WO2008137446A1 - Methods and compositions for the treatment of respiratory disease - Google Patents

Methods and compositions for the treatment of respiratory disease Download PDF

Info

Publication number
WO2008137446A1
WO2008137446A1 PCT/US2008/061960 US2008061960W WO2008137446A1 WO 2008137446 A1 WO2008137446 A1 WO 2008137446A1 US 2008061960 W US2008061960 W US 2008061960W WO 2008137446 A1 WO2008137446 A1 WO 2008137446A1
Authority
WO
WIPO (PCT)
Prior art keywords
ggt
phosphono
methyl
inhibitor
amino
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/061960
Other languages
French (fr)
Inventor
Martin Joyce-Brady
Jyh-Chang Jean
Matthew Lowry
Rebecca Hughey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boston University
University of Pittsburgh
Original Assignee
Boston University
University of Pittsburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boston University, University of Pittsburgh filed Critical Boston University
Publication of WO2008137446A1 publication Critical patent/WO2008137446A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics

Definitions

  • Asthma sufferers are subject to acute attacks characterized by increased responsiveness of the tracheobronchial tree to various stimuli, which leads to generalized airway constriction manifested by dyspnea, cough and wheezing. Asthma sufferers often experience acute exacerbations of bronchoconstriction, which may be life-threatening.
  • the degrees of severity of an acute asthma attack have been classified as mild, moderate and severe in NIH Publication No. 97-4051 (April 1997) of the National Heart, Lung and Blood Institute of the National Institutes of Health and these classifications are used herein and NIH Publication No. 97-4051 is incorporated herein by reference.
  • a patient presenting with severe asthma is treated with a series of drugs including inhaled ⁇ 2 -agonist and anticholinergic and systemic corticosteroid medications, and is given oxygen to achieve O 2 saturation > 90%.
  • Any patient with impending or actual respiratory failure is treated with parenteral ⁇ 2 -agonist, inhaled anticholinergic and parenteral corticosteroid medications, and if no favorable response is shown, by endotracheal intubation and mechanical ventilation and treatment in an intensive care unit.
  • Annually several thousand patients with severe asthma die.
  • Extracellular glutathione is metabolized by the enzyme gamma- glutamyl transferase (GGT), which is present in the lung lining fluid ⁇ Joyce-Brady, 1994, / Biol Chem, 269:14219-14226 ⁇ .
  • GGT gamma- glutamyl transferase
  • Extracellular pools of glutathione in the blood, the urine ⁇ Harding, 1997, / Biol Chem, 272:12560-12567; Lieberman, 1996, Proc Natl Acad Sci USA, 93:7923-7926 ⁇ and the lung lining fluid ⁇ Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776 ⁇ enlarge due to decreased turnover.
  • GSH glutathione
  • GGT gamma glutamyl transpeptidase
  • a GGT inhibiting agent can be administered alone or in conjunction with other agents for the treatment of respiratory disorders.
  • Compositions disclosed herein include inhibitors of GGT in combination with other agents for the treatment of respiratory disorders.
  • One embodiment disclosed herein provides a method of treating a respiratory disorder, the method comprising administering to an individual in need of such treatment an inhibitor of gamma-glutamyl transpeptidase (GGT).
  • the respiratory disorder is asthma.
  • the inhibitor is selected from the group consisting of : an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin.
  • the small molecule is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L- methionine sulfoxide, among others.
  • the gamma phosphono diester analog of glutamate is selected from the group consisting of 2-(N- benzyloxycarbonylamino)-4-phosphonobutanoic acid, benzyl 2-(N- benzyloxycarboxylamino)-4-phosphonobutanoate, benzyl 2-(N-benzyloxycarbonylamino)-4- (dichlorophosphono)butanoate, benzyl 2-(N- benzyloxycarboxylamino)-4-[4- methoxyphenyl(methyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarboxylamino)-4- [methyl(4-methylphenyl)phosphono]butanoate, benzyl2-(N-4- nitrobenzyloxycarbonylamino)-4-[methyl(phenyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarbon
  • the gamma phosphono diester analog of glutamate is 2-amino-4-[methylumbelliferyl)phosphono]butanoic acid, 2-Amino-4- ⁇ [3-(carboxymethyl)phenyl](methyl)phosphono ⁇ -butanoic acid or a pharmaceutically acceptable salt or ester thereof.
  • the nucleic acid comprises an RNAi agent that directs the cleavage of GGT mRNA.
  • the inhibitor is administered in inhaled form.
  • the inhibitor is administered in combination with inhaled glutathione.
  • the inhibitor is administered in combination with a different drug for treatment of the respiratory disorder.
  • the different drug is selected from the group consisting of: zafirlukast, fluticasone propionate, salmeterol, flunisolide, metaproteranol sulfate, triamcinalone acetonide, beclomethasone, trebutaline sulfate, formoterol, cromolyn sodium, methylprednisone, prednisolone sodium phosphate acetate, albuterol sulfate, budesonide, salmeterol xinafoate, montelukast sodium, theophylline, levalbuterol hydrochloride and zileuton.
  • a pharmaceutical composition comprising a GGT inhibitor plus another compound having efficacy against an indicator of asthma, and a pharmaceutically acceptable excipient.
  • the inhibitor is selected from the group consisting of: an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin.
  • the GGT inhibitor is a gamma phosphono diester analog of glutamate.
  • the gamma phosphono diester analog of glutamate is 2-amino-4- [methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4- ⁇ [3- (carboxymethyl)phenyl] (methyl)phosphono ⁇ -butanoic acid.
  • an inhibitor of GGT for the treatment of a respiratory disorder, including, but not limited to asthma.
  • the GGT inhibitor is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin.
  • the small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide.
  • the small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate.
  • the gamma phosphono diester analog of glutamate is 2-amino-4- [methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4- ⁇ [3- (carboxymethyl)phenyl] (methyl)phosphono ⁇ -butanoic acid.
  • an inhibitor of GGT in the preparation of a medicament for the treatment of a respiratory disorder including, but not limited to asthma.
  • the GGT inhibitor is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin.
  • the small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide.
  • the small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate.
  • the gamma phosphono diester analog of glutamate is 2-amino-4-[methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4- ⁇ [3- (carboxymethyl)phenyl] (methyl)phosphono ⁇ -butanoic acid.
  • the term "respiratory disorder” refers to a disease or disorder affecting the lung and airways, and more particularly to diseases or disorders that involve oxidant stress and impaired function of the airway.
  • “Respiratory disorders” include, but are not limited to, e.g., asthma, pulmonary fibrosis, respiratory tract infection, acute respiratory distress syndrome and oxidant-mediated acute lung injury. Respiratory disorders can additionally include lung cancer, chronic obstructive pulmonary disease (COPD), chronic bronchitis and emphysema.
  • COPD chronic obstructive pulmonary disease
  • Treatment of a respiratory disorder refers to therapeutic intervention that stabilizes or improves the function of the lung or the airway. That is, “treatment” is oriented to the function of the respiratory tract.
  • a “treatment” as the term is used herein can stabilize or improve respiratory function without necessarily, for example, killing an infectious agent or killing a tumor.
  • the phrase "indicator of asthma” refers to a clinically accepted, measurable, indicium of asthma.
  • Measurable indicia of asthma include, as non-limiting examples, airway hyper-responsiveness, e.g., bronchial hyperreactivity by methacholine challenge, changes in Forced Expiratory Volume as measured by spirometry, exhaled nitric oxide level, serum eosinophil cationic protein, serum atopy markers and chemokine levels (e.g., macrophage-derived chemokine (MDC), thymus and activation regulated chemokine (TARC), eotaxin), and leukotriene B4 levels in exhaled breath condensate.
  • MDC macrophage-derived chemokine
  • TARC activation regulated chemokine
  • eotaxin eotaxin
  • the term "inhibitor of gamma-glutamyl transpeptidase (GGT)” refers to an agent that reduces the activity of human gamma glutamyl transpeptidase by at least 20%, and preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more, up to and including 100% (complete inhibition), relative to the enzyme activity in the absence of the agent.
  • GGT activity is “inhibited” if it is reduced by at least 20%, and preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more, up to and including 100% (complete inhibition) relative to activity in the absence of an inhibitor or inhibitory treatment.
  • GGT activity can be measured in any manner known in the art.
  • one way of measuring inhibition of GGT is that described by Han et al. (2007), Biochemistry 46: 1432-1447, which is incorporated herein by reference. This assay is also described in further detail herein below.
  • An inhibitor of GGT as the term is used herein can function in a competitive or noncompetitive manner, and can function, in one embodiment, by interfering with the expression of the GGT polypeptide.
  • a GGT inhibitor as the term is used herein does not include acivicin.
  • an inhibitor of GGT in the preparation of a medicament for the treatment of a respiratory disease or disorder, including, but not limited to asthma.
  • the inhibitor can be selected from the group consisting of : an antibody or antigen- binding fragment thereof that specifically binds GGT; a nucleic acid; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin.
  • the small molecule can be selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide. In a preferred embodiment, the small molecule is a gamma phosphono diester analog of glutamate.
  • the term "in combination with” refers to administration of a GGT inhibitor in conjunction with another therapeutic agent, e.g., glutathione or another respiratory therapeutic agent.
  • the administration of a GGT inhibitor "in combination with” such other agent encompasses not only the concurrent co-administration of the GGT inhibitor and the other agent, but also administration of the GGT inhibitor prior to (e.g., from 1 day to a minute or less prior to) or following (e.g., from 1 day to a minute or less following) administration of the other agent.
  • the agent administered "in combination with" the GGT inhibitor can be administered by the same or different pathway as the GGT inhibitor, e.g., systemically, such as orally or by IV injection, or locally, as by inhalation or direct injection or instillation to a target site.
  • the term "specifically binds" refers to binding with a dissociation constant (K d ) of 100 ⁇ M or lower, e.g., 75 ⁇ M, 60 ⁇ M, 50 ⁇ M, 40 ⁇ M, 30 ⁇ M, 20 ⁇ M, 10 ⁇ M, 1 ⁇ M, 100 nM, 50 nM, 10 nM, 1 nM or less.
  • K d dissociation constant
  • small molecule refers to a chemical agent including, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • organic or inorganic compounds i.e., including heteroorganic and organometallic compounds
  • RNA interfering agent is defined as any agent which interferes with or inhibits expression of a target gene or genomic sequence by RNA interference (RNAi).
  • RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target gene or genomic sequence, or a fragment thereof, short interfering RNA (siRNA), short hairpin or small hairpin RNA (shRNA), and small molecules which interfere with or inhibit expression of a target gene by RNA interference (RNAi).
  • FIG. 1 Lung inflammatory milieu induced by IL13.
  • IE The level of versican mRNA was induced 6-fold in WT lung following IL13 treatment. For GGT enul lung, the level of versican mRNA was the same as that of saline- treated WT lung, and following ILl 3 treatment it was induced to a similar level as that of IL13-treated WT lung.
  • IF No versican protein signal was detected in saline-treated lung by immunohistochemistry in either genotype. Photomicropgraph shows saline-treated WT lung at 4Ox magnification.
  • IG An intense signal for versican protein was detected in the basement membranes surrounding airways following ILl 3 treatment in both genotypes. Photomicrograph shows airway from IL13-treated WT lung at 4Ox magnification.
  • IL13 induces lung mucous accumulation plus mucin and mucin-related gene expression.
  • 2A An intense signal for periodic acid Schiff (PAS) positive material was present in airway epithelial cells from IL13-treated WT mice.
  • 2B Few cells exhibited any PAS positive material in GGT enul lung and the signal was sparse. No PAS positive cells were identified in saline-treated lung from either genotype (data not shown). Both photomicrographs are the same magnification (40X) and show a terminal bronchus.
  • 2C Muc 5ac gene expression was assayed by quantitative RT-PCR as described in Methods.
  • Asterisk marks significance difference by post-hoc analysis.
  • FIG. 3 Airway hyper-reactivity assay. Saline-treated and IL13-treated WT and GGT enul mice were challenged with methacholine as described herein below. Airway resistance in cm H 2 0/ml/sec is plotted on the ordinate against the two genotypes and two treatment groups exposed to increasing doses of methacholine from one representative experiment. Asterisks denote significant increases in resistance over saline treated WT lung only in IL13-treated WT mice.
  • total glutathione content was not different between saline-treated and IL13-treated WT mice but was significantly elevated by 4.5-fold in IL13-treated GGT enul mice.
  • Asterisks mark specific differences at P ⁇ 0.05 by post hoc analysis.
  • FIG. 5 Epidermal growth factor receptor (EGFR) analysis. Native EGF receptor expression was localized by immunohistochemistry using peptide- specific antisera against EGFR as described in Methods. The photomicrograph shows the presence of signal on ciliated airway epithelial cells in saline-treated WT lung at 4OX (8A), and 10Ox (8B). No signal was evident in (8C) using non-immune rabbit IgG as a negative control (4Ox). EGFR signal was abolished in (8D) by co-incubation with the peptide antigen in a competition assay (4Ox). The same results were evident in saline-treated GGT enul lung (data not shown).
  • EGF receptor was localized using peptide-specific antisera against phosphorylated EGFR as described in Methods. Signal was identified in nuclei of airway epithelial cells only from IL13-treated WT lung (8E, 4Ox). Arrow marks nucleus with signal present among surrounding nuclei with an absence of signal. No signal was evident using non-immune rabbit IgG as a negative control (8F, 4Ox). This nuclear signal was abolished in (8G, 4Ox) by co- incubation with the peptide antigen in a competition assay. (H) EGF receptor mRNA levels were assayed by quantitative RT-PCT as described in Methods.
  • FIG. 6 Inhibition of lung lining fluid GGT attenuates airway hyper-reactivity in wild type mice.
  • the invention relates to methods and compositions for the treatment of respiratory diseases or disorders, and particularly those involving oxidative stress.
  • Asthma was long thought to be characterized only by bronchospasm, but then it was learned that inflammation precedes bronchospasm, rendering the airway hyper-responsive to stimuli that then trigger the bronchospasm.
  • the treatment of asthma has therefore focused on the use of inhaled corticosteroid drugs to treat the inflammation, often in conjunction with inhaled beta-2 agonist bronchodilators for the relief of acute symptoms. Inflammation, however, induces oxidative stress through increases in reactive oxygen species.
  • Oxidative stress is emerging as a unifying factor in different respiratory diseases in addition to asthma, including but not limited to acute respiratory distress syndrome (ARDS), pulmonary fibrosis, emphysema and lung cancer.
  • ARDS acute respiratory distress syndrome
  • pulmonary fibrosis fibrosis
  • emphysema emphysema
  • lung cancer emphysema
  • Treatment or prevention of oxidative stress apart from treatment of the inflammation itself, provides another avenue for the treatment of such respiratory diseases. This approach therefore provides a new avenue for the treatment or prevention of asthma and other respiratory diseases or disorders involving oxidative stress.
  • treatments which increase the anti-oxidant pool in lung lining fluid can reduce the oxidative state and treat symptoms of the disease or disorder.
  • GGT is the key enzyme in glutathione metabolism.
  • GGT enul mice deficient in ⁇ - glutamyl transferase (GGT) and unable to metabolize extracellular glutathione, develop cellular glutathione deficiency and oxidant stress. Oxidant stress causes asthma.
  • the inventors suspected that deficiency of GGT would accentuate asthma in GGT-deficient mice and used IL13-induced asthma to compare the experimental phenotype in GGT enul mice compared to Wild Type control mice. Both genotypes developed a similar lung inflammatory milieu.
  • GGT enul lung resisted ILl 3 induced mucous cell hyperplasia, mucin and mucin-related gene expression, and airway hyperreactivity that developed in the Wild Type lung.
  • GGT is an ectoenzyme and resides in lung lining fluid normally to turnover the extracellular glutathione pool. This pool actually increases in size in GGT deficient GGT enul mouse lung, and after IL 13 treatment, the pool size increases even further to approximately 10-fold over that in Wild Type lung.
  • the augmented extracellular glutathione pool buffered inflammation-associated reactive oxygen species in the GGT deficient mouse lung, as evidenced by a lack of epithelial cell EGFR activation, a marker for oxidative stress.
  • Nrf2 knockout mice have an increased susceptibility to severe airway inflammation and airway hyper-reactivity in the ovalbumin model of experimental asthma. Nrf2 regulates transcription of several antioxidant genes, but part of the imbalance involves glutathione, because lung glutathione content and redox ratio (GSH/GSSG) increased only in ovalbumin- sensitized WT mice. Normally, lung glutathione is abundant in cells and extracellular lining fluid bathing the gas exchange surface. Extracellular glutathione is metabolized by gamma-glutamyl transferase (GGT, EC 2.3.2.2), which is present in lung lining fluid.
  • GTT gamma-glutamyl transferase
  • GGT deficiency decreased turnover causes extracellular glutathione pools in lung lining fluid to enlarge, but also depletes cellular glutathione because cysteine availability, derived from glutathione breakdown, limits intracellular glutathione synthesis.
  • Cellular glutathione deficiency causes oxidant stress, which is evident in GGT enul lung in normoxia and hyperoxia.
  • experimental asthma was induced with IL13. Analogous to the airway hypersensitivity observed in Nrf2 knockout mice, it was anticipated that cellular glutathione deficiency would increase asthma susceptibility in GGT enul mice.
  • Eosinophil accumulation is a marker of an inflammatory response. Eosinophils are an important source of reactive oxygen species, and are believed to contribute to the onset of the asthma phenotype. Given the pronounced eosinophil response in the GGT enul mice it is even more surprising that the asthmatic response was attenuated in these animals. The attenuated asthmatic response was evident as decreased levels of airway mucous cell hyperplasia, mucin and gob-5 gene induction, EGF receptor activation and airway hyper-reactivity. GGT deficiency therefore protected the GGT enul mouse lung against this experimental model of asthma.
  • GGT inhibition provides an approach for the treatment of asthma, and also of other respiratory diseases or disorders involving oxidative stress. That is, one can treat asthma or other respiratory diseases or disorders involving oxidative stress by administering a GGT inhibitor to an individual in need of such treatment. It is further contemplated that GGT inhibition can similarly treat non-respiratory diseases or disorders that involve oxidative stress. This could have wide ranging applicability in the treatment of inflammatory diseases or disorders, which are characterized by an oxidative environment.
  • GGT activity could inhibit glutathione turnover in those situations as well, thereby increasing extracellular glutathione and protecting tissues from damage due to the inflammatory response.
  • Such treatment could be used in place of or, in combination with, anti-inflammatory drugs, such as corticosteroids or in combination with other anti-asthma medications.
  • anti-asthma medications include, for example, zafirlukast, fluticasone propionate, salmeterol, flunisolide, metaproteranol sulfate, triamcinalone acetonide, beclomethasone, trebutaline sulfate, formoterol, cromolyn sodium, methylprednisone, prednisolone sodium phosphate acetate, albuterol sulfate, budesonide, salmeterol xinafoate, montelukast sodium, theophylline, levalbuterol hydrochloride and zileuton.
  • GGT gamma- glutamyl teukotrienase
  • Attenuation of IL- 13 induced airway hyper-reactivity in GGT enul lung is unlikely to be related to altered cysteinyl leukotnene metabolism, and no significant differences in leukotriene accumulation in BAL fluid of WT or GGT enul mice were found regardless of saline or IL 13 treatment.
  • the data further indicate that GGT functions in mouse lung to selectively metabolize glutathione.
  • Lung lining fluid glutathione deficiency has been augmented by inhalation of glutathione aerosols and this technique has been proposed as treatment for diseases associated with glutathione deficiency.
  • Pharmacological means to manipulate lung lining fluid GGT activity also enhance extra-cellular glutathione levels in the presence of oxidant stress associated with inflammation and are demonstrated herein to prevent asthma in an accepted animal model.
  • GGT inhibition can be effected by any of a number of different approaches, each of which is encompassed by the treatment methods described herein.
  • small molecule inhibitors of GGT or antibodies or antibody fragments that inhibit GGT function can be administered.
  • approaches that down-regulate the expression of GGT polypeptide in the lung can also be used.
  • Inhibitors used in the methods and compositions described herein are preferably specific inhibitors of GGT activity.
