRNA sequence

AW13662 UI-H-BI1 -aco-h-02-0-Ul.s1 NCI_CGAP_Sub3 Homo 5.03 Down 3.64E-03 2 sapiens cDNA clone IMAGE:2715122 3, mRNA sequence CA314922 UI-CF-FN0-afi-b-1 1-0-Ul.s1 UI-CF-FNO Homo 5.03 Down 2.59E-03 sapiens cDNA clone UI-CF-FN0-afi-b-1 1 -0-UI 3, mRNA sequence

NM 0043 Homo sapiens NK2 transcription factor related, locus 5.03 Down 2.55E-05 87 5 (Drosophila) (NKX2-5), mRNA

NM_1827 Homo sapiens MCM4 minichromosome maintenance 5.02 Down 8.06E-04 46 deficient 4 (S. cerevisiae) (MCM4), transcript variant

2, mRNA AK095053 Homo sapiens cDNA FLJ37734 fis, clone 5.01 Down 3.30E-05


NM 0247 Homo sapiens SHC SH2-domain binding protein 1 5.01 Down 6.18E-05 45 (SHCBP1 ), mRNA

AI798701 we91fO1 .x1 Soares NFL T GBC SI Homo sapiens 5.01 Down 4.93E-04 cDNA clone IMAGE:2348473 3, mRNA sequence H71242 ys12gO9.s1 Soares fetal liver spleen 1 NFLS Homo 5.01 Down 1.01E-03 sapiens cDNA clone IMAGE:214624 3, mRNA sequence AI832562 at70a09.x1 Barstead colon HPLRB7 Homo sapiens 5.01 Down 2.69E-04 cDNA clone IMAGE:2377336 3, mRNA sequence NM 0056 Homo sapiens nuclear receptor subfamily 2, group F, 5.01 Down 2.85E-05 54 member 1 (NR2F1 ), mRNA

AA662240 nu89cO1 .s1 NCI CGAP AIvi Homo sapiens cDNA 5 Down 3.37E-04 clone IMAGE:1217856, mRNA sequence


