WO2008149356A1 - Methods of generating dopaminergic cells and uses thereof - Google Patents

Methods of generating dopaminergic cells and uses thereof Download PDF

Info

Publication number
WO2008149356A1
WO2008149356A1 PCT/IL2008/000759 IL2008000759W WO2008149356A1 WO 2008149356 A1 WO2008149356 A1 WO 2008149356A1 IL 2008000759 W IL2008000759 W IL 2008000759W WO 2008149356 A1 WO2008149356 A1 WO 2008149356A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
mesenchymal stem
lmxia
stem cell
mscs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2008/000759
Other languages
French (fr)
Inventor
Daniel Offen
Eldad Melamed
Ran Barzilay
Tali Ben-Zur
Shlomo Bulvik
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ramot at Tel Aviv University Ltd
Original Assignee
Ramot at Tel Aviv University Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ramot at Tel Aviv University Ltd filed Critical Ramot at Tel Aviv University Ltd
Publication of WO2008149356A1 publication Critical patent/WO2008149356A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0619Neurons
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/119Other fibroblast growth factors, e.g. FGF-4, FGF-8, FGF-10
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40Regulators of development
    • C12N2501/41Hedgehog proteins; Cyclopamine (inhibitor)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1346Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
    • C12N2506/1353Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from bone marrow mesenchymal stem cells (BM-MSC)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • the present invention in some embodiments thereof, relates to cells useful for treating neurodegenerative disorders and methods of generating same.
  • Parkinson's disease affects more than 1 % of the population over 60 years old in the western world.
  • Current treatments for PD are mainly comprised of dopamine replacement and symptom alleviation rather than presenting a cure for the disease.
  • the type specificity of the damaged cells makes PD patients ideal candidates for cellular therapy strategies.
  • Proofs of concept of cellular therapies for PD have long ago been established in a series of open label trials involving fetal graft transplantations into human PD patients.
  • Post-mortem studies demonstrated long graft survival years after transplantation and a significant reinnervation in the patients' striata. These studies illustrated the enormous therapeutic potential in cell therapy for PD but the moral issues concerning the use of fetuses and the risk of immune rejection require new solutions to be found.
  • MSCs bone marrow derived mesenchymal stem cells
  • MSCs have been known for years for their role in nourishing the hematopoietic cells in the bone marrow. It has also been long recognized that MSCs bare the capacity to self renew and differentiate along the mesenchymal lineage into bone, fat and cartilage cells.
  • dopaminergic differentiation is still much in haze.
  • Studies in dopaminergic cell development are currently working on deciphering the molecular code determining the dopaminergic fate.
  • signaling molecules such as Shh, FGF8 and wnts [Ye W, et al., 1998, Cell, 93, 755-766], and intrinsic determinants in the form of specific transcription factors that are crucial for differentiation [Simon HH, et al., Ann NY Acad Sci, 991 , 36-47].
  • LIM homeobox transcription factor 1 beta (LMXIb), the orphan nuclear receptor-related 1 (Nurr1 ), the paired-like homeodomain transcription factor 3 (Pitx3) and the engrailed genes (En1/2) [Smidt MP, et al., (2000), Nat Neurosci. 3, 337-341 ; Smidt MP et al. (2004); Development. 131 , 1145-1155].
  • an isolated mesenchymal stem cell expressing an exogenous polynucleotide, the exogenous polynucleotide comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
  • a method of generating cells useful for treating a neurodegenerative disorder comprising: (a) genetically modifying a mesenchymal stem cell with a nucleic acid construct comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide to generate genetically modified mesenchymal stem cells; and
  • a pharmaceutical composition comprising as an active agent the cells of the present invention and a pharmaceutically acceptable carrier.
  • the present invention there is provided a use of the cells generated according to the method of the present invention, for the manufacture of a medicament identified for the treatment of a neurodegenerative disorder.
  • a method of treating a neurodegenerative disorder comprising transplanting to an individual in need thereof cells generated according to the method of the present invention, thereby treating the neurodegenerative disorder.
  • the isolated mesenchymal stem cell is human.
  • an amount of the Lmxia polypeptide is at least twice an amount of Lmxia polypeptide in an identical mesenchymal stem cell not expressing the exogenous polynucleotide.
  • the isolated mesenchymal stem cell expresses at least twice an amount of midbrain dopaminergic polypeptide, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide, the midbrain dopaminergic polypeptide being selected from the group consisting of SRY-related HMG-box gene 2 (Sox2), msh homeobox 1 (MSX1), Neurogenin 2 ( ⁇ /G ⁇ /2), Human achaete-scute
  • LIM homeobox transcription factor 1 beta (LMXI b) and the orphan nuclear receptor-related 1 (NurM ).
  • the isolated mesenchymal stem cell expresses at least twice an amount of tyrosine hydroxylase, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide.
  • the isolated mesenchymal stem cell expresses fibronectin.
  • the isolated mesenchymal stem cell expresses VMAT2.
  • the exogenous polynucleotide further comprises a lentiviral nucleic acid sequence. According to some embodiments of the invention, the exogenous polynucleotide further comprises a promoter operably linked to the nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
  • the differentiating medium comprises at least one component selected from the group consisting of Fibroblast growth factor 2 (FGF-2), Fibroblast growth factor 8 (FGF8) and Sonic hedgehog (Shh).
  • FGF-2 Fibroblast growth factor 2
  • FGF8 Fibroblast growth factor 8
  • Sonic hedgehog Sonic hedgehog
  • the culturing is effected for a period of at least two weeks.
  • the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, autoimmune encephalomyelitis, Alzheimer's disease, Stroke and Huntington's disease.
  • the neurodegenerative disorder is Parkinson's.
  • all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
  • methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control.
  • the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
  • FIGs. 3A-D are photographs and graphs illustrating transduction efficiency of human mesenchymal stem cells with lentiviral reporter constructs.
  • Figures 3A-C illustrated imunoflorescence of MSCs transduced with pLenti6-CMV-AcGFP, pLenti6-CMV-DsRed and untreated control MSCs. Scale bar represents 20 ⁇ m.
  • Figure 3D illustrates results from a FACS analysis of GFP expression following transduction with pLenti6-CMV-AcGFP at different modes of infection (0.1 , 1 and 10). Error bars represent +SEM for small values of n ( * P ⁇ 0.005).
  • FIGS. 4A-D are graphs and photographs illustrating that transduction of MSCs with pLenti/CMV/LMX1a results in increased LMXIa gene and protein expression.
  • Figure 4A RNA extracts from MSCs transduced with LMXIa show high expression of LMXIa as indicated by early detection in quantative PCR (cycle 27) whereas in control MSCs expression is detected only in cycle 32. No differences in GAPDH expression were observed.
  • Figure 4B Semi quantitative PCR gel electropheresis reveals low levels of LMXIa in MSCs transduced with a mock vector pLe ⁇ ti.CMV/AcGFPi in comparison to LMXIa encoding vector.
  • Figures 4C-D lmmunocytochemistry of LMXIa (Red) shows expression in MSCs transduced with pLe ⁇ ti/CMV/LMX1a ( Figure 4D) in contrast to mock transduced MSCs ( Figure 4C). (DAPl nuclear staining in blue, Original magnification X20),
  • FlGs. 5A-F are bar graphs illustrating that expression of midbrain dopaminergic transcripts in MSCs overexpressing LMXIa is up regulated following differentiation.
  • Non- transduced MSCs and LMXIa-MSCs were induced to differentiate as described herein.
  • RNA was extracted following 3 weeks of differentiation. Samples were analyzed by semi quantitative PCR for Sox2 (Figure 5A), MSX1 (Figure 5B) 1 HASH1 (Figure 6C), NGN2 ( Figure 5D), En1 (Figure 5E) and Pitx3 (Figure 5F) gene expression. Calculations of trie investigated gene versus GAPDH were done by using the ⁇ CT method. The data presented here are from a representative experiment repeated 3 times with similar results.
  • FlGs. 6A-N are photomicrographs illustrating expression of dopaminergic transcription factors in LMXIa-MSCs following dopaminergic differentiation, as analyzed by immu ⁇ ocyt ⁇ chemistry.
  • Figure 6A-B Staining for LMXIa (red) and MSX1 (green) in LMXIa- MSCs following differentiation.
  • Figure 6C-D Merged photos following and prior to differentiation.
  • Figures 6E-F Staining for LMXIa (reel) and En1 (green) in LMXIa-MSCs following differentiation.
  • Figures 6G-H Merged photos following and prior to differentiation.
  • LMXIa-MSCs Merged photos of LMXIa-MSCs before differentiation stained for LMXIa (red), Tuj1/TH (green) and DAPI (blue).
  • Figures 7C-E staining of dopaminergic differentiated LMXIa-MSCs for LMXIa (red), Tuj1 (green) and DAPI (blue).
  • the present invention in some embodiments thereof, relates to cells and populations thereof which can be transplanted into a patient in order to treat a CNS disease or disorder such as Parkinson's.
  • a CNS disease or disorder such as Parkinson's.
  • PD Parkinson's disease
  • WISCs bone marrow derived mesenchymal stem cells
  • the present inventors initially confirmed the efficiency of lentiviral gene delivery of fluorescent reporter genes for transforming mesenchymal stem cells. Subsequently, the present inventors showed that forced expression of LMXi a in human mesenchymal stem cells, followed by incubation of the LMXIa transduced cells in differentiation medium, induced upregulation of key transcriptional factors which are known to be involved in the dopaminergic differentiation of primitive stem cells In the developing midbrain and of embryonic stem cells
  • transduced and differentiated cells expressed higher levels of tyrosine hydroxylase ( Figures 71-J), the rate limiting enzyme in dopamine synthesis and secreted higher level of dopamine in comparison to non-transduced cells ( Figure 7K).
  • a method of generating cells useful for treating a neurodegenerative disorder comprising:
  • neurodegenerative disorder refers to any disorder, disease or condition of the nervous system (preferably CNS) which is characterized by gradual and progressive loss of neural tissue, neurotransmitter, or neural functions.
  • CNS the nervous system
  • neurodegenerative disorder include, Parkinson's disease, Multiple sclerosis, Amyatrophic Lateral Sclerosis, autoimmune encephalomyelitis, Alzheimer's disease, Stroke and Huntington's disease.
  • the method of this aspect of the present invention is affected by a two-step process, namely genetically modifying mesenchymal stem cells to express Lmxia and subsequent culturing of the genetically modified cells in a differentiation medium.
  • the cells of the present invention may be derived from any stem cell, although preferably not ES cells.
  • Bone marrow can be isolated from the iliac crest of an individual by aspiration.
  • Low- density BM mononuclear cells (BMMNC) may be separated by a FICOL-PAGUE density gradient.
  • a cell population comprising the mesenchymal stem cells (e.g. BMMNC) may be cultured in a proliferating medium capable of maintaining and/or expanding the cells.
  • the populations are plated on polystyrene plastic surfaces (e.g. in a flask) and mesenchymal stem cells are isolated by removing non-adherent cells.
  • mesenchymal stem cell may be isolated by FACS using mesenchymal stem cell markers.
  • the MSCs are at least 50 % purified, more preferably at least 75 % purified and even more preferably at least 90 % purified.
  • the cells are typically expanded by culturing in a proliferation medium capable of maintaining and/or expanding the isolated cells ex vivo as described in Example 1 hereinbelow.
  • the proliferation medium may be DMEM, alpha-MEM or DMEM/F12.
  • the proliferation medium may further comprise SPN, L-glutamine and a serum (such as fetal calf serum or horse serum).
  • a serum such as fetal calf serum or horse serum.
  • the expression vector of the present invention may also include additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhancers) and transcription and translation terminators (e.g., polyadenylation signals).
  • the expression vector of the present invention may contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • SV40 vectors include pSVT7 and pMT2 Vectors derived from bovine papilloma virus include pBV-1 MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5
  • Other exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells
  • Retroviral constructs of the present invention may contain retroviral LTRs, packaging signals, and any other sequences that facilitate creation of infectious retroviral vectors
  • Retroviral LTRs and packaging signals allow the Lmx1-a polypeptides of the invention to be packaged into infectious particles and delivered to the cell by viral infection
  • Methods for making recombinant retroviral vectors are well known in the art (see for example, Brenner et al , PNAS 86 5517-5512 (1989), Xiong et al , Developmental Dynamics 212 181-197 (1998) and references therein, each incorporated herein by reference)
  • retroviral sequences useful in the present invention include those derived from adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV)
  • viruses known in the art are also useful in the present invention and therefore will be familiar to the ordinarily skilled artisan
  • identical mesenchymal stem cell refers to a mesenchymal stem cell that has been treated in an identical fashion to the mesenchymal stem cell of the present invention and therefore is at an identical stage of differentiation According to one embodiment, the cells express at least five times the amount of
  • the cells express at least ten times the amount of Lmxia polypeptide as compared with an identical mesenchymal stem cell not expressing the exogenous polynucleotide
  • the mesenchymal stem cells of the present invention are cultured in a differentiating medium under conditions sufficient to induce differentiation
  • Differentiation of mesenchymal stem cells can be effected by incubation thereof in differentiating media such as those described in U S Pat No 6,528,245 and by Sanchez- Ramos ef a/ (2000), Woodburry ef al (2000), Woodburry ef al (J Neu ⁇ sci Res 96 908-917, 2001), Black and Woodbury (Blood Cells MoI Dis 27 632-635, 2001 ), Deng ef al (2001), Kohyama ef a/ (2001 ), Reyes and Verfatile (Ann N Y Acad Sci 938 231-235, 2001) and Jiang ef al (Nature 418 47-49, 2002)
  • the differentiating media may be DMEM or DMEM/F12, or any other medium that supports neuronal growth
  • the medium is 50 % Neurobasal medium (e g Cat No 21103049, Invitrogen, Ca, U S A ) and 50 % DMEM/F12
  • the MSCs are differentiated for a period of time between about 5 days to about 13 days in the differentiating medium so that differentiation into oligodendrocyte-like cells may occur
  • the exact number of days is dependent upon the particular differentiating agents added to the medium and may be determined empirically
  • the cells are incubated (e g for about 2-3 weeks) in a differentiating medium comprising FGF-2, (e g 20 ng/ml, R&D Systems, Minneapolis, MN, USA), Fibroblast growth factor 8 (FGF8, e g 100 ng/ml, PeproTech, London, UK) and Sonic hedgehog (Shh, e g 17 nM R&D Systems)
  • the differentiating medium may also comprise other differentiating agents including, but not limited to 11-1 ⁇ , N2 supplement, B27 supplement, TH, db-cAMP, bone morphogenetic proteins, forskolm, retinoic acid, ascorbic acid, put
  • Cells obtained according to the methods described herein typically express at least twice an amount of midbrain dopaminergic polypeptide, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide
  • midbrain dopaminergic polypeptide refers to a polypeptide which is expressed preferentially in a dopaminergic neuron present in the midbrain as opposed to the forebrain
  • Exemplary midbrain dopaminergic polypeptides include, but are not limited to SRY-related HMG-box gene 2 (Sox2), msh homeobox 1 (MSX1), Neurogenin 2 ( ⁇ /G ⁇ /2), Human achaete-scute Homologue (hASH1), E ⁇ grailedi (En1 ), Paired-Like Homeodomain transcription factor 3 (P ⁇ tx3) the LIM homeobox transcription factor 1 beta (LMXIb) and the orphan nuclear receptor-related 1 (Nu ⁇ i)
  • the cells generated according to the method of the present invention express at least two, at least three, at least four, at least five, at least six or more midbrain dopaminergic polypeptides
  • the cells are capable of synthesizing dopamine It will be appreciated that the cells of the present invention may also retain characteristics of mesenchymal stem cells For example, the present inventors showed that the cells generated as described herein express fibronectin and RUNX2 (See Example 4, herein below)
  • the cells of the present invention may express a marker (e g surface marker) typical to mesenchymal stem cells but atypical to native dopamine secreting cells
  • a marker e g surface marker
  • mesenchymal stem cell surface markers include but are not limited to CD105+, CD29+, CD44+, CD90+, CD34-, CD45-, CD19-, CD5-, CD20-, CD11 B- and FMC7-
  • non-homogeneous cell populations may be obtained
  • the percentage of cells which comprise a particular phenotype e g dopamine-like phenotype may be raised or lowered according to the intended needs
  • the cell populations may be enriched for dopamine secreting cells by FACS using an antibody specific for a dopamine-secreting cell marker
  • the FACS analysis comprises antibodies or fragments thereof which may easily penetrate a cell and may easily be washed out of the cell following detection
  • the FACS process may be repeated a number of times using the same or different markers depending on the degree of enrichment and the cell phenotype required as the end product
  • the cells may be tested (in culture) for their neuronal phenotype (e g ability to secrete dopamine)
  • the cultures may be comparatively analyzed for a neuronal phenotype, using biochemical analytical methods such as immunoassays, Western blot and Real-time PCR as described in Example 4 of the Examples section which follows, or by enzyme activity bioassays
