WO2008128233A1 - Methods and compositions concerning the vegfr-2 gene (kinase domain receptor, kdr) - Google Patents

Methods and compositions concerning the vegfr-2 gene (kinase domain receptor, kdr) Download PDF

Info

Publication number
WO2008128233A1
WO2008128233A1 PCT/US2008/060381 US2008060381W WO2008128233A1 WO 2008128233 A1 WO2008128233 A1 WO 2008128233A1 US 2008060381 W US2008060381 W US 2008060381W WO 2008128233 A1 WO2008128233 A1 WO 2008128233A1
Authority
WO
WIPO (PCT)
Prior art keywords
vegfr
patient
cancer
sequence
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/060381
Other languages
French (fr)
Inventor
Xin Ye
Wanqing Liu
Elisa Cerri
Federico Innocenti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Chicago
Original Assignee
University of Chicago
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Chicago filed Critical University of Chicago
Publication of WO2008128233A1 publication Critical patent/WO2008128233A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention relates generally to the field of pharmacogenomics, oncology, and angiogenesis. More particularly, it concerns methods and kits related to variants in the vascular endothelial growth factor receptor 2 (VEGFR-2) gene (kinase insert domain receptor, KDR) and its gene products.
  • VEGFR-2 vascular endothelial growth factor receptor 2
  • Angiogenesis is an essential event in tumor growth and metastatization.
  • Tumor cells produce vascular endothelial growth factor (VEGF) to stimulate the proliferation of adjacent vascular endothelial cells via activating their main receptor, VEGFR-2.
  • VEGFR- 2 mediates all cellular responses to VEGF (i.e., mitogenic, angiogenic and permeability- enhancing effects) to establish a tumor's neo vasculature.
  • VEGF-2 vascular endothelial growth factor
  • VEGFR-2 mediates all cellular responses to VEGF (i.e., mitogenic, angiogenic and permeability- enhancing effects) to establish a tumor's neo vasculature.
  • VEGFR-2 is also expressed in cancer cells and, through its activation by VEGF, it sustains an autocrine loop; by this mechanism, tumors are capable of stimulating their own growth (Ferrara et al, 2003).
  • VEGF and VEGFR-2 Increased expression and activity of VEGF and VEGFR-2 in both endothelial and cancer cells is a hallmark of several tumors. Moreover, VEGF and VEGFR-2 over- expression is thought to play a significant role in the development of metastases. For these reasons, several new anticancer agents targeting the VEGF/VEGFR-2 pathway have been approved, and others are undergoing testing in clinical trials. These drugs inhibit tumor growth not only by reducing the microvasculature in the tumor, but also by altering the autocrine loop of cancer cells via direct inhibition of VEGFR-2 expressed on their membranes.
  • the VEGF -blocking antibody bevacizumab is used in the treatment of metastatic colorectal cancers (Hurwitz et al, 2004).
  • bevacizumab is being also evaluated in phase III trials of metastatic breast, lung, and pancreatic cancer. Due to its promising results in lung cancer, bevacizumab is expected to gain FDA approval for the treatment of this disease. In addition to blocking VEGF, inhibition of VEGFR-2 is also another attractive therapeutic strategy. Many compounds have been developed to inhibit VEGFR-2. Among them, sorafenib is a tyrosine kinase inhibitor that has been recently approved for the treatment of metastatic kidney cancer.
  • VEGFR-2 gene mutations have been identified in colorectal cancer cell lines (Bardelli et al, 2003), but their existence and prevalence of these mutations in other cancer types is unknown. More importantly, their functional consequences have never been investigated.
  • the VEGFR-2 gene has not yet been sequenced in tumor samples and there are no data on somatic mutations in this gene. Moreover, determining which tumors and which patients are going to respond to anti-angiogenic therapy is an area of great interest (Iqbal and Lenz, 2004). Hence, identifying the biological markers of response to anti-angiogenic therapy would allow treatment of those patients who would likely benefit from therapy.
  • the purpose of pharmacogenetic studies is to improve the outcome of drug therapy by identifying genetic markers of antitumor response (Innocenti and Ratain, 2002). At present, no markers predictive of the response of patients to anti-angiogenesis therapy have been identified (Iqbal and Lenz, 2004).
  • KDR KDR
  • angiogenesis inhibitors are a growing class of therapeutics, there is a need to tailor therapies for patients with respect to this category of drugs.
  • the present invention is based on several pieces of data regarding the human VEGFR-2 genomic sequence. Re-sequencing of portions of the VEGFR-2 genomic sequence both identified new polymorphisms and confirmed previously known polymorphisms. Moreover, sequencing of the VEGFR-2 gene in breast and lung cancer samples identified polymorphisms and mutations (somatic/acquired and germline). These variants of the VEGFR-2 gene may affect VEGFR-2 expression levels, the level of risk of cancer or other angiogenesis-related disease or condition in an individual, prognosis of a patient with respect to an angiogenesis-related disease or condition (independently of treatment-predictive markers), and/or likelihood of efficacy and/or toxicity with respect to an anti-angiogenic therapy. In particular, the inventors report that -271G>A is a polymorphic variant that shows a significant decrease in expression when an "A" is present at that position. Other SNPs show a significant decrease in polypeptide activity.
  • the present invention concerns methods for assessing expression or activity of vascular endothelial growth factor receptor 2 (VEGFR-2) in a patient with an angiogenesis-dependent condition or disease comprising determining the presence of one or more variants in a VEGFR-2 allele (KDR) in a biological sample from the patient.
  • VEGFR-2 vascular endothelial growth factor receptor 2
  • methods involve assessing specifically VEGFR-2 expression, which is indicative of activity.
  • methods for evaluating prognosis of a patient with an angiogenesis-dependent disease or condition comprising determining the presence of a polymorphism in a VEGFR-2 allele in a biological sample from the patient.
  • there are methods for predicting toxicity or efficacy of an anti-angiogenic therapy comprising determining the presence of a variant in a VEGFR-2 allele in biological sample from a patient who has been or may be treated with an anti- angiogenic therapy (which can also be spelled "antiangiogenic therapy").
  • Additional aspects of the invention include methods for predicting risk of having or developing an angiogenesis-related disease or condition comprising determining the presence of a variant in a VEGFR-2 allele in biological sample from a patient.
  • the present invention also relates to methods for optimizing dosage of an anti- angiogenic therapy comprising a) obtaining a biological sample from a patient who will be treated with an anti-angiogenic therapy; b) having the presence of at least one variant in a VEGFR-2 allele determined from the biological sample; c) being notified of the presence of the at least one variant; and, d) optimizing dosage of the anti-angiogenic therapy.
  • the present invention also pertains to methods of optimizing treatment for an angiogenesis-related disease or condition by providing information on whether to treat with an anti-angiogenic therapy at all.
  • It comprises a) obtaining a biological sample from a patient who may be treated with an anti-angiogenic therapy; b) having the presence of at least one variant in a VEGFR-2 allele determined from the biological sample; c) being notified of the presence of the at least one variant; and, d) administering or not administering an anti-angiogenic therapy to the patient depending the status of variants in the VEGFR-2 allele of the patient.
  • the best option for a patient may be to forego an anti-angiogenic treatment and/or to treat the patient with a non-anti-angiogenic treatment.
  • variants include but are not limited to nucleotide deletions, nucleotide insertions, and nucleotide substitutions.
  • variants of the invention comprise somatic mutations, single nucleotide polymorphisms (SNPs), and polymorphisms involving 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, or more nucleotides.
  • genetic variants may alter the expression of the VEGFR-2 gene.
  • genetic variants may alter the transcription of VEGFR-2 RNA, alter the splicing of VEGFR-2 RNA, alter the stability of VEGFR-2 RNA or alter the translatability of VEGFR-2 RNA.
  • a genetic variation results in altered expression of the VEGFR-2 gene product, particularly the protein.
  • polymorphisms may also alter the coding region of the VEGFR-2 gene, thus variants may also result in premature stop codons in the VEGFR-2 open reading frame, missense mutations that alter the polypeptide coding region of VEGFR-2, synonymous mutations in regions containing exonic splicing enhancers or exonic splicing inhibitors (hence affecting constitutive splicing), and synonymous mutations altering codon usage during RNA synthesis.
  • polymorphisms in the VEGFR-2 gene may be in 5' or 3' sequences flanking the coding region, or in the intron or exons of the VEGFR-2 gene.
  • VEGFR-2 variants have been identified herein, however the current invention is no way limited to these variants.
  • These variants in the VEGFR-2 gene or allele include, but are not limited to, -3601 G>A, -3538 C>T, -2886 T>C, -2854 A>C, -2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 G>A, -2008 A>G, -1973 (TAAA) 6 - H , -1942 A>G, -1918 G>A, -1846 OT, -1361 G>T, -1067 OA, -906 T>C, -679 G>A, -645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, -2
  • Polymorphisms that provide for lower expression of KDR (-271 G>A) or that lead to a KDR polypeptide with less activity are specifically contemplated as embodiments of the invention.
  • the sequence at position -271 is determined. Determining there is a "G" at position -271 indicates a higher VEGFR expression than if an "A" had been determined at position -271.
  • An "A" at position -271 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "G” at position -271.
  • the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
  • an "A" at position -271 of the VEGFR-2 gene is also indicative of decreased risk of toxicity and decreased efficacy of an anti-angiogenic therapy, as well as a reduced dosage for that therapy, relative to a subject having a "G" at position -271.
  • the sequence at position 6648 is determined.
  • a “T” at position 6648 is represented by the patient having the SNP 1 polymorphism, where a "C” at position 6648 is the wild type. Determining a “C” at position 6648 indicates a higher VEGFR expression than if a "T” had been determined at position 6648.
  • a “T” at position 6648 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "C” at position 6648.
  • the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
  • a "T" at position 6648 of the VEGFR-2 gene indicates lower receptor activation.
  • a "T" at position 6648 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "C" at position 6648.
  • a "T" at position 6648 indicates a worse cancer prognosis.
  • a "T" at position 6648 is predictive of lower efficacy of an anti-angiogenesis drug.
  • a "T" at position 6648 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
  • the sequence at position 18487 is determined.
  • a “T” at position 18487 is represented by the patient having the SNP 4 polymorphism, where a "A” at position 18487 is the wild type. Determining a "A” at position 18487 indicates a higher VEGFR expression than if an "T” had been determined at position 18487.
  • a “T” at position 18487 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "A" at position 18487.
  • the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
  • a "T" at position 18487 of the VEGFR-2 gene indicates lower receptor activation.
  • a "T" at position 18487 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "A" at position 18487.
  • a "T" at position 18487 indicates a worse cancer prognosis.
  • a "T" at position 18487 is predictive of lower efficacy of an anti-angiogenesis drug.
  • a "T" at position 18487 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
  • the sequence at position 18515 is determined.
  • a “C” at position 18515 is represented by the patient having the SNP 5 polymorphism, where a "T” at position 18515 is the wild type. Determining a "T” at position 18515 indicates a higher VEGFR expression than if an "C” had been determined at position 18515.
  • a “C” at position 18515 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "T” at position 18515.
  • the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
  • a "C" at position 18515 of the VEGFR- 2 gene indicates lower receptor activation.
  • a "C" at position 18515 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "T" at position 18515.
  • a "C" at position 18515 indicates a worse cancer prognosis.
  • a "C” at position 18515 is predictive of lower efficacy of an anti-angiogenesis drug.
  • a "C" at position 18515 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
  • a variant is associated with an increase in expression of, of at least, or of at most a 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
  • determining the sequence at position X means that the nucleotide at that position is directly or indirectly determined, i.e., identified. In some embodiments, the sequence at a particular position is determined, while in other embodiments, what is determined at a particular position is that a particular nucleotide is not at that position.
  • Positions are indicated by conventional numbering where a negative sign (-) refers to nucleotides upstream (5') from the transcriptional start site (+1) (these sequences are in the promoter), unless otherwise designated.
  • a sequence in the 5' untranslated region (5' UTR) may also be referred to by a negative sign, and in these cases, the positioning is with respect to the translated portion, where the first nucleotide of a codon is understood as +1.
  • Positions downstream of the translational start site may or may not have a plus sign (+).
  • identification of a position downstream of the transcriptional start site refers to a position with respect to only the coding region of the gene, that is, its exons and not the introns. In some instances, positions within introns are referred to and the numbering for these positions is typically with respect to that intron alone, and not the gene as a whole.
  • gene amplification in the tumor may be assessed. Gene amplification may be assessed by various methods known to those of skill in the art, including but not limited to fluorescence in situ hybridization (FISH) or quantitative RT- PCR. In some embodiments, the presence of a -271, SNP 1, SNP 4, and/or SNP 5 variant may predict the occurrence of VEGFR-2 gene amplification in the tumor.
  • FISH fluorescence in situ hybridization
  • SNP 1 SNP 4
  • SNP 5 variant may predict the occurrence of VEGFR-2 gene amplification in the tumor.
  • methods also include obtaining a sample from a patient and using the sample to determine one or more sequences or to evaluate polymorphisms in the VEGFR-2 gene.
  • the sample may contain blood, serum, or a tissue biopsy, as well as buccal cells, mononuclear cells, endothelial cells, and/or cancer cells.
  • an increased copy number is correlated with the presence of the polymorphism identified in this application.
  • Determining a sequence may be determined directly or indirectly.
  • a direct determination involves performing an assay with respect to that position(s).
  • An indirect determination means that a determination is based on data regarding a different position, particularly by evaluating the sequence of a position in linkage disequilibrium (LD) with the sequence. In some cases, more than one position in linkage disequilibrium with the sequence is evaluated. Therefore, in some embodiments of the invention, a haplotype is evaluated. In these embodiments, a determination of one or more sequences in one or both alleles of a gene in the haplotype is included in methods of the invention.
  • LD linkage disequilibrium
  • the sequence at position -271 is determined by determining the sequence of a polymorphism, which may or may not be a SNP, in linkage disequilibrium with position -271.
  • the polymorphism in linkage disequilibrium with position -271 is at position -367.
  • the patient being evaluated is Caucasian, African-American, or Asian and the variants being evaluated are from one or more groupings identified in FIG. 4 for that race.
  • the patient is Caucasian and the polymorphism in linkage disequilibrium with position -271 is at position -906 or position -607.
  • the patient is Asian and the polymorphism in linkage disequilibrium with position -271 is at position -906. In still further embodiments, the patient is African- American and the polymorphism in linkage disequilibrium with position -271 is at position -906, -607, or -645.
  • methods involve determining a variant in a VEGFR-2 gene by evaluating a nucleic acid, either DNA or RNA.
  • a variant can be determined by evaluating the VEGFR-2 polypeptide.
  • the nucleic acid is evaluated using sequencing, microsequencing, allele-specific hybridization, amplification, or pyrosequencing.
  • the DNA is amplified using the polymerase chain reaction (PCR).
  • the primers used for amplification may be labeled for instance with radioactive, fluorescent, or luminescent label.
  • SNPs or other variants may be directly detected by a variety of methods known to those in the art, including but not limited to, DNA sequencing or differential hybridization. Additionally, indirect methods of detection may be used to determine the presence of a polymorphism, for example, detection of changes in a fluorescent, colorimetric, or radioactive signal.
  • the variant is at position -3601, -3538, -2886, -2854, -2806, -2766, -2756, - 2750, -2628, -2502, -2455, -2406, -2008, -1973, -1942, -1918, -1846, -1361, -1067, -906, -679, -645, -607, -565, -425, -417, -367, -319, -271, -1, 1107, 1367, 3684, 4068, 4238, 3684, 4423, 4442, 4459, 6536, 6590, 6614, 6648, 9485, 11005, 11222, 11259, 11903, 14752, 16583, 16925, 17070,
  • the variant is at position -271.
  • the variant may change protein function; of the 8 nonsynonymous SNPs found in the protein (shown in FIG. 2), R106W, Q472H and C482E may be evaluated in specific embodiments of the invention.
  • the variant is at position -3601, -2886, -2854, -2806, -2766, -2750, -2628, -2455, -906, -645, -607, -565, -425, -367, -319, -271, 4459, 11005, 11222, 11903, 16599, 18487, 18515, 22716, 23408, 26429, 26626, 26856, 26896, 27360, 28915, 29103, 30302, 36229, 42868, or 45380 or any combination thereof.
  • the variant is at position -565, -271, -1, 11903, 18487, 23408, 30302, 36229, 45107, or any combination thereof, or at position -3757, -3651, 6536, 6590, 6114, 6648, 20470, 20498, 22820, 23336, 27534, 29636, or 30375, or any combination thereof.
  • the present invention concerns patients who have, have been diagnosed with, and/or are at risk for one or more angiogenesis-dependent diseases or conditions.
  • An angiogenesis-dependent disease or condition is one whose pathology is dependent on angiogenesis, and thus, anti-angiogenic therapies (i.e., a therapy that inhibits, prevents, or reduces angiogenesis) may be employed to the patient's benefit (either as a preventative and/or therapeutic).
  • angiogenesis-dependent condition or disease is cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; or wound granulation.
  • cancer rheumatoid arthritis
  • psoriasis ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque n
  • methods also include identifying a patient who is a candidate for an anti-angiogenesis drug generally or for a specific anti- angiogenesis drug, such as one disclosed herein. Methods are also understood as being useful with patients who is being considered for treatment with an anti-angiogenesis drug or for a patient who has failed or shown resistance to a previous anti-angiogenesis or cancer therapy.
  • a patient has an angiogenesis-dependent cancer.
  • cancers include a solid tumor, leukemia, tumor metastases, or benign tumor.
  • the cancer is a solid tumor.
  • cancer is lung cancer or breast cancer.
  • Such cancers may be malignant.
  • cancers may be metastatic or metastasized, and they may be the primary tumor or a secondary tumor.
  • the cancer is a benign tumor, such as a hemangioma, acoustic neuroma, neurofibroma, trachoma, or pyogenic granuloma.
  • some methods of invention may be applied specifically to cancer patients in some embodiments or a patient at risk for cancer.
  • Methods of the invention provide ways of identifying patients whose genotype leads to lower expression of KDR compared to a patient who doesn't have that genotype or leads to a KDR polypeptide with less activity compared to a patient who doesn't have that genotype.
  • methods of predicting efficacy of an antiangiogenic drug are provided.
  • a patient whose genotype which leads to lower KDR expression or lower KDR activity are predicted to be less responsive to VEGFR2 inhibitor drugs or require higher doses of VEGFR2 inhibitor drugs than a patient who does not have that genotype.
  • Specific VEGFR2 inhibitor drugs include CAI,
  • CM101/ZDO 101 Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190,
  • AZD2171 CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP,
  • VEGFR2 inhibitors that do not have activity against multiple tyrosine kinase receptors are contemplated where in other embodiments the VEGFR2 inhibitor targets multiple tyrosine kinase receptors. In other embodiments, the
  • VEGFR-2 inhibitor drug targets the VEGFR-2 ligand.
  • the VEGFR-2 ligand targets the VEGFR-2 ligand.
  • VEGFR-2 inhibitor is Avastin.
  • Embodiments of the invention further include adjusting dosage (concentration and/or administration (timing and/or frequency)) or route of administration of the anti- angiogenesis therapy, or altering the treatment regimen overall. In some cases, the time between treatment regimens may be altered. Therefore, in certain embodiments, the patient has undergone or may undergo anti-angiogenic therapy.
  • a patient is given a different dosage than he or she would have otherwise received had the genotyping not been performed.
  • a typical dosage is adjusted for a particular person (individualized therapy).
  • a patient may be considered for anti-angiogenic therapy or already be on anti-angiogenic therapy.
  • the anti-angiogenic therapy is CAI, CM101/ZDO 101, Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190, AZD2171, CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP, AG-013958, JSM6427, TG100801, ATG3, Sirolimus, OT-551, pazopanib, AG-0736, cilengitide,
  • the presence of the variant can be predictive of serum levels of soluble VEGFR-2.
  • the level of serum KDR may be used to indicate efficacy and/or toxicity.
  • the presence of the variant can be also predictive of other markers (hypertension, proteinuria, and laboratory abnormalities) that might be related to the inhibition of KDR by anti-angiogenesis therapy.
  • these other markers may be undergoing development as potential markers of efficacy and/or toxicity.
  • a marker may be identified by lab abnormalities.
  • assessments or predictions of activity and response are relative with respect to patients having a different genotype at the relevant position(s).
  • the effect will be considered additive with respect to those indicators that identify a greater or higher risk of toxicity.
  • a person of ordinary skill in the art will use these different indicators in considering adjustments in dosage that might reduce the risk of toxicity in the patient.
  • Methods of the invention also include monitoring for toxicity or adverse events once the anti-angiogenic therapy is administered, and possibly, adjusting or modifying dosage based on those results.
  • Toxicity indicators or indicators of adverse events secondary to treatment with anti-angiogenesis inhibitors include hypertension, skin rush, bleeding complications, cardiovascular accidents, deep venous thrombosis, gastrointestinal perforation, diarrhea, neutropenic fever, other hematologic toxicities, as well as other non listed non-hematologic toxicities.
  • methods involve monitoring for drug efficacy to determine if drug dosages or regimens should be increased in amount and/or frequency.
  • methods can involve knowing the sequence of one or more variants instead of detecting or determining the polymorphism.
  • a doctor or clinician who is selecting the most appropriate therapy or optimizing its dosages need not perform the polymorphism himself/herself; the doctor may have one or more sequences determined and then use the information accordingly.
  • a method of the invention comprises the steps of obtaining a DNA sample from an individual, amplifying the DNA comprising all or part of the VEGFR-2 genomic region and, determining the presence of a variant in the DNA.
  • the method may comprise amplifying all or part of the VEGFR-2 gene 5' flanking sequence, intron 1, intron 2, exon 3, intron 3, intron 5, intron 6, exon 7, exon 9, intron 9, intron 10, exon 11, intron 12, exon 13, intron 13, exon 14, exon 15, intron 15, intron 16, intron 17, exon 18, intron 18, intron 19, exon 20, intron 20, exon 21, intron 21, intron 22, intron 25, intron 26, intron 27, intron 28, intron 29, 3' UTR, and/or the 3' flanking sequence and determining the presence of a variant in the amplified sequence.
  • the invention may comprise detecting a genetic variant within the VEGFR-2 genomic region from germline DNA of patients.
  • the invention may involve detecting a genetic variant from tumor DNA of patients; in this case, the invention may involve detecting also somatic/acquired mutations.
  • variants in linkage disequilibrium may be evaluated, as are identified in FIG. 4A-C.
  • the patient being evaluated is Caucasian, African-American, or Asian and the variants being evaluated are from one or more groupings identified in FIG. 4 for that race.
  • a patient's race is known, in which case, it may or may not be considered when employing methods of the invention. In other embodiments, a patient's race is not known and/or is not considered when employing methods of the invention.
  • a biological sample is obtained from a patient.
  • the entity evaluating the sample for a variant did not directly obtain the sample from the patient. Therefore, methods of the invention involve obtaining the sample indirectly or directly from the patient.
  • a doctor, medical practitioner, or their staff may obtain a biological sample for evaluation.
  • the sample may be analyzed by the practitioner or their staff, or it may be sent to an outside or independent laboratory.
  • the medical practitioner may be cognizant of whether the test is providing information regarding a nucleic acid or polypeptide sequence, or the medical practitioner may be aware that the test indicates directly or indirectly that the test was positive or negative for a variant or polymorphism.
  • the evaluation may indicate simply that a sample is positive or negative for a particular polymorphism or protein or that expression or activity of KDR is decreased or not, relative to someone with a different genotype at the evaluated positions.
  • Suitable biological samples include any sample with genomic nucleic acids, such as blood, serum, PBMC, semen saliva, tears, urine, fecal material, sweat, a buccal sample, tissue sample, skin and hair.
  • the biological sample is a biopsy from a tumor.
  • the biological sample is from a biopsy of tissue that may or may not be cancerous, tumorigenic, and/or metastatic. It is also contemplated that biological samples may be placed on a slide for histological analysis on either the protein or nucleic acid level. In such cases, the sample may be fixed or not fixed. Such methods are well known to those of skill in the art.
  • the medical practitioner may know the relevant information that will allow him or her to determine whether the patient has the phenotype associated with a particular genotype. It is contemplated that, for example, a laboratory conducts the test to assess whether a patient has one or more polymorphisms or variants.
  • Laboratory personnel may report back to the practitioner with the specific result of the test performed or the laboratory may simply report that the patient is positive for a particular phenotype.
  • the patient from whom a biological sample is obtained may be identified as in need of anti-angiogenesis treatment or have symptoms of a disease that is potentially treatable with an anti-angiogenesis treatment. Moreover, some methods of the invention involve identifying a patient such patients.
  • kits for achieving methods of the invention. It is contemplated that kits can include particular components in suitable containers for uses consistent with the invention.
  • the present invention further concerns compositions that can be used to determine the sequence at the variants discussed above or any other sequence in LD with it.
  • the nucleic acid is a primer for amplifying the sequence.
  • the nucleic acid is a specific hybridization probe for detecting the sequence.
  • a probe can also be adjacent to the specific hybridization probe for a sequence.
  • the specific hybridization probe can be comprised in an oligonucleotide array or microarray.
  • the invention further comprises a kit for screening individuals for variation in VEGFR-2 activity by detecting variants in the VEGFR-2 gene.
  • kits for evaluating vascular endothelial growth factor receptor 2 (VEGFR-2) expression comprising oligonucleotides to evaluate at least two variants in a VEGFR-2 allele in biological sample.
  • the kit comprising primers for amplifying DNA in a region comprising all or part of the VEGFR-2 gene or allele and/or specific hybridization probes for detecting any of the VEGFR-2 variants.
  • the kit also contains deoxynucleoside triphosphates, buffers, labels for detecting the polymorphisms and instructions.
  • Kits may involve compositions that can detect variants at positions -3601, -3538, - 2886, -2854, -2806, -2766, -2756, -2750, -2628, -2502, -2455, -2406, -2008, -1973, - 1942, -1918, -1846, -1361, -1067, -906, -679, -645, -607, -565, -425, -417, -367, -319, - 271, -1, 1107, 1367, 3684, 4068, 4238, 3684, 4423, 4442, 4459, 6536, 6590, 6614, 6648, 9485, 11005, 11222, 11259, 11903, 14752, 16583, 16925, 17070, 17171, 17186, 17366, 18465, 18487, 18515, 19948, 20220, 20470, 20498, 20679, 22716, 2
  • a nucleic acid included in a kit can detect the variant at position -271. In other particular embodiments, a nucleic acid included in a kit can detect the variant at position 6648. In other embodiments, a nucleic acid included in a kit can detect the variant at position 18487. In still further embodiments, a nucleic acid included in a kit can detect the variant at position 18515.
  • the invention further comprises a kit for screening individuals to detect variants in the VEGFR-2 gene, the kit comprising primers for amplifying DNA in a region comprising all or part of a the VEGFR-2 gene.
  • the kit also contains deoxynucleoside triphosphates, buffers, labels for detecting the polymorphisms and instructions.
  • primers are part of a kit. Individual primers or primers pairs as disclosed in the Examples may be included in certain kit embodiments. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more different primers with a sequence of SEQ ID NOs:4-141 may be part of a kit. It is contemplated that in some embodiments, specific hybridization probes are comprised in an oligonucleotide array or microarray. Primers may be comprised in a multi-well assay plate.
  • VEGFR-2 gene and “KDR” may be used interchangeably throughout this application.
  • FIG. 1 VEGFR-2 gene (KDR) structure showing the sequenced regions.
  • FIG. 2 VEGFR-2 (1357 amino acids): nonsynonymous variants and their frequency (gray highlights the SNPs that are predicted by SIFT to have functional changes).
  • FIG. 3 Comparison of resequencing data with HapMap data. Frequency of VEGFR-2 gene variants that have been found also in HapMap.
  • FIG. 4A-C Tagging SNPs for the three ethnic groups. Parameters are r2 of 0.8 and 10% cut-off for allele frequency.
  • FIG. 5A-C LD plot for three ethnic groups.
  • FIG. 6 Luciferase activity levels relative to the internal control.
  • FIG. 7 VEGFR-2 genomic sequence, from 4 kb before the start of 5' UTR region, to 1 kb after the end of 3' UTR. Shaded portion shows the start point of "ATG”; the "A” is +1. All the exon regions and UTR regions are capitalized. The underlined sequence is the core promoter region.
  • FIG. 8 Table showing different VEGFR-2 variants. Those variants relevant to
  • Cluster-buster are -3538, 9485, 16599, 16925, 33738, 33828, 44123, 44189, and 44306.
