WO2008124109A2 - System for pulling out regulatory elements using yeast - Google Patents
System for pulling out regulatory elements using yeast Download PDFInfo
- Publication number
- WO2008124109A2 WO2008124109A2 PCT/US2008/004474 US2008004474W WO2008124109A2 WO 2008124109 A2 WO2008124109 A2 WO 2008124109A2 US 2008004474 W US2008004474 W US 2008004474W WO 2008124109 A2 WO2008124109 A2 WO 2008124109A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- plasmid
- gene
- protein
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
Definitions
- HOLLENBACH Andrew D., New La, LA (US); JOHANSON, Kelly E., New La, LA (US).
- the present invention relates to processes of using microorganisms to measure or test interaction between nucleic acids and protein.
- the present invention more specifically relates to an improved method for the in vivo identification and optional characterization of genomic DNA sequences that interact with DNA-binding proteins.
- the present invention further relates to a kit useful for carrying out the method of the invention.
- the present invention further provides vectors and vector components configured for expression of fusion proteins in yeast and bacteria, or for cloning of genomic DNA.
- the present invention also provides vectors and vector components that allow inserted nucleic acid sequences that are deleterious to a host cell to be cloned successfully.
- DNA molecules and proteins RNA molecules and proteins, two or more proteins or RNA molecules, or ligands and receptors.
- alteration e.g., modifications causing changes in the expression or binding capacity of transcription factors
- alveolar rhabdomyosarcoma is a form of cancer characterized by a t(2;13)(q35;ql4) chromosomal translocation that results in the fusion of two myogenic transcription factors: Pax3 and FKHR (FOXOIa).
- transcription factor describes any protein required to initiate or regulate DNA transcription in eukaryotes.
- ARMS is an aggressive solid muscle tumor occurring predominantly in children. It has a poor prognosis, and an approximate event-free four- year survival rate of only 17%.
- Pax3-FKHR little is known about the genes directly regulated by Pax3 or FKHR, or how their expression may be altered by the Pax3-FKHR fusion protein.
- reticulocytes immunoglobin — the iron- containing oxygen-transport metalloprotein in red blood cells — while nerve cells do not.
- the particular DNA sequences that encode the mRNA in a cell can be cloned by using retroviral reverse transcriptase to make DNA copies of the mRNA (the copies are called "complimentary DNA,” or cDNA clones) isolated from the cell.
- cDNA libraries contain only sequences expressed as mRNA in the particular cell-type used to generate the library, but they lack the intronic (intragenic), non-coding sequences of genomic DNA, which were spliced out of the transcribed RNA seqeunces by posttranscriptional modification.
- cDNA libraries also contain 5' and 3 1 untranslated regions (5'-UTR and 3'-UTR), wluch arc ll ⁇ i ⁇ -COuii ⁇ g iluclcOti ⁇ c ⁇ cgiOi ⁇ S at citllcf ciiCi Oi each iliRNA ⁇ ilolcCUic, ailu ucfiVc from 5'-UTR and 3'-UTR), wluch arc ll ⁇ i ⁇ -COuii ⁇ g iluclcOti ⁇ c ⁇ cgiOi ⁇ S at citllcf ciiCi Oi each iliRNA ⁇ ilolcCUic, ailu ucfiVc from 5' and 3 1 untranslated regions (5'-UTR and 3'-UTR), wluch arc ll ⁇ i ⁇ -COuii ⁇ g iluclcOti ⁇ c ⁇ cgiOi ⁇ S at citllcf
- the 5'- and 3'-UTRs may contain protein binding sites, and can be involved in regulating expression of the adjacent gene.
- a cDNA library is also of limited use in identifying promoter-proximal elements, which are non- coding regions that lie much closer to transcriptional start sites (e.g., 100-200 base pairs upstream) and also provide protein binding sites, but which are not contained within mRNA, and so are not contained in cDNA libraries. Still, the relative proximity of promoter elements makes them easier to find than enhancers. Because enhancer and promoter elements are so fundamental to the regulation of transcription, and because the dysregulation of transcription can lead to disease, methods of identifying and characterizing enhancer and promoter have generated tremendous interest.
- Genomic DNA is all the DNA sequences comprising the genome (the total genetic information carried) of a cell or organism, and a genomic DNA library is a collection of clones that contains the entire genome.
- genomic DNA libraries are often contained within plasmid vectors.
- genomic DNA libraries are derived directly from genomic DNA, not mRNA, and so contain non-coding DNA (including introns) as well as coding DNA (exons). Creating genomic DNA libraries is difficult, however, because of the relatively low efficiency of E. colt transformation and the number of colonies that can be grown on a culture plate.
- a genomic DNA library must contain a sufficient number of independently-derived clones that the probability is high ( ⁇ 95%) that every DNA sequence of the organism is contained within the library.
- the difficulty of creating such libraries is compounded by the effects of some cloned genomic DNA fragments, which may contain promoter or enhancer elements, sequences that encode toxic peptides, or other unstable elements.
- a clone containing a promoter or enhancer may drive transcription into the plasmid vector, thus interfering with the vector's replication or expression of drug resistance.
- the resulting library would lack genomic DNA clones bearing those sequences because bacteria bearing those clones would die, yet those are some of the very sequences that are the object of study by the methods of this invention.
- Mutation of either a DNA-binding protein or a genomic regulatory element may disrupt their ability to interact, thereby producing dire consequences by altering the biological processes under their control. Such mutations can form the basis of congenital diseases, or of certain cancers. While many DNA-binding proteins and the nucleic acid sequences they recognize have been identified, there remains a need for improved methods to investigate and identify the manner in which they interact, the genomic contexts of these sequences, the downstream genes they in turn control, the biological processes they regulate.
- yeast two-hybrid (Y2H) system (Fields and Song 1989; see also U.S. Patent No. 5,955,280) represented a ground-breaking development in the identification of novel protein- protein interactions, and points the way to methods for identifying interactions between nucleic acids and proteins.