  • specific in this context is meant that the subject inhibitor has greater inhibitory activity, by at least 50%, and preferably by at least 75% or 100% or more, including, for example, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. It is most preferred that the subject inhibitor have no inhibitory activity against other known enzymes at the inhibitor concentrations at which GGT is at least 95% inhibited.
  • Small molecule inhibitors of GGT activity are known in the art.
  • the well known inhibitor acivicin L-(aS,5S)- ⁇ -amino-3- chloro-4,5-dihydro-5-isoxazoleacetic acid; also known as AT- 125 and U-42126
  • the inhibitor is not acivicin.
  • modified forms of acivicin having GGT-inhibiting activity are specifically contemplated as useful in the methods described herein.
  • Such modified forms of this, or any other known GGT inhibitory compound can be designed by one of skill in the art and tested for GGT inhibition and/or treatment of respiratory disease using methods known in the art or described herein.
  • GGT inhibitors of GGT include, for example, those described by Anderson and Meister (1986, Proc. Natl. Acad. Sci. U.S.A. 83: 5-29-5032), which is incorporated herein by reference. These include, for example, L-g-glutamyl-(o- carboxy)phenylhydrazide and other hydrazides, as well as 6-diazo-5-oxo-L-norleucine. Derivatives of these molecules which retain GGT inhibitory activity are further contemplated herein and can be designed and tested by those of skill in the art.
  • Small molecule inhibitors of GGT further include those described by Lherbet and Keillor (2004, Org. Biomol. Chem. 2: 238-245), which is incorporated herein by reference.
  • the reference teaches that ⁇ -glutamyl derivatives containing a sulfoxide moiety at the ⁇ position are a class of GGT inhibitors.
  • the compound 2-amino-4-[2- (carboxymethylcarbamoyl)ethylsuylfinyl] -butyric acid (referred to therein as Compound 16) is particularly potent, with a K 1 value of 53+3 micromolar.
  • Derivatives of these molecules which retain GGT inhibitory activity are further contemplated herein and can be designed and tested by those of skill in the art.
  • a class of ⁇ -phosphono diester glutamate analogues has recently been described as novel transition- state mimic GGT inhibitors (Han et al., Biochemistry (2007) 46: 1432-1447, incorporated herein by reference) that strongly inhibit both human and E. coli GGT, and some are even more potent than the classical inhibitor acivicin.
  • the electrophilic phosphonate diesters described were shown to be irreversible inhibitors of GGT. While mechanism should not be seen as limiting, it is believed that these compounds inhibit the enzyme by phosphonylating the catalytic Thr residue.
  • [methylumbelliferyl)phosphono]butanoic acid has 6000X higher activity toward human GGT relative to acivicin.
  • Other phosphonate diester-based GGT inhibitors derived from the teachings of the Han et al. reference would also be expected to be useful in the methods and compositions described herein.
  • the GGT inhibitory activity of a given small molecule can be assessed using methods known in the art or described herein.
  • Antibodies that specifically bind GGT can be used for the inhibition of the enzyme in vivo. It is noted that where extracellular GGT appears to be an important target for GGT inhibition in the lung, problems frequently associated with the delivery of antibodies and other relatively large macromolecules across membranes do not present an issue. Antibodies to GGT can be raised by one of skill in the art using well known methods. The GGT inhibitory activity of a given antibody can be assessed using methods known in the art or described herein. The catalytic site of the GGT enzyme has been characterized (see, e.g., Han et al., supra, and references therein). Antibodies that recognize and bind to the catalytic site of the enzyme can therefore be generated through the selection and use of GGT fragments that retain the active site topology for immunization.
  • Antibody inhibitors of GGT can include polyclonal and monoclonal antibodies and antigen-binding derivatives or fragments thereof.
  • Well known antigen binding fragments include, for example, single domain antibodies (dAbs; which consist essentially of single V L or V H antibody domains), Fv fragment, including single chain Fv fragment (scFv), Fab fragment, and F(ab')2 fragment. Methods for the construction of such antibody molecules are well known in the art.
  • RNA interference uses small interfering RNA (siRNA) duplexes that target the messenger RNA encoding the target polypeptide for selective degradation.
  • siRNA-dependent post-transcriptional silencing of gene expression involves cutting the target messenger RNA molecule at a site guided by the siRNA.
  • RNA interference is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target gene results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene ⁇ see Coburn, G. and Cullen, B. (2002) /. of Virology 76(18):9225), thereby inhibiting expression of the target gene.
  • mRNA messenger RNA
  • dsRNA double stranded RNA
  • RNAi is initiated by the dsRN A-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double- stranded fragments termed siRNAs.
  • siRNAs are incorporated into a protein complex (termed “RNA induced silencing complex,” or “RISC”) that recognizes and cleaves target mRNAs.
  • RISC RNA induced silencing complex
  • RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target genes.
  • inhibiting target gene expression includes any decrease in expression or protein activity or level of the target gene or protein encoded by the target gene as compared to a situation wherein no RNA interference has been induced.
  • the decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target gene or the activity or level of the protein encoded by a target gene which has not been targeted by an RNA interfering agent.
  • siRNA Short interfering RNA
  • small interfering RNA is defined as an agent which functions to inhibit expression of a target gene, e.g., by RNAi.
  • An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell.
  • siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, 22, or 23 nucleotides in length, and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides.
  • the length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand.
  • the siRNA is capable of promoting RNA interference through degradation or specific post- transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
  • PTGS post- transcriptional gene silencing
  • siRNAs also include small hairpin (also called stem loop) RNAs (shRNAs).
  • shRNAs small hairpin (also called stem loop) RNAs
  • these shRNAs are composed of a short (e.g., about 19 to about 25 nucleotide) antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand.
  • the sense strand may precede the nucleotide loop structure and the antisense strand may follow.
  • shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter (see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501, incorporated by reference herein in its entirety).
  • the target gene or sequence of the RNA interfering agent may be a cellular gene or genomic sequence, e.g. the GGT sequence.
  • An siRNA may be substantially homologous to the target gene or genomic sequence, or a fragment thereof.
  • the term "homologous” is defined as being substantially identical, sufficiently complementary, or similar to the target mRNA, or a fragment thereof, to effect RNA interference of the target.
  • RNA suitable for inhibiting or interfering with the expression of a target sequence include RNA derivatives and analogs.
  • the siRNA is identical to its target.
  • the siRNA preferably targets only one sequence.
  • RNA interfering agents such as siRNAs
  • expression profiling Such methods are known to one skilled in the art and are described, for example, in Jackson et al. Nature Biotechnology 6:635-637, 2003.
  • expression profiling one may also screen the potential target sequences for similar sequences in the sequence databases to identify potential sequences which may have off-target effects. For example, according to Jackson et al. (Id.) 15, or perhaps as few as 11 contiguous nucleotides, of sequence identity are sufficient to direct silencing of non-targeted transcripts. Therefore, one may initially screen the proposed siRNAs to avoid potential off-target silencing using the sequence identity analysis by any known sequence comparison methods, such as BLAST.
  • siRNA molecules need not be limited to those molecules containing only RNA, but, for example, further encompasses chemically modified nucleotides and non-nucleotides, and also include molecules wherein a ribose sugar molecule is substituted for another sugar molecule or a molecule which performs a similar function. Moreover, a non-natural linkage between nucleotide residues can be used, such as a phosphorothioate linkage.
  • the RNA strand can be derivatized with a reactive functional group of a reporter group, such as a fluorophore. Particularly useful derivatives are modified at a terminus or termini of an RNA strand, typically the 3' terminus of the sense strand. For example, the 2'-hydroxyl at the 3' terminus can be readily and selectively derivatizes with a variety of groups.
  • RNA derivatives incorporate nucleotides having modified carbohydrate moieties, such as 2'0-alkylated residues or 2'-O-methyl ribosyl derivatives and 2'-O-fluoro ribosyl derivatives.
  • the RNA bases may also be modified. Any modified base useful for inhibiting or interfering with the expression of a target sequence may be used. For example, halogenated bases, such as 5-bromouracil and 5-iodouracil can be incorporated.
  • the bases may also be alkylated, for example, 7-methylguanosine can be incorporated in place of a guanosine residue. Non-natural bases that yield successful inhibition can also be incorporated.
  • siRNA modifications include 2'-deoxy-2'-fluorouridine or locked nucleic acid (LAN) nucleotides and RNA duplexes containing either phosphodiester or varying numbers of phosphorothioate linkages.
  • LAN locked nucleic acid
  • modifications are known to one skilled in the art and are described, for example, in Braasch et al., Biochemistry, 42: 7967-7975, 2003.
  • Most of the useful modifications to the siRNA molecules can be introduced using chemistries established for antisense oligonucleotide technology.
  • the modifications involve minimal 2'-O-methyl modification, preferably excluding such modification. Modifications also preferably exclude modifications of the free 5'-hydroxyl groups of the siRNA.
  • siRNAs useful for targeting GGT expression can be readily designed and tested. Accordingly, siRNAs useful for the methods described herein include siRNA molecules of about 15 to about 40 or about 15 to about 28 nucleotides in length, which are homologous to a GGT gene. Preferably, the siRNA molecules have a length of about 19 to about 25 nucleotides. More preferably, the siRNA molecules have a length of about 19, 20, 21, or 22 nucleotides. The siRNA molecules can also comprise a 3' hydroxyl group. The siRNA molecules can be single-stranded or double stranded; such molecules can be blunt ended or comprise overhanging ends (e.g., 5', 3'). In specific embodiments, the RNA molecule is double stranded and either blunt ended or comprises overhanging ends.
  • At least one strand of the RNA molecule has a 3' overhang from about 0 to about 6 nucleotides (e.g., pyrimidine nucleotides, purine nucleotides) in length.
  • the 3' overhang is from about 1 to about 5 nucleotides, from about 1 to about 3 nucleotides and from about 2 to about 4 nucleotides in length.
  • the RNA molecule is double stranded, one strand has a 3' overhang and the other strand can be blunt-ended or have an overhang.
  • the length of the overhangs may be the same or different for each strand.
  • the RNA of the present invention comprises about 19, 20, 21, or 22 nucleotides which are paired and which have overhangs of from about 1 to about 3, particularly about 2, nucleotides on both 3' ends of the RNA.
  • the 3' overhangs can be stabilized against degradation.
  • the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine 2 nucleotide 3' overhangs by T- deoxythymidine is tolerated and does not affect the efficiency of RNAi.
  • the absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium.
  • siRNA duplex sequences effective for reducing GGT expression include: antisense, 5'-AACCUGACAACCAUGUGUACAC-S' (SEQ ID NO: 1) and sense, 5'-AAGUGUACACAUGGUUGUCAGG-S' (SEQ ID NO: 2), which form a duplex and target bases 582-603 of human GGT mRNA; and antisense, 5'- AAUGCCC ACAGC AUGGGC AUCG-3' (SEQ ID NO: 3), and sense, 5'- AACGAUGCCCAUGCUGUGGGC A-3' (SEQ ID NO: 4), which form a duplex and target bases 722-743 of human GGT mRNA.
  • siRNA sequences are chosen to maximize the uptake of the antisense (guide) strand of the siRNA into RISC and thereby maximize the ability of RISC to target human GGT mRNA for degradation. This can be accomplished by scanning for sequences that have the lowest free energy of binding at the 5 '-terminus of the antisense strand. The lower free energy leads to an enhancement of the unwinding of the 5'- end of the antisense strand of the siRNA duplex, thereby ensuring that the antisense strand will be taken up by RISC and direct the sequence-specific cleavage of the human GGT mRNA.
  • the siRNA or modified siRNA is delivered to the organ in a pharmaceutically acceptable carrier.
  • Additional carrier agents such as liposomes, may be added to the pharmaceutically acceptable carrier.
  • a preferred mode of introduction to the lung is through inhalation in a pharmaceutically acceptable carrier for inhalation therapy.
  • the siRNA is delivered by delivering a vector encoding small hairpin RNA (shRNA) in a pharmaceutically acceptable carrier to the cells in an organ of an individual.
  • shRNA small hairpin RNA
  • the shRNA is converted by the cells after transcription into siRNA capable of targeting, for example, GGT.
  • the vector may be a regulatable vector, such as tetracycline inducible vector.
  • the RNA interfering agents used in the methods described herein are taken up actively by cells in vivo following intravenous injection, e.g., hydrodynamic injection, without the use of a vector, illustrating efficient in vivo delivery of the RNA interfering agents, e.g., the siRNAs used in the methods of the invention.
  • One method to deliver the siRNAs is catheterization of the blood supply vessel of the target organ.
  • RNA interfering agents e.g., the siRNAs or shRNAss uusseedd iinn tthhee methods of the invention
  • a vector e.g., a plasmid or viral vector, e.g., a lentiviral vector.
  • a vector e.g., a plasmid or viral vector, e.g., a lentiviral vector.
  • Such vectors can be used as described, for example, in Xiao-Feng Qin et al. Proc. Natl. Acad. Sci. U.S.A., 100: 183-188.
  • RNA interfering agents e.g., the siRNAs or shRNAs of the invention
  • a basic peptide by conjugating or mixing the RNA interfering agent with a basic peptide, e.g., a fragment of a TAT peptide, mixing with cationic lipids or formulating into particles.
  • the dsRNA such as siRNA or shRNA
  • an inducible vector such as a tetracycline inducible vector.
  • RNA interfering agents e.g., the siRNAs targeting GGT mRNA
  • GGT siRNAs may also be administered in combination with other pharmaceutical agents which are used to treat or prevent diseases or disorders associated with oxidative stress, especially respiratory diseases, and more especially asthma.
  • siRNA molecules can be obtained using a number of techniques known to those of skill in the art.
  • the siRNA molecule can be chemically synthesized or recombinantly produced using methods known in the art, such as using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer (see, e.g., Elbashir, S.M. et al. (2001) Nature 411:494-498; Elbashir, S.M., W. Lendeckel and T. Tuschl (2001) Genes & Development 15:188-200; Harborth, J. et al. (2001) /. Cell Science 114:4557-4565; Masters, J.R.
  • RNA synthesis suppliers include, but not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK).
  • siRNA molecules are not overly difficult to synthesize and are readily provided in a quality suitable for RNAi.
  • dsRNAs can be expressed as stem loop structures encoded by plasmid vectors, retroviruses and lentiviruses (Paddison, PJ. et al. (2002) Genes Dev. 16:948-958; McManus, M.T. et al. (2002) RNA 8:842-850; Paul, CP. et al. (2002) Nat. Biotechnol. 20:505-508; Miyagishi, M. et al. (2002) Nat. Biotechnol. 20:497-500; Sui, G. et al. (2002) Proc. Natl. Acad. ScL, USA 99:5515-5520; Brummelkamp, T. et al.
  • Dicer processes the short hairpin RNA (shRNA) into effective siRNA.
  • the targeted region of the siRNA molecule of the present invention can be selected from a given target gene sequence, e.g., a GGT coding sequence, beginning from about 25 to 50 nucleotides, from about 50 to 75 nucleotides, or from about 75 to 100 nucleotides downstream of the start codon. Nucleotide sequences may contain 5' or 3' UTRs and regions nearby the start codon.
  • One method of designing a siRNA molecule of the present invention involves identifying the 23 nucleotide sequence motif AA(N19)TT (where N can be any nucleotide) and selecting hits with at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% G/C content.
  • the "TT" portion of the sequence is optional.
  • the search may be extended using the motif NA(N21), where N can be any nucleotide.
  • the 3' end of the sense siRNA may be converted to TT to allow for the generation of a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs.
  • the antisense siRNA molecule may then be synthesized as the complement to nucleotide positions 1 to 21 of the 23 nucleotide sequence motif.
  • the use of symmetric 3' TT overhangs may be advantageous to ensure that the small interfering ribonucleoprotein particles (siRNPs) are formed with approximately equal ratios of sense and antisense target RNA-cleaving siRNPs (Elbashir et al. (2001) supra and Elbashir et al. 2001 supra).
  • Methods of delivering RNA interfering agents, e.g., an siRNA, or vectors containing an RNA interfering agent, to the target cells, e.g., cells of the lung or other desired target cells, for uptake include injection of a composition containing the RNA interfering agent, e.g., an siRNA, or directly contacting the cell, e.g., a cell of the lung, with a composition comprising an RNA interfering agent, e.g., an siRNA.
  • RNA interfering agents e.g., an siRNA may be injected directly into any blood vessel, such as vein, artery, venule or arteriole, via, e.g., hydrodynamic injection or catheterization. Administration may be by a single injection or by two or more injections.
  • the RNA interfering agent is delivered in a pharmaceutically acceptable carrier.
  • One or more RNA interfering agents may be used simultaneously.
  • siRNA that targets human GGT is used.
  • the delivery or administration of the siRNA is preferably performed in free form, i.e. without the use of vectors.
  • the direct delivery of siRNA to the lung can be performed by inhalation for example, using an electronebulizer.
  • specific cells are targeted with RNA interference, limiting potential side effects of RNA interference caused by non-specific targeting of RNA interference.
  • the method can use, for example, a complex or a fusion molecule comprising a cell targeting moiety and an RNA interference binding moiety that is used to deliver RNA interference effectively into cells.
  • a complex or a fusion molecule comprising a cell targeting moiety and an RNA interference binding moiety that is used to deliver RNA interference effectively into cells.
  • an antibody-protamine fusion protein when mixed with siRNA, binds siRNA and selectively delivers the siRNA into cells expressing an antigen recognized by the antibody, resulting in silencing of gene expression only in those cells that express the antigen.
  • the siRNA or RNA interference-inducing molecule binding moiety is a protein or a nucleic acid binding domain or fragment of a protein, and the binding moiety is fused to a portion of the targeting moiety.
  • the location of the targeting moiety may be either in the carboxyl-terminal or amino-terminal end of the construct or in the middle of the fusion protein.
  • a viral-mediated delivery mechanism can also be employed to deliver siRNAs to cells in vitro and in vivo as described in Xia, H. et al. (2002) Nat Biotechnol 20(10): 1006). Plasmid- or viral-mediated delivery mechanisms of shRNA may also be employed to deliver shRNAs to cells in vitro and in vivo as described in Rubinson, D. A., et al. ((2003) Nat. Genet. 33:401-406) and Stewart, S.A., et al. ((2003) RNA 9:493-501).
  • RNA interfering agents e.g., the siRNAs or shRNAs
  • the RNA interfering agents can be introduced along with components that perform one or more of the following activities: enhance uptake of the RNA interfering agents, e.g., siRNA, by the cell, e.g., pulmonary or airway epithelial cells, inhibit annealing of single strands, stabilize single strands, or otherwise facilitate delivery to the target cell and increase inhibition of the target gene, e.g., GGT.
  • RNA interfering agents e.g., an siRNA
  • RNA interfering agents can also be introduced into cells via topical application to a mucosal membrane or dermally.
  • Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are also sites where the agents can be introduced.
  • the dose of the particular RNA interfering agent will be in an amount necessary to effect RNA interference, e.g., post translational gene silencing (PTGS), of the particular target gene, thereby leading to inhibition of target gene expression or inhibition of activity or level of the protein encoded by the target gene.
  • RNA interference e.g., post translational gene silencing (PTGS)
  • PTGS post translational gene silencing
  • GGT activity can measured in a number of ways known to those of skill in the art. For example, Han et al. (supra) describe a fluorometric assay for the hydrolytic activity of E. coli GGT. This assay monitors the release of 7-amino- 4-methylcoumarin (AMC) using 0.2 ⁇ M 7-(N- ⁇ -glutamyl-amino)-4-methylcoumarin ( ⁇ -Glu- AMC) as the substrate at 25°C (pH 5.5).
  • AMC 7-amino- 4-methylcoumarin
  • ⁇ -Glu- AMC 7-(N- ⁇ -glutamyl-amino)-4-methylcoumarin
  • Assays are initiated by adding 10 ⁇ l of enzyme solution to 100 mM succcinate-NaOH buffer (pH 5.5) in a total volume of 1 ml containing 100 ⁇ l of ⁇ -Glu-AMC stock solution (2 ⁇ M in water) at 25°C (a final ⁇ -Glu-AMC concentration of 0.2 ⁇ M).