  • FIG. 9 Association between the -271G>A genotype and VEGFR-2 protein expression in 101 stage I-II NSCLC.
  • FIG. 10 VEGF-Ai 64 induced VEGFR-2 activation in Hek 293 cells tranfected with VEGFR-2 SNPs.
  • pBE-K868M is the negative control (wt-);
  • pcDNA5-FRT VEGFR-2 is the wild-type (wt+).
  • Host endothelial cells are stimulated by tumor growth factors to produce neovessels providing blood supply to the growing tumor.
  • the angiogenesis process is an important component of tumor growth and metastatization (Folkman, 2002), and is mediated by a complex interplay between pro- and anti-angiogenesis factors in the endothelial cells (Collins and Hurwitz, 2005; see below the VEGF pathway from the Pharmacogenetics and Pharmacogenomic Knowledge (on the World Wide Web at pharmgkb.org/search/pathway/vegf/vegf.jsp).
  • VEGF vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • the VEGF family consists of six glycoproteins, including VEGF-A, -B, -C, - D, -E, and the placental growth factor.
  • VEGF family members mediate their effects by binding to one or more VEGF receptors, with resultant activation of the receptor's intracellular tyrosine kinase domain.
  • VEGF-A commonly referred as VEGF, can be secreted by a variety of cells and its activity is mediated mainly through two receptors, VEGFR-I and -2.
  • VEGFR-2 is the most important receptor of VEGF; it stimulates endothelial cell proliferation and migration via its tyrosine kinase activity, whereas VEGFR-I does not affect proliferation (Veikkola et al, 2000). In solid tumor angiogenesis, VEGF and VEGFR-2 are regarded as the most critical endothelial cell ligand and receptor, respectively.
  • VEGFR-2 mediates all endothelial cellular responses to VEGF ⁇ i.e., mitogenic, angiogenic and permeability-enhancing effects) to establish a tumor's neovasculature (Meyer et al, 1999; Wise et al, 1999; Gille et al, 2001).
  • VEGFR-2 is expressed predominantly on endothelial cell (Robinson and Stringer, 2001), and is thought to play a significant role in the development of metastases (Iqbal and Lenz, 2004).
  • VEGFR-2 expression levels are low in normal tissues and only increase in pathological states when neovascularization occurs, including tumor formation.
  • VEGF and VEGFR-2 staining in colon tumor endothelia correlates with tumor growth rate, micro-vessel density/proliferation, and tumor metastatic potential (Takahashi et al, 1995).
  • VEGFR-I and -2 were upregulated in liver metastases compared to adjacent nontumorous liver tissue (Warren et al, 1995).
  • VEGFR-2 status is a significant predictor of tamoxifen response (Ryden et al, 2005).
  • Differences in VEGFR-2 expression and/or activity among cancer patients can affect the antitumor response of agents interfering with the VEGF- VEGFR-2 pathway, and such variability has a genetic basis that may be predicted by characterizing VEGFR-2 gene variation in the population and its functional effects.
  • VEGF- VEGFR-2 pathway Several new anticancer agents interfering with the VEGF- VEGFR-2 pathway have been developed and are undergoing testing in clinical trials. Some of these molecules are antibodies ⁇ e.g., bevacizumab) and soluble receptors targeting the VEGF ligand. Recently, the anti- VEGF blocking antibody bevacizumab has been approved by the FDA for the treatment of metastatic colorectal cancer (Hurwitz et al, 2004). At present, bevacizumab is being also evaluated in phase III trials for metastatic breast cancer, non-small cell lung cancer, pancreatic cancer and renal cell carcinoma, and it is expected to be approved for the treatment of non-small cell lung cancer.
  • bevacizumab is being also evaluated in phase III trials for metastatic breast cancer, non-small cell lung cancer, pancreatic cancer and renal cell carcinoma, and it is expected to be approved for the treatment of non-small cell lung cancer.
  • VEGFR-2 Due to the central role of VEGFR-2 in the angiogenesis pathway, blockade of VEGFR-2 is a highly attractive therapeutic strategy.
  • the efficacy of VEGFR-2 inhibitors might be affected by differences in the ligand binding property of the receptor and its tyrosine kinase activity.
  • gene variation information is used to predict the risk of severe toxicity of irinotecan (Innocenti et al, 2004) and 6-mercaptopurine (Evans et al, 2001), and the labels of these two drugs have been recently revised to indicate the inherited risk for patients.
  • gene variation information has been strongly associated with tamoxifen survival (Jin et al, 2005) and gefitinib response (Lynch et al, 2004; Paez et al, 2004).
  • Pharmaco genetic studies to predict patient's response to drug therapy rely on the genetic information available on genes playing an important role in the drug pharmacokinetics and targets of mechanisms of action.
  • the targets of anticancer therapy are expressed in normal tissue, like VEGFR-2, germline DNA variation that is correlated with changes in expression and/or function of the target might significantly affect drug antitumor activity.
  • KDR kinase insert domain receptor
  • KDR haplotype structure cannot rely on the scarce information provided by HapMap, as the density of the surveyed sequence of KDR (average spacing of 4 Kb) is not sufficient to provide an accurate estimate of the haplotype-tagging SNPs.
  • Other SNPs at intermediate-high frequency have been deposited into the dbSNP database (World Wide Web at ncbi.nlm.nih.gov/SNP). A few of them were genotyped in a case-control study of Kawasaki disease, and an intron 2 variant seems to have a silencer effect on gene transcription in luciferase assays (Kariyazono et ah, 2004). The functional effects of other variants and their haplotypic combinations are unknown.
  • dbSNP data are not an accurate reflection of the extent of variation in a certain gene due to a considerable rate of false positives and false negatives.
  • UGTlA gene Grimsley et ah, 2003
  • the differences in allele frequencies and haplotypic composition of the KDR gene among Caucasians, Asians, and African Americans have not been described in detail. As population structure has been shown to affect phenotypic characterization in genetic association studies (Pritchard et al, 2000), this information is crucial to characterize the KDR genetic variation in individuals with different ethnic backgrounds.
  • VEGFR-2 plays a significant role in angiogenesis.
  • Angiogenesis-related diseases or conditions include, but are not limited to, cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation.
  • V ⁇ GFR-2 has been targeted for anti-angiogenic therapy. Consequently, such therapies may be impacted by the status of VEGFR-2. These therapies include, but are not limited to, the therapies listed in Table 1.
  • CAI (inhibitor of calcium influx) — NCI]; ABT-627 [(endothelin receptor antagonist)-- Abbott/NCI]; CM101/ZDO 101 [(group B Strep toxin that selectively disrupts proliferating endothelium by interaction with the CM201 receptor)— CarboMed/Zeneca]; Interleukin-12 [(induction of interferon- ⁇ , down-regulation of IL-10, induction of IP-10) ⁇ M. D.
  • IM862 [(blocks production of VEGF and bFGF, increases production of the inhibitor IL- 12)— Cytran] ; PNU- 145156E [(blocks angiogenesis induced by Tat protein) ⁇ Pharmacia & Upjohn]; Neovastat [(AE-941; Aeterna Laboratories, Quebec City, Canada)]; SUl 1248 (inhibits the TK activity of VEGF-R, platelet-derived growth factor receptor (PDGF-R), c-kit, and flt3); Suramib; bevacizumab (Avastin, Genentech); endostatin; radiotherapy; sorafenib; sunitinib; vatalanib; ZD-6474; ZD4190; AZD2171; CEP-7055; PTK787; SU5416; Macugen (pegaptanib sodium); Lucentis (ranibizum
  • VEGFR-2 variant(s) as described above (see articles on World Wide Web at medscape.com/viewarticle/406399_4, Simons et ah, 2002 and Mukherjee, 2004, which are hereby incorporate by reference).
  • a variant at -271 G>A, 6648 OT (SNP 1), 18487 A>T (SNP 4), and/or 18515 T>C (SNP 5) is indicative of a patient who has lower expression of VEGFR-2 than a patient who does not have that variant.
  • Higher expression of the VEGFR-2 is predicative of a worse cancer prognosis and/or a higher efficacy of an anti-angiogenesis drug in patients with that phenotype. It has been shown that a variant at SNP2 could be related to a significant decrease in VEGF binding efficiency to KDR (Wang et ai, 2007).
  • Patent 5,786,344 U.S. Serial No. 60/549,069, U.S. Serial No. 60/550,268, all of which are incorporated by reference in their entirety.
  • nucleic Acids Certain embodiments of the present invention concern various nucleic acids, including amplification primers, oligonucleotide probes, and other nucleic acid elements involved in the analysis of genomic DNA, in particular, the VEGFR-2 gene.
  • a nucleic acid comprises a wild-type or variant nucleic acid.
  • nucleic acid is well known in the art.
  • a “nucleic acid” as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil "U” or a C).
  • nucleic acid encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • oligonucleotide refers to a molecule of between about 3 and about 100 nucleobases in length.
  • polynucleotide refers to at least one molecule of greater than about 100 nucleobases in length.
  • a “gene” refers to coding sequence of a gene product, as well as introns and the promoter of the gene product.
  • the cDNA sequence for the human VEGFR-2 gene (also referred to as KDR gene) is provided in SEQ ID NO:1, which encodes the human VEGFR-2 gene product provided in SEQ ID NO:2.
  • a genomic sequence for the VEGFR-2 gene is provided in
  • FIG. 7 (SEQ ID NO:3). It will be understood that a "variant" refers to a sequence that is or contains a polymorphism (frequency >1%) or a sequence that is or contains a mutation. In certain embodiments of the invention, the mutation is a somatic mutation, as opposed to a germline mutation.
  • FIG. 8 A list of variants that may be evaluated in methods and kits of the invention are identified in FIG. 8. The identity of these variants is described by position relative to the ATG (+1) and other information is provided.
  • nucleic acids of the invention comprise or are complementary to all or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
  • nucleic acids of the invention may be or be at least 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% homologous to all or part (any lengths discussed in previous paragraph) of SEQ ID NOs: 1-141.
  • primers and probes for hybridization and amplification, including the limits of homology needed to implement primers and probes. These definitions generally refer to a single-stranded molecule, but in specific embodiments will also encompass an additional strand that is partially, substantially or fully complementary to the single-stranded molecule.
  • a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a molecule.
  • a single stranded nucleic acid may be denoted by the prefix "ss”, a double stranded nucleic acid by the prefix "ds”, and a triple stranded nucleic acid by the prefix "ts.”
  • a nucleic acid encodes a protein, polypeptide, or peptide.
  • the present invention concerns novel compositions comprising at least one proteinaceous molecule.
  • a proteinaceous molecule As used herein, a "proteinaceous molecule,"
  • proteinaceous composition proteinaceous compound
  • proteinaceous chain proteinaceous chain
  • proteinaceous material generally refers, but is not limited to, a protein of greater than about 200 amino acids or the full length endogenous sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. All the “proteinaceous” terms described above may be used interchangeably herein.
  • a nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production.
  • a synthetic nucleic acid ⁇ e.g., a synthetic oligonucleotide
  • Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in European Patent 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and
  • a non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference.
  • a non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 2001, incorporated herein by reference).
  • nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, chromatography columns or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference).
  • a nucleic acid is a pharmacologically acceptable nucleic acid. Pharmacologically acceptable compositions are known to those of skill in the art, and are described herein.
  • the present invention concerns a nucleic acid that is an isolated nucleic acid.
  • isolated nucleic acid refers to a nucleic acid molecule (e.g. , an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells.
  • isolated nucleic acid refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
  • nucleic acid is a nucleic acid segment.
  • nucleic acid segment are fragments of a nucleic acid, such as, for a non-limiting example, those that encode only part of a VEGFR-2 gene sequence.
  • a “nucleic acid segment” may comprise any part of a gene sequence, including from about 2 nucleotides to the full length gene including promoter regions to the polyadenylation signal and any length that includes all of the coding region.
  • Various nucleic acid segments may be designed based on a particular nucleic acid sequence, and may be of any length.
  • nucleic acid segments By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all nucleic acid segments can be created: n to n + y where n is an integer from 1 to the last number of the sequence and y is the length of the nucleic acid segment minus one, where n + y does not exceed the last number of the sequence.
  • n is an integer from 1 to the last number of the sequence
  • y is the length of the nucleic acid segment minus one, where n + y does not exceed the last number of the sequence.
  • the nucleic acid segments correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on.
  • nucleic acid segments correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on.
  • nucleic segments correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on.
  • the nucleic acid segment may be a probe or primer.
  • a probe generally refers to a nucleic acid used in a detection method or composition.
  • a primer generally refers to a nucleic acid used in an extension or amplification method or composition.
  • the present invention also encompasses a nucleic acid that is complementary to a nucleic acid.
  • a nucleic acid is "complement(s)" or is “complementary” to another nucleic acid when it is capable of base-pairing with another nucleic acid according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules.
  • another nucleic acid may refer to a separate molecule or a spatial separated sequence of the same molecule.
  • a complement is a hybridization probe or amplification primer for the detection of a nucleic acid polymorphism.
  • the term “complementary” or “complement” also refers to a nucleic acid comprising a sequence of consecutive nucleobases or semiconsecutive nucleobases (e.g., one or more nucleobase moieties are not present in the molecule) capable of hybridizing to another nucleic acid strand or duplex even if less than all the nucleobases do not base pair with a counterpart nucleobase.
  • semiconsecutive nucleobases e.g., one or more nucleobase moieties are not present in the molecule
  • completely complementary nucleic acids are preferred.
  • Some embodiments of the invention concern identifying variants (both polymorphisms and/or mutations) in the VEGFR-2 gene such as one that affects expression, correlating genotype or haplotype to phenotype, wherein the phenotype is altered VEGFR-2 activity or expression, and then identifying such polymorphisms in patients who have or will be given a VEGFR-2 inhibitor or other drugs or compounds that affect angiogenesis.
  • the present invention involves assays for identifying variants and other nucleic acid detection methods. Such assays involve identifying the variant in the VEGFR-2 gene, as shown in the Examples. It is contemplated that probes and primers can be prepared using the sequences disclosed in SEQ ID NOs: 1 and 3.
  • nucleic acids therefore, have utility as probes or primers for embodiments involving nucleic acid hybridization. They may be used in diagnostic or screening methods of the present invention. Detection of nucleic acids encoding VEGFR-2, as well as nucleic acids involved in the expression or stability of VEGFR-2 polypeptides or transcripts, are encompassed by the invention. General methods of nucleic acid detection methods are provided below, followed by specific examples employed for the identification of mutations and polymorphisms, including single nucleotide polymorphisms (SNPs) or other kinds of polymorphisms. A. Hybridization
  • probe or primer of between 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 60, 70, 80, 90, or 100 nucleotides, preferably between 17 and 100 nucleotides in length, or in some aspects of the invention up to 1 -2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective.
  • probes or primers can be generated from SEQ ID NO:1 and 3. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length are generally preferred, to increase stability and/or selectivity of the hybrid molecules obtained.
  • nucleic acid molecules for hybridization having one or more complementary sequences of 20 to 30 nucleotides, or even longer where desired.
  • Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.
  • amplification is employed to determine the number of TA repeats. See, e.g., U.S. Patent Nos. 6,472,157 and 6,395,481; Te et al, 2000; and, Innocenti et al, 2004, all of which are hereby incorporated by reference for their teachings regarding determining the number of TA repeats in the UGTlAl gene.
  • nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNAs and/or RNAs or to provide primers for amplification of DNA or RNA from samples.
  • relatively high stringency conditions For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids.
  • relatively low salt and/or high temperature conditions such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50 0 C to about 70 0 C.
  • Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting a specific polymorphism. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
  • hybridization to filter-bound DNA may be carried out in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 niM EDTA at 65°C, and washing in 0.1 x SSC/0.1% SDS at 68°C (Ausubel et al, 1989).
  • Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature.
  • a medium stringency condition could be provided by about 0.1 to 0.25M NaCl at temperatures of about 37°C to about 55°C
  • a low stringency condition could be provided by about 0.15M to about 0.9M salt, at temperatures ranging from about 20 0 C to about 55 0 C.
  • the washing may be carried out for example in 0.2 x SSC/0.1% SDS at 42 0 C (Ausubel et al, 1989).
  • Hybridization conditions can be readily manipulated depending on the desired results.
  • hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl 2 , 1.0 niM dithiothreitol, at temperatures between approximately 2O 0 C to about 37°C.
  • Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, at temperatures ranging from approximately 40 0 C to about 72°C.
  • nucleic acids of defined sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization.
  • appropriate indicator means include fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected.
  • colorimetric indicator substrates are known that can be employed to provide a detection means that is visibly or spectrophotometrically detectable, to identify specific hybridization with complementary nucleic acid containing samples.
  • a particular nuclease cleavage site may be present and detection of a particular nucleotide sequence can be determined by the presence or absence of nucleic acid cleavage.
  • the probes or primers described herein will be useful as reagents in solution hybridization, as in PCR, for detection of expression or genotype of corresponding genes, as well as in embodiments employing a solid phase.
  • the test DNA or RNA
  • the test DNA is adsorbed or otherwise affixed to a selected matrix or surface.
  • This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions.
  • the conditions selected will depend on the particular circumstances (depending, for example, on the
  • Nucleic acids used as a template for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al, 2001). In certain embodiments, analysis is performed on whole cell or tissue homogenates or biological fluid samples with or without substantial purification of the template nucleic acid.
  • the nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to first convert the RNA to a complementary DNA.
  • primer is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process.
  • primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed.
  • Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is preferred.
  • Pairs of primers designed to selectively hybridize to nucleic acids corresponding to the KDR gene locus, or variants thereof, and fragments thereof are contacted with the template nucleic acid under conditions that permit selective hybridization.
  • high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers.
  • hybridization may occur under reduced stringency to allow for amplification of nucleic acids that contain one or more mismatches with the primer sequences.
  • the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles,” are conducted until a sufficient amount of amplification product is produced.
  • the amplification product may be detected, analyzed or quantified.
  • the detection may be performed by visual means.
  • the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incorporated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology; Bellus, 1994).
  • PCRTM polymerase chain reaction
  • LCR ligase chain reaction
  • U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence.
  • a method based on PCRTM and oligonucleotide ligase assay (OLA) (described in further detail below), disclosed in U.S. Patent 5,912,148, may also be used.
  • SDA Strand Displacement Amplification
  • nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al, 1989; PCT Application WO 88/10315, incorporated herein by reference in their entirety).
  • TAS transcription-based amplification systems
  • NASBA nucleic acid sequence based amplification
  • 3SR Zaoh et al, 1989; PCT Application WO 88/10315, incorporated herein by reference in their entirety.
  • European Application 329 822 disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA”), ssDNA, and double-stranded DNA (dsDNA), which may be used in accordance with the present invention.
  • ssRNA single-stranded RNA
  • dsDNA double-stranded DNA
  • PCT Application WO 89/06700 disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter region/primer sequence to a target single-stranded DNA ("ssDNA”) followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e., new templates are not produced from the resultant RNA transcripts.
  • Other amplification methods include "RACE” and “one-sided PCR” (Frohman, 1990; Ohara et al, 1989).
  • amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al, 2001). Separated amplification products may be cut out and eluted from the gel for further manipulation. Using low melting point agarose gels, the separated band may be removed by heating the gel, followed by extraction of the nucleic acid.
  • Separation of nucleic acids may also be effected by spin columns and/or chromatographic techniques known in art.
  • chromatographic techniques There are many kinds of chromatography which may be used in the practice of the present invention, including adsorption, partition, ion-exchange, hydroxylapatite, molecular sieve, reverse-phase, column, paper, thin-layer, and gas chromatography as well as HPLC.
  • the amplification products are visualized, with or without separation.
  • a typical visualization method involves staining of a gel with ethidium bromide and visualization of bands under UV light.
  • the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the separated amplification products can be exposed to x-ray film or visualized under the appropriate excitatory spectra.
  • a labeled nucleic acid probe is brought into contact with the amplified marker sequence.
  • the probe preferably is conjugated to a chromophore but may be radiolabeled.
  • the probe is conjugated to a binding partner, such as an antibody or biotin, or another binding partner carrying a detectable moiety.
  • detection is by Southern blotting and hybridization with a labeled probe.
  • the techniques involved in Southern blotting are well known to those of skill in the art (see Sambrook et al. , 2001).
  • U.S. Patent 5,279,721, incorporated by reference herein discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids.
  • the apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention.
  • Restriction Fragment Length Polymorphism is a technique in which different DNA sequences may be differentiated by analysis of patterns derived from cleavage of that DNA. If two sequences differ in the distance between sites of cleavage of a particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme. The similarity of the patterns generated can be used to differentiate species (and even strains) from one another.
  • Restriction endonucleases in turn are the enzymes that cleave DNA molecules at specific nucleotide sequences depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 base pairs in length. Generally, the shorter the recognition sequence, the greater the number of fragments generated. If molecules differ in nucleotide sequence, fragments of different sizes may be generated. The fragments can be separated by gel electrophoresis. Restriction enzymes are isolated from a wide variety of bacterial genera and are thought to be part of the cell's defenses against invading bacterial viruses. Use of RFLP and restriction endonucleases in SNP analysis requires that the SNP affect cleavage of at least one restriction enzyme site.
  • Primer extension may also be employed.
  • the primer and no more than three NTPs may be combined with a polymerase and the target sequence, which serves as a template for amplification.
  • a polymerase By using less than all four NTPs, it is possible to omit one or more of the variant nucleotides needed for incorporation at the variant site. It is important for the practice of the present invention that the amplification be designed such that the omitted nucleotide(s) is(are) not required between the 3' end of the primer and the target variant site.
  • the primer is then extended by a nucleic acid polymerase, in a preferred embodiment by Taq polymerase.
  • the primer is extended up to the variant site, at which point the polymerization ceases. However, if the omitted NTP is not required at the variant site, the primer will be extended beyond the variant site, creating a longer product. Detection of the extension products is based on, for example, separation by size/length which will thereby reveal which variant is present.
  • DGGE denaturing gradient gel electrophoresis
  • RFLP restriction fragment length polymorphism analysis
  • SSCP single-strand conformation polymorphism analysis
  • mismatch is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single or multiple base point mutations.
  • U.S. Patent 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.
  • RNase I in mismatch assays.
  • the use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is reported to cleave three out of four known mismatches. Others have described using the MutS protein or other DNA-repair enzymes for detection of single-base mismatches.
  • VNTRs variable nucleotide type polymorphisms
  • RFLPs restriction fragment length polymorphisms
  • SNPs single nucleotide polymorphisms
  • SNPs single nucleotide polymorphisms
  • SNPs are the most common genetic variations and occur once every 100 to 300 bases and several SNP mutations have been found that affect a single nucleotide in a protein-encoding gene in a manner sufficient to actually cause a genetic disease.
  • SNP diseases are exemplified by hemophilia, sickle-cell anemia, hereditary hemochromatosis, late-onset alzheimer disease etc.
  • SNPs or other variants can be the result of deletions, point mutations and insertions and in general any single base alteration, whatever the cause, can result in a variant.
  • the greater frequency of SNPs means that they can be more readily identified than the other classes of polymorphisms.
  • the greater uniformity of their distribution permits the identification of SNPs "nearer" to a particular trait of interest.
  • the combined effect of these two attributes makes SNPs extremely valuable. For example, if a particular trait (e.g., inability to efficiently metabolize irinotecan) reflects a mutation at a particular locus, then any variant that is linked to the particular locus can be used to predict the probability that an individual will exhibit that trait.
  • Variants of the VEGFR-2 gene can be characterized by the use of any of these methods or suitable modification thereof.
  • Such methods include the direct or indirect sequencing of the site, the use of restriction enzymes where the respective alleles of the site create or destroy a restriction site, the use of allele-specific hybridization probes, the use of antibodies that are specific for the proteins encoded by the different alleles of the polymorphism, or any other biochemical interpretation.
  • the methods discussed below may be employed with respect to variants generally, whether they concern a mutation or a polymorphism.
  • the most commonly used method of characterizing a variant is direct DNA sequencing of the genetic locus that flanks and includes the variant. Such analysis can be accomplished using either the "dideoxy-mediated chain termination method,” also known as the “Sanger Method” (Sanger et al., 1975) or the “chemical degradation method,” also known as the “Maxam-Gilbert method” (Maxam et al, 1977). Sequencing may also be performed by pyrosequencing technology (Royo et al, 2007; Nilsson and Olsson, 2008), all of the above incorporated herein by reference.
  • nucleotide present at a polymorphic site utilize a specialized exonuclease-resistant nucleotide derivative (U.S. Patent. 4,656,127).
  • a primer complementary to an allelic sequence immediately 3 '-to the variant site is hybridized to the DNA under investigation. If the polymorphic site on the DNA contains a nucleotide that is complementary to the particular exonucleotide-resistant nucleotide derivative present, then that derivative will be incorporated by a polymerase onto the end of the hybridized primer. Such incorporation makes the primer resistant to exonuclease cleavage and thereby permits its detection. As the identity of the exonucleotide-resistant derivative is known one can determine the specific nucleotide present in the polymorphic site of the DNA.
  • French Patent 2,650,840 and PCT Application WO91/02087 discuss a solution- based method for determining the identity of the nucleotide of a variant site. According to these methods, a primer complementary to allelic sequences immediately 3 '-to a variant site is used. The identity of the nucleotide of that site is determined using labeled dideoxynucleotide derivatives which are incorporated at the end of the primer if complementary to the nucleotide of the polymorphic site. 5. Genetic Bit Analysis or Solid-Phase Extension
  • PCT Application WO92/15712 describes a method that uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site.
  • the labeled terminator that is incorporated is complementary to the nucleotide present in the polymorphic site of the target molecule being evaluated and is thus identified.
  • the primer or the target molecule is immobilized to a solid phase.
  • oligonucleotides capable of hybridizing to abutting sequences of a single strand of a target DNA are used.
  • One of these oligonucleotides is biotinylated while the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation permits the recovery of the labeled oligonucleotide by using avidin.
  • Other nucleic acid detection assays, based on this method, combined with PCR have also been described (Nickerson et al, 1990). Here PCR is used to achieve the exponential amplification of target DNA, which is then detected using the OLA.
  • U.S. Patent 5,952,174 describes a method that also involves two primers capable of hybridizing to abutting sequences of a target molecule.
  • the hybridized product is formed on a solid support to which the target is immobilized.
  • the hybridization occurs such that the primers are separated from one another by a space of a single nucleotide.
  • Incubating this hybridized product in the presence of a polymerase, a ligase, and a nucleoside triphosphate mixture containing at least one deoxynucleoside triphosphate allows the ligation of any pair of abutting hybridized oligonucleotides.
  • Invasive cleavage reactions can be used to evaluate cellular DNA for a particular variant, especially a polymorphism.
  • a technology called INVADER® employs such reactions (e.g., de Arruda et al, 2002; Stevens et al, 2003, which are incorporated by reference).
