WO2008125366A2 - Treatment of autoimmune diseases - Google Patents

Treatment of autoimmune diseases Download PDF

Info

Publication number
WO2008125366A2
WO2008125366A2 PCT/EP2008/004992 EP2008004992W WO2008125366A2 WO 2008125366 A2 WO2008125366 A2 WO 2008125366A2 EP 2008004992 W EP2008004992 W EP 2008004992W WO 2008125366 A2 WO2008125366 A2 WO 2008125366A2
Authority
WO
WIPO (PCT)
Prior art keywords
ebv
cells
cell
use according
substance
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2008/004992
Other languages
French (fr)
Other versions
WO2008125366A3 (en
Inventor
Francesca Aloisi
Barbara Serafini
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Istituto Superiore di Sanita ISS
Original Assignee
Istituto Superiore di Sanita ISS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Istituto Superiore di Sanita ISS filed Critical Istituto Superiore di Sanita ISS
Publication of WO2008125366A2 publication Critical patent/WO2008125366A2/en
Publication of WO2008125366A3 publication Critical patent/WO2008125366A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52—Purines, e.g. adenine
    • A61K31/522—Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/21—Interferons [IFN]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/245—Herpetoviridae, e.g. herpes simplex virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16211—Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to treatments for chronic inflammatory diseases characterised by autoimmune features.
  • MS multiple sclerosis
  • CNS central nervous system
  • EBV Epstein-Barr virus
  • a variety of abnormalities in humoral immunity are associated with MS, including: intrathecal synthesis of immunoglobulins (predominantly oligoclonal IgG) 12 ; presence of clonally related B cells 13 14 and unusual B-cell subsets (germinal centre centroblasts and centrocytes) 15 in demyelinated lesions and cerebrospinal fluid (CSF); and, in a subset of early-onset MS patients, formation of intrameningeal lymphoid-like structures resembling B-cell follicles 16 ' 17 .
  • EBV Epstein-Barr virus
  • the present invention provides the use of at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent, in the manufacture of a medicament for the treatment of an autoimmune disease.
  • the use includes only an anti-EBV substance.
  • the use includes both an anti-EBV substance and a B cell cidal agent.
  • Autoimmune diseases may include, inter alia, systemic lupus erythematosus, Hashimoto's thyroiditis, Grave's disease, Sjogren's syndrome, multiple sclerosis, rheumatoid arthritis, myasthenia gravis and inflammatory myopathies (dermatomyositis, inclusion body myositis, and polymyositis).
  • Hashimoto's thyroiditis is a disease that commonly causes the condition known as hypothyroidism.
  • the present invention is also useful in treating said condition.
  • the invention also provides at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent for the treatment of an autoimmune disease.
  • a pharmaceutical composition comprising at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent, for the treatment of an autoimmune disease.
  • the invention also provides a method for treating an autoimmune disease, comprising administering, to a patient in need thereof, a therapeutically effective amount of at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent.
  • EBV establishes a low level, persistent, infected state in B cells. In this state, little or no active virus production is seen, and B cells are actively encouraged to replicate, with concomitant suppression of normal apoptotic regulation. This type of infection is referred to herein as latent infection.
  • Infected plasma cells which arise from infected B cells, are the cell type in which viral reactivation occurs and may optionally be further targeted by the medicaments of the present invention.
  • levels of latent infection may be high, or may alternate on an occasional basis with lytic infection, where whole virus is expressed by infected cells.
  • B cells The latent infection of B cells stimulates a cytotoxic T cell response directed at the infected B cells. It is apparent that brain damage is caused predominantly by the antiviral immune response. In multiple sclerosis, the B cells form ectopic follicles in the central nervous system (CNS), especially in the meninges, and these lymphoid-like structures represent the main intracerebral foci of viral reactivation. Without being bound by theory, it appears that the meningeal localisation of B cells leads to extended cortical lesions by causing the clustering of cytotoxic T cells. The effect may be enhanced by the apparent dysregulation, as described above, of EBV infection in susceptible individuals. Around 90% of the population is EBV -seropositive, but the virus is generally efficiently controlled. Any deviation from this delicate host-virus balance is considered to be 'dysregulation', whether it is caused by EBV, by other viruses or by genetic factors.
  • autoimmune disease is associated with regions of the body not restricted to the CNS
  • a B cell cidal agent in a systemic medicament, and to just use one or more substances (a).
  • a B cell cidal agent for the treatment of systemic lupus erythematosus or rheumatoid arthritis, for example, it is preferred to use one or more anti-EBV substances, and no B cell cidal agents.
  • a B cell cidal agent for instance a monoclonal antibody, such as rituximab, for treating both lupus and rheumatoid arthritis. This has been shown to work well.
  • B cell cidal agents may help reduce the pool of infected B cells in the body and lower the EBV-specific immune response which mediates brain damage.
  • Plasma cell cidal agents may also be employed in addition to or separately from B cell cidal agents, although it is generally preferred to target B cells, as these are the progenitors of the plasma cells.
  • Cidal agents as defined herein may be thought of as being capable of reducing or leading to a reduction in the number of B-cells, including those infected with EBV, or rendering said cells inactive.
  • Anti-EBV substances include drugs, antibodies and siRNA, for example.
  • Suitable anti-EBV drugs include nucleotide and nucleoside analogues such as, inter alia, acyclovir, valacyclovir, and ganciclovir, and Type-1 interferons, such as IFN- ⁇ and IFN- ⁇ .
  • nucleotide and nucleoside analogues such as, inter alia, acyclovir, valacyclovir, and ganciclovir
  • Type-1 interferons such as IFN- ⁇ and IFN- ⁇ .
  • Other anti- EBV substances will be apparent to the skilled person.
  • Antibodies against EBV may be against any suitable target. Clinical trials have been performed on vaccines comprising the gp350/220 surface glycoprotein, as well as the HLA B8 restricted epitope from EBNA-3A. When used in treatment, as opposed to prophylaxis, of an autoimmune disease, then antibodies specific for latent markers may be employed, these markers including Epstein Barr Nuclear Antigen 2 and latent membrane protein 1 (LMPl). Where a vaccine against EBV is to be administered to prevent EBV infection and subsequent autoimmune disease, then it is generally preferable to target antigens associated with active infection, such as BFRFl and gp220/350.
  • active infection such as BFRFl and gp220/350.
  • siRNA short interfering RNA
  • EBNAl and EBNA2 genes may be employed that targets any part of the EBV genome necessary for EBV replication, such as the EBNAl and EBNA2 genes.
  • Particularly preferred targets are EBNAl sequences such as 5'-ggaggttccaacccgaaat-3' (SEQ ID NO: 23) and 5'- ggactaccgacgaaggaac-3' (SEQ ID NO: 24), as disclosed in Virology 2006; 346:385, and those derived from LMPl, such as 5'-ggaatttgcacggacaggc-3' (SEQ ID NO: 25), as disclosed in Cancer Letters 2006; 232:189.
  • Other suitable targets will be readily apparent to those skilled in the art.
  • SEQ ID NOs: 26-28 (the RNAi sequences directed at SEQ ID NOs: 23-25 respectively), or variants or fragments capable of hybridising to SEQ ID NOs: 23-25 under highly stringent conditions such as 6 x SSC, are useful for siRNA.
  • the anti-EBV substances may be administered systemically, or directly to the CNS, either by injection into the ventricles or intrathecally.
  • Administration direct to the CNS is referred to herein as intrathecal administration, although intracerebroventricular administration is also contemplated by the present invention.
  • Administration to the CNS is particularly preferred for treatment of MS.
  • administration may be to the area affected, for instance the thyroid or neck, or the affected joint. Delivery may be intravenous or by transdermal, transmucosal by oral means, although suitable encapsulation or formulation may be required in respect of oral delivery.
  • B cell cidal agent in the medicament.
  • Any physiologically acceptable B cell cidal agent may be used, as appropriate.
  • B cell cidal agents are apparent to those skilled in the art, and include monoclonal antibodies targeting B-cell surface proteins, such as the chimaeric monoclonal antibody known as Rituximab developed by IDEC Pharmaceuticals, to activate antibody-dependent cellular cytotoxicity and/or complement-dependent cytotoxicity and or/apoptosis.
  • both the anti-EBV substance or the B cell cidal agent are administered, preferably contemporaneously. However, it is also preferred that only one of these two is administered.
  • Either the anti-EBV substance or the B cell cidal agent alone may be effective in controlling, suppressing, and even eliminating B cell infections, but it is particularly preferable to employ at least one of each where possible, especially intrathecally.
  • a particularly preferred medicament employs both Rituximab and valacyclovir. Another preferred combination is Rituximab and acyclovir. Where the medicament comprises more than one active ingredient, these may be administered together or separately. Where a disease has both CNS and systemic components, then, where a B cell cidal agent is employed, this is advantageously restricted to intrathecal administration, while an anti-EBV substance may be administered both systemically and intrathecally, if desired.
  • Medicaments of the present invention may also comprise, additionally to, or alternatively to, one of the active ingredients, a T cell inhibitory, blocking, suppressing, or cidal substance when administered intrathecally.
  • a T cell inhibitory, blocking, suppressing, or cidal substance when administered intrathecally.
  • Such a substance is preferably targeted at CD8+ T cells.
  • the substance is preferably a specific antibody.
  • Type II topoisomerase inhibitors are effective as CD8+ T cell cidal agents, and include etoposide, which induces apoptosis of EBV-infected lymphocytes.
  • the medicament of the present invention be directed to multiple sclerosis, and it is preferred that any such medicament be suitable for intrathecal administration.
  • the components of the disease in human brain are; the latent EBV infection, the infected B cells, the periodic reactivation of EBV, and the bystander tissue damage caused by cytotoxic T cells in response to the latently and lytically infected B cells. Any one of these aspects is targetable by the medicaments of the present invention.
  • Acyclovir and valacyclovir are particularly preferred, especially when it is desired to only target the lytic infection and not the latent infection.
  • the present invention further extends to a vaccine for the prevention of multiple sclerosis, or any other autoimmune disease, comprising at least one epitope characteristic of EBV.
  • Suitable vaccines are well known to those skilled in the art, and it is preferred to administer such a vaccine in early childhood (or during the first year after birth), before the individual becomes EBV-seropositive.
  • EBERs EBV-encoded small nuclear mRNAs
  • EBN A2 Epstein-Barr nuclear antigen 2 (EBNA2) and latent membrane protein 1 (LMPl) 18 .
  • EBNA2 Epstein-Barr nuclear antigen 2
  • LMPl latent membrane protein 1
  • EBN A2 is the first viral protein to be expressed in EBV-infected B-cells in vitro and acts as a transactivator of viral and cellular genes inducing B-cell proliferation (growth program).
  • LMPl is an integral membrane protein that promotes B-cell proliferation and survival and is expressed during the growth program and the more restricted viral transcription program, named default program 18 .
  • EBV latent proteins provides a mechanism for B-cell expansion and activation in the MS brain and is consistent with the presence of B-cells expressing the proliferation marker Ki67 and the anti-apoptotic molecule be 12 in intrameningeal follicles (Fig.lb,f) and acute lesions (Fig.3c).
  • LMPl may also induce expression of the enzyme activation-induced cytidine deaminase 19 (Fig.ld), which is normally restricted to germinal centre B-cells.
  • BFRFl + cells were present inside and around all intrameningeal follicles and acute lesions analysed in EBV-high MS cases (Fig.2g-m). A few BFRFl + cells were also detected in the small ectopic follicles identified in one EBV-low MS case (not shown).
  • Double immunostainings showed that BFRFl immunoreactivity was present in a substantial proportion of B-cells and plasma cells (30-55%) but was much stronger in plasma cells than in B-cells (Fig.2 h-m), in agreement with findings in healthy carriers where terminal differentiation into plasma cells initiates the viral replicative cycle 21 .
  • Rare gp350/220 + cells were found only in the parenchymal lesions of one EBV- high MS case (Fig.2o), indicating occasional production of infectious virus, probably due to abortive replication or efficient immune surveillance.
  • cytotoxic CD8 + T-cells have a key role in controlling latent EBV infection and in preventing viral replication 22 .
  • the presence of EBV-infected cells in the MS brain would associate with CD8 + T-cell infiltration. Indeed, intracerebral accumulation of CD8 + T-cells was much more prominent in EBV-high than in EBV-low MS cases (Fig. 7). Participation of CD8 + T-cells in the clearance of EBV-infected cells was supported by the findings that these cells did infiltrate all sites where infected B -cells/plasma cells were located and that the frequency of CDS + T-cells in the meninges and white matter strikingly correlated with that of EBER + cells (Fig.3a,b,k).
  • CD8 + T-cells expressing the proliferation marker Ki-67 were detected in some ectopic follicles and all acute lesions, consistent with recent antigen stimulation likely related to viral reactivation (Fig.3c).
  • CD8 + T-cells established close anatomical contacts with B-cells, plasma cells and BFRFl + cells, and about 3% of them expressed perforin, a key component of lytic granules, indicating recognition and attack of EBV-infected B-cells/plasma cells (Fig.3d-g).
  • Fig.3d-g Even in the EBV-low MS cases, some of the scattered CD8 + T-cells were found in direct contact with B-cells (Fig.3h).