  • the release of AMC is monitored continuously for 10 min, e.g., using a Hitachi F- 2000 spectrophotometer (350 nm excitation, 440 nm emission).
  • the fluorescence intensity is proportional to the concentration of AMC up to 2.0 ⁇ M.
  • the Michaelis constant (K m ) for ⁇ - GIu-AMC was determined under these conditions to be 0.2 ⁇ M.
  • the hydrolytic activity of human GGT is measured under the same conditions, except the final substrate concentration if 4.0 ⁇ M in 100 mM succinate-NaOH buffer.
  • the K m for ⁇ -Glu-AMC has been determined to be 12.6 ⁇ M under these conditions.
  • the inhibition of GGT activity can be measured using a continuous or discontinuous assay method under pseudo-first-order rate conditions.
  • a typical run is as follows: enzyme is added to a preincubated mixture of varying concentrations of an inhibitor and the substrate (final concentration 4.0 ⁇ M ⁇ -Glu-AMC for measurement of human GGT) in 100 mM sodium succinate buffer (pH 5.5) at 25°C. Time-dependent inhibition of the enzyme is followed by continuously monitoring the release of AMC for 10 min.
  • GGT activity can also be monitored by measurement of GGT protein levels, e.g., as described by Williams et al. (supra).
  • Glutathione levels can be measured, where desired or necessary, using methods known to those of skill in the art. Assay kits are also commercially available, for example, from Cayman Chemical Corp. (Ann Arbor, Michigan, USA) and Oxford Biomedical Research, Inc. (Oxford, Michigan, USA).
  • GGT inhibitors as described herein can be tested in vivo for the desired therapeutic or prophylactic activity as well as for determination of therapeutically effective dosage.
  • such compounds can be tested in suitable animal model systems prior to testing in humans, including, but not limited to, rats, mice, chicken, cows, monkeys, rabbits, etc.
  • suitable animal model systems prior to testing in humans, including, but not limited to, rats, mice, chicken, cows, monkeys, rabbits, etc.
  • any animal model system known in the art can be used.
  • IL-13-induced experimental model of asthma is described in detail in the Examples below.
  • Other experimental models of asthma that can be used in assessment of the efficacy of a given GGT inhibition approach can include, for example, an IL-18-induced mouse asthma model (see, e.g., Tsutsui et al., 2004, Immunological Reviews 202: 115-138), an ovalbumin-induced model (see, for example, Ghao et al, 2002, Chin. Med. J. 115: 1470- 1474, and/or Choi et al., 2005 Clin. Exp. Allergy 35: 89-96) and a diisocyanate-induced asthma model (see, e.g., Johnson et al., 2004, Curr. Opin. Allergy Clin. Immunol. 4: 105- 110), among others.
  • Various other models that can be employed are described, for example, in the review by Szeleny, 2004, Inflammation Res. 49: 639-654.
  • compositions inert, pharmaceutically acceptable carriers or excipients used for preparing pharmaceutical compositions of the GGT inhibitors described herein can be either solid or liquid.
  • Solid preparations include powders, tablets, dispersible granules, capsules, cachets and suppositories.
  • the powders and tablets may comprise from about 5 to about 70% active ingredient.
  • Suitable solid carriers are known in the art, e.g., magnesium carbonate, magnesium stearate, talc, sugar, and/or lactose. Tablets, powders, cachets and capsules can be used as solid dosage forms suitable for oral administration.
  • a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted, and the active ingredient is dispersed homogeneously therein as by stirring. The molten homogeneous mixture is then poured into conveniently sized molds, allowed to cool and thereby solidify.
  • Liquid preparations include solutions, suspensions and emulsions. As an example can be mentioned water or water-propylene glycol solutions for parenteral injection. Liquid preparations can also include solutions for intranasal administration. Where direct administration to the lung is desired, aerosol preparations suitable for inhalation are preferred. Aerosol preparations suitable for inhalation can include solutions and solids in powder form, which can be in combination with a pharmaceutically acceptable carrier, such as an inert compressed gas.
  • a pharmaceutically acceptable carrier such as an inert compressed gas.
  • solid preparations which are intended for conversion, shortly before use, to liquid preparations for either oral or parenteral administration.
  • liquid forms include solutions, suspensions and emulsions.
  • the GGT inhibitory agents described herein can also be deliverable transdermally.
  • the transdermal compositions can take the form of creams, lotions, aerosols and/or emulsions and can be included in a transdermal patch of the matrix or reservoir type as are conventional in the art for this purpose.
  • the compounds are administered by inhalation, but parenteral or oral administration can be used where appropriate.
  • the pharmaceutical preparation is in unit dosage form. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component, e.g., an effective amount to achieve the desired purpose.
  • the actual dosage employed may be varied depending upon the requirements of the patient and the severity of the condition being treated. Determination of the proper dosage for a particular situation is within the skill of the art. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small amounts until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired.
  • the amount and frequency of administration of the GGT inhibitory agents will be regulated according to the judgment of the attending clinician (physician) considering such factors as age, condition and size of the patient as well as severity of the disease being treated. Amounts needed to achieve the desired effect, i.e., a "therapeutically effective dose” will vary with these and other factors known to the ordinarily skilled practitioner, but generally range from 0.001 to 5.0 mg of inhibitory agent per kilogram of body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used.
  • compositions containing the GGT inhibitory agent can also be administered in similar or slightly lower dosages relative to therapeutic dosages, and often with lower frequency (illustrative examples include, every other day or even weekly or monthly for a maintenance or preventative regimen, as opposed to, for example, every day for a therapeutic regimen).
  • the frequency of dosages for either therapeutic or maintenance/prophylactic uses will also depend, for example, on the in vivo half-life of the GGT inhibitor used. Thus, more frequent dosing is appropriate where the half-life is shorter, and vice versa.
  • One of skill in the art can measure the in vivo half-life for a given GGT inhibitor.
  • GGT inhibitors can be coupled to agents that increase the in vivo half-life of the agent.
  • polypeptides or other agents can be coupled to a serum protein, e.g., serum albumin, to increase the half-life of the polypeptide.
  • the GGT inhibitory agent or treatment can be administered according to therapeutic protocols well known in the art. It will be apparent to those skilled in the art that the administration of a GGT inhibitory therapy can be varied depending on the disease being treated and the known effects of the agent administered on that disease. Also, in accordance with the knowledge of the skilled clinician, the therapeutic protocols (e.g., dosage amounts and times of administration) can be varied in view of the observed effects of the administered therapeutic agents (e.g., amelioration of asthma symptoms) on the patient, and in view of the observed responses of the disease to the administered therapeutic agents.
  • therapeutic protocols e.g., dosage amounts and times of administration
  • a GGT inhibitory agent can be administered concurrently or sequentially with another agent for the treatment of respiratory disease, e.g., asthma.
  • another agent for the treatment of respiratory disease e.g., asthma.
  • the advantage of a simultaneous or essentially simultaneous administration is well within the determination of the skilled clinician.
  • the GGT inhibitory agent and the other therapeutic agent do not have to be administered in the same pharmaceutical composition, and may, because of different physical and chemical characteristics, have to be administered by different routes.
  • the GGT inhibitory agent may be administered orally to generate and maintain good blood levels thereof, while the other agent may be administered by inhalation, or vice versa.
  • the determination of the mode of administration and the advisability of administration, where possible, in the same pharmaceutical composition, is well within the knowledge of the skilled clinician.
  • the initial administration can be made according to established protocols known in the art, and then, based upon the observed effects, the dosage, modes of administration and times of administration can be modified by the skilled clinician .
  • GGT inhibitory agent and, where desired or necessary, another therapeutic agent, will depend upon the diagnosis of the attending physicians and their judgment of the condition of the patient and the appropriate treatment protocol.
  • the initial order of administration of the GGT inhibitory agent and the other agent may not be important.
  • the GGT inhibitory agent can be administered first, followed by the administration of the other agent; or the other agent can be administered first followed by the administration of the GGT inhibitory agent.
  • This alternate administration can be repeated during a single treatment protocol. The determination of the order of administration, and the number of repetitions of administration of each therapeutic agent during a treatment protocol, is well within the knowledge of the skilled physician after evaluation of the disease being treated and the condition of the patient.
  • the practicing physician can modify each protocol for the administration of a component of the treatment according to the individual patient's needs, as the treatment proceeds.
  • the attending clinician in judging whether treatment is effective at the dosage administered, can consider the general well-being of the patient as well as more definite signs such as relief of clinically accepted disease-related symptoms.
  • the efficacy of treatment can be determined by the skilled clinician.
  • a treatment is considered effective, as the term is used herein, if any one or all of the following symptoms, or other clinically accepted symptoms or markers of respiratory disease are ameliorated, e.g., by at least 10%.
  • Clinical markers of asthma include, for example, airway mucus cell hyperplasia, mucin and gob-5 gene induction, EGF Receptor activation, and airway hyper-reactivity. Methods of measuring these indicators are known to those of skill in the art and/or described herein.
  • Standard measures of asthma include, for example, Forced Expiratory Volume (FEV) as measured by spirometry, bronchial hyperreactivity by methacholine challenge, exhaled nitric oxide level (Fe NO ), serum eosinophil cationic protein, serum atopy markers and chemokine levels (e.g., macrophage-derived chemokine (MDC), thymus and activation regulated chemokine (TARC), eotaxin), and leukotriene B4 measurements in exhaled breath condensate (EBC).
  • FEV Forced Expiratory Volume
  • MeNO exhaled nitric oxide level
  • MDC macrophage-derived chemokine
  • TARC thymus and activation regulated chemokine
  • EBC leukotriene B4 measurements in exhaled breath condensate
  • BAL fluid was assessed for ILl 3 and eotaxin content with a mouse Quantikine® ELISA kit from R&D Systems, employing an internal standard curve according to the manufacturer's instructions.
  • BAL fluid cytokine accumulation was also assayed using the RayBioTM 32-mouse cytokine array from Ray Biotech according to the manufacturer's instructions (Norcorss, GA). Signal intensity was determined by densitometry and values were normalized to internal standards on each blot and then to the saline-treated WT lung as described in ⁇ Zhou, 2005, Infect Immun, 73:935-943 ⁇ . Glutathione, cyst(e)ine and GSNO was assessed by HPLC as described in ⁇ Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776; Fortenberry, 1999, Am J Physiol, 276:L435-L442 ⁇ . Leukotrienes C4 and E4 were assessed with an ELISA kit from Cayman Chemical (Ann Arbor, MI) used according to the manufacturer's instructions.
  • EGF receptor was localized in lung by immunohistochemistry using peptide-specific rabbit antisera from Cell Signaling Technology at a dilution of 1:25 and incubation at 4°C overnight (Catalogue #2232, Beverly, MA). Exposure to 50 mM glycine at pH 3.5, 10 mM EDTA for 10 min at 95°C was used for antigen retrival prior to antibody incubation. Activation of EGF receptor was assessed by immunohistochemistry using a Phospho-specific antisera raised against phosphorylated EGFR from the same company at a dilution of 1:25 and incubation at 4°C overnight (Catalogue #2231).
  • This antibody was raised against a GST fusion protein containing amino acids 1360 through 1439 of mouse versican and recognizes a large molecular weight band by Western blot in aortic and cardiac tissue from mouse and media from mouse smooth muscle cells. Unstained sections were photographed in a Leitz Orthoplan microscope ⁇ Jean JC, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776; Joyce-Brady, 1994, / Biol Chem, 269:14219-14226 ⁇ .
  • Relative quantification was performed using the Taqman Gene Expression Assay Mm00490179_ml to detect all versican splice variants by amplifying across the exon junction of the last C-type lectin domain and the complement control protein module or SUSHI domain in the G3 domain. Gene expression was normalized to eukaryotic 18S rRNA Endogenous Control part no. 4333760 (Applied Biosystems).
  • EGF receptor mRNA induction in response to ILl 3 was assessed by quantitative real time PCR with SYBR green using primers purchased from Superarray Bioscience Corporation (Frederick. MD). Fifty nanograms of cDNA were used in a 50 microliter reaction volume with SYBR Green PCR master mix from Applied Biosciences. Forty cycles of amplification, data acquisition and data analysis were performed on the ABI Prism 7700 Sequence detector (PE Applied Biosystems). EGFR was normalized to GAPDH as this mRNA species remained constant under all conditions.
  • B. IL13 induces an inflammatory response independent of genotype.
  • Bronchalveolar lavage cytokine profile ILl 3 was measured in BAL fluid to ensure equal delivery of cytokine to WT and GGT enul mouse lung.
  • ELISA assay showed barely detectable levels of IL13 in BAL fluid from saline-treated mice but levels around 1000 pg/ml in BAL fluid from IL13-treated mice from both genotypes ( Figure IA).
  • the RayBio mouse cytokine array was used to determine if there were qualitative differences in cytokine profiles induced by ILl 3. This array also showed a similar degree of ILl 3 content in BAL fluid from WT and GGT enul lung treated with IL13.
  • IL6 and IL12 were the major cytokines induced in BAL by ILl 3 treatment and the levels of induction were not different between genotypes (Figure IB).
  • Inflammatory cells in bronchoalveolar lavage Total cell counts in BAL fluid showed the same number of cells in saline-treated WT and GGT enul mice, and a significant 3-4-fold accumulation of cells after ILl 3 treatment in each genotype ( Figure 1C). Differential cell counts were also similar in saline-treated mice from the two genotypes and macrophages predominated. IL-13 treatment was associated with a significant accumulation of eosinophils in WT-BAL fluid (26%) and even moreso in GGT enul BAL fluid (52%, Figure ID).
  • ILl 3 induction of inflammation-associated proteoglycan Versican was examined as a proteoglycan that is known to accumulate in the subepithelial layer of human airways in response to inflammatory mediators associated with asthma ⁇ Huang, 1999 1096 /id, Am J Respir Crit Care Med, 160:725-729 ⁇ . Compared to saline-treated WT lung, versican mRNA levels were the same in saline-treated GGT enul lung, and were induced 5-6 fold in IL13- treated mice from both genotypes (Figure IE). No airway or vascular signal for versican protein was detectable by immunohistochemistry in saline-treated mice of either genotype ( Figure IF). However, an intense signal was present and surrounded airways (Figure IG) and vasculature in IL13-treated mice from each genotype.
  • GGT deficiency attenuates the epithelial cell response to IL13.
  • Muc5ac mRNA accumulated significantly after ILl 3 treatment, but only in WT lung where it was induced 35-fold.
  • Muc5ac mRNA induction was significantly attenuated in IL13-treated GGT enul lung where its level was 4-fold less than that of IL13-treated WT lung ( Figure 2C).
  • Muc 1, Muc 2, Muc 3, Muc 4 and Muc5b were measured in an identical fashion to determine if loss of GGT gene expression itself affected the expression of these other mucin genes under any condition, and to assess the specificity of mucin gene induction following IL13-treatment.
  • the levels of gene expression for these mucins were the same in saline- treated lungs from both genotypes. IL13 treatment did not significantly alter the expression of any of these mucin genes in either genotype.
  • the PCR signal for Muc 3, a gut-specific mucin gene was detected in gut-derived RNA (data not shown), but not lung-derived RNA. This absence serves as a negative control for the pattern of mucin gene expression in the lung under all conditions (Figure 2E).
  • Methacholine challenge Induction of airway hyper-reactivity was assessed by methacholine challenge. Saline-treatment did not induce any change in airway resistance from either genotype when inhalationally challenged with this cholinergic agonist. ILl 3 treatment did elicit a significant and progressive increase in airway resistance starting with the lowest methacholine dose, but only in WT mice. IL13-treated GGT enul mice, challenged with methacholine, were as non-reactive as saline-treated GGT enul mice ( Figure 3).
  • Broncho-alveolar lavage glutathione content Since oxidant stress plays a causative role in asthma, and the asthma phenotype was unexpectedly attenuated in the IL13-treated GGT enul mouse, we redirected our attention lung lining fluid glutathione as we already showed a 2- fold increase in this pool at baseline in GGT enul mice compared to WT controls (REF). This surfeit of extracellular glutathione, bathing the gas exchange surface, may bolster antioxidant defense, despite depletion of the intracellular glutathione ⁇ Jean JC, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776 ⁇ .
  • BAL glutathione content did increase 2.2-fold in IL13-treated WT mice, compared to saline-treated WT mice, but this was not significant.
  • Total cyst(e)ine content did not differ significantly among the three groups of mice, suggesting that lung cysteine supply was able to meet demand.
  • Glutathione content of plasma GGT enul mice also exhibit glutathionemia (5-fold elevation) and normocysteinemia compared to WT controls at baseline ⁇ Harding, 1997 284 /id, J Biol Chem, 272:12560-12567 ⁇ .
  • total glutathione in plasma increased 1.5-fold compared to saline-treated WT mice, but this change was not significant.
  • Total glutathione in plasma of IL13-treated GGT enul mice remained elevated at 4.5-fold showing that the baseline level of glutathionemia was largely maintained despite cytokine treatment.
  • Glutathione-related molecules We also examined BAL fluid for accumulation of glutathione-related molecules, including nitrosoglutathione (GSNO), an endogenous bronchodilator, and leukotrienes C4 and E4, bronchoconstrictors induced during inflammation. There was no significant accumulation of GSNO in either saline-treated or IL- 13 treated mice (data not shown).
  • GSNO nitrosoglutathione
  • GGT deficiency attenuates IL13-induced lung epidermal growth factor receptor activation
  • lung EGFR was examined as its activation depend on oxidant -related mechanisms.
  • EGFR immunohistochemistry Muc5ac gene induction in asthma is mediated by oxidant-dependent mechanisms that activate expression of the EGFR.
  • EGF receptor protein was identified on the apical surface of ciliated airway epithelial cells using peptide- specific antisera and immunohistochemical techniques described in Methods. This pattern was clearly present in saline-treated WT (Fig 5A 4Ox, 5B 10Ox) and GGT enul lung (data not shown) in agreement with that reported by Tyner et al. ⁇ Tyner, 2006 1099 /id, / CHn Invest, 116:309-321 ⁇ .
  • Nrf2 a member of the Cap-n-Collar family of transcription factors, mediates a genetic response to oxidant stress by binding to the antioxidant response element in the upstream regions of an array of antioxidant genes, including genes involved with glutathione homeostasis ⁇ McMahon et al., 2001, Cancer Res. 61: 3299-3307; Cho et al., 2005, Free Radicals in Biol, and Med. 38: 325-343 ⁇ .
  • Nrf2 deficiency eliminates this pattern of antioxidant gene induction and unopposed oxidant stress is associated with increased levels of inflammatory cell influx, mucous cell hyperplasia and airway hyper-reactivity.
  • Oxidant stress is due, in part, to glutathione deficiency as glutathione content fails to increase in the Nrf2 null mouse lung following the onset of asthma.
  • Regulation of glutathione homeostasis appears to be an important component of the response to oxidant stress in this allergen-induced model of inflammatory airway disease ⁇ Rangasamy, 2005, J Exp Med, 202:47-59 ⁇ .
  • GGT is the key ectoenzyme in extracellular glutathione turnover.
  • GGT controls the availability of cysteine, which is transported by glutathione and is the rate-limiting amino acid for intracellular glutathione synthesis ⁇ Harding, 1997 284 /id, J Biol Chem, 272:12560-12567; Lieberman, 1996 427 /id, Proc Natl Acad Sci USA, 93:7923-7926 ⁇ .
  • GGT enzyme activity in the GGT enul mouse impairs glutathione metabolism and causes deficiency of cellular glutathione pools. This is particularly evident in endothelial cells, alveolar macrophages and bronchiolar Clara cells in the GGT enul lung even in normoxia ⁇ Jean, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776 ⁇ .
  • GGT regulates the size and the turnover of extracellular glutathione pools in the plasma ⁇ Harding, 1997, J Biol Chem, 272:12560-12567 ⁇ , in lung lining fluid ⁇ Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776) and in epididymal lining fluid (Hinton, 1991 ⁇ . In the absence of turnover, these extracellular pools of glutathione enlarge.