  • upstream oligo an oligonucleotide upstream of the target site
  • probe a probe oligonucleotide covering the target site
  • target a single-stranded DNA with the the target site
  • the upstream oligo and probe do not overlap but they contain contiguous sequences.
  • the probe contains a donor fluorophore, such as fluoroscein, and an acceptor dye, such as Dabcyl.
  • a donor fluorophore such as fluoroscein
  • an acceptor dye such as Dabcyl
  • the nucleotide at the 3' terminal end of the upstream oligo overlaps ("invades") the first base pair of a probe-target duplex. Then the probe is cleaved by a structure- specific 5' nuclease causing separation of the fluorophore/quencher pair, which increases the amount of fluorescence that can be detected (Lu et al, 2004).
  • the assay is conducted on a solid-surface or in an array format. 9. Other Methods To Detect SNPs
  • Fluorescence in situ hybridization (FISH) and single nucleotide polymorphism arrays are additional methods that can detect the presence of SNPs in a sample. FISH may be useful to assess gene amplification in the tumor.
  • a SNP array is a type of DNA microarray which is used to detect polymorphisms within a population. High-throughput single-nucleotide polymorphism (SNP) genotyping can be applied in genome-wide association studies (GWASs). Such methods are known to those of skill in the art (Beaudet and Belmont, 2008; Bier et al, 2008; Noel et al, 2008; each of which are incorporated by reference herein).
  • extended haplotypes may be determined at any given locus in a population, which allows one to identify exactly which SNPs will be redundant and which will be essential in association studies.
  • the latter is referred to as 'haplotype tag SNPs (htSNPs) 1 , markers that capture the haplotypes of a gene or a region of linkage disequilibrium. See Johnson et al. (2001) and Ke and Cardon (2003), each of which is incorporated herein by reference, for exemplary methods.
  • the VDA-assay utilizes PCR amplification of genomic segments by long PCR methods using TaKaRa LA Taq reagents and other standard reaction conditions.
  • the long amplification can amplify DNA sizes of about 2,000-12,000 bp.
  • Hybridization of products to variant detector array (VDA) can be performed by a Affymetrix High
  • Chip Assay uses PCR amplification of genomic segments by standard or long PCR protocols. Hybridization products are analyzed by VDA, Halushka et al. (1999), incorporated herein by reference. SNPs are generally classified as “Certain” or “Likely” based on computer analysis of hybridization patterns. By comparison to alternative detection methods such as nucleotide sequencing, “Certain” SNPs have been confirmed 100% of the time; and “Likely” SNPs have been confirmed 73% of the time by this method.
  • PCR-amplification of genomic DNA is performed using the following conditions: 200 ng
  • DNA template 0.5 ⁇ M each primer, 80 ⁇ M each of dCTP, dATP, dTTP and dGTP, 5% formamide, 1.5mM MgCl 2 , 0.5U of Taq polymerase and 0.1 volume of the Taq buffer.
  • PCR-SSCP PCR-single strand conformation polymorphism
  • Electrophoresis is performed overnight. PCR-products that show mobility shifts are reamplified and sequenced to identify nucleotide variation.
  • sequence and alignment data from a PHRAP. ace file
  • quality scores for the sequence base calls from PHRED quality files
  • distance information from PHYLIP dnadist and neighbour programs
  • base- calling data from PHRED '-d' switch
  • Sequences are aligned and examined for each vertical chunk ('slice') of the resulting assembly for disagreement. Any such slice is considered a candidate SNP (DEMIGLACE).
  • a number of filters are used by DEMIGLACE to eliminate slices that are not likely to represent true polymorphisms.
  • filters that: (i) exclude sequences in any given slice from SNP consideration where neighboring sequence quality scores drop 40% or more; (ii) exclude calls in which peak amplitude is below the fifteenth percentile of all base calls for that nucleotide type; (iii) disqualify regions of a sequence having a high number of disagreements with the consensus from participating in SNP calculations; (iv) removed from consideration any base call with an alternative call in which the peak takes up 25% or more of the area of the called peak; (v) exclude variations that occur in only one read direction.
  • PHRED quality scores were converted into probability-of-error values for each nucleotide in the slice. Standard Baysian methods are used to calculate the posterior probability that there is evidence of nucleotide heterogeneity at a given location. In a method called CU-RDF (RESEQ), PCR amplification is performed from a method called CU-RDF (RESEQ).
  • DNA isolated from blood using specific primers for each SNP and after typical cleanup protocols to remove unused primers and free nucleotides, direct sequencing using the same or nested primers.
  • DEBNICK a comparative analysis of clustered EST sequences is performed and confirmed by fluorescent-based DNA sequencing.
  • ERO ERO
  • new primers sets are designed for electronically published STSs and used to amplify DNA from 10 different mouse strains.
  • the amplification product from each strain is then gel purified and sequenced using a standard dideoxy, cycle sequencing technique with 33 P-labeled terminators. All the ddATP terminated reactions are then loaded in adjacent lanes of a sequencing gel followed by all of the ddGTP reactions and so on. SNPs are identified by visually scanning the radiographs.
  • ERO RESEQ-HT
  • new primers sets are designed for electronically published murine DNA sequences and used to amplify DNA from 10 different mouse strains.
  • the amplification product from each strain is prepared for sequencing by treating with Exonuclease I and Shrimp Alkaline Phosphatase. Sequencing is performed using ABI Prism Big Dye Terminator Ready Reaction Kit (Perkin-Elmer) and sequence samples are run on the 3700 DNA Analyzer (96 Capillary Sequencer).
  • FGU-CBT (SCA2-SNP) identifies a method where the region containing the SNP were PCR amplified using the primers SCA2-FP3 and SCA2-RP3. Approximately 100 ng of genomic DNA is amplified in a 50 ml reaction volume containing a final concentration of 5mM Tris, 25mM KCl, 0.75mM MgCl 2 , 0.05% gelatin, 20pmol of each primer and 0.5U of Taq DNA polymerase.
  • Samples are denatured, annealed and extended and the PCR product is purified from a band cut out of the agarose gel using, for example, the QIAquick gel extraction kit (Qiagen) and is sequenced using dye terminator chemistry on an ABI Prism 377 automated DNA sequencer with the PCR primers.
  • QIAquick gel extraction kit Qiagen
  • JBLACK SEQ/RESTRICT
  • two independent PCR reactions are performed with genomic DNA. Products from the first reaction are analyzed by sequencing, indicating a unique Fspl restriction site. The mutation is confirmed in the product of the second PCR reaction by digesting with Fsp I.
  • SNPs are identified by comparing high quality genomic sequence data from four randomly chosen individuals by direct DNA sequencing of PCR products with dye-terminator chemistry (see Kwok et al, 1996).
  • SNPs are identified by comparing high quality genomic sequence data from overlapping large-insert clones such as bacterial artificial chromosomes (BACs) or Pl -based artificial chromosomes (PACs). An STS containing this SNP is then developed and the existence of the SNP in various populations is confirmed by pooled DNA sequencing (see Taillon-Miller et al, 1998).
  • SNPs are identified by comparing high quality genomic sequence data from overlapping large-insert clones BACs or PACs.
  • the SNPs found by this approach represent DNA sequence variations between the two donor chromosomes but the allele frequencies in the general population have not yet been determined.
  • SNPs are identified by comparing high quality genomic sequence data from a homozygous DNA sample and one or more pooled DNA samples by direct DNA sequencing of PCR products with dye-terminator chemistry.
  • the STSs used are developed from sequence data found in publicly available databases.
  • these STSs are amplified by PCR against a complete hydatidiform mole (CHM) that has been shown to be homozygous at all loci and a pool of DNA samples from 80 CEPH parents (see Kwok et ⁇ /., 1994).
  • CHM complete hydatidiform mole
  • KWOK OverlapSnpDetectionWithPolyBayes
  • SNPs are discovered by automated computer analysis of overlapping regions of large-insert human genomic clone sequences.
  • clone sequences are obtained directly from large-scale sequencing centers. This is necessary because base quality sequences are not present/available through GenBank.
  • Raw data processing involves analyzed of clone sequences and accompanying base quality information for consistency. Finished ('base perfect', error rate lower than 1 in 10,000 bp) sequences with no associated base quality sequences are assigned a uniform base quality value of 40 (1 in 10,000 bp error rate). Draft sequences without base quality values are rejected. Processed sequences are entered into a local database.
  • a version of each sequence with known human repeats masked is also stored. Repeat masking is performed with the program "MASKERAID.” Overlap detection: Putative overlaps are detected with the program "WUBLAST.” Several filtering steps followed in order to eliminate false overlap detection results, i.e. similarities between a pair of clone sequences that arise due to sequence duplication as opposed to true overlap. Total length of overlap, overall percent similarity, number of sequence differences between nucleotides with high base quality value "high-quality mismatches.” Results are also compared to results of restriction fragment mapping of genomic clones at Washington University Genome Sequencing Center, finisher's reports on overlaps, and results of the sequence contig building effort at the NCBI.
  • SNP detection Overlapping pairs of clone sequence are analyzed for candidate SNP sites with the 'POLYBAYES' SNP detection software. Sequence differences between the pair of sequences are scored for the probability of representing true sequence variation as opposed to sequencing error. This process requires the presence of base quality values for both sequences. High-scoring candidates are extracted. The search is restricted to substitution-type single base pair variations. Confidence score of candidate SNP is computed by the POLYBAYES software.
  • TaqMan assay In method identified by KWOK (TaqMan assay), the TaqMan assay is used to determine genotypes for 90 random individuals.
  • PCR products are post- labeled with fluorescent dyes and analyzed by an automated capillary electrophoresis system under SSCP conditions (PLACE-SSCP).
  • PLACE-SSCP automated capillary electrophoresis system under SSCP conditions
  • PCR primers are tagged to have 5'-ATT or 5'-GTT at their ends for post-labeling of both strands.
  • Samples of DNA (10 ng/ul) are amplified in reaction mixtures containing the buffer (1OmM Tris-HCl, pH 8.3 or 9.3, 5OmM KCl, 2.OmM MgCl 2 ), 0.25 ⁇ M of each primer, 200 ⁇ M of each dNTP, and 0.025 units/ ⁇ l of Taq DNA polymerase premixed with anti-Taq antibody.
  • the two strands of PCR products are differentially labeled with nucleotides modified with RI lO and R6G by an exchange reaction of Klenow fragment of DNA polymerase I.
  • the reaction is stopped by adding EDTA, and unincorporated nucleotides are dephosphorylated by adding calf intestinal alkaline phosphatase.
  • SSCP For the SSCP: an aliquot of fluorescenfly labeled PCR products and TAMRA-labeled internal markers are added to deionized formamide, and denatured. Electrophoresis is performed in a capillary using an ABI Prism 310 Genetic Analyzer. Genescan softwares (P-E Biosystems) are used for data collection and data processing. DNA of individuals (two to eleven) including those who showed different genotypes on SSCP are subjected for direct sequencing using big-dye terminator chemistry, on ABI Prism 310 sequencers. Multiple sequence trace files obtained from ABI Prism 310 are processed and aligned by Phred/Phrap and viewed using Consed viewer. SNPs are identified by PolyPhred software and visual inspection.
  • KYUGEN In yet another method identified as KYUGEN (Method2), individuals with different genotypes are searched by denaturing HPLC (DHPLC) or PLACE-SSCP (Inazuka et al, 1997) and their sequences are determined to identify SNPs. PCR is performed with primers tagged with 5'-ATT or 5'-GTT at their ends for post-labeling of both strands. DHPLC analysis is carried out using the WAVE DNA fragment analysis system (Transgenomic). PCR products are injected into DNASep column, and separated under the conditions determined using WAVEMaker program (Transgenomic).
  • SNPs are identified by PolyPhred software and visual inspection. Trace chromatogram data of EST sequences in Unigene are processed with PHRED. To identify likely SNPs, single base mismatches are reported from multiple sequence alignments produced by the programs PHRAP, BRO and POA for each Unigene cluster. BRO corrected possible misreported EST orientations, while POA identified and analyzed non-linear alignment structures indicative of gene mixing/chimeras that might produce spurious SNPs.
  • Bayesian inference is used to weigh evidence for true polymorphism versus sequencing error, misalignment or ambiguity, misclustering or chimeric EST sequences, assessing data such as raw chromatogram height, sharpness, overlap and spacing; sequencing error rates; context-sensitivity; cDNA library origin, etc.
  • MARSHFIELD Method identified as MARSHFIELD(Method-B)
  • overlapping human DNA sequences which contained putative insertion/deletion polymorphisms are identified through searches of public databases.
  • PCR primers that flanked each polymorphic site are selected from the consensus sequences.
  • Primers are used to amplify individual or pooled human genomic DNA. Resulting PCR products are resolved on a denaturing polyacrylamide gel and a Phosphorlmager is used to estimate allele frequencies from DNA pools.
  • Linkage disequilibrium (“LD” as used herein, though also referred to as “LED” in the art) refers to a situation where a particular combination of alleles (i.e., a variant form of a given gene) or polymorphisms at two loci appears more frequently than would be expected by chance.
  • Haplotype is used according to its plain and ordinary meaning to one skilled in the art. It refers to a collective genotype of two or more alleles or polymorphisms along one of the homologous chromosomes.
  • the present invention concerns evaluating the VEGFR-2 gene, as well as the expression and/or activity of the polypeptide VEGFR-2, including variants of the gene that result in a variant polypeptide.
  • proteinaceous compound generally refers, but is not limited to, a protein of greater than about 200 amino acids or the full length endogenous sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. All the “proteinaceous” terms described above may be used interchangeably herein.
  • the size of the at least one proteinaceous molecule may be at least, at most or may comprise, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210,
  • Certain aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of an encoded protein or peptide.
  • the term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state.
  • a purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
  • Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis.
  • a preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number.”
  • the actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.
  • Various techniques suitable for use in protein purification will be well known to those of skill in the art.
  • the antibody is used to identify a VEGFR-2 variant or to evaluate, assess, or determine VEGFR-2 activity or expression. It is understood that antibodies can be used to quantify polypeptides. Such antibodies, polyclonal .or monoclonal, can be generated. Means for preparing and characterizing antibodies are also well known in the art ⁇ See, e.g., Harlow and Lane, 1988; incorporated herein by reference). Alternatively, they can be obtained commercially. As discussed, in some embodiments, the present invention concerns immunodetection methods for assessing, evaluating, determining, quantifying and/or otherwise detecting biological components such as VEGFR-2 variant polypeptides.
  • Immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay, bioluminescent assay, western blot, and screening an antibody array, though several others are well known to those of ordinary skill.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunoradiometric assay fluoroimmunoassay
  • fluoroimmunoassay chemiluminescent assay
  • bioluminescent assay bioluminescent assay
  • western blot western blot
  • the steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Doolittle et al, 1999; Gulbis and Galand, 1993; De Jager et al, 1993; and Nakamura et al, 1987, each incorporated herein by reference.
  • the immunobinding methods include obtaining a sample suspected of containing a protein, polypeptide and/or peptide, and contacting the sample with a first antibody, monoclonal or polyclonal, in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
  • the immunobinding methods include methods for detecting and quantifying the amount of an antigen component in a sample and the detection and quantification of any immune complexes formed during the binding process.
  • a sample suspected of containing an antigen or antigenic domain and contact the sample with an antibody against the antigen or antigenic domain, and then detect and quantify the amount of immune complexes formed under the specific conditions.
  • the biological sample analyzed may be any sample that is suspected of containing an antigen or antigenic domain, such as, for example, a cancer cell or tissue, or any biological fluid that comes into contact with the cell or tissue, including blood and/or serum.
  • the chosen biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any antigens present.
  • the sample-antibody composition such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non- specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
  • a first step biotinylated, monoclonal or polyclonal antibody is used to detect the target antigen(s), and a second step antibody is then used to detect the biotin attached to the complexed biotin.
  • the sample to be tested is first incubated in a solution containing the first step antibody. If the target antigen is present, some of the antibody binds to the antigen to form a biotinylated antibody/antigen complex.
  • the antibody/antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin), biotinylated DNA, and/or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody/antigen complex.
  • streptavidin or avidin
  • biotinylated DNA and/or complementary biotinylated DNA
  • the amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution containing the second step antibody against biotin.
  • This second step antibody is labeled, for example, with an enzyme that can be used to detect the presence of the antibody/antigen complex by histoenzymology using a chromogen substrate.
  • a conjugate can be produced which is macroscopically visible.
  • PCRTM Polymerase Chain Reaction
  • DNA/biotin/streptavidin/antibody complex is washed out with a low pH or high salt buffer that releases the antibody.
  • the resulting wash solution is then used to carry out a
  • PCRTM reaction with suitable primers with appropriate controls. At least in theory, the enormous amplification capability and specificity of PCRTM can be utilized to detect a single antigen molecule.
  • immunoassays in their most simple and/or direct sense, are binding assays.
  • Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and/or radioimmunoassays (RIA) known in the art.
  • ELISAs enzyme linked immunosorbent assays
  • RIA radioimmunoassays
  • Immunohistochemical detection using tissue sections is also particularly useful. However, it will be readily appreciated that detection is not limited to such techniques, and/or western blotting, dot blotting, FACS analyses, and/or the like may also be used.
  • ELISAs have certain features in common, such as coating, incubating and binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described below.
  • a plate with either antigen or antibody In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein or solutions of milk powder.
  • BSA bovine serum albumin
  • the coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure.
  • the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand.
  • Under conditions effective to allow immune complex (antigen/antibody) formation means that the conditions preferably include diluting the antigens and/or antibodies with solutions such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
  • suitable conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours or so, at temperatures preferably on the order of 25 0 C to 27°C, or may be overnight at about 4°C or so.
  • the contacted surface is washed so as to remove non-complexed material.
  • An example of a washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined.
  • the second or third antibody will have an associated label to allow detection.
  • This may be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate.
  • a urease glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 h at room temperature in a PBS- containing solution such as PBS-Tween).
  • the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl- benzthiazoline-6-sulfonic acid (ABTS), or H 2 O 2 , in the case of peroxidase as the enzyme label. Quantification is then achieved by measuring the degree of color generated, e.g., using a visible spectra spectrophotometer.
  • a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl- benzthiazoline-6-sulfonic acid (ABTS), or H 2 O 2 , in the case of peroxidase as the enzyme label.
  • Quantification is then achieved by measuring the degree of color generated, e.g., using a visible spectra spectrophotometer.
  • the antibodies of the present invention may also be used in conjunction with both fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks prepared for study by immunohistochemistry (IHC).
  • immunohistochemistry may be utilized to characterize VEGFR-2 or to evaluate the amount a variant VEGFR-2 in a cell.
  • the method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors, and/or is well known to those of skill in the art (Brown et al, 1990; Abbondanzo et al, 1990; Allred et al, 1990).
  • kits This generally will comprise a primer or probe designed to hybridize specifically to or upstream of target nucleotides of the variant of interest.
  • the primer or probe may be labeled with a radioisotope, a fiuorophore, a chromophore, a dye, an enzyme, or TOF carrier.
  • kits may also include enzymes and other reagents suitable for detection of specific nucleic acids or amplification products.
  • Kits of the invention may comprise any of the nucleic acid discussed herein of fragments thereof. Particularly contemplated for use in kits are any combination of primers set forth herein. Thus, any of SEQ ID NOs:4-141 may be included in a kit.
  • the container means of the kits will generally include at least one vial, test tube, flask, bottle, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container.
  • the kits of the present invention also will typically include a means for packaging the component containers in close confinement for commercial sale. Such packaging may include injection or blow-molded plastic containers into which the desired component containers are retained. IV. Examples
  • DNA sequencing For resequencing of KDR, the inventors used DNA samples including samples from 24 healthy Caucasians, 24 African- Americans and 24 Asians (Chinese). DNA sequencing
  • Exons, intron-exon boundaries, the promoter region ( ⁇ 3 Kb upstream of the 5'UTR region), 1 Kb downstream to the 3'UTR, evolutionary conserved noncoding regions (mainly intronic, selected by comparative genomics), and transcription factor binding cluster regions (selected by Cluster-Buster) were resequenced (FIG. 1).
  • PCR was used to amplify about 27 Kb of genomic DNA.
  • Fifty two primers were designed according to the KDR reference sequence AF035121 from Genbank by using the Primer3 program (on the World Wide Web at workbench.sdsc.edu).
  • PCR was carried out using 1 units of Hotstar Taq polymerase (Qiagen), with 4 ⁇ l of Buffer (1Ox), 2 ⁇ l of dNTP (2 mM), 2.4 ⁇ l OfMg 2+ (25 mM) and 10 ⁇ 30 ng of DNA in 40 ⁇ l of final volume.
  • a touchdown thermal cycling protocol was used for all amplifications: 95 0 C for 15 min for denaturation and activation of DNA polymerase, followed by 7 cycles of touchdown process: 95°C for 30 s, 65 0 C (-1.5 0 C per cycle) for 30 s and 72°C for 1.5 min.
  • PCR products were then purified with Montage PCR micro 96 filter (Millipore) and sequenced from both ends using the bigdye terminator at the Sequencing Facility of University of Chicago. Sequencing data were then analyzed by using the Sequencer 4.6 software.
  • LD was calculated using r 2 statistic and evaluated using the LDplotter software (World Wide Web at innateimmunity.org).
  • haplotypes were inferred from ethnicity-specific genotype data using LDSelect VG2 software online (on the Internet at pga.mbt.washington.edu/VG2.html).
  • the threshold for minor-allele frequency (MAF) for these estimates was 5%.
  • Cluster-Buster regions and 19 were in conserved regions. Only 52of the 98 noncoding region polymorphisms were previously reported in dbSNP, indicating that the resequencing has led to the discovery of a significant number of previously unknown variants.
  • KDR variants Fifteen KDR variants were located in coding regions and 8 of them were nonsynonymous. Eleven of the 15 coding region SNPs were not previously reported in dbSNP. The position and frequency of each nonsynonymous variant and the correspondent amino acid change in the VEGFR-2 structure is shown in FIG. 2. Among 8 nonsynonymous SNPs, 6 were found in the extracellular domain and 2 were located in the intracellular domain, one in the TK domain 1 and the other one in the insert domain between the TK domains 1 and 2.
  • FIG. 5 clearly describes the LD pattern among the variants found in the three ethnicities.
  • the two common variants (-367T>C or rs9994560, -271G>A or rs7667298) found in the promoter region were investigated using the luciferase assay to evaluate the impact of these 2 SNPs on KDR transcriptional activity.
  • Constructs were generated by site-directed mutagenesis on a KDR reference template. Briefly, three different construct with variant -367T>C, -271G>A, and double-SNPs (-367T>C, -271G>A) were used. A control was obtained that had a different sequence that the three constructs was used for comparison purposes.
  • KDR is a highly variable gene showing 113 polymorphisms (including indels). Interestingly 57 polymorphisms (including indels) have been described in the present invention for the first time, suggesting the utility of the inventors' resequencing analysis to discover new genetic variation in the population. In addition, the investigation of KDR genetic variation in different ethnic groups allowed us to define the pattern of variation across different populations. High variability was found in the African-American group, which showed the greatest number of SNPs compared to the other two groups. The functional studies identified a promoter variant affecting the transcriptional activity of the gene.
  • KDR-5F LEFT -324 20 82 40 ATGCCTCTGCCAAAAGAAAA
  • the core promoter region (approximately 550 bp) and coding regions of VEGFR-
  • Exonl1 102 AATATGCGCTGTTATCTCTTTCTT TTAATCTCCAATATGCCTCACA 103 238
  • Exonl5 110 AAATTTCCCTGAAAAACTTCACA CCTTTTTACGGCTGCATAGC 111 265
  • the VEGFR-2 gene was also sequenced in 51 adenocarcinoma samples from NSCLC patients. All the germ line VEGFR-2 variants, including the -271G>A variant, with a frequency > 5% were also found in these NSCLC samples. These data suggest that the genetic profile of the VEGFR-2 gene in tumors has a high level of concordance with the germ line DNA, and that the tumor samples retain the germ line genetic information. However, two new SNPs were found in these tumor specimens: they appear to be rare and sequencing of matching DNA is ongoing to establish their acquired nature.
  • VEGFR-2 The inventors' preliminary data on the genetic variation of VEGFR-2 have identified a common polymorphism that might affect gene expression in the tumors (FIG. 9). It is hypothesized that the level of expression of VEGFR-2 might be, in part, genetically determined. To test this hypothesis, the association between VEGFR-2 -
  • 271G>A promoter variant 271G>A promoter variant.
  • -271 G>A was genotyped by a single base extension (SBE) method.
  • SBE single base extension
  • the primers were designed using the Oligo Primer Analysis Software (on the World Wide Web at oligo.net). The specificity and optimization of all primers was determined using the BLAST algorithm from the National Center for Biotechnology Information (on the World Wide Web at ncbi.nlm.nih.gov) and the BLAT algorithm. The primer sequences were also carefully checked to ensure they do not encompass SNP locations. Appropriate controls for each genotype were also included to ensure the assay was performing optimally.
  • a single base extension (SBE) with separation of extension products by denaturing high performance liquid chromatography (DHPLC) was used.
  • TMA tissue microarray
  • IHC Immunohistochemistry
  • TMAs were then processed by an IHC staining procedure exposing the slides to primary antibodies anti-VEGFR-2.
  • a biotynilated secondary antibody and the streptavidin-biotin peroxidase technique with diaminobenzidine as chromogen were applied to visualize binding of the primary antibody.
  • the staining quantification was then performed using the automated cellular imaging system (ACIS) available at Human Tissue Research Center at University of Chicago (corr.bsd.uchicago.edu/facilities/imageanalysis.html).
  • ACIS automated cellular imaging system
  • Each TMA's core was scanned at low magnification (xlO) in the ACIS and scored quantitatively using a free- scoring or x40 tool.
  • the ACIS software calculated VEGFR-2 staining through integrated optical density (IOD) of the stained cells. The data were then normalized by dividing the IOD for
  • DMEM Dulbecco's Modified Eagle Medium
  • the experiment was performed in triplicates.
  • the cells were transfected using the Ca 3 (PO 4 ) 2 -method.
  • the Ca 3 (PO 4 ) 2 -method involved 1) pipeting 5 ⁇ g of DNA into an eppendorf tube; 2) adding 100 ⁇ l of Solution A (250 mM CaCl 2 in H 2 O); 3) adding 100 ⁇ l of Solution B (140 mM NaCl; 50 mM HEPES; 1.5 mM Na 2 HPO 4 in H 2 O; pH 7.05); mixing by flipping; 4) adding the solution to the cells whilst mixing well; and 5) incubating the cells at 37 0 C.
  • the medium was replaced with fresh DMEM medium.
  • the medium was replaced with starvation medium (DMEM supplemented with 1% Bovine Serum Albumin).
  • VEGF-Ai 64 diluted in PBS
  • Incubating the cells involved 1) stopping stimulation on ice and wash cells with ice cold PBS; 2) adding 100 ⁇ l Lysis buffer (50 mM Tris pH 7.5; 100 mM NaCl; 0.5% Triton-X) containing protease- and phosphatase-inhibitors to each well, scrape off and collect cells; 3) sonificating cell lysate (4 pulses), centrifuging cells 5 min at 4 0 C, and collecting the supernatant; 4) separating samples by SDS-PAGE, transfering to a PVDF membrane and exposing to X-Ray film; and 5) determining VEGFR-2 activity in Western blots using a phospho-specific antibody directed against Yl 175 of VEGFR-2 (Cell Signaling; dilution 1 :1000 in 0.5% BSA in TBST) and an antibody
  • the level of VEGFR-2 expression of NSCLC is a negative prognostic factor in these patients (Kajita et al, 2001 ; Seto et al, 2006; Donnem et al, 2007), the -217G>A variant might be used as a prognostic marker that is easily accessible (from a single blood sample from patients).
  • NCSLCs with higher VEGFR-2 expression are likely to be more dependent from VEGF activity through VEGFR-2 signaling for their survival, and hence, might be more likely to respond to therapy with an angiogenesis inhibitor.
  • compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention concerns methods and compositions related to evaluating variants in the vascular endothelial growth factor receptor 2 (VEGFR-2) and using this information to yield phenotypic information related to these genotypes. In certain embodiments, methods are provided in which a variant indicates an altered level of expression of the VEGFR-2 gene (KDR). Additionally, methods of evaluating prognosis of a patient with an angiogenesis-dependent disease or condition and methods for optimizing dosage of an anti-angiogenic therapy and for guiding treatment selection are provided.