  • Prominent macrophage activation was also associated with intracerebral EBER + and CD8 + T-cell accumulation (not shown).
  • the presence of a large number of EBV-infected cells and cytotoxic T-cells in the brain of the MS cases with ectopic follicles is compatible with the severe clinical and neuropathological features of this patient subset 17 .
  • BDCA2 blood dendritic cell antigen 2
  • plasmacytoid dendritic cells which are the main source of type-I interferon and have a key role in antiviral immunity, were detected in many MS immune infiltrates, predominantly in meningeal follicles and acute lesions of EBV-high MS cases (Fig. 3 i,j).
  • EBV DNA was generally undetectable, being found at low copy number in the CSF of only 2 of 16 MS cases (2 primary progressive MS with 1310 and 4900 copies/ml, respectively). None of the other viruses investigated [herpes simplex viruses type 1 and 2 (HSV- 1/2), varicella- zoster virus (VZV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6) and JC virus (JCV)] were detected in the 16 CSF samples analysed.
  • Oligoclonal bands which are generally CSF-restricted and relatively constant throughout the disease 12 , were found in the CSF of 15 of 16 MS cases. Interestingly, the number of CSF OCBs was significantly higher in EBV-high MS cases (Fig.4a), further indicating a relationship between EBV infection and intracerebral B-cell activation. Consistent with previous findings 8 - 23 , EBV-specific OCBs were detected in 7 of 16 MS cases (44%), but showed no preferential distribution in the EBV-high and EBV-low MS groups (Fig.4b).
  • Perturbed EBV infection also provides an explanation for the dominance and persistence of CD8 + T-cell clones in the MS brain 25 ' 26 , and implies that bystander tissue damage mediated by cytotoxic T-cells is a major determinant of MS lesions, similar to what happens in other EBV-associated diseases 22 .
  • Stimulation of autoreactive B-cell clones by EBV is not excluded and may explain the variable pattern of antibody reactivities toward CNS-restricted and ubiquitous self-antigens observed in MS patients 27 . This also extends to other chronic diseases with autoimmune features, such as systemic lupus erythematosus and rheumatoid arthritis, in which an association with EBV is indicated by epidemiological, serological and DNA studies 28 .
  • MS cases analysed had not received immunosuppressive therapies, except for MSl 14 (treated with ACTH for 12 months), MS80 (treated with ACTH for 11 years), MS5 (treated with mitoxantrone for 3 years), and MS 153 (treated with ACTH for 30 months).
  • Control tissue specimens, lymphoma and normal human lymph node were provided by the Institute of Pathological Anatomy, A. Gemelli Hospital, and the Pathology Department of S. Andrea Hospital, Rome.
  • tissue blocks (2 x 2 cm) from the cerebral hemispheres were analysed and classified by histopathological methods, i.e. hematoxylin/eosin staining, and the combined Luxol fast blue-periodic acid-Schiff reaction, or by immunohistochemistry using anti-myelin oligodendrocyte glycoprotein antibody, to identify areas of inflammation and demyelination 15 ' 16 .
  • Immunohistochemical stainings for T and B lymphocytes, macrophages, and MHC class II molecule expression were performed to evaluate the degree of lesion activity (pre-active, acute, chronic active, and chronic inactive), as previously described 15 ' 16 .
  • EBER Epstein-Barr virus
  • PNA ISH detection kit both from Dako
  • the kit also included negative and positive control fluorescein- conjugated PNA probes.
  • Treatment with proteinase-k was performed on frozen, PFA fixed-frozen and paraffin-embedded sections at the following dilutions in TBS: 1:500 for 10 min, 1 :100 and 1:10 for 20 min, respectively.
  • An EBV-associated B-cell lymphoma paraffin-embedded sections was used as positive control tissue for EBER signals.
  • EBER + , CD20 + and CD8 + cells was counted in 6 adjacent sections per tissue block (two 2 x 2 cm-sections were analysed for each immunohistochemical staining) at 2Ox magnification by one investigator blinded to the case number (B. S.). One-two blocks per MS case were analysed. Values are expressed as the mean number of positive cells per mm 2 in the white matter and per mm in the meninges.
  • the pattern of OCBs in autopsy CSF was investigated with agarose isoelectric focusing (IEF) (pH 3.0-10.0, Cambrex, Rockland, ME, USA) and affinity immunoblotting using a standard protocol 29 .
  • IgG and albumin were determined with turbidimetry (Cobas Integra, Roche, Milan, Italy).
  • EBV-specif ⁇ c OCBs were determined using a previously published IEF/affinity-mediated immunoblotting protocol 29 , using nitrocellulose membranes that had been previously coated with highly pure EBV Antigen, strain P3HR1, and a mouse monoclonal anti-EBV EA-D IgG as a positive control (both from Fitzgerald Industries International, Concorde, MA, USA).
  • CSF samples were tested by real-time PCR for DNA of the following viruses: EBV, HSV-I, HSV-2, VZV, CMV, HHV6-A, HHV6-B, and JCV.
  • PCR protocols are listed in Table 3. In all virus assays, an internal control was used to control for PCR inhibitors in the samples.
  • the Mann Whitney fZ-test was used to compare the median values of EBER + , CD20 + and CD8 + cells counted in adjacent MS brain sections and of CSF OCBs between EBV-low and EBV- high groups of MS cases. Spearman's rank correlation was calculated to analyse the relationship between number Of EBER + cells and number of CD20 + or CD8 + T cells in MS brain sections. A p value lower than 0.05 was considered as significant.
  • RR relapsing remitting
  • PR progressive relapsing
  • SP secondary progressive
  • PP primary progressive.
  • EBER + cells were detected in pre-active, acute and chronic active, but not inactive, lesions.
  • CD3 T lymphocytes Mouse monoclonal/PS 1 Pre-diluted Irnmunotech, Marseille, F CD20 B lymphocytes Mouse monoclonal/L26 Pre-diluted Immunotech
  • CDl 38 Plasma cells 1:100 Serotec, Oxford, UK monoclonal/B-B4
  • Plasmacytoid dendritic cells Mouse monoclonal/ AC 144 1:10 Miltenyi Biotec, CA, USA
  • CNS tissues from 9 patients with SPMS, 2 patients with PPMS, 2 patients with PRMS and 2 control subjects were fixed in 4% paraformaldehyde (PFA) for several days, cryoprotected in sucrose, frozen by immersion in isopentane precooled on a bed of dry ice (-55°C), and stored a - 80°C until use.
  • Brain tissue blocks from 1 patient with PPMS, 2 patients with RRMS, 6 patients with OIND and one control with Alzheimer's disease were fixed in buffered formalin and embedded in paraffin wax. Brain tissue blocks from 4 patients with SPMS were snap frozen. For MS79 and MS 153 cases both PFA-fixed and snap frozen tissue blocks were analysed.
  • Antigen retrieval procedures utilised microwave of PFA-fixed and paraffin sections in citrate buffer (10 mM, pH 6.0).
  • CD8 clone 4Bl 1
  • EDTA solution 1 mM, pH 9.0
  • Sections immunostained for MOG were treated with cold methanol without antigen retrieval procedure.
  • biotinylated secondary Abs rabbit anti-mouse or goat anti-rabbit IgG (Jackson Laboratories) were used.
  • rhodamine-conjugated goat anti-rabbit IgG and fluorescein- conjugated goat anti-mouse IgG were used as secondary Abs.
  • JC virus VPl VPl-F GAG TGT TGG GAT CCT GTGTTTTC (4) 77 100 VPl-R GAG AAG TGG GAT GAA GAC CTG TTT (5) VPl probe 6-FAM-TCA TCA CTG GCA AAC ATT TCTTCA TGG C-TAMRA (6)
  • Herpes simplex US4-US5 HSV-2 Ql F AGA TAT CCT CTTTAT CAT CAG CAC CA (10) 73 1000 virus-2 (HSV-2) HSV-2 Q2 R TTGTGC TGG CAA GGC GA (11) HSV-2 probe 6-FAM-CAG ACAAAC GAA CGC CGC CG-TAMRA (12)
  • HHV-6 probe A 6-FAM-CAG CCA TAT TTC CGGTAT ATGACC TTC GTAAGC T-TAMRA (18)
  • a representative ectopic follicle located in the depth of a cerebral sulcus displays the morphological features of a germinal centre as it is composed of CD20 + B- cells clustered around a network of stromal/follicular dendritic cells expressing the B- cell attracting chemokine CXCLl 3 (a: double immunofluorescence staining for CD20 in red and CXCL 13 in green).
  • the same ectopic follicle also contains numerous proliferating B-cells (b: double labelling for CD20 in green and the proliferation marker Ki67 in red; the inset in b shows 3 double labelled CD20 + /Ki67 + cells at higher magnification) and peripherally located Ig + plasma cells (c).
  • a distinct intrameningeal ectopic follicle contains: (d) numerous cells expressing activation-induced cytidine deaminase, the key enzyme responsible for somatic hypermutation and Ig class-switch recombination in germinal centre B-cells; (e) fewer cells expressing cleaved caspase-3, which is expressed in germinal centre centroblasts undergoing apoptotic cell death; and (f) numerous cells expressing the anti-apoptotic molecule bcl-2, which is expressed in positively selected germinal centre B-cells.
  • In situ hybridisation for EBER shows enrichment of EBER + cells in 2 follicles from 2 different MS cases
  • In situ hybridisation for EBER blue -black nuclei
  • In situ hybridisation for EBER blue -black nuclei
  • immunostaining for the pan B-cell marker CD20 red membrane staining
  • the inset shows a cell double labelled for the plasma cell marker CD 138 (red staining) and EBER (blue-black nucleus).
  • Enrichment of EBER + B-cells and plasma cells in MS follicles suggests that these structures are generated by clonal expansion of EBV-infected B-cells.
  • EBER signals in the MS brain are confined to the cell nuclei, similar to what is observed in a control, EBV-associated B-cell lymphoma (j).
  • EBV latent and lytic proteins in the MS brain, (a-d) Expression of the EBV latent proteins EBNA2 (a, b) and LMPl (c, d) in the brain of EBV-high MS cases.
  • An acute (a) and a chronic (b) white matter lesion containing several EBNA2 + cells in a perivascular position are shown.
  • the inset in b shows that EBNA2 staining is confined to the cell nucleus.
  • a sparse meningeal infiltrate (c) and an intrameningeal ectopic B-cell follicle (d) containing LMPl + cells (membrane staining) are shown; the inset in d shows the same follicle stained for EBER.
  • e, f Perivascular EBNA2 + and LMPl + cells in chronic active lesions from an EBV-low MS case,
  • g-m Expression of the EBV early lytic protein BFRFl in EBV-high MS cases. Numerous BFRFl + cells are present in an intrameningeal ectopic follicle (g).
  • Double immunofluorescence staining for CD20 (green) and BFRFl (red) shows that BFRFl is expressed in a substantial proportion of CD20 + B-cells but its intensity is much stronger in CD20-negative cells (arrows).
  • the insets in g and h highlight the typical perinuclear localisation of BFRFl immunoreactivity.
  • G" m Double immunofluorescence staining for Ig (green) and BFRFl (red).
  • the lytic cycle- associated protein is strongly expressed in a proportion of Ig + plasma cells in the same ectopic follicle shown in i (j; the asterisks in i and j mark the Ig-negative B-cells with lower BFRFl expression in the centre of the follicle).
  • BFRFl is mainly expressed in Ig + plasma cells located at the periphery ofthe large perivascular inflammatory cell infiltrate (k).
  • Two double labelled Ig + /BFRF1 + plasma cells in the same infiltrate are shown at higher magnification (1, m).
  • the same perivascular cuff contains numerous proliferating cells some of which were identified as B-cells (double positive CD20 + /Ki67 + cells in c, arrows) and some as CD8 + T-cells (double positive CD8 + /Ki67 + cells in the inset in c).
  • Double immunostainings for CD8 (red) and CD20, CD8 (red) and Ig (green), and CD8 (green) and BFRFl (red) show that CD8 + T cells with an activated, lymphoblastoid morphology cluster around and extend cytoplasmic processes that contact CD20 + B- cells (d), Ig + plasma cells (e) and BFRFl + cells (f and insets), (g)
  • the presence of perform granules (green) in a CD8 + T-cell (red) identified in the same BFRFl + perivascular cuff shown in panels b and c and in Fig.2k confirms the cytotoxic activity of CD8 + T-cells.
  • OCBs oligoclonal IgG bands
  • An additional control for binding specificity included CSF from the MS 102 case that was blotted onto casein-coated nitrocellulose paper (absence of reactivity) (lane 5). Faint (lane 1) and and both faint and strong (lane 2) EBV-specific OCBs are present in MS 154 and MS 102 cases, respectively (arrows indicate OCBs).
  • MS 102 was also positive for EBV DNA and had the highest frequency of EBER + and CD8 + cells in both white matter lesions and meninges among the EBV-low MS cases.
  • MS cases with and without ectopic follicles were a posteriori classified as EBV-high and EBV-low, respectively.
  • the graphs show significant differnces in the number of CD20+, EBER+ and CD 8+ cells in the white matter (A) and meninges (B) between the two groups.
  • Dot points represent values for each MS case. Each value represents the mean of cell counts performed in adjacent brain sections (2 sections for each marker) for each brain tissue block; 1-2 blocks for each MS case were analysed.
  • EBV Epstein-Barr virus
  • Ectopic B cell follicles stained with the pan B-cell marker CD20 in the thyroid of patients affected by Hashimoto's thyroiditis A, B. Numerous cells expressing the EBV latency protein LMPl were observed inside ectopic B follicles (C and inset; the same follicle shown in C is circled in red in panel B), whereas immunopositivity for EBNA2 was restricted to a small number of cells distributed at the edge of the follicle and in areas of hyperplasia (D, E). Numerous cells expressing the replication factor BALF2 (F) and the early lytic cycle-associated proteins BMRFl and BFRFl (G, H) were found within and around the B cell follicles. Conversely, cells expressing the most abundant protein of the viral envelope, gp350/220, and the viral capsid antigen pl60 were observed only occasionally (I, J, respectively).
  • Ectopic B cell follicles stained with the pan B-cell marker CD20 in the thymus of patients affected by myasthenia gravis (A-C).
  • In situ hybridization for EBER reveals the presence of numerous EBV-infected cells inside ectopic follicles (D) and as well as in sparse B-cell inflitrates (E).
  • Rarely, isolated EBNA2+ cells were observed at the edge of ectopic follicles (F); the latter comprised numerous cells positive for the EBV latency protein LMPl (G and inset. Numerous cells expressing the early lytic cycle-associated proteins BMRFl and BFRFl were found within and outside the B cell follicles (H-J).
  • EBV-encoded latent membrane protein 1 cooperates with BAFF/BLyS and APRIL to induce T cell-independent Ig heavy chain class switching. J. Immunol. 171, 5215-5224 (2003).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Transplantation (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Aberrant infection of B cells by EBV leads to autoimmune disease, especially multiple sclerosis, myasthenia gravis and Hashimoto's thyroiditis, and can be treated or immunised against.