- the Y2H system allows rapid demonstration of in vivo interactions between proteins, along with easy isolation of the nucleic acid sequences that encode the interacting proteins.
- the Y2H system exploits one of the features shared by many eukaryotic transcription factors that carry two separable, functional domains: a first domain serves to recognize and bind to specific DNA sequences (the DNA binding domain, or "DB”); and a second domain activates the RNA- polymerase complex (the activation domain, or "AD”).
- a "bait" protein is expressed in yeast cells as a fusion protein comprising a DNA binding domain (e.g., the GAL4 DB) and a protein of interest ("X").
- the same yeast cell expresses a "fish" protein as a fusion protein comprising an activation domain (e.g., the GAL4 AD) and another protein of interest ("Y").
- an activation domain e.g., the GAL4 AD
- Y another protein of interest
- the DNA binding domain of the complex binds a cognate DNA sequence, while the activation domain of that complex triggers expression of a reporter gene (e.g., HIS3 or lacZ).
- yeast cells containing interacting proteins X and Y are auxotrophic for histidine on media lacking histidine, only yeast cells bearing interacting X and Y proteins will grow and form colonies because only those cells will express histidine. Such colonies can be identified visually on solid media, isolated, and subjected to further analysis.
- the genetic sequence corresponding to protein X may be determined by isolating the corresponding plasmid DNA and subjecting it to sequence analysis.
- Many variants of the Y2H system exist see, e.g., U.S. Pat. No. 5,955,280).
- a "reverse two-hybrid" (R2H) system permits identification of interaction between proteins (just as with the traditional Y2H system), but through counterselection techniques also allows testing of the relative strength of that interaction.
- expression of the URA3 gene which encodes orotidine-5'- ⁇ hosphate, is lethal to yeast in the presence of medium containing 5-fluoroorotic acid (5-FOA).
- Yeast expressing URA3 can also be identified by growing them on media lacking uracil.
- URA3 can be used either for positive or negative selection — it is a selectable/counterselectable reporter gene.
- a counterselectable reporter gene is useful in identifying mutations that disrupt interactions between proteins. For example, if the interaction of X and Y moieties (on bait and fish fusion proteins, respectively) triggers expression of the URA3 gene, yeast expressing X and Y will not grow on media containing 5-FOA. However, if X and Y can no longer interact (e.g., because of a fortuitous or an intentional mutation in either moiety), yeast expressing the disruptive mutation(s) will now be able to grow on media containing 5-FOA but will not be able to grow on media lacking uracil. Thus, these techniques enable not just identification of interacting proteins, but also the analysis of points of contact between partners.
- the yeast one-hybrid (YlH) system (Li and Herskowitz, 1993), derived from the Y2H system for detecting protein-protein interactions, provided the first in vivo method to isolate and identify a protein that interacts with a known DNA sequence. Briefly, a library of genomic yeast DNA sequences was cloned into an expression vector upstream of and in frame with a GAL4 activation domain sequence, producing protein coding sequences fused to the GAL4 AD — an expression library. The expression library was transformed into a yeast reporter strain containing a lacZ reporter gene under the control of four copies of a yeast autonomous replicating sequence (ARS) consensus sequence (ACS).
- ARS yeast autonomous replicating sequence
- Hybrid proteins that recognized the ACS binding site activated transcription of lacZ, turning the cell blue in a /9-galactosidase assay.
- the methods of the present invention bear similarities to the yeast one-hybrid system (Li & Herskowitz, 1993).
- the yeast one-hybrid system uses an oligonucleotide, containing a known DNA recognition site, as "bait” for unknown DNA-binding proteins.
- the methods of the present invention employ known or putative DNA-binding proteins as "bait” to screen a stable genomic DNA library containing all DNA recognition sites within the genome, both known and unknown.
- the yeast one-hybrid system described above uses a genomic DNA library contained in an expression vector, a system that inherently introduces bias to the screening method.
- the methods of the present invention use a stable genomic library designed to eliminate such bias.
- a known DNA-binding protein e.g., a transcription factor
- all prior reports of YlH screens have failed to appreciate or anticipate that the expression library used is biased because the plasmid vector itself can drive transcription and translation of the inserted DNA, resulting in sequence rearrangements, small deletions in the insert, or outright loss of the insert.
- the DNA-binding protein expressed from the inserted DNA may be toxic to host cell.
- fusion of the yeast transcriptional activation domain to the carboxyl terminus of the DNA-binding protein expressed from the DNA inserted in to a vector may inhibit the ability of the DNA-binding protein to interact with its recognition sequence, while its fusion to the amino terminus of the DNA-binding protein expressed from the DNA inserted in to a vector may be toxic to host cells.
- genomic DNA inserted into a vector contains a promoter or enhancer sequence itself, it too may drive transcription and result in unintended or toxic effects. Therefore, such genomic DNA sequences will not be identified to any DNA-bindin ⁇ protein because the deleterious effects they produce in conventional YlH systems will delete them from the genomic library.
- ChIP Chrin immunoprecipitation
- ChIP-PET ChIP paired-end diTag
- ChIP-chip ChIP microarray
- Chromatin from the cells is isolated, and the DNA is sheared or restriction-digested into small fragments (some of which are also comprised of crosslinked DNA).
- Crosslinked DNA-binding proteins are immunoprccipitated using protein- specific antibodies, and so co-immunoprecipitating any attached DNA attached to the proteins.
- the crosslinking is reversed, and polymerase chain reaction (PCR) is used to amplify specific DNA sequences to identify those that were bound to the protein and co-immunoprecipitnted with the antibody.
- PCR polymerase chain reaction
- the isolated fragments can be cloned into a plasmid vector for subsequent sequence analysis. Either method provides a population of DNA fragments that are able to interact with the particular DNA-binding protein used.