Description

DESCRIPTION
METHODS AND COMPOSITIONS CONCERNING THE VEGFR-2 GENE
(KINASE DOMAIN RECEPTOR. KDK)
BACKGROUND OF THE INVENTION
This application claims the benefit of the filing date of U.S. Provisional Patent Application Serial No. 60/911,895, filed April 15, 2007, the contents of which is hereby specifically incorporated by reference in its entirety. 1. Field of the Invention
The present invention relates generally to the field of pharmacogenomics, oncology, and angiogenesis. More particularly, it concerns methods and kits related to variants in the vascular endothelial growth factor receptor 2 (VEGFR-2) gene (kinase insert domain receptor, KDR) and its gene products. 2. Description of Related Art
Angiogenesis is an essential event in tumor growth and metastatization. Tumor cells produce vascular endothelial growth factor (VEGF) to stimulate the proliferation of adjacent vascular endothelial cells via activating their main receptor, VEGFR-2. VEGFR- 2 mediates all cellular responses to VEGF (i.e., mitogenic, angiogenic and permeability- enhancing effects) to establish a tumor's neo vasculature. VEGFR-2 is also expressed in cancer cells and, through its activation by VEGF, it sustains an autocrine loop; by this mechanism, tumors are capable of stimulating their own growth (Ferrara et al, 2003).
Increased expression and activity of VEGF and VEGFR-2 in both endothelial and cancer cells is a hallmark of several tumors. Moreover, VEGF and VEGFR-2 over- expression is thought to play a significant role in the development of metastases. For these reasons, several new anticancer agents targeting the VEGF/VEGFR-2 pathway have been approved, and others are undergoing testing in clinical trials. These drugs inhibit tumor growth not only by reducing the microvasculature in the tumor, but also by altering the autocrine loop of cancer cells via direct inhibition of VEGFR-2 expressed on their membranes. The VEGF -blocking antibody bevacizumab is used in the treatment of metastatic colorectal cancers (Hurwitz et al, 2004). At present, bevacizumab is being also evaluated in phase III trials of metastatic breast, lung, and pancreatic cancer. Due to its promising results in lung cancer, bevacizumab is expected to gain FDA approval for the treatment of this disease. In addition to blocking VEGF, inhibition of VEGFR-2 is also another attractive therapeutic strategy. Many compounds have been developed to inhibit VEGFR-2. Among them, sorafenib is a tyrosine kinase inhibitor that has been recently approved for the treatment of metastatic kidney cancer.
Although these drugs show a remarkable activity in tumors that are highly dependent upon VEGF and VEGFR-2, the inventors hypothesize that their clinical efficacy might be affected by somatic or germline variations altering the expression and the molecular functions of these two important proteins. Previous experience indicates that the genetic variation of tumor molecular targets alters the response of cancer patients to targeted therapies. For example, 1) the presence of somatic mutations in the epidermal growth factor receptor (EGFR) increases the likelihood of response of non- small cell lung cancer (NSCLC) patients treated with EGFR inhibitors (Lynch et al, 2004; Paez et al,
2004), and 2) somatic mutations in the BCR/ AbI oncogene lead to the recurrence of disease in patients with chronic myeloid leukemia treated with imatinib (Hughes and
Branford, 2006). The identification of EGFR mutations has changed the face of the treatment of metastatic NSCLC patients (for review, see Pao and Miller, 2005). Assays for mutation analysis are now used to screen patients and identify somatic mutations leading to imatinib resistance (Hughes and Branford, 2006).
The identification of molecular markers of response in cancer patients remains an unsolved issue for most of the common tumor types. Differences in VEGF and VEGFR-2 gene expression and tyrosine kinase activity due to somatic mutations might compromise the efficacy of anti-angiogenic therapy.
VEGFR-2 gene mutations have been identified in colorectal cancer cell lines (Bardelli et al, 2003), but their existence and prevalence of these mutations in other cancer types is unknown. More importantly, their functional consequences have never been investigated. The VEGFR-2 gene has not yet been sequenced in tumor samples and there are no data on somatic mutations in this gene. Moreover, determining which tumors and which patients are going to respond to anti-angiogenic therapy is an area of great interest (Iqbal and Lenz, 2004). Hence, identifying the biological markers of response to anti-angiogenic therapy would allow treatment of those patients who would likely benefit from therapy. The purpose of pharmacogenetic studies is to improve the outcome of drug therapy by identifying genetic markers of antitumor response (Innocenti and Ratain, 2002). At present, no markers predictive of the response of patients to anti-angiogenesis therapy have been identified (Iqbal and Lenz, 2004).
There is a need to identify germline and somatic variations in the VEGFR-2 gene
(KDR) and to be able to translate a patient's sequence information into other additional useful information related to angiogenesis in that patient. Moreover, because angiogenesis inhibitors are a growing class of therapeutics, there is a need to tailor therapies for patients with respect to this category of drugs.
SUMMARY OF THE INVENTION
The present invention is based on several pieces of data regarding the human VEGFR-2 genomic sequence. Re-sequencing of portions of the VEGFR-2 genomic sequence both identified new polymorphisms and confirmed previously known polymorphisms. Moreover, sequencing of the VEGFR-2 gene in breast and lung cancer samples identified polymorphisms and mutations (somatic/acquired and germline). These variants of the VEGFR-2 gene may affect VEGFR-2 expression levels, the level of risk of cancer or other angiogenesis-related disease or condition in an individual, prognosis of a patient with respect to an angiogenesis-related disease or condition (independently of treatment-predictive markers), and/or likelihood of efficacy and/or toxicity with respect to an anti-angiogenic therapy. In particular, the inventors report that -271G>A is a polymorphic variant that shows a significant decrease in expression when an "A" is present at that position. Other SNPs show a significant decrease in polypeptide activity.
In some embodiments, the present invention concerns methods for assessing expression or activity of vascular endothelial growth factor receptor 2 (VEGFR-2) in a patient with an angiogenesis-dependent condition or disease comprising determining the presence of one or more variants in a VEGFR-2 allele (KDR) in a biological sample from the patient. In particular embodiments, methods involve assessing specifically VEGFR-2 expression, which is indicative of activity. Also provided are methods for evaluating prognosis of a patient with an angiogenesis-dependent disease or condition comprising determining the presence of a polymorphism in a VEGFR-2 allele in a biological sample from the patient.
In further embodiments, there are methods for predicting toxicity or efficacy of an anti-angiogenic therapy comprising determining the presence of a variant in a VEGFR-2 allele in biological sample from a patient who has been or may be treated with an anti- angiogenic therapy (which can also be spelled "antiangiogenic therapy").
Additional aspects of the invention include methods for predicting risk of having or developing an angiogenesis-related disease or condition comprising determining the presence of a variant in a VEGFR-2 allele in biological sample from a patient.
The present invention also relates to methods for optimizing dosage of an anti- angiogenic therapy comprising a) obtaining a biological sample from a patient who will be treated with an anti-angiogenic therapy; b) having the presence of at least one variant in a VEGFR-2 allele determined from the biological sample; c) being notified of the presence of the at least one variant; and, d) optimizing dosage of the anti-angiogenic therapy. Alternatively, the present invention also pertains to methods of optimizing treatment for an angiogenesis-related disease or condition by providing information on whether to treat with an anti-angiogenic therapy at all. It comprises a) obtaining a biological sample from a patient who may be treated with an anti-angiogenic therapy; b) having the presence of at least one variant in a VEGFR-2 allele determined from the biological sample; c) being notified of the presence of the at least one variant; and, d) administering or not administering an anti-angiogenic therapy to the patient depending the status of variants in the VEGFR-2 allele of the patient. With some results, the best option for a patient may be to forego an anti-angiogenic treatment and/or to treat the patient with a non-anti-angiogenic treatment.
Such variants include but are not limited to nucleotide deletions, nucleotide insertions, and nucleotide substitutions. Thus variants of the invention comprise somatic mutations, single nucleotide polymorphisms (SNPs), and polymorphisms involving 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, or more nucleotides. In some aspects of the invention, genetic variants may alter the expression of the VEGFR-2 gene. For example, genetic variants may alter the transcription of VEGFR-2 RNA, alter the splicing of VEGFR-2 RNA, alter the stability of VEGFR-2 RNA or alter the translatability of VEGFR-2 RNA. In particular embodiments of the invention, a genetic variation results in altered expression of the VEGFR-2 gene product, particularly the protein. In certain other embodiments polymorphisms may also alter the coding region of the VEGFR-2 gene, thus variants may also result in premature stop codons in the VEGFR-2 open reading frame, missense mutations that alter the polypeptide coding region of VEGFR-2, synonymous mutations in regions containing exonic splicing enhancers or exonic splicing inhibitors (hence affecting constitutive splicing), and synonymous mutations altering codon usage during RNA synthesis. In certain cases polymorphisms in the VEGFR-2 gene may be in 5' or 3' sequences flanking the coding region, or in the intron or exons of the VEGFR-2 gene.
Some exemplary VEGFR-2 variants have been identified herein, however the current invention is no way limited to these variants. These variants in the VEGFR-2 gene or allele include, but are not limited to, -3601 G>A, -3538 C>T, -2886 T>C, -2854 A>C, -2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 G>A, -2008 A>G, -1973 (TAAA)6-H, -1942 A>G, -1918 G>A, -1846 OT, -1361 G>T, -1067 OA, -906 T>C, -679 G>A, -645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, -271 G>A, -1 G>T, 1107 T>C, 1367 T>C, 3684 OT, 4068 G>C, 4238 A>C, 3684 OT, 4423 (AC)i0-i2, 4442 OT, 4459 A>C, 6536 T>C, 6590 G>A, 6614 OT, 6648 OT, 9485 G> A, 11005 G>A, 11222 G>A, 11259 G>A, 11903 G>A, 14752 G>C, 16583 GAGG>-, 16925 T>C, 17070 T>C, 17171 OG, 17186 G>A, 17366 A>G, 18465 T>G, 18487 A>T, 18515 T>C, 19948 T>C, 20220 G>T, 20470 T>A, 20498 T>C, 20679 OT, 22716 G>C, 22820 G>C, 23336 OT, 23408 T>G, 26027 T>C, 26429 A>-, 26626 G>A, 26856 G>A, 26896 T>C, 27311 A>T, 27360 A>G, 27534 OT, 28914 >C, 29103 A>G, 29636 OT, 29743 G>A, 30302 A>G, 30375 G>A, 30564 G>A, 32309 T>C, 33738 T>C, 33828 G>A, 36229 G>A, 36438 OT, 37978 OT, 38081 T>C, 38131 G>A, 39592 A>G, 39638 T>C, 39730 OT, 39733 OA, 40029 A>C, 40096 OT, 40161 A>G, 42868 OT, 43353 OT, 43393 OA, 44123 A>G, 44189 T>C, 44306 T>G, 44497 A>C, 44559 A>T, 44790 OT, 45022 OT, 45107 OA, 45380 T>C, 45638 T>-, 46188 T>C, 46810 T>C, or 46843 A>C or any combination thereof. One of skill in the art will recognize that additional variants in the VEGFR-2 gene may also be identified and are included as part of the current invention. Moreover, methods of the invention that involve determining the presence of one or more variants in a VEGFR-2 allele may involve assaying for the variant or assaying for the reference sequence. Determining the presence of a variant in the VEGFR-2 gene may involve determining the sequence, for example, at position -271 and this may be done by assaying for a "G," "A," or both at that position in one or both alleles.
Polymorphisms that provide for lower expression of KDR (-271 G>A) or that lead to a KDR polypeptide with less activity (6648 C>T, 18487 A>T, and/or 18515 T>C) are specifically contemplated as embodiments of the invention.
In some embodiments of the invention the sequence at position -271 is determined. Determining there is a "G" at position -271 indicates a higher VEGFR expression than if an "A" had been determined at position -271. An "A" at position -271 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "G" at position -271. In particular embodiments, the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein. In further embodiments, an "A" at position -271 of the VEGFR-2 gene is also indicative of decreased risk of toxicity and decreased efficacy of an anti-angiogenic therapy, as well as a reduced dosage for that therapy, relative to a subject having a "G" at position -271.
In other embodiments of the invention the sequence at position 6648 is determined. A "T" at position 6648 is represented by the patient having the SNP 1 polymorphism, where a "C" at position 6648 is the wild type. Determining a "C" at position 6648 indicates a higher VEGFR expression than if a "T" had been determined at position 6648. A "T" at position 6648 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "C" at position 6648. In particular embodiments, the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein. In further embodiments, a "T" at position 6648 of the VEGFR-2 gene indicates lower receptor activation. In some embodiments, a "T" at position 6648 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "C" at position 6648. In some embodiments, a "T" at position 6648 indicates a worse cancer prognosis. In other embodiments, a "T" at position 6648 is predictive of lower efficacy of an anti-angiogenesis drug. In some embodiments, a "T" at position 6648 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
In other embodiments of the invention the sequence at position 18487 is determined. A "T" at position 18487 is represented by the patient having the SNP 4 polymorphism, where a "A" at position 18487 is the wild type. Determining a "A" at position 18487 indicates a higher VEGFR expression than if an "T" had been determined at position 18487. A "T" at position 18487 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "A" at position 18487. In particular embodiments, the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein. In further embodiments, a "T" at position 18487 of the VEGFR-2 gene indicates lower receptor activation. In some embodiments, a "T" at position 18487 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "A" at position 18487. In some embodiments, a "T" at position 18487 indicates a worse cancer prognosis. In other embodiments, a "T" at position 18487 is predictive of lower efficacy of an anti-angiogenesis drug. In some embodiments, a "T" at position 18487 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
In other embodiments of the invention the sequence at position 18515 is determined. A "C" at position 18515 is represented by the patient having the SNP 5 polymorphism, where a "T" at position 18515 is the wild type. Determining a "T" at position 18515 indicates a higher VEGFR expression than if an "C" had been determined at position 18515. A "C" at position 18515 of the VEGFR-2 gene is generally associated with a decrease in VEGFR-2 expression compared to a sample in which there is a "T" at position 18515. In particular embodiments, the decrease in expression and/or activity is, is at least, or is at most about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein. In further embodiments, a "C" at position 18515 of the VEGFR- 2 gene indicates lower receptor activation. In some embodiments, a "C" at position 18515 of the VEGFR-2 gene is indicative of a patient who has lower expression of KDR than a patient who has a "T" at position 18515. In some embodiments, a "C" at position 18515 indicates a worse cancer prognosis. In other embodiments, a "C" at position 18515 is predictive of lower efficacy of an anti-angiogenesis drug. In some embodiments, a "C" at position 18515 is indicative of the need for an increased dosage of an anti-angiogenesis therapy.
It is further contemplated that in other embodiments of the invention a variant is associated with an increase in expression of, of at least, or of at most a 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, or any range derivable therein.
It will be understood that the term "determine" is used according to its ordinary and plain meaning to indicate "to ascertain definitely by observation, examination, calculation, etc.," according to the Oxford English Dictionary (2n ed.). It will also be understood that the phrase "determining the sequence at position X" means that the nucleotide at that position is directly or indirectly determined, i.e., identified. In some embodiments, the sequence at a particular position is determined, while in other embodiments, what is determined at a particular position is that a particular nucleotide is not at that position.
Positions are indicated by conventional numbering where a negative sign (-) refers to nucleotides upstream (5') from the transcriptional start site (+1) (these sequences are in the promoter), unless otherwise designated. A sequence in the 5' untranslated region (5' UTR) may also be referred to by a negative sign, and in these cases, the positioning is with respect to the translated portion, where the first nucleotide of a codon is understood as +1. Positions downstream of the translational start site may or may not have a plus sign (+). Furthermore, unless otherwise indicated or understood, identification of a position downstream of the transcriptional start site refers to a position with respect to only the coding region of the gene, that is, its exons and not the introns. In some instances, positions within introns are referred to and the numbering for these positions is typically with respect to that intron alone, and not the gene as a whole.
In other embodiments, gene amplification in the tumor may be assessed. Gene amplification may be assessed by various methods known to those of skill in the art, including but not limited to fluorescence in situ hybridization (FISH) or quantitative RT- PCR. In some embodiments, the presence of a -271, SNP 1, SNP 4, and/or SNP 5 variant may predict the occurrence of VEGFR-2 gene amplification in the tumor.
In further embodiments of the invention, methods also include obtaining a sample from a patient and using the sample to determine one or more sequences or to evaluate polymorphisms in the VEGFR-2 gene. The sample may contain blood, serum, or a tissue biopsy, as well as buccal cells, mononuclear cells, endothelial cells, and/or cancer cells. In some embodiments, an increased copy number is correlated with the presence of the polymorphism identified in this application.
Determining a sequence may be determined directly or indirectly. A direct determination involves performing an assay with respect to that position(s). An indirect determination means that a determination is based on data regarding a different position, particularly by evaluating the sequence of a position in linkage disequilibrium (LD) with the sequence. In some cases, more than one position in linkage disequilibrium with the sequence is evaluated. Therefore, in some embodiments of the invention, a haplotype is evaluated. In these embodiments, a determination of one or more sequences in one or both alleles of a gene in the haplotype is included in methods of the invention. In particular embodiments of the invention, the sequence at position -271 is determined by determining the sequence of a polymorphism, which may or may not be a SNP, in linkage disequilibrium with position -271. In certain embodiments, the polymorphism in linkage disequilibrium with position -271 is at position -367. In particular embodiments, the patient being evaluated is Caucasian, African-American, or Asian and the variants being evaluated are from one or more groupings identified in FIG. 4 for that race. In certain embodiments, the patient is Caucasian and the polymorphism in linkage disequilibrium with position -271 is at position -906 or position -607. In further embodiments, the patient is Asian and the polymorphism in linkage disequilibrium with position -271 is at position -906. In still further embodiments, the patient is African- American and the polymorphism in linkage disequilibrium with position -271 is at position -906, -607, or -645.
In some embodiments, methods involve determining a variant in a VEGFR-2 gene by evaluating a nucleic acid, either DNA or RNA. In other embodiments, a variant can be determined by evaluating the VEGFR-2 polypeptide. In embodiments involving evaluating a nucleic acid, in some cases the nucleic acid is evaluated using sequencing, microsequencing, allele-specific hybridization, amplification, or pyrosequencing. In some embodiments the DNA is amplified using the polymerase chain reaction (PCR). In certain embodiments, the primers used for amplification may be labeled for instance with radioactive, fluorescent, or luminescent label. SNPs or other variants may be directly detected by a variety of methods known to those in the art, including but not limited to, DNA sequencing or differential hybridization. Additionally, indirect methods of detection may be used to determine the presence of a polymorphism, for example, detection of changes in a fluorescent, colorimetric, or radioactive signal.
It will be recognized by one skilled in the art that methods and compositions described herein comprise any VEGFR-2 gene variant, however, exemplary polymorphisms and methods for their detection are discussed herein. In certain embodiments, the variant is at position -3601, -3538, -2886, -2854, -2806, -2766, -2756, - 2750, -2628, -2502, -2455, -2406, -2008, -1973, -1942, -1918, -1846, -1361, -1067, -906, -679, -645, -607, -565, -425, -417, -367, -319, -271, -1, 1107, 1367, 3684, 4068, 4238, 3684, 4423, 4442, 4459, 6536, 6590, 6614, 6648, 9485, 11005, 11222, 11259, 11903, 14752, 16583, 16925, 17070, 17171, 17186, 17366, 18465, 18487, 18515, 19948, 20220, 20470, 20498, 20679, 22716, 22820, 23336, 23408, 26027, 26429, 26626, 26856, 26896, 27311, 27360, 27534, 28914, 29103, 29636, 29743, 30302, 30375, 30564, 32309, 33738, 33828, 36229, 36438, 37978, 38081, 38131, 39592, 39638, 39730, 39733, 40029, 40096, 40161, 42868, 43353, 43393, 44123, 44189, 44306, 44497, 44559, 44790, 45022, 45107, 45380, 45638, 46188, 46810, or 46843 or any combination thereof. Any other variants described in FIG. 8 or in the Tables provided herein are also embodiments of the invention. In certain embodiments, variants in the core promoter region are employed in methods and composition of the invention.
In particular embodiments, the variant is at position -271. In other embodiments, the variant may change protein function; of the 8 nonsynonymous SNPs found in the protein (shown in FIG. 2), R106W, Q472H and C482E may be evaluated in specific embodiments of the invention. Moreover, in particular embodiments in which a patient has breast cancer, the variant is at position -3601, -2886, -2854, -2806, -2766, -2750, -2628, -2455, -906, -645, -607, -565, -425, -367, -319, -271, 4459, 11005, 11222, 11903, 16599, 18487, 18515, 22716, 23408, 26429, 26626, 26856, 26896, 27360, 28915, 29103, 30302, 36229, 42868, or 45380 or any combination thereof. In other embodiments, where a patient has lung cancer, the variant is at position -565, -271, -1, 11903, 18487, 23408, 30302, 36229, 45107, or any combination thereof, or at position -3757, -3651, 6536, 6590, 6114, 6648, 20470, 20498, 22820, 23336, 27534, 29636, or 30375, or any combination thereof.
The present invention concerns patients who have, have been diagnosed with, and/or are at risk for one or more angiogenesis-dependent diseases or conditions. An angiogenesis-dependent disease or condition is one whose pathology is dependent on angiogenesis, and thus, anti-angiogenic therapies (i.e., a therapy that inhibits, prevents, or reduces angiogenesis) may be employed to the patient's benefit (either as a preventative and/or therapeutic). Methods and compositions of the invention are not limited by the angiogenesis-dependent condition or disease, though in particular embodiments, the angiogenesis-dependent condition or disease is cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; or wound granulation. In certain embodiments of the invention, methods also include identifying a patient who is a candidate for an anti-angiogenesis drug generally or for a specific anti- angiogenesis drug, such as one disclosed herein. Methods are also understood as being useful with patients who is being considered for treatment with an anti-angiogenesis drug or for a patient who has failed or shown resistance to a previous anti-angiogenesis or cancer therapy.
In certain embodiments, a patient has an angiogenesis-dependent cancer. Such cancers include a solid tumor, leukemia, tumor metastases, or benign tumor. In particular embodiments of the invention, the cancer is a solid tumor. In further embodiments, cancer is lung cancer or breast cancer. Such cancers may be malignant. Moreover, such cancers may be metastatic or metastasized, and they may be the primary tumor or a secondary tumor. It also may be the case that the cancer is a benign tumor, such as a hemangioma, acoustic neuroma, neurofibroma, trachoma, or pyogenic granuloma. Thus, some methods of invention may be applied specifically to cancer patients in some embodiments or a patient at risk for cancer.
Methods of the invention provide ways of identifying patients whose genotype leads to lower expression of KDR compared to a patient who doesn't have that genotype or leads to a KDR polypeptide with less activity compared to a patient who doesn't have that genotype.
In some embodiments, methods of predicting efficacy of an antiangiogenic drug are provided. In particular, a patient whose genotype which leads to lower KDR expression or lower KDR activity are predicted to be less responsive to VEGFR2 inhibitor drugs or require higher doses of VEGFR2 inhibitor drugs than a patient who does not have that genotype. Specific VEGFR2 inhibitor drugs include CAI,
CM101/ZDO 101, Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190,
AZD2171, CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP,
AG-013958, JSM6427, TG100801, ATG3, Sirolimus, OT-551, pazopanib, AG-0736, cilengitide, thalidomide, ABT-869, ZD 4190, IMC-ICl 1, IMC-1121B, CDP-791, AZD 2171, Bay 57-9352, XL647, XL999, CHIR258, CEP7055, AEE788, ZK304709, SU6668,
SUl 11248, GW654652, GW786034, AG13736, CP-547632,OSI-930, RO4383596, or
ZM323881.
In particular embodiments, VEGFR2 inhibitors that do not have activity against multiple tyrosine kinase receptors are contemplated where in other embodiments the VEGFR2 inhibitor targets multiple tyrosine kinase receptors. In other embodiments, the
VEGFR-2 inhibitor drug targets the VEGFR-2 ligand. In a particular embodiment, the
VEGFR-2 inhibitor is Avastin.
Embodiments of the invention further include adjusting dosage (concentration and/or administration (timing and/or frequency)) or route of administration of the anti- angiogenesis therapy, or altering the treatment regimen overall. In some cases, the time between treatment regimens may be altered. Therefore, in certain embodiments, the patient has undergone or may undergo anti-angiogenic therapy.
It is contemplated that a patient is given a different dosage than he or she would have otherwise received had the genotyping not been performed. Thus, in some embodiments of the invention, a typical dosage is adjusted for a particular person (individualized therapy).
In specific embodiments, a patient may be considered for anti-angiogenic therapy or already be on anti-angiogenic therapy. In some cases, the anti-angiogenic therapy is CAI, CM101/ZDO 101, Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190, AZD2171, CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP, AG-013958, JSM6427, TG100801, ATG3, Sirolimus, OT-551, pazopanib, AG-0736, cilengitide, thalidomide, ABT-869, ZD 4190, IMC-ICl 1, IMC-1121B, CDP-791, AZD 2171, Bay 57-9352, XL647, XL999, CHIR258, CEP7055, AEE788, ZK304709, SU6668, SUl 11248 , GW654652, GW786034, AG13736, CP-547632,OSI-930, RO4383596, or ZM323881. Specifically contemplated in some embodiments are therapies that are used to treat cancer and/or VEGFR-2 inhibitors (that is, agents that inhibit the activity of VEGFR-2). In particular embodiments, the anti-angiogenic therapy is a KDR inhibitor.
In some embodiments, the presence of the variant can be predictive of serum levels of soluble VEGFR-2. The level of serum KDR may be used to indicate efficacy and/or toxicity.
In other embodiments, the presence of the variant can be also predictive of other markers (hypertension, proteinuria, and laboratory abnormalities) that might be related to the inhibition of KDR by anti-angiogenesis therapy. In some embodiments, these other markers may be undergoing development as potential markers of efficacy and/or toxicity.
In particular embodiments, a marker may be identified by lab abnormalities.
It will be of course understood that the assessments or predictions of activity and response are relative with respect to patients having a different genotype at the relevant position(s). Moreover, when multiple polymorphisms or factors are considered the effect will be considered additive with respect to those indicators that identify a greater or higher risk of toxicity. A person of ordinary skill in the art will use these different indicators in considering adjustments in dosage that might reduce the risk of toxicity in the patient.
Methods of the invention also include monitoring for toxicity or adverse events once the anti-angiogenic therapy is administered, and possibly, adjusting or modifying dosage based on those results. Toxicity indicators or indicators of adverse events secondary to treatment with anti-angiogenesis inhibitors include hypertension, skin rush, bleeding complications, cardiovascular accidents, deep venous thrombosis, gastrointestinal perforation, diarrhea, neutropenic fever, other hematologic toxicities, as well as other non listed non-hematologic toxicities. In other embodiments, methods involve monitoring for drug efficacy to determine if drug dosages or regimens should be increased in amount and/or frequency.
Moreover, it is contemplated in any of the methods of the invention that methods can involve knowing the sequence of one or more variants instead of detecting or determining the polymorphism. A doctor or clinician who is selecting the most appropriate therapy or optimizing its dosages need not perform the polymorphism himself/herself; the doctor may have one or more sequences determined and then use the information accordingly.
In some cases, a method of the invention comprises the steps of obtaining a DNA sample from an individual, amplifying the DNA comprising all or part of the VEGFR-2 genomic region and, determining the presence of a variant in the DNA. In certain cases the method may comprise amplifying all or part of the VEGFR-2 gene 5' flanking sequence, intron 1, intron 2, exon 3, intron 3, intron 5, intron 6, exon 7, exon 9, intron 9, intron 10, exon 11, intron 12, exon 13, intron 13, exon 14, exon 15, intron 15, intron 16, intron 17, exon 18, intron 18, intron 19, exon 20, intron 20, exon 21, intron 21, intron 22, intron 25, intron 26, intron 27, intron 28, intron 29, 3' UTR, and/or the 3' flanking sequence and determining the presence of a variant in the amplified sequence.
It is contemplated that more than one variant may be determined in methods of the invention. It is contemplated that 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, Or 20 variants, or any range therein, may be determined according to methods of the invention or with kits of the invention. In some specific embodiments the invention may comprise detecting a genetic variant within the VEGFR-2 genomic region from germline DNA of patients. However, in other embodiments, the invention may involve detecting a genetic variant from tumor DNA of patients; in this case, the invention may involve detecting also somatic/acquired mutations. In certain embodiments, variants in linkage disequilibrium may be evaluated, as are identified in FIG. 4A-C. In particular embodiments, the patient being evaluated is Caucasian, African-American, or Asian and the variants being evaluated are from one or more groupings identified in FIG. 4 for that race. In particular embodiments, a patient's race is known, in which case, it may or may not be considered when employing methods of the invention. In other embodiments, a patient's race is not known and/or is not considered when employing methods of the invention.
In further embodiments of the invention, a biological sample is obtained from a patient. In other embodiments of the method, the entity evaluating the sample for a variant did not directly obtain the sample from the patient. Therefore, methods of the invention involve obtaining the sample indirectly or directly from the patient. To achieve these methods, a doctor, medical practitioner, or their staff may obtain a biological sample for evaluation. The sample may be analyzed by the practitioner or their staff, or it may be sent to an outside or independent laboratory. The medical practitioner may be cognizant of whether the test is providing information regarding a nucleic acid or polypeptide sequence, or the medical practitioner may be aware that the test indicates directly or indirectly that the test was positive or negative for a variant or polymorphism.
It is specifically contemplated that the evaluation may indicate simply that a sample is positive or negative for a particular polymorphism or protein or that expression or activity of KDR is decreased or not, relative to someone with a different genotype at the evaluated positions.
Suitable biological samples include any sample with genomic nucleic acids, such as blood, serum, PBMC, semen saliva, tears, urine, fecal material, sweat, a buccal sample, tissue sample, skin and hair. In particular embodiments, the biological sample is a biopsy from a tumor. In certain embodiments, the biological sample is from a biopsy of tissue that may or may not be cancerous, tumorigenic, and/or metastatic. It is also contemplated that biological samples may be placed on a slide for histological analysis on either the protein or nucleic acid level. In such cases, the sample may be fixed or not fixed. Such methods are well known to those of skill in the art.
In any of these circumstances, the medical practitioner may know the relevant information that will allow him or her to determine whether the patient has the phenotype associated with a particular genotype. It is contemplated that, for example, a laboratory conducts the test to assess whether a patient has one or more polymorphisms or variants.
Laboratory personnel may report back to the practitioner with the specific result of the test performed or the laboratory may simply report that the patient is positive for a particular phenotype.
The patient from whom a biological sample is obtained may be identified as in need of anti-angiogenesis treatment or have symptoms of a disease that is potentially treatable with an anti-angiogenesis treatment. Moreover, some methods of the invention involve identifying a patient such patients.
Accordingly, the present invention concerns kits for achieving methods of the invention. It is contemplated that kits can include particular components in suitable containers for uses consistent with the invention.
The present invention further concerns compositions that can be used to determine the sequence at the variants discussed above or any other sequence in LD with it. In some embodiments, the nucleic acid is a primer for amplifying the sequence. In others, the nucleic acid is a specific hybridization probe for detecting the sequence. A probe can also be adjacent to the specific hybridization probe for a sequence. Additionally, it is contemplated that the specific hybridization probe can be comprised in an oligonucleotide array or microarray.