What is claimed is:
1. A substantially pure population of chorionic villus-derived cells.
2. The chorionic villus-derived cells of claim 1 which are obtained from chorionic villus samples of about 11 to about 14 weeks gestation.
3. The chorionic villus-derived cells of claim 1 wherein such cells are derived from single, isolated cells.
4. The population of chorionic villus-derived cells according to claim 1, wherein the cells are substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.
5. The population of chorionic villus-derived cells according to claim 1, wherein the cells are substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA- 3, TRA1-81, TRA1-60, TRA2-54, C-Met, E-cadherin, EPCAM, or CXCR4.
6. The population of chorionic villus-derived cells according to claim 1, wherein the cells are substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.
7. The population of chorionic villus-derived cells according to claim 1, wherein the cells are substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF- lbeta, HNF-3beta, Oct- 4, Nanog, Sox-2, or CDX-2.
8. The population of chorionic villus-derived cells according to claim 1, capable of propagating in vitro.
9. The population of chorionic villus-derived cells according to claim 1, capable of propagating in vitro under hypoxic conditions.
10. The population of chorionic villus-derived cells according to claim 1, capable of differentiating into cells displaying the characteristics of the β-cell lineage.
11. A method of obtaining a population of cells from chorionic villus, comprising: a. Isolating a chorionic villus sample, b. Obtaining cells from the chorionic villus sample, and c. Culturing the cells in growth medium.
12. The method of claim 11 in which the chorionic villus samples are obtained at about 11 to about 14 weeks gestation.
13. The method according to claim 11, wherein the cells are cultured under hypoxic conditions.
14. The method according to claim 11, wherein the cells are substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.
15. The method according to claim 11, wherein the cells are substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA-3, TRA1-81, TRA1-60, TRA2-54, C- Met, E-cadherin, EPCAM, or CXCR4.
16. The method according to claim 11 , wherein the cells are substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.
17. The method according to claim 11, wherein the cells are substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF-I beta, HNF-3beta, Oct-4, Nanog, Sox-2, or CDX-2.
18. The method according to claim 11, wherein the cells are capable of propagating in vitro.
19. The method according to claim 11, wherein the cells are capable of propagating in vitro under hypoxic conditions.
20. The method according to claim 11, wherein the cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
21. A method of obtaining a population of cells from chorionic villus, comprising: a. Isolating a chorionic villus sample, b. Obtaining cells from the chorionic villus sample, c. Culturing the cells in growth medium, d. Isolating distinct colonies, e. Culturing the isolated colonies in growth medium, f. Serial dilution cloning and identifying single cells that give rise to proliferating colonies, and g. Culturing the clones in growth media.
22. The method according to claim 21, wherein the cells are cultured under hypoxic conditions.
23. The method of claim 21 in which the chorionic villus samples are obtained at about 11 to about 14 weeks gestation.
24. The method according to claim 21, wherein the cells are substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.
25. The method according to claim 21, wherein the cells are substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA-3, TRA1-81, TRA1-60, TRA2-54, C- Met, E-cadherin, EPCAM, or CXCR4.
26. The method according to claim 21, wherein the cells are substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.
27. The method according to claim 21, wherein the cells are substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF-I beta, HNF-3beta, Oct-4, Nanog, Sox-2, or CDX-2.
28. The method according to claim 21, wherein the cells are capable of propagating in vitro.
29. The method according to claim 21, wherein the cells are capable of propagating in vitro under hypoxic conditions.
30. The method according to claim 21, wherein the cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
31. A method of obtaining a population of cells from chorionic villus, comprising: a. Isolating a chorionic villus sample, b. Disrupting the chorionic villus sample, c. Obtaining cells from the chorionic villus sample, d. Culturing the cells in growth medium, e. Leaving the culture undisturbed for about 5 to 10 days without any media changes, f. Isolating distinct colonies, g. Culturing the isolated colonies in growth medium, h. Serial dilution cloning and identifying single cells that give rise to proliferating colonies, and i. Culturing the clones in growth media.
32. The method according to claim 31, wherein the chorionic villus sample is disrupted by enzymatic digestion.
33. The method of claim 31 in which the chorionic villus sample is obtained at about 11 to about 14 weeks gestation.
34. The method according to claim 31, wherein the cells are cultured under hypoxic conditions.
35. The method according to claim 31, wherein the cells are substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.
36. The method according to claim 31, wherein the cells are substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA-3, TRA1-81, TRA1-60, TRA2-54, C- Met, E-cadherin, EPCAM, or CXCR4.
37. The method according to claim 31, wherein the cells are substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.
38. The method according to claim 31, wherein the cells are substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF-I beta, HNF-3beta, Oct-4, Nanog, Sox-2, or CDX-2.
39. The method according to claim 31, wherein the cells are capable of propagating in vitro.
40. The method according to claim 31, wherein the cells are capable of propagating in vitro under hypoxic conditions.
41. The method according to claim 31, wherein the cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
42. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising: a. Isolating a population of chorionic villus-derived cells from a donor, and b. Transferring the cells into the patient.
43. The method according to claim 42, wherein the cells are cultured under hypoxic conditions.
44. The method of claim 42 in which the chorionic villus-derived cells are obtained at about 11 to about 14 weeks gestation.
45. The method according to claim 42, wherein the cells are substantially positive for the expression of at least one protein marker selected from the group consisting of: SSEA-4, CD9, CDlO, CD44, CD73, CD90, alpha 3 integrin, alpha 4, beta3 integrin, or CD 105.
46. The method according to claim 42, wherein the cells are substantially negative for the expression of at least one protein marker selected from the group consisting of: SSEA-3, TRA1-81, TRA1-60, TRA2-54, C- Met, E-cadherin, EPCAM, or CXCR4.
47. The method according to claim 42, wherein the cells are substantially positive for the expression of at least one marker selected from the group consisting of: vimentin, nestin, Sox-9, GATA-2, or GATA-4.
48. The method according to claim 42, wherein the cells are substantially negative for the expression of at least one marker selected from the group consisting of: GATA6, HNF-I beta, HNF-3beta, Oct-4, Nanog, Sox-2, or CDX-2.
49. The method according to claim 42, wherein the cells are capable of propagating in vitro.
50. The method according to claim 42, wherein the cells are capable of propagating in vitro under hypoxic conditions.
51. The method according to claim 42, wherein the cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
PCT/US2007/071150 2007-06-13 2007-06-13 Chorionic villus derived cells WO2008153568A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/US2007/071150 WO2008153568A1 (en) 2007-06-13 2007-06-13 Chorionic villus derived cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2007/071150 WO2008153568A1 (en) 2007-06-13 2007-06-13 Chorionic villus derived cells

Publications (1)

Publication Number Publication Date
WO2008153568A1 true WO2008153568A1 (en) 2008-12-18



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/071150 WO2008153568A1 (en) 2007-06-13 2007-06-13 Chorionic villus derived cells