  • the cells of the present invention may be useful for a variety of therapeutic purposes
  • a method of treating a neurodegenerative disease Examples of neurodegenerative diseases are listed herein above
  • the cells may be obtained from any autologous or non-autologous ( ⁇ e , allogeneic or xenogeneic) human donor
  • cells may be isolated from a human cadaver or a donor subject
  • the cells of the present invention can be administered to the treated individual using a variety of transplantation approaches, the nature of which depends on the site of implantation
  • the cells can be grafted into the central nervous system or into the ventricular cavities or subdurally onto the surface of a host brain
  • Conditions for successful transplantation include ( ⁇ ) viability of the implant, (n) retention of the graft at the site of transplantation, and (HI) minimum amount of pathological reaction at the site of transplantation
  • Methods for transplanting various nerve tissues, for example embryonic brain tissue, into host brains have been described in "Neural grafting in the mammalian CNS", Bjorklund and Stenevi, eds (1985), Freed et al , 2001 , Olanow et al., 2003). These procedures include intraparenchymal transplantation, i.e.
  • Intraparenchymal transplantation can be effected using two approaches: (i) injection of cells into the host brain parenchyma or (ii) preparing a cavity by surgical means to expose the host brain parenchyma and then depositing the graft into the cavity. Both methods provide parenchymal deposition between the graft and host brain tissue at the time of grafting, and both facilitate anatomical integration between the graft and host brain tissue. This is of importance if it is required that the graft becomes an integral part of the host brain and survives for the life of the host.
  • Injections into selected regions of the host brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted.
  • the microsyringe is preferably mounted in a stereotaxic frame and three dimensional stereotaxic coordinates are selected for placing the needle into the desired location of the brain or spinal cord.
  • the cells may also be introduced into the putamen, nucleus basalis, hippocampus cortex, striatum, substantia nigra or caudate regions of the brain, as well as the spinal cord.
  • the cells may also be transplanted to a healthy region of the tissue. In some cases the exact location of the damaged tissue area may be unknown and the cells may be inadvertently transplanted to a healthy region.
  • tissue is removed from regions close to the external surface of the central nerve system (CNS) to form a transplantation cavity, for example as described by Stenevi et al (Brain Res 114 1-20 ,
  • the site of implantation is dictated by the CNS disorder being treated Demyelinated MS lesions are distributed across multiple locations throughout the CNS, such that effective treatment of MS may rely more on the migratory ability of the cells to the appropriate target sites
  • non-autologous cells are likely to induce an immune reaction when administered to the body
  • approaches have been developed to reduce the likelihood of rejection of non-autologous cells
  • diseases such as multiple sclerosis are inflammatory based diseases
  • the problem of immune reaction is exacerbated These include either suppressing the recipient's immune system, providing anti-inflammatory treatment and/or encapsulating the non-autologous cells in immunoisolating, semipermeable membranes before transplantation
  • Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludag, H et al Technology of mammalian cell encapsulation Adv Drug Deliv Rev 2000, 42 29-64)
  • Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu MZ, et al , Cell encapsulation with alginate and alpha- phenoxycinnamylidene-acetylated poly(allylam ⁇ ne) Biotechnol Bioeng 2000, 70 479-83, Chang TM and Prakash S Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms MoI Biotechnol 2001 , 17 249-60, and Lu MZ, et al , A novel cell encapsulation method using photosensitive poly(allylam ⁇ ne alpha-cyanocinnamylideneacetate) J Micro
  • microcapsules are based on alginate, a marine polysaccharide (Sambanis, A Encapsulated islets in diabetes treatment Diabetes Technol Ther 2003, 5 665-8) or its derivatives
  • microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guan ⁇ d ⁇ ne) hydrochloride in the presence of calcium chloride
  • NSAIDs include, but are not limited to acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors and tramadol.
  • the cells can be administered either per se or, preferably as a part of a pharmaceutical composition that further comprises a pharmaceutically acceptable carrier.
  • the term "pharmaceutically acceptable carrier” refers to a carrier or a diluent that does not cause significant irritation to a subject and does not abrogate the biological activity and properties of the administered compound.
  • carriers are propylene glycol, saline, emulsions and mixtures of organic solvents with water.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • the pharmaceutical carrier is an aqueous solution of saline.
  • Suitable routes of administration include direct administration into the tissue or organ of interest.
  • the cells may be administered directly into the brain.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose is formulated in an animal model to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • 6-OHDA-lesioned mice may be used as animal models of Parkinson's.
  • a sunflower test may be used to test improvement in delicate motor function by challenging the animals to open sunflowers seeds during a particular time period.
  • Transgenic mice may be used as a model for Huntingdon's disease which comprise increased numbers of CAG repeats have intranuclear inclusions of huntingtin and ubiquitin in neurons of the striatum and cerebral cortex but not in the brain stem, thalamus, or spinal cord, matching closely the sites of neuronal cell loss in the disease.
  • the septohippocampal pathway transected unilaterally by cutting the fimbria, mimics the cholinergic deficit of the septohippocampal pathway loss in Alzheimers disease. Accordingly animal models comprising this lesion may be used to test the cells of the present invention for treating Alzheimers.
  • Animal models of demyelinating diseases include shiverer (shi/shi, MBP deleted) mouse, MD rats (PLP deficiency), Jimpy mouse (PLP mutation), dog shaking pup (PLP mutation), twitcher mouse (galactosylceramidase defect, as in human Krabbe disease), trembler mouse (PMP-22 deficiency).
  • Virus induced demyelination model comprise use if Theiler's virus and mouse hepatitis virus. Autoimmune EAE is a possible model for multiple sclerosis.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (see e.g., Fingl, er a/., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1).
  • a Parkinon's patient can be monitored symptomatically for improved motor functions indicating positive response to treatment.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. Dosages necessary to achieve the desired effect will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or diminution of the disease state is achieved.
  • the amount of a composition to be administered will, of course, be dependent on the individual being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • the dosage and timing of administration will be responsive to a careful and continuous monitoring of the individual changing condition. For example, a treated multiple sclerosis patient will be administered with an amount of cells which is sufficient to alleviate the symptoms of the disease, based on the monitoring indications.
  • the cells of the present invention may be co-administered with therapeutic agents useful in treating neurodegenerative disorders, such as gangliosides; antibiotics, neurotransmitters, neurohormones, toxins, neurite promoting molecules; and antimetabolites and precursors of neurotransmitter molecules such as L-DOPA. Additionally, the cells of the present invention may be co-administered with other cells capable of synthesizing a neurotransmitter. Such cells are described in U.S. Pat. Appl. No. 20050265983 for example. Additionally, the cells of the present invention may be co-administered with other cells capable of myelination - e.g. Schwann cells, such as those described in U.S. Pat. No. 6,989,271. As used herein the term "about" refers to ⁇ 10 %.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • hMSCs were harvested from the tissue culture flasks centrifuged and resuspe ⁇ ded in phosphate-buffered saline (PBS). Cells were incubated with mouse anti CD29-PE (1 :25, eBioscibce, San Diego, CA), mouse anti CD34-PE (1:10, Miltenyi Biotech, Cologne, Germany), mouse anti CD44-PE (1 :10, Cymbus Technology, Hampshire, UK), mouse anti CD45-PE (1 :10, DAKO, Cambridgeshire, UK), mouse anti CD105-FITC (1 :100, Ancell Corporation, Bayport, MN) for 45 minutes on ice, washed twice in flow-buffer, consisting of 5 % fetal calf serum and 0.1 % sodium azide in PBS, and analyzed using a Beckton Dickinson flow cytometer.
  • PBS phosphate-buffered saline
  • Mesenchymal stem cells were produced from freshly harvested adult human bone marrow aspirates. After 2-5 passages, cells were characterized for their cell surface phenotype using FACS caliber. MSCs did not express the common leukocyte antigen CD45 and the hematopoetic stem cell marker CD34 ( Figures 1 D-E). In contrast, the cells ubiquitously expressed the mesenchymal markers CD29, CD44 and CD105 ( Figures 1A-C). Thus, the observed phenotype is characteristic of non hematopoetic mesenchymal stem cell population.
  • Viral construct preparation pLenti6/CMV/LMX1a, pLenti6/CMV/AcGFP and pLenti ⁇ /CMVDsRed were constructed using ViraPowerTM Promoterless Lentiviral Gateway® Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol.
  • CMV cytomegalovirus
  • plRES2/AcGFP1 Clontech, Mountain View, CA, USA
  • CMV FW 5'- CGTATTACCGCCATGCATTAG-3' SEQ ID NO: 1
  • CMV REV 5'- CGGATCTGACGGTTCACTAAA-S 1 SEQ ID NO: 2
  • the CMV-PCR product was cloned into pENTRTM5 ' -TOPO® (Invitrogen).
  • the LMXIa gene was amplified from the plasmid pBluescript/LMX1a (ACCESSION number BC066353, purchased from RZPD, Berlin, Germany) using the following primers M 13 FW ⁇ '-GTAAAACGACGGCCAG-S' (SEQ ID NO: 3) and M13 REV ⁇ '-CAGGAAACAGCTATGAC-S' (SEQ ID NO: 4).
  • the AcGFPI gene was amplified by PCR from plasmid plRES2/AcGFP1 (Clontech) using the following primers: AcGFP FW ⁇ '-CGATGATAATATGGCCACAACS-' (SEQ ID NO: 5) and AcGFP REV 5'- TCTACAAATGTGGTATGGCTGA-3' (SEQ ID NO: 6).
  • the DsRed gene was amplified by PCR from plasmid pDsRed2-1 (Clontech) using the following primers: DsRed FW 5'- TAGCGCTACCGG ACTCAG AT-3' (SEQ ID NO: 7) and DsRed REV 5'GGGAGGTGTGGGAGGTTTT-3 • (SEQ ID NO: 8).
  • the medium containing the viral particles was collected 48 or 72 hours after transfection, filtered through 0.45 ⁇ m PVDF filters following low speed centrifugation (3000 rpm for 15 min 4 0 C) and concentrated using Amicon ultra-15 centrifugal filter 100,000 NMWL (Millipore, Billerica, MA, USA).
  • Viral titers transducing units/ml were determined by transduction of HeLa cells with serial dilutions of the viral supernatant and colony counting after blasticidin selection (4ng/ml, Invitrogen) with Crystal Violet staining (Sigma, St. Louis, MO, USA).
  • the genes of interest were inserted under the control of the cytomegalovirus (CMV) promoter since it was reported to induce the highest expression rate in MSCs compared to other promoters.
  • CMV cytomegalovirus
  • the virus was pseudotyped with the vesicular stomatitis virus G-protein.
  • 2 reporter vectors were constructed encoding AcGFP and DsRed fluorescent proteins and an expression vector encoding LMXIa cDNA ( Figure 2).
  • RNA isolation and cDNA synthesis Total RNA was isolated from cultured untreated human MSCs and pLenti-CMV-LMX1a transduced MSCs using a commercial reagent TriReagent (Sigma) and the manufacturer's recommended procedure. The amount and quality of RNA was determined spectrophotometrically by using the ND-1000 spectrophotometer (Nano-drop, Wilmington, DE, USA). First-strand cDNA synthesis was carried out with Super Script Il RNase H-reverse transcriptase (Invitrogen) using random primer.
  • PCR Real-time semi quantitative reverse transcription polymerase chain reaction
  • Lentiviral transduction of human MSCs did not affect the constitutive expression of the reference gene, GAPDH.
  • verifying a single peak in melting curve analysis assessed the specificity of the PCR product.
  • the PCR was performed in a total volume of 20 ⁇ l containing 1 ⁇ l of the previously described cDNA, the 3' and 5' primers in final concentration of 500 nM each and 10 ⁇ l of Sybr Green Mix.
  • the amplification protocol was 40 cycles of 95 0 C for 15 sec followed by 60 °C for 1 min each.
  • Quantitative calculations of the gene of interest versus GAPDH was done using the ⁇ CT method, as instructed in the user bulletin 2 ABI prism 7700 sequence detection system.
  • the major aim of this experiment was to induce dopaminergic differentiation on adult MSCs.
  • the present inventors transduced the cells with pLenti6-CMV-LMX1a.
  • RNA isolation and cDNA synthesis Total RNA was isolated from cultured untreated MSCs and MSCs transduced with p/Lenti/CMV/LMX1a using a commercial reagent TriReagent (Sigma) according to the manufacturer's recommended procedure. DNAse treatment was performed followed by RNA cleaning using RNeasy mini kit (both from Qiagen.Valencia, CA). The amount and quality of RNA was determined spectrophotometrically by using the ND-1000 spectrophotometer (Nano-drop, Wilmington, DE, USA). First-strand cDNA synthesis was carried out with Super Script Il RNase H-reverse transcriptase (Invitrogen) using random primer.
  • Real-time semi quantitative reverse transcription polymerase chain reaction (Real-time PC/?j;Real-time semi quantitative PCR of the desired genes was performed in an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA) by using Platinum® SYBR® Green qPCR SuperMix UDG with ROX (Invitrogen). PCR amplification was stopped at 40 cycles (program: 2 min at 50 0 C; 2 min at 95 0 C; 40 repeats of 15 sec at 95 0 C and 30 sec at 60 0 C).
  • GAPDH sense CGACAGTCAGCCGCATCTT SEQ ID NO: 9
  • GAPDH antisense CCAATACGACCAAATCCGTTG SEQ ID NO: 10
  • LMXIa sense CCTGCAGGAAGGTGAGAGA SEQ ID NO: 11
  • LMXIa antisense TGGACGACACGGACACTCAG SEQ ID NO: 12
  • Sox2 sense CAGGAGAACCCCAAGATGC SEQ ID NO: 13
  • Sox2 antisense GCAGCCGCTTAGCCTCG SEQ ID NO: 14
  • NGN2 sense CAACTAAGATGTTCGTCAAATCCG SEQ ID NO: 15
  • NGN2 antisense CCTTCAACTCCAAGGTCTCGG SEQ ID NO: 16
  • hASH1 sense AGCAGGGTGATCGCACAAC SEQ ID NO: 17
  • hASH1 antisense ACGCCACTGACAAGAAAGCACTA SEQ ID NO: 18
  • GTTATTCGGATCGTCCATCCTC (SEQ ID NO: 21 ) EEnn11 aannttiisseennssee CGCCTTGAGTCTCTGCAGCT JEQ ID NO: 22); NNuu ⁇ ii sseennssee
  • HPLC High Performance Liquid Chromatography
  • Error bars in Figures 5A-F represent the standard deviation between samples (STD). Error bars on Figure 7L-M represent the standard error of the mean. For comparisons between two groups two-tailed Student's f test was employed. Significance was considered for p ⁇ 0.05.
  • LMXIa-MSCs upregulate typical midbrain dopaminergic transcripts: To evaluate the effect of LMXIa forced expression on the dopaminergic differentiation of MSCs, the relative gene expression of key transcription factors involved in the mesencephalic dopaminergic neuron development was analyzed using semi quantitative real time PCR. Prior to differentiation, no change in the transcripts' expression levels was observed.
  • LMXIa-MSCs express dopaminergic specific transcription factors: Following observations that the dopaminergic mRNA transcripts were upregulated in the LMXIa-MSCs, immunocytochemistry analysis was performed for detection of the dopaminergic transcription factors in the differentiated cells.
  • the MSX1 protein was found to be expressed in the LMXIa-MSCs co-localizing with LWIXIa ( Figure 6A-C). The same picture was observed when the cells were stained for EM ⁇ Figure ⁇ E-G). Pit ⁇ 3 was also expressed in LWlXIa- MSCs ( Figure 61-0). No expression of those transcription factors was noticed in LMXIa-MSCs prior to incubation in differentiation medium ( Figure 6D, H 1 K).
  • TH protein upregulation was significantly higher in LMXIa-MSCs compared with non transduced MSCs (Figure 7J) 1 following one week of differentiation 3.05-fdds ⁇ SEM 0.39 in LMXia-MSCs and 1.71-foids ⁇ SEM 0,26 in untransduced MSCs, following three weeks of differentiation 4.43-folds ⁇ SEM 0.66 in LMXIa- MSCs and 1 ,82-folds ⁇ SEM 0,22 in non transduced MSCs.
  • the present examples describe the efficient transduction of human MSCs with a lentiviral vector encoding the complete cDNA of the human Lmxia gene. Forced expression of Lmxia in human cells harvested from an adult patient was shown to induce upregulation of key transcriptional factors which are known to be involved in the dopaminergic differentiation of primitive stem cells in the developing midbrain and of embryonic stem cells. Lmxia forced expression, together with extrinsic signaling molecules such as Shh and FGF8 were shown to be sufficient to produce cells that exhibit a gene expression profile typical of dopaminergic cells. Moreover, the LMXIa-MSCs expressed higher levels of TH, the rate limiting enzyme in dopamine synthesis, and secreted significantly higher levels of dopamine compared with non transduced cells.
  • the present work shows that forced expression of LMXIa in cells harvested from an adult, together with exposure of the cells to extrinsic signals in the form of Shh and FGF8, resulted in a gene expression profile which mimics the expression pattern of dopaminergic precursors
  • the differentiated LMXIa-MSCs displayed significant up regulation of Sox2, MSX1, NGN2, hASH1 , En1 and Pitx3 compared with non transduced MSCs expressing little or no LMXIa. Analyzing the functional dopaminergic traits of the cells, a clear advantage of the
  • LMXIa-MSCs was found. While tyrosine hydroxylase upregulation in differentiated MSCs has been reported before [Barzilay et al., 2008, in press; Trzaska et al., 2007, Stem Cells. 25, 2797- 2808], the present inventors found that LMXIa forced expression facilitated this upregulation and resulted in higher levels of dopamine secretion in LMXIa-MSCs than in non transduced MSCs. A trend of increased dopamine secretion in response to depolarization in LMXIa-MSCs was also observed, suggesting that a compatible neuronal differentiation was yet to be established.