In another embodiment, the invention further comprises a kit for screening individuals for variation in VEGFR-2 activity by detecting variants in the VEGFR-2 gene. Alternatively, there are kits for evaluating vascular endothelial growth factor receptor 2 (VEGFR-2) expression comprising oligonucleotides to evaluate at least two variants in a VEGFR-2 allele in biological sample. In certain embodiments, the kit comprising primers for amplifying DNA in a region comprising all or part of the VEGFR-2 gene or allele and/or specific hybridization probes for detecting any of the VEGFR-2 variants. In some embodiments, the kit also contains deoxynucleoside triphosphates, buffers, labels for detecting the polymorphisms and instructions.
Kits may involve compositions that can detect variants at positions -3601, -3538, - 2886, -2854, -2806, -2766, -2756, -2750, -2628, -2502, -2455, -2406, -2008, -1973, - 1942, -1918, -1846, -1361, -1067, -906, -679, -645, -607, -565, -425, -417, -367, -319, - 271, -1, 1107, 1367, 3684, 4068, 4238, 3684, 4423, 4442, 4459, 6536, 6590, 6614, 6648, 9485, 11005, 11222, 11259, 11903, 14752, 16583, 16925, 17070, 17171, 17186, 17366, 18465, 18487, 18515, 19948, 20220, 20470, 20498, 20679, 22716, 22820, 23336, 23408, 26027, 26429, 26626, 26856, 26896, 27311, 27360, 27534, 28914, 29103, 29636, 29743, 30302, 30375, 30564, 32309, 33738, 33828, 36229, 36438, 37978, 38081, 38131, 39592, 39638, 39730, 39733, 40029, 40096, 40161, 42868, 43353, 43393, 44123, 44189, 44306, 44497, 44559, 44790, 45022, 45107, 45380, 45638, 46188, 46810, or 46843. Any other variants described in FIG. 8 or in the Tables provided herein are also embodiments of the invention. In specific embodiments, a nucleic acid included in a kit can detect the variant at position -271. In other particular embodiments, a nucleic acid included in a kit can detect the variant at position 6648. In other embodiments, a nucleic acid included in a kit can detect the variant at position 18487. In still further embodiments, a nucleic acid included in a kit can detect the variant at position 18515.
The invention further comprises a kit for screening individuals to detect variants in the VEGFR-2 gene, the kit comprising primers for amplifying DNA in a region comprising all or part of a the VEGFR-2 gene. In a certain embodiments, the kit also contains deoxynucleoside triphosphates, buffers, labels for detecting the polymorphisms and instructions.
In certain embodiments, primers are part of a kit. Individual primers or primers pairs as disclosed in the Examples may be included in certain kit embodiments. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more different primers with a sequence of SEQ ID NOs:4-141 may be part of a kit. It is contemplated that in some embodiments, specific hybridization probes are comprised in an oligonucleotide array or microarray. Primers may be comprised in a multi-well assay plate.
The terms "VEGFR-2 gene" and "KDR" may be used interchangeably throughout this application.
Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well.
The embodiments in the Example section are understood to be embodiments of the invention that are applicable to all aspects of the invention. The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."
Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
Following long-standing patent law, the words "a" and "an," when used in conjunction with the word "comprising" in the claims or specification, denotes one or more, unless specifically noted.
Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1. VEGFR-2 gene (KDR) structure showing the sequenced regions.
FIG. 2. VEGFR-2 (1357 amino acids): nonsynonymous variants and their frequency (gray highlights the SNPs that are predicted by SIFT to have functional changes).
FIG. 3. Comparison of resequencing data with HapMap data. Frequency of VEGFR-2 gene variants that have been found also in HapMap.
FIG. 4A-C. Tagging SNPs for the three ethnic groups. Parameters are r2 of 0.8 and 10% cut-off for allele frequency.
FIG. 5A-C. LD plot for three ethnic groups.
FIG. 6. Luciferase activity levels relative to the internal control.
FIG. 7. VEGFR-2 genomic sequence, from 4 kb before the start of 5' UTR region, to 1 kb after the end of 3' UTR. Shaded portion shows the start point of "ATG"; the "A" is +1. All the exon regions and UTR regions are capitalized. The underlined sequence is the core promoter region.
FIG. 8. Table showing different VEGFR-2 variants. Those variants relevant to
Cluster-buster are -3538, 9485, 16599, 16925, 33738, 33828, 44123, 44189, and 44306.
Those variants with conserved regions are 3684, 4238, 3684, 4442, 11005, 17366, 19948, 23408, 26856, 27360, 29743, 38081, 39592, 39638, 40029, 40096, 40161, 44790, 45107, and 45380.
FIG. 9. Association between the -271G>A genotype and VEGFR-2 protein expression in 101 stage I-II NSCLC.
FIG. 10 VEGF-Ai64 induced VEGFR-2 activation in Hek 293 cells tranfected with VEGFR-2 SNPs. pBE-K868M is the negative control (wt-); pcDNA5-FRT VEGFR-2 is the wild-type (wt+). DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS I. VEGFR-2 and Angiogenesis
Host endothelial cells are stimulated by tumor growth factors to produce neovessels providing blood supply to the growing tumor. The angiogenesis process is an important component of tumor growth and metastatization (Folkman, 2002), and is mediated by a complex interplay between pro- and anti-angiogenesis factors in the endothelial cells (Collins and Hurwitz, 2005; see below the VEGF pathway from the Pharmacogenetics and Pharmacogenomic Knowledge (on the World Wide Web at pharmgkb.org/search/pathway/vegf/vegf.jsp). Among them, the vascular endothelial growth factor (VEGF) is considered the key regulator of blood vessel growth (Ferrara et al, 2003). The VEGF family consists of six glycoproteins, including VEGF-A, -B, -C, - D, -E, and the placental growth factor. In general, VEGF family members mediate their effects by binding to one or more VEGF receptors, with resultant activation of the receptor's intracellular tyrosine kinase domain. There are three members of the VEGF receptor family, including VEGFR-I (FIt-I), VEGFR-2 (KDR or FIk-I), and VEGFR-3 (Flt-4). VEGF-A, commonly referred as VEGF, can be secreted by a variety of cells and its activity is mediated mainly through two receptors, VEGFR-I and -2.
VEGFR-2 is the most important receptor of VEGF; it stimulates endothelial cell proliferation and migration via its tyrosine kinase activity, whereas VEGFR-I does not affect proliferation (Veikkola et al, 2000). In solid tumor angiogenesis, VEGF and VEGFR-2 are regarded as the most critical endothelial cell ligand and receptor, respectively. Among the VEGFR family of proteins, VEGFR-2 mediates all endothelial cellular responses to VEGF {i.e., mitogenic, angiogenic and permeability-enhancing effects) to establish a tumor's neovasculature (Meyer et al, 1999; Wise et al, 1999; Gille et al, 2001). VEGFR-2 is expressed predominantly on endothelial cell (Robinson and Stringer, 2001), and is thought to play a significant role in the development of metastases (Iqbal and Lenz, 2004). VEGFR-2 expression levels are low in normal tissues and only increase in pathological states when neovascularization occurs, including tumor formation. Increased expression of pro-angiogenic factors by the tumor- associated vasculature is a hallmark of a variety of human tumors. For example, the amount of VEGF and VEGFR-2 staining in colon tumor endothelia correlates with tumor growth rate, micro-vessel density/proliferation, and tumor metastatic potential (Takahashi et al, 1995). In a colon cancer mouse model, VEGFR-I and -2 were upregulated in liver metastases compared to adjacent nontumorous liver tissue (Warren et al, 1995). In a recent study, differences in tumor staining of VEGFR-2 were highly predictive of recurrence- free survival of breast cancer patients treated with tamoxifen, indicating that the VEGFR-2 status is a significant predictor of tamoxifen response (Ryden et al, 2005). Differences in VEGFR-2 expression and/or activity among cancer patients can affect the antitumor response of agents interfering with the VEGF- VEGFR-2 pathway, and such variability has a genetic basis that may be predicted by characterizing VEGFR-2 gene variation in the population and its functional effects.
Several new anticancer agents interfering with the VEGF- VEGFR-2 pathway have been developed and are undergoing testing in clinical trials. Some of these molecules are antibodies {e.g., bevacizumab) and soluble receptors targeting the VEGF ligand. Recently, the anti- VEGF blocking antibody bevacizumab has been approved by the FDA for the treatment of metastatic colorectal cancer (Hurwitz et al, 2004). At present, bevacizumab is being also evaluated in phase III trials for metastatic breast cancer, non-small cell lung cancer, pancreatic cancer and renal cell carcinoma, and it is expected to be approved for the treatment of non-small cell lung cancer. Due to the central role of VEGFR-2 in the angiogenesis pathway, blockade of VEGFR-2 is a highly attractive therapeutic strategy. Many compounds inhibit VEGFR-2 and these include antibodies, small molecule inhibitors of the tyrosine kinase activity (i.e., vatalanib, sorafenib), ribozymes, and vaccines. Sorafenib is expected to receive FDA approval for the treatment of metastatic kidney cancer. The efficacy of VEGFR-2 inhibitors might be affected by differences in the ligand binding property of the receptor and its tyrosine kinase activity.
In oncology, gene variation information is used to predict the risk of severe toxicity of irinotecan (Innocenti et al, 2004) and 6-mercaptopurine (Evans et al, 2001), and the labels of these two drugs have been recently revised to indicate the inherited risk for patients. Moreover, gene variation information has been strongly associated with tamoxifen survival (Jin et al, 2005) and gefitinib response (Lynch et al, 2004; Paez et al, 2004). Pharmaco genetic studies to predict patient's response to drug therapy rely on the genetic information available on genes playing an important role in the drug pharmacokinetics and targets of mechanisms of action. When the targets of anticancer therapy are expressed in normal tissue, like VEGFR-2, germline DNA variation that is correlated with changes in expression and/or function of the target might significantly affect drug antitumor activity.
Very little genetic data are available on the VEGFR-2 gene (kinase insert domain receptor, KDR). KDR is located at 4ql2, contains 30 exons and spans 47 Kb of genomic sequence. Limited single nucleotide polymorphism (SNP) data are currently available. For example, the HapMap website (on the World Wide Web at hapmap.org) reports 11 SNPs at intermediate-high frequency in Caucasians, and no information on insertion/deletions is provided. It has been estimated that a SNP spacing of even 2 Kb shows a considerable loss of information in the analysis of haplotype-tagging SNPs (lies, 2004). The definition of the KDR haplotype structure cannot rely on the scarce information provided by HapMap, as the density of the surveyed sequence of KDR (average spacing of 4 Kb) is not sufficient to provide an accurate estimate of the haplotype-tagging SNPs. Other SNPs at intermediate-high frequency have been deposited into the dbSNP database (World Wide Web at ncbi.nlm.nih.gov/SNP). A few of them were genotyped in a case-control study of Kawasaki disease, and an intron 2 variant seems to have a silencer effect on gene transcription in luciferase assays (Kariyazono et ah, 2004). The functional effects of other variants and their haplotypic combinations are unknown. Moreover, dbSNP data are not an accurate reflection of the extent of variation in a certain gene due to a considerable rate of false positives and false negatives. For example, in a recent resequencing study of the UGTlA gene (Grimsley et ah, 2003), only about 20% of the variants found after resequencing were also reported in the dbSNP database. Moreover, the differences in allele frequencies and haplotypic composition of the KDR gene among Caucasians, Asians, and African Americans have not been described in detail. As population structure has been shown to affect phenotypic characterization in genetic association studies (Pritchard et al, 2000), this information is crucial to characterize the KDR genetic variation in individuals with different ethnic backgrounds.
As discussed above, VEGFR-2 plays a significant role in angiogenesis. Angiogenesis-related diseases or conditions include, but are not limited to, cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation.
VΕGFR-2 has been targeted for anti-angiogenic therapy. Consequently, such therapies may be impacted by the status of VEGFR-2. These therapies include, but are not limited to, the therapies listed in Table 1.
CAI [(inhibitor of calcium influx) — NCI]; ABT-627 [(endothelin receptor antagonist)-- Abbott/NCI]; CM101/ZDO 101 [(group B Strep toxin that selectively disrupts proliferating endothelium by interaction with the CM201 receptor)— CarboMed/Zeneca]; Interleukin-12 [(induction of interferon-γ, down-regulation of IL-10, induction of IP-10)~M. D. Anderson Cancer Center/Temple University, Temple University, Genetics Institute, Hoffman LaRoche]; IM862 [(blocks production of VEGF and bFGF, increases production of the inhibitor IL- 12)— Cytran] ; PNU- 145156E [(blocks angiogenesis induced by Tat protein)~Pharmacia & Upjohn]; Neovastat [(AE-941; Aeterna Laboratories, Quebec City, Canada)]; SUl 1248 (inhibits the TK activity of VEGF-R, platelet-derived growth factor receptor (PDGF-R), c-kit, and flt3); Suramib; bevacizumab (Avastin, Genentech); endostatin; radiotherapy; sorafenib; sunitinib; vatalanib; ZD-6474; ZD4190; AZD2171; CEP-7055; PTK787; SU5416; Macugen (pegaptanib sodium); Lucentis (ranibizumab); Tryptophanyl-tRNA synthetase (TrpRS); Retaane 15 mg (aka anecortave acetate); Combretastatin A4 Prodrug (CA4P); AdPEDF; VEGF-TRAP; AG-Ol 3958; JSM6427; TGl 00801; ATG3; Sirolumus (rapamycin); OT- 551 ; pazopanib; AG-0736; cilengitide; thalidomide; and/or ABT-869 (inhibitor of KDR) (Albert et al, 2006). Anti-angiogenic drugs particularly for wet macular degeneration can be found at the Macular Degeneration Support website (on the World Wide Web at on the World Wide Web at mdsupport.org/library/anti-angio.html).
Moreover, therapy with recombinant VEGF and FGF for coronary artery disease
(therapeutic myocardial angiogenesis) has progressed pro-angiogenesis therapies and it is contemplated that they may be impacted by one or more VEGFR-2 variant(s) as described above (see articles on World Wide Web at medscape.com/viewarticle/406399_4, Simons et ah, 2002 and Mukherjee, 2004, which are hereby incorporate by reference).
A variant at -271 G>A, 6648 OT (SNP 1), 18487 A>T (SNP 4), and/or 18515 T>C (SNP 5) is indicative of a patient who has lower expression of VEGFR-2 than a patient who does not have that variant. Higher expression of the VEGFR-2 is predicative of a worse cancer prognosis and/or a higher efficacy of an anti-angiogenesis drug in patients with that phenotype. It has been shown that a variant at SNP2 could be related to a significant decrease in VEGF binding efficiency to KDR (Wang et ai, 2007).
Other methods of using the invention are described in Canadian Appln. 2,558,753, Canadian Appln. 2194277, China Appln. 200580006465.7, EGB 0768895,
EIE 0768895, ELU 0768895, EP Appln. 05724156.4, EPA 0768895, Japanese Appln.
2006-242179, Japanese Appln. 2007-501893, Japanese Appln. 503964/96, Korean Appln.
10-2006-7020515, PCT Appln. PCT/US2005/006559, PCT Appln. PCT/US2005/007410,
PCT Appln. PCT/US2007/060995, PCT Appln. WO96/01127, U.S. Appln. Serial 08/271,278, U.S. Appln. Serial 10/558510, U.S. Appln. Serial 10/591,484, U.S. Appln.
Serial 10/591228, U.S. Appln. Serial 11/561341, U.S. Appln. Serial 11/913,150, U.S.
Patent 5,786,344, U.S. Serial No. 60/549,069, U.S. Serial No. 60/550,268, all of which are incorporated by reference in their entirety.
II. Nucleic Acids Certain embodiments of the present invention concern various nucleic acids, including amplification primers, oligonucleotide probes, and other nucleic acid elements involved in the analysis of genomic DNA, in particular, the VEGFR-2 gene. In certain aspects, a nucleic acid comprises a wild-type or variant nucleic acid.
The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompass the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid." The term "oligonucleotide" refers to a molecule of between about 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. A "gene" refers to coding sequence of a gene product, as well as introns and the promoter of the gene product.
The cDNA sequence for the human VEGFR-2 gene (also referred to as KDR gene) is provided in SEQ ID NO:1, which encodes the human VEGFR-2 gene product provided in SEQ ID NO:2. A genomic sequence for the VEGFR-2 gene is provided in
FIG. 7 (SEQ ID NO:3). It will be understood that a "variant" refers to a sequence that is or contains a polymorphism (frequency >1%) or a sequence that is or contains a mutation. In certain embodiments of the invention, the mutation is a somatic mutation, as opposed to a germline mutation.
A list of variants that may be evaluated in methods and kits of the invention are identified in FIG. 8. The identity of these variants is described by position relative to the ATG (+1) and other information is provided.
In some embodiments, nucleic acids of the invention comprise or are complementary to all or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420,
430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600,
610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780,
790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960,
970, 980, 990, 1000 or more contiguous nucleotides, or any range derivable therein, of any of SEQ ID NOs:l-141.
Moreover, it is contemplated that nucleic acids of the invention may be or be at least 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% homologous to all or part (any lengths discussed in previous paragraph) of SEQ ID NOs: 1-141. One of skill in the art knows how to design and use primers and probes for hybridization and amplification, including the limits of homology needed to implement primers and probes. These definitions generally refer to a single-stranded molecule, but in specific embodiments will also encompass an additional strand that is partially, substantially or fully complementary to the single-stranded molecule. Thus, a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix "ss", a double stranded nucleic acid by the prefix "ds", and a triple stranded nucleic acid by the prefix "ts."
In particular aspects, a nucleic acid encodes a protein, polypeptide, or peptide. In certain embodiments, the present invention concerns novel compositions comprising at least one proteinaceous molecule. As used herein, a "proteinaceous molecule,"
"proteinaceous composition," "proteinaceous compound," "proteinaceous chain," or
"proteinaceous material" generally refers, but is not limited to, a protein of greater than about 200 amino acids or the full length endogenous sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. All the "proteinaceous" terms described above may be used interchangeably herein.
A. Preparation of Nucleic Acids
A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production. Non-limiting examples of a synthetic nucleic acid {e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in European Patent 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and
U.S. Patent 5,705,629, each incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S.
Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference. A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. A non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 2001, incorporated herein by reference).
B. Purification of Nucleic Acids A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, chromatography columns or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference). In some aspects, a nucleic acid is a pharmacologically acceptable nucleic acid. Pharmacologically acceptable compositions are known to those of skill in the art, and are described herein.
In certain aspects, the present invention concerns a nucleic acid that is an isolated nucleic acid. As used herein, the term "isolated nucleic acid" refers to a nucleic acid molecule (e.g. , an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells. In certain embodiments, "isolated nucleic acid" refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
C. Nucleic Acid Segments In certain embodiments, the nucleic acid is a nucleic acid segment. As used herein, the term "nucleic acid segment," are fragments of a nucleic acid, such as, for a non-limiting example, those that encode only part of a VEGFR-2 gene sequence. Thus, a "nucleic acid segment" may comprise any part of a gene sequence, including from about 2 nucleotides to the full length gene including promoter regions to the polyadenylation signal and any length that includes all of the coding region. Various nucleic acid segments may be designed based on a particular nucleic acid sequence, and may be of any length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all nucleic acid segments can be created: n to n + y where n is an integer from 1 to the last number of the sequence and y is the length of the nucleic acid segment minus one, where n + y does not exceed the last number of the sequence. Thus, for a 10-mer, the nucleic acid segments correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on. For a 15-mer, the nucleic acid segments correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on. For a 20-mer, the nucleic segments correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on. In certain embodiments, the nucleic acid segment may be a probe or primer. As used herein, a "probe" generally refers to a nucleic acid used in a detection method or composition. As used herein, a "primer" generally refers to a nucleic acid used in an extension or amplification method or composition. D. Nucleic Acid Complements
The present invention also encompasses a nucleic acid that is complementary to a nucleic acid. A nucleic acid is "complement(s)" or is "complementary" to another nucleic acid when it is capable of base-pairing with another nucleic acid according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules. As used herein "another nucleic acid" may refer to a separate molecule or a spatial separated sequence of the same molecule. In preferred embodiments, a complement is a hybridization probe or amplification primer for the detection of a nucleic acid polymorphism.
As used herein, the term "complementary" or "complement" also refers to a nucleic acid comprising a sequence of consecutive nucleobases or semiconsecutive nucleobases (e.g., one or more nucleobase moieties are not present in the molecule) capable of hybridizing to another nucleic acid strand or duplex even if less than all the nucleobases do not base pair with a counterpart nucleobase. However, in some diagnostic or detection embodiments, completely complementary nucleic acids are preferred. III. Nucleic Acid Detection
Some embodiments of the invention concern identifying variants (both polymorphisms and/or mutations) in the VEGFR-2 gene such as one that affects expression, correlating genotype or haplotype to phenotype, wherein the phenotype is altered VEGFR-2 activity or expression, and then identifying such polymorphisms in patients who have or will be given a VEGFR-2 inhibitor or other drugs or compounds that affect angiogenesis. Thus, the present invention involves assays for identifying variants and other nucleic acid detection methods. Such assays involve identifying the variant in the VEGFR-2 gene, as shown in the Examples. It is contemplated that probes and primers can be prepared using the sequences disclosed in SEQ ID NOs: 1 and 3. Specific primers are also provided in SEQ ID NOs:4- 141. Nucleic acids, therefore, have utility as probes or primers for embodiments involving nucleic acid hybridization. They may be used in diagnostic or screening methods of the present invention. Detection of nucleic acids encoding VEGFR-2, as well as nucleic acids involved in the expression or stability of VEGFR-2 polypeptides or transcripts, are encompassed by the invention. General methods of nucleic acid detection methods are provided below, followed by specific examples employed for the identification of mutations and polymorphisms, including single nucleotide polymorphisms (SNPs) or other kinds of polymorphisms. A. Hybridization
The use of a probe or primer of between 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 60, 70, 80, 90, or 100 nucleotides, preferably between 17 and 100 nucleotides in length, or in some aspects of the invention up to 1 -2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective. Such probes or primers can be generated from SEQ ID NO:1 and 3. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length are generally preferred, to increase stability and/or selectivity of the hybrid molecules obtained. One will generally prefer to design nucleic acid molecules for hybridization having one or more complementary sequences of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.
In certain embodiments, amplification is employed to determine the number of TA repeats. See, e.g., U.S. Patent Nos. 6,472,157 and 6,395,481; Te et al, 2000; and, Innocenti et al, 2004, all of which are hereby incorporated by reference for their teachings regarding determining the number of TA repeats in the UGTlAl gene.
Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNAs and/or RNAs or to provide primers for amplification of DNA or RNA from samples. Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of the probe or primers for the target sequence.
For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 500C to about 700C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting a specific polymorphism. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide. For example, under highly stringent conditions, hybridization to filter-bound DNA may be carried out in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 niM EDTA at 65°C, and washing in 0.1 x SSC/0.1% SDS at 68°C (Ausubel et al, 1989).
Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15M to about 0.9M salt, at temperatures ranging from about 200C to about 550C. Under low stringent conditions, such as moderately stringent conditions the washing may be carried out for example in 0.2 x SSC/0.1% SDS at 420C (Ausubel et al, 1989). Hybridization conditions can be readily manipulated depending on the desired results. In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 1.0 niM dithiothreitol, at temperatures between approximately 2O0C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, at temperatures ranging from approximately 400C to about 72°C.
In certain embodiments, it will be advantageous to employ nucleic acids of defined sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In preferred embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a detection means that is visibly or spectrophotometrically detectable, to identify specific hybridization with complementary nucleic acid containing samples. In other aspects, a particular nuclease cleavage site may be present and detection of a particular nucleotide sequence can be determined by the presence or absence of nucleic acid cleavage.
In general, it is envisioned that the probes or primers described herein will be useful as reagents in solution hybridization, as in PCR, for detection of expression or genotype of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The conditions selected will depend on the particular circumstances (depending, for example, on the
G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Optimization of hybridization conditions for the particular application of interest is well known to those of skill in the art. After washing of the hybridized molecules to remove non-specifically bound probe molecules, hybridization is detected, and/or quantified, by determining the amount of bound label. Representative solid phase hybridization methods are disclosed in U.S. Patents 5,843,663, 5,900,481 and 5,919,626.
Other methods of hybridization that may be used in the practice of the present invention are disclosed in U.S. Patents 5,849,481, 5,849,486 and 5,851,772. The relevant portions of these and other references identified in this section of the Specification are incorporated herein by reference.
B. Amplification of Nucleic Acids Nucleic acids used as a template for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al, 2001). In certain embodiments, analysis is performed on whole cell or tissue homogenates or biological fluid samples with or without substantial purification of the template nucleic acid. The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to first convert the RNA to a complementary DNA.
The term "primer," as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is preferred.
Pairs of primers designed to selectively hybridize to nucleic acids corresponding to the KDR gene locus, or variants thereof, and fragments thereof are contacted with the template nucleic acid under conditions that permit selective hybridization. Depending upon the desired application, high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers. In other embodiments, hybridization may occur under reduced stringency to allow for amplification of nucleic acids that contain one or more mismatches with the primer sequences. Once hybridized, the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product is produced.
The amplification product may be detected, analyzed or quantified. In certain applications, the detection may be performed by visual means. In certain applications, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incorporated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology; Bellus, 1994).
A number of template dependent processes are available to amplify the oligonucleotide sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR™) which is described in detail in U.S. Patents 4,683,195, 4,683,202 and 4,800,159, and in Innis et al,
1988, each of which is incorporated herein by reference in their entirety.
Another method for amplification is ligase chain reaction ("LCR"), disclosed in
European Application No. 320 308, incorporated herein by reference in its entirety. U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence. A method based on PCR™ and oligonucleotide ligase assay (OLA) (described in further detail below), disclosed in U.S. Patent 5,912,148, may also be used.
Alternative methods for amplification of target nucleic acid sequences that may be used in the practice of the present invention are disclosed in U.S. Patents 5,843,650, 5,846,709, 5,846,783, 5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776, 5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825, 5,939,291 and 5,942,391, Great Britain Application 2 202 328, and in PCT Application PCT/US89/01025, each of which is incorporated herein by reference in its entirety. Qbeta Replicase, described in PCT Application PCT/US87/00880, may also be used as an amplification method in the present invention.
An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]-triphosphates in one strand of a restriction site may also be useful in the amplification of nucleic acids in the present invention (Walker et al, 1992). Strand Displacement Amplification (SDA), disclosed in U.S. Patent 5,916,779, is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e., nick translation.
Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al, 1989; PCT Application WO 88/10315, incorporated herein by reference in their entirety). European Application 329 822 disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be used in accordance with the present invention.
PCT Application WO 89/06700 (incorporated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter region/primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e., new templates are not produced from the resultant RNA transcripts. Other amplification methods include "RACE" and "one-sided PCR" (Frohman, 1990; Ohara et al, 1989). C. Detection of Nucleic Acids
Following any amplification, it may be desirable to separate the amplification product from the template and/or the excess primer. In one embodiment, amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al, 2001). Separated amplification products may be cut out and eluted from the gel for further manipulation. Using low melting point agarose gels, the separated band may be removed by heating the gel, followed by extraction of the nucleic acid.
Separation of nucleic acids may also be effected by spin columns and/or chromatographic techniques known in art. There are many kinds of chromatography which may be used in the practice of the present invention, including adsorption, partition, ion-exchange, hydroxylapatite, molecular sieve, reverse-phase, column, paper, thin-layer, and gas chromatography as well as HPLC.
In certain embodiments, the amplification products are visualized, with or without separation. A typical visualization method involves staining of a gel with ethidium bromide and visualization of bands under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the separated amplification products can be exposed to x-ray film or visualized under the appropriate excitatory spectra.
In one embodiment, following separation of amplification products, a labeled nucleic acid probe is brought into contact with the amplified marker sequence. The probe preferably is conjugated to a chromophore but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, or another binding partner carrying a detectable moiety.
In particular embodiments, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art (see Sambrook et al. , 2001). One example of the foregoing is described in U.S. Patent 5,279,721, incorporated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention.
Restriction Fragment Length Polymorphism (RFLP) is a technique in which different DNA sequences may be differentiated by analysis of patterns derived from cleavage of that DNA. If two sequences differ in the distance between sites of cleavage of a particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme. The similarity of the patterns generated can be used to differentiate species (and even strains) from one another.
Restriction endonucleases in turn are the enzymes that cleave DNA molecules at specific nucleotide sequences depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 base pairs in length. Generally, the shorter the recognition sequence, the greater the number of fragments generated. If molecules differ in nucleotide sequence, fragments of different sizes may be generated. The fragments can be separated by gel electrophoresis. Restriction enzymes are isolated from a wide variety of bacterial genera and are thought to be part of the cell's defenses against invading bacterial viruses. Use of RFLP and restriction endonucleases in SNP analysis requires that the SNP affect cleavage of at least one restriction enzyme site.
Primer extension may also be employed. The primer and no more than three NTPs may be combined with a polymerase and the target sequence, which serves as a template for amplification. By using less than all four NTPs, it is possible to omit one or more of the variant nucleotides needed for incorporation at the variant site. It is important for the practice of the present invention that the amplification be designed such that the omitted nucleotide(s) is(are) not required between the 3' end of the primer and the target variant site. The primer is then extended by a nucleic acid polymerase, in a preferred embodiment by Taq polymerase. If the omitted NTP is required at the variant site, the primer is extended up to the variant site, at which point the polymerization ceases. However, if the omitted NTP is not required at the variant site, the primer will be extended beyond the variant site, creating a longer product. Detection of the extension products is based on, for example, separation by size/length which will thereby reveal which variant is present.
Other methods of nucleic acid detection that may be used in the practice of the instant invention are disclosed in U.S. Patents 5,840,873, 5,843,640, 5,843,651, 5,846,708, 5,846,717, 5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993, 5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024, 5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862, 5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is incorporated herein by reference.
D. Other Assays
Other methods for genetic screening may be used within the scope of the present invention, for example, to detect mutations in genomic DNA, cDNA and/or RNA samples. Methods used to detect point mutations include denaturing gradient gel electrophoresis ("DGGE"), restriction fragment length polymorphism analysis ("RFLP"), chemical or enzymatic cleavage methods, direct sequencing of target regions amplified by PCR™ (see above), single-strand conformation polymorphism analysis ("SSCP") and other methods well known in the art.