- ChIP-PET (Wei et al., 2006) is an enhanced ChIP technique whereby two 18 base-pair sequence tags, one from each end of a DNA fragment isolated by ChIP, are extracted and joined together. The joined tags are then sequenced to identify transcription factor binding sites. Finally, ChIP and ChIP-PET techniques may be enhanced further by hybridizing the extracted sequences to a microarray chip (ChIP-chip) (Ren et al., 2000). [0026] While ChIP and its variants can provide valuable information regarding binding sites for DNA-binding proteins — transcription factors in particular — the methods suffer significant limitations. ChIP analysis requires extensive cellular manipulations with multiple steps that must be optimized for each individual DNA-binding protein to be analyzed.
- ChIP analysis is also dependent on the ability to express the desired DNA-binding protein in a suitable cell type.
- the major disadvantage of ChIP techniques is the requirement for highly specific antibodies for each protein to be tested.
- the immunoprecipitation steps of ChIP analysis can be limited severely by the lack of suitable antibodies specific for the DNA-binding protein, and so may require the creation of an epitope-tagged protein (e.g., incorporating an HA or c-Myc moiety at the C- or N-terminus of the DN ⁇ -binding protein).
- any epitope tag added may be masked when the DNA-binding protein is bound to the DNA, severely inhibiting the ability of the epitope-specific antibody to immunoprecipitate the DNA-binding protein.
- ChIP is performed in a cellular context, the analysis is limited to identifying regulatory elements active only in that particular cell type. In the ChIP-chip procedure, analysis is limited to the regions of genomic DNA present on the microarray chips. Finally, ChIP-chip analysis requires the purchase and maintenance of expensive microarray systems, in addition to experienced personnel to assist in analyzing the results.
- the methods of the present invention are distinct from other methods in that they involve a stable genomic library present in a plasmid vector and are directed at identifying DNA regulatory elements, not just at identifying a synthetic DNA recognition sequence homolog or an unknown DNA-binding protein.
- Our assay provides a method of identifying specific gene targets of transcription factors or other DNA-binding proteins by testing their ability to directly bind genomic elements in vivo.
- This method has distinct advantages over other screening methods presently available in that it involves an assay that is directly dependent on the binding of known or suspected DNA-binding proteins (e.g., Pax3, FKHR, or Pax3-FKHR) to the promoter elements that they control, made available in a stable genomic DNA library, and therefore allows for a full examination of the natural, in vivo genomic DNA substrates of any protein.
- known or suspected DNA-binding proteins e.g., Pax3, FKHR, or Pax3-FKHR
- the present invention features, in one aspect, a method for determining whether a test protein interacts with a test nucleic acid sequence, the method comprising: (a) providing a population of competent cells wherein a plurality of the cells of said population contain: (i) a reporter gene operably linked to a test nucleic acid sequence; (ii) a fusion gene, wherein the fusion gene expresses a hybrid protein, said hybrid protein comprising a test protein covalently bonded to a gene activating moiety; and (b) detecting expression of the reporter gene as a measure of the ability of the test protein to interact with the test nucleic acid sequence, wherein the test nucleic acid sequence in the population of competent cells is derived from a genomic DNA library.
- the genomic DNA library is a stable genomic DNA library.
- the reporter gene may be selected from the group consisting of selectable reporter genes, counterselectable reporter genes, and selectablc/counterselectable reporter genes.
- the reporter gene may also be selected from the group consisting of amino acid biosynthetic genes, nucleic acid biosynthetic genes, and antibiotic resistance genes.
- the reporter gene may also be selected from the group consisting of LEU2, H1S3, TRPl, and URA3.
- the reporter gene and test nucleic acid sequence may be located on a first plasmid, and the first plasmid may comprise one or more transcription terminators upstream of the test nucleic acid sequence and one or more transcription terminators downstream of the reporter gene.
- the first plasmid is a low copy number plasmid, and may further comprise a first selectable marker.
- the first plasmid is pKAD202.
- the fusion gene may be located on a second plasmid.
- the second plasmid comprises an ADHl terminator and a terminator selected from the group consisting of T3 terminator, T7 terminator, and TonB terminator, downstream of the fusion gene, and wherein the second plasmid further comprises a second selectable marker, wherein the second selectable marker is not the same as the first selectable marker.
- the second plasmid may be a high copy number plasmid, or it may be a low copy number plasmid.
- the second plasmid is a high copy number plasmid, it is pSMACK ⁇ Ol or pSPANK201.
- the second plasmid is a low copy number plasmid, it is pSMACK701 or pSPANK301.
- the test nucleic acid sequence preferably comprises genomic DNA, -wherein the genomic DN ⁇ is comprised of genomic DNA fragments, and wherein the genomic DNA fragments are cloned into the first plasmid.
- the test nucleic acid sequence may comprise a randomly generated sequence and/or an intentionally designed sequence.
- the test protein comprises an intentionally designed sequence.
- the test protein is selected from the group consisting of known DNA-binding proteins and suspected DNA-binding proteins.
- the test protein is selected from the group consisting of Pax3, FKHR, and Pax3-FKHR.
- the population of competent cells is yeast cells, and more preferably S. cerevi ⁇ ae cells.
- the gene activating moiety comprises the transcription activation domain of a protein selected from the group consisting of GAL4 and B42.
- This aspect of the invention further comprises isolating a cell that expresses the reporter gene, thereby producing an isolated cell.
- Plasmid DNA may be isolated from the isolated cell, at least a portion of a test nucleic acid sequence of the isolated cell may by amplified, and at least a portion of a test nucleic acid sequence of the isolated cell may be sequcnced.
- a probe may be hybridized to the DNA of the isolated cell. Genomic DNA of interest derived from the methods and processes of the present invention can be used as a probe in a DNA hybridization assay against DNA extracted from yeast colonies and organized on a solid support (e.g., a nitrocellulose filter).