Landscapes

  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Pulmonology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Emergency Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed herein are methods and compositions for the treatment of diseases or disorders involving disturbances in glutathione (GSH) metabolism and oxidative stress, especially respiratory diseases or disorders, and most especially asthma. In particular embodiments, methods are disclosed for the treatment of respiratory diseases or disorders, involving the step of administering an agent that inhibits gamma glutamyl transpeptidase (GGT) activity in lung and airway lining fluid.

Description

METHODS AND COMPOSITIONS FOR THE TREATMENT OF RESPIRATORY
DISEASE
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims benefit under 35 U. S. C. § 119(e) of the United States Provisional Application No. 60/927,477 filed May 3, 2007, the contents of which are incorporated herein by reference in its entirety.
U.S. GOVERNMENT RIGHTS
This invention was made with Government Support under Contract No. HL47049 awarded by the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION
About 10 million asthmatics live in the USA. Asthma sufferers are subject to acute attacks characterized by increased responsiveness of the tracheobronchial tree to various stimuli, which leads to generalized airway constriction manifested by dyspnea, cough and wheezing. Asthma sufferers often experience acute exacerbations of bronchoconstriction, which may be life-threatening. The degrees of severity of an acute asthma attack have been classified as mild, moderate and severe in NIH Publication No. 97-4051 (April 1997) of the National Heart, Lung and Blood Institute of the National Institutes of Health and these classifications are used herein and NIH Publication No. 97-4051 is incorporated herein by reference.
A patient presenting with severe asthma is treated with a series of drugs including inhaled β2 -agonist and anticholinergic and systemic corticosteroid medications, and is given oxygen to achieve O2 saturation > 90%. Any patient with impending or actual respiratory failure is treated with parenteral β2 -agonist, inhaled anticholinergic and parenteral corticosteroid medications, and if no favorable response is shown, by endotracheal intubation and mechanical ventilation and treatment in an intensive care unit. Annually several thousand patients with severe asthma die.
That oxidant-antioxidant imbalance plays a causative role in asthma is supported by the increased susceptibility of the Nrf2 null mouse to severe airway inflammation and airway hyper-reactivity in an ovalbumin model of experimental asthmajRangasamy, 2005, J Exp Med, 202:47-59}. Both glutathione content and the ratio of GSH/GSSG (redox ratio) increase in the ovalbumin-sensitized lung of normal mice but not in that of Nrf2 null mice. Glutathione is normally abundant in lung cells and in the extracellular lining fluid that bathes the gas exchange surface {Cantin, 1987, J Appl Physiol, 63:152-57}. Extracellular glutathione is metabolized by the enzyme gamma- glutamyl transferase (GGT), which is present in the lung lining fluid { Joyce-Brady, 1994, / Biol Chem, 269:14219-14226}. In the absence of GGT, extracellular pools of glutathione in the blood, the urine {Harding, 1997, / Biol Chem, 272:12560-12567; Lieberman, 1996, Proc Natl Acad Sci USA, 93:7923-7926} and the lung lining fluid{Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776} enlarge due to decreased turnover. Lack of catabolism, however, leads to depletion of cellular glutathione since cysteine availability, derived from glutathione breakdown, becomes limiting for intracellular glutathione synthesis {Lieberman, 1996, Proc Natl Acad Sci USA, 93:7923-7926}. Cellular glutathione deficiency causes oxidant stress, which is evident in the GGT deficient GGTenul mouse lung in normoxia and hyperoxia {Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776}. The observed oxidant stress in GGT deficient GGTenul mice was anticipated to render these animals more susceptible to asthma than wild type mice.
SUMMARY OF THE INVENTION
Disclosed herein are methods and compositions for the treatment of diseases or disorders involving disturbances in glutathione (GSH) metabolism and oxidative stress, especially respiratory diseases or disorders, and most especially asthma.
Methods are disclosed for the treatment of respiratory diseases or disorders, involving the step of administering an agent that inhibits gamma glutamyl transpeptidase (GGT) activity in lung and airway lining fluid. While not wishing to be bound by theory, it is believed that inhibition of GGT results in an increase in extracellular GSH that provides a buffering effect against oxidative stress effects induced by inflammatory responses in airways and the lung. A GGT inhibiting agent can be administered alone or in conjunction with other agents for the treatment of respiratory disorders. Compositions disclosed herein include inhibitors of GGT in combination with other agents for the treatment of respiratory disorders.
One embodiment disclosed herein provides a method of treating a respiratory disorder, the method comprising administering to an individual in need of such treatment an inhibitor of gamma-glutamyl transpeptidase (GGT). In one embodiment, the respiratory disorder is asthma.
In another embodiment, the inhibitor is selected from the group consisting of : an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin. In one embodiment, the small molecule is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L- methionine sulfoxide, among others. In one embodiment, the gamma phosphono diester analog of glutamate is selected from the group consisting of 2-(N- benzyloxycarbonylamino)-4-phosphonobutanoic acid, benzyl 2-(N- benzyloxycarboxylamino)-4-phosphonobutanoate, benzyl 2-(N-benzyloxycarbonylamino)-4- (dichlorophosphono)butanoate, benzyl 2-(N- benzyloxycarboxylamino)-4-[4- methoxyphenyl(methyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarboxylamino)-4- [methyl(4-methylphenyl)phosphono]butanoate, benzyl2-(N-4- nitrobenzyloxycarbonylamino)-4-[methyl(phenyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarbonylamino)-4-[4-chlorophenyl(methyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarbonylamino)-4-[methyl(4-trifluoromnethylphenyl)phosphono]butanoate, benzyl 2-(N-benzyloxycarbonylamino)-4-[4-cyanophenyl(methyl)phosphono]butanoate; benzyl 2- (N-benzyloxycarbonylamino)-4-[methyl(4-nitrophenyl)phosphono]butanoate, benzyl 2-(N- benzyloxycarbonylamino)-4-[methyl(4-methylumbelliferyl)phosphono]butanoate; N-(2- hydroxybutanoyl)glycine benzyl ester, benzy,2-(N-benzyloxycarbonylamino)-4-{ 1-[N- (benzyloxycarbonylmethyl)carbamoyl]propyl(phenyl)phosphono jbutanoate, Benzyl 2-(N- benzyloxycarbonylamino)-4-{ [3-(benzyloxycarbonylmethyl)phenyl] (methyl)phosphono}butanoate, Benzyl 2-(N-benzyloxycarbonylamino)-4-{ [4- (benzyloxycarbonylmethyl)phenyl](methyl)phosphono}butanoate, 2-Amino-4-[(4- methoxyphenyl)(methyl)phosphono]-butanoic Acid, 2-Amino-4-[methyl(4- methylphenyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(phenyl)phosphono]butanoic Acid, 2-Amino-4-[4-chlorophenyl(methyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- trifluoromethylphenyl)phosphono]-butanoic Acid, 2-Amino-4-[4- cyanophenyl(methyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- nitrophenyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- methylumbelliferyl)phosphono]butanoic Acid, 2-Amino-4-{ l-[N- (carboxymethy^carbamoy^propy^pheny^-phosphonojbutanoic Acid, 2-Amino-4-{ [3- (carboxymethyl)phenyl](methyl)phosphono}-butanoic Acid, and 2-Amino-4-{ [4- (carboxymethyl)phenyl](methyl)phosphono}-butanoic Acid or a pharmaceutically acceptable salt or ester of any of these compounds. In one embodiment, the gamma phosphono diester analog of glutamate is 2-amino-4-[methylumbelliferyl)phosphono]butanoic acid, 2-Amino-4- { [3-(carboxymethyl)phenyl](methyl)phosphono}-butanoic acid or a pharmaceutically acceptable salt or ester thereof.
In another embodiment, the nucleic acid comprises an RNAi agent that directs the cleavage of GGT mRNA.
In another embodiment, the inhibitor is administered in inhaled form.
In another embodiment, the inhibitor is administered in combination with inhaled glutathione.
In another embodiment, the inhibitor is administered in combination with a different drug for treatment of the respiratory disorder. In one embodiment, the different drug is selected from the group consisting of: zafirlukast, fluticasone propionate, salmeterol, flunisolide, metaproteranol sulfate, triamcinalone acetonide, beclomethasone, trebutaline sulfate, formoterol, cromolyn sodium, methylprednisone, prednisolone sodium phosphate acetate, albuterol sulfate, budesonide, salmeterol xinafoate, montelukast sodium, theophylline, levalbuterol hydrochloride and zileuton.
Also encompassed is a pharmaceutical composition comprising a GGT inhibitor plus another compound having efficacy against an indicator of asthma, and a pharmaceutically acceptable excipient. In one embodiment, the inhibitor is selected from the group consisting of: an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin. In another embodiment, the GGT inhibitor is a gamma phosphono diester analog of glutamate. In a preferred embodiment, the gamma phosphono diester analog of glutamate is 2-amino-4- [methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4-{ [3- (carboxymethyl)phenyl] (methyl)phosphono } -butanoic acid.
Further encompassed is the use of an inhibitor of GGT for the treatment of a respiratory disorder, including, but not limited to asthma. In one embodiment of this use, the GGT inhibitor is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin. In another embodiment of this use, the small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide. In another embodiment of this use, the small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate. In a preferred embodiment, the gamma phosphono diester analog of glutamate is 2-amino-4- [methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4-{ [3- (carboxymethyl)phenyl] (methyl)phosphono } -butanoic acid.
Further encompassed is the use of an inhibitor of GGT in the preparation of a medicament for the treatment of a respiratory disorder including, but not limited to asthma. In one embodiment of this use, the GGT inhibitor is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin. In another embodiment of this use, the small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide. In another embodiment of this use, the small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate. In a preferred embodiment, the gamma phosphono diester analog of glutamate is 2-amino-4-[methylumbelliferyl)phosphono]butanoic acid or 2-Amino-4-{ [3- (carboxymethyl)phenyl] (methyl)phosphono } -butanoic acid.
Definitions:
As used herein, the term "respiratory disorder" refers to a disease or disorder affecting the lung and airways, and more particularly to diseases or disorders that involve oxidant stress and impaired function of the airway. "Respiratory disorders" include, but are not limited to, e.g., asthma, pulmonary fibrosis, respiratory tract infection, acute respiratory distress syndrome and oxidant-mediated acute lung injury. Respiratory disorders can additionally include lung cancer, chronic obstructive pulmonary disease (COPD), chronic bronchitis and emphysema.
"Treatment" of a respiratory disorder as referred to herein refers to therapeutic intervention that stabilizes or improves the function of the lung or the airway. That is, "treatment" is oriented to the function of the respiratory tract. A therapeutic approach that stabilizes or improves the function of the lung or the airway by at least 10%, and preferably by at least 20%, 30%, 40%, 50%, 75%, 90%, 100% or more, e.g., 2-fold, 5-fold, 10-fold or more, up to and including full function, relative to such function prior to such therapy need not cure or directly impact the underlying cause of the respiratory disease or disorder to be considered effective treatment. It is particularly noted that a "treatment" as the term is used herein can stabilize or improve respiratory function without necessarily, for example, killing an infectious agent or killing a tumor.
As used herein, the phrase "indicator of asthma" refers to a clinically accepted, measurable, indicium of asthma. Measurable indicia of asthma include, as non-limiting examples, airway hyper-responsiveness, e.g., bronchial hyperreactivity by methacholine challenge, changes in Forced Expiratory Volume as measured by spirometry, exhaled nitric oxide level, serum eosinophil cationic protein, serum atopy markers and chemokine levels (e.g., macrophage-derived chemokine (MDC), thymus and activation regulated chemokine (TARC), eotaxin), and leukotriene B4 levels in exhaled breath condensate.
As used herein, the term "inhibitor of gamma-glutamyl transpeptidase (GGT)" refers to an agent that reduces the activity of human gamma glutamyl transpeptidase by at least 20%, and preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more, up to and including 100% (complete inhibition), relative to the enzyme activity in the absence of the agent. Thus, GGT activity is "inhibited" if it is reduced by at least 20%, and preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more, up to and including 100% (complete inhibition) relative to activity in the absence of an inhibitor or inhibitory treatment. In this context, GGT activity can be measured in any manner known in the art. For the avoidance of doubt, one way of measuring inhibition of GGT is that described by Han et al. (2007), Biochemistry 46: 1432-1447, which is incorporated herein by reference. This assay is also described in further detail herein below. An inhibitor of GGT as the term is used herein can function in a competitive or noncompetitive manner, and can function, in one embodiment, by interfering with the expression of the GGT polypeptide. Various types of inhibitors useful in the methods and compositions disclosed herein are described in further detail herein below. In one embodiment, a GGT inhibitor as the term is used herein does not include acivicin.
Also encompassed by the compositions and methods described herein are the use of an inhibitor of GGT in the preparation of a medicament for the treatment of a respiratory disease or disorder, including, but not limited to asthma. In this aspect, as in others described herein, the inhibitor can be selected from the group consisting of : an antibody or antigen- binding fragment thereof that specifically binds GGT; a nucleic acid; and a small molecule inhibitor of GGT, wherein the small molecule inhibitor does not include acivicin. The small molecule can be selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide. In a preferred embodiment, the small molecule is a gamma phosphono diester analog of glutamate.
As used herein, the term "in combination with" refers to administration of a GGT inhibitor in conjunction with another therapeutic agent, e.g., glutathione or another respiratory therapeutic agent. The administration of a GGT inhibitor "in combination with" such other agent encompasses not only the concurrent co-administration of the GGT inhibitor and the other agent, but also administration of the GGT inhibitor prior to (e.g., from 1 day to a minute or less prior to) or following (e.g., from 1 day to a minute or less following) administration of the other agent. The agent administered "in combination with" the GGT inhibitor can be administered by the same or different pathway as the GGT inhibitor, e.g., systemically, such as orally or by IV injection, or locally, as by inhalation or direct injection or instillation to a target site.
As used herein, the term "specifically binds" refers to binding with a dissociation constant (Kd) of 100 μM or lower, e.g., 75 μM, 60 μM, 50 μM, 40 μM, 30 μM, 20 μM, 10 μM, 1 μM, 100 nM, 50 nM, 10 nM, 1 nM or less.
As used herein, the term "small molecule" refers to a chemical agent including, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
An "RNA interfering agent" as used herein, is defined as any agent which interferes with or inhibits expression of a target gene or genomic sequence by RNA interference (RNAi). Such RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target gene or genomic sequence, or a fragment thereof, short interfering RNA (siRNA), short hairpin or small hairpin RNA (shRNA), and small molecules which interfere with or inhibit expression of a target gene by RNA interference (RNAi).
It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
As used herein and in the claims, the singular forms include the plural reference and vice versa unless the context clearly indicates otherwise. Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" when used in connection with percentages may mean ±1%. Further, where ranges of values are cited, it should be understood that the range includes any integer value within the range as if it were explicitly recited, and that sub-ranges within the range are likewise included as if they were specifically recited.
All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents. Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques of the present application are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, (2d ed., Cold Spring Harbor Lab. Press, Cold Spring Harbor, N.Y., 1989) and Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIO. (Greene Pub. Assoc, 1992). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Standard techniques can be used for chemical syntheses, chemical analyses, formulations, and preparations.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains. Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are described herein. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Lung inflammatory milieu induced by IL13. (IA) Compared to saline-treated lung, ILl 3 accumulated in BAL fluid by 200-fold in both wild type (WT) and GGTenul mice treated with this cytokine (n=4 for each). (IB) The RayBio array for 32 different mouse cytokines showed a similar profile and level of cytokine induction by ILl 3 in both WT and GGχ enui mice IL6 was induced on average 15-fold (ANOVA P = 0.017) and IL12 by 5-fold
(ANOVA P = 0.014). This array also detected the increase in IL13 content (ANOVA P = 0.016). Asterisks mark significant differences from saline-treated WT mice by post-hoc analysis (P<0.05). (1C) All cells in BAL fluid were counted on a hemocytometer and normalized to the average number of cells from the saline-treated WT lung (6 x 105 cells/ml). IL13-treated WT and GGTenul mouse BAL fluid exhibited a significant and similar 3-fold increase in cell number compared to that from saline-treated mice (ANOVA P=0.0006). Asterisks mark significant differences from saline-treated WT mice by post-hoc analysis (P<0.05). (ID) Cytospin preparations were prepared from BAL fluid, stained with Diff-Quik and counted for cell differentials. Macrophages predominated in the BAL fluid in saline- treated mice (n= 4) from both genotypes. Following ILl 3 treatment, there was a significant decline in the % macrophages (ANOVA P=O.000005), increase in the % of eosinophils (ANOVA P=0.000006) but no change in the % of lymphocytes for each genotype. Eosinophils accumulated to a greater degree in BAL fluid from IL13-treated GGTenul versus WT mice (n=7 per group). Asterisks mark significant differences from saline-treated WT mice and cross marks significant difference between IL13-treated mice by post-hoc analysis (P<0.05). (IE) The level of versican mRNA was induced 6-fold in WT lung following IL13 treatment. For GGTenul lung, the level of versican mRNA was the same as that of saline- treated WT lung, and following ILl 3 treatment it was induced to a similar level as that of IL13-treated WT lung. (IF) No versican protein signal was detected in saline-treated lung by immunohistochemistry in either genotype. Photomicropgraph shows saline-treated WT lung at 4Ox magnification. (IG) An intense signal for versican protein was detected in the basement membranes surrounding airways following ILl 3 treatment in both genotypes. Photomicrograph shows airway from IL13-treated WT lung at 4Ox magnification.
Figure 2. IL13 induces lung mucous accumulation plus mucin and mucin-related gene expression. (2A) An intense signal for periodic acid Schiff (PAS) positive material was present in airway epithelial cells from IL13-treated WT mice. (2B) Few cells exhibited any PAS positive material in GGTenul lung and the signal was sparse. No PAS positive cells were identified in saline-treated lung from either genotype (data not shown). Both photomicrographs are the same magnification (40X) and show a terminal bronchus. (2C) Muc 5ac gene expression was assayed by quantitative RT-PCR as described in Methods. Muc 5ac mRNA was significantly induced following ILl 3 treatment but only in WT lung (35-fold, ANOVA P<106, n = 6), as induction was 4-fold less in the GGTenul lung (n=6). (2D) The mRNA level for the chloride channel 3 gene (CaCB, also known as Gob-5), was significantly induced following IL13 treatment but only in WT lung (281-fold, ANOVA P=0.002, n = 6), as induction was 4-fold less in the GGTenul lung (n=7). Asterisk marks significance difference by post-hoc analysis. (2E) Neither ILl 3 treatment, nor GGT deficiency, affected the level of mRNA expression for Muc 1, Muc 2, Muc 3, Muc 4 or Muc 5b to any significant degree. Muc 3 expression is gut-specific and served as a negative control for this mucin gene analysis.
Figure 3. Airway hyper-reactivity assay. Saline-treated and IL13-treated WT and GGTenul mice were challenged with methacholine as described herein below. Airway resistance in cm H20/ml/sec is plotted on the ordinate against the two genotypes and two treatment groups exposed to increasing doses of methacholine from one representative experiment. Asterisks denote significant increases in resistance over saline treated WT lung only in IL13-treated WT mice.
Figure 4. Glutathione and cysteine content in BAL Fluid and Plasma. Glutathione, cysteine and protein were assayed as described in Methods. For BAL fluid, total glutathione content was insignificantly elevated by only 2-fold in IL13-treated WT mice (n=4), compared to saline-treated WT mice (n=3), but significantly elevated (see asterisk) by 10-fold in IL13- treated GGTenul mice (n=4, ANOVA P=0.03), which represented a 5-fold elevation over the IL13-treated WT mice. Total non-protein cyst(e)ine content was similar in all three groups. Total protein content was significantly higher by about 35-fold in IL13-treated WT and GGT enui mice compared to saline treated WT mice (ANOVA P=0.0004), but total protein content did not differ between IL13-treated genotypes. For plasma, total glutathione content was not different between saline-treated and IL13-treated WT mice but was significantly elevated by 4.5-fold in IL13-treated GGTenul mice. Plasma cyst(e)ine was similar in saline- treated and IL13-treated WT mice and decreased in IL13-treated GGTenul mice (ANOVA P=0.058). Total protein was elevated significantly by 2-fold in IL13-treated mice, but did differ between genotypes (ANOVA P=0.003). Asterisks mark specific differences at P<0.05 by post hoc analysis.
Figure 5. Epidermal growth factor receptor (EGFR) analysis. Native EGF receptor expression was localized by immunohistochemistry using peptide- specific antisera against EGFR as described in Methods. The photomicrograph shows the presence of signal on ciliated airway epithelial cells in saline-treated WT lung at 4OX (8A), and 10Ox (8B). No signal was evident in (8C) using non-immune rabbit IgG as a negative control (4Ox). EGFR signal was abolished in (8D) by co-incubation with the peptide antigen in a competition assay (4Ox). The same results were evident in saline-treated GGTenul lung (data not shown). Activated EGF receptor was localized using peptide-specific antisera against phosphorylated EGFR as described in Methods. Signal was identified in nuclei of airway epithelial cells only from IL13-treated WT lung (8E, 4Ox). Arrow marks nucleus with signal present among surrounding nuclei with an absence of signal. No signal was evident using non-immune rabbit IgG as a negative control (8F, 4Ox). This nuclear signal was abolished in (8G, 4Ox) by co- incubation with the peptide antigen in a competition assay. (H) EGF receptor mRNA levels were assayed by quantitative RT-PCT as described in Methods. Compared to its saline- treated control, lung EGF receptor mRNA was significantly induced 2-fold in IL13-treated WT lung (ANOVA P=OOl, n=3), but did not change in IL13-treated GGTenul lung.
Figure 6. Inhibition of lung lining fluid GGT attenuates airway hyper-reactivity in wild type mice. (6A) Wild type mice were treated with intratracheal acivicin (1 or 2.5 uM) and GGT specific activity was assessed over time in lung lining fluid obtained by bronchoalveolar lavage. (6B) Airway hyper-reactivity in response to methacholine was assessed in wild type mice were treated with intratracheal saline (n=6), saline + acivicin (n=10), IL13 (n=5) or IL13 + acivicin (n=4) as described in Methods. Airway hyperreactivity increased only in IL13-treated mice (ANOVA P<0.05) and asterisks denote significant increase in resistance compared to saline-treated controls by post-hoc analysis.
DESCRIPTION