One method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA/DNA or RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single or multiple base point mutations.
U.S. Patent 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.
Other investigators have described the use of RNase I in mismatch assays. The use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is reported to cleave three out of four known mismatches. Others have described using the MutS protein or other DNA-repair enzymes for detection of single-base mismatches.
Alternative methods for detection of deletion, insertion or substitution mutations that may be used in the practice of the present invention are disclosed in U.S. Patents 5,849,483, 5,851,770, 5,866,337, 5,925,525 and 5,928,870, each of which is incorporated herein by reference in its entirety.
E. Specific Examples of Nucleic Acid Variant Screening Methods
Spontaneous mutations that arise during the course of evolution in the genomes of organisms are often not immediately transmitted throughout all of the members of the species, thereby creating polymorphic alleles that co-exist in the species populations. Often polymorphisms are the cause of genetic diseases. Several classes of polymorphisms have been identified. For example, variable nucleotide type polymorphisms (VNTRs), arise from spontaneous tandem duplications of di- or trinucleotide repeated motifs of nucleotides. If such variations alter the lengths of DNA fragments generated by restriction endonuclease cleavage, the variations are referred to as restriction fragment length polymorphisms (RFLPs). RFLPs are been widely used in human and animal genetic analyses.
Another class of polymorphisms are generated by the replacement of a single nucleotide. Such single nucleotide polymorphisms (SNPs) rarely result in changes in a restriction endonuclease site. Thus, SNPs are rarely detectable restriction fragment length analysis. SNPs are the most common genetic variations and occur once every 100 to 300 bases and several SNP mutations have been found that affect a single nucleotide in a protein-encoding gene in a manner sufficient to actually cause a genetic disease. SNP diseases are exemplified by hemophilia, sickle-cell anemia, hereditary hemochromatosis, late-onset alzheimer disease etc. SNPs or other variants can be the result of deletions, point mutations and insertions and in general any single base alteration, whatever the cause, can result in a variant. The greater frequency of SNPs means that they can be more readily identified than the other classes of polymorphisms. The greater uniformity of their distribution permits the identification of SNPs "nearer" to a particular trait of interest. The combined effect of these two attributes makes SNPs extremely valuable. For example, if a particular trait (e.g., inability to efficiently metabolize irinotecan) reflects a mutation at a particular locus, then any variant that is linked to the particular locus can be used to predict the probability that an individual will exhibit that trait. Several methods have been developed to screen polymorphisms and some examples are listed below. The reference of Kwok and Chen (2003) and Kwok (2001) provide overviews of some of these methods; both of these references are specifically incorporated by reference.
Variants of the VEGFR-2 gene can be characterized by the use of any of these methods or suitable modification thereof. Such methods include the direct or indirect sequencing of the site, the use of restriction enzymes where the respective alleles of the site create or destroy a restriction site, the use of allele-specific hybridization probes, the use of antibodies that are specific for the proteins encoded by the different alleles of the polymorphism, or any other biochemical interpretation. The methods discussed below may be employed with respect to variants generally, whether they concern a mutation or a polymorphism.
1. DNA Sequencing
The most commonly used method of characterizing a variant is direct DNA sequencing of the genetic locus that flanks and includes the variant. Such analysis can be accomplished using either the "dideoxy-mediated chain termination method," also known as the "Sanger Method" (Sanger et al., 1975) or the "chemical degradation method," also known as the "Maxam-Gilbert method" (Maxam et al, 1977). Sequencing may also be performed by pyrosequencing technology (Royo et al, 2007; Nilsson and Olsson, 2008), all of the above incorporated herein by reference. Sequencing in combination with genomic sequence-specific amplification technologies, such as the polymerase chain reaction may be utilized to facilitate the recovery of the desired genes (Mullis et al., 1986; European Patent Application 50,424; European Patent Application. 84,796, European Patent Application 258,017, European Patent Application. 237,362; European Patent Application. 201,184; U.S. Patents 4,683,202; 4,582,788; and 4,683,194), all of the above incorporated herein by reference. 2. Exonuclease Resistance
Other methods that can be employed to determine the identity of a nucleotide present at a polymorphic site utilize a specialized exonuclease-resistant nucleotide derivative (U.S. Patent. 4,656,127). A primer complementary to an allelic sequence immediately 3 '-to the variant site is hybridized to the DNA under investigation. If the polymorphic site on the DNA contains a nucleotide that is complementary to the particular exonucleotide-resistant nucleotide derivative present, then that derivative will be incorporated by a polymerase onto the end of the hybridized primer. Such incorporation makes the primer resistant to exonuclease cleavage and thereby permits its detection. As the identity of the exonucleotide-resistant derivative is known one can determine the specific nucleotide present in the polymorphic site of the DNA.
3. Microsequencing Methods
Several other primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher et al, 1989; Sokolov, 1990; Syvanen 1990; Kuppuswamy et al, 1991; Prezant et al, 1992; Ugozzoll et al, 1992; Nyren et α/., 1993). These methods rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. As the signal is proportional to the number of deoxynucleotides incorporated, variants that occur in runs of the same nucleotide result in a signal that is proportional to the length of the run (Syvanen et al, ,1990). 4. Extension in Solution
French Patent 2,650,840 and PCT Application WO91/02087 discuss a solution- based method for determining the identity of the nucleotide of a variant site. According to these methods, a primer complementary to allelic sequences immediately 3 '-to a variant site is used. The identity of the nucleotide of that site is determined using labeled dideoxynucleotide derivatives which are incorporated at the end of the primer if complementary to the nucleotide of the polymorphic site. 5. Genetic Bit Analysis or Solid-Phase Extension
PCT Application WO92/15712 describes a method that uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site.
The labeled terminator that is incorporated is complementary to the nucleotide present in the polymorphic site of the target molecule being evaluated and is thus identified. Here the primer or the target molecule is immobilized to a solid phase.
6. Oligonucleotide Ligation Assay (OLA)
This is another solid phase method that uses different methodology (Landegren et ai, 1988). Two oligonucleotides, capable of hybridizing to abutting sequences of a single strand of a target DNA are used. One of these oligonucleotides is biotinylated while the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation permits the recovery of the labeled oligonucleotide by using avidin. Other nucleic acid detection assays, based on this method, combined with PCR have also been described (Nickerson et al, 1990). Here PCR is used to achieve the exponential amplification of target DNA, which is then detected using the OLA.
7. Ligase/Polymerase-Mediated Genetic Bit Analysis
U.S. Patent 5,952,174 describes a method that also involves two primers capable of hybridizing to abutting sequences of a target molecule. The hybridized product is formed on a solid support to which the target is immobilized. Here the hybridization occurs such that the primers are separated from one another by a space of a single nucleotide. Incubating this hybridized product in the presence of a polymerase, a ligase, and a nucleoside triphosphate mixture containing at least one deoxynucleoside triphosphate allows the ligation of any pair of abutting hybridized oligonucleotides.
Addition of a ligase results in two events required to generate a signal, extension and ligation. This provides a higher specificity and lower "noise" than methods using either extension or ligation alone and unlike the polymerase-based assays, this method enhances the specificity of the polymerase step by combining it with a second hybridization and a ligation step for a signal to be attached to the solid phase. 8. Invasive Cleavage Reactions
Invasive cleavage reactions can be used to evaluate cellular DNA for a particular variant, especially a polymorphism. A technology called INVADER® employs such reactions (e.g., de Arruda et al, 2002; Stevens et al, 2003, which are incorporated by reference). Generally, there are three nucleic acid molecules: 1) an oligonucleotide upstream of the target site ("upstream oligo"), 2) a probe oligonucleotide covering the target site ("probe"), and 3) a single-stranded DNA with the the target site ("target"). The upstream oligo and probe do not overlap but they contain contiguous sequences. The probe contains a donor fluorophore, such as fluoroscein, and an acceptor dye, such as Dabcyl. The nucleotide at the 3' terminal end of the upstream oligo overlaps ("invades") the first base pair of a probe-target duplex. Then the probe is cleaved by a structure- specific 5' nuclease causing separation of the fluorophore/quencher pair, which increases the amount of fluorescence that can be detected (Lu et al, 2004).
In some cases, the assay is conducted on a solid-surface or in an array format. 9. Other Methods To Detect SNPs
Several other specific methods for SNP detection and identification are presented below and may be used as such or with suitable modifications in conjunction with identifying variants of the VEGFR-2 gene in the present invention. Several other methods are also described on the SNP web site of the NCBI at the website on the World Wide Web at ncbi.nlm.nih.gov/SNP, incorporated herein by reference.
Fluorescence in situ hybridization (FISH) and single nucleotide polymorphism arrays are additional methods that can detect the presence of SNPs in a sample. FISH may be useful to assess gene amplification in the tumor. A SNP array is a type of DNA microarray which is used to detect polymorphisms within a population. High-throughput single-nucleotide polymorphism (SNP) genotyping can be applied in genome-wide association studies (GWASs). Such methods are known to those of skill in the art (Beaudet and Belmont, 2008; Bier et al, 2008; Noel et al, 2008; each of which are incorporated by reference herein).
In a particular embodiment, extended haplotypes may be determined at any given locus in a population, which allows one to identify exactly which SNPs will be redundant and which will be essential in association studies. The latter is referred to as 'haplotype tag SNPs (htSNPs)1, markers that capture the haplotypes of a gene or a region of linkage disequilibrium. See Johnson et al. (2001) and Ke and Cardon (2003), each of which is incorporated herein by reference, for exemplary methods.
The VDA-assay utilizes PCR amplification of genomic segments by long PCR methods using TaKaRa LA Taq reagents and other standard reaction conditions. The long amplification can amplify DNA sizes of about 2,000-12,000 bp. Hybridization of products to variant detector array (VDA) can be performed by a Affymetrix High
Throughput Screening Center and analyzed with computerized software.
A method called Chip Assay uses PCR amplification of genomic segments by standard or long PCR protocols. Hybridization products are analyzed by VDA, Halushka et al. (1999), incorporated herein by reference. SNPs are generally classified as "Certain" or "Likely" based on computer analysis of hybridization patterns. By comparison to alternative detection methods such as nucleotide sequencing, "Certain" SNPs have been confirmed 100% of the time; and "Likely" SNPs have been confirmed 73% of the time by this method.
Other methods simply involve PCR amplification following digestion with the relevant restriction enzyme. Yet others involve sequencing of purified PCR products from known genomic regions.
In yet another method, individual exons or overlapping fragments of large exons are PCR-amplified. Primers are designed from published or database sequences and
PCR-amplification of genomic DNA is performed using the following conditions: 200 ng
DNA template, 0.5μM each primer, 80μM each of dCTP, dATP, dTTP and dGTP, 5% formamide, 1.5mM MgCl2, 0.5U of Taq polymerase and 0.1 volume of the Taq buffer.
Thermal cycling is performed and resulting PCR-products are analyzed by PCR-single strand conformation polymorphism (PCR-SSCP) analysis, under a variety of conditions, e.g, 5 or 10% polyacrylamide gel with 15% urea, with or without 5% glycerol.
Electrophoresis is performed overnight. PCR-products that show mobility shifts are reamplified and sequenced to identify nucleotide variation.
In a method called CGAP-GAI (DEMIGLACE), sequence and alignment data (from a PHRAP. ace file), quality scores for the sequence base calls (from PHRED quality files), distance information (from PHYLIP dnadist and neighbour programs) and base- calling data (from PHRED '-d' switch) are loaded into memory. Sequences are aligned and examined for each vertical chunk ('slice') of the resulting assembly for disagreement. Any such slice is considered a candidate SNP (DEMIGLACE). A number of filters are used by DEMIGLACE to eliminate slices that are not likely to represent true polymorphisms. These include filters that: (i) exclude sequences in any given slice from SNP consideration where neighboring sequence quality scores drop 40% or more; (ii) exclude calls in which peak amplitude is below the fifteenth percentile of all base calls for that nucleotide type; (iii) disqualify regions of a sequence having a high number of disagreements with the consensus from participating in SNP calculations; (iv) removed from consideration any base call with an alternative call in which the peak takes up 25% or more of the area of the called peak; (v) exclude variations that occur in only one read direction. PHRED quality scores were converted into probability-of-error values for each nucleotide in the slice. Standard Baysian methods are used to calculate the posterior probability that there is evidence of nucleotide heterogeneity at a given location. In a method called CU-RDF (RESEQ), PCR amplification is performed from
DNA isolated from blood using specific primers for each SNP, and after typical cleanup protocols to remove unused primers and free nucleotides, direct sequencing using the same or nested primers.
In a method called DEBNICK (METHOD-B), a comparative analysis of clustered EST sequences is performed and confirmed by fluorescent-based DNA sequencing. In a related method, called DEBNICK (METHOD-C), comparative analysis of clustered EST sequences with phred quality > 20 at the site of the mismatch, average phred quality >=
20 over 5 bases 5'-FLANK and 3' to the SNP, no mismatches in 5 bases 5' and 3' to the
SNP, at least two occurrences of each allele is performed and confirmed by examining traces.
In a method identified by ERO (RESEQ), new primers sets are designed for electronically published STSs and used to amplify DNA from 10 different mouse strains. The amplification product from each strain is then gel purified and sequenced using a standard dideoxy, cycle sequencing technique with 33P-labeled terminators. All the ddATP terminated reactions are then loaded in adjacent lanes of a sequencing gel followed by all of the ddGTP reactions and so on. SNPs are identified by visually scanning the radiographs. In another method identified as ERO (RESEQ-HT), new primers sets are designed for electronically published murine DNA sequences and used to amplify DNA from 10 different mouse strains. The amplification product from each strain is prepared for sequencing by treating with Exonuclease I and Shrimp Alkaline Phosphatase. Sequencing is performed using ABI Prism Big Dye Terminator Ready Reaction Kit (Perkin-Elmer) and sequence samples are run on the 3700 DNA Analyzer (96 Capillary Sequencer).
FGU-CBT (SCA2-SNP) identifies a method where the region containing the SNP were PCR amplified using the primers SCA2-FP3 and SCA2-RP3. Approximately 100 ng of genomic DNA is amplified in a 50 ml reaction volume containing a final concentration of 5mM Tris, 25mM KCl, 0.75mM MgCl2, 0.05% gelatin, 20pmol of each primer and 0.5U of Taq DNA polymerase. Samples are denatured, annealed and extended and the PCR product is purified from a band cut out of the agarose gel using, for example, the QIAquick gel extraction kit (Qiagen) and is sequenced using dye terminator chemistry on an ABI Prism 377 automated DNA sequencer with the PCR primers.
In a method identified as JBLACK (SEQ/RESTRICT), two independent PCR reactions are performed with genomic DNA. Products from the first reaction are analyzed by sequencing, indicating a unique Fspl restriction site. The mutation is confirmed in the product of the second PCR reaction by digesting with Fsp I.
In a method described as KWOK(I), SNPs are identified by comparing high quality genomic sequence data from four randomly chosen individuals by direct DNA sequencing of PCR products with dye-terminator chemistry (see Kwok et al, 1996). In a related method identified as KWOK(2) SNPs are identified by comparing high quality genomic sequence data from overlapping large-insert clones such as bacterial artificial chromosomes (BACs) or Pl -based artificial chromosomes (PACs). An STS containing this SNP is then developed and the existence of the SNP in various populations is confirmed by pooled DNA sequencing (see Taillon-Miller et al, 1998). In another similar method called KWOK(3), SNPs are identified by comparing high quality genomic sequence data from overlapping large-insert clones BACs or PACs. The SNPs found by this approach represent DNA sequence variations between the two donor chromosomes but the allele frequencies in the general population have not yet been determined. In method KWOK(5), SNPs are identified by comparing high quality genomic sequence data from a homozygous DNA sample and one or more pooled DNA samples by direct DNA sequencing of PCR products with dye-terminator chemistry. The STSs used are developed from sequence data found in publicly available databases. Specifically, these STSs are amplified by PCR against a complete hydatidiform mole (CHM) that has been shown to be homozygous at all loci and a pool of DNA samples from 80 CEPH parents (see Kwok et α/., 1994).
In another such method, KWOK (OverlapSnpDetectionWithPolyBayes), SNPs are discovered by automated computer analysis of overlapping regions of large-insert human genomic clone sequences. For data acquisition, clone sequences are obtained directly from large-scale sequencing centers. This is necessary because base quality sequences are not present/available through GenBank. Raw data processing involves analyzed of clone sequences and accompanying base quality information for consistency. Finished ('base perfect', error rate lower than 1 in 10,000 bp) sequences with no associated base quality sequences are assigned a uniform base quality value of 40 (1 in 10,000 bp error rate). Draft sequences without base quality values are rejected. Processed sequences are entered into a local database. A version of each sequence with known human repeats masked is also stored. Repeat masking is performed with the program "MASKERAID." Overlap detection: Putative overlaps are detected with the program "WUBLAST." Several filtering steps followed in order to eliminate false overlap detection results, i.e. similarities between a pair of clone sequences that arise due to sequence duplication as opposed to true overlap. Total length of overlap, overall percent similarity, number of sequence differences between nucleotides with high base quality value "high-quality mismatches." Results are also compared to results of restriction fragment mapping of genomic clones at Washington University Genome Sequencing Center, finisher's reports on overlaps, and results of the sequence contig building effort at the NCBI. SNP detection: Overlapping pairs of clone sequence are analyzed for candidate SNP sites with the 'POLYBAYES' SNP detection software. Sequence differences between the pair of sequences are scored for the probability of representing true sequence variation as opposed to sequencing error. This process requires the presence of base quality values for both sequences. High-scoring candidates are extracted. The search is restricted to substitution-type single base pair variations. Confidence score of candidate SNP is computed by the POLYBAYES software.
In method identified by KWOK (TaqMan assay), the TaqMan assay is used to determine genotypes for 90 random individuals. In method identified by KYUGEN(Ql), DNA samples of indicated populations are pooled and analyzed by PLACE-SSCP. Peak heights of each allele in the pooled analysis are corrected by those in a heterozygote, and are subsequently used for calculation of allele frequencies. Allele frequencies higher than 10% are reliably quantified by this method. Allele frequency = 0 (zero) means that the allele was found among individuals, but the corresponding peak is not seen in the examination of pool. Allele frequency = 0-0.1 indicates that minor alleles are detected in the pool but the peaks are too low to reliably quantify.
In yet another method identified as KYUGEN (Method 1), PCR products are post- labeled with fluorescent dyes and analyzed by an automated capillary electrophoresis system under SSCP conditions (PLACE-SSCP). Four or more individual DNAs are analyzed with or without two pooled DNA (Japanese pool and CEPH parents pool) in a series of experiments. Alleles are identified by visual inspection. Individual DNAs with different genotypes are sequenced and SNPs identified. Allele frequencies are estimated from peak heights in the pooled samples after correction of signal bias using peak heights in heterozygotes. For the PCR primers are tagged to have 5'-ATT or 5'-GTT at their ends for post-labeling of both strands. Samples of DNA (10 ng/ul) are amplified in reaction mixtures containing the buffer (1OmM Tris-HCl, pH 8.3 or 9.3, 5OmM KCl, 2.OmM MgCl2), 0.25μM of each primer, 200μM of each dNTP, and 0.025 units/μl of Taq DNA polymerase premixed with anti-Taq antibody. The two strands of PCR products are differentially labeled with nucleotides modified with RI lO and R6G by an exchange reaction of Klenow fragment of DNA polymerase I. The reaction is stopped by adding EDTA, and unincorporated nucleotides are dephosphorylated by adding calf intestinal alkaline phosphatase. For the SSCP: an aliquot of fluorescenfly labeled PCR products and TAMRA-labeled internal markers are added to deionized formamide, and denatured. Electrophoresis is performed in a capillary using an ABI Prism 310 Genetic Analyzer. Genescan softwares (P-E Biosystems) are used for data collection and data processing. DNA of individuals (two to eleven) including those who showed different genotypes on SSCP are subjected for direct sequencing using big-dye terminator chemistry, on ABI Prism 310 sequencers. Multiple sequence trace files obtained from ABI Prism 310 are processed and aligned by Phred/Phrap and viewed using Consed viewer. SNPs are identified by PolyPhred software and visual inspection.
In yet another method identified as KYUGEN (Method2), individuals with different genotypes are searched by denaturing HPLC (DHPLC) or PLACE-SSCP (Inazuka et al, 1997) and their sequences are determined to identify SNPs. PCR is performed with primers tagged with 5'-ATT or 5'-GTT at their ends for post-labeling of both strands. DHPLC analysis is carried out using the WAVE DNA fragment analysis system (Transgenomic). PCR products are injected into DNASep column, and separated under the conditions determined using WAVEMaker program (Transgenomic). The two strands of PCR products that are differentially labeled with nucleotides modified with Rl 10 and R6G by an exchange reaction of Klenow fragment of DNA polymerase I. The reaction is stopped by adding EDTA, and unincorporated nucleotides are dephosphorylated by adding calf intestinal alkaline phosphatase. SSCP followed by electrophoresis is performed in a capillary using an ABI Prism 310 Genetic Analyzer. Genescan softwares (P-E Biosystems). DNA of individuals including those who showed different genotypes on DHPLC or SSCP are subjected for direct sequencing using big- dye terminator chemistry, on ABI Prism 310 sequencer. Multiple sequence trace files obtained from ABI Prism 310 are processed and aligned by Phred/Phrap and viewed using Consed viewer. SNPs are identified by PolyPhred software and visual inspection. Trace chromatogram data of EST sequences in Unigene are processed with PHRED. To identify likely SNPs, single base mismatches are reported from multiple sequence alignments produced by the programs PHRAP, BRO and POA for each Unigene cluster. BRO corrected possible misreported EST orientations, while POA identified and analyzed non-linear alignment structures indicative of gene mixing/chimeras that might produce spurious SNPs. Bayesian inference is used to weigh evidence for true polymorphism versus sequencing error, misalignment or ambiguity, misclustering or chimeric EST sequences, assessing data such as raw chromatogram height, sharpness, overlap and spacing; sequencing error rates; context-sensitivity; cDNA library origin, etc. In a method identified as MARSHFIELD(Method-B), overlapping human DNA sequences which contained putative insertion/deletion polymorphisms are identified through searches of public databases. PCR primers that flanked each polymorphic site are selected from the consensus sequences. Primers are used to amplify individual or pooled human genomic DNA. Resulting PCR products are resolved on a denaturing polyacrylamide gel and a Phosphorlmager is used to estimate allele frequencies from DNA pools. F. Linkage Disequilibrium
Polymorphisms in linkage disequilibrium with a particular polymorphism may also be used with the methods of the present invention. "Linkage disequilibrium" ("LD" as used herein, though also referred to as "LED" in the art) refers to a situation where a particular combination of alleles (i.e., a variant form of a given gene) or polymorphisms at two loci appears more frequently than would be expected by chance. "Significant" as used in respect to linkage disequilibrium, as determined by one of skill in the art, is contemplated to be a statistical p or α value that may be 0.25 or 0.1 and may be 0.1, 0.05. 0.001, 0.00001 or less. "Haplotype" is used according to its plain and ordinary meaning to one skilled in the art. It refers to a collective genotype of two or more alleles or polymorphisms along one of the homologous chromosomes.
IV. Proteinaceous Compositions
The present invention concerns evaluating the VEGFR-2 gene, as well as the expression and/or activity of the polypeptide VEGFR-2, including variants of the gene that result in a variant polypeptide. As used herein, a "proteinaceous molecule," "proteinaceous composition,"
"proteinaceous compound," "proteinaceous chain" or "proteinaceous material" generally refers, but is not limited to, a protein of greater than about 200 amino acids or the full length endogenous sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. All the "proteinaceous" terms described above may be used interchangeably herein.
In certain embodiments the size of the at least one proteinaceous molecule may be at least, at most or may comprise, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 582, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 or greater amino molecule residues, and any range derivable therein. It is specifically contemplated that such lengths of contiguous amino acids from SEQ ID NO:2 (amino acid sequence of human VEGFR-2) may be employed as part of the invention. Moreover, antibodies recognizing all or part of VEGFR-2 are contemplated as part of the invention, particularly those that are specific to a VEGFR-2 protein variant.
Certain aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of an encoded protein or peptide. The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur. Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity. Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite and affinity chromatography; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.
Another embodiment of the present invention involves antibodies. In some cases, the antibody is used to identify a VEGFR-2 variant or to evaluate, assess, or determine VEGFR-2 activity or expression. It is understood that antibodies can be used to quantify polypeptides. Such antibodies, polyclonal .or monoclonal, can be generated. Means for preparing and characterizing antibodies are also well known in the art {See, e.g., Harlow and Lane, 1988; incorporated herein by reference). Alternatively, they can be obtained commercially. As discussed, in some embodiments, the present invention concerns immunodetection methods for assessing, evaluating, determining, quantifying and/or otherwise detecting biological components such as VEGFR-2 variant polypeptides.
Immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent assay, bioluminescent assay, western blot, and screening an antibody array, though several others are well known to those of ordinary skill. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Doolittle et al, 1999; Gulbis and Galand, 1993; De Jager et al, 1993; and Nakamura et al, 1987, each incorporated herein by reference. In general, the immunobinding methods include obtaining a sample suspected of containing a protein, polypeptide and/or peptide, and contacting the sample with a first antibody, monoclonal or polyclonal, in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
The immunobinding methods include methods for detecting and quantifying the amount of an antigen component in a sample and the detection and quantification of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of containing an antigen or antigenic domain, and contact the sample with an antibody against the antigen or antigenic domain, and then detect and quantify the amount of immune complexes formed under the specific conditions. In terms of antigen detection, the biological sample analyzed may be any sample that is suspected of containing an antigen or antigenic domain, such as, for example, a cancer cell or tissue, or any biological fluid that comes into contact with the cell or tissue, including blood and/or serum.
Contacting the chosen biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any antigens present. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non- specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological and enzymatic tags. U.S. Patents concerning the use of such labels include 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241, each incorporated herein by reference. Of course, one may find additional advantages through the use of a secondary binding ligand such as a second antibody and/or a biotin/avidin ligand binding arrangement, as is known in the art. One method of immunodetection designed by Charles Cantor uses two different antibodies (see, Sano et al, 1992). A first step biotinylated, monoclonal or polyclonal antibody is used to detect the target antigen(s), and a second step antibody is then used to detect the biotin attached to the complexed biotin. In that method the sample to be tested is first incubated in a solution containing the first step antibody. If the target antigen is present, some of the antibody binds to the antigen to form a biotinylated antibody/antigen complex. The antibody/antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin), biotinylated DNA, and/or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody/antigen complex. The amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution containing the second step antibody against biotin. This second step antibody is labeled, for example, with an enzyme that can be used to detect the presence of the antibody/antigen complex by histoenzymology using a chromogen substrate. With suitable amplification, a conjugate can be produced which is macroscopically visible.
Another known method of immunodetection takes advantage of the immuno-PCR
(Polymerase Chain Reaction) methodology. The PCR™ method is similar to the Cantor method up to the incubation with biotinylated DNA, however, instead of using multiple rounds of streptavidin and biotinylated DNA incubation, the
DNA/biotin/streptavidin/antibody complex is washed out with a low pH or high salt buffer that releases the antibody. The resulting wash solution is then used to carry out a
PCR™ reaction with suitable primers with appropriate controls. At least in theory, the enormous amplification capability and specificity of PCR™ can be utilized to detect a single antigen molecule.
As detailed above, immunoassays, in their most simple and/or direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and/or radioimmunoassays (RIA) known in the art. Immunohistochemical detection using tissue sections is also particularly useful. However, it will be readily appreciated that detection is not limited to such techniques, and/or western blotting, dot blotting, FACS analyses, and/or the like may also be used.
Irrespective of the format employed, ELISAs have certain features in common, such as coating, incubating and binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described below.
In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein or solutions of milk powder. The coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of a protein or antibody to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand.
"Under conditions effective to allow immune complex (antigen/antibody) formation" means that the conditions preferably include diluting the antigens and/or antibodies with solutions such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
The "suitable" conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours or so, at temperatures preferably on the order of 250C to 27°C, or may be overnight at about 4°C or so.
Following all incubation steps in an ELISA, the contacted surface is washed so as to remove non-complexed material. An example of a washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined.
To provide a detecting means, the second or third antibody will have an associated label to allow detection. This may be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact or incubate the first and second immune complex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 h at room temperature in a PBS- containing solution such as PBS-Tween). After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl- benzthiazoline-6-sulfonic acid (ABTS), or H2O2, in the case of peroxidase as the enzyme label. Quantification is then achieved by measuring the degree of color generated, e.g., using a visible spectra spectrophotometer. The antibodies of the present invention may also be used in conjunction with both fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks prepared for study by immunohistochemistry (IHC). For example, immunohistochemistry may be utilized to characterize VEGFR-2 or to evaluate the amount a variant VEGFR-2 in a cell. The method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors, and/or is well known to those of skill in the art (Brown et al, 1990; Abbondanzo et al, 1990; Allred et al, 1990).
IV. Kits
All the essential materials and reagents required for detecting nucleic acid mutations in a sample may be assembled together in a kit. This generally will comprise a primer or probe designed to hybridize specifically to or upstream of target nucleotides of the variant of interest. The primer or probe may be labeled with a radioisotope, a fiuorophore, a chromophore, a dye, an enzyme, or TOF carrier. Also included may be enzymes suitable for amplifying nucleic acids, including various polymerases (reverse transcriptase, Taq, etc.), dNTPs/rNTPs and buffers {e.g., 1OX buffer = 100 mM Tris-HCl (pH 8.3), and 500 mM KCl) to provide the necessary reaction mixture for amplification. One or more of the deoxynucleotides may be labeled with a radioisotope, a fiuorophore, a chromophore, a dye, or an enzyme. Such kits may also include enzymes and other reagents suitable for detection of specific nucleic acids or amplification products. Kits of the invention may comprise any of the nucleic acid discussed herein of fragments thereof. Particularly contemplated for use in kits are any combination of primers set forth herein. Thus, any of SEQ ID NOs:4-141 may be included in a kit.