- yeast colony By identifying a yeast colony to which the DNA of interest hybridizes, one immediately has identified a yeast strain containing a molecule which interacts with the protein of interest encoded by the DNA of interest.
- the regulatory element that interacts with the protein of interest can then be cloned from a yeast cell derived from a hybridization positive colony.
- the invention features a cell comprising: (i) a reporter gene operably linked to a test nucleic acid sequence; (ii) a fusion gene, wherein the fusion gene expresses a hybrid protein, said hybrid protein comprising a test protein covalently bonded to a gene activating moiety; and (b) wherein the test nucleic acid sequence in the population of competent cells is derived from a genomic DNA library.
- the genomic DNA library is a stable genomic DNA library.
- the reporter gene may be selected from the group consisting of selectable reporter genes, counterselectable reporter genes, and selectable/counterselectable reporter genes.
- the reporter gene may also be selected from the group consisting of amino acid biosynthetic genes, nucleic acid biosynthetic genes, and antibiotic resistance genes.
- the reporter gene may also be selected from the group consisting of LEU2, HIS3, TRPl, and URA3.
- the reporter gene and test nucleic acid sequence may be located on a first plasmid, and the first plasmid may comprise one or more transcription terminators upstream of the test nucleic acid sequence and one or more transcription terminators downstream of the reporter gene.
- the first plasmid is a low copy number plasmid, and may further comprise a first selectable marker.
- the first plasmid is pKAD202.
- the fusion gene may be located on a second plasmid.
- the second plasmid comprises an ADHl terminator and a terminator selected from the group consisting of T3 terminator, T7 terminator, and TonB terminator, downstream of the fusion gene, and wherein the second plasmid further comprises a second selectable marker, wherein the second selectable marker is not the same as the first selectable marker.
- the second plasmid may be a high copy number plasmid, or it may be a low copy number plasmid.
- the second plasmid is a high copy number plasmid, it is pSMACK.601 or pSPANK201.
- the second plasmid is a low copy number plasmid, it is pSMACK701 or pSPANK301.
- the test nucleic acid sequence preferably comprises genomic DNA, wherein the genomic DNA is comprised of genomic DNA fragments, and wherein the genomic DNA fragments are cloned into the first plasmid.
- the test nucleic acid sequence may comprise a randomly generated sequence and/or an intentionally designed sequence.
- the test protein comprises an intentionally designed sequence.
- the test protein is selected from the group consisting of known DNA-binding proteins and suspected DNA-binding proteins.
- the test protein is selected from the group consisting of Pax3, FKHR, and Pax3-FKHR.
- the cell is a yeast cell, and more preferably an S. cerevisiae cell.
- the gene activating moiety comprises the transcription activation domain of a protein selected from the group consisting of GAL4 and B42.
- the invention further features several genetic constructs — plasmids — which are useful in practicing various aspects of the invention.
- the genetic construct comprises a circular plasmid, further comprising: (a) a protein expression cassette, wherein the protein expression cassette comprises: (i) a GALl promoter operably linked to a multiple cloning site, a nuclear localization signal, a B42 acid blob domain, and an epitope tag; (b) a bacterial origin of replication; (c) at least one transcriptional terminator between said protein expression cassette and said origin of replication; (d) a marker gene; (e) a ROP gene between said bacterial origin of replication and said marker gene; (f) a reporter gene; (g) and an element.
- the protein expression cassette comprises: (i) a GALl promoter operably linked to a multiple cloning site, a nuclear localization signal, a B42 acid blob domain, and an epitope tag; (b) a bacterial origin of replication; (c)
- a preferred 5' to 3' order for the protein expression cassette is: GALl promoter, multiple cluimig Mte, nuclear localization signal, B42 acid blob domain, epitope tag, transcriptional terminator, and another preferred 5 1 to 3' order is: GALl promoter, nuclear localization signal, B42 acid blob domain, epitope tag, multiple cloning site, transcriptional terminator.
- the at least one transcriptional terminator is configured to terminate RNA transcripts entering said bacterial origin of replication from said protein expression cassette.
- the marker gene is selected from the group consisting of ampicillin resistance gene, kanamycin resistance gene, and chloramphenicol acetyltransferase gene.
- the reporter gene is selected from the group consisting of LEU2, HIS3, TRPl, and URA 3.
- the element may be a 2 ⁇ sequence or a CEN4 centromeric sequence and an ARS6 origin of replication (CEN4/ARS6 origin of replication).
- the genetic construct is ⁇ SMACK601, pSMACK701, pSPANK201, or pSPANK301.
- the genetic construct comprises a circular plasmid, further comprising: a multiple cloning site (MCS) upstream of a minimal promoter operably linked to a reporter gene; a bacterial origin of replication; a yeast origin of replication; a first marker gene, a repressor of primer (ROP) gene; a second marker gene; and one or more transcription terminatorss.
- MCS multiple cloning site
- the 5' to 3' order of the features is: MCS; minimal promoter operably linked to a reporter gene; first transcription terminator; first marker gene; ROP gene; second marker gene; yeast origin of replication; second transcription terminator; bacterial origin of replication; and third transcription terminator.
- the minimal promoter and reporter gene may be a minimal H1S3 promoter and HIS3, respectively.
- the first marker gene may be an ampicillin resistance gene, or a kanamycin resistance gene.
- the second marker gene may be selected from the group consisting of LEU2, HIS3, TRPl, and URA 3.
- the yeast origin of replication may be 2 ⁇ , but is preferably CEN4/ARS6.
- the bacterial origin of replication may be CoIEl; the transcription terminators may be selected from the group consisting of T7, T3, TonB, and ADHl terminator sequences.
- the genetic construct is pKAD202.
- gene is meant a nucleic acid (e.g., deoxyribonucleic acid, or "DNA”) sequence that comprises coding sequences necessary for the production of a polypeptide or precursor (e.g., messenger RNA, or "mRNA").