Description

NOVEL DISEASE TREATMENTS
The present invention relates to treatments for chronic inflammatory diseases characterised by autoimmune features.
The cause(s) of multiple sclerosis (MS), the most common chronic inflammatory disease of the central nervous system (CNS), remain unknown but likely involve genetic and environmental factors1'2. Among the latter, Epstein-Barr virus (EBV) is the virus most consistently associated with MS, as indicated by a higher prevalence and titre of anti-EBV antibodies3"7 and enhanced EBV- specific cellular immune responses8'9 in MS patients compared to controls, and by molecular mimicry between certain EBV and CNS components10. However, the mechanisms linking EBV infection, which is latent and harmless in most individuals, to MS-associated immune dysfunction remain unknown. EBV latently infects B cells, promotes their proliferation and activation, and, in doing so, provides constant antigenic challenge to the immune system11. A variety of abnormalities in humoral immunity are associated with MS, including: intrathecal synthesis of immunoglobulins (predominantly oligoclonal IgG)12; presence of clonally related B cells13 14 and unusual B-cell subsets (germinal centre centroblasts and centrocytes)15 in demyelinated lesions and cerebrospinal fluid (CSF); and, in a subset of early-onset MS patients, formation of intrameningeal lymphoid-like structures resembling B-cell follicles16'17.
Surprisingly, it has now been found that aberrant infection by Epstein-Barr virus (EBV) of B cells present in the brain is a primary cause of autoimmune disease, particularly multiple sclerosis, in humans.
Thus, in a first aspect, the present invention provides the use of at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent, in the manufacture of a medicament for the treatment of an autoimmune disease.
Preferably, the use includes only an anti-EBV substance. Alternatively, it is also preferred that the use includes only a B cell cidal agent. However, most preferably the use includes both an anti-EBV substance and a B cell cidal agent.
Autoimmune diseases may include, inter alia, systemic lupus erythematosus, Hashimoto's thyroiditis, Grave's disease, Sjogren's syndrome, multiple sclerosis, rheumatoid arthritis, myasthenia gravis and inflammatory myopathies (dermatomyositis, inclusion body myositis, and polymyositis). In all, at a recent count, there were more than eighty types of autoimmune disease. Hashimoto's thyroiditis is a disease that commonly causes the condition known as hypothyroidism. Thus, the present invention is also useful in treating said condition.
In a further aspect, the invention also provides at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent for the treatment of an autoimmune disease. Also provided is a pharmaceutical composition comprising at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent, for the treatment of an autoimmune disease. The invention also provides a method for treating an autoimmune disease, comprising administering, to a patient in need thereof, a therapeutically effective amount of at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent.
It is apparent that EBV establishes a low level, persistent, infected state in B cells. In this state, little or no active virus production is seen, and B cells are actively encouraged to replicate, with concomitant suppression of normal apoptotic regulation. This type of infection is referred to herein as latent infection. Infected plasma cells, which arise from infected B cells, are the cell type in which viral reactivation occurs and may optionally be further targeted by the medicaments of the present invention.
In susceptible individuals, levels of latent infection may be high, or may alternate on an occasional basis with lytic infection, where whole virus is expressed by infected cells.
The latent infection of B cells stimulates a cytotoxic T cell response directed at the infected B cells. It is apparent that brain damage is caused predominantly by the antiviral immune response. In multiple sclerosis, the B cells form ectopic follicles in the central nervous system (CNS), especially in the meninges, and these lymphoid-like structures represent the main intracerebral foci of viral reactivation. Without being bound by theory, it appears that the meningeal localisation of B cells leads to extended cortical lesions by causing the clustering of cytotoxic T cells. The effect may be enhanced by the apparent dysregulation, as described above, of EBV infection in susceptible individuals. Around 90% of the population is EBV -seropositive, but the virus is generally efficiently controlled. Any deviation from this delicate host-virus balance is considered to be 'dysregulation', whether it is caused by EBV, by other viruses or by genetic factors.
Where the autoimmune disease is associated with regions of the body not restricted to the CNS, then it is preferred, in one embodiment, not to employ a B cell cidal agent in a systemic medicament, and to just use one or more substances (a). Thus, for the treatment of systemic lupus erythematosus or rheumatoid arthritis, for example, it is preferred to use one or more anti-EBV substances, and no B cell cidal agents. However, in another embodiment, it is preferred to use a B cell cidal agent, for instance a monoclonal antibody, such as rituximab, for treating both lupus and rheumatoid arthritis. This has been shown to work well. Indeed, in 2008, the results of a phase II trial of rituximab in multiple sclerosis were published (Hauser SL, Waubant E, Arnold DL, Vollmer T, Antel J, Fox RJ, Bar-Or A, Panzara M, Sarkar N, Agarwal S, Langer-Gould A, Smith CH; HERMES Trial Group. B-cell depletion with rituximab in relapsing-remitting multiple sclerosis N Engl J Med. 2008 Feb 14;358(7):676-88)), again showing a good response to the drug, with a rapid decrease in disease activity and a long-lasting effect.
Without being bound by theory, it is believed that B cell cidal agents may help reduce the pool of infected B cells in the body and lower the EBV-specific immune response which mediates brain damage. Plasma cell cidal agents may also be employed in addition to or separately from B cell cidal agents, although it is generally preferred to target B cells, as these are the progenitors of the plasma cells. Cidal agents as defined herein may be thought of as being capable of reducing or leading to a reduction in the number of B-cells, including those infected with EBV, or rendering said cells inactive.
Anti-EBV substances include drugs, antibodies and siRNA, for example. Suitable anti-EBV drugs include nucleotide and nucleoside analogues such as, inter alia, acyclovir, valacyclovir, and ganciclovir, and Type-1 interferons, such as IFN-α and IFN-β. Of these, it is generally preferred to use at least valacyclovir, and it may be advantageous to use valacyclovir in combination with at least one another anti-EBV substance, preferably at least one of those mentioned above. Other anti- EBV substances will be apparent to the skilled person.
Antibodies against EBV may be against any suitable target. Clinical trials have been performed on vaccines comprising the gp350/220 surface glycoprotein, as well as the HLA B8 restricted epitope from EBNA-3A. When used in treatment, as opposed to prophylaxis, of an autoimmune disease, then antibodies specific for latent markers may be employed, these markers including Epstein Barr Nuclear Antigen 2 and latent membrane protein 1 (LMPl). Where a vaccine against EBV is to be administered to prevent EBV infection and subsequent autoimmune disease, then it is generally preferable to target antigens associated with active infection, such as BFRFl and gp220/350.
siRNA (short interfering RNA) may be employed that targets any part of the EBV genome necessary for EBV replication, such as the EBNAl and EBNA2 genes. Particularly preferred targets are EBNAl sequences such as 5'-ggaggttccaacccgaaat-3' (SEQ ID NO: 23) and 5'- ggactaccgacgaaggaac-3' (SEQ ID NO: 24), as disclosed in Virology 2006; 346:385, and those derived from LMPl, such as 5'-ggaatttgcacggacaggc-3' (SEQ ID NO: 25), as disclosed in Cancer Letters 2006; 232:189. Other suitable targets will be readily apparent to those skilled in the art. Based on these target, SEQ ID NOs: 26-28 (the RNAi sequences directed at SEQ ID NOs: 23-25 respectively), or variants or fragments capable of hybridising to SEQ ID NOs: 23-25 under highly stringent conditions such as 6 x SSC, are useful for siRNA.
The anti-EBV substances may be administered systemically, or directly to the CNS, either by injection into the ventricles or intrathecally. Administration direct to the CNS is referred to herein as intrathecal administration, although intracerebroventricular administration is also contemplated by the present invention. Administration to the CNS is particularly preferred for treatment of MS. For treatment of other conditions, such as thyroiditis or arthritis, then administration may be to the area affected, for instance the thyroid or neck, or the affected joint. Delivery may be intravenous or by transdermal, transmucosal by oral means, although suitable encapsulation or formulation may be required in respect of oral delivery.
In conditions where intrathecal administration is indicated, such as multiple sclerosis, for example, then it is desirable to employ at least one B cell cidal agent in the medicament. Any physiologically acceptable B cell cidal agent may be used, as appropriate. B cell cidal agents are apparent to those skilled in the art, and include monoclonal antibodies targeting B-cell surface proteins, such as the chimaeric monoclonal antibody known as Rituximab developed by IDEC Pharmaceuticals, to activate antibody-dependent cellular cytotoxicity and/or complement-dependent cytotoxicity and or/apoptosis. As Rituximab does not target plasma cells, other plasma cell cidal agents, such as a depleting plasma cell-specific antibody or the anti-CD138 plasma-cell-specific immunotoxin (IT, B-B4-SO6), may also be used to specifically eliminate EBV-infected plasma cells.
It is preferred that both the anti-EBV substance or the B cell cidal agent are administered, preferably contemporaneously. However, it is also preferred that only one of these two is administered.
Either the anti-EBV substance or the B cell cidal agent alone may be effective in controlling, suppressing, and even eliminating B cell infections, but it is particularly preferable to employ at least one of each where possible, especially intrathecally. A particularly preferred medicament employs both Rituximab and valacyclovir. Another preferred combination is Rituximab and acyclovir. Where the medicament comprises more than one active ingredient, these may be administered together or separately. Where a disease has both CNS and systemic components, then, where a B cell cidal agent is employed, this is advantageously restricted to intrathecal administration, while an anti-EBV substance may be administered both systemically and intrathecally, if desired.
Medicaments of the present invention may also comprise, additionally to, or alternatively to, one of the active ingredients, a T cell inhibitory, blocking, suppressing, or cidal substance when administered intrathecally. Such a substance is preferably targeted at CD8+ T cells. The substance is preferably a specific antibody. Type II topoisomerase inhibitors are effective as CD8+ T cell cidal agents, and include etoposide, which induces apoptosis of EBV-infected lymphocytes.
It is particularly preferred that the medicament of the present invention be directed to multiple sclerosis, and it is preferred that any such medicament be suitable for intrathecal administration.
The components of the disease in human brain are; the latent EBV infection, the infected B cells, the periodic reactivation of EBV, and the bystander tissue damage caused by cytotoxic T cells in response to the latently and lytically infected B cells. Any one of these aspects is targetable by the medicaments of the present invention. Acyclovir and valacyclovir are particularly preferred, especially when it is desired to only target the lytic infection and not the latent infection.
As mentioned above, the present invention further extends to a vaccine for the prevention of multiple sclerosis, or any other autoimmune disease, comprising at least one epitope characteristic of EBV. Suitable vaccines are well known to those skilled in the art, and it is preferred to administer such a vaccine in early childhood (or during the first year after birth), before the individual becomes EBV-seropositive.
The present invention will now be further illustrated with regard to the accompanying, non- limiting Examples section. All references cited herein are hereby incorporated by reference, unless otherwise apparent.
EXAMPLE 1
Using in situ hybridisation, we examined human post-mortem brain tissue for the presence of EBV-encoded small nuclear mRNAs (EBERs) that are expressed during the latent phase of EBV infection. Nuclear EBER signals were detected in the meninges and immunologically active white matter lesions, mostly in perivascular positions, in 19 of 20 MS cases analysed, but not in controls and patients with other neuroinflammatory diseases (Table 1). The highest frequency of EBER+ cells was observed in a subset of 8 MS patients (hereafter termed EBV-high) who died during secondary progressive disease. These cases had been previously extensively characterised for the presence of abundant intralesional and intrameningeal mononuclear cell infiltrates and ectopic B- cell follicles displaying germinal centre-like features16'17 (Fig.la-f). In this subset, all ectopic follicles (n=15) and the acute (n=4) and chronic active (n=16) white matter lesions analysed were enriched in EBER+ cells (Fig.lg-1).
Among the MS cases with less CNS inflammation and a low frequency of EB V- infected cells (EBV-low cases) (Fig.lm-o and Fig. 7), only one had two small EBER+ ectopic follicles in the meninges despite negligible parenchymal inflammation. Occasional perivascular EBER+ cells were also found in areas of normal-appearing white matter that contained clusters of activated, MHC class H+ microglia (pre-active lesions) (Fig.lp-r). No EBER signals were detected in inactive lesions, indicating a relationship between inflammatory activity and viral gene expression. By combining in situ hybridisation for EBER with immunohistochemistry for the pan B-cell marker CD20, 70-90% OfEBER+ cells were identified as B-cells, whereas 40-90% of B-cells were EBER+, depending on the MS case analysed (Fig.li,k). The highest percentage of infected B-cells (about 90%) was detected in the meninges and ectopic follicles of EBV-high MS cases. A substantial proportion of CD138+ plasma cells (50-80%) was also EBER+ (Fig.li, inset), while no EBER+ cells with the morphological features of neurons, glial, meningeal or endothelial cells were detected. The identification of EBV-infected cells as predominantly B-cells was confirmed by the existence of a positive correlation between the number of EBER+ and CD20+ cells in the brain of all MS cases analysed (Fig. Is).