The container means of the kits will generally include at least one vial, test tube, flask, bottle, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. The kits of the present invention also will typically include a means for packaging the component containers in close confinement for commercial sale. Such packaging may include injection or blow-molded plastic containers into which the desired component containers are retained. IV. Examples
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1
MATERIALS AND METHODS FOR EXAMPLE 2
DNA samples
For resequencing of KDR, the inventors used DNA samples including samples from 24 healthy Caucasians, 24 African- Americans and 24 Asians (Chinese). DNA sequencing
Exons, intron-exon boundaries, the promoter region (~3 Kb upstream of the 5'UTR region), 1 Kb downstream to the 3'UTR, evolutionary conserved noncoding regions (mainly intronic, selected by comparative genomics), and transcription factor binding cluster regions (selected by Cluster-Buster) were resequenced (FIG. 1). PCR was used to amplify about 27 Kb of genomic DNA. Fifty two primers were designed according to the KDR reference sequence AF035121 from Genbank by using the Primer3 program (on the World Wide Web at workbench.sdsc.edu).
Touch-down PCR was optimized in the inventors' laboratory for all primers and all PCR reactions were performed according to the inventors' optimized procedures. PCR was carried out using 1 units of Hotstar Taq polymerase (Qiagen), with 4 μl of Buffer (1Ox), 2 μl of dNTP (2 mM), 2.4 μl OfMg2+ (25 mM) and 10 ~ 30 ng of DNA in 40 μl of final volume. A touchdown thermal cycling protocol was used for all amplifications: 950C for 15 min for denaturation and activation of DNA polymerase, followed by 7 cycles of touchdown process: 95°C for 30 s, 650C (-1.50C per cycle) for 30 s and 72°C for 1.5 min. After touchdown, other 30 cycles were performed at: 950C for 30 s, 55°C for 30 s, and 72°C for 1.5 min, then extend at 72 for 7min. PCR products were then purified with Montage PCR micro 96 filter (Millipore) and sequenced from both ends using the bigdye terminator at the Sequencing Facility of University of Chicago. Sequencing data were then analyzed by using the Sequencer 4.6 software.
Functional assay
For the luciferase assay, the luciferase pGL2 clone with core promoter region (-225-+ 127) was used. Sequencing was confirmed, and site-directed mutagenesis was introduced according to the inventors' SNP information. DNA was co-transfected with an internal renilla luciferase control DNA into the SVEC4-10 endothelial cells. Standard luciferase assay was performed after 40 hours of transfection, by using the Promega's Dual-Luciferase Reporter Assay System, according to the manufacturer's instruction. The experiments have been performed three times, in triplicate (n=9).
Data analysis Linkage disequilibrium (LD) between variants in each ethnicity was evaluated.
LD was calculated using r2 statistic and evaluated using the LDplotter software (World Wide Web at innateimmunity.org).
To identify sets of tagging-SNPs (tSNPs) in each ethnicity, haplotypes were inferred from ethnicity-specific genotype data using LDSelect VG2 software online (on the Internet at pga.mbt.washington.edu/VG2.html). The threshold for minor-allele frequency (MAF) for these estimates was 5%.
The 8 nonsynonymous variants were investigated using the SIFT software (on the Internet at blocks.fhcrc.org/sift/SIFT.html) to predict tolerated and deleterious substitutions. EXAMPLE 2 RESEOUENCING OF VEGFR-2 GENE (KDR)
Genetic variation in KDR
A total of 113 variants including seven indels (insertion or deletion) were identified in the samples used for resequencing (FIG. 1). Among the variants, 98 were found in noncoding regions. Nine of the 98 noncoding region variants were located in
Cluster-Buster regions and 19 were in conserved regions. Only 52of the 98 noncoding region polymorphisms were previously reported in dbSNP, indicating that the resequencing has led to the discovery of a significant number of previously unknown variants.
Fifteen KDR variants were located in coding regions and 8 of them were nonsynonymous. Eleven of the 15 coding region SNPs were not previously reported in dbSNP. The position and frequency of each nonsynonymous variant and the correspondent amino acid change in the VEGFR-2 structure is shown in FIG. 2. Among 8 nonsynonymous SNPs, 6 were found in the extracellular domain and 2 were located in the intracellular domain, one in the TK domain 1 and the other one in the insert domain between the TK domains 1 and 2.
In addition, 7 insertion/deletions were identified in the KDR sequence. Among all the KDR variants the inventors found, there were 42 common variants with a frequency >20% in at least one ethnicity.
Five polymorphisms were found in the promoter region. Among them, 3 SNPs were less common (<5%) and only appeared in one ethnic group. Two other SNPs (rs9994560 and rs7667298) were common and appeared in all ethnic groups. The distribution of these 5 variants in the population is shown in details in Table 1. Table 1. Ethnic distribution of SNPs in the romoter re ion and their fre uenc .
Figure imgf000059_0001
Moreover, when the presence of alleles and their frequencies were compared across different ethnicities, significant inter-ethnic differences were observed, with African- Americans carrying the larger number of variants (94) followed by Asians (52) and Caucasians (52) (Table 2).
A high concordance was observed between the resequencing data and the HapMap data (FIG. 3). Table 2. KDR variants location in the three ethnic groups.
Conserved UTR 3' Cluster Flanking 3 '
Ethnicity Exons Others regions anf* 5' Buster and 5'
Caucasians 3 7 2 5 19 16
Asians 5 10 3 6 19 9
African
11 16 4 9 27 27 Americans
Haplotype structure of KDR.
Data obtained from each ethnicity were then analyzed using LDSelect to identify haplotype-tagging SNPs in Caucasians, Asians and African-Americans that can be utilized for future genotyping in association studies. Eighteen tSNPs were identified in Caucasians, 21 in Asians and 30 in African-Americans (FIG. 4).
Further analyses are ongoing to identify the haplotypes structure of KDR in the whole population and in each ethnic group by using the PHASE software. Then linkage disequilibrium (LD) was described for each ethnicity by LDplotter.
FIG. 5 clearly describes the LD pattern among the variants found in the three ethnicities.
EXAMPLE 3 REDUCTION IN VEGFR-2 EXPRESSION Lucif erase assay
The two common variants (-367T>C or rs9994560, -271G>A or rs7667298) found in the promoter region were investigated using the luciferase assay to evaluate the impact of these 2 SNPs on KDR transcriptional activity. Constructs were generated by site-directed mutagenesis on a KDR reference template. Briefly, three different construct with variant -367T>C, -271G>A, and double-SNPs (-367T>C, -271G>A) were used. A control was obtained that had a different sequence that the three constructs was used for comparison purposes.
No activity difference was found for plasmidic DNA carrying SNP -367T>C compared to the KDR reference. Interestingly, a statistically significant reduction of luciferase activity was observed for the constructs with either SNP -271G>A or double- SNPs (p<0.05). The inventors' results indicate that the SNP -271G>A could affect the regulatory activity of the promoter region and might modify KDR transcription, ultimately resulting in differences in KDR expression among individuals (Table 3; FIG. 6). Table 3. Luciferase assay on promoter variants.
Luciferase activity
(relative ratio compared to internal control,
Figure imgf000060_0001
KDR-SN? 1+2 1.59 ± 0.21
Functional prediction of KDR coding variants.
The possible effects of the 8 nonsynonymous variants were studied by using the SIFT software to infer whether an amino acid substitution could have a phenotypic effect. The analysis had shown that 3 of these SNPs (shaded in FIG. 2) could potentially affect the protein function and functional assays will be performed to confirm these results.
SIFT result:
Substitution at pos 106 from R to W is predicted to AFFECT PROTEIN FUNCTION with a score of 0.01. Median sequence conservation: 3.05 Sequences represented at this position: 18
Substitution at pos 297 from V to I is predicted to be TOLERATED with a score of 0.19. Median sequence conservation: 3.03 Sequences represented at this position: 19
Substitution at pos 372 from E to D is predicted to be TOLERATED with a score of 0.54. Median sequence conservation: 3.03 Sequences represented at this position: 19
Substitution at pos 472 from O to H is predicted to AFFECT PROTEIN FUNCTION with a score of 0.03. Median sequence conservation: 3.05 Sequences represented at this position: 18
Substitution at pos 482 from C to R is predicted to AFFECT PROTEIN FUNCTION with a score of 0.00. Median sequence conservation: 3.05 Sequences represented at this position: 18
Substitution at pos 674 from E to D is predicted to be TOLERATED with a score of 0.29. Median sequence conservation: 3.03 Sequences represented at this position: 19 Substitution at pos 839 from P to L is predicted to be TOLERATED with a score of 0.39. Median sequence conservation: 3.03 Sequences represented at this position: 19
Substitution at pos 952 from V to I is predicted to be TOLERATED with a score of 0.40. Median sequence conservation: 3.03 Sequences represented at this position: 19
KDR is a highly variable gene showing 113 polymorphisms (including indels). Interestingly 57 polymorphisms (including indels) have been described in the present invention for the first time, suggesting the utility of the inventors' resequencing analysis to discover new genetic variation in the population. In addition, the investigation of KDR genetic variation in different ethnic groups allowed us to define the pattern of variation across different populations. High variability was found in the African-American group, which showed the greatest number of SNPs compared to the other two groups. The functional studies identified a promoter variant affecting the transcriptional activity of the gene.
EXAMPLE 4 ANALYSIS OF BREAST CANCERS
Resequenced regions:
Approximately 4 Kb from the ATG start site, coding regions, ClusterBuster regions, 3 ' -UTR of the VEGFR-2 gene were resequenced.
Samples
13 frozen breast cancer samples from patients were resequenced. Samples were also classified by race (W=Caucasian, B=African American).
#10-W #30-B
#36-B
#37-B
#49-W
#51-W #52-B
#57-B
#63-B
#70-B
#86-B #94-B
#97-W (Hispanic)
Table 4: Primer sets used for the resequencing analysis
SEQID Size
No OLIGO start length Tm gc% sequence (bp)
60.7 4
KDR-IF LEFT -2344 21 5 47.6 GTCTTGGCAATTCAGGCTCTT
59.8 5
KDR-IR RIGHT -1705 20 1 45 GCAGGCTCATTCATTCAACA 640
59. 6
KDR-2F LEFT -1840 22 63 4455..445 TGTCTTGGGTGAGGCTATTACA
59. 7
KDR-2R RIGHT -1178 24 05 41.6 CTTAGAAGTGCCTTAGGTTCACAA 663
59. 8
KDR- 3 F LEFT -1303 20 7 45 ACTCCTTTGCAATGCCAGAT
61. 9
KDR-3R RIGHT -706 20 58 50 TAAGCTGGCTGCGAACAAAG 598
57. 10
KDR-4F LEFT -797 25 25 40 CCTCCCAGATAAATATGAGTACATC
60. 1111
KDR-4R RIGHT -191 23 19 39.1 CACGCTTTTACTTTTCCAAGTTG 598 59. 12
KDR-5F LEFT -324 20 82 40 ATGCCTCTGCCAAAAGAAAA
61. 13
KDR-5R RIGHT 310 21 65 52. 3 CCAACGAAGAGCCCTAGTGAA 634
60. 14
KDR-6F LEFT 241 21 19 52. 38 GGATATCTTGGCTGGAAGCTC
64. 15
KDR-6R RIGHT 889 17 51 70. 59 GTACCCGGCGGCGATCT 649
61. 16
KDR-7F LEFT 816 19 11 57. 89 CAGCGCAGTCCAGTTGTGT
61. 17
KDR-7R RIGHT 1470 23 61 52. 1 CCAACTCTCCAGCTCTACGATTC 655
59. 18
KDR-IOF LEFT 5294 20 95 45 TGAATTGCTGAAGAGGCCTT
58. 19
KDRlOR RIGHT 5863 22 14 40. 91 TCCTTAAATGTATGCCCTCAAC 570
59. 20
KDR-IlF LEFT 7664 20 87 60 CTGGCCGGTAGAAGACTGAC
60. 21
KDRIlR RIGHT 8257 20 01 45 AATGGCCAACAGTGAACACA 594
59. 22
KDR-I3F LEFT 7664 20 87 60 CTGGCCGGTAGAAGACTGAC
60. 23
KDR13R RIGHT 8257 20 01 45 AATGGCCAACAGTGAACACA 594
59. 24
KDR-I4 F LEFT 11422 20 93 45 AGGAAGGGTCAAATGCAATG
60. 25
KDR14R RIGHT 11844 20 34 55 GCCCAACACCATATCCTGAG 423
63. 26
KDR-15F LEFT 12171 20 88 55 GTTGGCCATTTTCCTGGGAG
58. 27
KDR15R RIGHT 12668 20 22 50 CTTTTGGTGGGTGCTATCTG 498
59. 28
KDR-I 6F LEFT 12989 20 17 45 TGGTGTCCCTGTTTTTAGCA
59. 29
KDR16R RIGHT 13422 20 68 45 TGGCCTCCCTAACAAGAAAA 434
59. 30
KDR-17F LEFT 15719 21 1 57. 14 TGCAGCTACTCAGACCCTCAAG
60. 31
KDR17R RIGHT 16295 20 55 55 ATGAGTGAAGCAGCAGGAGG 577
59. 32
KDR-I8F LEFT 17640 22 74 40. 9 TAGCCCATTTCATCAGTTCATG
58. 33
KDR18R RIGHT 18295 21 76 47. 62 AATCCTGTGCCTCTCATCTGT 655
58. 34
KDR-20F LEFT 18506 20 8 50 CCATGCCTGGCTAGTTGTTA
59. 35
KDR20R RIGHT 18999 21 09 47. 6 GATGGATGGAGATTCAGGCTA 494
61. 36
KDR-22F left 19661 19 59 52. 6 ATGGTAGGCTGCGTTGGAA
59. 37
KDR22R right 20147 24 91 45. 8 GAATCACCCTACACAGATGCATAG 487
60. 38
KDR-23F LEFT 20575 20 02 55 TTGTGGAGACTGCTGGACTG
61. 39
KDR23R RIGHT 20869 20 34 45 AAATGCCATGCCACTCACAT 295
60. 40
KDR-25F LEFT 21490 20 22 55 TCACCTGGAACGGATAGAGC
59. 41
KDR25R RIGHT 22083 20 31 55 GGTGAAGAAGTGTGCACCAG 594
60. 42
KDR-26F LEFT 23911 21 08 52. 38 GTGTCCTGACTGACTTGTTTCAT
59. 43
KDR26R RIGHT 24354 20 21 50 CCAGGTCATGGACACCAATA 444
59. 44
KDR-27F LEFT 24420 24 18 45. 83 GATTAGTCAGCAGTAGATCCCATG 62. 45
KDR27R RIGHT 24804 18 47 55. 5 TCCAGCTCCATCCATGCA 385
58. 46
KDR-28F LEFT 27631 25 94 40 TTCTGTAGACTCCATTCAAGTTACG
59. 47
KDR28R RIGHT 28246 20 8 50 TTGGAGCCTCATTCCTGTCT 616
59. 48
KDR-29F LEFT 28227 20 8 50 AGACAGGAATGAGGCTCCAA
61. 49
KDR29R RIGHT 28846 20 13 55 ACGGCCAAGAGGCTTACCTA 620
58. CATTCATATAGCCACTTAGAGGTAG 50
KDR-30F LEFT 28600 26 79 42. 31 G
59. 51
KDR30R RIGHT 29168 21 23 47. 62 GTAACCAGGCAAGAAGGTGAA 569
59. 52
KDR-31F LEFT 30155 24 98 45. 83 GGAGGGTAAGTTGTATAGTGGCAT
60. 53
KDR31R RIGHT 30453 20 39 55 GGCCAGAGGAGTTGACTGCT 291
58. 54
KDR-32F LEFT 30810 23 53 47. 83 CCTGTCCCAATGAAAGGTTGTAG
59. 55
KDR32R RIGHT 31266 20 6 55 CTCGCTCATACCTGCCTTCT 457
58. 56
KDR-33F LEFT 31484 22 95 45. 45 CAGCTCAGAGATTGCATAATCC
59. 57
KDR33R RIGHT 31953 20 26 55 GGAGACAGAATGGAGGCAGT 470
59. GGTCAGTGTTACCTTATTCTACCTC 58
KDR-35F LEFT 33615 26 76 46. 15 C
59. 59
KDR35R RIGHT 34155 24 15 45. 83 CTCCTTAACCACTCTTACTCAGCA 541
KDR-37F LEFT 36443 22 60 45. 45 GATGCATGAGGTCACAACAGAT 60
60. 61
KDR37R RIGHT 37055 22 66 45. 45 TCTTGCACATCCTCATCACCTA 613
60. 62
KDR-38F LEFT 36922 20 05 55 TGTCCTTCCATCCAGACTCC
60. 63
KDR38R RIGHT 37382 22 26 45. 45 GAAGTGATGACTCCATGCTTGA 461
59. 64
KDR-39F LEFT 37459 21 7 52. 38 CATTGAGCCTCTGGAGTATGG
61. 65
KDR39R RIGHT 37837 20 15 50 TTCAATGGCTGAGAGGATGG 379
61. 66
KDR-40F LEFT 38563 20 15 55 TCTCTGACCACAGCCTGCTT
59. 67
KDR40R RIGHT 39151 19 75 57. 89 CCTCTTCCAGGAGCATTCC 589
58. 68
KDR-44F LEFT 43792 20 38 45 TTAAGCCTTCCATGTGTGCT
59. 69
KDR44R RIGHT 44258 21 61 52. 38 CACTGTCTTGAACCTTGGACC 467
57. 70
KDR-45F LEFT 44360 20 74 55 CCTGGCCTGTGTCTACTCAT
60. 71
KDR45R RIGHT 44948 20 61 50 ACGGATCACATCCAATCACC 589
59. 72
KDR-48F LEFT 46203 24 82 45. 83 AAGACTTGGACCTGAGTAAGAGGA
KDR48R RIGHT 46834 22 61 50 CACAAGCCTCTTCCAGGATATG 73 632
58. 74
KDR-49F LEFT 46735 18 57 55. 5 AGCAGGAAGTAGCCGCAT
62. 75
KDR49R RIGHT 47371 21 33 52. 3 CACGTAACGGTCTGGAAGGAA 637
59. 76
KDR-50F LEFT 47284 20 91 50 AGGTTGCGTGTTCTTCGAGT
60. 77
KDR50R RIGHT 47862 20 09 45 GGACAGAACAAGGGCAAAAA 579 Table 5: Variants found in breast cancer samples dbSNP Allele
Phr SNP Database Frequency Frequency Frequency frequency in
Position (Common in CA in AS in AA the breast position
/Rare) (MAF) (MAF) (MAF) cancer samples
55835989 702 G/A rs9992737 0.250 0.208 0.125 0.115
55835274 1417 T/C N/A 0.063 — 0.021 0.192
55835242 1449 A/C rs1551645 0.292 0.208 0.125 0.231
55835194 1497 T/A rs1551644 0.292 0.208 0.125 0.231
55835154 1537 A/T rs1551643 0.292 0.208 0.125 0.231
55835138 1553 A/G rs1551642 0.292 0.208 0.125 0.231
55835016 1675 T/A N/A — 0.146 0.308
55834843 1848 G/A rs1551641 0.292 0.208 0.125 0.188
55833294 3397 T/C rs2071559 0.458 0.625 0.500 0.708
55833033 3658 G/C N/A 0.313 0.229 0.458 0.125
55832995 3696 T/C N/A 0.458 0.667 0.521 0.583
55832953 3738 C/T N/A 0.208 0.292 0.167 0.083 rs1002786
55832813 3878 C/G 2 0.042 0.083
55832755 3936 T/C rs9994560 0.250 0.125 0.458 0.3
55832707 3984 T/A rs6824124 — — 0.042 0.077
55832659 4032 G/A rs7667298 0.354 0.125 0.521 0.462 new 4107 G/T — — — — 0.038
55827930 8761 A/C rs2054246 0.188 — 0.146 0.077
55821384 15307 G/A rs2305949 0.146 0.188 0.125 0.077
55821167 15524 G/A rs7692791 0.458 0.521 0.479 0.308
55820486 16205 G/A rs2305948 0.083 0.188 0.250 0.154
55815790 20901 del"GAGG" N/A 0.396 0.75 0.333 0.460
55813902 22789 A/T rs1870377 0.354 0.521 0.104 0.091
55813874 22817 T/C N/A 0.083 — 0.045 rs1313556
55809673 27018 G/C 2 0.021 0.038
55808981 27710 T/G rs7655964 0.250 0.271 0.125 0.231
55805960 30731 A/- N/A 0.042 — — 0.039
55805763 30928 G/A N/A — — 0.042 0.045
55805533 31158 G/A rs2305946 0.375 0.500 0.083 0.136
55805493 31198 T/C rs3816584 0.375 0.500 0.083 0.136
55805029 31662 A/G rs6838752 0.375 0.500 0.083 0.115
55803474 33217 C/CC N/A 0.375 0.5 0.125 0.115 rs1051734
55803286 33405 — —
A/G 0 0.188 0.188 new 34594 C/T — — — — 0.045
55802087 34604 A/G rs2219471 0.375 0.542 0.167 0.038
55796160 40531 G/A rs1531289 0.292 0.208 0.625 0.423
55789521 47170 C/T N/A — 0.021 0.071
55787009 49682 T/C rs4421048 — — 0.021 0.077 new 50160 G/A — — — — 0.077 new 50369 G/A — — — — 0.038 EXAMPLE 5
ANALYSIS OF LUNG CANCERS
Resequenced regions The core promoter region (approximately 550 bp) and coding regions of VEGFR-
2 were resequenced.
Samples
51 paraffin embedded adenocarcinoma samples from patients (race unknown) were evaluated.
Table 6: Primer sets used for resequencing analysis (Multiplex PCR)
SEQ SEQ
ID Forward Reverse ID size proml 78 AATCTTGGAGTTGCTCAGCG ACTCAGTGCAGGGTGGGA 79 291 prom2 80 CCTCCGCGCTCTAGAGTTT TCTCCCAGCGCCTGTCTA 81 293
Exonl 82 CTGTGCGCTCAACTGTCCT CCGAGTTAGATCTGGCTTTCA 83 275
Exon2 84 CATTGTTTATGGAAGGTGTTTCC AGAAACCTCACCACTTATGAACAA 85 297
Exon3 86 GCACTTCATATTAATACCTCCCTGA TGAGCCTATTGTCTTTTATAACTGG 87 300
Exon4 88 TGTCTGGTTAGAGTTTAGGAACCTG GGATCCTTAAAACTCATTGTGAA 89 322
Exon5 90 TGTACATGGCTCTCATTTTTGG TCAATATCCTTCTTCACTCTATGTTG 91 320
Exonδ 92 GGAAAAACAATGTGGCATGT CCCTATCTCTCAAGCAAACTTC 93 330
Exon7 94 TGCTGTGCTTTGGAAGTTCA TTTAAATTATCTCACTTGTCAAGGC 95 270
Exon8 96 AAGGTCTTTGACGTTTCACTTG GGACTCAAGGGGTATTCCATT 97 320
Exon9 98 GCAAAGCATCATTTCGTGTG AAATCTTGGGCAGAGAGGAA 99 268
ExonlO 100 TCATATGCTTAAAGAAAGTCAGCTT TCATAGCTCAGCTGTAAGAAATGC 101 319
Exonl1 102 AATATGCGCTGTTATCTCTTTCTT TTAATCTCCAATATGCCTCACA 103 238
Exonl2 104 AAACAGCCGCGTTGTTTATG CATAGCTTAGTACCCACTGTGTGA 105 217
Exonl3 106 AAATCACCATTCAATAACTATGGC AGGCATTCCAACTGCCTCTG 107 426
Exonl4 108 TGCTGATACCAGAACCATTTCA GGCTTTTTAGATAACATCCCTGG 109 279
Exonl5 110 AAATTTCCCTGAAAAACTTCACA CCTTTTTACGGCTGCATAGC 111 265
Exonl 6 112 TGGGATTTTGCTTTAGTGCT AAGAACCCCAGTCAGTTTTCA 113 270
Exonl7 114 TGAGGCTCCAATAAACAGCA CACCACATTTGTCATCATTCTAA 115 305
Exonl8 116 CTCTGCGTATCACTTTGGTTG GCCTTGCAACATATTTAAAGACTAGA 117 240
Exonl 9 118 GAGGGAGGGACCCCAATTAT TCCCTCAAACACTATCAGAGAGG 119 249
Exon20 120 AGGAATATGAGTGAAAACCCATT GGTAATATGAGAAGATTCCTCACAAG 121 260
Exon21 122 TTCAATTATCTCCATGGTTTACTACA CCCTATCACCCTGTCTGCTC 123 316
Exon22 124 AAACTTAACTCCCAAGTCTTAAAAAG ATTTCCAAACCTGTGATCTGAA 125 257
Exon23 126 TGATGCATGAGGTCACAACA CCTGAAGCTCTCTACGAGGA 127 269
Exon24 128 GATATTTGCTAATTTGGGTTCTGA GCCTGATAGACATGAAGTACAGGA 129 249 Exon25 130 GGTGATGAGGATGTGCAAGA TTCCAGGCAAGGAGAATTTG 131 250
Exon2β 132 TCCTTATTTAGCATCTCACCTCG AAGTCCTTGACATCTAAGTACTCTTTG 133 279
Exon27 134 GCCACACACCCTATGTAGCC GATGGCCTTGAAGTCACCCT 135 310
Exon28 136 GATAATGAACTTAGGTAGCCGATCT TCCATAATGACCCCATGATACA 137 315
Exon29 138 GATGGGTTGAGAAATCAGCTT CCTAAGTTCCTTCCAAAAATTCC 139 230
Exon30 140 AAGCAAAAGAATTGTCTTCTCTCTG GGGGTGTGGATGCTTCCTT 141 298
The VEGFR-2 gene was also sequenced in 51 adenocarcinoma samples from NSCLC patients. All the germ line VEGFR-2 variants, including the -271G>A variant, with a frequency > 5% were also found in these NSCLC samples. These data suggest that the genetic profile of the VEGFR-2 gene in tumors has a high level of concordance with the germ line DNA, and that the tumor samples retain the germ line genetic information. However, two new SNPs were found in these tumor specimens: they appear to be rare and sequencing of matching DNA is ongoing to establish their acquired nature.
Variants found in lung cancer samples
SNPs found in adenocarcinoma lung samples are shown in Table 7.
Table 7
Position common/rare germ line race freq
Database
CA AS AA
3738 CfT N/A 0.208 0.292 0.167
5'UTR 4032 G/A rs7667298 0.354 0.125 0.521
5'UTR 4302 GfT N/A 0.063 — — exon7 16205 G/A rs2305948 0.083 0.188 0.250 exon11 22789 A/T rs 1870377 0.354 0.521 0.104 intron15 27710 T/G rs7655964 0.250 0.271 0.125 intron20 34604 A/G rs2219471 0.375 0.542 0.167 intron25 40531 G/A rs1531289 0.292 0.208 0.625 intron29 49409 C/A rs10006115 — 0.146 0.083
Table 8: Germ line SNPs not found in adenocarcinoma lung samples, due to their low frequency in 72 germ line DNA samples
Position common/rare D , , germ line race freq
CA AS AA
5'flanking 984 T/A rs6824124 — — 0. 042
5'flanking 878 C/G rs10027862 — — 0. 042 exon3 10838 T/C N/A — — 0.021 exon3 10892 G/A N/A — — 0.021 exon3 10916 C/T N/A — — 0.021 exon3 10950 C/T N/A — — 0.021 exon 13 24772 T/A N/A — — 0.021 exon 13 24800 T/C N/A — — 0.021 exon 14 27122 G/C N/A — — 0.021 exon 15 27638 C/T N/A — 0.021 — exon 18 31836 C/T N/A — 0.021 — exon 20 33938 C/T N/A — 0.021 — exon 21 34677 G/A rs13129474 — — 0.021
The four new SNPs previously reported in breast cancer samples and not found in germ line DNA were not found in the lung cancer samples, and are shown in Table 9.
Table 9 position common/rare frequency
4107 GfT 0.038
34594 CfT 0.045
50160 G/A 0.077
50369 G/A 0.038
EXAMPLE 6
EVALUATION OF THE ASSOCIATION BETWEEN THE -271OA VARIANT AND VEGFR-2 PROTEIN EXPRESSION IN LUNG TUMORS
The inventors' preliminary data on the genetic variation of VEGFR-2 have identified a common polymorphism that might affect gene expression in the tumors (FIG. 9). It is hypothesized that the level of expression of VEGFR-2 might be, in part, genetically determined. To test this hypothesis, the association between VEGFR-2 -
271 G>T variation and gene expression in tumors has been assessed.
Methods and patients
Patients. Clinical features and surgery information (sex, age, histology, performance status, TNM stage, grade of differentiation, smoking status, overall survival) of 101 Caucasian patients from the Medical University of Gdansk, Poland, with diagnosis of NSCLC are available. All patients had undergone surgical resection for NSCLC. In the database, each patient is coded by an ID number and is devoid of identifiers. The median follow up is 3.5 years (range 1.9-3.9 years). Genotyping of the -271OA variant. NSCLC DNA samples were genotyped for
271G>A promoter variant. -271 G>A was genotyped by a single base extension (SBE) method. The PCR and SBE primers used were:
5'- CCACCCTGCACTGAGTCCC -3' (forward PCR primer) 5'- GCAGCGGAGGACAGTTGAG -3' (reverse PCR primer) 5'- GAAACGCAGCGACCACACA -3 ' (upstream extension primer).
A standard procedure was used for primer design. The primers were designed using the Oligo Primer Analysis Software (on the World Wide Web at oligo.net). The specificity and optimization of all primers was determined using the BLAST algorithm from the National Center for Biotechnology Information (on the World Wide Web at ncbi.nlm.nih.gov) and the BLAT algorithm. The primer sequences were also carefully checked to ensure they do not encompass SNP locations. Appropriate controls for each genotype were also included to ensure the assay was performing optimally. A single base extension (SBE) with separation of extension products by denaturing high performance liquid chromatography (DHPLC) was used. This method of genotyping is known to those of skill in the art {see Innocenti et al, 2002; Innocenti et al, 2005; Innocenti et al, 2004; Liu et al, 2003; Liu et al, 2005; Ramirez et al, 2006; each incorporated by reference in its entirety).
Immunohistochemistry (IHC). Ten tissue microarray (TMA) sections constructed from tumor (1 core in triplicate for each tumor tissue) were evaluated for tumor content using hematoxylin and eosin staining. TMAs were then processed by an IHC staining procedure exposing the slides to primary antibodies anti-VEGFR-2. A biotynilated secondary antibody and the streptavidin-biotin peroxidase technique with diaminobenzidine as chromogen were applied to visualize binding of the primary antibody. The staining quantification was then performed using the automated cellular imaging system (ACIS) available at Human Tissue Research Center at University of Chicago (corr.bsd.uchicago.edu/facilities/imageanalysis.html). Each TMA's core was scanned at low magnification (xlO) in the ACIS and scored quantitatively using a free- scoring or x40 tool.
The ACIS software calculated VEGFR-2 staining through integrated optical density (IOD) of the stained cells. The data were then normalized by dividing the IOD for
10 um2. A mean of IOD/10um among the three cores available was calculated to analyze the results. Standard deviation (SD) and coefficient of variance (CV) were calculated for each core in triplicate and a CV cut off <30% was applied.
The data for FIG. 9 was generated by the following protocol:
In the morning of Day 1, Hek 293 cells was plated in 6-well plates in 2 ml
Dulbecco's Modified Eagle Medium (DMEM supplemented with 10% FBS). The experiment was performed in triplicates. In the afternoon of Day 1, the cells were transfected using the Ca3(PO4)2-method. The Ca3(PO4)2-method involved 1) pipeting 5 μg of DNA into an eppendorf tube; 2) adding 100 μl of Solution A (250 mM CaCl2 in H2O); 3) adding 100 μl of Solution B (140 mM NaCl; 50 mM HEPES; 1.5 mM Na2HPO4 in H2O; pH 7.05); mixing by flipping; 4) adding the solution to the cells whilst mixing well; and 5) incubating the cells at 370C. In the morning of Day 2, the medium was replaced with fresh DMEM medium. In the afternoon of Day 2, the medium was replaced with starvation medium (DMEM supplemented with 1% Bovine Serum Albumin).
In the afternoon of Day 3, the cells were incubated with or without 1.5 nM VEGF-Ai64 (diluted in PBS) for 10 min at 37°C. Incubating the cells involved 1) stopping stimulation on ice and wash cells with ice cold PBS; 2) adding 100 μl Lysis buffer (50 mM Tris pH 7.5; 100 mM NaCl; 0.5% Triton-X) containing protease- and phosphatase-inhibitors to each well, scrape off and collect cells; 3) sonificating cell lysate (4 pulses), centrifuging cells 5 min at 40C, and collecting the supernatant; 4) separating samples by SDS-PAGE, transfering to a PVDF membrane and exposing to X-Ray film; and 5) determining VEGFR-2 activity in Western blots using a phospho-specific antibody directed against Yl 175 of VEGFR-2 (Cell Signaling; dilution 1 :1000 in 0.5% BSA in TBST) and an antibody against VEGFR-2 (Cell Signaling; dilution 1 :10 000 in 0.5% BSA in TBST).
Results
The frequency of the -271G>A in this population of Caucasian patient was 48%, and was concordant with our previous sequencing data generated in germline DNA (Table 1). As shown in FIG. 1, a significantly lower VEGFR-2 protein expression was found in the tumor of patients with AA genotype compared to AG+GG genotypes (p=0.02, Mann- Whitney). This result is consistent with our preliminary data of the luciferase assay (FIG. 9), where we discovered that constructs with the -27 IA allele have reduced transcriptional efficiency of the VEGFR-2 gene. No other covariates (tumor and patient characteristics) were associated with the variability in VEGFR-2 staining in NSCLC tumors. From these results it is clear that, as the level of VEGFR-2 expression of NSCLC is a negative prognostic factor in these patients (Kajita et al, 2001 ; Seto et al, 2006; Donnem et al, 2007), the -217G>A variant might be used as a prognostic marker that is easily accessible (from a single blood sample from patients). It is further clear that, as bevacizumab (an antiangio genie agent that inhibits VEGF) is approved for therapy in NSCLC patients, -271G>A could be used as a predictive marker for response: NCSLCs with higher VEGFR-2 expression are likely to be more dependent from VEGF activity through VEGFR-2 signaling for their survival, and hence, might be more likely to respond to therapy with an angiogenesis inhibitor.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
U.S. Patent 3,817,837 U.S. Patent 3,850,752 U.S. Patent 3,939,350 U.S. Patent 3,996,345 U.S. Patent 4,275,149 U.S. Patent 4,277,437 U.S. Patent 4,366,241 U.S. Patent 4,582,788 U.S. Patent 4,656,127 U.S. Patent 4,659,774 U.S. Patent 4,682,195 U.S. Patent 4,683,194 U.S. Patent 4,683,195 U.S. Patent 4,683,202 U.S. Patent 4,683,202 U.S. Patent 4,800,159 U.S. Patent 4,816,571 U.S. Patent 4,883,750 U.S. Patent 4,946,773 U.S. Patent 4,959,463 U.S. Patent 5,141,813 U.S. Patent 5,264,566 U.S. Patent 5,279,721 U.S. Patent 5,428,148 U.S. Patent 5,554,744 U.S. Patent 5,574,146 U.S. Patent 5,602,244 U.S. Patent 5,602,244 U.S. Patent 5,645,897 U.S. Patent 5,705,629 U.S. Patent 5,786,344 U.S. Patent 5,840,873 U.S. Patent 5,843,640 U.S. Patent 5,843,650 U.S. Patent 5,843,651 U.S. Patent 5,843,663 U.S. Patent 5,846,708 U.S. Patent 5,846,709 U.S. Patent 5,846,717 U.S. Patent 5,846,726 U.S. Patent 5,846,729 U.S. Patent 5,846,783 U.S. Patent 5,849,481 U.S. Patent 5,849,483 U.S. Patent 5,849,486 U.S. Patent 5,849,487 U.S. Patent 5,849,497 U.S. Patent 5,849,546 U.S. Patent 5,849,547 U.S. Patent 5,851,770 U.S. Patent 5,851,772 U.S. Patent 5,853,990 U.S. Patent 5,853,992 U.S. Patent 5,853,993 U.S. Patent 5,856,092 U.S. Patent 5,858,652 U.S. Patent 5,863,732 U.S. Patent 5,863,753 U.S. Patent 5,866,331 U.S. Patent 5,866,337 U.S. Patent 5,866,366 U.S. Patent 5,900,481 U.S. Patent 5,905,024 U.S. Patent 5,910,407 U.S. Patent 5,912,124 U.S. Patent 5,912,145 U.S. Patent 5,912,148 U.S. Patent 5,916,776 U.S. Patent 5,916,779 U.S. Patent 5,919,626 U.S. Patent 5,919,630 U.S. Patent 5,922,574 U.S. Patent 5,925,517 U.S. Patent 5,925,525 U.S. Patent 5,928,862 U.S. Patent 5,928,869 U.S. Patent 5,928,870 U.S. Patent 5,928,905 U.S. Patent 5,928,906 U.S. Patent 5,929,227 U.S. Patent 5,932,413 U.S. Patent 5,932,451 U.S. Patent 5,935,791 U.S. Patent 5,935,825 U.S. Patent 5,939,291 U.S. Patent 5,942,391 U.S. Patent 5,952,174 U.S. Patent 6,395,481 U.S. Patent 6,472,157 U.S. Serial No. 60/549,069 U.S. Serial No. 60/550,268 U.S. Appln. Serial 08/271,278 U.S. Appln. Serial 10/558510 U.S. Appln. Serial 10/591,484 U.S. Appln. Serial 10/591228 U.S. Appln. Serial 11/561341 U.S. Appln. Serial 11/913,150
Abbondanzo et al, Breast Cancer Res. Treat., 16:182(151), 1990.
Albert et al, MoI. Cancer Ther., 5:995-1006, 2006.
Allred et ah, Breast Cancer Res. Treat., 16:182(149), 1990.
Ausubel et al, In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY,
1994; 1989.
Bardelli et al, Science, 300:949, 2003. Beaudet and Belmont, Annu. Rev. Med., 59:113-129, 2008. Bier et al, Adv. Biochem. Eng. Biotechnol, 109:433-453, 2008. Brown et al Immunol. Ser., 53:69-82, 1990. Canadian Appln. 2,558,753 Canadian Appln. 2194277
Carlson et al, Am. J. Hum. Genet., 74(l):106-120, 2004. China Appln. 200580006465.7
Collins and Hurwitz, Semin. Oncol, 32(l):61-68, 2005. Cunningham et al, J. of Bio. Chem., 270(35):20254-20257, 1995. de Arruda et al, Expert. Rev. MoI. Diagn., 2:487-496, 2002. De Jager et al, Semin. Nucl Med, 23(2):165-179, 1993. Donnem et al, Clin. Cancer Res., 13(22 Pt l):6649-6657, 2007. Doolittle and Ben-Zeev, Methods MoI, Biol,, 109:215-237, 1999. EGB 0768895
EIE 0768895
ELU 0768895
EP Appln. 05724156.4
EPA 0768895
European Appln. 201,184
European Appln. 237,362
European Appln. 258,017
European Appln. 266,032
European Appln. 320,308
European Appln. 329,822
European Appln. 50,424
European Appln. 84,796
Evans et al, J. Clin. Oncol, 19(8):2293-2301, 2001.
Ferrara et al, Nat. Med., 9(6):669-676, 2003.
Folkman, Semin. Oncol, 6(16):15-18, 2002.
French Appln. 2,650,840
Frith et al, Nucleic Acids Res., 31(13):3666-3668, 2003.
Froehler et al, Nucleic Acids Res., 14(13):5399-5407, 1986.
Frohman, In: PCR Protocols: A Guide To Methods And Applications, Academic Press,
N. Y., 1990.
Gille et al, J. Biol. Chem., 276(5):3222-3230, 2001. Great Britain Appln. 2 202 328
Grimsley et al, "Big IA" data. PAAR meeting, personal communication, 2003. Gulbis and Galand, Hum. Pathol, 24(12):1271-1285, 1993. Halushka et al, Nat. Genet, 22(3):239-247,1999. Harlow and Lane, In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY, 346-348, 1988. Hughes and Branford, Blood Rev., 20(l):29-41, 2006. Hurwitz et al, N. Engl. J. Med., 350(23):2335-2342, 2004. lies, Ann. Hum. Genet., 69(Pt 2):209-215, 2005. Inazuka et al, Genome Res, 7(11): 1094-1103, 1997.
Innis et al, Proc. Natl. Acad. Sci. USA, 85(24):9436-9440, 1988.
Innocenti and Ratain, Eur. J. Cancer, 38(5):639-644, 2002.
Innocenti et al, J. Clin. Oncol, 22(8):1382-1388, 2004.
Innocenti et al, J. Clin. Oncol, 22(8):1382-1388, 2004.
Innocenti et al, Pharmacogenet Genomics, 15(5):295-301, 2005.
Innocenti et al, Pharmacogenetics, 12(9):725-33, 2002.
Iqbal and Lenz, Semin. Oncol, 6(17):10-6, 2004.
Japanese Appln. 2006-242179
Japanese Appln. 2007-501893
Japanese Appln. 503964/96
Jin et al, J. Natl. Cancer Inst., 97(l):30-39, 2005.
Johnson et al, Nat. Genet., 29(2):233-237, 2001.
Kajita et al, Br. J. Cancer, 85(2):255-260, 2001.
Kariyazono et al, Pediatr. Res., 56(6):953-959, 2004.
Ke and Cardon, Bioinformatics, 19(2):287-288, 2003.
Kendall and Thomas, Proc. Natl. Acad. Sci. USA, 90(22): 10705- 10709, 1993.
Kendall et al, J. Bio. Chem., 274(10): 6453-6460, 1999.
Kendall et al, J. Bio. Chem., 274(10):6453-6460, 1999.
Komher, et al, Nucl Acids. Res. 17:7779-7784, 1989.
Korean Appln. 10-2006-7020515
Kuppuswamy, et al, Proc. Natl. Acad. Sci. USA, 88:1143-1147,1991.
Kwoh et al, Proc. Natl Acad. Sci. USA, 86:1173, 1989.
Kwok and Chen, Curr Issues MoI Biol, Apr;5(2):43-60, 2003.
Kwok et al, Genomics, 23(1):138-144, 1994.
Kwok et al, J. Med. Genet., 33(6):465-468, 1996)
Kwok, Annu. Rev. Genomics Hum. Genet., 2:235-258, 2001.
Landegren, et al, Science 241 :1077-1080, 1988.
Lingen, Methods MoI Med., 78:337-347, 2003.
Liu et al, Cancer Res., 65(l):46-53, 2005.
Liu et al, Clin. Cancer Res., 9(3):1009-1012, 2003. Lu et al, Biopolymers, 73:606-613, 2004.
Lynch et al., N. Engl. J. Med., 350(21):2129-2139, 2004.
Maxam, et al., Proc. Natl. Acad. ScL USA, 74:560, 1977.
Meyer et al, EMBOJ., 18(2):363-374, 1999.
Mukherjee, MoI. Cell Biochem., 264: 157-167, 2004.
Mullis et al, Cold Spring Harbor Symp. Quant. Biol. 51 :263-273, 1986.
Nakamura et al., In: Handbook of Experimental Immunology (4n Ed.), Weir et al. (Eds),
1 :27, Blackwell Scientific Publ., Oxford, 1987. Nickerson et al, Proc. Natl Acad. Sci. USA, 87:8923-8927,1990. Nilsson and Olsson, Clin. Chem. Lab. Med., 46(l):80-84, 2008. Noel et al, Genes Chromosomes Cancer, Apr 2 [Epub ahead of print], 2008. Nyren et al, Anal. Biochem. 208:171-175, 1993. Ohara et al, Proc. Natl. Acad. Sci. USA, 86:5673-5677, 1989. Paez et al, Science, 304(5676):1497-1500, 2004. Pao and Miller, J. Clin. Oncol, 23(11):2556-2568, 2005. Patterson et al, J. Bio. Chem., 270(39):23111-23118, 1995. PCT Appln. PCT/US2005/006559 PCT Appln. PCT/US2005/007410 PCT Appln. PCT/US2007/060995 PCT Appln. PCT/US87/00880 PCT Appln. PCT/US89/01025 PCT Appln. WO 88/10315 PCT Appln. WO 89/06700 PCT Appln. WO91/02087 PCT Appln. WO92/15712 PCT Appln. WO96/01127 Prezant et al, Hum. Mutat, 1 :159-164, 1992. Pritchard et al, Am. J. Hum. Genet., 67(l):170-181, 2000. Ramirez et al, Pharmacogenet Genomics., 16(2):79-86, 2006. Robinson and Stringer, J. Cell ScL, 114(Pt 5):853-865, 2001. Royo et al, Nat. Protoc, 2(7): 1734- 17349, 2007. Ryden et al, J. Clin. Oncol, 23(21):4695-4704, 2005.
Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3rd Ed., Cold Spring
Harbor Laboratory Press, 2001. Sanger et al, J. Molec. Biol, 94:441, 1975. Sano et al, Science, 258(5079):120-122, 1992. Seto et al, Lung Cancer, 53(l):91-96, 2006. Shinkai et al, J. Bio. Chem., 273(47):31283-31288, 1998. Simons et al, Circulation, 105:788, 2002. Sokolov, Nucl. Acids Res. 18:3671, 1990. Stevens et al, Biotechniques, 34:198-203, 2003. Syvanen et al, Genomics 8:684-692, 1990. Taillon-Miller et α/., Genome Res, 8(7):748-754, 1998. Takahashi et al, Cancer Res., 55(18):3964-3968, 1995. Te et al, Transplantation, 69:1882, 2000. Thompson et al, Am. J. Hum. Genet., 75(6): 1059-1069, 2004. Ugozzoll et al, GATA, 9:107-112, 1992. Veikkola et al, Cancer Res., 60(2):203-212, 2000. W ralker et al, Nucleic Acids Res. 20(7):1691-1696, 1992. Wang et al J. Am. Coll. Cardiol.,50(8):760-767, 2007. Warren et al, J. Clin. Invest, 95(4): 1789- 1797, 1995. Wise et al, Proc. Natl. Acad. Sci. USA, 96(6):3071-3076, 1999. Zhong et al, Biochimica. Biophysica. Acta, 1722:254-261, 2005.