- the polypeptide may be encoded by a full length coding sequence or by any portion of the coding sequence, so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) are retained.
- the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5 1 and 3' ends, for a distance of about 1 kb on either end, such that the gene is capable of being transcribed into a full-length mRNA.
- the sequences located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences, and form the 5 1 untranslated region (5' UTR).
- the sequences located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences, and form the 3' untranslated region (3' UTR).
- the term "gene” encompasses both cDNA and genomic forms of a gene.
- Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript, and therefore are absent from the mRNA transcript. mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
- nucleotide is meant a monomeric structural unit of nucleic acid (e.g., DNA or RNA) consisting of a sugar moiety (a pentose: ribose, or deoxyribose), a phosphate group, and a nitrogenous heterocyclic base.
- the base is linked to the sugar moiety via a glycosidic bond (at the 1 ' carbon of the pentose ring) and the combination of base and sugar is called a nucleoside.
- nucleoside contains a phosphate group bonded to the 3' or 5 1 position of the pentose, it is referred to as a nucleotide.
- nucleotide monophosphate When the nucleotide contains one such phosphate group, it is referred to as a nucleotide monophosphate; with the addition of two or three such phosphate groups, it is called a nucleotide diphosphate or triphosphate, respectively.
- nucleotide bases are derivatives of purine or pyrimidine, with the most common purines being adenine and guanine, and the most common pyrimidines being thymidine, uracil, and cytosine.
- a sequence of operatively linked nucleotides is typically referred to herein as a "base sequence” or “nucleotide sequence” or “nucleic acid sequence,” and is represented herein by a formula whose left-to-right orientation is in the conventional direction of 5'-terminus to 3'-terminus.
- a "test nucleic acid sequence” is a nucleic acid sequence used according to the methods of the present invention to measure or test interaction between said nucleic acid sequence and a protein.
- the test nucleic acid sequence may be a genomic DNA fragment.
- polynucleotide molecule is mcaiii a molecule comprised of muitipie nucleotides. Nucleotides are the basic unit of DNA, and consist of a nitrogenous base (adenine, guanine, cytosine, or thymine), a phosphate molecule, and a deoxyribose molecule. When linked together, they form polynucleotide molecules.
- DNA molecules are said to have "5 1 ends” and "3' ends” because mononucleotides are joined to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction, via a phosphodiester linkage. Therefore, an end of an oligonucleotide is referred to as the "5' end” if its 5'- ⁇ hosphate is not linked to the 3' oxygen of a mononucleotide pentose ring.
- a double stranded nucleic acid molecule may also be said to have 5'- and 3' ends, wherein the "5"' refers to the end containing the accepted beginning of the particular region, gene, or structure, and die “3"' refers to the end downstream of the 5' end.
- a nucleic acid sequence even if internal to a larger oligonucleotide, may also be said to have 5' and 3' ends, although these ends are not free ends.
- the 5' and 3 1 ends of the internal nucleic acid sequence refer to the 5 1 and 3' ends that said fragment would have were it isolated from the larger oligonucleotide.
- discrete elements may be referred to as being "upstream” or 5 1 of the "downstream” or 3' elements.
- Ends are said to "compatible” if: a) they are both blunt or contain complementary single strand extensions (such as that created after digestion with a restriction endonuclease); and b) at least one of the ends contains a 5' phosphate group. Compatible ends are therefore capable of being ligated by a double stranded DNA ligase (e.g., T4 DNA ligase) under standard conditions. Nevertheless, blunt ends may also be ligated.
- promoter is meant a DNA sequence usually found at the 5' region of a gene, proximal to the start codon. Transcription of an adjacent gene is initiated at the promoter region. If the promoter is an inducible promoter, the rate of transcription increases in response to an inducing agent.
- minimal promoter is meant a promoter is the noncoding sequence upstream (5 1 direction) of a gene, providing a site for RNA polymerase to bind and initiate transcription.
- a minimal promoter is the minimal elements of a promoter, including a TATA box and transcription initiation site, and is inactive unless regulatory enhancer elements are situated upstream.
- enhancer is meant a regulatory sequence of DNA that may be located a great distance (thousands of base pairs) upstream or downstream from the gene it controls, or even within an intron of the gene it controls. Binding of DNA-binding proteins to an enhancer influences the rate of transcription of the associated gene.
- operably linked is meant that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein.
- a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence.
- a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence.
- a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second, separate nucleic acid sequence.
- operably linked means that the DNA sequences being linked are contiguous, although they need not be, and that a gene and a regulatory sequence or sequences (e.g., a promoter) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins — transcription factors — or proteins which include transcriptional activator domains) arc bound to the regulatory sequence or sequences.
- a gene and a regulatory sequence or sequences e.g., a promoter
- genomic DNA is meant all the DNA sequences comprising the genome (the total genetic information carried) of a cell or organism
- genomic DNA library is meant a collection of genomic DNA that includes all the DNA sequences of a given species (e.g., a human genomic DNA library, or a simply human genomic library).
- human genomic double-stranded DNA is cleaved with restriction endonudease or mechanically sheared (e.g., by sonication), generating millions of “genomic DNA fragments.” These fragments are cloned (inserted via ligation) into plasmids, thus creating recombinant DNA molecules.
- the recombinant molecules are introduced in to bacteria by standard means known in the art, generating millions of different colonies of transfected bacterial cells. Each of these colonies is clonally derived from a single ancestor cell, and so contains many copies of a particular region of the fragmented genome.
- the plasmids are referred to as containing a genomic DNA clone, and the collection of plasmids is a genomic DNA library.
- a genomic DNA library is said to be "stable" when the library is constructed in such a manner that the genomic DNA insert does not promote unwanted transcription into the vector housing the library, which would induce recombination and destabiliza ⁇ ' on of the vector, and the vector is maintained at a low copy number.