We further analysed the status of EBV infection in MS brains using immunohistochemical techniques with antibodies against latent and lytic viral proteins. As markers of viral latency, we studied Epstein-Barr nuclear antigen 2 (EBNA2) and latent membrane protein 1 (LMPl)18. EBN A2 is the first viral protein to be expressed in EBV-infected B-cells in vitro and acts as a transactivator of viral and cellular genes inducing B-cell proliferation (growth program). LMPl is an integral membrane protein that promotes B-cell proliferation and survival and is expressed during the growth program and the more restricted viral transcription program, named default program18. LMPl+ and EBN A2+ cells were detected in the immune infiltrates of 15 and 14 of the 20 MS cases analysed, respectively (Table 1), the highest frequency being observed in EBV-high MS cases (Fig.2a-f). Ectopic follicles contained numerous LMPl+ (Fig.2d), but no EBNA2+ cells (not shown), reminiscent of what has been observed in tonsillar germinal centre and memory B-cells1 '. Expression of EBV latent proteins provides a mechanism for B-cell expansion and activation in the MS brain and is consistent with the presence of B-cells expressing the proliferation marker Ki67 and the anti-apoptotic molecule be 12 in intrameningeal follicles (Fig.lb,f) and acute lesions (Fig.3c). LMPl may also induce expression of the enzyme activation-induced cytidine deaminase19 (Fig.ld), which is normally restricted to germinal centre B-cells. These findings raise the possibility that germinal centre-like features in the MS meninges might be induced by EBV, independently of antigenic stimulation and T-cell help, hi turn, according to a current model of EBV infection in healthy carriers11, EBV could exploit the B-cell maturation process occurring in ectopic follicles to establish a persistent infection in the MS brain.
As markers of the lytic program, we studied BFRFl which, along with BFLF2, is expressed during early viral replication20, and gp350/220, the most abundant glycoprotein of the viral envelope18. BFRFl+ cells were present inside and around all intrameningeal follicles and acute lesions analysed in EBV-high MS cases (Fig.2g-m). A few BFRFl+ cells were also detected in the small ectopic follicles identified in one EBV-low MS case (not shown). Double immunostainings showed that BFRFl immunoreactivity was present in a substantial proportion of B-cells and plasma cells (30-55%) but was much stronger in plasma cells than in B-cells (Fig.2 h-m), in agreement with findings in healthy carriers where terminal differentiation into plasma cells initiates the viral replicative cycle21. Rare gp350/220+ cells were found only in the parenchymal lesions of one EBV- high MS case (Fig.2o), indicating occasional production of infectious virus, probably due to abortive replication or efficient immune surveillance.
Because cytotoxic CD8+ T-cells have a key role in controlling latent EBV infection and in preventing viral replication22, we predicted that the presence of EBV-infected cells in the MS brain would associate with CD8+ T-cell infiltration. Indeed, intracerebral accumulation of CD8+ T-cells was much more prominent in EBV-high than in EBV-low MS cases (Fig. 7). Participation of CD8+ T-cells in the clearance of EBV-infected cells was supported by the findings that these cells did infiltrate all sites where infected B -cells/plasma cells were located and that the frequency of CDS+ T-cells in the meninges and white matter strikingly correlated with that of EBER+ cells (Fig.3a,b,k). Notably, CD8+ T-cells expressing the proliferation marker Ki-67 were detected in some ectopic follicles and all acute lesions, consistent with recent antigen stimulation likely related to viral reactivation (Fig.3c). At these sites, many CD8+ T-cells established close anatomical contacts with B-cells, plasma cells and BFRFl+ cells, and about 3% of them expressed perforin, a key component of lytic granules, indicating recognition and attack of EBV-infected B-cells/plasma cells (Fig.3d-g). Even in the EBV-low MS cases, some of the scattered CD8+ T-cells were found in direct contact with B-cells (Fig.3h). Prominent macrophage activation was also associated with intracerebral EBER+ and CD8+ T-cell accumulation (not shown). The presence of a large number of EBV-infected cells and cytotoxic T-cells in the brain of the MS cases with ectopic follicles is compatible with the severe clinical and neuropathological features of this patient subset17. Consistent with the idea that an antiviral immune response occurs in the MS brain, blood dendritic cell antigen 2 (BDCA2)+ plasmacytoid dendritic cells, which are the main source of type-I interferon and have a key role in antiviral immunity, were detected in many MS immune infiltrates, predominantly in meningeal follicles and acute lesions of EBV-high MS cases (Fig. 3 i,j).
We also investigated whether frequency of EBV-infected cells and status of EBV infection in MS brains correlated with viral load and oligoclonal IgG bands (OCBs) in the corresponding postmortem CSF. EBV DNA was generally undetectable, being found at low copy number in the CSF of only 2 of 16 MS cases (2 primary progressive MS with 1310 and 4900 copies/ml, respectively). None of the other viruses investigated [herpes simplex viruses type 1 and 2 (HSV- 1/2), varicella- zoster virus (VZV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6) and JC virus (JCV)] were detected in the 16 CSF samples analysed.
Oligoclonal bands (OCBs), which are generally CSF-restricted and relatively constant throughout the disease12, were found in the CSF of 15 of 16 MS cases. Interestingly, the number of CSF OCBs was significantly higher in EBV-high MS cases (Fig.4a), further indicating a relationship between EBV infection and intracerebral B-cell activation. Consistent with previous findings8-23, EBV-specific OCBs were detected in 7 of 16 MS cases (44%), but showed no preferential distribution in the EBV-high and EBV-low MS groups (Fig.4b). Except for one case, EBV-specific OCBs, when present, were few (median number = 2; range 1-5) and generally faint (Fig.4c), indicating that persistent EBV infection in the MS brain does not yield a robust, virus- specific oligoclonal humoral response which is typical of CNS infections associated with viral replication24.
Although the prevailing hypothesis is that MS is caused by an autoimmune response toward CNS antigens1, conclusive evidence supporting this idea is lacking. Without being bound by theory, we have demonstrated that EBV infection is dysregulated in the MS brain, thereby providing an explanation for altered humoral and cellular immune responses to EBV in MS patients3'9. Our findings implicate EBV in intrathecal Ig synthesis, the MS hallmark, through infection and activation of CNS-infiltrating B-cells, and in recurrent CNS inflammation through induction of an antiviral immune response. Perturbed EBV infection also provides an explanation for the dominance and persistence of CD8+ T-cell clones in the MS brain25'26, and implies that bystander tissue damage mediated by cytotoxic T-cells is a major determinant of MS lesions, similar to what happens in other EBV-associated diseases22. Stimulation of autoreactive B-cell clones by EBV is not excluded and may explain the variable pattern of antibody reactivities toward CNS-restricted and ubiquitous self-antigens observed in MS patients27. This also extends to other chronic diseases with autoimmune features, such as systemic lupus erythematosus and rheumatoid arthritis, in which an association with EBV is indicated by epidemiological, serological and DNA studies28.
METHODS
Post-mortem brain tissue specimens and CSF
This study was performed on post-mortem brain tissue obtained from 20 MS patients with different disease courses, 6 patients affected by other inflammatory neurological diseases, 2 control patients without neurological disease and 1 patient with Alzheimer's disease. Patient details are given in Table 1. Brain tissue specimens were provided by the UK Multiple Sclerosis Tissue Bank at Imperial College London (confirmation of MS diagnosis provided by Drs F. Roncaroli and R. Nicholas), the Department of Neurosciences, Ophtalmology and Genetics, University of Genova, Italy, and the Institute of Pathological Anatomy, U.C.S.C. Policlinico A. Gemelli, Rome, Italy. The post-mortem delay ranged between 7 and 27 h (median time, 18.5 h). The MS cases analysed had not received immunosuppressive therapies, except for MSl 14 (treated with ACTH for 12 months), MS80 (treated with ACTH for 11 years), MS5 (treated with mitoxantrone for 3 years), and MS 153 (treated with ACTH for 30 months). Control tissue specimens, lymphoma and normal human lymph node were provided by the Institute of Pathological Anatomy, A. Gemelli Hospital, and the Pathology Department of S. Andrea Hospital, Rome.
For the MS cases, 32 tissue blocks (2 x 2 cm) from the cerebral hemispheres were analysed and classified by histopathological methods, i.e. hematoxylin/eosin staining, and the combined Luxol fast blue-periodic acid-Schiff reaction, or by immunohistochemistry using anti-myelin oligodendrocyte glycoprotein antibody, to identify areas of inflammation and demyelination15'16. Immunohistochemical stainings for T and B lymphocytes, macrophages, and MHC class II molecule expression (Table 2) were performed to evaluate the degree of lesion activity (pre-active, acute, chronic active, and chronic inactive), as previously described15'16.
Post-mortem CSF samples were also available from some of the MS cases (n = 16) obtained from the UK MS Tissue Bank and were used for OCB determination and viral DNA analysis. The set of CSF samples used in this study was rather homogeneous (mean albumin concentration = 31.7 mg/dL, with a standard error of 2.1 and a 95% CI of 4.9; mean post-mortem delay of CSF collection = 17.1 hours, with a standard error of 1.2 and a 95% CI of 2.6).
EBER -In situ hybridisation
In situ hybridisation experiments were carried out using the Epstein-Barr virus (EBER) PNA Probe/Fluorescein and the PNA ISH detection kit (both from Dako), according to the manufacturer's instructions. The kit also included negative and positive control fluorescein- conjugated PNA probes. Treatment with proteinase-k was performed on frozen, PFA fixed-frozen and paraffin-embedded sections at the following dilutions in TBS: 1:500 for 10 min, 1 :100 and 1:10 for 20 min, respectively. An EBV-associated B-cell lymphoma (paraffin-embedded sections) was used as positive control tissue for EBER signals. To perform double stainings for EBER and CD20 or CD138, after the in situ hybridisation procedure sections were subjected to antigen retrieval in citrate buffer pH6.0 and then incubated overnight with anti-CD20 or anti-CD138 monoclonal antibody (mAb), extensively washed, incubated with a biotinylated rabbit anti-mouse secondary Ab (Jackson Laboratories) for 1 h, washed and treated with avidin-biotin alkaline phosphatase complex (Standard ABC-AP, Vector Laboratories) for 45 min. The reaction was visualised with fast red (Sigma, St. Louis, MO,USA). Sections were sealed in aqueous medium (Ultramount, Dako) and viewed and photographed with an Axiophot Zeiss microscope equipped with an Axiocam digital camera, using the Axiovision 4 AC software.
Immunohistochemistry
Deparaffinised 5-μm-thick and air dried, acetone fixed 10-μm-thick cryosections were rehydrated with PBS and immunostained with the Abs listed in Table 2. For single immunostainings, post-fixed sections were subjected to the antigen retrieval procedure and incubated for 20 min with 0.1% H2O2 in PBS to eliminate endogenous peroxidase activity, then for 1 h with 10% of normal sera (all from Jackson Immunoresearch Laboratories, Cambridgeshire, UK), and overnight at 4°C with the primary Abs diluted in PBS containing 1% BSA. For EBNA2 and cleaved-caspase 3 immunostainings, 0,05 % Triton X 100 and 0,1% Tween 20 were added to the medium, respectively. The binding of biotinylated secondary Abs (Table 2) was visualised with avidin-biotin horseradish peroxidase complex technique (ABC Vectastain Elite kit; Vector Laboratories, Burlingame, CA) and 3,3'-diaminobenzidine (DAB) (Sigma) containing 0.01% H2O2 as substrate. All sections were counterstained with hematoxylin, sealed with Canadian Balsam viewed and photographed as described above. Negative controls included the use of IgG isotype controls or preimmune serum, or omission of the primary antibody. Indirect immunofluorescence and confocal analysis
After an initial blockade with 10% normal goat or donkey serum in PBS, sections were incubated overnight at 4°C with the primary Abs indicated in Table 2, either alone or in combination, as indicated in the legend. Sections were then incubated for 1 hour at room temperature with fluorochrome-conjugated second Abs (Table 2) and sealed in Vectashield (Vector Laboratories). For negative controls, primary Abs were replaced with preimmune serum and IgG isotype controls. Images were analysed and acquired with a laser scanning confocal microscope (LSM 5 Pascal, Carl Zeiss).
Quantitative analysis
The number of EBER+, CD20+ and CD8+ cells was counted in 6 adjacent sections per tissue block (two 2 x 2 cm-sections were analysed for each immunohistochemical staining) at 2Ox magnification by one investigator blinded to the case number (B. S.). One-two blocks per MS case were analysed. Values are expressed as the mean number of positive cells per mm2 in the white matter and per mm in the meninges.
IEF immunoblot
The pattern of OCBs in autopsy CSF was investigated with agarose isoelectric focusing (IEF) (pH 3.0-10.0, Cambrex, Rockland, ME, USA) and affinity immunoblotting using a standard protocol29. Although the lack of paired serum samples, which were not available at autopsy, inherently affected the CSF analysis, in MS OCBs are typically restricted to the CSF, without corresponding serum bands12. IgG and albumin were determined with turbidimetry (Cobas Integra, Roche, Milan, Italy). EBV-specifϊc OCBs were determined using a previously published IEF/affinity-mediated immunoblotting protocol29, using nitrocellulose membranes that had been previously coated with highly pure EBV Antigen, strain P3HR1, and a mouse monoclonal anti-EBV EA-D IgG as a positive control (both from Fitzgerald Industries International, Concorde, MA, USA). The serum of a patient with a monoclonal gammapathy tested on EBV-precoated papers and EBV-specific OCB-positive CSF samples tested on lanes coated with a Blocking Solution containing casein (WesternBreeze, Invitrogen, Carlsbad, CA, USA) only were used for assessing non-specific binding. For each sample, 0.3 μg of IgG were used.
Viral DNA detection
Using TaqMan® technology, CSF samples were tested by real-time PCR for DNA of the following viruses: EBV, HSV-I, HSV-2, VZV, CMV, HHV6-A, HHV6-B, and JCV. PCR protocols are listed in Table 3. In all virus assays, an internal control was used to control for PCR inhibitors in the samples.
Statistical analysis
The Mann Whitney fZ-test was used to compare the median values of EBER+, CD20+ and CD8+ cells counted in adjacent MS brain sections and of CSF OCBs between EBV-low and EBV- high groups of MS cases. Spearman's rank correlation was calculated to analyse the relationship between number Of EBER+ cells and number of CD20+ or CD8+ T cells in MS brain sections. A p value lower than 0.05 was considered as significant.