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurosurgery (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

An isolated mesenchymal stem cell expressing an exogenous polynucleotide is disclosed. The exogenous polynucleotide comprises a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmx1a) polypeptide. Methods of generating same, uses of same and pharmaceutical compositions comprising same are also disclosed.

Description

METHODS OF GENERATING DOPAMINERGIC CELLS AND USES THEREOF
FIELD AND BACKGROUND OF THE INVENTION The present invention, in some embodiments thereof, relates to cells useful for treating neurodegenerative disorders and methods of generating same.
Parkinson's disease (PD) affects more than 1 % of the population over 60 years old in the western world. Current treatments for PD are mainly comprised of dopamine replacement and symptom alleviation rather than presenting a cure for the disease. The type specificity of the damaged cells makes PD patients ideal candidates for cellular therapy strategies. Proofs of concept of cellular therapies for PD have long ago been established in a series of open label trials involving fetal graft transplantations into human PD patients. Post-mortem studies demonstrated long graft survival years after transplantation and a significant reinnervation in the patients' striata. These studies illustrated the enormous therapeutic potential in cell therapy for PD but the moral issues concerning the use of fetuses and the risk of immune rejection require new solutions to be found.
Adult bone marrow derived mesenchymal stem cells (MSCs) present an attractive candidate for autologous cell transplantation source for regenerative medicine. MSCs have been known for years for their role in nourishing the hematopoietic cells in the bone marrow. It has also been long recognized that MSCs bare the capacity to self renew and differentiate along the mesenchymal lineage into bone, fat and cartilage cells. However, more recent works demonstrated MSCs capacity to differentiate outside their accepted mesenchymal identity, transdifferentiating to other developmental lineages, including neuron-like cells demonstrating neuronal markers [Sanchez-Ramos ef al., 2000, Exp Neurol 164:247-256; Schwarz ef al., 1999, Hum Gene Ther 10:2539-2549; Woodbury et al., 2000, J Neurosci Res 61 :364-370] and some electro-physiological functions [Kohyama ef al., 2001 , Differentiation 68: 235-244], Such cells have also been shown to express dopaminergic markers and also to secrete dopamine following depolarization [Levy ef al., 2004, J MoI. Neurosci. 24:353-386].
It was reported that bone marrow cells have the potential to migrate into injured neural tissues and to differentiate into neurons [Mahmood ef al., 2001 , J Neurosurg 94:589-595; Li ef al., 2001; 2002, Neurosci Lett 316:67-70; Kan ef a/., 2005, Current Drug Targets, 6]. Moreover, transplantation of BMSc in mouse and rat models of Parkinson's disease resulted in beneficial effects (Li ef al., 2001 , Neurosci Lett 316:67-70).
Lately a report has been made describing the neurotrophin directed differentiation of bone marrow stem cells to dopaminergic-like cells [Tatard V.M. et al, 2007, Bone, 40, 360-373].
The complete picture of dopaminergic differentiation is still much in haze. Studies in dopaminergic cell development are currently working on deciphering the molecular code determining the dopaminergic fate. However, it is accepted by most researchers that the fully compatible dopaminergic differentiation requires both extrinsic cues provided by signaling molecules such as Shh, FGF8 and wnts [Ye W, et al., 1998, Cell, 93, 755-766], and intrinsic determinants in the form of specific transcription factors that are crucial for differentiation [Simon HH, et al., Ann NY Acad Sci, 991 , 36-47]. Knock out studies enabled researchers to identify some of the transcription factors essential for dopaminergic differentiation, those include the LIM homeobox transcription factor 1 beta (LMXIb), the orphan nuclear receptor-related 1 (Nurr1 ), the paired-like homeodomain transcription factor 3 (Pitx3) and the engrailed genes (En1/2) [Smidt MP, et al., (2000), Nat Neurosci. 3, 337-341 ; Smidt MP et al. (2004); Development. 131 , 1145-1155].
Andersson et al. [Cell, 124, 393-405, 2006] teaches the generation of a pure dopaminergic neuron population derived from embryonic stem cells upon delivery of LMXIa and exposure to Shh both in human and mouse cell systems. Moreover, ectopic injection of Lmxia in the neural tube was shown therein to be sufficient to induce midbrain dopaminergic neurons whereas RNA-interference experiments in chicken embryos resulted in reduction of dopaminergic neurongenesis. Additional background art includes U.S. Patent Application No. 20050265983.
SUMMARY OF THE INVENTION
According to an aspect of some embodiments of the present invention there is provided an isolated mesenchymal stem cell expressing an exogenous polynucleotide, the exogenous polynucleotide comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
According to an aspect of some embodiments of the present invention there is provided a method of generating cells useful for treating a neurodegenerative disorder, the method comprising: (a) genetically modifying a mesenchymal stem cell with a nucleic acid construct comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide to generate genetically modified mesenchymal stem cells; and
(b) culturing the genetically modified mesenchymal stem cells in a differentiating medium, thereby generating cells useful for treating the neurodegenerative disorder. According to an aspect of some embodiments of the present invention there is provided a pharmaceutical composition comprising as an active agent the cells of the present invention and a pharmaceutically acceptable carrier.
According to an aspect of some embodiments of the present invention there is provided a use of the cells generated according to the method of the present invention, for the manufacture of a medicament identified for the treatment of a neurodegenerative disorder.
According to an aspect of some embodiments of the present invention there is provided a method of treating a neurodegenerative disorder, the method comprising transplanting to an individual in need thereof cells generated according to the method of the present invention, thereby treating the neurodegenerative disorder. According to some embodiments of the invention, the isolated mesenchymal stem cell is human.
According to some embodiments of the invention, an amount of the Lmxia polypeptide is at least twice an amount of Lmxia polypeptide in an identical mesenchymal stem cell not expressing the exogenous polynucleotide.
According to some embodiments of the invention, the isolated mesenchymal stem cell secretes dopamine.
According to some embodiments of the invention, the isolated mesenchymal stem cell expresses at least twice an amount of midbrain dopaminergic polypeptide, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide, the midbrain dopaminergic polypeptide being selected from the group consisting of SRY-related HMG-box gene 2 (Sox2), msh homeobox 1 (MSX1), Neurogenin 2 (Λ/GΛ/2), Human achaete-scute
Homologue (hASH1), Engrailedi (En1 ), Paired-Like Homeodomain transcription factor 3 (Pitx3),
LIM homeobox transcription factor 1 beta (LMXI b) and the orphan nuclear receptor-related 1 (NurM ).
According to some embodiments of the invention, the isolated mesenchymal stem cell expresses at least twice an amount of tyrosine hydroxylase, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide.
According to some embodiments of the invention, the isolated mesenchymal stem cell expresses fibronectin.
According to some embodiments of the invention, the isolated mesenchymal stem cell expresses VMAT2.
According to some embodiments of the invention, the exogenous polynucleotide further comprises a lentiviral nucleic acid sequence. According to some embodiments of the invention, the exogenous polynucleotide further comprises a promoter operably linked to the nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
According to some embodiments of the invention, the differentiating medium comprises at least one component selected from the group consisting of Fibroblast growth factor 2 (FGF-2), Fibroblast growth factor 8 (FGF8) and Sonic hedgehog (Shh).
According to some embodiments of the invention, the culturing is effected for a period of at least two weeks.
According to some embodiments of the invention, the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, autoimmune encephalomyelitis, Alzheimer's disease, Stroke and Huntington's disease.
According to some embodiments of the invention, the neurodegenerative disorder is Parkinson's. Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
BRIEF DESCRIPTION OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
FIGs. 1A-H are graphs and photographs characterizing human mesenchymal stem cells. Figures 1A-C: FACS analysis of human mesenchymal stem cell expression of mesenchymal markers CD29, CD105 and C44. Figures 1D-E: FACS analysis of human mesenchymal stem cell expression of hematopoietic markers CD45 and CD105. Figures 1 F-G: Adipogenic induced cells were positively stained for Oil Red O in contrast to untreated cells. Scale bar represents 20 μm. Figure 1 H: lmmunohistochemistry analysis of untreated human mesenchymal stem cells for expression of the neural progenitor marker nestin. Scale bar represents 50 μm.
FIGs. 2A-C are schematic diagrams of lentiviral vectors. All of the vectors are self inactivating vectors because of deletions in the U3 region of the long terminal repeat (ΔU3) and contain the packaging signal (Ψ) and the complete RRE to facilitate RNA export. Expression of LMXIa (Figure 2A) or fluorescent reporter genes (Figures 2B-C) is controlled by the CMV reporter.
FIGs. 3A-D are photographs and graphs illustrating transduction efficiency of human mesenchymal stem cells with lentiviral reporter constructs. Figures 3A-C illustrated imunoflorescence of MSCs transduced with pLenti6-CMV-AcGFP, pLenti6-CMV-DsRed and untreated control MSCs. Scale bar represents 20 μm. Figure 3D illustrates results from a FACS analysis of GFP expression following transduction with pLenti6-CMV-AcGFP at different modes of infection (0.1 , 1 and 10). Error bars represent +SEM for small values of n (*P<0.005). FIGs. 4A-D are graphs and photographs illustrating that transduction of MSCs with pLenti/CMV/LMX1a results in increased LMXIa gene and protein expression. Figure 4A: RNA extracts from MSCs transduced with LMXIa show high expression of LMXIa as indicated by early detection in quantative PCR (cycle 27) whereas in control MSCs expression is detected only in cycle 32. No differences in GAPDH expression were observed. Figure 4B: Semi quantitative PCR gel electropheresis reveals low levels of LMXIa in MSCs transduced with a mock vector pLeπti.CMV/AcGFPi in comparison to LMXIa encoding vector. Figures 4C-D; lmmunocytochemistry of LMXIa (Red) shows expression in MSCs transduced with pLeπti/CMV/LMX1a (Figure 4D) in contrast to mock transduced MSCs (Figure 4C). (DAPl nuclear staining in blue, Original magnification X20),
FlGs. 5A-F are bar graphs illustrating that expression of midbrain dopaminergic transcripts in MSCs overexpressing LMXIa is up regulated following differentiation. Non- transduced MSCs and LMXIa-MSCs were induced to differentiate as described herein. RNA was extracted following 3 weeks of differentiation. Samples were analyzed by semi quantitative PCR for Sox2 (Figure 5A), MSX1 (Figure 5B)1 HASH1 (Figure 6C), NGN2 (Figure 5D), En1 (Figure 5E) and Pitx3 (Figure 5F) gene expression. Calculations of trie investigated gene versus GAPDH were done by using the ΔΔCT method. The data presented here are from a representative experiment repeated 3 times with similar results.
FlGs. 6A-N are photomicrographs illustrating expression of dopaminergic transcription factors in LMXIa-MSCs following dopaminergic differentiation, as analyzed by immuπocytøchemistry. (Figure 6A-B) Staining for LMXIa (red) and MSX1 (green) in LMXIa- MSCs following differentiation. (Figure 6C-D) Merged photos following and prior to differentiation. (Figures 6E-F) Staining for LMXIa (reel) and En1 (green) in LMXIa-MSCs following differentiation. (Figures 6G-H) Merged photos following and prior to differentiation. (Figure 61) Staining for Pitx3 in LMXIa-MSCs following differentiation. (Figure 6J-K) Merged photos following and prior to differentiation. (Figure 6L-M) High magnification of differentiated LMXIa-MSCs stained for LMXIa and MSX1 or EnL (Figure 6N) High magnification of differentiated LMXIa-MSCs stained for Pitx3. Cell nuclei were stained with DAPI (blue). (Scale bars in figures A-K= 50 μm, scale bars in figures L-N= 25 μm). FIGs. 7A-K illustrate the neuronal and dopaminergic phenotype of differentiated
LMXIa-MSCs. (Figure 7 A-B) Merged photos of LMXIa-MSCs before differentiation stained for LMXIa (red), Tuj1/TH (green) and DAPI (blue). (Figures 7C-E) staining of dopaminergic differentiated LMXIa-MSCs for LMXIa (red), Tuj1 (green) and DAPI (blue). (Figures 7F-H) staining of dopaminergic differentiated LMXIa-MSCs for LMXIa (red), TH (green) and DAPl (blue). (Scale bars in figures A-H=* 100 μm,). (Figure 7I) Western blot analysis of TH in non transduced MSCs and LMXIa-MSCs prior to differentiation, and following one or three weeks of differentiation. (Figure 7J) Densitometry analysis of the western blot for TH. Expression levels were normalized to β-actin. Values represent the level of upregulation in TH expression in relation to expression before differentiation (error bars represent standard error of means, *p<0.05). (Figure 7K) HPLC analysis for dopamine secretion levels following incubation in secretion media for 30 minutes f*p<0.05). DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
The present invention, in some embodiments thereof, relates to cells and populations thereof which can be transplanted into a patient in order to treat a CNS disease or disorder such as Parkinson's. Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Current treatments for Parkinson's disease (PD) are comprised mainly of dopamine replacement and symptom alleviation rather than offering a cure for the disease. The specificity of the damaged cells makes PD patients ideal candidates for cellular therapy strategies. Recent works have suggested the possibility that adυit bone marrow derived mesenchymal stem cells (WISCs) are capable of differentiating towards the neuroectodermal lineage. Accordingly, these cells present an attractive candidate as a cell-replacement therapy of neurodegenerative diseases, such as Parkinson's disease.
The present inventors hypothesized that a differentiation protocol which allows mesenchymal stem cells to follow the developmental pathways of the midbrain dopaminergic neuron may be advantageous for the generation of an autologous cell transplantation source for regenerative medicine, Whilst reducing the present invention to practice, the present inventors reprogramrnβd bone marrow derived mesenchymal stem cells towards dopaminergic differentiation through delivery of LMXIa.
The present inventors initially confirmed the efficiency of lentiviral gene delivery of fluorescent reporter genes for transforming mesenchymal stem cells. Subsequently, the present inventors showed that forced expression of LMXi a in human mesenchymal stem cells, followed by incubation of the LMXIa transduced cells in differentiation medium, induced upregulation of key transcriptional factors which are known to be involved in the dopaminergic differentiation of primitive stem cells In the developing midbrain and of embryonic stem cells
(Figures 5A-F and 6A-N). (n addition, the differentiated LMXIa expressing cells were shown to express neuronal and dopaminergic markers (Figures 7A-F).
Moreover, the transduced and differentiated cells expressed higher levels of tyrosine hydroxylase (Figures 71-J), the rate limiting enzyme in dopamine synthesis and secreted higher level of dopamine in comparison to non-transduced cells (Figure 7K).
Thus, according to one aspect of the present invention, there is provided a method of generating cells useful for treating a neurodegenerative disorder, the method comprising:
(a) genetically modifying a mesenchymal stem cell with a nucleic acid construct comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide to generate genetically modified mesenchymal stem cells; and (b) culturing the genetically modified mesenchymal stem cells in a differentiating medium, thereby generating cells useful for treating the neurodegenerative disorder.
As used herein, the phrase "neurodegenerative disorder" refers to any disorder, disease or condition of the nervous system (preferably CNS) which is characterized by gradual and progressive loss of neural tissue, neurotransmitter, or neural functions. -Examples of neurodegenerative disorder include, Parkinson's disease, Multiple sclerosis, Amyatrophic Lateral Sclerosis, autoimmune encephalomyelitis, Alzheimer's disease, Stroke and Huntington's disease.
The method of this aspect of the present invention is affected by a two-step process, namely genetically modifying mesenchymal stem cells to express Lmxia and subsequent culturing of the genetically modified cells in a differentiation medium.
The term "mesenchymal stem cell" or "MSC" refers to fetal or postnatal (e.g., adult) cells which irreversibly differentiate (either terminally or non-terminally) to give rise to cells of a mesenchymal cell lineage and which are also capable of dividing to yield stem cells. The mesenchymal stem cells of the present invention may be of a syngeneic or allogeneic source.
It will be appreciated that the cells of the present invention may be derived from any stem cell, although preferably not ES cells.
Mesenchymal stem cells may be isolated from various tissues including but not limited to bone marrow, peripheral blood, blood, placenta and adipose tissue. A method of isolating mesenchymal stem cells from peripheral blood is described by Kassis et al [Bone Marrow Transplant. 2006 May;37(10):967-76]. A method of isolating mesenchymal stem cells from placental tissue is described by Zhang et al [Chinese Medical Journal, 2004, 117 (6):882-887]. Methods of isolating and culturing adipose tissue, placental and cord blood mesenchymal stem cells are described by Kern et al [Stem Cells, 2006;24: 1294-1301]. According to an embodiment of this aspect of the present invention, the mesenchymal stem cells are isolated from humans.