The invention relates to methods and compositions for the treatment of respiratory diseases or disorders, and particularly those involving oxidative stress. Asthma was long thought to be characterized only by bronchospasm, but then it was learned that inflammation precedes bronchospasm, rendering the airway hyper-responsive to stimuli that then trigger the bronchospasm. The treatment of asthma has therefore focused on the use of inhaled corticosteroid drugs to treat the inflammation, often in conjunction with inhaled beta-2 agonist bronchodilators for the relief of acute symptoms. Inflammation, however, induces oxidative stress through increases in reactive oxygen species. Oxidative stress is emerging as a unifying factor in different respiratory diseases in addition to asthma, including but not limited to acute respiratory distress syndrome (ARDS), pulmonary fibrosis, emphysema and lung cancer. Treatment or prevention of oxidative stress, apart from treatment of the inflammation itself, provides another avenue for the treatment of such respiratory diseases. This approach therefore provides a new avenue for the treatment or prevention of asthma and other respiratory diseases or disorders involving oxidative stress.
Specifically, treatments which increase the anti-oxidant pool in lung lining fluid can reduce the oxidative state and treat symptoms of the disease or disorder.
GGT is the key enzyme in glutathione metabolism. GGTenul mice, deficient in γ- glutamyl transferase (GGT) and unable to metabolize extracellular glutathione, develop cellular glutathione deficiency and oxidant stress. Oxidant stress causes asthma. The inventors suspected that deficiency of GGT would accentuate asthma in GGT-deficient mice and used IL13-induced asthma to compare the experimental phenotype in GGTenul mice compared to Wild Type control mice. Both genotypes developed a similar lung inflammatory milieu. However, GGTenul lung resisted ILl 3 induced mucous cell hyperplasia, mucin and mucin-related gene expression, and airway hyperreactivity that developed in the Wild Type lung. GGT is an ectoenzyme and resides in lung lining fluid normally to turnover the extracellular glutathione pool. This pool actually increases in size in GGT deficient GGTenul mouse lung, and after IL 13 treatment, the pool size increases even further to approximately 10-fold over that in Wild Type lung. The augmented extracellular glutathione pool buffered inflammation-associated reactive oxygen species in the GGT deficient mouse lung, as evidenced by a lack of epithelial cell EGFR activation, a marker for oxidative stress. When lung lining fluid GGT activity is inhibited with the chemical GGT inhibitor acivicin in Wild Type lung, IL- 13 induced airway hyperreactivity is also alleviated. These data indicate that lung lining fluid glutathione protects against asthma despite cellular glutathione deficiency. Inhibiting GGT activity in this pool represents a useful therapeutic strategy to treat asthma.
The discovery that increasing the extracellular glutathione pool protects against asthma stems from reports regarding Nrf2 knockout mice. Nrf2 knockout mice have an increased susceptibility to severe airway inflammation and airway hyper-reactivity in the ovalbumin model of experimental asthma. Nrf2 regulates transcription of several antioxidant genes, but part of the imbalance involves glutathione, because lung glutathione content and redox ratio (GSH/GSSG) increased only in ovalbumin- sensitized WT mice. Normally, lung glutathione is abundant in cells and extracellular lining fluid bathing the gas exchange surface. Extracellular glutathione is metabolized by gamma-glutamyl transferase (GGT, EC 2.3.2.2), which is present in lung lining fluid. With GGT deficiency, decreased turnover causes extracellular glutathione pools in lung lining fluid to enlarge, but also depletes cellular glutathione because cysteine availability, derived from glutathione breakdown, limits intracellular glutathione synthesis. Cellular glutathione deficiency causes oxidant stress, which is evident in GGTenul lung in normoxia and hyperoxia. To explore the consequences of this stress, experimental asthma was induced with IL13. Analogous to the airway hypersensitivity observed in Nrf2 knockout mice, it was anticipated that cellular glutathione deficiency would increase asthma susceptibility in GGTenul mice.
It was hypothesized that a deficiency of cellular glutathione pools would increase oxidant stress and accentuate the asthma phenotype in GGTenul lung following ILl 3 treatment. However, initial experiments surprisingly showed exactly the opposite - that the hyper- sensitivity phenotype is attenuated in GGTenul mice, despite equal IL13 delivery, cytokine activation, inflammatory cell and matrix-associated protein accumulation to levels seen in WT controls.
Differential cell counts showed an even greater percentage of eosinophils in GGTenul lung after ILl 3 treatment. Eosinophil accumulation is a marker of an inflammatory response. Eosinophils are an important source of reactive oxygen species, and are believed to contribute to the onset of the asthma phenotype. Given the pronounced eosinophil response in the GGTenul mice it is even more surprising that the asthmatic response was attenuated in these animals. The attenuated asthmatic response was evident as decreased levels of airway mucous cell hyperplasia, mucin and gob-5 gene induction, EGF receptor activation and airway hyper-reactivity. GGT deficiency therefore protected the GGTenul mouse lung against this experimental model of asthma.
The generality of GGT inhibition in protection from asthma was tested by inhibition of lung lining fluid GGT activity in Wild Type mice. As discussed further in the Examples herein, treatment of Wild Type mice with the GGT inhibitor acivicin similarly protected against IL- 13 induced asthma. Therefore, GGT inhibition provides an approach for the treatment of asthma, and also of other respiratory diseases or disorders involving oxidative stress. That is, one can treat asthma or other respiratory diseases or disorders involving oxidative stress by administering a GGT inhibitor to an individual in need of such treatment. It is further contemplated that GGT inhibition can similarly treat non-respiratory diseases or disorders that involve oxidative stress. This could have wide ranging applicability in the treatment of inflammatory diseases or disorders, which are characterized by an oxidative environment. Reduction in GGT activity could inhibit glutathione turnover in those situations as well, thereby increasing extracellular glutathione and protecting tissues from damage due to the inflammatory response. Such treatment could be used in place of or, in combination with, anti-inflammatory drugs, such as corticosteroids or in combination with other anti-asthma medications. Other anti-asthma medications include, for example, zafirlukast, fluticasone propionate, salmeterol, flunisolide, metaproteranol sulfate, triamcinalone acetonide, beclomethasone, trebutaline sulfate, formoterol, cromolyn sodium, methylprednisone, prednisolone sodium phosphate acetate, albuterol sulfate, budesonide, salmeterol xinafoate, montelukast sodium, theophylline, levalbuterol hydrochloride and zileuton.
The possibility was considered that lack of IL13-induced airway hyper-reactivity in GGTenul lung could involve accumulation of glutathione-related molecules such as the nitrosothiol GSNO, a recently described endogenous bronchodilator. Interestingly this GSNO role was identified by its accumulation following loss of the metabolic enzyme S- nitrosoglutathione reductase. However, there were no differences detected in GSNO content between saline-treated or IL13-treated broncho alveolar lavage (BAL) fluid from either genotype. Enhanced glutathione content in lung lining fluid itself could explain the lack of airway hyper-reactivity in GGTenul lung, as this thiol appears to affect airway tone as an antioxidant, independent of NO or GSNO activity.
It was also considered whether GGT could be involved in production of the bronchoconstrictive cysteinyl leukotriene LTD4. However, recent data suggests that metabolism of LTC4 to LTD4 is regulated by gamma- glutamyl teukotrienase (GGL), a GGT- related enzyme encoded by a separate gene. Loss of GGL activity, not GGT activity, exacerbates airway hyper-reactivity as bronchoconstrictive LTC4 accumulates from lack of metabolism to LTD4. Attenuation of IL- 13 induced airway hyper-reactivity in GGTenul lung is unlikely to be related to altered cysteinyl leukotnene metabolism, and no significant differences in leukotriene accumulation in BAL fluid of WT or GGTenul mice were found regardless of saline or IL 13 treatment. The data further indicate that GGT functions in mouse lung to selectively metabolize glutathione.
While not wishing to be bound by a specific mechanism, the results of studies in Wild Type and GGT deficient mice support enhanced antioxidant activity in the extracellular glutathione pool as a mechanism for the attenuation of IL13-mediated asthma in GGTenul lung. This extracellular pool does not affect the inflammatory response. Rather it protects epithelial cells, particularly in airways, by buffering the oxidizing milieu created by acute inflammation. These data implicate epithelial cells in the process that leads to airway hyperreactivity since the absence of EGFR activation correlates with the absence of airway hyperreactivity. Lung lining fluid glutathione deficiency has been augmented by inhalation of glutathione aerosols and this technique has been proposed as treatment for diseases associated with glutathione deficiency. Pharmacological means to manipulate lung lining fluid GGT activity also enhance extra-cellular glutathione levels in the presence of oxidant stress associated with inflammation and are demonstrated herein to prevent asthma in an accepted animal model.
Inhibitors of GGT:
GGT inhibition can be effected by any of a number of different approaches, each of which is encompassed by the treatment methods described herein. For example, small molecule inhibitors of GGT or antibodies or antibody fragments that inhibit GGT function can be administered. Alternatively, approaches that down-regulate the expression of GGT polypeptide in the lung can also be used. Inhibitors used in the methods and compositions described herein are preferably specific inhibitors of GGT activity. By "specific" in this context is meant that the subject inhibitor has greater inhibitory activity, by at least 50%, and preferably by at least 75% or 100% or more, including, for example, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. It is most preferred that the subject inhibitor have no inhibitory activity against other known enzymes at the inhibitor concentrations at which GGT is at least 95% inhibited.
Small Molecule or Chemical Inhibitors: Small molecule inhibitors of GGT activity are known in the art. For example, the well known inhibitor acivicin (L-(aS,5S)- α-amino-3- chloro-4,5-dihydro-5-isoxazoleacetic acid; also known as AT- 125 and U-42126) is demonstrated herein to inhibit GGT in the lung and to reduce IL-13-induced asthma. In one embodiment of the methods and compositions described herein, the inhibitor is not acivicin. However, modified forms of acivicin having GGT-inhibiting activity, but, for example, reduced CNS disturbing effects, are specifically contemplated as useful in the methods described herein. Such modified forms of this, or any other known GGT inhibitory compound can be designed by one of skill in the art and tested for GGT inhibition and/or treatment of respiratory disease using methods known in the art or described herein.
Further small molecule inhibitors of GGT include, for example, those described by Anderson and Meister (1986, Proc. Natl. Acad. Sci. U.S.A. 83: 5-29-5032), which is incorporated herein by reference. These include, for example, L-g-glutamyl-(o- carboxy)phenylhydrazide and other hydrazides, as well as 6-diazo-5-oxo-L-norleucine. Derivatives of these molecules which retain GGT inhibitory activity are further contemplated herein and can be designed and tested by those of skill in the art.
Small molecule inhibitors of GGT further include those described by Lherbet and Keillor (2004, Org. Biomol. Chem. 2: 238-245), which is incorporated herein by reference. The reference teaches that γ-glutamyl derivatives containing a sulfoxide moiety at the δ position are a class of GGT inhibitors. In particular, the compound 2-amino-4-[2- (carboxymethylcarbamoyl)ethylsuylfinyl] -butyric acid (referred to therein as Compound 16) is particularly potent, with a K1 value of 53+3 micromolar. Derivatives of these molecules which retain GGT inhibitory activity are further contemplated herein and can be designed and tested by those of skill in the art.
A class of γ-phosphono diester glutamate analogues has recently been described as novel transition- state mimic GGT inhibitors (Han et al., Biochemistry (2007) 46: 1432-1447, incorporated herein by reference) that strongly inhibit both human and E. coli GGT, and some are even more potent than the classical inhibitor acivicin. The electrophilic phosphonate diesters described were shown to be irreversible inhibitors of GGT. While mechanism should not be seen as limiting, it is believed that these compounds inhibit the enzyme by phosphonylating the catalytic Thr residue. Each of the inhibitors taught in the Han et al. reference is specifically contemplated for use in the methods and compositions described herein for the treatment of respiratory diseases or disorders or for the treatment of other diseases or disorders involving an oxidative stress component. In particular, the compound referred to therein as "compound 3," 2-amino-4-
[methylumbelliferyl)phosphono]butanoic acid, has 6000X higher activity toward human GGT relative to acivicin. Other phosphonate diester-based GGT inhibitors derived from the teachings of the Han et al. reference would also be expected to be useful in the methods and compositions described herein. The GGT inhibitory activity of a given small molecule can be assessed using methods known in the art or described herein.
Pharmaceutically acceptable salts or esters of any small molecule inhibitor of GGT that retain GGT inhibitory activity (i.e., retains at least 80% of the activity of the free acid form) are specifically contemplated for use in the methods described herein and can be prepared by one of ordinary skill in the art.
Antibody Inhibitors of GGT: Antibodies that specifically bind GGT can be used for the inhibition of the enzyme in vivo. It is noted that where extracellular GGT appears to be an important target for GGT inhibition in the lung, problems frequently associated with the delivery of antibodies and other relatively large macromolecules across membranes do not present an issue. Antibodies to GGT can be raised by one of skill in the art using well known methods. The GGT inhibitory activity of a given antibody can be assessed using methods known in the art or described herein. The catalytic site of the GGT enzyme has been characterized (see, e.g., Han et al., supra, and references therein). Antibodies that recognize and bind to the catalytic site of the enzyme can therefore be generated through the selection and use of GGT fragments that retain the active site topology for immunization.
Antibody inhibitors of GGT can include polyclonal and monoclonal antibodies and antigen-binding derivatives or fragments thereof. Well known antigen binding fragments include, for example, single domain antibodies (dAbs; which consist essentially of single VL or VH antibody domains), Fv fragment, including single chain Fv fragment (scFv), Fab fragment, and F(ab')2 fragment. Methods for the construction of such antibody molecules are well known in the art.
Nucleic Acid Inhibitors of GGT Expression: Extracellular GGT can be reduced by inhibition of the expression of GGT polypeptide. A powerful approach for inhibiting the expression of selected target polypeptides is RNA interference or RNAi. RNAi uses small interfering RNA (siRNA) duplexes that target the messenger RNA encoding the target polypeptide for selective degradation. siRNA-dependent post-transcriptional silencing of gene expression involves cutting the target messenger RNA molecule at a site guided by the siRNA.
"RNA interference (RNAi)" is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target gene results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene {see Coburn, G. and Cullen, B. (2002) /. of Virology 76(18):9225), thereby inhibiting expression of the target gene. In one embodiment, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRN A- specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double- stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex (termed "RNA induced silencing complex," or "RISC") that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target genes. As used herein, "inhibition of target gene expression" includes any decrease in expression or protein activity or level of the target gene or protein encoded by the target gene as compared to a situation wherein no RNA interference has been induced. The decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target gene or the activity or level of the protein encoded by a target gene which has not been targeted by an RNA interfering agent.
"Short interfering RNA" (siRNA), also referred to herein as "small interfering RNA" is defined as an agent which functions to inhibit expression of a target gene, e.g., by RNAi. An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell. In one embodiment, siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, 22, or 23 nucleotides in length, and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand. Preferably the siRNA is capable of promoting RNA interference through degradation or specific post- transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
siRNAs also include small hairpin (also called stem loop) RNAs (shRNAs). In one embodiment, these shRNAs are composed of a short (e.g., about 19 to about 25 nucleotide) antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand may precede the nucleotide loop structure and the antisense strand may follow. These shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter (see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501, incorporated by reference herein in its entirety).
The target gene or sequence of the RNA interfering agent may be a cellular gene or genomic sequence, e.g. the GGT sequence. An siRNA may be substantially homologous to the target gene or genomic sequence, or a fragment thereof. As used in this context, the term "homologous" is defined as being substantially identical, sufficiently complementary, or similar to the target mRNA, or a fragment thereof, to effect RNA interference of the target. In addition to native RNA molecules, RNA suitable for inhibiting or interfering with the expression of a target sequence include RNA derivatives and analogs. Preferably, the siRNA is identical to its target. The siRNA preferably targets only one sequence. Each of the RNA interfering agents, such as siRNAs, can be screened for potential off-target effects by, for example, expression profiling. Such methods are known to one skilled in the art and are described, for example, in Jackson et al. Nature Biotechnology 6:635-637, 2003. In addition to expression profiling, one may also screen the potential target sequences for similar sequences in the sequence databases to identify potential sequences which may have off-target effects. For example, according to Jackson et al. (Id.) 15, or perhaps as few as 11 contiguous nucleotides, of sequence identity are sufficient to direct silencing of non-targeted transcripts. Therefore, one may initially screen the proposed siRNAs to avoid potential off-target silencing using the sequence identity analysis by any known sequence comparison methods, such as BLAST.
siRNA molecules need not be limited to those molecules containing only RNA, but, for example, further encompasses chemically modified nucleotides and non-nucleotides, and also include molecules wherein a ribose sugar molecule is substituted for another sugar molecule or a molecule which performs a similar function. Moreover, a non-natural linkage between nucleotide residues can be used, such as a phosphorothioate linkage. The RNA strand can be derivatized with a reactive functional group of a reporter group, such as a fluorophore. Particularly useful derivatives are modified at a terminus or termini of an RNA strand, typically the 3' terminus of the sense strand. For example, the 2'-hydroxyl at the 3' terminus can be readily and selectively derivatizes with a variety of groups.
Other useful RNA derivatives incorporate nucleotides having modified carbohydrate moieties, such as 2'0-alkylated residues or 2'-O-methyl ribosyl derivatives and 2'-O-fluoro ribosyl derivatives. The RNA bases may also be modified. Any modified base useful for inhibiting or interfering with the expression of a target sequence may be used. For example, halogenated bases, such as 5-bromouracil and 5-iodouracil can be incorporated. The bases may also be alkylated, for example, 7-methylguanosine can be incorporated in place of a guanosine residue. Non-natural bases that yield successful inhibition can also be incorporated.
The most preferred siRNA modifications include 2'-deoxy-2'-fluorouridine or locked nucleic acid (LAN) nucleotides and RNA duplexes containing either phosphodiester or varying numbers of phosphorothioate linkages. Such modifications are known to one skilled in the art and are described, for example, in Braasch et al., Biochemistry, 42: 7967-7975, 2003. Most of the useful modifications to the siRNA molecules can be introduced using chemistries established for antisense oligonucleotide technology. Preferably, the modifications involve minimal 2'-O-methyl modification, preferably excluding such modification. Modifications also preferably exclude modifications of the free 5'-hydroxyl groups of the siRNA.
Other siRNAs useful for targeting GGT expression can be readily designed and tested. Accordingly, siRNAs useful for the methods described herein include siRNA molecules of about 15 to about 40 or about 15 to about 28 nucleotides in length, which are homologous to a GGT gene. Preferably, the siRNA molecules have a length of about 19 to about 25 nucleotides. More preferably, the siRNA molecules have a length of about 19, 20, 21, or 22 nucleotides. The siRNA molecules can also comprise a 3' hydroxyl group. The siRNA molecules can be single-stranded or double stranded; such molecules can be blunt ended or comprise overhanging ends (e.g., 5', 3'). In specific embodiments, the RNA molecule is double stranded and either blunt ended or comprises overhanging ends.
In one embodiment, at least one strand of the RNA molecule has a 3' overhang from about 0 to about 6 nucleotides (e.g., pyrimidine nucleotides, purine nucleotides) in length. In other embodiments, the 3' overhang is from about 1 to about 5 nucleotides, from about 1 to about 3 nucleotides and from about 2 to about 4 nucleotides in length. In one embodiment the RNA molecule is double stranded, one strand has a 3' overhang and the other strand can be blunt-ended or have an overhang. In the embodiment in which the RNA molecule is double stranded and both strands comprise an overhang, the length of the overhangs may be the same or different for each strand. In a particular embodiment, the RNA of the present invention comprises about 19, 20, 21, or 22 nucleotides which are paired and which have overhangs of from about 1 to about 3, particularly about 2, nucleotides on both 3' ends of the RNA. In one embodiment, the 3' overhangs can be stabilized against degradation. In a preferred embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine 2 nucleotide 3' overhangs by T- deoxythymidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium.
GGT mRNA has been successfully targeted using siRNAs; see, for example, Williams et al., 2004, Biochem. Biophys Res. Commun. 314: 63-68, which is incorporated herein by reference. Thus, two siRNA duplex sequences effective for reducing GGT expression include: antisense, 5'-AACCUGACAACCAUGUGUACAC-S' (SEQ ID NO: 1) and sense, 5'-AAGUGUACACAUGGUUGUCAGG-S' (SEQ ID NO: 2), which form a duplex and target bases 582-603 of human GGT mRNA; and antisense, 5'- AAUGCCC ACAGC AUGGGC AUCG-3' (SEQ ID NO: 3), and sense, 5'- AACGAUGCCCAUGCUGUGGGC A-3' (SEQ ID NO: 4), which form a duplex and target bases 722-743 of human GGT mRNA. Others may be readily prepared by those of skill in the art based on the known sequence of the target mRNA. To avoid doubt, the sequence of a human GGT cDNA is provided at, for example, GenBank Accession Nos. NM_013430 and E02290. The sequence at E02290 is the following (SEQ ID NO: 5):
1 gggtgaagaa gaagttagtg gtgctgggcc tgctggccgt ggtcctggtg ctggtcattg
61 tcggcctctg tctctggctg ccctcagcct ccaaggaacc tgacaaccat gtgtacacca
121 gggctgccgt ggccgcggat gccaagcagt gctcgaagat tgggagggat gcactgcggg
181 acggtggctc tgcggtggat gcagccattg cagccctgtt gtgtgtgggg ctcatgaatg
241 cccacagcat gggcatcggg ggtggcctct tcctcaccat ctacaacagc accacacgaa
301 aagctgaggt catcaacgcc cgcgaggtgg cccccaggct ggcctttgcc accatgttca
361 acagctcgga gcagtcccag aagggggggc tgtcggtggc ggtgcctggg gagatccgag
421 gctatgagct ggcacaccag cggcatgggc ggctgccctg ggctcgcctc ttccagccca
481 gcatccagct ggcccgccag ggcttccccg tgggcaaggg cttggcggca gccctggaaa
541 acaagcggac cgtcatcgag cagcagcctg tcttgtgtga ggtgttctgc cgggatagaa
601 aggtgcttcg ggagggggag agactgaccc tgccgcagct ggctgacacc tacgagacgc
661 tggccatcga gggtgcccag gccttctaca acggcagcct cacggcccag attgtgaagg
721 acatccaggc ggccgggggc attgtgacag ctgaggacct gaacaactac cgtgctgagc
781 tgatcgagca cccgctgaac atcagcctgg gagacgcggt gctgtacatg cccagtgcgc
841 cgctcagcgg gcccgtgctg gccctcatcc tcaacatcct caaagggtac aacttctccc
901 gggagagcgt ggagagcccc gaggagaagg gcctgacgta ccaccgcatc gtagaggctt
961 tccggtttgc ctacgccaag aggaccctgc ttggggaccc caagtttgtg gatgtgactg
1021 aggtggtccg caacatgacc tccgagttct tcgctgccca gctccgggcc cagatctctg
1081 acgacaccac tcacccgatc tcctactaca agcccgagtt ctacacgccg gatgacgggg