Table 1 Demographic and clinical data of MS and control cases and summary of inflammatory degree and EBV marker expression in their blVR tissue
Sex/ Age at Disease Cause of death Degree of Frequency of Expression of Expression of lytic
Patient/type Age at onset duration CNS EBER+ cellsc: latent EBV EBV antigensd of MSa death inflammationb/ meninges/ antigens'1
(years) number of white matter ectopic LMPl EBNA2e BFRFl Gp350/220 follicles analysed
Disseminated
MS2/RR F/28 18 10 intravascular ±/O 0f/low n.p.e n.p. n.p. n.p. coagulopathy
MS274 /RR M/56 24 32 Gut carcinoma ± / O Low/low + + n.p. n.p. ronchopneumonia + +
M/38 21 17 B + / 0 Low/
MSl 07/PR moderate
M/57 44 + +
13 MS + / 0 Low/
MS98/PR moderate
MS83/PP M/53 36 17 Bronchopneumonia ±/ o + +
Low/low
+ +
+ / 0 Low/
MSl 02/PP M/73 21 52 Bronchopneumonia moderate
Cerebrovascular
MSG1/PP F/43 33 10 ±/ o Low/low n.p. disease
MSl 14 /SP F/52 37 15 Bronchopneumonia ±/ o + +
Low/low
Urinary tract
MS104/SP M/53 42 11 ±/ o Low/low - - - - infection
MS80/SP F/71 36 35 Heart failure ±/ o 0/0h - - _
+
MS5/SP M/66 unknown unknown Bronchopneumonia ±/ o Low/0
MS109/SP1 F/60 35 25 Myocardial infarct ± / 2 Moderate/low + +
MSl 54/SP F/35 23 12 Bronchopneumonia " / 1 High/high + +
MS92/SP F/37 20 17 MS " / 5 High/high + + +
MSl 80/SP F/44 26 18 MS " 12 High/high + + +
MS121/SP F/49 35 14 Bronchopneumonia " 12 High/high + + +
MS79/SP F/49 25 24 Bronchopneumonia " 1 2 High/high + + + +
π / l High/
MSl 53/SP F/50 18 32 MS moderate
Cerebrovascular High/
MS85/SP F/59 24 35 disease moderate
High/
MSl 60/SP F/44 26 16 Bronchopneumonia moderate
Other inflammatory neurological diseases (OIND)
Primary cerebral VO Absent
OINDl M/60 vasculitis
Primary cerebral +/0 Absent
OIND 2 F/55 vasculitis
Viral encephalitis Absent
OIND4 M/60 (arbovirus)
OIND6 F/68 Mycotic meningitis Absent
F/ +/0 Absent OIND7 Mycotic meningitis unknown
Lymphoblastic Absent leukemia with
OIND8 M/23 leukemic blasts in the CNS; CMV IgM+
Controls
Cl M/35 Crohn's disease -/0 Absent
C16 M/92 Cardiac failure -/0 Absent
Alzheimer F/ Pneumonia ab -/0 Absent disease/ unknown ingestis
NIND2
M&C Folio: WPP97077
aRR = relapsing remitting; PR = progressive relapsing; SP = secondary progressive; PP = primary progressive. b The degree of CNS inflammation represents an average estimate of the degree of immune cell infiltration in MS meninges and white matter: - = negative; ± = scarce; + = moderate; ** = abundant;
"1^+ = massive. c The frequency OfEBER+ cells was calculated in the meninges and parenchyma (white matter).
Based on the cell counts shown in Fig. 7, the following scores were used: for the cerebral meninges,
0 = no EBER+ cells; low = 0,1-5 EBER+ cells/mm; moderate = 5-20 EBER+ cells/mm high = 20-100 EBER+ cells/mm; for the white matter, 0 = no EBER+ cells; low = 0,02-0,2 EBER+ cells/mm2; moderate = 0,2-1,5 EBER+ cells/mm2, high = 1,5-5 EBER+ cells/mm2. In the white matter, EBER+ cells were detected in pre-active, acute and chronic active, but not inactive, lesions. d + = present; - : absent e EBNA2 immunostaining was detected in cells localised in acute and chronic active white matter lesions and in sparse meningeal infiltrates, but not in ectopic follicles. f Poorly preserved meninges. ε n.p. = not performed due to lack of brain tissue. h The only MS case devoid OfEBER+ cells in this series also lacked B cells/plasma cells and had largely inactive white matter lesions in the two brain tissue blocks analysed.
1 MS 109 is at the borderline between EBV-low and EBV-high MS cases. In this case, negligible intraparenchymal inflammation was observed in 8 brain tissue blocks analysed here and in a previous study17 whereas 2 small B-cell follicles containing a few EBER+ and BFRFl+ cells and relatively more CD8+ T cells were detected in the meninges. In Fig. 7 and Fig. 4 this case was classified among the EBV-low MS cases. Table 2: List of primary antibodies used in this study
Antigen Specificity Type of antibody/clone Dilution Source
CD3 T lymphocytes Mouse monoclonal/PS 1 Pre-diluted Irnmunotech, Marseille, F CD20 B lymphocytes Mouse monoclonal/L26 Pre-diluted Immunotech
Tcell subset of cytotoxic/suppressor
CD8 Mouse monoclonal/4Bl 1 1:30 UCS Diagnostic, Italy cells
Tcell subset of cytotoxic/suppressor ABR Affinity BioReagents, CD8 Rabbit polyclonal 1:30 cells CO, USA
Mouse
CDl 38 (Syndecan-1) Plasma cells 1:100 Serotec, Oxford, UK monoclonal/B-B4
Ig-A5-G, -M Plasma cells and plasma blasts Rabbit polyclonal 1:300 Dako,-Carpinteria, CA
CD68 Macrophages Mouse monoclonal/KPl 1:50 Dako
MHC class II antigens Antigen presenting cells Mouse monoclonal/CR3/43 1:50 Dako
Myelin-oligodendrocyte Kind gift of S.Piddlesden, glycoprotein (MOG) Myelin and oligodendrocytes Mouse monoclonal/Z12 1:50 Cardiff, UK
Novocastra Labs, Newcastle,
Ki67 nuclear antigen Proliferating cells Rabbit polyclonal 1:400 UK
R&D Systems, Minneapolis,
CXCL 13 Follicular dendritic cells, stromal cells Goat polyclonal 1 :15
MN5 USA
Activation-induced cytid Rat monoclonal/
Germinal centre centroblasts 1 :5 Ascenion, Munich, Germany deaminase EK2 5G9
Bcl2 Bcl2 oncoDrotein Mouse monoclonal/ 124 1:50 Dako
Cell Signaling, Boston, MA,
:aved caspase-3 Apoptotic cells Rabbit polyclonal 1:100 USA ιNA2 EBV latent protein Mouse monoclonal/PE2 1 :75 Dako
IPl EBV latent protein Mouse monoclonal/CS. 1-4 1:300 Dako
RPl EBV early lytic protein Rabbit polyclonal 1 :800 Ref. 19
DSMZ, Braunschweig,
350/220 Protein of the EBV envelope Mouse monoclonal/72Al 1:200 Germany
Blood dendritic cell antigen „, . . , , , ... ,, to Plasmacytoid dendritic cells Mouse monoclonal/ AC 144 1:10 Miltenyi Biotec, CA, USA
BD Biosciences, S. Diego,
Perforin Perforin Mouse monoclonal/δG9 1 : 8 CA, USA
CNS tissues from 9 patients with SPMS, 2 patients with PPMS, 2 patients with PRMS and 2 control subjects were fixed in 4% paraformaldehyde (PFA) for several days, cryoprotected in sucrose, frozen by immersion in isopentane precooled on a bed of dry ice (-55°C), and stored a - 80°C until use. Brain tissue blocks from 1 patient with PPMS, 2 patients with RRMS, 6 patients with OIND and one control with Alzheimer's disease were fixed in buffered formalin and embedded in paraffin wax. Brain tissue blocks from 4 patients with SPMS were snap frozen. For MS79 and MS 153 cases both PFA-fixed and snap frozen tissue blocks were analysed. Antigen retrieval procedures utilised microwave of PFA-fixed and paraffin sections in citrate buffer (10 mM, pH 6.0). For CD8 (clone 4Bl 1) immunostaining, heat treatment with EDTA solution (1 mM, pH 9.0) was performed. Sections immunostained for MOG were treated with cold methanol without antigen retrieval procedure. For single immunostainings in bright field, the biotinylated secondary Abs rabbit anti-mouse or goat anti-rabbit IgG (Jackson Laboratories) were used. For immunofluorescence stainings, rhodamine-conjugated goat anti-rabbit IgG and fluorescein- conjugated goat anti-mouse IgG, and fluorescein-conjugated donkey anti-goat IgG and rhodamine- conjugated donkey anti-mouse IgG Abs diluted in PBS + 5% normal sera (all from Jackson Laboratories) were used as secondary Abs.
The primers sequences provided below are listed as SEQ ID NOs: 1-22 in the sequence listing.
Table 3: Real-time PCR protocols for viral DNA detection
Amplicon Detection
Genome Primers and length limit
Virus region probe Primers and probe in 5'-3' orientation (and SEQ ID NO) (bp) (c/mL)
Epstein-Barr virus LMPl LMPl F AAG GTC AAA GAA CAA GGC CAA G (1) 64 100 (EBV)30 LMPl R GCA TCG GAGTCG GTG GG (2) LMPl probe 6-FAM-AGG AGC GTG TCC CCG TGG AGG-TAMRA (3)
JC virus (JCV) VPl VPl-F GAG TGT TGG GAT CCT GTGTTTTC (4) 77 100 VPl-R GAG AAG TGG GAT GAA GAC CTG TTT (5) VPl probe 6-FAM-TCA TCA CTG GCA AAC ATT TCTTCA TGG C-TAMRA (6)
Herpes simplex gD HSV-I Ql F GGCCTGGCTATCCGGAGA (7) 63 1000 virus-1 (HSV-I) HSV-I Q2 R GCGCAGAGACATCGCGA (8) HSV-I probe 6-FAM-CAG CAC ACG ACTTGG CGT TCT GTGT-TAMRA (9)
Herpes simplex US4-US5 HSV-2 Ql F AGA TAT CCT CTTTAT CAT CAG CAC CA (10) 73 1000 virus-2 (HSV-2) HSV-2 Q2 R TTGTGC TGG CAA GGC GA (11) HSV-2 probe 6-FAM-CAG ACAAAC GAA CGC CGC CG-TAMRA (12)
Varicella-zoster ORF 4 Orf4 F ATG GCG TAC CGA GTC AAT GG (13) 86 100 virus (VZV) Orf4 R TAC GGG CCG TGC TAT TGAAG (14) Orf 4 probe 6-FAM-CAC GCT GGC TCC CGC GGT-TAMRA (15)
Human herpesvirus US67 HHV-6 F ATGCTGCCAGGTACAAAGAGC (16) 87 (A/ B) 100 6 (HHV-6) A/B HHV-6 R AAATGACAAGYGCACYGAG (17)
HHV-6 probe A 6-FAM-CAG CCA TAT TTC CGGTAT ATGACC TTC GTAAGC T-TAMRA (18)
HHV-6 probe B 6-FAM-CAG CGA TAT TTC CGGTAT ATGACC TTC GTAAGC T-TAMRA (19)
Cytomegalovirus US 17 US17 F GCG TGC TTT TTA GCC TCT GCA (20) 151 100 (CMV) US17 R AAA AGT TTG TGC CCC AAC GGT A (21)
US 17 probe 6-FAM-TGA TCG GCG TTA TCG CGT TCT TGA TC-3-TAMRA
FIGURE LEGENDS
Figure 1
Localisation, immunophenotype and frequency of EBV-infected cells in postmortem MS brains with different degrees of CNS inflammation. (a-i) Immunohistochemical characterisation of ectopic B-cell follicles enriched in EBER+ B- cells in the cerebral meninges of a subset of MS patients with prominent CNS inflammation. A representative ectopic follicle located in the depth of a cerebral sulcus displays the morphological features of a germinal centre as it is composed of CD20+ B- cells clustered around a network of stromal/follicular dendritic cells expressing the B- cell attracting chemokine CXCLl 3 (a: double immunofluorescence staining for CD20 in red and CXCL 13 in green). The same ectopic follicle also contains numerous proliferating B-cells (b: double labelling for CD20 in green and the proliferation marker Ki67 in red; the inset in b shows 3 double labelled CD20+/Ki67+ cells at higher magnification) and peripherally located Ig+ plasma cells (c). (d-f) A distinct intrameningeal ectopic follicle is shown that contains: (d) numerous cells expressing activation-induced cytidine deaminase, the key enzyme responsible for somatic hypermutation and Ig class-switch recombination in germinal centre B-cells; (e) fewer cells expressing cleaved caspase-3, which is expressed in germinal centre centroblasts undergoing apoptotic cell death; and (f) numerous cells expressing the anti-apoptotic molecule bcl-2, which is expressed in positively selected germinal centre B-cells. (g, h) In situ hybridisation for EBER shows enrichment of EBER+ cells in 2 follicles from 2 different MS cases, (i) In situ hybridisation for EBER (blue -black nuclei) combined with immunostaining for the pan B-cell marker CD20 (red membrane staining) shows that most EBER+ cells in a meningeal follicle express CD20. The inset shows a cell double labelled for the plasma cell marker CD 138 (red staining) and EBER (blue-black nucleus). Enrichment of EBER+ B-cells and plasma cells in MS follicles suggests that these structures are generated by clonal expansion of EBV-infected B-cells. Note that EBER signals in the MS brain are confined to the cell nuclei, similar to what is observed in a control, EBV-associated B-cell lymphoma (j). (k) Presence of EBER+ cells in a large, B-cell rich perivascular cuff located in an acute white matter lesion of an EBV-high MS case (double staining for CD20 and EBER, as above); the inset shows a high magnification picture of a CD20+/EBER+ cell from the same infiltrate. (1) Perivascular and scattered intraparenchymal EBER+ cells in a chronic active white matter lesion of an EBV-high MS case (the inset shows CD20 staining of the same blood vessel in an adjacent section), (m-o) Scattered EBER+ cells in the meninges (m) and around scarcely infiltrated blood vessels in chronic active white matter lesions (n, o) of EBV-low MS cases; the insets in m and o show CD20 immunostaining of the same areas in adjacent sections, (p-r) A pre-active lesion characterised by numerous activated MHC class 1I+ microglia (p) and still preserved myelin [inset in p: immunostaining of the same area for myelin-oligodendrocyte glycoprotein (MOG)], contains two small blood vessels, each containing a single perivascular EBER+ cell (q and r, respectively). This finding suggests early pathogen recognition by the brain's innate immune system. Bars: 10 μm in the insets in b, i and k; 20 μm in b, f, k, q and r; 50 μm in a, c-e, g-j, 1-p and insets in 1, m, o and p. . (s) Statistically significant correlation between the number of CD20+ and EBER+ cells in the white matter (left panel) and meninges (right panel) of EBV-low (n = 12) and EBV-high (n = 8) MS cases. EBER+ and CD20+ cells were counted as indicated in the legend of Figure 7.
Figure 2
Detection of EBV latent and lytic proteins in the MS brain, (a-d) Expression of the EBV latent proteins EBNA2 (a, b) and LMPl (c, d) in the brain of EBV-high MS cases. An acute (a) and a chronic (b) white matter lesion containing several EBNA2+ cells in a perivascular position are shown. The inset in b shows that EBNA2 staining is confined to the cell nucleus. A sparse meningeal infiltrate (c) and an intrameningeal ectopic B-cell follicle (d) containing LMPl+ cells (membrane staining) are shown; the inset in d shows the same follicle stained for EBER. (e, f) Perivascular EBNA2+ and LMPl+ cells in chronic active lesions from an EBV-low MS case, (g-m) Expression of the EBV early lytic protein BFRFl in EBV-high MS cases. Numerous BFRFl+ cells are present in an intrameningeal ectopic follicle (g). In two different ectopic follicles (h, i), double immunofluorescence staining for CD20 (green) and BFRFl (red) shows that BFRFl is expressed in a substantial proportion of CD20+ B-cells but its intensity is much stronger in CD20-negative cells (arrows). The insets in g and h highlight the typical perinuclear localisation of BFRFl immunoreactivity. G"m) Double immunofluorescence staining for Ig (green) and BFRFl (red). The lytic cycle- associated protein is strongly expressed in a proportion of Ig+ plasma cells in the same ectopic follicle shown in i (j; the asterisks in i and j mark the Ig-negative B-cells with lower BFRFl expression in the centre of the follicle). In an acute intraparenchymal lesion, BFRFl is mainly expressed in Ig+ plasma cells located at the periphery ofthe large perivascular inflammatory cell infiltrate (k). Two double labelled Ig+/BFRF1+ plasma cells in the same infiltrate are shown at higher magnification (1, m). (n) Absence of BFRFl immunoreactivity in the B-cell area of a control human lymph node, (o) One productively infected cell expressing gp350/220, a protein ofthe viral envelope, in the perivascular cuff of a chronic active lesion in an EBV-high MS case. Bars: 5μm in 1, m and insets in g and h; 20 μm in a-j, n,o and inset in b; 50 μm in k and inset in d.
Figure 3