Bone marrow can be isolated from the iliac crest of an individual by aspiration. Low- density BM mononuclear cells (BMMNC) may be separated by a FICOL-PAGUE density gradient. In order to obtain mesenchymal stem cells, a cell population comprising the mesenchymal stem cells (e.g. BMMNC) may be cultured in a proliferating medium capable of maintaining and/or expanding the cells. According to one embodiment the populations are plated on polystyrene plastic surfaces (e.g. in a flask) and mesenchymal stem cells are isolated by removing non-adherent cells. Alternatively mesenchymal stem cell may be isolated by FACS using mesenchymal stem cell markers. According to an embodiment of this aspect of the present invention, the MSCs are at least 50 % purified, more preferably at least 75 % purified and even more preferably at least 90 % purified.
Following isolation, the cells are typically expanded by culturing in a proliferation medium capable of maintaining and/or expanding the isolated cells ex vivo as described in Example 1 hereinbelow. The proliferation medium may be DMEM, alpha-MEM or DMEM/F12.
The proliferation medium may further comprise SPN, L-glutamine and a serum (such as fetal calf serum or horse serum).
Genetic modification may be effected by transforming mesenchymal stem cells with an expression construct which is designed for expression of Lmxia.
The term "Lmxia" refers to at least an active portion (i.e. having Lmxia activity) of a Lmxia polypeptide. Preferably the Lmxia polypeptide comprises an amino acid sequence being at least 80 % homologous and even more preferably 90 % homologous to SEQ ID NO. 33. The phrase "Lmxia activity", as used herein, refers to the capability of regulating transcription of at least one gene in the differentiation pathway of a dopaminergic neuron.
The expression construct can be designed as a gene knock-in construct in which case it will lead to genomic integration of construct sequences, or it can be designed as an episomal expression vector. In any case, the expression construct can be generated using standard ligation and restriction techniques, which are well known in the art (see Maniatis et a/., in: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1982). Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired. At its minimum, the expression vector of the present invention comprises a polynucleotide comprising a Lmx1-a nucleic acid sequence (e.g. as set forth in SEQ ID NO: 34).
The expression vector of the present invention may also include additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhancers) and transcription and translation terminators (e.g., polyadenylation signals).
In addition to the elements already described, the expression vector of the present invention may contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid. Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3 1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3 1 , pSinRepδ, DH26S, DHBB, pNMT1 , pNMT41 , pNMT81 , which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives
Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used SV40 vectors include pSVT7 and pMT2 Vectors derived from bovine papilloma virus include pBV-1 MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5 Other exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells
Recombinant viral vectors may also be used to transduce (ι e infect) the mesenchymal stem cells of the present invention Viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms Typically, viruses infect and propagate in specific cell types The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell The present inventors have shown that retroviruses (e g lentivirus) may be used to efficiently transduce mesenchymal stem cells
Retroviral constructs of the present invention may contain retroviral LTRs, packaging signals, and any other sequences that facilitate creation of infectious retroviral vectors Retroviral LTRs and packaging signals allow the Lmx1-a polypeptides of the invention to be packaged into infectious particles and delivered to the cell by viral infection Methods for making recombinant retroviral vectors are well known in the art (see for example, Brenner et al , PNAS 86 5517-5512 (1989), Xiong et al , Developmental Dynamics 212 181-197 (1998) and references therein, each incorporated herein by reference)
Examples of retroviral sequences useful in the present invention include those derived from adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) Other viruses known in the art are also useful in the present invention and therefore will be familiar to the ordinarily skilled artisan
Various methods can be used to introduce the expression vector of the present invention into cells Such methods are generally described in Sambrook et al , Molecular Cloning A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al , Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md (1989), Chang et al , Somatic Gene Therapy, CRC Press, Ann Arbor, Mich (1995), Vega et al , Gene Targeting, CRC Press, Ann Arbor Mich (1995), Vectors A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass (1988) and Gilboa et at [Biotechniques 4 (6) 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors In addition, see U S Pat Nos 5,464,764 and 5,487,992 for positive-negative selection methods
Cells obtained following the genetic modification described herein express at least twice an amount of Lmxia polypeptide as compared with an identical mesenchymal stem cell not expressing the exogenous polynucleotide
The phrase "identical mesenchymal stem cell" refers to a mesenchymal stem cell that has been treated in an identical fashion to the mesenchymal stem cell of the present invention and therefore is at an identical stage of differentiation According to one embodiment, the cells express at least five times the amount of
Lmxia polypeptide as compared with an identical mesenchymal stem cell not expressing the exogenous polynucleotide
According to another embodiment, the cells express at least ten times the amount of Lmxia polypeptide as compared with an identical mesenchymal stem cell not expressing the exogenous polynucleotide
Methods of quantifying an amount of Lmxia polypeptide are known in the art, and include for example immunocytochemistry, quantitative RT-PCR, Western blotting etc
As mentioned, following genetic modification, the mesenchymal stem cells of the present invention are cultured in a differentiating medium under conditions sufficient to induce differentiation
Differentiation of mesenchymal stem cells can be effected by incubation thereof in differentiating media such as those described in U S Pat No 6,528,245 and by Sanchez- Ramos ef a/ (2000), Woodburry ef al (2000), Woodburry ef al (J Neuπsci Res 96 908-917, 2001), Black and Woodbury (Blood Cells MoI Dis 27 632-635, 2001 ), Deng ef al (2001), Kohyama ef a/ (2001 ), Reyes and Verfatile (Ann N Y Acad Sci 938 231-235, 2001) and Jiang ef al (Nature 418 47-49, 2002)
The differentiating media may be DMEM or DMEM/F12, or any other medium that supports neuronal growth According to a preferred embodiment of this aspect of the present invention, the medium is 50 % Neurobasal medium (e g Cat No 21103049, Invitrogen, Ca, U S A ) and 50 % DMEM/F12
Preferably, the MSCs are differentiated for a period of time between about 5 days to about 13 days in the differentiating medium so that differentiation into oligodendrocyte-like cells may occur The exact number of days is dependent upon the particular differentiating agents added to the medium and may be determined empirically According to one embodiment of this aspect of the present invention, the cells are incubated (e g for about 2-3 weeks) in a differentiating medium comprising FGF-2, (e g 20 ng/ml, R&D Systems, Minneapolis, MN, USA), Fibroblast growth factor 8 (FGF8, e g 100 ng/ml, PeproTech, London, UK) and Sonic hedgehog (Shh, e g 17 nM R&D Systems) According to this embodiment, the differentiating medium may also comprise other differentiating agents including, but not limited to 11-1 β, N2 supplement, B27 supplement, TH, db-cAMP, bone morphogenetic proteins, forskolm, retinoic acid, ascorbic acid, putrescin, selenium and transferrin In addition, the differentiating medium of this aspect of the present invention may comprise neurotrophic factors (e g BDNF, CNTF, GDNF, NTN, NT3 or LIF), growth factors (e g TGF-β3 and TGF-α), vitamins and hormones e g , insulin, and progesterone
Cells obtained according to the methods described herein typically express at least twice an amount of midbrain dopaminergic polypeptide, as compared to an identical mesenchymal stem cell not expressing the exogenous polynucleotide
As used herein, the phrase "midbrain dopaminergic polypeptide" refers to a polypeptide which is expressed preferentially in a dopaminergic neuron present in the midbrain as opposed to the forebrain Exemplary midbrain dopaminergic polypeptides include, but are not limited to SRY-related HMG-box gene 2 (Sox2), msh homeobox 1 (MSX1), Neurogenin 2 (Λ/GΛ/2), Human achaete-scute Homologue (hASH1), Eπgrailedi (En1 ), Paired-Like Homeodomain transcription factor 3 (Pιtx3) the LIM homeobox transcription factor 1 beta (LMXIb) and the orphan nuclear receptor-related 1 (Nuπi)
According to one embodiment, the cells generated according to the method of the present invention express at least two, at least three, at least four, at least five, at least six or more midbrain dopaminergic polypeptides
The cells may also express other neuronal markers including, but not limited to of 2', 3'- Cyclic nucleotide 3'-phosphodιesterase (CNPase), Glypιcan-4 (GPC4), Necdin, Nestin, Neuπte growth-promoting factor 2 (NEGF-2), Neurofilament-Heavy, Neurofilament-light, Neurofilament- medium, Neuron specific enolase (NSE), Neurotrophic tyrosine kinase receptor type 2 (TRK-2), Patched homolog(PTCH), RET tyrosine kinase, Retinoic acid receptor type α (RARA), Smoothened (SMO), Vesicular monoamine transporter 2 (VMAT 2), Neuronal Nuclei (NeuN), Aryl hydrocarbon receptor/Aryl hydrocarbon receptor nuclear translocator binding element (AhR/Arnt), Ecotropic viral integration site 1 (EVI-1 ), Forkhead box O1A human (FKHRhu), Glycosaminoglycan (GAG), Hepatocyte nuclear factor 3β (HNF-3β), Myelin gene expression factor 2 MEF2(2), Nuclear Y box factor (NF-Y), Neural zinc fingure 3 (NZF-3), Paired box gene 3 (Pax-3), Paired box gene 6 (Pax-6), Xenobiotic response element (XRE), Aldehyde dehydrogenase 1 (Aldhi), Engrailed 1(En-I ), Nurr-1 , Paired-like homeodomain transcription factor 3 (PITX-3), Aromatic L-amino acid decarboxylase (AADC), Catechol-o-methyltransferase (COMT), Dopamine transporter (DAT^Dopamine receptor D2 (DRD2), GTP cyclohydrolase-1 (GCH), Monoamine oxidase B (MAO-B), Tryptophan hydroxylase (TPH) and Tyrosine hydroxylase (TH)
According to yet another embodiment, the cells are capable of synthesizing dopamine It will be appreciated that the cells of the present invention may also retain characteristics of mesenchymal stem cells For example, the present inventors showed that the cells generated as described herein express fibronectin and RUNX2 (See Example 4, herein below)
Alternatively or additionally the cells of the present invention may express a marker (e g surface marker) typical to mesenchymal stem cells but atypical to native dopamine secreting cells Examples of mesenchymal stem cell surface markers include but are not limited to CD105+, CD29+, CD44+, CD90+, CD34-, CD45-, CD19-, CD5-, CD20-, CD11 B- and FMC7-
It will be appreciated that following the cultuπng procedure of the present invention, non-homogeneous cell populations may be obtained The percentage of cells which comprise a particular phenotype e g dopamine-like phenotype may be raised or lowered according to the intended needs Thus for example, the cell populations may be enriched for dopamine secreting cells by FACS using an antibody specific for a dopamine-secreting cell marker
Examples of such markers are described hereinabove If the cell marker is an internal marker, preferably the FACS analysis comprises antibodies or fragments thereof which may easily penetrate a cell and may easily be washed out of the cell following detection The FACS process may be repeated a number of times using the same or different markers depending on the degree of enrichment and the cell phenotype required as the end product
Once differentiated and optionally isolated, the cells may be tested (in culture) for their neuronal phenotype (e g ability to secrete dopamine) The cultures may be comparatively analyzed for a neuronal phenotype, using biochemical analytical methods such as immunoassays, Western blot and Real-time PCR as described in Example 4 of the Examples section which follows, or by enzyme activity bioassays
The cells of the present invention may be useful for a variety of therapeutic purposes Thus, according to another aspect of the present invention there is provided a method of treating a neurodegenerative disease Examples of neurodegenerative diseases are listed herein above
In any of the methods described herein the cells may be obtained from any autologous or non-autologous (ι e , allogeneic or xenogeneic) human donor For example, cells may be isolated from a human cadaver or a donor subject
The cells of the present invention can be administered to the treated individual using a variety of transplantation approaches, the nature of which depends on the site of implantation
The term or phrase "transplantation", "cell replacement" or "grafting" are used interchangeably herein and refer to the introduction of the cells of the present invention to target tissue
The cells can be grafted into the central nervous system or into the ventricular cavities or subdurally onto the surface of a host brain Conditions for successful transplantation include (ι) viability of the implant, (n) retention of the graft at the site of transplantation, and (HI) minimum amount of pathological reaction at the site of transplantation Methods for transplanting various nerve tissues, for example embryonic brain tissue, into host brains have been described in "Neural grafting in the mammalian CNS", Bjorklund and Stenevi, eds (1985), Freed et al , 2001 , Olanow et al., 2003). These procedures include intraparenchymal transplantation, i.e. within the host brain (as compared to outside the brain or extraparenchymal transplantation) achieved by injection or deposition of tissue within the host brain so as to be opposed to the brain parenchyma at the time of transplantation. Intraparenchymal transplantation can be effected using two approaches: (i) injection of cells into the host brain parenchyma or (ii) preparing a cavity by surgical means to expose the host brain parenchyma and then depositing the graft into the cavity. Both methods provide parenchymal deposition between the graft and host brain tissue at the time of grafting, and both facilitate anatomical integration between the graft and host brain tissue. This is of importance if it is required that the graft becomes an integral part of the host brain and survives for the life of the host.
Alternatively, the graft may be placed in a ventricle, e.g. a cerebral ventricle or subdurally, i.e. on the surface of the host brain where it is separated from the host brain parenchyma by the intervening pia mater or arachnoid and pia mater. Grafting to the ventricle may be accomplished by injection of the donor cells or by growing the cells in a substrate such as 3% collagen to form a plug of solid tissue which may then be implanted into the ventricle to prevent dislocation of the graft. For subdural grafting, the cells may be injected around the surface of the brain after making a slit in the dura. Injections into selected regions of the host brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted. The microsyringe is preferably mounted in a stereotaxic frame and three dimensional stereotaxic coordinates are selected for placing the needle into the desired location of the brain or spinal cord. The cells may also be introduced into the putamen, nucleus basalis, hippocampus cortex, striatum, substantia nigra or caudate regions of the brain, as well as the spinal cord. The cells may also be transplanted to a healthy region of the tissue. In some cases the exact location of the damaged tissue area may be unknown and the cells may be inadvertently transplanted to a healthy region. In other cases, it may be preferable to administer the cells to a healthy region, thereby avoiding any further damage to that region. Whatever the case, following transplantation, the cells preferably migrate to the damaged area. For transplanting, the cell suspension is drawn up into the syringe and administered to anesthetized transplantation recipients. Multiple injections may be made using this procedure.
The cellular suspension procedure thus permits grafting of the cells to any predetermined site in the brain or spinal cord, is relatively non-traumatic, allows multiple grafting simultaneously in several different sites or the same site using the same cell suspension, and permits mixtures of cells from different anatomical regions. Multiple grafts may consist of a mixture of cell types, and/or a mixture of transgenes inserted into the cells. Preferably from approximately 104 to approximately 108 cells are introduced per graft.
For transplantation into cavities, which may be preferred for spinal cord grafting, tissue is removed from regions close to the external surface of the central nerve system (CNS) to form a transplantation cavity, for example as described by Stenevi et al (Brain Res 114 1-20 ,
1976), by removing bone overlying the brain and stopping bleeding with a material such a gelfoam Suction may be used to create the cavity The graft is then placed in the cavity More than one transplant may be placed in the same cavity using injection of cells or solid tissue implants Preferably, the site of implantation is dictated by the CNS disorder being treated Demyelinated MS lesions are distributed across multiple locations throughout the CNS, such that effective treatment of MS may rely more on the migratory ability of the cells to the appropriate target sites
Since non-autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non-autologous cells Furthermore, since diseases such as multiple sclerosis are inflammatory based diseases, the problem of immune reaction is exacerbated These include either suppressing the recipient's immune system, providing anti-inflammatory treatment and/or encapsulating the non-autologous cells in immunoisolating, semipermeable membranes before transplantation
Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludag, H et al Technology of mammalian cell encapsulation Adv Drug Deliv Rev 2000, 42 29-64) Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu MZ, et al , Cell encapsulation with alginate and alpha- phenoxycinnamylidene-acetylated poly(allylamιne) Biotechnol Bioeng 2000, 70 479-83, Chang TM and Prakash S Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms MoI Biotechnol 2001 , 17 249-60, and Lu MZ, et al , A novel cell encapsulation method using photosensitive poly(allylamιne alpha-cyanocinnamylideneacetate) J Microencapsul 2000, 17 245-51