Claims

1. A method for assessing expression of vascular endothelial growth factor receptor 2 (VEGFR-2) in a patient with an angiogenesis-dependent condition or disease comprising determining the presence of one or more variants in a VEGFR-2 allele in a biological sample from the patient.
2. The method of claim 1, wherein a variant is determined using sequencing, microsequencing, allele-specific hybridization, or amplification.
3. The method of claim 1, wherein the one or more variants is -3601 G>A, - 3538 OT, -2886 T>C, -2854 A>C, -2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 G>A, -2008 A>G, -1973 (TAAA)6-H, - 1942 A>G, -1918 G>A, -1846 OT, -1361 G>T, -1067 OA, -906 T>C, -679 G>A, - 645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, -271 G>A, -1 G>T, 1107 T>C, 1367 T>C, 3684 OT, 4068 G>C, 4238 A>C, 3684 OT, 4423 (AC)io_i2) 4442 OT, 4459 A>C, 6536 T>C, 6590 G>A, 6614 OT, 6648 OT, 9485 G>A, 11005 G>A, 11222 G> A, 11259 G>A, 11903 G> A, 14752 G>C, 16583 GAGG>-, 16925 T>C, 17070 T>C, 17171 OG, 17186 G>A, 17366 A>G, 18465 T>G, 18487 A>T, 18515 T>C, 19948 T>C, 20220 G>T, 20470 T>A, 20498 T>C, 20679 OT, 22716 G>C, 22820 G>C, 23336 OT, 23408 T>G, 26027 T>C, 26429 A>-, 26626 G>A, 26856 G> A, 26896 T>C, 27311 A>T, 27360 A>G, 27534 OT, 28914 >C, 29103 A>G, 29636 OT, 29743 G>A, 30302 A>G, 30375 G>A, 30564 G>A, 32309 T>C, 33738 T>C, 33828 G>A, 36229 G>A, 36438 OT, 37978 OT, 38081 T>C, 38131 G> A, 39592 A>G, 39638 T>C, 39730 OT, 39733 OA, 40029 A>C, 40096 OT, 40161 A>G, 42868 OT, 43353 OT, 43393 OA, 44123 A>G, 44189 T>C, 44306 T>G, 44497 A>C, 44559 A>T, 44790 OT, 45022 OT, 45107 OA, 45380 T>C, 45638 T>-, 46188 T>C, 46810 T>C, or 46843 A>C.
4. The method of claim 3, wherein the sequence at position -271 is determined.
5. The method of claim 3, wherein the sequence at position 6648 is determined.
6. The method of claim 3, wherein the sequence at position 18487 is determined.
7. The method of claim 3, wherein the sequence at position 18515 is determined.
8. The method of claim 4, wherein the nucleotide as position -271 is directly determined.
9. The method of claim 4, wherein the sequence at position -271 is determined by determining the sequence of a polymorphism in linkage disequilibrium with position -271.
10. The method of claim 9, wherein the polymorphism in linkage disequilibrium with position -271 is at position -367.
11. The method of claim 4, wherein determining there is a G at position -271 is indicative of higher VEGFR expression than if an A had been determined at position -
271.
12. The method of claim 5, wherein determining there is a T at position 6648 is indicative of lower VEGFR expression than if an C had been determined at position 6648.
13. The method of claim 6, wherein determining there is a T at position 18487 is indicative of lower VEGFR expression than if an A had been determined at position 18487.
14. The method of claim 7, wherein determining there is a C at position 18515 is indicative of lower VEGFR expression than if an T had been determined at position 18515.
15. The method of claim 1, wherein the angiogenesis-dependent condition or disease is cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation.
16. The method of claim 1 , wherein the patient has an angiogenesis-dependent cancer.
17. The method of claim 16, wherein the cancer is a solid tumor, leukemia, tumor metastases, or benign tumor.
18. The method of claim 17, wherein the cancer is a solid tumor.
19. The method of claim 16, wherein the cancer is lung cancer or breast cancer.
20. The method of claim 19, wherein the cancer is lung cancer and the variant is at position -565, -271, -1, 11903, 18487, 23408, 30302, 36229, 45107, -3757, -3651, 6536, 6590, 6114, 6648, 20470, 20498, 22820, 23336, 27534, 29636, or 30375.
21. The method of claim 19, wherein the cancer is breast cancer and the variant is at position -3601, -2886, -2854, -2806, -2766, -2750, -2628, -2455, -906, -645, -607, -565, -425, -367, -319, -271, 4459, 11005, 11222, 11903, 16599, 18487, 18515, 22716, 23408, 26429, 26626, 26856, 26896, 27360, 28915, 29103, 30302, 36229, 42868, or 45380.
22. The method of claim 17, wherein the benign tumor is a hemangioma, acoustic neuroma, neurofibroma, trachoma, or pyogenic granuloma.
23. The method of claim 16, wherein the patient has or may undergo anti- angiogenic therapy.
24. The method of claim 23, wherein the anti-angiogenic therapy is CAI,
CM101/ZDO 101, Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190, AZD2171, CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP, AG-Ol 3958, JSM6427, TGl 00801, ATG3, Sirolimus, OT-551, pazopanib, AG-0736, cilengitide, thalidomide, ABT-869, ZD 4190, IMC-ICl 1, IMC-1121B, CDP-791, AZD 2171, Bay 57-9352, XL647, XL999, CHIR258, CEP7055, AEE788, ZK304709, SU6668, SUl 11248 , GW654652, GW786034, AG13736, CP-547632,OSI-930, RO4383596, or ZM323881.
25. The method of claim 24, wherein the anti-angiogenic therapy is a KDR inhibitor.
26. The method of claim 25, wherein the KDR inhibitor is ABT-869.
27. The method of claim 1, wherein the presence of more than one variant is determined.
28. A method for evaluating prognosis of a patient with an angiogenesis- dependent disease or condition comprising determining the presence of a variant in a VEGFR-2 allele in a biological sample from the patient.
29. The method of claim 28, wherein a variant is determined using sequencing, microsequencing, allele-specific hybridization, or amplification.
30. The method of claim 28, wherein the one or more variants is -3601 G>A, - 3538 OT, -2886 T>C, -2854 A>C, -2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 OA, -2008 A>G, -1973 (TAAA)6-H, - 1942 A>G, -1918 G>A, -1846 OT, -1361 OT, -1067 OA, -906 T>C, -679 OA, - 645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, -271 OA, -1 OT, 1107 T>C, 1367 T>C, 3684 OT, 4068 OC, 4238 A>C, 3684 OT, 4423 (AC)IO-I2, 4442 OT, 4459 A>C, 6536 T>C, 6590 OA, 6614 OT, 6648 OT, 9485 G>A, 11005 OA, 11222 G>A, 11259 G>A, 11903 G>A, 14752 OC, 16583 GAGO-, 16925 T>C, 17070 T>C, 17171 OG, 17186 OA, 17366 A>G, 18465 T>G, 18487 A>T, 18515 T>C, 19948 T>C, 20220 G>T, 20470 T>A, 20498 T>C, 20679 OT, 22716 OC, 22820 OC, 23336 OT, 23408 T>G, 26027 T>C, 26429 A>-, 26626 OA, 26856 OA, 26896 T>C, 27311 A>T, 27360 A>G, 27534 OT, 28914 >C, 29103 A>G, 29636 OT, 29743 G>A, 30302 A>G, 30375 OA, 30564 G>A, 32309 T>C, 33738 T>C, 33828 OA, 36229 OA, 36438 OT, 37978 OT, 38081 T>C, 38131 G>A, 39592 A>G, 39638 T>C, 39730 OT, 39733 OA, 40029 A>C, 40096 OT, 40161 A>G, 42868 OT, 43353 OT, 43393 OA, 44123 A>G, 44189 T>C, 44306 T>G, 44497 A>C, 44559 A>T, 44790 OT, 45022 OT, 45107 OA, 45380 T>C, 45638 T>-, 46188 T>C, 46810 T>C, or 46843 A>C.
31. The method of claim 30, wherein the sequence at position -271 is determined.
32. The method of claim 31, wherein the nucleotide as position -271 is directly determined.
33. The method of claim 31, wherein the sequence at position -271 is determined by determining the sequence of a polymorphism in linkage disequilibrium with position -271.
34. The method of claim 33, wherein the polymorphism in linkage disequilibrium with position -271 is at position -367.
35. The method of claim 28, wherein the angiogenesis-dependent condition or disease is cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation.
36. The method of claim 28, wherein the patient has an angiogenesis- dependent cancer.
37. The method of claim 36, wherein the cancer is a solid tumor, leukemia, tumor metastases, or benign tumor.
38. The method of claim 37, wherein the cancer is a solid tumor.
39. The method of claim 37, wherein the benign tumor is a hemangioma, acoustic neuroma, neurofibroma, trachoma, or pyogenic granuloma.
40. The method of claim 36, wherein the patient has or may undergo anti- angiogenic therapy.
41. The method of claim 41, wherein the anti-angiogenic therapy is CAI,
CM101/ZDO 101, Interleukin-12, IM862, PNU-145156E, Neovastat, SUl 1248, Suramib, bevacizumab, endostatin, radiotherapy, sorafenib, sunitinib, ZD-6474, ZD4190, AZD2171, CEP-7055, ( vatalanib) PTK787, SU5416, Macugen, Lucentis, Tryptophanyl- tRNA synthetase, Retaane, Combretastatin A4 Prodrug (CA4P), AdPEDF, VEGF-TRAP, AG-Ol 3958, JSM6427, TGl 00801, ATG3, Sirolimus, OT-551, pazopanib, AG-0736, cilengitide, thalidomide, ABT-869, ZD 4190, IMC-ICl 1, IMC-1121B, CDP-791, AZD 2171, Bay 57-9352, XL647, XL999, CHIR258, CEP7055, AEE788, ZK304709, SU6668, SUl 11248 , GW654652, GW786034, AG13736, CP-547632,OSI-930, RO4383596, or ZM323881.
42. The method of claim 28, wherein the presence of more than one variant is determined.
43. A method for predicting toxicity or efficacy of an anti-angiogenic therapy comprising determining the presence of a polymorphism in a VEGFR-2 allele in biological sample from a patient who has been or may be treated with an anti-angiogenic therapy.
44. The method of claim 43, wherein the patient is a cancer patient.
45. The method of claim 43, wherein a polymorphism at position -271 is evaluated.
46. The method of claim 43, further comprising optimizing an anti-angiogenic therapy dosage for the patient.
47. The method of claim 46, further comprising administering an anti- angiogenic therapy to the patient.
48. A method for optimizing dosage for an anti-angiogenic therapy comprising: a) obtaining a biological sample from a patient who will be treated with an anti-angiogenic therapy; b) having the presence of at least one variant in a VEGFR-2 allele determined from the biological sample; c) being notified of the presence of the at least one variant; and, d) optimizing dosage of the anti-angiogenic therapy.
49. The method of claim 48, wherein the patient has been diagnosed with cancer; rheumatoid arthritis; psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, Rubeosis; Osier-Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation.
50. The method of claim 49, wherein the polymorphism is at position -271.
51. The method of claim 48, further comprising administering an anti- angiogenic therapy to the patient after optimizing the dosage for the patient.
52. A kit for evaluating vascular endothelial growth factor receptor 2
(VEGFR-2) expression comprising oligonucleotides to evaluate at least two variants in a VEGFR-2 allele in biological sample.
53. The kit of claim 52, further comprising amplification primers of the VEGFR-2 allele, wherein the amplification primers amplify haplotype tag SNPs.
54. The kit of claim 52, wherein the amplification primers amplify a variant selected from the group consisting of -3601 G>A, -3538 OT, -2886 T>C, -2854 A>C, - 2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 G>A, -2008 A>G, -1973 (TAAA)6-H, -1942 A>G, -1918 G>A, -1846 OT, - 1361 G>T, -1067 OA, -906 T>C, -679 G>A, -645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, -271 G>A, -1 G>T, 1107 T>C, 1367 T>C, 3684 OT, 4068 G>C, 4238 A>C, 3684 OT, 4423 (AC)10-I2, 4442 OT, 4459 A>C, 6536 T>C, 6590 G>A, 6614 OT, 6648 OT, 9485 G> A, 11005 G>A, 11222 G>A, 11259 G>A, 11903 OA, 14752 G>C, 16583 GAGO-, 16925 T>C, 17070 T>C, 17171 OG, 17186 G>A, 17366 A>G, 18465 T>G, 18487 A>T, 18515 T>C, 19948 T>C, 20220 G>T, 20470 T>A, 20498 T>C, 20679 OT, 22716 G>C, 22820 G>C, 23336 OT, 23408 T>G, 26027 T>C, 26429 A>-, 26626 G>A, 26856 G>A, 26896 T>C, 27311 A>T, 27360 A>G, 27534 OT, 28914 >C, 29103 A>G, 29636 OT, 29743 G>A, 30302 A>G, 30375 G> A, 30564 G> A, 32309 T>C, 33738 T>C, 33828 G> A, 36229 G>A, 36438 OT, 37978 OT, 38081 T>C, 38131 G> A, 39592 A>G, 39638 T>C, 39730 OT, 39733 OA, 40029 A>C, 40096 OT, 40161 A>G, 42868 OT, 43353 OT, 43393 OA, 44123 A>G, 44189 T>C, 44306 T>G, 44497 A>C, 44559 A>T, 44790 OT, 45022 OT, 45107 OA, 45380 T>C, 45638 T>-, 46188 T>C, 46810 T>C, or 46843 A>C.
55. The kit of claim 53, wherein the amplification primers are comprised in multi-well assay plate.
56. The kit of claim 52, further comprising specific hybridization probes.
57. The kit of claim 56, wherein the specific hybridization probes detect one or more variants in the VEGFR-2 gene selected from the group consisting of -3601 G>A, -3538 OT, -2886 T>C, -2854 A>C, -2806 T>A, -2766 A>T, -2756 OT, -2750 A>G, -2628 T>A, -2502 >T, -2455 G>A, -2406 G>A, -2008 A>G, -1973 (TAAA)6- ii, -1942 A>G, -1918 G>A, -1846 OT, -1361 G>T, -1067 OA, -906 T>C, -679 G>A, -645 G>C, -607 T>C, -565 OT, -425 OG, -417 G>C, -367 T>C, -319 T>A, - 271 G>A, -1 G>T, 1107 T>C, 1367 T>C, 3684 OT, 4068 G>C, 4238 A>C, 3684 OT, 4423 (AC)10-I2, 4442 OT, 4459 A>C, 6536 T>C, 6590 G>A, 6614 OT, 6648 OT, 9485 G>A, 11005 G> A, 11222 G>A, 11259 G>A, 11903 G>A, 14752 OC, 16583 GAGG>-, 16925 T>C, 17070 T>C, 17171 OG, 17186 G>A, 17366 A>G, 18465 T>G, 18487 A>T, 18515 T>C, 19948 T>C, 20220 G>T, 20470 T>A, 20498 T>C, 20679 OT, 22716 G>C, 22820 G>C, 23336 OT, 23408 T>G, 26027 T>C, 26429 A>-, 26626 G> A, 26856 G> A, 26896 T>C, 27311 A>T, 27360 A>G, 27534 OT, 28914 >C, 29103 A>G, 29636 OT, 29743 G>A, 30302 A>G, 30375 G>A, 30564 G>A, 32309 T>C, 33738 T>C, 33828 G>A, 36229 G>A, 36438 OT, 37978 OT, 38081 T>C, 38131 G>A, 39592 A>G, 39638 T>C, 39730 OT, 39733 OA, 40029 A>C, 40096 OT, 40161 A>G, 42868 OT, 43353 OT, 43393 OA, 44123 A>G, 44189 T>C, 44306 T>G, 44497 A>C, 44559 A>T, 44790 OT, 45022 OT, 45107 OA, 45380 T>C, 45638 T>-, 46188 T>C, 46810 T>C, or 46843 A>C.
58. The kit of claim 57, wherein the specific hybridization probes identify the sequence at position -271 in the VEGFR-2 allele.
59. The kit of claim 57, wherein the specific hybridization probes are comprised in an oligonucleotide array or microarray.
PCT/US2008/060381 2007-04-15 2008-04-15 Methods and compositions concerning the vegfr-2 gene (kinase domain receptor, kdr) Ceased WO2008128233A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US91189507P 2007-04-15 2007-04-15
US60/911,895 2007-04-15

Publications (1)

Publication Number Publication Date
WO2008128233A1 true WO2008128233A1 (en) 2008-10-23

Family

ID=39864391

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/060381 Ceased WO2008128233A1 (en) 2007-04-15 2008-04-15 Methods and compositions concerning the vegfr-2 gene (kinase domain receptor, kdr)

Country Status (1)

Country Link
WO (1) WO2008128233A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011008696A3 (en) * 2009-07-13 2011-04-14 Genentech, Inc. Diagnostic methods and compositions for treatment of cancer
WO2013030167A1 (en) * 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Responsiveness to angiogenesis inhibitors
WO2013030168A1 (en) * 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Method for predicting risk of hypertension associated with anti-angiogenesis therapy
WO2013113796A1 (en) * 2012-01-31 2013-08-08 Smithkline Beecham (Cork) Limited Method of treating cancer

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050059067A1 (en) * 2000-11-03 2005-03-17 Smith John Craig Chemical compounds
US20060121452A1 (en) * 2002-05-08 2006-06-08 Ravgen, Inc. Methods for detection of genetic disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050059067A1 (en) * 2000-11-03 2005-03-17 Smith John Craig Chemical compounds
US20060121452A1 (en) * 2002-05-08 2006-06-08 Ravgen, Inc. Methods for detection of genetic disorders

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE SNP [online] 5 November 2003 (2003-11-05), accession no. NCBI Database accession no. (rs9992737) *
DATABASE SNP [online] 8 November 2006 (2006-11-08), accession no. NCBI Database accession no. (rs7667298) *
FORSTI A. ET AL.: "Polymorphisms in the KDR and POSTN genes: association with breast cancer susceptibility and prognosis", BREAST CANCER RESEARCH AND TREATMENT, vol. 101, 29 June 2006 (2006-06-29), pages 83 - 93, XP019464116 *
PARK H.-W. ET AL.: "Association between genetic variations of vascular endothelial growth factor receptor 2 and atopy in Korean population", JOURNAL ALLERGY CLINICAL IMMUNOL., vol. 117, December 2006 (2006-12-01), pages 774 - 779, XP005373628 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011008696A3 (en) * 2009-07-13 2011-04-14 Genentech, Inc. Diagnostic methods and compositions for treatment of cancer
WO2013030167A1 (en) * 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Responsiveness to angiogenesis inhibitors
WO2013030168A1 (en) * 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Method for predicting risk of hypertension associated with anti-angiogenesis therapy
CN104024431A (en) * 2011-08-31 2014-09-03 霍夫曼-拉罗奇有限公司 Response to angiogenesis inhibitors
EP3085793A1 (en) * 2011-08-31 2016-10-26 F. Hoffmann-La Roche AG Method for predicting risk of hypertension associated with anti-angiogenesis therapy
WO2013113796A1 (en) * 2012-01-31 2013-08-08 Smithkline Beecham (Cork) Limited Method of treating cancer
JP2015506955A (en) * 2012-01-31 2015-03-05 スミスクライン ビーチャム (コーク) リミテッド How to treat cancer

Similar Documents

Publication Publication Date Title
US20160348178A1 (en) Disease-associated genetic variations and methods for obtaining and using same
JP7197915B2 (en) Methods and compositions for predicting activity of enzastaurin
Grassmann et al. A candidate gene association study identifies DAPL1 as a female-specific susceptibility locus for age-related macular degeneration (AMD)
KR20100020960A (en) Genetic markers associated with endometriosis and use thereof
US20110178110A1 (en) Genotype and Expression Analysis for Use in Predicting Outcome and Therapy Selection
US20050164196A1 (en) Methods to predict patient responsiveness to tyrosine kinase inhibitors
US20090098056A1 (en) Alpk1 gene variants in diagnosis risk of gout
Mostowska et al. Association between polymorphisms at the GREM1 locus and the risk of nonsyndromic cleft lip with or without cleft palate in the Polish population
US20070275386A1 (en) Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter
KR101793775B1 (en) A marker for predicting the risks of developing lung cancer among never-smoker and a method for predicting the risks of developing lung cancer using the same
WO2008049022A2 (en) Methods for detection of cancer
JP2008524999A (en) Compositions and methods for treating mental disorders
US20080020383A1 (en) Haplotype Markers And Methods Of Using The Same To Determine Response To Treatment
US20130096178A1 (en) Genetic markers for paget&#39;s disease
KR102543907B1 (en) A genetic marker for evaluating risk of periodontitis
WO2010071405A1 (en) Markers for detecting predisposition for risk, incidence and progression of osteoarthritis
US20140045717A1 (en) Single Nucleotide Polymorphism Biomarkers for Diagnosing Autism
WO2013189015A1 (en) Snp markers associated with polycystic ovary syndrome
US8236497B2 (en) Methods of diagnosing cardiovascular disease
US20080194419A1 (en) Genetic Association of Polymorphisms in the Atf6-Alpha Gene with Insulin Resistance Phenotypes
EP4256087A1 (en) Method for predicting patient response to cd40-targeted therapies
WO2010127176A2 (en) Methods and compositions for prognosing detecting age-related macular degeneration
WO2011004345A1 (en) Upstream binding protein 1 polymorphisms and their use for prognosing or diagnosing arterial blood pressure
JP2011239697A (en) Risk marker for development of parkinson&#39;s disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08745891

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08745891

Country of ref document: EP

Kind code of ref document: A1