- the vector may lack a promoter upstream of the inserted genomic DNA, it may contain terminator sequences configured to flank the inserted genomic DNA, and it may contain a CEN4/ARS6 low-copy-number yeast origin of replication.
- a preferred example of such a vector is pKAD202, described more fully below.
- genomic DNA ligand is meant a stretch of genomic DNA that provides or represents a binding site for a DNA-binding protein (i.e., a segment of DNA that is necessary and sufficient to specifically interact with a given polypeptide, such as a DNA-binding protein).
- the portion of the DNA-binding protein that specifically interacts with the genomic DNA ligand is referred to as a “ligand binding domain” or "DNA-binding domain.”
- DNA-binding protein is meant any of numerous proteins which can or may specifically interact with a nucleic acid.
- a DNA-binding protein used in the invention can be the portion of a transcription factor which specifically interacts with a nucleic acid sequence in the promoter of a gene.
- the DNA-binding protein can be any protein which specifically interacts with a sequence which is naturally-occurring or artificially inserted into die promoter of a reporter gene.
- the DNA-binding protein can be covalcntly bonded to a solid support (e.g., the DNA-binding protein may be expressed as a fusion protein, bearing an epitope tag, which epitope tag may facilitate binding to the solid support, which may be agarose beads).
- a "test protein” may be shown to be a "DNA-binding protein” by the methods of the invention.
- fusion or “hybrid” protein, DNA molecule, or gene is meant a chimera of at least two covalently bonded polypeptides or DNA molecules
- DNA-binding domain or “DNA-binding moiety” is meant a polypeptide sequence or cluster which is capable of directing specific polypeptide binding to a particular DNA sequence (i.e., to a genomic DNA ligand).
- domain in this context is not intended to be limited to a single discrete folding domain. Rather, consideration of a polypeptide as a "DNA-binding domain” for use in the methods of this invention can be made simply by the observation that the polypeptide has specific DNA binding activity or that the polypeptide shares sequence similarity with proteins having known DNA-binding activity.
- gene activating moiety or “transcription activation domain” is meant a stretch of amino acids that is covalently bonded to a test protein (i.e., as a fusion protein), wherein the gene activating moiety is capable of inducing the expression of a gene (e.g., a reporter gene) that is operably linked to an upstream test nucleic acid sequence when the test nucleic acid sequence contains a genomic DNA ligand for the test protein and the protein binds to the genomic DNA ligand.
- a gene e.g., a reporter gene
- protein or “polypeptide” is meant a sequence of amino acids of any length, constituting all or a part of a naturally-occurring polypeptide or peptide, or constituting a non- naturally occurring polypeptide or peptide (e.g., a randomly generated peptide sequence or one of an intentionally designed collection of peptide sequences).
- a “test protein” or “test polypeptide” is a protein used according to the methods of the present invention to measure or test interaction between nucleic acids and said test protein or test polypeptide.
- expression or “gene expression” is meant transcription (e.g., from a gene) and, in some cases, translation of a gene into a protein, or “gene product.”
- a DNA chain coding for the sequence of gene product is first transcribed to a complementary RNA, which is often a messenger RNA, and, in some cases, the transcribed messenger RNA is then translated into the gene product — a protein.
- RNA complementary RNA
- the terms are also used to mean the degree to which a gene is active in a cell or tissue, measured by the amount of mRNA in the tissue and/or the amount of protein expressed.
- vectors are used in reference to extra-chromosomal nucleic acid molecules capable of replication in a cell and to which an insert sequence can be operatively linked so as to bring about replication of the insert sequence.
- Vectors are used to transport DNA sequences into a cell, and some vectors may have properties tailored to produce protein expression in a cell, while others may not.
- a vector may include expression signals such as a promoter and/or a terminator, a selectable marker such as a gene conferring resistance to an antibiotic, and one or more restriction sites into which insert sequences can be cloned.
- Vectors can have other unique features (such as the size of DNA insert they can accommodate).
- a plasmid or plasmid vector is an autonomously replicating, extrachromosomal, circular DNA molecule (usually double-stranded) found mostly in bacterial and protozoan cells. Plasmids are distinct from the bacterial genome, although they can be incorporated into a genome, and are often used as vectors in recombinant DNA technology.
- prokaryotic termination sequence refers to a nucleic acid sequence, recognized by an RNA polymerase, that results in the termination of transcription.
- Prokaryotic termination sequences commonly comprise a GC-rich region that has a twofold symmetry, followed by an AT-rich sequence.
- prokaryotic termination sequences are the ADHl, T7, T3, and TonB termination sequences.
- a variety of Lcrtrui'iali ⁇ sequence., arc known m die art and may be employed in the nucleic acid constructs of the present invention, including the TV n -, T L1 , T 1 ⁇ , T R1 , R R2 , T 6 ⁇ termination signals derived from the bacteriophage lambda, and termination signals derived from bacterial genes such as the trp gene of E. colt.
- reporter gene is meant a gene whose expression can be assayed as a measure of the ability of two test molecules to interact (i.e., as a measure of protein/DNA interactions).
- a useful reporter gene is operably linked to an upstream test nucleic acid sequence, which may or may not contain a DNA-binding-protein recognition site, to which a reconstituted transcription factor or DNA-binding protein of interest or test protein binds.
- Such genes include, without limitation, lacZ, amino acid biosynthetic genes (e.g., the yeast LEU2, HIS3, LYS2, or TRPl), URA3 genes, nucleic acid biosynthetic genes, the bacterial chloramphenicol transacetylase (CAT) gene, and the bacterial gus gene.
- Certain reporter genes are considered to be “selectable,” “counterselectable,” or “selectable/countcrselectable” reporter genes, as is described below
- selectable reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, confers a growth advantage on cells containing it.
- selectable reporter genes include LEU2 and TRPl.