For example, microcapsules are prepared by complexing modified collagen with a ter- polymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 μm Such microcapsules can be further encapsulated with additional 2-5 μm ter-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S M et al Multi- layered microcapsules for cell encapsulation Biomateπals 2002 23 849-56)
Other microcapsules are based on alginate, a marine polysaccharide (Sambanis, A Encapsulated islets in diabetes treatment Diabetes Technol Ther 2003, 5 665-8) or its derivatives For example, microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanιdιne) hydrochloride in the presence of calcium chloride
It will be appreciated that cell encapsulation is improved when smaller capsules are used Thus, the quality control, mechanical stability, diffusion properties, and in vitro activities of encapsulated cells improved when the capsule size was reduced from 1 mm to 400 μm
(Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002; 13:783-96). Moreover, nanoporous biocapsules with well-controlled pore size as small as 7 nm, tailored surface chemistries and precise microarchitectures were found to successfully immunoisolate microenvironments for cells (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999, 10: 6-9; Desai, T. A. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002, 2: 633-46).
Examples of immunosuppressive agents include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine (sulphasalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE™), etanercept, TNF. alpha, blockers, a biological agent that targets an inflammatory cytokine, and Non-Steroidal Anti-Inflammatory Drug (NSAIDs). Examples of NSAIDs include, but are not limited to acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors and tramadol.
In any of the methods described herein, the cells can be administered either per se or, preferably as a part of a pharmaceutical composition that further comprises a pharmaceutically acceptable carrier.
As used herein a "pharmaceutical composition" refers to a preparation of one or more of the chemical conjugates described herein, with other chemical components such as pharmaceutically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to a subject.
Hereinafter, the term "pharmaceutically acceptable carrier" refers to a carrier or a diluent that does not cause significant irritation to a subject and does not abrogate the biological activity and properties of the administered compound. Examples, without limitations, of carriers are propylene glycol, saline, emulsions and mixtures of organic solvents with water. Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
According to a preferred embodiment of the present invention, the pharmaceutical carrier is an aqueous solution of saline.
Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference. Suitable routes of administration include direct administration into the tissue or organ of interest. Thus, for example the cells may be administered directly into the brain.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. Preferably, a dose is formulated in an animal model to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. For example, 6-OHDA-lesioned mice may be used as animal models of Parkinson's. In addition, a sunflower test may be used to test improvement in delicate motor function by challenging the animals to open sunflowers seeds during a particular time period.
Transgenic mice may be used as a model for Huntingdon's disease which comprise increased numbers of CAG repeats have intranuclear inclusions of huntingtin and ubiquitin in neurons of the striatum and cerebral cortex but not in the brain stem, thalamus, or spinal cord, matching closely the sites of neuronal cell loss in the disease.
Transgenic mice may be used as a model for ALS disease which comprise SOD-1 mutations.
The septohippocampal pathway, transected unilaterally by cutting the fimbria, mimics the cholinergic deficit of the septohippocampal pathway loss in Alzheimers disease. Accordingly animal models comprising this lesion may be used to test the cells of the present invention for treating Alzheimers.
Survival and rotational behavior (e.g. on a rotarod) of the animals may be analyzed following administration of the cells of the present invention. Animal models of demyelinating diseases include shiverer (shi/shi, MBP deleted) mouse, MD rats (PLP deficiency), Jimpy mouse (PLP mutation), dog shaking pup (PLP mutation), twitcher mouse (galactosylceramidase defect, as in human Krabbe disease), trembler mouse (PMP-22 deficiency). Virus induced demyelination model comprise use if Theiler's virus and mouse hepatitis virus. Autoimmune EAE is a possible model for multiple sclerosis. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (see e.g., Fingl, er a/., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1). For example, a Parkinon's patient can be monitored symptomatically for improved motor functions indicating positive response to treatment.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. Dosages necessary to achieve the desired effect will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or diminution of the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent on the individual being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. The dosage and timing of administration will be responsive to a careful and continuous monitoring of the individual changing condition. For example, a treated multiple sclerosis patient will be administered with an amount of cells which is sufficient to alleviate the symptoms of the disease, based on the monitoring indications.
The cells of the present invention may be co-administered with therapeutic agents useful in treating neurodegenerative disorders, such as gangliosides; antibiotics, neurotransmitters, neurohormones, toxins, neurite promoting molecules; and antimetabolites and precursors of neurotransmitter molecules such as L-DOPA. Additionally, the cells of the present invention may be co-administered with other cells capable of synthesizing a neurotransmitter. Such cells are described in U.S. Pat. Appl. No. 20050265983 for example. Additionally, the cells of the present invention may be co-administered with other cells capable of myelination - e.g. Schwann cells, such as those described in U.S. Pat. No. 6,989,271. As used herein the term "about" refers to ± 10 %.
The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".
The term "consisting of means "including and limited to". The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1 , 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et at., (1989); "Current Protocols in Molecular Biology" Volumes l-lll Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", VoIs. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531 ;
5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes l-lll CeIMs1 J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes l-lll Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791 ,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901 ,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011 ,771 and 5,281 ,521; Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
EXAMPLE 1
Isolation and characterization of human bone marrow mesenchymal stem cells MATERIALS AND METHODS MSCs isolation and culture: Fresh bone marrow aspirates harvested from iliac crests of healthy adult donors and were diluted with Hank's balanced salt solution. Isolation of mononuclear cells was achieved by centrifugation in UNISEP-MAXI tubes (Novamed, Jerusalem) on the basis of density gradient. Mononuclear cells were plated in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 15 % fetal bovine serum (FBS), 2 mM glutamine, 100 μgr/ml streptomycin, 100 units/ml penicillin, 12.5 units/ml nystatin (Biological industries, Israel), in polystyrene plastic 75-cm2 tissue culture flasks. After 24 hours nonadherent cells were removed. Medium was changed every 3-4 days. Adherent ceils were cultured to 70 %-90 % confluency and reseeded at a density of 5,000-10,000 cells/cm2. Cells were maintained at 37 0C in a humidified 5 % CO2 incubator. Characterization of hMSCs: After 2-3 passages hMSCs were harvested from the tissue culture flasks centrifuged and resuspeπded in phosphate-buffered saline (PBS). Cells were incubated with mouse anti CD29-PE (1 :25, eBioscibce, San Diego, CA), mouse anti CD34-PE (1:10, Miltenyi Biotech, Cologne, Germany), mouse anti CD44-PE (1 :10, Cymbus Technology, Hampshire, UK), mouse anti CD45-PE (1 :10, DAKO, Cambridgeshire, UK), mouse anti CD105-FITC (1 :100, Ancell Corporation, Bayport, MN) for 45 minutes on ice, washed twice in flow-buffer, consisting of 5 % fetal calf serum and 0.1 % sodium azide in PBS, and analyzed using a Beckton Dickinson flow cytometer. The results were analysed with CellQuest software. An appropriate fluorophore conjugated isotype control was included in each experiment (1 :10, eBioscibce ,San Diego, CA). For functional characterization, adipogenic differentiation was induced following detailed protocols [Smith, 2004, Stem Cells, 22, 823-831]. Adipogenic differentiation was identified by Oil Red O staining of lipid vacuoles.
Immunocytochemistry: Cells were fixed with 4 % paraformaldehyde and blocked by 10 % goat serum (Biological Industries, Israel). Human MSCs were stained with primary anti- Nestin antibody (1 :20, R&D Systems, Minneapolis, MN, USA) and Cy3-conjugated secondary antibody (1 :500, Jackson laboratories, West Grove, PA, USA). DNA-specific fluorescent dye 4,6-diamidino- 2-phenylindole (DAPI; Sigma, St Louis, MO, USA) counterstain was used to detect cell nuclei. Cells were photographed by fluorescence Olympus IX70-S8F2 microscope with fluorescent light source (excitation wavelength, 330-385 nm; barrier filter, 420 nm) and a U-MNU filter cube (Olympus). RESULTS
Mesenchymal stem cells were produced from freshly harvested adult human bone marrow aspirates. After 2-5 passages, cells were characterized for their cell surface phenotype using FACS caliber. MSCs did not express the common leukocyte antigen CD45 and the hematopoetic stem cell marker CD34 (Figures 1 D-E). In contrast, the cells ubiquitously expressed the mesenchymal markers CD29, CD44 and CD105 (Figures 1A-C). Thus, the observed phenotype is characteristic of non hematopoetic mesenchymal stem cell population.
To verify MSCs' differentiation potential cells were incubated with adipogenic induction medium. Following 3 weeks of induction, adipogenic induced cells showed round morphology and were positively stained with Oil Red O for fat vacuoles (Figures 1 F-G). To determine whether adult MSCs are capable of neural differentiation the cells were stained for nestin, a common marker for neural stem cells, of which expression is required prior to neural differentiation. It was found that even prior to any inductive signal the cells widely expressed nestin (Figure 1 H).
EXAMPLE 2
Generation of lentiviral vectors MATERIALS AND METHODS
Viral construct preparation: pLenti6/CMV/LMX1a, pLenti6/CMV/AcGFP and pLentiθ/CMVDsRed were constructed using ViraPower™ Promoterless Lentiviral Gateway® Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Briefly, the cytomegalovirus (CMV) promoter was amplified by PCR from plasmid plRES2/AcGFP1 (Clontech, Mountain View, CA, USA) using the following primers: CMV FW 5'- CGTATTACCGCCATGCATTAG-3' (SEQ ID NO: 1 ) and CMV REV 5'- CGGATCTGACGGTTCACTAAA-S1 (SEQ ID NO: 2). The CMV-PCR product was cloned into pENTR™5'-TOPO® (Invitrogen). For the expression genes, the LMXIa gene was amplified from the plasmid pBluescript/LMX1a (ACCESSION number BC066353, purchased from RZPD, Berlin, Germany) using the following primers M 13 FW δ'-GTAAAACGACGGCCAG-S' (SEQ ID NO: 3) and M13 REV δ'-CAGGAAACAGCTATGAC-S' (SEQ ID NO: 4). The AcGFPI gene was amplified by PCR from plasmid plRES2/AcGFP1 (Clontech) using the following primers: AcGFP FW δ'-CGATGATAATATGGCCACAACS-' (SEQ ID NO: 5) and AcGFP REV 5'- TCTACAAATGTGGTATGGCTGA-3' (SEQ ID NO: 6). The DsRed gene was amplified by PCR from plasmid pDsRed2-1 (Clontech) using the following primers: DsRed FW 5'- TAGCGCTACCGG ACTCAG AT-3' (SEQ ID NO: 7) and DsRed REV 5'GGGAGGTGTGGGAGGTTTT-3 (SEQ ID NO: 8). Each of the PCR amplified constructs, LMXIa, AcGFPI and DsRed were cloned into the pCR®8/GW/TOPO® (Invitrogen). All PCR reactions were taken out using Extensor Hi-Fidelity PCR Enzyme (ABgene, Epsom, UK). To obtain the final expression construct a recombination of the entry clone harboring the CMV promoter, the entry clone harboring the expression gene of interest and pLenti6/R4R2/V5-DEST (Invitrogen) was performed. Following recombination, the expression construct was transformed into One Shot® Stbl3™ Competent E. coli. (Invitrogen). Expression clones were sequenced to confirm both the CMV promoter and the expression gene presence (LMXIa, AcGFPI or DsRed). Virus production: Virus was produced using ViraPowerLentiviral Expression System
(Invitrogen) according to the manufacturer's instructions. Briefly, expression constructs were cotransfected with the mixture of the packaging plasmids: pLP1, pLP2, and pLP/VSVG using LipofectAMINE 2000 (Invitrogen) into the 293FT producer cell line which stably expresses the SV40 large T antigen. The medium was replaced one day after transfection with DMEM containing 10 % FBS and sodium pyruvate. The medium containing the viral particles was collected 48 or 72 hours after transfection, filtered through 0.45μm PVDF filters following low speed centrifugation (3000 rpm for 15 min 4 0C) and concentrated using Amicon ultra-15 centrifugal filter 100,000 NMWL (Millipore, Billerica, MA, USA). Viral titers (transducing units/ml) were determined by transduction of HeLa cells with serial dilutions of the viral supernatant and colony counting after blasticidin selection (4ng/ml, Invitrogen) with Crystal Violet staining (Sigma, St. Louis, MO, USA).
Transduction of human MSCs and estimation of transduction efficacy: 1 day prior to transduction, human MSCs (passage 3-5) were seeded to 30 %-50 % confluency. On the following day MSCs were transduced at an MOI of 0.1 , 1 and 10 with pLenti6-CMV-AcGFP in the presence of 6 ng/ml Polybrenne (Sigma). Transduction of MSCs with pLenti6/-CMV-LMX1a or pLenti6-CMV-DsRed was conducted at an MOI of 1. One day following transduction medium was changed. Four days after transduction, transduction efficiency was estimated by FACS analysis for GFP expression following fixation and washing of cells. For immunofluorescence analysis, MSCs transduced with reporter genes were reseeded on glass cover slips, fixed with 4
% PFA, counterstained with DAPI and photographed.
Statistics: Error bars on Figure 3D represent the standard error of the mean (SEM) which is equal to SD/V(n -1 ) for small values of n. Statistical analysis of data sets was carried out with the aid of SPSS for windows (version 10.0.1 ), data was analyzed by one-way analysis of variance (ANOVA) followed by multiple paired comparisons (Tukey test).
RESULTS
In order to examine whether over-expression of dopaminergic transcripts will enhance differentiation in adult MSCs, a successful gene delivery protocol had to be established that brought about sustained expression in MSCs. Few recent studies reported the ability of lentiviral vectors to transduce MSCs and sustain transgene expression longer than other viral and non viral vectors. Those studies also indicated that the transduction procedure by itself did not affect the differentiation potential of MSCs.
The genes of interest were inserted under the control of the cytomegalovirus (CMV) promoter since it was reported to induce the highest expression rate in MSCs compared to other promoters. The virus was pseudotyped with the vesicular stomatitis virus G-protein. 2 reporter vectors were constructed encoding AcGFP and DsRed fluorescent proteins and an expression vector encoding LMXIa cDNA (Figure 2).
To evaluate the efficacy of transduction of human MSCs, 2 different reporter constructs were used. Following harvest of virus and titer determination human MSCs were incubated with viral supernatant at a mode of infection (MOI) of 1 to verify reporter protein expression in the cells. Transduced cells were fixed and analyzed using a fluorescent microscope (Figures 3A-C). No differences in transgene expression were observed between cells analyzed 4 days or 3 weeks following exposure to virus (data not shown). After confirming the constructs1 ability to transduce the cells and sustain expression, the transduction rate was quantified. For that purpose, human MSCs were transduced with pLentiδ- CMV-AcGFP at different MOIs of 0.1, 1 and 10. Four days following transduction, the transduced cells were fixed and analyzed by FACS caliber for GFP expression. Consistent results were found indicating a clear dose response pattern between the used MOI and the observed GFP+ percentage of cells. In cells transduced at an MOI of 0.1 about 5 % were GFP+, MOI of 1 resulted in more than 30 % GFP+ cells whereas the maximal MOI of 10 yielded more than 80 % rate of transduction (Figure 3D). EXAMPLE 3
Lentiviral delivery of LMXIa into human MSCs results in generation of dopaminergic precursors
MATERIALS AND METHODS
RNA isolation and cDNA synthesis: Total RNA was isolated from cultured untreated human MSCs and pLenti-CMV-LMX1a transduced MSCs using a commercial reagent TriReagent (Sigma) and the manufacturer's recommended procedure. The amount and quality of RNA was determined spectrophotometrically by using the ND-1000 spectrophotometer (Nano-drop, Wilmington, DE, USA). First-strand cDNA synthesis was carried out with Super Script Il RNase H-reverse transcriptase (Invitrogen) using random primer.
Real-time semi quantitative reverse transcription polymerase chain reaction (PCR): Real-time quantitative PCR of the desired genes was performed in an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA) by using Sybr green PCR master mix (Applied Biosystems) and the following primers: GAPDH sense CGACAGTCAGCCGCATCTT (SEQ ID NO: 9), GAPDH antisense CCAATACGACCAAATCCGTTG (SEQ ID NO: 10); LMXIa sense CCTGCAGGAAGGTGAGAGAGA (SEQ ID NO: 11), LMXIa antisense TGGACGACACGGACACTCAG (SEQ ID NO: 12); The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene served as an internal control. Lentiviral transduction of human MSCs did not affect the constitutive expression of the reference gene, GAPDH. For each gene, verifying a single peak in melting curve analysis assessed the specificity of the PCR product. The PCR was performed in a total volume of 20 μl containing 1 μl of the previously described cDNA, the 3' and 5' primers in final concentration of 500 nM each and 10 μl of Sybr Green Mix. The amplification protocol was 40 cycles of 95 0C for 15 sec followed by 60 °C for 1 min each. Quantitative calculations of the gene of interest versus GAPDH was done using the ΔΔCT method, as instructed in the user bulletin 2 ABI prism 7700 sequence detection system.