Country Status (1)

Country Link
WO (1) WO2008153568A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018046929A1 (en) * 2016-09-09 2018-03-15 Zernicka Goetz Magdalena Methods and compositions for co-culturing pluripotent and extra-embryonic cells

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030082155A1 (en) * 1999-12-06 2003-05-01 Habener Joel F. Stem cells of the islets of langerhans and their use in treating diabetes mellitus
WO2003042405A2 (en) * 2001-11-15 2003-05-22 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030082155A1 (en) * 1999-12-06 2003-05-01 Habener Joel F. Stem cells of the islets of langerhans and their use in treating diabetes mellitus
WO2003042405A2 (en) * 2001-11-15 2003-05-22 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
GENBACEV O. ET AL.: "Hypoxia Alters Early Gestation Human Cytotrophoblast Differentiation/Invasion in Vitro and Models the Placental Defects that Occur in Preeclampsia", J. CLIN. INVEST., vol. 97, 1996, pages 540 - 547, XP000579303, DOI: doi:10.1172/JCI118447 *
HENDERSON J.K. ET AL.: "Preimplantation Human Embryos and Embryonic Stem Cells Show Comparable Expression of Stage-Specific Embryonic Antigens", STEM CELLS, vol. 20, 2002, pages 329 - 332, XP002968908, DOI: doi:10.1634/stemcells.20-4-329 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018046929A1 (en) * 2016-09-09 2018-03-15 Zernicka Goetz Magdalena Methods and compositions for co-culturing pluripotent and extra-embryonic cells

Similar Documents

Publication Publication Date Title
Steiner et al. Derivation, propagation and controlled differentiation of human embryonic stem cells in suspension
Solchaga et al. FGF‐2 enhances the mitotic and chondrogenic potentials of human adult bone marrow‐derived mesenchymal stem cells
Vallier et al. Early cell fate decisions of human embryonic stem cells and mouse epiblast stem cells are controlled by the same signalling pathways
Matin et al. Specific knockdown of Oct4 and β2‐microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells
Riekstina et al. Embryonic stem cell marker expression pattern in human mesenchymal stem cells derived from bone marrow, adipose tissue, heart and dermis
Eyster et al. Whole genome deoxyribonucleic acid microarray analysis of gene expression in ectopic versus eutopic endometrium
Walker et al. Polycomb-like 2 associates with PRC2 and regulates transcriptional networks during mouse embryonic stem cell self-renewal and differentiation
Mizrak et al. Embryonic stem cell-like cells derived from adult human testis
Tran et al. Wnt3a‐induced mesoderm formation and cardiomyogenesis in human embryonic stem cells
EP1641916B1 (en) Regeneration and repair of neural tissue using postpartum-derived cells
CN101188942B (en) Adult pancreatic-derived stromal cells
US8163553B2 (en) Human trophoblast stem cells and use thereof
Ivey et al. MicroRNA regulation of cell lineages in mouse and human embryonic stem cells
Ishii et al. FGF2 mediates mouse spermatogonial stem cell self-renewal via upregulation of Etv5 and Bcl6b through MAP2K1 activation
US20060194321A1 (en) Directed differentiation of embryonic stem cells and uses thereof
Mahmood et al. Enhanced differentiation of human embryonic stem cells to mesenchymal progenitors by inhibition of TGF‐β/activin/nodal signaling using SB‐431542
Fong et al. Human Wharton’s jelly stem cells have unique transcriptome profiles compared to human embryonic stem cells and other mesenchymal stem cells
Cho et al. Dynamic changes in mitochondrial biogenesis and antioxidant enzymes during the spontaneous differentiation of human embryonic stem cells
Easley IV et al. Direct differentiation of human pluripotent stem cells into haploid spermatogenic cells
Wu et al. Combinatorial signals of activin/nodal and bone morphogenic protein regulate the early lineage segregation of human embryonic stem cells
Lovati et al. Comparison of equine bone marrow-, umbilical cord matrix and amniotic fluid-derived progenitor cells
Kidder et al. Examination of transcriptional networks reveals an important role for TCFAP2C, SMARCA4, and EOMES in trophoblast stem cell maintenance
ES2624713T3 (en) Treatment of pluripotent cells
US20120207744A1 (en) Reprogramming compositions and methods of using the same
Spitzer et al. Perivascular human endometrial mesenchymal stem cells express pathways relevant to self-renewal, lineage specification, and functional phenotype

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07784432

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07784432

Country of ref document: EP

Kind code of ref document: A1