- counterselectable reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, prevents the growth of a cell containing it. Examples of countcrselectable reporter genes include URA3, LYS2, GALl, CYH2, and CANl.
- selectable/counterselectable reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, is lethal to a cell containing it, and when it is expressed a different set of conditions, confers a selective growth advantage on cells containing it.
- a single gene can be used as both a selectable reporter gene and a counterselectable reporter gene.
- selectable/counterselectable reporter genes include URA3, LYS2, and GALl .
- a combination of a selectable reporter gene and a counterselectable reporter gene can be used in lieu of a single selectable/counterselectable reporter gene.
- yeast cells may first be transfected with plasmid bearing a selectable reporter gene, and transformants identified by their growth on appropriate media (e.g, synthetic complete media lacking leucine). These transformants could then be transformed with a second plasmid bearing a counterselectable reporter gene, and double-transformants identified by their growth on appropriate media (e.g., synthetic complete media lacking leucine and uracil, but containing 5-FOA).
- appropriate media e.g, synthetic complete media lacking leucine
- selectable marker refers to a gene or other DNA fragment that encodes or provides an activity conferring the ability to grow or survive in what would otherwise be a deleterious environment.
- a selectable marker may confer resistance to an antibiotic or drug (e.g., ampicillin or kanamycin) upon the host cell in which the selectable marker is expressed.
- An origin of replication (Ori) may also be used as a selectable marker enabling propagation of a plasmid vector. Further examples include, without limitation, kanamycin resistance genes, ampicillin resistance genes, LEU2, TRPl, and HIS3.
- ROP gene is meant a gene encoding the repressor of primer protein, which regulates plasmid DNA replication by modulating the initiation of transcription. It is used to keep plasmid copy number low, thus preventing or minimizing potentially toxic effects to host cells that may arise from cloned genomic DNA fragments.
- expression vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding sequence (e.g., an insert sequence that codes for a product) in a particular host cell.
- Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences.
- epitope tag is meant to include, but not be limited to a GST (glutathione-S- transferase) tag, an HA (haemagglutinin) tag, a Myc tag, a FLAG tag, and a His tag.
- GST glutthione-S- transferase
- HA haemagglutinin
- oil of replication refers to a DNA sequence conferring functional replication capabilities in a host cell. Examples include, but are not limited to, normal or non-conditional origin of replications such as the CoIEl origin, and its derivatives, which are functional in a broad range of host cells.
- An origin of replication may be a "high copy number” or "low copy number” origin of replication.
- non-promoter sequence refers to any nucleic acid sequence that is unable to serve as an operable promoter element for initiating transcription in a given host cell, such as a bacterial host cell, or a eukaryotic host cell.
- the host cell in which the non-promoter sequence is unable to serve as an operable promoter is an E. coli host cell.
- the terms "insert sequence” or “foreign DNA” refer to any nucleic acid sequences that are capable of being placed in a vector. Examples include, but are not limited to, random DNA libraries and known nucleic acid sequences.
- a particular "insert sequence” or “foreign DNA” may refer to a pool or a member of a pool of identical nucleic acid molecules, a pool or a member of a pool of non-identical nucleic acid molecules, or a specific individual nucleic acid molecule (e.g., nucleotide sequences encoding Pax3, FKHR, or other proteins).
- covalently bonded is meant that two molecules (e.g., DNA molecules or proteins) arc joined by covalent bonds, directly or indirectly.
- the "covalently bonded” proteins or protein moieties may be immediately contiguous, or they may be separated by stretches of one or more amino acids within the same hybrid protein.
- target protein or "target DNA molecule” is meant a peptide, protein, domain of a protein, or nucleic acid molecule whose function (i.e., whose ability to interact with a second molecule) is being characterized with the methods of the invention.
- a target protein may further comprise an epitope tag, and so exist as a fusion protein.
- Such a fusion protein or target fusion protein may also be "immobilized" on a solid support (e.g., agarose or Sepharose®), which means that the fusion protein has been purified or isolated by affinity chromatography, using a solid support that has attached to it a moiety (e.g., glutathione) with affinity for the epitope tag (e.g., a GST epitope tag).
- a solid support e.g., agarose or Sepharose®
- a moiety e.g., glutathione
- affinity for the epitope tag e.g., a GST epitope tag
- genomic DNA ligands relate to the ability of the person skilled in the art to detect and distinguish interaction between genomic DNA ligands and target proteins from false positive interactions due to non-specific interaction, and optionally to characterize at least one of said interacting genomic DNA ligands by one or a set of unambiguous features including but not limited to direct sequencing.
- said genomic DNA ligands are characterized by the DNA sequence encoding them, upon isolation, polymerase chain reaction amplification, and sequencing of the respective DNA molecules, according to the methods of the present invention.
- host cell or "competent cell” refers to any cell that can be transformed with heterologous DNA (such as a plasmid vector).
- heterologous DNA such as a plasmid vector.
- host cells include, but are not limited to: Saccharomjces cerevis ⁇ ae strains W303 (ATCC #200060), K2346 (ATCC #200864), K2348 (ATCC #200865), DYl 50 (ATCC #96029), K699 (ATCC #200903), K700 (ATCC
- E. coli strains that contain the F or P factor (e.g., DH5 ⁇ F or DHSaF * ) or E. coli strains that lack the F or F factor (e.g., DHlOB).
- F or P factor e.g., DH5 ⁇ F or DHSaF *
- E. coli strains that lack the F or F factor e.g., DHlOB
- the term "population" in the context of competent cells or host cells refers to the whole number of such cells in a given sample, colony, or clone. It may be the total of such cells occupying an area on solid medium or some other limited and separated space (e.g., an eppendorf flask). It may also refer to a body, grouping, or cluster of such cells having a particular characteristic in common (e.g., Leucine auxotrophy), or a group of such cells from which samples are taken for measurement.