Immunocytochemistry: Untreated human MSCs or cells following viral infection were fixed with 4 % PFA and blocked with 5 % goat serum (Biological Industries) and 0.1 % bovine serum albumin (Sigma) in PBS. Cells were washed and incubated with rabbit anti-LMX1a antibody (1:50, Aviva Systems, San Diego, CA), followed by suitable biotin conjugated anti rabbit (1 :500, Molecular Probes, Invitrogen) and Sreptavidin conjugated Alexa 488 or Alexa 568 secondary antibodies (1:500, Molecular Probes). Second antibody controls were performed in each experiment. DAPI counterstain (Sigma) was used to detect cell nuclei. Cells were photographed by fluorescence Olympus IX70-S8F2 microscope with fluorescent light source (excitation wavelength, 330-385 nm; barrier filter, 420 nm) and a U-MNU filter cube (Olympus) at magnification X100, X200 or X400. Quantification of LMXIa positive cells was performed following analysis of 20 randomly taken fields of cells stained for LMXIa and DAPI (at magnification X100). Image processing and photo merging was employed using Image-Pro®
Plus software (Media Cybernetics, Silver Spring, MD, USA). RESULTS
The major aim of this experiment was to induce dopaminergic differentiation on adult MSCs. After establishing a consistent way of gene delivery, the present inventors transduced the cells with pLenti6-CMV-LMX1a.
Four day after transduction at an MOI of 1 , total RNA was extracted from cells and cDNA was produced. Semi quantitative real time PCR or semi quantitative RT-PCR confirmed a significant level of LMXIa over expression in transduced cells in comparison to untransduced control samples (Figures 4A-B).
To assess the expression level of the LMXIa protein immunocytochemistry analysis was performed in the transduced cells. It was found that most of the MSCs were positively stained with anti-LMX1a (Figure 4D), 73.34 % ± STD 15.38 % in contrast to no or basal expression level in MSCs transduced with the GFP encoding mock vector (Figure 4C).
EXAMPLE 4 Differentiation of MSCs following forced expression of LMXIa
MATERIALS AND METHODS Differentiation of human MSCs: Following expansion in growth medium, cells were transduced with viral supernatant and incubated in differentiation media as described previously [Andersson et al., 2006, Cell. 124, 393-405]. Briefly, the differentiation media consisted 50 % DMEM/F12 (Biological industries) supplemented with N2 (Invitrogen) and 50 % Neurobasal medium with B27 supplement (both from invitrogen), 2 mM glutamine, 100 μgr/ml streptomycin, 100 units/ml penicillin, 12.5 units/ml nystatin (all from Biological industries), 20 ng/ml FGF-2, (R&D Systems, Minneapolis, MN, USA), 100 ng/ml Fibroblast growth factor 8 (FGF8, PeproTech, London, UK) and 17 nM Sonic hedgehog (Shh, R&D Systems) for two to three weeks, medium was changed twice a week.
Immunocytochemistry. Untreated human MSCs or cells following 2 weeks of differentiation were fixed with 4 % PFA and blocked with 5 % goat serum (Biological Industries) and 0.1 % bovine serum albumin (Sigma) in PBS. Cells were washed and incubated with rabbit anti-LMX1a antibody (1 :50, Aviva Systems, San Diego, CA), mouse anti TH (1 :200), mouse anti Tuj1 (1:200, both from Sigma), mouse anti En1 (1 :50), mouse anti Msx1 (1 :50, both the monoclonal antibodies were developed by Jessell, T.M. and Morton, S. and were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, USA), rabbit anti Pitx3 (1:300, Zymed, Invitrogen) and rabbit anti VMAT2 (1:500, Chemicon) followed by suitable biotin conjugated anti mouse (Zymed, Invitrogen) or anti rabbit (1 :500, Molecular Probes, Invitrogen) and Sreptavidin conjugated Alexa 488 or Alexa 568 secondary antibodies (1 :500, Molecular Probes). Second antibody controls were performed in each experiment. DAPI counterstain (Sigma) was used to detect cell nuclei. Cells were photographed by fluorescence Olympus IX70-S8F2 microscope with fluorescent light source (excitation wavelength, 330-385 nm; barrier filter, 420 nm) and a U-MNU filter cube (Olympus) at magnification X100, X200 or X400. Quantification of LMXIa positive cells was performed following analysis of 20 randomly taken fields of cells stained for LMXIa and DAPI (at magnification X100). Image processing and photo merging was employed using Image-Pro® Plus software (Media Cybernetics, Silver Spring, MD, USA).
RNA isolation and cDNA synthesis: Total RNA was isolated from cultured untreated MSCs and MSCs transduced with p/Lenti/CMV/LMX1a using a commercial reagent TriReagent (Sigma) according to the manufacturer's recommended procedure. DNAse treatment was performed followed by RNA cleaning using RNeasy mini kit (both from Qiagen.Valencia, CA). The amount and quality of RNA was determined spectrophotometrically by using the ND-1000 spectrophotometer (Nano-drop, Wilmington, DE, USA). First-strand cDNA synthesis was carried out with Super Script Il RNase H-reverse transcriptase (Invitrogen) using random primer.
Real-time semi quantitative reverse transcription polymerase chain reaction (Real-time PC/?j;Real-time semi quantitative PCR of the desired genes was performed in an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA) by using Platinum® SYBR® Green qPCR SuperMix UDG with ROX (Invitrogen). PCR amplification was stopped at 40 cycles (program: 2 min at 50 0C; 2 min at 95 0C; 40 repeats of 15 sec at 95 0C and 30 sec at 60 0C). The following primers were used: GAPDH sense CGACAGTCAGCCGCATCTT (SEQ ID NO: 9), GAPDH antisense CCAATACGACCAAATCCGTTG (SEQ ID NO: 10), LMXIa sense CCTGCAGGAAGGTGAGAGAGA (SEQ ID NO: 11), LMXIa antisense TGGACGACACGGACACTCAG (SEQ ID NO: 12); Sox2 sense CAGGAGAACCCCAAGATGC (SEQ ID NO: 13), Sox2 antisense GCAGCCGCTTAGCCTCG (SEQ ID NO: 14); NGN2 sense CAACTAAGATGTTCGTCAAATCCG (SEQ ID NO: 15), NGN2 antisense CCTTCAACTCCAAGGTCTCGG (SEQ ID NO: 16); hASH1 sense AGCAGGGTGATCGCACAAC (SEQ ID NO: 17), hASH1 antisense ACGCCACTGACAAGAAAGCACTA (SEQ ID NO: 18); Pitx3 sense GTTCGCTGAAAAAGAAGCAGC (SEQ ID NO: 19), Pitx3 antisense TCTGGAAGGTCGCCTCTAGCT (SEQ ID NO: 20); En1 sense
GTTATTCGGATCGTCCATCCTC (SEQ ID NO: 21 ) EEnn11 aannttiisseennssee CGCCTTGAGTCTCTGCAGCT JEQ ID NO: 22); NNuuππii sseennssee
GGATGGTCAAAGAAGTGGTTCG (SEQ ID NO: 23), Nurri antisense CCTGTGGGCTCTTCGGTTT ( EQ ID NO: 24); Fibronectin sense GAGATCAGTGGGATAAGCAGCA (SEQ ID NO: 25), Fibronectin antisense CCTCTTCATGACGCTTGTGGA (SEQ ID NO: 26); RUNX2 sense GCCTTCAAGGTGGTAGCCC (SEQ ID NO 27), RUNX2 antisense CGTTACCCGCCATGACAGTA (SEQ ID NO 28), VMAT2 sense CCGCCCTGGTACTCTTGGAT (SEQ ID NO 29), VMAT2 antisense TCCCCTTCTGACTCTCTGGCT (SEQ ID NO 30), Dopamine transporter sense CTGGAGC CATAGACGGCATC (SEQ ID NO 31 ) and Dopamine transporter antisense CCGCGTCAATCCAAACAGA (SEQ ID NO 32), The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene served as an internal control Lentiviral transduction of human MSCs did not influence the constitutive expression of the reference gene, GAPDH For each gene, verifying a single peak in melting curve analysis assessed the specificity of the PCR product PCR analyses were conducted in triplicate for each sample The PCR was performed in a total volume of 20 μl containing 1 μl of the previously described cDNA, the 31 and 5' primers at a final concentration of either 25OnM or 500 nM each and 10 μl of Sybr Green Mix Quantitative calculations of the gene of interest versus GAPDH was done using the ΔΔCT method, as instructed in the user bulletin 2 ABI prism 7700 sequence detection system Western blot: Total protein was extracted by suspending the harvested cells in lysis buffer containing 10 mM Tπs base (U S Biochemical Corporation, Cleveland, OH, USA), 5 mM EDTA (Merck, Whitehouse Station, NJ, USA), 14O mM sodium chloride (NaCI, BioLab, Jerusalem, Israel), 1O mM sodium fluoride (NaF, Sigma), 0 5% NP 40 (U S Biochemical Corporation), and 1 μM phenylmethylsulfonyl fluoride (PMSF, Sigma) Following incubation on ice for 30 minutes, the mixture was centrifuged and the supernatants were collected Protein content was determined by the BCA protein assay kit (Pierce, Rockford, IL, USA) Fifty micrograms of protein from each sample were subjected to sodium dodecyl-sulfate (SDS)- polyacrylamide gel electrophoresis (PAGE) (12 5 % acrylamide), followed by electrophoretic transfer to nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany) Membranes were probed with mouse antι-TH (1 10,000, Sigma) and mouse anti β-actin (1 10,000, Chemicon) and then by goat anti-mouse horseradish peroxidase conjugated antibody (1 10,000, Jackson, West Grove, PA, USA) Proteins of interest were detected using the enhanced Super Signal® chemiluminescent detection kit (Pierce) and exposed to medical X-ray film (FUJI Photo Film, Tokyo, Japan) Densitometry of the specific protein bands was preformed by VersaDoc® imaging system and Quantity One® software (BioRad, Hercules, CA, USA)
High Performance Liquid Chromatography (HPLC): Sample collection for HPLC analysis was conducted as follows, media was removed from cells and replaced with Hank's balanced salt solution (HBSS, Biological Industries) for 30 mm Following the collection all the samples were stabilized with 0 1 M perchloric acid/metabisulfite (2 mg/ml, Sigma), mixed with the internal standard dihydroxybenzylamine and extracted by aluminum adsorption (Bioanalytical Systems, West Lafayette, IN, USA) Dopamine levels were measured using an HPLC coupled to an ESA Coulochem Il Detector (Model 5200A, ESA, lnc , Chelmsford, MA, USA) Samples were injected by an autosampler (AS-2057plus, Jasco, Tokyo, Japan) into a C- 18 reverse-phase column (5μm, particle size, 4 6 X 150 mm, interfile ODS-2, GL Science lnc , Tokyo, Japan). The electrode potentials employed were E1 :+100mv and E2:-300mv. Results were validated by co-elution with catecholamine standards under various buffer conditions and detector settings.
Statistics: Error bars in Figures 5A-F represent the standard deviation between samples (STD). Error bars on Figure 7L-M represent the standard error of the mean. For comparisons between two groups two-tailed Student's f test was employed. Significance was considered for p<0.05.
RESULTS
Following differentiation, LMXIa-MSCs upregulate typical midbrain dopaminergic transcripts: To evaluate the effect of LMXIa forced expression on the dopaminergic differentiation of MSCs, the relative gene expression of key transcription factors involved in the mesencephalic dopaminergic neuron development was analyzed using semi quantitative real time PCR. Prior to differentiation, no change in the transcripts' expression levels was observed.
However, following differentiation with Sonic Hedgehog, the receptors of which (Patched and Smoothened) are known to be expressed in MSCs, an impressive number of those transcription factors were found to be upregulated at least 3-folds (Figures 5A-F).
Among the upregulated genes, the neural stem cell marker SRY-related HMG-box gene
2 (Sox2) was identified (Figure 5A), which is expressed in the developing CNS and is required for neural stem cell maintenance, lineage specification and neurogenesis in the adult brain. An increase in msh homeobox 1 (MSX1) was also observed (Figure 5B), which was reported to act downstream of LMXIa and enable dopaminergic differentiation in rodents' developmental systems. In addition, it was found that LMXIa-MSCs upregulated their expression of the proneural genes Neurogenin 2 (NGN2) and the Human achaete-scute Homologue (hASH1)
(Figures 5C-D). Those factors belong to the basic loop helix (bHLH) protein family that is involved in the induction of neuronal cell fate. Moreover, differentiation of LMXIa-MSCs resulted in the upregulation of the specific mesencephalic transcripts Engrailedi (En1 ) and Paired-Like
Homeodomain transcription factor 3 (Pitx3), (Figures 5E-F), both of which are known to be crucial for the mesencephalic dopaminergic neuron differentiation. As for other developmental transcripts, no change in the expression level of Nuπi was detected (data not shown), which is expressed already in MSCs prior to any induction. At no time point was the expression of
LMXIb, En2, Otx2 or Foxia detected.
Regarding expression patterns of genes associated with mesenchymal properties, no significant difference in fibronectin basal expression following dopaminergic differentiation was detected while a small decrease in RUNX2 (osteogenic transcription factor runt-related transcription factor) expression was observed in LMXIa-MSCs compared with the non transduced MSCs (data not shown).
Differentiated LMXIa-MSCs express dopaminergic specific transcription factors: Following observations that the dopaminergic mRNA transcripts were upregulated in the LMXIa-MSCs, immunocytochemistry analysis was performed for detection of the dopaminergic transcription factors in the differentiated cells. The MSX1 protein was found to be expressed in the LMXIa-MSCs co-localizing with LWIXIa (Figure 6A-C). The same picture was observed when the cells were stained for EM {Figure δE-G). Pitχ3 was also expressed in LWlXIa- MSCs (Figure 61-0). No expression of those transcription factors was noticed in LMXIa-MSCs prior to incubation in differentiation medium (Figure 6D, H1 K). Higher magnification of the stained LMXIa-WlSCs further demonstrated that the transcription factors were mainly concentrated in and around the cell nucleus (Figure 6L-N). Strong expression of WISX1 and En 1 was found to coincide with high level of expression of LMXIa in some of the cells.
Differentiated LMXIa-MSCs express neuronal end dopaminergic markers and secrete a higher level of dopamine: To examine whether the change in gene expression profile and the expression of dopaminergic transcription factors were accompanied by expression of neuronal markers, the cells were stained for the neuronal precursor marker Tuj1 (β-3Tubulin), the rate limiting enzyme in dopamine synthesis tyrosine hydroxylase (TH) and the vesicular monoamine transporter 2 (VMAT2). It was found that following differentiation, the LMXIa-MSCs expressed Tuj1 at higher levels (>90 %, Figure 7C-E) compared with the basal level of Tuji expression in untreated MSCs (Figure 7A). Staining for TH expression revealed a similar picture, as LWlXIa-WiSCs expressed higher levels of the enzyme following differentiation (Figure 7F-H). compared with the cells prior differentiation (Figure 7B). Some of the differentiated LWlXIa-WISGs showed neuronal morphology and were positively stained for TH and VMAT2. VWIAT2 positively stained cells were detected only in the differentiated LMXIa-WISCs, but not in LMXIa-MSCs prior to differentiation or in non transduced MSCs. Moreover, Real-time PCR revealed that VMAT2 mRNA was only detected in differentiated LMXIa-MSCs and not in untransduced MSCs (data not shown). At no time point could dopamine transporter mRNA expression be detected. tn order to better quantify the upregulation of TH expression, a western blot analysis was performed on ceils with or without LMXIa forced expression prior to differentiation and along the differentiation course (following one week and three weeks of differentiation). The differentiated ceils upregulated the protein expression level of TH both in non transduced MSCs and in LMXIa-WISCs (Figure 71). However, TH protein upregulation was significantly higher in LMXIa-MSCs compared with non transduced MSCs (Figure 7J)1 following one week of differentiation 3.05-fdds ±SEM 0.39 in LMXia-MSCs and 1.71-foids ±SEM 0,26 in untransduced MSCs, following three weeks of differentiation 4.43-folds ±SEM 0.66 in LMXIa- MSCs and 1 ,82-folds ±SEM 0,22 in non transduced MSCs.
Finally, to evaluate the functional dopaminergic differentiation, cells were incubated in neutralized secretion media (HBSS) and dopamine secretion was analyzed with HPLC Following differentiation, LMXIa-MSCs secreted threefold more dopamine to the secretion medium compared with untransduced MSCs (Figure 7K). LMXIa-MSCs secreted higher, though not statistically significant, levels of dopamine in response to depolarization media (56 mM KCI) compared to HBSS (data not shown). No dopamine secretion was detected in cells prior to differentiation. DISCUSSION
The present examples describe the efficient transduction of human MSCs with a lentiviral vector encoding the complete cDNA of the human Lmxia gene. Forced expression of Lmxia in human cells harvested from an adult patient was shown to induce upregulation of key transcriptional factors which are known to be involved in the dopaminergic differentiation of primitive stem cells in the developing midbrain and of embryonic stem cells. Lmxia forced expression, together with extrinsic signaling molecules such as Shh and FGF8 were shown to be sufficient to produce cells that exhibit a gene expression profile typical of dopaminergic cells. Moreover, the LMXIa-MSCs expressed higher levels of TH, the rate limiting enzyme in dopamine synthesis, and secreted significantly higher levels of dopamine compared with non transduced cells.
The present work shows that forced expression of LMXIa in cells harvested from an adult, together with exposure of the cells to extrinsic signals in the form of Shh and FGF8, resulted in a gene expression profile which mimics the expression pattern of dopaminergic precursors The differentiated LMXIa-MSCs displayed significant up regulation of Sox2, MSX1, NGN2, hASH1 , En1 and Pitx3 compared with non transduced MSCs expressing little or no LMXIa. Analyzing the functional dopaminergic traits of the cells, a clear advantage of the
LMXIa-MSCs was found. While tyrosine hydroxylase upregulation in differentiated MSCs has been reported before [Barzilay et al., 2008, in press; Trzaska et al., 2007, Stem Cells. 25, 2797- 2808], the present inventors found that LMXIa forced expression facilitated this upregulation and resulted in higher levels of dopamine secretion in LMXIa-MSCs than in non transduced MSCs. A trend of increased dopamine secretion in response to depolarization in LMXIa-MSCs was also observed, suggesting that a compatible neuronal differentiation was yet to be established. This results fall in place with previous reports that show that, in the course of neurogenesis, the neurotransmitter identity is determined prior to the acquirement of electrophysiological properties. The inability to detect expression of the dopamine transporter, a more mature dopaminergic marker, supported the notion that the dopaminergic phenotype was still immature.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