1141 gcactgctca cctgtctgtc gtcgcagagg acggcagtgc tgtgtccgcc accagcacca
1201 tcaacctcta ctttggctcc aaggtccgct ccccggtcag cgggatcctg ttcaataatg
1261 aaatggacga cttcagctct cccagcatca ccaacgagtt tggggtaccc ccctcacctg
1321 ccaatttcat ccagccaggg aagcagccgc tctcgtccat gtgcccgacg atcatggtgg
1381 gccaggacgg ccaggtccgg atggtggtgg gagctgctgg gggcacacag atcaccacgg
1441 ccactgcact ggccatcatc tacaacctct ggttcggcta tgacgtgaag cgggccgtgg
1501 aggagccccg gctgcacaac cagcttctgc ccaacgtcac gacagtggag agaaacattg
1561 accaggcagt gactgcagcc ctggagaccc ggcaccatca cacccagatc gcgtccacct
1621 tcatcgctgt ggtgcaagcc atcgtccgca cggctggtgg ctgggcagct gcctcggact
1681 ccaggaaagg cggggagcct gccggctact gagtgctcca ggaggacaag gctgacaagc
1741 aatccaggga caagatactc accaggacca ggaaggggac tctgggggac cggcttcccc
1801 tgtgagcagc agagcagcac aataaatgag gccactgtgc caggaaaaaa aaaaaaaaaa
siRNA sequences are chosen to maximize the uptake of the antisense (guide) strand of the siRNA into RISC and thereby maximize the ability of RISC to target human GGT mRNA for degradation. This can be accomplished by scanning for sequences that have the lowest free energy of binding at the 5 '-terminus of the antisense strand. The lower free energy leads to an enhancement of the unwinding of the 5'- end of the antisense strand of the siRNA duplex, thereby ensuring that the antisense strand will be taken up by RISC and direct the sequence-specific cleavage of the human GGT mRNA.
In a preferred embodiment, the siRNA or modified siRNA is delivered to the organ in a pharmaceutically acceptable carrier. Additional carrier agents, such as liposomes, may be added to the pharmaceutically acceptable carrier. A preferred mode of introduction to the lung is through inhalation in a pharmaceutically acceptable carrier for inhalation therapy.
In another embodiment, the siRNA is delivered by delivering a vector encoding small hairpin RNA (shRNA) in a pharmaceutically acceptable carrier to the cells in an organ of an individual. The shRNA is converted by the cells after transcription into siRNA capable of targeting, for example, GGT. In one embodiment, the vector may be a regulatable vector, such as tetracycline inducible vector.
In one embodiment, the RNA interfering agents used in the methods described herein are taken up actively by cells in vivo following intravenous injection, e.g., hydrodynamic injection, without the use of a vector, illustrating efficient in vivo delivery of the RNA interfering agents, e.g., the siRNAs used in the methods of the invention.
One method to deliver the siRNAs is catheterization of the blood supply vessel of the target organ.
Other strategies for delivery of the RNA interfering agents, e.g., the siRNAs or shRNAss uusseedd iinn tthhee methods of the invention, may also be employed, such as, for example, delivery by a vector, e.g., a plasmid or viral vector, e.g., a lentiviral vector. Such vectors can be used as described, for example, in Xiao-Feng Qin et al. Proc. Natl. Acad. Sci. U.S.A., 100: 183-188. Other delivery methods include delivery of the RNA interfering agents, e.g., the siRNAs or shRNAs of the invention, using a basic peptide by conjugating or mixing the RNA interfering agent with a basic peptide, e.g., a fragment of a TAT peptide, mixing with cationic lipids or formulating into particles.
In one embodiment, the dsRNA, such as siRNA or shRNA, is delivered using an inducible vector, such as a tetracycline inducible vector. Methods described, for example, in Wang et al. Proc. Natl. Acad. Sci. 100: 5103-5106, using pTet-On vectors (BD Biosciences Clontech, Palo Alto, CA) can be used.
The RNA interfering agents, e.g., the siRNAs targeting GGT mRNA, may be delivered singly, or in combination with other RNA interfering agents, e.g., siRNAs, such as, for example siRNAs directed to other cellular genes. GGT siRNAs may also be administered in combination with other pharmaceutical agents which are used to treat or prevent diseases or disorders associated with oxidative stress, especially respiratory diseases, and more especially asthma.
Synthetic siRNA molecules, including shRNA molecules, can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA molecule can be chemically synthesized or recombinantly produced using methods known in the art, such as using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer (see, e.g., Elbashir, S.M. et al. (2001) Nature 411:494-498; Elbashir, S.M., W. Lendeckel and T. Tuschl (2001) Genes & Development 15:188-200; Harborth, J. et al. (2001) /. Cell Science 114:4557-4565; Masters, J.R. et al. (2001) Proc. Natl. Acad. ScL, USA 98:8012-8017; and Tuschl, T. et al. (1999) Genes & Development 13:3191-3197). Alternatively, several commercial RNA synthesis suppliers are available including, but not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). As such, siRNA molecules are not overly difficult to synthesize and are readily provided in a quality suitable for RNAi. In addition, dsRNAs can be expressed as stem loop structures encoded by plasmid vectors, retroviruses and lentiviruses (Paddison, PJ. et al. (2002) Genes Dev. 16:948-958; McManus, M.T. et al. (2002) RNA 8:842-850; Paul, CP. et al. (2002) Nat. Biotechnol. 20:505-508; Miyagishi, M. et al. (2002) Nat. Biotechnol. 20:497-500; Sui, G. et al. (2002) Proc. Natl. Acad. ScL, USA 99:5515-5520; Brummelkamp, T. et al. (2002) Cancer Cell 2:243; Lee, N.S., et al. (2002) Nat. Biotechnol. 20:500-505; Yu, J.Y., et al. (2002) Proc. Natl. Acad. ScL, USA 99:6047-6052; Zeng, Y., et al. (2002) MoI. Cell 9:1327-1333; Rubinson, D.A., et al. (2003) Nat. Genet. 33:401-406; Stewart, S.A., et al. (2003) RNA 9:493-501). These vectors generally have apolIII promoter upstream of the dsRNA and can express sense and antisense RNA strands separately and/or as a hairpin structures. Within cells, Dicer processes the short hairpin RNA (shRNA) into effective siRNA. The targeted region of the siRNA molecule of the present invention can be selected from a given target gene sequence, e.g., a GGT coding sequence, beginning from about 25 to 50 nucleotides, from about 50 to 75 nucleotides, or from about 75 to 100 nucleotides downstream of the start codon. Nucleotide sequences may contain 5' or 3' UTRs and regions nearby the start codon. One method of designing a siRNA molecule of the present invention involves identifying the 23 nucleotide sequence motif AA(N19)TT (where N can be any nucleotide) and selecting hits with at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% G/C content. The "TT" portion of the sequence is optional. Alternatively, if no such sequence is found, the search may be extended using the motif NA(N21), where N can be any nucleotide. In this situation, the 3' end of the sense siRNA may be converted to TT to allow for the generation of a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs. The antisense siRNA molecule may then be synthesized as the complement to nucleotide positions 1 to 21 of the 23 nucleotide sequence motif. The use of symmetric 3' TT overhangs may be advantageous to ensure that the small interfering ribonucleoprotein particles (siRNPs) are formed with approximately equal ratios of sense and antisense target RNA-cleaving siRNPs (Elbashir et al. (2001) supra and Elbashir et al. 2001 supra). Analysis of sequence databases, including but not limited to the NCBI, BLAST, Derwent and GenSeq as well as commercially available oligosynthesis companies such as Oligoengine®, may also be used to select siRNA sequences against EST libraries to ensure that only one gene is targeted.
Delivery of RNA Interfering Agents: Methods of delivering RNA interfering agents, e.g., an siRNA, or vectors containing an RNA interfering agent, to the target cells, e.g., cells of the lung or other desired target cells, for uptake include injection of a composition containing the RNA interfering agent, e.g., an siRNA, or directly contacting the cell, e.g., a cell of the lung, with a composition comprising an RNA interfering agent, e.g., an siRNA. In another embodiment, RNA interfering agents, e.g., an siRNA may be injected directly into any blood vessel, such as vein, artery, venule or arteriole, via, e.g., hydrodynamic injection or catheterization. Administration may be by a single injection or by two or more injections. The RNA interfering agent is delivered in a pharmaceutically acceptable carrier. One or more RNA interfering agents may be used simultaneously.
In one preferred embodiment, only one siRNA that targets human GGT is used. The delivery or administration of the siRNA is preferably performed in free form, i.e. without the use of vectors. The direct delivery of siRNA to the lung can be performed by inhalation for example, using an electronebulizer.
In one embodiment, specific cells are targeted with RNA interference, limiting potential side effects of RNA interference caused by non-specific targeting of RNA interference. The method can use, for example, a complex or a fusion molecule comprising a cell targeting moiety and an RNA interference binding moiety that is used to deliver RNA interference effectively into cells. For example, an antibody-protamine fusion protein when mixed with siRNA, binds siRNA and selectively delivers the siRNA into cells expressing an antigen recognized by the antibody, resulting in silencing of gene expression only in those cells that express the antigen. The siRNA or RNA interference-inducing molecule binding moiety is a protein or a nucleic acid binding domain or fragment of a protein, and the binding moiety is fused to a portion of the targeting moiety. The location of the targeting moiety may be either in the carboxyl-terminal or amino-terminal end of the construct or in the middle of the fusion protein.
A viral-mediated delivery mechanism can also be employed to deliver siRNAs to cells in vitro and in vivo as described in Xia, H. et al. (2002) Nat Biotechnol 20(10): 1006). Plasmid- or viral-mediated delivery mechanisms of shRNA may also be employed to deliver shRNAs to cells in vitro and in vivo as described in Rubinson, D. A., et al. ((2003) Nat. Genet. 33:401-406) and Stewart, S.A., et al. ((2003) RNA 9:493-501).
The RNA interfering agents, e.g., the siRNAs or shRNAs, can be introduced along with components that perform one or more of the following activities: enhance uptake of the RNA interfering agents, e.g., siRNA, by the cell, e.g., pulmonary or airway epithelial cells, inhibit annealing of single strands, stabilize single strands, or otherwise facilitate delivery to the target cell and increase inhibition of the target gene, e.g., GGT.
RNA interfering agents, e.g., an siRNA, can also be introduced into cells via topical application to a mucosal membrane or dermally. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are also sites where the agents can be introduced.
The dose of the particular RNA interfering agent will be in an amount necessary to effect RNA interference, e.g., post translational gene silencing (PTGS), of the particular target gene, thereby leading to inhibition of target gene expression or inhibition of activity or level of the protein encoded by the target gene.
Measurement of GGT activity: GGT activity can measured in a number of ways known to those of skill in the art. For example, Han et al. (supra) describe a fluorometric assay for the hydrolytic activity of E. coli GGT. This assay monitors the release of 7-amino- 4-methylcoumarin (AMC) using 0.2 μM 7-(N-γ-glutamyl-amino)-4-methylcoumarin (γ-Glu- AMC) as the substrate at 25°C (pH 5.5). Assays are initiated by adding 10 μl of enzyme solution to 100 mM succcinate-NaOH buffer (pH 5.5) in a total volume of 1 ml containing 100 μl of γ-Glu-AMC stock solution (2 μM in water) at 25°C (a final γ-Glu-AMC concentration of 0.2 μM). The release of AMC is monitored continuously for 10 min, e.g., using a Hitachi F- 2000 spectrophotometer (350 nm excitation, 440 nm emission). AMC concentrations are calculated using a standard calibration curve of fluorescence intensity (F) versus AMC concentration I: ΔF/ΔC = 0.11 nM"1. In this assay, the fluorescence intensity is proportional to the concentration of AMC up to 2.0 μM. The Michaelis constant (Km) for γ- GIu-AMC was determined under these conditions to be 0.2 μM. The hydrolytic activity of human GGT is measured under the same conditions, except the final substrate concentration if 4.0 μM in 100 mM succinate-NaOH buffer. The Km for γ-Glu-AMC has been determined to be 12.6 μM under these conditions.
The inhibition of GGT activity can be measured using a continuous or discontinuous assay method under pseudo-first-order rate conditions. For the continuous assay, a typical run is as follows: enzyme is added to a preincubated mixture of varying concentrations of an inhibitor and the substrate (final concentration 4.0 μM γ-Glu-AMC for measurement of human GGT) in 100 mM sodium succinate buffer (pH 5.5) at 25°C. Time-dependent inhibition of the enzyme is followed by continuously monitoring the release of AMC for 10 min. The resulting progress curves are analyzed by fitting the data to the first-order rate equation [P] = [P][l-exp(-fcobs t)] (where [P] and [P] are the concentrations of AMC formed at time t and at time approaching infinity, respectively) to calculate the observed pseudo-first- order rate constants for enzyme inactivation (fcobs) using, for example, the KaleidaGraph™ v. 3.5 program package (Synergy Software). Where the replot of ko\,s versus inhibitor concentration [I] exhibits no saturation under standard inhibitor concentrations, the second- order rate constant for enzyme inactivation (kon) is calculated according to the equation kobs = fcon[I]/(l+[S]/Km), where S is the substrate γ-Glu-AMC, and [S] and Km are 0.2 and 0.2 μM (E. coli GGT), and 4.0 and 12.6 μM (human GGT).
Other assays of GGT activity and described by, for example, Lherbet & Keillor (supra) and by Anderson & Meister (supra). Any or all of these approaches can be used to determine whether a given compound or treatment inhibits GGT as needed for the methods described herein.
Where GGT expression is targeted, GGT activity can also be monitored by measurement of GGT protein levels, e.g., as described by Williams et al. (supra).
Measurement of GSH: Glutathione levels can be measured, where desired or necessary, using methods known to those of skill in the art. Assay kits are also commercially available, for example, from Cayman Chemical Corp. (Ann Arbor, Michigan, USA) and Oxford Biomedical Research, Inc. (Oxford, Michigan, USA).
Experimental Models of Asthma: GGT inhibitors as described herein can be tested in vivo for the desired therapeutic or prophylactic activity as well as for determination of therapeutically effective dosage. For example, such compounds can be tested in suitable animal model systems prior to testing in humans, including, but not limited to, rats, mice, chicken, cows, monkeys, rabbits, etc. For in vivo testing, prior to administration to humans, any animal model system known in the art can be used.
An IL-13-induced experimental model of asthma is described in detail in the Examples below. Other experimental models of asthma that can be used in assessment of the efficacy of a given GGT inhibition approach can include, for example, an IL-18-induced mouse asthma model (see, e.g., Tsutsui et al., 2004, Immunological Reviews 202: 115-138), an ovalbumin-induced model (see, for example, Ghao et al, 2002, Chin. Med. J. 115: 1470- 1474, and/or Choi et al., 2005 Clin. Exp. Allergy 35: 89-96) and a diisocyanate-induced asthma model (see, e.g., Johnson et al., 2004, Curr. Opin. Allergy Clin. Immunol. 4: 105- 110), among others. Various other models that can be employed are described, for example, in the review by Szeleny, 2004, Inflammation Res. 49: 639-654.
Pharmaceutical Compositions: Inert, pharmaceutically acceptable carriers or excipients used for preparing pharmaceutical compositions of the GGT inhibitors described herein can be either solid or liquid. Solid preparations include powders, tablets, dispersible granules, capsules, cachets and suppositories. The powders and tablets may comprise from about 5 to about 70% active ingredient. Suitable solid carriers are known in the art, e.g., magnesium carbonate, magnesium stearate, talc, sugar, and/or lactose. Tablets, powders, cachets and capsules can be used as solid dosage forms suitable for oral administration.
For preparing suppositories, a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted, and the active ingredient is dispersed homogeneously therein as by stirring. The molten homogeneous mixture is then poured into conveniently sized molds, allowed to cool and thereby solidify.
Liquid preparations include solutions, suspensions and emulsions. As an example can be mentioned water or water-propylene glycol solutions for parenteral injection. Liquid preparations can also include solutions for intranasal administration. Where direct administration to the lung is desired, aerosol preparations suitable for inhalation are preferred. Aerosol preparations suitable for inhalation can include solutions and solids in powder form, which can be in combination with a pharmaceutically acceptable carrier, such as an inert compressed gas.
Also included are solid preparations which are intended for conversion, shortly before use, to liquid preparations for either oral or parenteral administration. Such liquid forms include solutions, suspensions and emulsions.
The GGT inhibitory agents described herein can also be deliverable transdermally. The transdermal compositions can take the form of creams, lotions, aerosols and/or emulsions and can be included in a transdermal patch of the matrix or reservoir type as are conventional in the art for this purpose.
The suitability of a particular route of administration will depend in part on the pharmaceutical composition (e.g., whether it can be administered orally without decomposing prior to entering the blood stream). Controlled release systems known to those skilled in the art can be used where appropriate.
Preferably the compounds are administered by inhalation, but parenteral or oral administration can be used where appropriate. Preferably, the pharmaceutical preparation is in unit dosage form. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component, e.g., an effective amount to achieve the desired purpose.
The actual dosage employed may be varied depending upon the requirements of the patient and the severity of the condition being treated. Determination of the proper dosage for a particular situation is within the skill of the art. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small amounts until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired.
The amount and frequency of administration of the GGT inhibitory agents will be regulated according to the judgment of the attending clinician (physician) considering such factors as age, condition and size of the patient as well as severity of the disease being treated. Amounts needed to achieve the desired effect, i.e., a "therapeutically effective dose" will vary with these and other factors known to the ordinarily skilled practitioner, but generally range from 0.001 to 5.0 mg of inhibitory agent per kilogram of body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used. For prophylactic or maintenance applications, compositions containing the GGT inhibitory agent can also be administered in similar or slightly lower dosages relative to therapeutic dosages, and often with lower frequency (illustrative examples include, every other day or even weekly or monthly for a maintenance or preventative regimen, as opposed to, for example, every day for a therapeutic regimen). The frequency of dosages for either therapeutic or maintenance/prophylactic uses will also depend, for example, on the in vivo half-life of the GGT inhibitor used. Thus, more frequent dosing is appropriate where the half-life is shorter, and vice versa. One of skill in the art can measure the in vivo half-life for a given GGT inhibitor. Where appropriate, and especially, for example, when the agent will be administered systemically (e.g., intravenously or other systemic route), it is specifically contemplated that GGT inhibitors can be coupled to agents that increase the in vivo half-life of the agent. For example, polypeptides or other agents can be coupled to a serum protein, e.g., serum albumin, to increase the half-life of the polypeptide.
The GGT inhibitory agent or treatment can be administered according to therapeutic protocols well known in the art. It will be apparent to those skilled in the art that the administration of a GGT inhibitory therapy can be varied depending on the disease being treated and the known effects of the agent administered on that disease. Also, in accordance with the knowledge of the skilled clinician, the therapeutic protocols (e.g., dosage amounts and times of administration) can be varied in view of the observed effects of the administered therapeutic agents (e.g., amelioration of asthma symptoms) on the patient, and in view of the observed responses of the disease to the administered therapeutic agents.
In the methods described herein, a GGT inhibitory agent can be administered concurrently or sequentially with another agent for the treatment of respiratory disease, e.g., asthma. However, for such administration, it is not necessary that, for example, the GGT inhibitory agent and the other agent be administered simultaneously or essentially simultaneously. The advantage of a simultaneous or essentially simultaneous administration is well within the determination of the skilled clinician.
Also, in general, the GGT inhibitory agent and the other therapeutic agent do not have to be administered in the same pharmaceutical composition, and may, because of different physical and chemical characteristics, have to be administered by different routes. For example, the GGT inhibitory agent may be administered orally to generate and maintain good blood levels thereof, while the other agent may be administered by inhalation, or vice versa. The determination of the mode of administration and the advisability of administration, where possible, in the same pharmaceutical composition, is well within the knowledge of the skilled clinician. The initial administration can be made according to established protocols known in the art, and then, based upon the observed effects, the dosage, modes of administration and times of administration can be modified by the skilled clinician .
The particular choice of GGT inhibitory agent, and, where desired or necessary, another therapeutic agent, will depend upon the diagnosis of the attending physicians and their judgment of the condition of the patient and the appropriate treatment protocol.
If the GGT inhibitory agent, and the other agent are not administered simultaneously or essentially simultaneously, then the initial order of administration of the GGT inhibitory agent and the other agent may not be important. Thus, the GGT inhibitory agent can be administered first, followed by the administration of the other agent; or the other agent can be administered first followed by the administration of the GGT inhibitory agent. This alternate administration can be repeated during a single treatment protocol. The determination of the order of administration, and the number of repetitions of administration of each therapeutic agent during a treatment protocol, is well within the knowledge of the skilled physician after evaluation of the disease being treated and the condition of the patient.
Thus, in accordance with experience and knowledge, the practicing physician can modify each protocol for the administration of a component of the treatment according to the individual patient's needs, as the treatment proceeds.
The attending clinician, in judging whether treatment is effective at the dosage administered, can consider the general well-being of the patient as well as more definite signs such as relief of clinically accepted disease-related symptoms. The efficacy of treatment can be determined by the skilled clinician. However, a treatment is considered effective, as the term is used herein, if any one or all of the following symptoms, or other clinically accepted symptoms or markers of respiratory disease are ameliorated, e.g., by at least 10%. Clinical markers of asthma include, for example, airway mucus cell hyperplasia, mucin and gob-5 gene induction, EGF Receptor activation, and airway hyper-reactivity. Methods of measuring these indicators are known to those of skill in the art and/or described herein.
Standard measures of asthma include, for example, Forced Expiratory Volume (FEV) as measured by spirometry, bronchial hyperreactivity by methacholine challenge, exhaled nitric oxide level (FeNO), serum eosinophil cationic protein, serum atopy markers and chemokine levels (e.g., macrophage-derived chemokine (MDC), thymus and activation regulated chemokine (TARC), eotaxin), and leukotriene B4 measurements in exhaled breath condensate (EBC). An improvement of 10% or more in any or all of these clinical markers of asthma is indicative of effective treatment.
The present invention is illustrated by the following non-limiting examples. It is to be understood that the particular examples, materials, amounts and procedures are to be interpreted broadly in accord with the scope and spirit of the invention as set forth herein and are not intended to limit the invention in any way. All references described herein, including patents and patent applications as well as literature references, whether published in paper, online or other electronic versions, are incorporated herein by reference in their entirety.
EXAMPLES
1. GGT Deficient Mouse Lung Is Resistant To Il-13-Induced Asthma. A. Materials and Methods