Relationship of CD8+ T-cells and plasmacytoid dendritic cells to EBV- infected cells in the MS brain, (a-f) Prominent accumulation of CD8+ T-cells in the brain of EBV-high MS cases. Double immunofluorescence staining for CD8 (red) and CD20 (green) shows the presence of numerous CD8+ T-cells in an intrameningeal ectopic follicle (a) and an impressive accumulation of CD8+ T-cells in a large perivascular cuff of an acute white matter lesion (b) which also contains several BFRFl+ plasma cells (see Fig. 2k; double BFRF 1/Ig immunostaining was performed in an adjacent section). The same perivascular cuff contains numerous proliferating cells some of which were identified as B-cells (double positive CD20+/Ki67+ cells in c, arrows) and some as CD8+ T-cells (double positive CD8+/Ki67+ cells in the inset in c). Double immunostainings for CD8 (red) and CD20, CD8 (red) and Ig (green), and CD8 (green) and BFRFl (red) show that CD8+ T cells with an activated, lymphoblastoid morphology cluster around and extend cytoplasmic processes that contact CD20+ B- cells (d), Ig+ plasma cells (e) and BFRFl+ cells (f and insets), (g) The presence of perform granules (green) in a CD8+ T-cell (red) identified in the same BFRFl+ perivascular cuff shown in panels b and c and in Fig.2k confirms the cytotoxic activity of CD8+ T-cells. (h) Two scattered CD8+ T-cells in the meninges of an EBV-low MS case are shown, of which one contacts a CD20+ B-cell. (i, j) Accumulation of BDCA2+ plasmacytoid dendritic cells in an ectopic B-cell follicle (i; the inset shows the same follicle stained for CD20), in a sparse meningeal inflammatory cell infiltrate (j) and in a perivascular cuff of a chronic active lesion (inset in j) from 3 different EBV-high MS cases, respectively, (k) Statistically significant correlation between the number of CD8+ T/EP2008/004992
and EBER+ cells in the white matter (left panel) and meninges (right panel) of EBV-low (n = 12) and EBV-high (n - 8) MS cases (see also Figure 7). CD8+ and EBER+ cells were counted as indicated in the legend of Figure 7. Bars: lQμm in d, e, g, h and insets in f and j; 20μm in f, i, j and inset in c; 50μm in a-c and inset in i.
Figure 4
Analysis of total and EBV-specific oligoclonal IgG bands in post-mortem cerebrospinal fluid from MS cases. The graphs show: (a) significantly higher numbers of oligoclonal IgG bands (OCBs) in the CSF of MS cases with a high frequency of EBV-positive cells (EBV-high; n = 7) versus those with a lower frequency of EBV-positive cells (EBV-low; n = 9) in MS lesions and meninges; and (b) no difference in the number of EBV-specific OCBs between EBV-high and EBV-low MS cases. Dot points represent values for each MS case; the bars represent median values for each group; p values, calculated by the Mann- Whitney U-test, are indicated where statistically significant, (c) Affinity-mediated immunoblotting on EBV antigen-coated nitrocellulose paper of isoelectrofocused CSF from two EBV-low MS cases (lanes 1 and 2, MS 154 and MS 102, respectively), anti-EBV EA-D monoclonal (mo) antibody used as positive control (lane 3), and serum (ser) from a patient with monoclonal IgG used as control for binding specificity (lane 4). An additional control for binding specificity included CSF from the MS 102 case that was blotted onto casein-coated nitrocellulose paper (absence of reactivity) (lane 5). Faint (lane 1) and and both faint and strong (lane 2) EBV-specific OCBs are present in MS 154 and MS 102 cases, respectively (arrows indicate OCBs). Of note, MS 102 was also positive for EBV DNA and had the highest frequency of EBER+ and CD8+ cells in both white matter lesions and meninges among the EBV-low MS cases.
Figure 7
Quantification of CD20+, EBER+ and CD8+ cells in MS brain sections. MS cases with and without ectopic follicles were a posteriori classified as EBV-high and EBV-low, respectively. The graphs show significant differnces in the number of CD20+, EBER+ and CD 8+ cells in the white matter (A) and meninges (B) between the two groups. Dot points represent values for each MS case. Each value represents the mean of cell counts performed in adjacent brain sections (2 sections for each marker) for each brain tissue block; 1-2 blocks for each MS case were analysed. The bars represent median values for each group (n = 8 for EBV-high MS cases; n = 12 for EBV- low MS cases).
EXAMPLE 2
Following on from the above discovery of huge deposits of Epstein-Barr virus (EBV)- infected B cells and plasma cells in the brain of multiple sclerosis patients (as also post- published as Serafini32 et al. 2007), we have asked whether an abnormal accumulation of EBV-infected cells in the target organ was also a feature of other autoimmune diseases characterized by dysregulated humoral immunity. We decided to address this issue in two diseases, autoimmune thyroiditis and myasthenia gravis (MG), in which tissue-specific autoantibodies have been unequivocally identified and play a role in disease pathogenesis. Moreover, both in the thyroid of patients with Hashimoto's thyroiditis (HT) and Grave's disease and in the thymus of myasthenic patients, B-cell hyperplasia and well organized ectopic B-cell follicles have been described (reviewed in Aloisi and Pujol-Borrell31, 2006; see also Fig. 5 A-B for HT and Fig. 6 A-C for MG), raising the suspect that EBV could be involved in these processes.
To evaluate the extent and status of EBV infection in bioptic tissues from patients with HT and MG, both in situ hybridization for EBER and immunohistochemical stainings for viral latency and lytic cycle-associated proteins were performed, as described above (and subsequently published in Serafini et al., 2007). Hashimoto's thyroiditis: tissues were provided by Dr Ricardo Pujol-Borrell Laboratory of Immunology (LIRAD), Bane de Sang iTeixits; Institute for Research in Health Sciences, Germans Trias i Pujol, 08916 Badalona, Barcelona, Spain; thyroid samples from 5 HT cases were examined. Myasthenia gravis: tissues were provided by Dr Renato Mantegazza, Istituto Neurologico Besta, Milan, Italy. Thymus samples from 8 MG cases were examined.
The following results were obtained. Proteins expressed during the EBV latency phase (EBNA2, growth programme, and LMPl, growth and default programmes) were observed in all thyroids examined from HT cases (Fig. 5 C-E) and in all the thymus samples from MG patients (Fig. 6 F, G) (representative cases are shown). LMP 1+ cells P2008/004992
were much more numerous that EBNA2+ cells and were detected mainly within ectopic B-cell follicles. The few cells expressing EBNA2 were found at the periphery of the follicles and within the hyperplasic areas. These data are in line with previous findings in multiple sclerosis brain tissue (and described above and in Serafini et al., 2007). In some MG thymus samples, the presence of EBV-infected cells was confirmed by in situ hybridization for EBV-associated small RNAs (EBERs) (Fig. 6 D, E). In all cases examined, the distribution of EBV markers in thyroid or thymus overlapped with that of the B cell marker CD20.
In all 5 HT thyroids analysed we also found expression of the replication factor B ALF2 (Fig.5 F) and of two early lytic antigens BMRFl and BFRFl associated with viral reactivation (Fig. 5 G and H). Numerous cells expressing these viral antigens were located both around and inside the ectopic follicles. Only rare cells in the hyperplasic areas were found positive for pi 60 and gp350/220, two EBV structural proteins that are expressed during the late phase of the lytic cycle (Fig. 5 I, J). Similar data was obtained in the MG thymus, where EBV-infected cells expressing BMRFl and BFRFl colocalized with B cell aggregates (Fig. 6 H and J) and cells expressing gp350 were present at a much lower frequency in the same areas (not shown).
Although a detailed analysis of the activation state and relationship to EBV-infected cells of CD8+ T cells infiltrating the HT thyroid and MG thymus has not been performed yet, both organs contain a large amount of CD8+ T cells, which suggests involvement of an EBV-targeted cytotoxic immune response in tissue damage.
Based on these findings, we conclude that abnormal accumulation of latently and lytically EBV-infected B cells and plasma cells with very limited production of infectious virus in the target, inflamed organ is a feature shared among several putative autoimmune diseases. We interpret these data as evidence that, similarly to what proposed for multiple sclerosis; also in autoimmune thyroiditis and myasthenia gravis, EBV could play a dual role: on the one hand, induce abnormal humoral immunity, including production of disease-specific autoantibodies, and on the other hand stimulate an EBV-specific cytotoxic immune response that, in the attempt to eliminate EBV deposits in the target organ (thyroid and thymus, respectively), would sustain the immunopathological process. These findings support the view that not only patients with MS, but also those with autoimmune thyroiditis and myasthenia gravis, could benefit from the treatments indicated herein.
Figure Legends for Example 2
Figure 5
Expression of EBV latent and lytic proteins in the thyroid of patients with Hashimoto's thyroiditis
Ectopic B cell follicles stained with the pan B-cell marker CD20 in the thyroid of patients affected by Hashimoto's thyroiditis (A, B). Numerous cells expressing the EBV latency protein LMPl were observed inside ectopic B follicles (C and inset; the same follicle shown in C is circled in red in panel B), whereas immunopositivity for EBNA2 was restricted to a small number of cells distributed at the edge of the follicle and in areas of hyperplasia (D, E). Numerous cells expressing the replication factor BALF2 (F) and the early lytic cycle-associated proteins BMRFl and BFRFl (G, H) were found within and around the B cell follicles. Conversely, cells expressing the most abundant protein of the viral envelope, gp350/220, and the viral capsid antigen pl60 were observed only occasionally (I, J, respectively).
Figure 6
Expression of EBV latent and lytic proteins in the thymus of patients with myasthenia gravis
Ectopic B cell follicles stained with the pan B-cell marker CD20 in the thymus of patients affected by myasthenia gravis (A-C). In situ hybridization for EBER reveals the presence of numerous EBV-infected cells inside ectopic follicles (D) and as well as in sparse B-cell inflitrates (E). Rarely, isolated EBNA2+ cells were observed at the edge of ectopic follicles (F); the latter comprised numerous cells positive for the EBV latency protein LMPl (G and inset. Numerous cells expressing the early lytic cycle-associated proteins BMRFl and BFRFl were found within and outside the B cell follicles (H-J). EP2008/004992
REFERENCES
1. Compston, A. & Coles, A. Multiple sclerosis Lancet 359, 1221-1231 (2002).
2. Gilden D.H. Infectious causes of multiple sclerosis. Lancet Neurol. 4, 195-202 (2005).
3. Sumaya, CV. , Myers, L.W., Ellison, G.W. & Ench, Y. Increased prevalence and titer of Epstein-Barr virus antibodies in patients with multiple sclerosis. Ann. Neurol. 17, 371-377 (1985).
4. Wandinger, K. et a Association between clinical disease activity and Epstein-Barr virus reactivation in MS. Neurology 25, 178-184 (2000).
5. Ascherio, A. et al. Epstein-Barr virus antibodies and risk of multiple sclerosis: a prospective study. JAMA 286, 3083-3088 (2001).
6. Haahr, S. & Hollsberg, P. Rev. Med. Virol. 16, 297-310 (2006).
7. DeLorenze, G.N. et al. Epstein.-Barr virus and multiple sclerosis: evidence of association from a prospective study with long-term follow-up. Arch. Neurol. 63, 839-844 (2006).
8. Cepok, S. et al. Identification of Epstein-Barr virus proteins as putative targets of the immune response in multiple sclerosis. J. Clin. Invest. 115, 1352-1360 (2005).
9. Lϋnemann, J.D. et al. Increased frequency and broadened specificity of latent EBV nuclear antigen- 1 -specific T cells in multiple sclerosis. Brain 129, 1493-1506 (2006).
10. Wucherpfennig, K. W. & Strominger, J.L. Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein. Cell 80: 695-705 (1995).
11. Thorley-Lawson, D. A. Epstein-Barr virus: exploiting the immune system. Nat. Rev. Immunol. 1, 75-82 (2001).
12. Link, H. & Huang, Y.-M. Oligoclonal bands in multiple sclerosis cerebrospinal fluid: An update on methodology and clinical usefulness. J. Neuroimmunol. 180, 17-28 (2006).
13. Qin, Y. et al. Clonal expansion and somatic hypermutation of V(H) genes of B cells from cerebrospinal fluid in multiple sclerosis. J. Clin. Invest., 102, 1045-1050 (1998). 14. Baranzini, S.E. et al. B cell repertoire diversity and clonal expansion in multiple sclerosis brain lesions. J. Immunol. 163, 5133-5144 (1999).
15. Corcione, A. et al. Recapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis. P roc. Natl. Acad. Sci. USA, 101: 11064- 11069 (2004).
16. Serafmi, B., Rosicarelli, B., Magliozzi, R., Stigliano, E. & Aloisi, F. Detection of ectopic B-cell follicles with germinal centres in the meninges of patients with secondary progressive multiple sclerosis. Brain Pathol. 14, 164-174 (2004).
17. Magliozzi, R. et al. Meningeal B-cell follicles in secondary progressive multiple sclerosis associate with early onset of disease and severe cortical pathology. Brain, in press..
18. Kϋppers, R. B cells under influence: transformation of B cells by Epstein-Barr virus. Nat. Rev. Immunol. 3, 801-812 (2003).
19. He et al. EBV-encoded latent membrane protein 1 cooperates with BAFF/BLyS and APRIL to induce T cell-independent Ig heavy chain class switching. J. Immunol. 171, 5215-5224 (2003).
20. Gonnella, R.. et al. Characterization and intracellular localization of the Epstein-Barr virus protein BFLF2: interactions with BFRFl and with the nuclear lamina. J. Virol., 79, 3713-3727 (2005).
21. Laichalk, L.L. & Thorley-Lawson, D. A. Terminal differentiation into plasma cells initiates the replicative cycle of Epstein-Barr virus in vivo. J. Virol. 79, 1296-1307 (2005).
22. Hislop, A.D., Taylor, G.S., Sauce, D. & Rickinson, A.B. Cellular responses to viral infection in humans: Lessons from Epstein-Barr virus. Annu. Rev. Immunol. 25, 587- 617 (2007).
23. Bray, P.F., Luka, J., CuIp, K.W. & Schlight, J.P. Antibodies against Epstein-Barr nuclear antigen (EBNA) in multiple sclerosis CSF, and two pentapeptide sequence identities between EBNA and myelin basic protein. Neurology 42, 1798-1804 (1992).
24. Sindic, C.J.M., Manteyne. P. & Laterre, E5C. The intrathecal synthesis of virus- specific oligoclonal IgG in multiple sclerosis. J. Neuroimmunol. 54:75-80 (1994). 25. Babbe, H. et al. Clonal expansions of CD8+ T cells dominate the T cell infiltrate in active multiple sclerosis lesions as shown by micromanipulation and single cell polymerase chain reaction. J. Exp. Med. 192, 393-404 (2000).
26. Skulina, C. et al. Multiple sclerosis: brain-infiltrating CD8+ T cells persist as clonal expansions in the cerebrospinal fluid and blood. Proc. Natl. Acad. Sci. USA 101, 2428-2433 (2004).
27. Reindl, M., Khalil, M. & Berger T. Antibodies as biological markers for pathophysiological processes in MS. J. Neuroimmunol. 180, 50-62 (2006).
28. Pender, M. P. Infection of autoreactive B lymphocytes with EBV, causing chronic autoimmune diseases. Trends Immunol.24, 584-588 (2003)
29. Franciotta, D. et al. Antigen-specific oligoclonal IgG in AIDS-related cytomegalovirus and toxoplasma encephalitis. Acta Neurol. Scand. 94, 215-218 (1996).
30.Bossolasco, S. et al. Epstein-Barr virus DNA load in cerebrospinal fluid and plasma of patients with AIDS-related lymphoma. J. Neurovirol. 8, 432-438 (2002).
31. Aloisi, F., Pujol-Borrell, R. (2006) Lymphoid neogenesis in chronic inflammation. Nature Rev. Immunol., 6:205-217
32. Serafini, B., Rosicarelli, B., Franciotta, D., Magliozzi, R., Reynolds, R., Cinque, P., Andreoni, P., Trivedi, P., Salvetti, M., Faggioni, A., Aloisi, F. (2007) Dysregulated Epstein Barr virus infection in the multiple sclerosis brain. J. Exp. Med 204:2899- 2912; Epub ahead of print 5 November 2007.