WHAT IS CLAIMED IS:
1. An isolated mesenchymal stem cell expressing an exogenous polynucleotide, said exogenous polynucleotide comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
2. The isolated mesenchymal stem cell of claim 1, being human.
3. The isolated mesenchymal stem cell of claim 1 , wherein an amount of said Lmxia polypeptide is at least twice an amount of Lmxia polypeptide in an identical mesenchymal stem cell not expressing said exogenous polynucleotide.
4. The isolated mesenchymal stem cell of claim 1 , secreting dopamine.
5. The isolated mesenchymal stem cell of claim 1 , expressing at least twice an amount of midbrain dopaminergic polypeptide, as compared to an identical mesenchymal stem cell not expressing said exogenous polynucleotide, said midbrain dopaminergic polypeptide being selected from the group consisting of SRY-related HMG-box gene 2 (Sox2), msh homeobox 1 (MSX1), Neurogenin 2 (Λ/GΛ/2), Human achaete-scute Homologue (hASH1), Engrailedi (En1), Paired-Like Homeodomain transcription factor 3 (Pitx3), LIM homeobox transcription factor 1 beta (LMXIb) and the orphan nuclear receptor-related 1 (NurM).
6. The isolated mesenchymal stem cell of claim 1 , expressing at least twice an amount of tyrosine hydroxylase, as compared to an identical mesenchymal stem cell not expressing said exogenous polynucleotide.
7. The isolated mesenchymal stem cell of any of claims 1-6, expressing fibronectin.
8. The isolated mesenchymal stem cell of any of claims 1-6, expressing VMAT2.
9. The isolated mesenchymal stem cell of claim 1 , wherein said exogenous polynucleotide further comprises a lentiviral nucleic acid sequence.
10. The isolated mesenchymal stem cell of claim 1 , wherein said exogenous polynucleotide further comprises a promoter operably linked to said nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide.
11. A method of generating cells useful for treating a neurodegenerative disorder, the method comprising:
(a) genetically modifying a mesenchymal stem cell with a nucleic acid construct comprising a nucleic acid sequence encoding a LIM homeobox transcription factor 1 alpha (Lmxia) polypeptide to generate genetically modified mesenchymal stem cells; and
(b) culturing said genetically modified mesenchymal stem cells in a differentiating medium, thereby generating cells useful for treating the neurodegenerative disorder.
12. The method of claim 11, wherein said differentiating medium comprises at least one component selected from the group consisting of Fibroblast growth factor 2 (FGF-2), Fibroblast growth factor 8 (FGF8) and Sonic hedgehog (Shh).
13. The method of claim 11 , wherein said culturing is effected for a period of at least two weeks.
14. The method of claim 11 , wherein said neurodegenerative disorder is selected from the group consisting of Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, autoimmune encephalomyelitis, Alzheimer's disease, Stroke and Huntington's disease.
15. The method of claim 14, wherein the neurodegenerative disorder is Parkinson's.
16. A pharmaceutical composition comprising as an active agent the cells of claim 1 and a pharmaceutically acceptable carrier.
17. Use of the cells generated according to the method of claim 11, for the manufacture of a medicament identified for the treatment of a neurodegenerative disorder.
18. A method of treating a neurodegenerative disorder, the method comprising transplanting to an individual in need thereof cells generated according to the method of claim 11, thereby treating the neurodegenerative disorder.
PCT/IL2008/000759 2007-06-04 2008-06-04 Methods of generating dopaminergic cells and uses thereof Ceased WO2008149356A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US92486507P 2007-06-04 2007-06-04
US60/924,865 2007-06-04
US92986507P 2007-07-16 2007-07-16
US60/929,865 2007-07-16