i. Mouse model. GGTenul mice were bred in the Laboratory and Animal Science Center and studied as a model of oxidant stress according to protocols approved by the Institutional Utilization and Animal Care Committee at Boston University School of Medicine. Animals were genotyped as previously described {Jean, 1999, Mutagenesis, 14:31- 36}. For the experiment, each mouse was transiently anesthetized with Metofane and received 5 micrograms of ILl 3 dosed for three successive days. ILl 3 was delivered via the trachea in 100 microliters of saline (n=4). Control mice received saline alone (n=3). On the fourth day, airway physiology was assessed in all mice under appropriate anesthesia via an intra-tracheal catheter using the Scireg flexivent apparatus (SCIREQ, Montreal, Quebec, Canada). The lungs were exposed sequentially to 0, 5, 10 and 15 ug/ml of methacholine and airway resistance was measured. The experiment was performed six times. The IL- 13 used in these experiments was the generous gift of Wyeth Pharmaceutical, Cambridge, MA. Lung lining fluid GGT activity in wild type mice was also inhibited with acivicin, an irreversible antagonist, by intratracheal delivery .
ii. Broncho-alveolar lavage analysis. The lung was gently lavaged a single time with 500 microliters of ice-cold saline, then aspirated to recover BAL fluid. Recovery was 99%. Cells were counted on a hemocytometer and cytospin slides prepared and stained with Diff-Quik for differential cell counts. BAL cells were sedimented by centrifugation and the cell-free broncho-alveolar lavage (BAL) was frozen until further analysis. BAL fluid was assessed for ILl 3 and eotaxin content with a mouse Quantikine® ELISA kit from R&D Systems, employing an internal standard curve according to the manufacturer's instructions. BAL fluid cytokine accumulation was also assayed using the RayBio™ 32-mouse cytokine array from Ray Biotech according to the manufacturer's instructions (Norcorss, GA). Signal intensity was determined by densitometry and values were normalized to internal standards on each blot and then to the saline-treated WT lung as described in {Zhou, 2005, Infect Immun, 73:935-943}. Glutathione, cyst(e)ine and GSNO was assessed by HPLC as described in {Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776; Fortenberry, 1999, Am J Physiol, 276:L435-L442}. Leukotrienes C4 and E4 were assessed with an ELISA kit from Cayman Chemical (Ann Arbor, MI) used according to the manufacturer's instructions.
iii. Histology and Immunohistochemistry: Lung tissue was inflation fixed with freshly prepared 4% paraformaldhyde, dehydrated in ethanol and embedded in paraffin. Tissues sections were deparaffinized prior to use {Joyce-Brady, 1994, J Biol Chem, 269:14219-14226; Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776}. Mucin accumulation was assessed with Alcian blue/periodic acid Schiff (PAS) stain as described previously {Christensen, 1988, Environ Res, 45:78-90}. Native EGF receptor was localized in lung by immunohistochemistry using peptide- specific rabbit antisera from Cell Signaling Technology at a dilution of 1:25 and incubation at 4°C overnight (Catalogue #2232, Beverly, MA). Exposure to 50 mM glycine at pH 3.5, 10 mM EDTA for 10 min at 95°C was used for antigen retrival prior to antibody incubation. Activation of EGF receptor was assessed by immunohistochemistry using a Phospho-specific antisera raised against phosphorylated EGFR from the same company at a dilution of 1:25 and incubation at 4°C overnight (Catalogue #2231). Exposure to Proteinase K (Zymeda preparation) at a dilution of 1:16 for 8 min at 42°C was used for antigen retrieval. In each case, rabbit IgG from Vector labs was used as the negative control and signal specificity was confirmed in a competition experiment with the corresponding peptide antigen obtained from Cell Signaling Technology. Sections were stained for peroxidase activity with the Vectabond ABC kit according to the manufacturer's instructions. Versican staining was performed in the laboratory of Dr. Thomas Wight using methods described previously. Briefly, versican was localized with 8 mg/ml of a rabbit anti-mouse versican (GAG b domain) polyclonal antibody (Chemicon International, Temecula, CA). This antibody was raised against a GST fusion protein containing amino acids 1360 through 1439 of mouse versican and recognizes a large molecular weight band by Western blot in aortic and cardiac tissue from mouse and media from mouse smooth muscle cells. Unstained sections were photographed in a Leitz Orthoplan microscope {Jean JC, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776; Joyce-Brady, 1994, / Biol Chem, 269:14219-14226}.
iv. Quantitative RT-PCR. Lung tissue was removed and frozen in liquid nitrogen prior to RNA isolation. RNA was isolated with Tri-Reagent, treated with DNase and quantified by spectrophotometry. Versican mRNA analysis was performed in the laboratory of Dr. Wight using 2 μm of total RNA and reverse transcribed in a 40 μl reaction mix with random primers and the High-Capacity cDAN Archive Kit (Applied Biosystems, Foster City, CA). Relative quantification was performed using the Taqman Gene Expression Assay Mm00490179_ml to detect all versican splice variants by amplifying across the exon junction of the last C-type lectin domain and the complement control protein module or SUSHI domain in the G3 domain. Gene expression was normalized to eukaryotic 18S rRNA Endogenous Control part no. 4333760 (Applied Biosystems).
All other mRNA analyses were performed in the Pulmonary Center at Boston University. Reverse transcription was performed with random hexamers as primer and 2 μg of total RNA. The volume was diluted 10-fold. Expression of the mucin genes Muc 1, Muc2, Muc3, Muc4, Muc5ac, Muc 5b and the mucous granule protein Clca3 (gob-5) were assessed by quantitative real time PCR using primer sets with Taqman probes from Applied Biosciences. All primers sets were designed to span an intron. The loading control was 18S ribosomal RNA quantified using stock Taqman probe. Target cDNA was quantified using Taqman probes and the standard curve method. All primer/probe sets were run with no-RT control to confirm absence of a genomic DNA signal. All quantitative PCR determinations were done with 3 replicates.
EGF receptor mRNA induction in response to ILl 3 was assessed by quantitative real time PCR with SYBR green using primers purchased from Superarray Bioscience Corporation (Frederick. MD). Fifty nanograms of cDNA were used in a 50 microliter reaction volume with SYBR Green PCR master mix from Applied Biosciences. Forty cycles of amplification, data acquisition and data analysis were performed on the ABI Prism 7700 Sequence detector (PE Applied Biosystems). EGFR was normalized to GAPDH as this mRNA species remained constant under all conditions.
v. Statistics. Nominal data is presented as means with standard error and analyzed by ANOVA using STATISTICA™ release 4.5 (StatSoft, Inc, 1993). Post hoc comparison was done with the Newman-Keuls test & Critical ranges. P values less than 0.05 were considered significant.
B. IL13 induces an inflammatory response independent of genotype.
Bronchalveolar lavage cytokine profile: ILl 3 was measured in BAL fluid to ensure equal delivery of cytokine to WT and GGTenul mouse lung. ELISA assay showed barely detectable levels of IL13 in BAL fluid from saline-treated mice but levels around 1000 pg/ml in BAL fluid from IL13-treated mice from both genotypes (Figure IA). The RayBio mouse cytokine array was used to determine if there were qualitative differences in cytokine profiles induced by ILl 3. This array also showed a similar degree of ILl 3 content in BAL fluid from WT and GGTenul lung treated with IL13. In addition, IL6 and IL12 were the major cytokines induced in BAL by ILl 3 treatment and the levels of induction were not different between genotypes (Figure IB).
Inflammatory cells in bronchoalveolar lavage: Total cell counts in BAL fluid showed the same number of cells in saline-treated WT and GGTenul mice, and a significant 3-4-fold accumulation of cells after ILl 3 treatment in each genotype (Figure 1C). Differential cell counts were also similar in saline-treated mice from the two genotypes and macrophages predominated. IL-13 treatment was associated with a significant accumulation of eosinophils in WT-BAL fluid (26%) and even moreso in GGTenul BAL fluid (52%, Figure ID). Eotaxin, an eosinophil chemotactic factor, was significantly induced in BAL fluid from IL13-treated mice of both genotypes (WT: saline at 4.8 + 1.9 pg/ml [n=3] and IL13 at 95.0 + 7 pg/ml [n=2]; GGTenul saline at 1.1 + 0.4 pg/ml [n=3] and ILl 3: 57 + 2 pg/ml [n=3], ANOVA P = 0.000003 with significant differences between saline-treated and IL13-treated samples only.
ILl 3 induction of inflammation-associated proteoglycan: Versican was examined as a proteoglycan that is known to accumulate in the subepithelial layer of human airways in response to inflammatory mediators associated with asthma {Huang, 1999 1096 /id, Am J Respir Crit Care Med, 160:725-729}. Compared to saline-treated WT lung, versican mRNA levels were the same in saline-treated GGTenul lung, and were induced 5-6 fold in IL13- treated mice from both genotypes (Figure IE). No airway or vascular signal for versican protein was detectable by immunohistochemistry in saline-treated mice of either genotype (Figure IF). However, an intense signal was present and surrounded airways (Figure IG) and vasculature in IL13-treated mice from each genotype.
C. GGT deficiency attenuates the epithelial cell response to IL13.
Accumulation of PAS positive material and Muc5ac mRNA: An abundance of PAS positive material was evident in airway epithelial cells of IL13-treated WT mice, where the signal was strong and intense (Figure 2A). In contrast, only sparse amounts of PAS positive material were present in airway epithelial cells of IL13-treated GGTenul mice and the signal was much weaker with many cells showing little to no signal at all (Figure 2B). No PAS positive material was evident in the airway epithelium of saline-treated mice from either genotype (data not shown).
Since the accumulation of PAS positive material is associated with the induction of mRNA for the mucin gene Muc5ac, we used quantitative real time PCR to assess Muc5ac mRNA abundance within total lung RNA. Muc5ac mRNA accumulated significantly after ILl 3 treatment, but only in WT lung where it was induced 35-fold. In contrast, Muc5ac mRNA induction was significantly attenuated in IL13-treated GGTenul lung where its level was 4-fold less than that of IL13-treated WT lung (Figure 2C).
Expression of Clca3 and other mucin genes: We extended our quantitative real time PCR analysis to assess mRNA abundance for the chloride channel Clca3, as a gene that is also induced with the onset of asthma {Nakanishi, 2001 1119 /id, Proc Natl Acad Sci USA, 98:5175-5180}, and additional mucin genes, such as Mucs 1, 2, 3, 4 and 5b, as controls for specificity of mucin gene induction by ILl 3. In a fashion similar to that of Muc5ac mRNA, Clca3 mRNA was also dramatically induced after ILl 3 treatment, but again only in WT mice (ANOVA P=0.002). In fact the degree of Clca3 mRNA induction exceeded that of Muc5ac by 8-fold. Lung Clca3 mRNA induction was significantly attenuated in IL13-treated GGTenul mice where it too was 4-fold less than that of IL13-treated WT mice (Figure 2D).
Muc 1, Muc 2, Muc 3, Muc 4 and Muc5b were measured in an identical fashion to determine if loss of GGT gene expression itself affected the expression of these other mucin genes under any condition, and to assess the specificity of mucin gene induction following IL13-treatment. The levels of gene expression for these mucins were the same in saline- treated lungs from both genotypes. IL13 treatment did not significantly alter the expression of any of these mucin genes in either genotype. The PCR signal for Muc 3, a gut-specific mucin gene, was detected in gut-derived RNA (data not shown), but not lung-derived RNA. This absence serves as a negative control for the pattern of mucin gene expression in the lung under all conditions (Figure 2E).
D. GGT deficiency attenuates IL13 induced airway hyper-reactivity
Methacholine challenge. Induction of airway hyper-reactivity was assessed by methacholine challenge. Saline-treatment did not induce any change in airway resistance from either genotype when inhalationally challenged with this cholinergic agonist. ILl 3 treatment did elicit a significant and progressive increase in airway resistance starting with the lowest methacholine dose, but only in WT mice. IL13-treated GGTenul mice, challenged with methacholine, were as non-reactive as saline-treated GGTenul mice (Figure 3).
E. GGT deficiency accentuates glutathione content in lung lining fluid after IL13.
Broncho-alveolar lavage glutathione content: Since oxidant stress plays a causative role in asthma, and the asthma phenotype was unexpectedly attenuated in the IL13-treated GGTenul mouse, we redirected our attention lung lining fluid glutathione as we already showed a 2- fold increase in this pool at baseline in GGTenul mice compared to WT controls (REF). This surfeit of extracellular glutathione, bathing the gas exchange surface, may bolster antioxidant defense, despite depletion of the intracellular glutathione {Jean JC, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776}. In accord with this hypothesis, BAL glutathione content did increase 2.2-fold in IL13-treated WT mice, compared to saline-treated WT mice, but this was not significant. In contrast, BAL glutathione content in IL13-treated GGTenul mice increased 10-fold, compared to saline-treated WT mice, and this was significantly elevated compared to either saline-treated or IL13-treated WT mice (ANOVA P=0.03, Figure 4). Total cyst(e)ine content did not differ significantly among the three groups of mice, suggesting that lung cysteine supply was able to meet demand. Total protein content increased to a greater degree in IL13-treated mice compared to saline-treated WT mice (35-fold, ANOVA P=0.0004), but the level was not different between IL13-treated genotypes.
Glutathione content of plasma: GGTenul mice also exhibit glutathionemia (5-fold elevation) and normocysteinemia compared to WT controls at baseline {Harding, 1997 284 /id, J Biol Chem, 272:12560-12567}. After IL13 treatment, total glutathione in plasma increased 1.5-fold compared to saline-treated WT mice, but this change was not significant. Total glutathione in plasma of IL13-treated GGTenul mice remained elevated at 4.5-fold showing that the baseline level of glutathionemia was largely maintained despite cytokine treatment. In contrast, while total cyst(e)ine content of plasma did not differ significantly between saline-treated and IL13-treated WT mice, it was decreased in IL13-treated GGTenul mice by 5-fold. This decline was at the margin of significance (ANOVA P=0.058) but likely is a reflection of increased systemic utilization of cysteine in the context of limited supply caused by GGT deficiency {Harding, 1997 284 /id, J Biol Chem, 272:12560-12567; Lieberman, 1996 427 /id, Proc Natl Acad Sci USA, 93:7923-7926}. Total protein content also increased significantly in plasma by 1.7-2 fold following ILl 3 treatment in both genotypes compared to the saline-treated WT control suggesting that the systemic effects from cytokine exposure were similar in both genotypes (ANOVA P=0.003).
Glutathione-related molecules: We also examined BAL fluid for accumulation of glutathione-related molecules, including nitrosoglutathione (GSNO), an endogenous bronchodilator, and leukotrienes C4 and E4, bronchoconstrictors induced during inflammation. There was no significant accumulation of GSNO in either saline-treated or IL- 13 treated mice (data not shown). Likewise, there was no significant difference in BAL content for leukotriene C4 (saline-treated WT: 123+7 pg/ml [n=3], IL13-treated WTW: 127+11 pg/ml [n=5], saline-treated GGTenul: 72+12 [n=4], and IL13-treated GGTenul: 80+9 pg/ml [n=6] with ANOVA P = 0.29), or leukotriene E4 (saline-treated WT: 56+4 pg/ml [n=4], IL13-treated WT: 79+4 pg/ml [n=4], saline-treated GGTenul: 48+3 [n=4], and IL13- treated GGTenul: 63+2 pg/ml [n=6] with ANOVA P = 0.052).
F. GGT deficiency attenuates IL13-induced lung epidermal growth factor receptor activation
To determine if enhanced lung lining fluid glutathione in the GGTenul lung was impacting the pro-oxidant milieu generated by the acute inflammatory response, lung EGFR was examined as its activation depend on oxidant -related mechanisms.
EGFR immunohistochemistry: Muc5ac gene induction in asthma is mediated by oxidant-dependent mechanisms that activate expression of the EGFR. Expression of EGF receptor protein was identified on the apical surface of ciliated airway epithelial cells using peptide- specific antisera and immunohistochemical techniques described in Methods. This pattern was clearly present in saline-treated WT (Fig 5A 4Ox, 5B 10Ox) and GGTenul lung (data not shown) in agreement with that reported by Tyner et al. {Tyner, 2006 1099 /id, / CHn Invest, 116:309-321 }. No such signal was produced with usage of non-immune rabbit IgG as a negative control (Figure 5C). Specificity was confirmed in a competition experiment co-incubating EGFR antisera with the EGFR peptide antigen, which abolished signal (Figure 5D). Expression of activated EGFR: Activated EGFR is known to translocate to the nucleus {Lin, 2001 1100 /id, Nat Cell Biol, 3:802-808}. This was assessed in saline-treated and IL13-treated cells from WT and GGTenul mouse lungs using a peptide- specific antisera raised against a phosphorylated domain of EGFR {Tyner, 2006 1099 /id, / Clin Invest, 116:309-321; Lin, 2001 1100 /id, Nat Cell Biol, 3:802-808}. Signal was only evident in scattered nuclei of airway epithelial cells from IL13-treated WT mice. Signal was evident in epithelial cells from larger airways more than smaller airways (Figure 5E). No signal was produced with usage of non-immune rabbit IgG produced as a negative control (Figure 5F). The nuclear signal in IL13-treated WT airway epithelial cells was abolished in a competition experiment co-incubating Dhosphor-EGFR antisera with the peptide antigen (Figure 5G).
Induction of EGF receptor mRNA: Lastly, to confirm differential activation of EGFR in IL13-treated WT lung, we assayed the level of EGFR mRNA, since receptor activation is associated with induction of the mRNA {Lin, 2001 1100 /id, Nat Cell Biol, 3:802-808}. Quantitative real time PCR showed induction of EGFR mRNA by 2.1 + 0.4 fold (P = 0.01, n=3) in IL13-treated WT lung compared to the saline-treated WT control. In contrast, there was no difference in the level of EGRF mRNA expression in saline-treated and IL13-treated GGχenui lung (0 95 ± 0O8 j n=3 j Figure 5H)
2. Inhibiting lung lining fluid GGT activity attenuates airway hyperreactivity in wild type mice.
A single intratracheal installation of 1 or 2.5 micromolar solutions of acivicin gave a similar profile of inhibition of enzyme activity in lung lining fluid (Figure 6A). In each case GGT activity was decreased by 70-80% of the saline treated control for up to 24 hr. Wild type mice were treated with 1 micromolar acivicin, and 24 hours later with the same ILl 3 protocol including a repeated acivicin dosing for three successive days, then assessed for airway hyper-reactivity by methacholine challenge. No reactivity was observed in saline- treated or saline + acivicin-treated control mice. Airway hyper-reactivity did develop in ILl 3- treated wild type mice, but not in ILl 3 + acivicin-treated mice. (Figure 6B).
3. Inhibition of GGT in wild-type mice with gamma-phosphono glutamate analog
The gamma-phosphono glutamate analog 2-Amino-4-{ [3-
(carboxymethyl)phenyl](methyl)phosphono}-butanoic acid has been tested for the inhibition of GGT in wild-type mice. The compound was dissolved in phosphate buffered saline and administered intraperitoneally at does of 0.5 mg/kg and 5 mg/kg. GGT activity was assayed using gamma-glutamyl-para-nitroanalide as substrate at 2 hr and 24 hr sfter injection, in both blood and bronchoalveolar lavage fluid. At 2 hours, the 0.5 mg/kg dose had no inhibitor activity, while the 5 mg/kg dose completely inhibited GGT activity in blood, but not in bronchoalveolar lavage fluid. At 24 hr, a sub-baseline level of blood GGT activity was present in mice receiving the 5 mg/kg dose, indicating partial recovery of GGT activity. These data indicate that this compound of the class of gamma phosphono glutamate analog inhibitors is active in vivo. It is anticipated from these data that any member of this class of GGT inhibitors can be effective in the in vivo inhibition of GGT (other members described herein and, for example by Han et al., 2007, Biochemistry 46: 1432-1447, which is incorporated herein by reference. These data also indicate that inhibition of lung lining fluid GGT activity may benefit from intratracheal delivery or other more direct delivery to the lung (including for example, aerosol delivery).
Definitive support for a causative role of oxidant stress in asthma pathogenesis has been provided recently by the response of the Nrf2 null mouse in an allergen-induced model of experimental asthma {Rangasamy, 2005, J Exp Med, 202:47-59}. Nrf2, a member of the Cap-n-Collar family of transcription factors, mediates a genetic response to oxidant stress by binding to the antioxidant response element in the upstream regions of an array of antioxidant genes, including genes involved with glutathione homeostasis {McMahon et al., 2001, Cancer Res. 61: 3299-3307; Cho et al., 2005, Free Radicals in Biol, and Med. 38: 325-343}. Nrf2 deficiency eliminates this pattern of antioxidant gene induction and unopposed oxidant stress is associated with increased levels of inflammatory cell influx, mucous cell hyperplasia and airway hyper-reactivity. Oxidant stress is due, in part, to glutathione deficiency as glutathione content fails to increase in the Nrf2 null mouse lung following the onset of asthma. Regulation of glutathione homeostasis appears to be an important component of the response to oxidant stress in this allergen-induced model of inflammatory airway disease {Rangasamy, 2005, J Exp Med, 202:47-59}.
A GGTenul mouse was exposed to ILl 3 in order to explore the role of glutathione metabolism and oxidant stress in a recently described animal model of experimental asthma, distinct from the ovalbumin model. GGT is the key ectoenzyme in extracellular glutathione turnover. By initiating glutathione breakdown, GGT controls the availability of cysteine, which is transported by glutathione and is the rate-limiting amino acid for intracellular glutathione synthesis {Harding, 1997 284 /id, J Biol Chem, 272:12560-12567; Lieberman, 1996 427 /id, Proc Natl Acad Sci USA, 93:7923-7926}. Loss of GGT enzyme activity in the GGTenul mouse impairs glutathione metabolism and causes deficiency of cellular glutathione pools. This is particularly evident in endothelial cells, alveolar macrophages and bronchiolar Clara cells in the GGTenul lung even in normoxia {Jean, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776}. Upon exposure to hyperoxia, where metabolism of oxygen increases the level of intracellular reactive oxygen species and induces oxidant stress, these cells are injured more rapidly so that the onset of pulmonary edema, hemorrhage and death is accelerated in GGTenul mice compared to wild type mice {Jean, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776}.
It was anticipated that deficiency of cellular glutathione pools would increase oxidant stress and accentuate the asthma phenotype in the GGTenul mouse lung following ILl 3 treatment. However, the experiments described herein show that the asthma phenotype is attenuated in these mice, despite equal ILl 3 delivery, cytokine activation, inflammatory cell and matrix-associated protein accumulation to levels seen in wild type mouse lung. In fact, differential cell counts showed an even greater percentage of eosinophils in the GGTenul lung after ILl 3 treatment and these cells are an important source of production of reactive oxygen species, which are believed to contribute to the onset of the asthma phenotype. The attenuated asthmatic response was evident as decreased levels of airway mucous cell hyperplasia, mucin and gob-5 gene induction, EGF receptor activation and airway hyper-reactivity. GGT deficiency protected the GGTenul mouse lung against this experimental model of asthma. Importantly, inhibition of GGT activity in lung lining fluid with acivicin also attenuated airway hyper-reactivity in wild type mice, demonstrating the generality of the therapeutic effect of GGT inhibition.
In addition to regulating intracellular glutathione pools, GGT regulates the size and the turnover of extracellular glutathione pools in the plasma {Harding, 1997, J Biol Chem, 272:12560-12567}, in lung lining fluid {Jean, 2002, Am J Physiol Lung Cell MoI Physiol, 283:L766-L776) and in epididymal lining fluid (Hinton, 1991 }. In the absence of turnover, these extracellular pools of glutathione enlarge. This was demonstrated in lung lining fluid, where LLF glutathione was elevated 2-fold (1600 uM versus 800 uM) in GGTenul compared to wild type mice{ Jean JC, 2002 797 /id, Am J Physiol Lung Cell MoI Physiol, 283:L766- L776}. This over- abundance of lung lining fluid glutathione in GGTenul mice is actually accentuated after ILl 3 treatment and increases antioxidant capacity against the extracellular load of ROS generated by the acute inflammatory response.
The ability of an enhanced extracellular glutathione pool to provide antioxidant protection in the GGTenul mouse and attenuation of mucin gene expression is supported by the data showing EGFR activation in wild type, but not GGTenul lung epithelial cells.