Claims

CLAIMS:
1. The use of at least one of (a) an anti-EB V substance, and (b) a B cell cidal agent, in the manufacture of a medicament for the treatment of an autoimmune disease.
2. Use according to claim 1, wherein the autoimmune disease is systemic lupus erythematosus, Hashimoto's thyroiditis, Grave's disease, multiple sclerosis, Sjogren's syndrome, rheumatoid arthritis, myasthenia gravis and inflammatory myopathies.
3. Use according to claim 1 or 2, wherein the autoimmune disease is multiple sclerosis.
4. Use according to claim 2, wherein the inflammatory myopathy is dermatomyositis, inclusion body myositis, and polymyositis.
5. Use according to any preceding claim, wherein the medicament comprises no B cell cidal agents, and the autoimmune disease is associated with regions of the body not restricted to the CNS.
6. Use according to claim 5, wherein the medicament is for the treatment of systemic lupus erythematosus or rheumatoid arthritis, and comprises one or more anti- EB V substances, and no B cell cidal agents.
7. Use according to any preceding claim, wherein the anti-EB V substance is selected from drugs, antibodies and siRNA.
8. Use according to any preceding claim, wherein the anti-EB V substance is one or more of acyclovir, valacyclovir, and a Type-1 interferon.
9. Use according to claim 7, wherein any antibody is selected from antibodies against EBV gp350/220 surface glycoprotein, the HLA B8 restricted epitope from EBNA-3A, Epstein Barr Nuclear Antigen 2, latent membrane protein 1 (LMPl), and BFRFl .
10. Use according to claim 7, wherein the siRNA targets the EBN A2 gene.
11. Use according to any preceding claim, wherein the medicament is for intrathecal administration.
12. Use according to claim 11, wherein the autoimmune disease is multiple sclerosis.
13. Use according to claim 11 or 12, wherein the medicament comprises at least one B cell cidal agent.
14. Use according to claim 13, wherein the B cell cidal agent is a monoclonal antibody targeting a B-cell surface protein to activate antibody-dependent cellular cytotoxicity and/or complement-dependent cytotoxicity and or/apoptosis.
15. Use according to claim 14, wherein the B cell cidal agent is Rituximab.
16. Use according to any preceding claim, wherein the medicament comprises at least one each of substance (a) and agent (b).
17. Use according to claim 16, wherein the medicament comprises Rituximab and valacyclovir.
18. Use according to claim 16, wherein the medicament comprises Rituximab and acyclovir.
19. Use according to any of claims 13 to 18, wherein the medicament further comprises a plasma cell cidal agent.
20. Use according to any of claims 13 to 19, wherein the medicament is for intrathecal administration.
21. Use according to any preceding claim, wherein the medicament is for intrathecal administration and comprises, additionally to, or alternatively to, one of substance (a) and agent (b), a T cell inhibitory, blocking, suppressing, or cidal substance.
22. Use according to claim 21, wherein the further substance is targeted at CD8+ T cells.
23. At least one of (a) an anti-EBV substance, and (b) a B cell cidal agent for the treatment of an autoimmune disease.
24 A pharmaceutical composition comprising at least one of (a) an anti-EBV substance, and (b) a B cell cidal agent, for the treatment of an autoimmune disease.
25. A method for treating an autoimmune disease, comprising administering, to a patient in need thereof, a therapeutically effective amount of at least one of (a) an anti- EBV substance, and (b) a B cell cidal agent.
26. A vaccine for the prevention of multiple sclerosis, or any other chronic, inflammatory, autoimmune disease, comprising at least one epitope characteristic of EBV.
PCT/EP2008/004992 2007-04-13 2008-04-11 Treatment of autoimmune diseases Ceased WO2008125366A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0707208.5A GB0707208D0 (en) 2007-04-13 2007-04-13 Novel disease treatments
GB0707208.5 2007-04-13