Publications (1)

Publication Number Publication Date
WO2008149356A1 true WO2008149356A1 (en) 2008-12-11

Family

ID=39758511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2008/000759 Ceased WO2008149356A1 (en) 2007-06-04 2008-06-04 Methods of generating dopaminergic cells and uses thereof

Country Status (1)

Country Link
WO (1) WO2008149356A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275935A (en) * 2012-12-12 2013-09-04 中国医学科学院医学生物学研究所 Method for differentiation of dopaminergic neuron by SHH/Lmx1a signal pathway regulation and control NTN modified rASCs
CN104099369A (en) * 2013-04-09 2014-10-15 中国农业大学 Method for constructing transgenic breeding layer cells capable of secreting and expression of cytokines
CN104826130A (en) * 2015-02-06 2015-08-12 中国人民解放军第二军医大学 Method of specifically inducing microglial cell selective polarization with MSX3 gene and application of same
CN116410921A (en) * 2023-02-09 2023-07-11 北京益华生物科技有限公司 A kind of human umbilical cord mesenchymal stem cell induction medium, induction method and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006071746A2 (en) * 2004-12-23 2006-07-06 Ludwig Institute For Cancer Research Engineered dopamine neurons and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006071746A2 (en) * 2004-12-23 2006-07-06 Ludwig Institute For Cancer Research Engineered dopamine neurons and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS, 5TH ANNUAL CONFERENCE OF THE ISRAELI SOCIETY OF GENE THERAPY TUESDAY, MARCH 17TH, 2007, 17 March 2007 (2007-03-17), pages 1 - 3, XP002497564, Retrieved from the Internet <URL:http://www.isgt.org.il/SiteFiles/program%20web(2).pdf> [retrieved on 20080925] *
JIANG YUEHUA ET AL: "Neuroectodermal differentiation from mouse multipotent adult progenitor cells.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 30 SEP 2003, vol. 100 Suppl 1, 30 September 2003 (2003-09-30), pages 11854 - 11860, XP002497565, ISSN: 0027-8424 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275935A (en) * 2012-12-12 2013-09-04 中国医学科学院医学生物学研究所 Method for differentiation of dopaminergic neuron by SHH/Lmx1a signal pathway regulation and control NTN modified rASCs
CN103275935B (en) * 2012-12-12 2015-09-23 中国医学科学院医学生物学研究所 The neuronic method of rASCs differentiating dopaminergic that SHH/Lmx1a signal path regulation and control NTN modifies
CN104099369A (en) * 2013-04-09 2014-10-15 中国农业大学 Method for constructing transgenic breeding layer cells capable of secreting and expression of cytokines
CN104826130A (en) * 2015-02-06 2015-08-12 中国人民解放军第二军医大学 Method of specifically inducing microglial cell selective polarization with MSX3 gene and application of same
CN116410921A (en) * 2023-02-09 2023-07-11 北京益华生物科技有限公司 A kind of human umbilical cord mesenchymal stem cell induction medium, induction method and application
CN116410921B (en) * 2023-02-09 2024-01-23 北京益华生物科技有限公司 A human umbilical cord mesenchymal stem cell induction medium, induction method and application

Similar Documents

Publication Publication Date Title
JP7407865B2 (en) Methods and their applications for cell reprogramming
Nagai et al. Multilineage potential of stable human mesenchymal stem cell line derived from fetal marrow
US6610540B1 (en) Low oxygen culturing of central nervous system progenitor cells
US6812027B2 (en) Discovery, localization, harvest, and propagation of an FGF2 and BDNF-responsive population of neural and neuronal progenitor cells in the adult human forebrain
EP2064319B1 (en) Methods of generating glial and neuronal cells and use of same for the treatment of medical conditions of the cns
Su et al. Direct conversion of fibroblasts into neural progenitor-like cells by forced growth into 3D spheres on low attachment surfaces
EP2982747B1 (en) Method for producing reprogrammed derivative neuronal stem cell from non-neuronal cell by using hmga2
CN104379731A (en) Midbrain dopamine (DA) neurons for implantation
WO2011130675A2 (en) Dopaminergic neurons differentiated from pluripotent stem cells and uses of thereof
Kitada Mesenchymal cell populations: development of the induction systems for Schwann cells and neuronal cells and finding the unique stem cell population
WO2011041062A1 (en) Cranial neural crest stem cells and culture condition that supports their growth
US20220106562A1 (en) Differentiated and nondifferentiated msc compositions and use thereof
WO2008149356A1 (en) Methods of generating dopaminergic cells and uses thereof
WO2013124309A1 (en) Direct reprogramming of somatic cells into neural stem cells
EP4547825A1 (en) Enhancing neuronal differentiation of ventral midbrain neural progenitor cells
WO2016207300A1 (en) Enhanced cell reprogramming by mrna
US20050196864A1 (en) Induction and high-yield preparative purification of mesencephalic dopaminergic neuronal progenitor cells and dopaminergic neurons from human embryonic stem cells
WO2023164499A2 (en) Methods of making induced pluripotent stem cells
Bianco et al. Rapid serum-free isolation of oligodendrocyte progenitor cells from adult rat spinal cord
Corti Uncoupling Tumorigenicity from Dopaminergic Differentiation Potential of HiPSCs by Acting on Glypican4: Combining in Vitro Differentiation Studies with Preclinical Studies for Parkinson's Disease Therapy
WO2007138577A2 (en) Methods of generating a neural tissue using muscle-derived cells
Keeffe et al. Induction of A9 dopaminergic neurons from neural stem cells improves motor function in an animal model of Parkinsons disease.
HK1131640A (en) Methods of generating glial and neuronal cells and use of same for the treatment of medical conditions of the cns
HK1131640B (en) Methods of generating glial and neuronal cells and use of same for the treatment of medical conditions of the cns
CA2351551A1 (en) Low oxygen culturing of cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08763517

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08763517

Country of ref document: EP

Kind code of ref document: A1