Claims

1. Use of an inhibitor of GGT for the preparation of a medicament for the treatment of a respiratory disorder.
2. The use of claim 1 wherein said respiratory disorder is asthma.
3. The use of any of claims 1 and 2 wherein said inhibitor of GGT is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein said small molecule inhibitor does not include acivicin.
4. The use of any of claims 1-3 wherein said small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide.
5. The use of any of claims 1-4 wherein said small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate.
6. A pharmaceutical composition comprising a gamma-glutamyl transpeptidase (GGT) inhibitor plus another compound having efficacy against an indicator of asthma, and a pharmaceutically acceptable excipient.
7. The pharmaceutical composition of claim 6 wherein said inhibitor is selected from the group consisting of: an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein said small molecule inhibitor does not include acivicin.
8. The use of an inhibitor of GGT for the treatment of a respiratory disorder.
9. The use of claim 8 wherein the respiratory disorder is asthma.
10. The use of either of claims 8 and 9 wherein said inhibitor of GGT is selected from the group consisting of an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; an RNA interfering agent; and a small molecule inhibitor of GGT, wherein said small molecule inhibitor does not include acivicin.
11. The use of any of claims 8-10 wherein said small molecule inhibitor of GGT is selected from the group consisting of a gamma phosphono diester analog of glutamate, L- serine sodium borate complex, and L-methionine sulfoxide.
12. The use of any of claims 8-11 wherein said small molecule inhibitor of GGT is a gamma phosphono diester analog of glutamate.
13. A method of treating a respiratory disorder, the method comprising administering to an individual in need of such treatment an inhibitor of gamma-glutamyl transpeptidase (GGT).
14. The method of claim 13 wherein said respiratory disorder is asthma.
15. The method of either of claims 13 and 14 wherein said inhibitor is selected from the group consisting of : an antibody or antigen-binding fragment thereof that specifically binds GGT; a nucleic acid; and a small molecule inhibitor of GGT, wherein said small molecule inhibitor does not include acivicin.
16. The method of any of claims 13-15 wherein said small molecule is selected from the group consisting of a gamma phosphono diester analog of glutamate, L-serine sodium borate complex, and L-methionine sulfoxide.
17. The method of any of claims 13-16 wherein the gamma phosphono diester analog of glutamate is selected from the group consisting of 2-(N-benzyloxycarbonylamino)-4- phosphonobutanoic acid, benzyl 2-(N-benzyloxycarboxylamino)-4-phosphonobutanoate, benzyl 2-(N-benzyloxycarbonylamino)-4-(dichlorophosphono)butanoate, benzyl 2-(N- benzyloxycarboxylamino)-4-[4-methoxyphenyl(methyl)phosphono]butanoate, benzyl 2- (N- benzyloxycarboxylamino)-4- [methyl(4-methylphenyl)phosphono]butanoate, benzyl2- (N-4-nitrobenzyloxycarbonylamino)-4-[methyl(phenyl)phosphono]butanoate, benzyl 2- (N-benzyloxycarbonylamino)-4-[4-chlorophenyl(methyl)phosphono]butanoate, benzyl 2- (N-benzyloxycarbonylamino)-4-[methyl(4-trifluoromnethylphenyl)phosphono]butanoate, benzyl 2-(N-benzyloxycarbonylamino)-4-[4-cyanophenyl(methyl)phosphono]butanoate; benzyl 2-(N-benzyloxycarbonylamino)-4-[methyl(4-nitrophenyl)phosphono]butanoate, benzyl 2-(N-benzyloxycarbonylamino)-4-[methyl(4- methylumbelliferyl)phosphono]butanoate; N-(2-hydroxybutanoyl)glycine benzyl ester, benzy,2-(N-benzyloxycarbonylamino)-4- { 1 - [N- (benzyloxycarbonylmethyl)carbamoyl]propyl(phenyl)phosphono jbutanoate, Benzyl 2- (N-benzyloxycarbonylamino)-4-{ [3-(benzyloxycarbonylmethyl)phenyl] (methyl)phosphono}butanoate, Benzyl 2-(N-benzyloxycarbonylamino)-4-{ [4- (benzyloxycarbonylmethyl)phenyl](methyl)phosphono}butanoate, 2-Amino-4-[(4- methoxyphenyl)(methyl)phosphono]-butanoic Acid, 2-Amino-4-[methyl(4- methylphenyl)phosphono]butanoic Acid, 2-Amino-4- [methyl(phenyl)phosphono]butanoic Acid, 2-Amino-4-[4- chlorophenyl(methyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- trifluoromethylphenyl)phosphono]-butanoic Acid, 2-Amino-4-[4- cyanophenyl(methyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- nitrophenyl)phosphono]butanoic Acid, 2-Amino-4-[methyl(4- methylumbelliferyl)phosphono]butanoic Acid, 2-Amino-4-{ l-[N- (carboxymethyl)carbamoyl]propyl(phenyl)-phosphono}butanoic Acid, 2-Amino-4-{ [S-Ccarboxymethy^phenylKmethy^phosphonoj-butanoic Acid, and 2-Amino-4-{ [4-(carboxymethyl)phenyl](methyl)phosphono}-butanoic Acid or a pharmaceutically acceptable salt or ester thereof of any of these compounds.
18. The method of any of claims 13-17 wherein the gamma phosphono diester analog of glutamate is 2-amino-4-[methylumbelliferyl)phosphono]butanoic acid, 2-Amino-4-{ [3- (carboxymethyl)phenyl](methyl)phosphono}-butanoic acid, or a pharmaceutically acceptable salt or ester thereof.
19. The method of any of claims 13-18 wherein the nucleic acid comprises an RNAi agent that directs the cleavage of GGT mRNA.
20. The method of any of claims 13-19 wherein said inhibitor is administered in inhaled form.
21. The method of any of claims 13-20 wherein said inhibitor is administered in combination with inhaled glutathione.
22. The method of any of claims 13-21 wherein said inhibitor is administered in combination with a different drug for treatment of said respiratory disorder.
23. The method of any of claims 13-22 wherein said different drug is selected from the group consisting of: zafirlukast, fluticasone propionate, salmeterol, flunisolide, metaproteranol sulfate, triamcinalone acetonide, beclomethasone, trebutaline sulfate, formoterol, cromolyn sodium, methylprednisone, prednisolone sodium phosphate acetate, albuterol sulfate, budesonide, salmeterol xinafoate, montelukast sodium, theophylline, levalbuterol hydrochloride and zileuton.
PCT/US2008/061960 2007-05-03 2008-04-30 Methods and compositions for the treatment of respiratory disease Ceased WO2008137446A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US92747707P 2007-05-03 2007-05-03
US60/927,477 2007-05-03

Publications (1)

Publication Number Publication Date
WO2008137446A1 true WO2008137446A1 (en) 2008-11-13

Family

ID=39651087

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/061960 Ceased WO2008137446A1 (en) 2007-05-03 2008-04-30 Methods and compositions for the treatment of respiratory disease

Country Status (1)

Country Link
WO (1) WO2008137446A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114404426A (en) * 2021-12-17 2022-04-29 杨明 Application of gamma glutamyl transpeptidase inhibitor GGsTop in preparing medicine for treating asthma acute attack and refractory asthma
WO2024018334A1 (en) * 2022-07-22 2024-01-25 Uniwersytet Medyczny w Łodzi Combination comprising a ggt1 inhibitor and a cysltr1 antagonist and use thereof in the treatment of invasive stages of cancer

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001051046A1 (en) * 2000-01-14 2001-07-19 University Of Virginia Patent Foundation Airway alkalinization as therapy for airway diseases
WO2002028869A1 (en) * 2000-10-05 2002-04-11 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, The National Institutes Of Health Gamma-glutamyl transpeptidase inhibitors
US20040101487A1 (en) * 1999-02-18 2004-05-27 Clarke Jeremy Guy Combinations of formoterol and fluticasone propionate for asthma
JP2005080629A (en) * 2003-09-11 2005-03-31 Applied Cell Biotechnologies Inc Anti-inflammatory agent and cytokine inducer, and screening method using cytokine induction.

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040101487A1 (en) * 1999-02-18 2004-05-27 Clarke Jeremy Guy Combinations of formoterol and fluticasone propionate for asthma
WO2001051046A1 (en) * 2000-01-14 2001-07-19 University Of Virginia Patent Foundation Airway alkalinization as therapy for airway diseases
WO2002028869A1 (en) * 2000-10-05 2002-04-11 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, The National Institutes Of Health Gamma-glutamyl transpeptidase inhibitors
JP2005080629A (en) * 2003-09-11 2005-03-31 Applied Cell Biotechnologies Inc Anti-inflammatory agent and cytokine inducer, and screening method using cytokine induction.

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE WPI Week 200527, Derwent World Patents Index; AN 2005-257319, XP002491851 *
HAN ET AL: "gamma-(Monophenyl)phosphono glutamate analogues as mechanism-based inhibitors of gamma-glutamyl transpeptidase", BIOORGANIC & MEDICINAL CHEMISTRY, ELSEVIER SCIENCE LTD, GB, vol. 14, no. 17, 1 September 2006 (2006-09-01), pages 6043 - 6054, XP005570388, ISSN: 0968-0896 *
HAN LIYOU ET AL: "Design, synthesis, and evaluation of gamma-phosphono diester analogues of glutamate as highly potent inhibitors and active site probes of gamma-glutamyl transpeptidase.", BIOCHEMISTRY 6 FEB 2007, vol. 46, no. 5, 6 February 2007 (2007-02-06), pages 1432 - 1447, XP002491849, ISSN: 0006-2960 *
JEAN JYH-CHANG ET AL: "The importance of gamma-glutamyl transferase in lung glutathione homeostasis and antioxidant defense.", BIOFACTORS (OXFORD, ENGLAND) 2003, vol. 17, no. 1-4, 2003, pages 161 - 173, XP002491850, ISSN: 0951-6433 *
LOWRY MATTHEW H ET AL: "Lung lining fluid glutathione attenuates IL-13-induced asthma.", AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY MAY 2008, vol. 38, no. 5, May 2008 (2008-05-01), pages 509 - 516, XP009104502, ISSN: 1535-4989 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114404426A (en) * 2021-12-17 2022-04-29 杨明 Application of gamma glutamyl transpeptidase inhibitor GGsTop in preparing medicine for treating asthma acute attack and refractory asthma
WO2024018334A1 (en) * 2022-07-22 2024-01-25 Uniwersytet Medyczny w Łodzi Combination comprising a ggt1 inhibitor and a cysltr1 antagonist and use thereof in the treatment of invasive stages of cancer

Similar Documents

Publication Publication Date Title
Luoni et al. Whole brain delivery of an instability-prone Mecp2 transgene improves behavioral and molecular pathological defects in mouse models of Rett syndrome
Zhen et al. IL-13 and epidermal growth factor receptor have critical but distinct roles in epithelial cell mucin production
US20220331332A1 (en) Methods and pharmaceutical compositions for the treatment of th2 mediated diseases
US20110244059A1 (en) Inhibiting obesity progression by inhibiting adipocyte differentiation with a pre-adipocyte autophagy inhibitor
US9708611B2 (en) RNA targeting in alpha-synucleinopathies
WO2021231887A1 (en) Compositions and methods of detection of pre-symptomatic als
EP2942060A1 (en) Use of Protein Kinase C Delta (PKCD) Inhibitors to Treat Diabetes, Obesity and, Hepatic Steatosis
JP2015522528A (en) Method and pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease
TW202402790A (en) Methods for reducing respiratory infections
Zhang et al. DNA hypomethylation of Syk induces oxidative stress and apoptosis via the PKCβ/P66shc signaling pathway in diabetic kidney disease
WO2008137446A1 (en) Methods and compositions for the treatment of respiratory disease
US11857531B2 (en) Combination mast cell inhibition for treatment of BPH/LUTS
US20110250260A1 (en) Inhibition of brain enzymes inolved in cerebral amyloid angiopathy and macular degeneration
US20240415802A1 (en) Genistein for asthma treatment
EP4392556A1 (en) Compositions and methods for inhibiting ?lpha-1 antitrypsin expression
US20130309238A1 (en) Signal transduction pathway modulation
CN115944740B (en) Application of targeting HIF-1/CBS in triple-negative breast cancer
US20220257614A1 (en) Use of 12-lipoxygenase inhibitors in the treatment of covid-19
WO2024126765A1 (en) Rnai-based therapies targeting claudin-1 for the treatment and prevention of fibrotic diseases
US8633161B2 (en) Therapeutic agents for the treatment of leukemia
CN103432592A (en) Treatment of intestinal conditions by a compound which causes RNA interference
US20130236480A1 (en) Transglutaminase 2 inhibitors for use in the prevention or treatment of rapidly progressive glomerulonephritis
WO2023152369A1 (en) Nucleic acid mir-9 inhibitor for the treatment of cystic fibrosis
Wei et al. miR-872 Protection Against Renal Ischemia-Reperfusion Injury via Targeting HMOX1
US20250228918A1 (en) Methods of controlling body weight and/or energy expenditure

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08754965

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08754965

Country of ref document: EP

Kind code of ref document: A1