Publications (2)

Publication Number Publication Date
WO2008125366A2 true WO2008125366A2 (en) 2008-10-23
WO2008125366A3 WO2008125366A3 (en) 2009-07-16

Family

ID=38116725

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/004992 Ceased WO2008125366A2 (en) 2007-04-13 2008-04-11 Treatment of autoimmune diseases

Country Status (2)

Country Link
GB (1) GB0707208D0 (en)
WO (1) WO2008125366A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2390334C1 (en) * 2008-12-17 2010-05-27 Государственное образовательное учреждение высшего профессионального образования "Санкт-Петербургский государственный медицинский университет имени академика И.П. Павлова Федерального агентства по здравоохранению и социальному развитию" Method of treating multiple sclerosis
ITRM20130206A1 (en) * 2013-04-05 2014-10-06 Univ Roma GENOTYPE VERSIONS OF EPSTEIN BARR VIRUSES AND THEIR USES AS POSSIBLE RISK PREDICTORS, THERAPEUTIC BIOMARKERS AND TARGETS IN MULTIPLE SCLEROSIS
US20150176089A1 (en) * 2012-06-18 2015-06-25 The United States of America, as Represented by th e Secretary,Department of Health and Human Servic Methods and compositions for identifying jc virus
US20150344976A1 (en) * 2013-01-08 2015-12-03 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
US10495641B2 (en) 2013-01-08 2019-12-03 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
WO2022146869A1 (en) * 2020-12-29 2022-07-07 The Board Of Trustees Of The Leland Stanford Junior University Diagnostics and therapeutics for ebv in ms and other autoimmune diseases
CN114990240A (en) * 2022-06-01 2022-09-02 昆明理工大学 Multiple qPCR detection reagent for detecting gynecological disease exogenous pathogens
US20230193398A1 (en) * 2020-04-22 2023-06-22 Nicca Chemical Co., Ltd. Nucleic acid detection method and oligonucleotide probe

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4550086A (en) * 1983-02-16 1985-10-29 Dana-Farber Cancer Institute, Inc. Monoclonal antibodies that recognize human T cells
JPH03503887A (en) * 1988-02-03 1991-08-29 エクソウマ コーポレーション Therapeutic use of anti-T cell immunotoxins for autoimmune diseases
IL89953A (en) * 1989-02-03 1994-04-12 Xoma Corp Pharmaceutical composition comprising anti-t cell immunotoxin for use in treating autoimmune disease
CA2059824A1 (en) * 1991-02-26 1992-08-27 Thomas M. Aune Hybridomas and monoclonal antibodies that inhibit anti-cd3-stimulated t cell proliferation
JPH07504399A (en) * 1991-08-28 1995-05-18 ザ・ウィスター・インスティチュート Treatment for chronic rheumatoid arthritis based on T-cell receptors
US7888458B1 (en) * 1993-11-30 2011-02-15 John B. Harley Diagnostics and therapy of epstein-barr virus in autoimmune disorders
US7790153B2 (en) * 1994-04-12 2010-09-07 Research Development Foundation Method of treating rheumatoid arthritis using orally administered type one interferons
US5833987A (en) * 1995-06-07 1998-11-10 Trustees Of Dartmouth College Treatment of T cell mediated autoimmune disorders
US7273613B1 (en) * 1997-01-13 2007-09-25 The Board of Regents, The University of Oklahoma Diagnostics and therapy of Epstein-Barr virus in autoimmune disorders
ATE311199T1 (en) * 1999-05-07 2005-12-15 Genentech Inc TREATMENT OF AUTOIMMUNE DISEASES WITH ANTAGONISTS THAT BIND SURFACE MARKERS OF B CELLS
US20040002474A1 (en) * 1999-10-07 2004-01-01 Maxygen Inc. IFN-alpha homologues
WO2001037868A1 (en) * 1999-11-24 2001-05-31 Oklahoma Medical Research Foundation Assays and therapies for latent viral infection
SE0002045D0 (en) * 2000-05-31 2000-05-31 Sahltech Ab New use
AU2002230758A1 (en) * 2000-12-11 2002-06-24 Tufts University Treatment and prevention of EBV infection and EBV-associated disorders
CA2463935A1 (en) * 2001-09-18 2003-03-27 Chiron Corporation Methods for treating multiple sclerosis
DE10148417A1 (en) * 2001-09-29 2003-04-17 Andreas Schwarting Use of interferon-ß for the therapy of systemic lupus erythematosus
AU2002346581A1 (en) * 2001-11-26 2003-06-10 Chiron Corporation Antagonist anti-cd40 monoclonal antibody therapy for multiple sclerosis treatment
US20060057107A1 (en) * 2001-12-21 2006-03-16 Shaked Ze Ev Combination treatment for multiple sclerosis
JP2006513139A (en) * 2002-07-03 2006-04-20 ザ・ブリガーム・アンド・ウーメンズ・ホスピタル・インコーポレーテッド Central airway administration for systemic delivery of therapeutic agents
EP1575514A2 (en) * 2002-07-31 2005-09-21 Seattle Genetics, Inc. Anti-cd20 antibody-drug conjugates for the treatment of cancer and immune disorders
SI1613350T1 (en) * 2003-04-09 2009-08-31 Genentech Inc Therapy of autoimmune disease in a patient with an inadequate response to a tnf-alpha inhibitor
WO2005009466A1 (en) * 2003-07-24 2005-02-03 Universita' Degli Studi Di Perugia Methods and compositions for increasing the efficiency of therapeutic antibodies using alloreactive natural killer cells
US20060257363A1 (en) * 2004-03-10 2006-11-16 Pepgen Corporation Treatment using an interferon
EP1753455A2 (en) * 2004-06-04 2007-02-21 Genentech, Inc. Method for treating multiple sclerosis
GT200600020A (en) * 2005-01-13 2006-11-08 TREATMENT PROCEDURE
BRPI0614183A2 (en) * 2005-07-25 2011-03-15 Trubion Pharmaceuticals Inc single-dose use of cd20-specific binding molecules

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2390334C1 (en) * 2008-12-17 2010-05-27 Государственное образовательное учреждение высшего профессионального образования "Санкт-Петербургский государственный медицинский университет имени академика И.П. Павлова Федерального агентства по здравоохранению и социальному развитию" Method of treating multiple sclerosis
US9631243B2 (en) * 2012-06-18 2017-04-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods and compositions for identifying JC virus
US20150176089A1 (en) * 2012-06-18 2015-06-25 The United States of America, as Represented by th e Secretary,Department of Health and Human Servic Methods and compositions for identifying jc virus
US20150344976A1 (en) * 2013-01-08 2015-12-03 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
US9617607B2 (en) * 2013-01-08 2017-04-11 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
US9933427B2 (en) 2013-01-08 2018-04-03 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
US10495641B2 (en) 2013-01-08 2019-12-03 Enzo Biochem, Inc. Diagnosis and treatment of viral diseases
US12061198B2 (en) 2013-01-08 2024-08-13 Enzo Biochem, Inc Diagnosis and treatment of viral diseases
WO2014162304A1 (en) 2013-04-05 2014-10-09 Università Degli Studi Di Roma "La Sapienza" Epstein barr virus genotipic variants and uses thereof as risk predictors, biomarkers and therapeutic targets of multiple sclerosis
ITRM20130206A1 (en) * 2013-04-05 2014-10-06 Univ Roma GENOTYPE VERSIONS OF EPSTEIN BARR VIRUSES AND THEIR USES AS POSSIBLE RISK PREDICTORS, THERAPEUTIC BIOMARKERS AND TARGETS IN MULTIPLE SCLEROSIS
US20230193398A1 (en) * 2020-04-22 2023-06-22 Nicca Chemical Co., Ltd. Nucleic acid detection method and oligonucleotide probe
WO2022146869A1 (en) * 2020-12-29 2022-07-07 The Board Of Trustees Of The Leland Stanford Junior University Diagnostics and therapeutics for ebv in ms and other autoimmune diseases
CN114990240A (en) * 2022-06-01 2022-09-02 昆明理工大学 Multiple qPCR detection reagent for detecting gynecological disease exogenous pathogens
CN114990240B (en) * 2022-06-01 2024-05-10 昆明理工大学 Multiple qPCR detection reagent for detecting gynecological disease exogenous pathogens

Also Published As

Publication number Publication date
GB0707208D0 (en) 2007-05-23
WO2008125366A3 (en) 2009-07-16

Similar Documents

Publication Publication Date Title
Serafini et al. Dysregulated Epstein-Barr virus infection in the multiple sclerosis brain
Serafini et al. Epstein-Barr virus latent infection and BAFF expression in B cells in the multiple sclerosis brain: implications for viral persistence and intrathecal B-cell activation
Niller et al. Regulation and dysregulation of Epstein–Barr virus latency: implications for the development of autoimmune diseases
Végső et al. Lymphoproliferative disorders after solid organ transplantation—classification, incidence, risk factors, early detection and treatment options
Van Aalderen et al. BK virus infection in transplant recipients: clinical manifestations, treatment options and the immune response
Severa et al. EBV stimulates TLR‐and autophagy‐dependent pathways and impairs maturation in plasmacytoid dendritic cells: implications for viral immune escape
Cavalcante et al. Epstein‐Barr virus persistence and reactivation in myasthenia gravis thymus
Valyi-Nagy et al. Herpes simplex virus type 1 latency in the murine nervous system is associated with oxidative damage to neurons
Deshpande et al. Herpes simplex virus-induced keratitis: evaluation of the role of molecular mimicry in lesion pathogenesis
Koyanagi et al. Herpes simplex virus-1 evasion of CD8+ T cell accumulation contributes to viral encephalitis
Chentoufi et al. The herpes simplex virus type 1 latency-associated transcript inhibits phenotypic and functional maturation of dendritic cells
Roy et al. Blockade of PD-1 and LAG-3 immune checkpoints combined with vaccination restores the function of antiviral tissue-resident CD8+ TRM cells and reduces ocular herpes simplex infection and disease in HLA transgenic rabbits
Andersen et al. Treatment options for Epstein-Barr virus-related disorders of the central nervous system
Nicoli et al. The HIV-1 Tat protein induces the activation of CD8+ T cells and affects in vivo the magnitude and kinetics of antiviral responses
Biolatti et al. The human cytomegalovirus tegument protein pp65 (pUL83): a key player in innate immune evasion
Deshpande et al. Herpetic eye disease: immunopathogenesis and therapeutic measures
Abedi et al. Preventive effect of IgG from EBV‐seropositive donors on the development of human lympho‐proliferative disease in SCID mice
Machala et al. Restriction of human cytomegalovirus infection by galectin-9
Delecluse et al. Epstein-Barr virus induces expression of the LPAM-1 integrin in B cells in vitro and in vivo
Gmyrek et al. Herpes simplex virus 1 (HSV-1) 0ΔNLS live-attenuated vaccine protects against ocular HSV-1 infection in the absence of neutralizing antibody in HSV-1 gB T cell receptor-specific transgenic mice
SoRelle et al. Multiple sclerosis and infection: history, EBV, and the search for mechanism
Trapp-Fragnet et al. Marek’s disease virus prolongs survival of primary chicken B-cells by inducing a senescence-like phenotype
Larcher et al. Role of Epstein‐Barr virus and soluble CD21 in persistent polyclonal B‐cell lymphocytosis
Watanabe et al. The role of polymorphonuclear leukocyte infiltration in herpes simplex virus infection of murine skin
Kasprzak et al. Epstein-Barr virus (EBV) infection in B-cell non-Hodgkin's lymphomas in children: virus latency and its correlation with CD21 and CD23 molecules.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08759309

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08759309

Country of ref document: EP

Kind code of ref document: A2