- isolated cell refers to a host cell that is selected from amongst other host cells according to at least one identifiable phenotype (e.g., expression of a reporter gene confering ability to grow on synthetic medium lacking leucine), and set apart from other host cells (e.g., by manually removing and transfering a colony from a plate on which cultures are grown).
- identifiable phenotype e.g., expression of a reporter gene confering ability to grow on synthetic medium lacking leucine
- isolated plasmid DNA refers to removing cellular material, or culture medium when the plasmid DNA is produced by recombinant techniques, or removing chemical precursors or other chemicals when chemically synthesized (e.g., after PCR).
- An "isolated plasmid DNA,” then, is substantially free of culture medium, cellular material, chemical precursors, or other chemicals, depending on the method of production.
- transformation or “transfection” as used herein refers to the introduction of foreign DNA into cells (e.g., prokaryotic cells, or host cells).
- Transformation may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE- dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.
- restriction endonuclease and “restriction enzyme” is meant enzymes (e.g., bacterial enzymes), each of which cut double-stranded DNA at or near a specific nucleotide sequence (a cognate restriction site). Examples include, but are not limited to, BamHI, EcoRV, Hindlll, Hindi, Ncol, Sail, and Notl.
- restriction is meant cleavage of DNA by a restriction enzyme at its cognate restriction site.
- restriction site is meant a particular DNA sequence recognized by its cognate restriction endonuclease.
- purify refers to the removal of contaminants from a sample.
- plasmids are grown in bacterial host cells and the plasmids are purified by the removal of host cell proteins, bacterial genomic DNA, and other contaminants. The percent of plasmid DN ⁇ is thereby increased in the sample.
- purify refers to isolation of the individual nucleic acid sequences from each other.
- sequencing or “DNA sequence analysis” refers to the process of determining the linear order of nucleotides bases in a nucleic acid sequence (e.g., insert sequence) or clone. These units are the C, T, A, and G bases.
- a nucleic acid sequence e.g., insert sequence
- clone e.g., clone.
- C, T, A, and G bases e.g., C, T, A, and G bases.
- DN ⁇ sequence of a short flanking region i.e., a primer binding site
- One method for sequencing is called dideoxy sequencing (or Sanger sequencing).
- One example for performing dideoxy sequencing uses the following reagents: 1) the DNA that will be used as a template (e.g., insert sequence); 2) a primer that corresponds to a known sequence that flanks the unknown sequence; 3) DNA nucleotides, to synthesize and elongate a new DNA strand; 4) dideoxynucleotides that mimic the G, A, T, and C building blocks to incorporate into DNA, but that prevent chain elongation, thus acting as termination bases for a DNA polymerase (the four different dideoxynucleotides also may be labeled with different fluorescent dyes for automated DNA sequence analysis); and 5) a nucleic acid polymerizing agent (e.g., DNA polymerase or Taq polymerase, both of which are enzymes that catalyze synthesis of a DNA strand from another DNA template strand).
- a nucleic acid polymerizing agent e.g., DNA polymerase or Taq polymerase, both of which are enzymes that cata
- the primer aligns with and binds the template at the primer binding site.
- the polymerizing agent then initiates DNA elongation by adding the nucleotide building blocks to the 3' end of the primer. Randomly, a dideoxynucleotide will integrate into a growing chain. When this happens, chain elongation stops and, if the dideoxynucleotide is fluorescently labeled, the label will be also be attached to the newly generated DNA strand. Multiple strands are generated from each template, each strand terminating at a different base of the template. Thus, a population is produced with strands of different sizes and different fluorescent labels, depending on the terminal dideoxynucleotide incorporated as the final base.
- This entire mix may, for example, be loaded onto a DNA sequencing instrument that separates DNA strands based on size and simultaneously uses a laser to detect the fluorescent label on each strand, beginning with the shortest.
- shotgun cloning refers to the multi-step process of randomly fragmenting target DNA into smaller pieces and cloning them en masse into plasmid vectors.
- to clone means ligation of the insert sequence into a vector capable of replicating in a host cell.
- a piece of DNA e.g., insert sequence
- a vector e.g., ligate it into a plasmid, creating a vector-insert construct
- a host usually a bacterium
- An individual bacterium is grown until visible as a single colony on nutrient media. The colony is picked and grown in liquid culture, and the plasmid containing the "cloned" DNA (the sequences inserted into the vector) is re-isolated from the bacteria, at which point there may be many millions of copies of the vector-insert construct.
- the term "done” can also refer either to a bacterium carrying a cloned DNA, or to the cloned DNA itself.
- library refers to a collection of insert sequences residing in transfected cells, each of which contains a single insert sequence from a genome, sub-doned into a vector.
- the term "electrophoresis” refers to the use of electrical fields to separate charged biomolecules such as DNA, RNA, and proteins.
- DNA and RNA carry a net negative charge because of the numerous phosphate groups in their structure. Proteins carry a charge that changes with pH, but becomes negative in the presence of certain chemical detergents.
- gel electrophoresis biomolecules are put into wells of a solid matrix typically made of an inert porous substance such as agarose. When this gel is placed into a bath and an electrical charge applied across the gd, the biomolecules migrate and separate according to size, in proportion to the amount of charge they carry.
- the biomoiecules can be stained for viewing (e.g., with ethidium bromide or with Coomassie dye) and isolated and purified from the gds for further analysis.
- Electrophoresis can be used to isolate pure biomolecules from a mixture, or to analyze biomolecules (such as for DNA sequencing).
- PCR and “amplifying” refer to the polymerase chain reaction method of enzymatically “amplifying” or copying a region of DNA.
- This exponential amplification procedure is based on repeated cycles of denaturation, oligonudeotide primer annealing, and primer extension by a DNA polymerizing agent such as a thermostable DNA polymerase (e.g., the Taq or TfI DNA polymerase enzymes isolated from The ⁇ nus aquaticus or Thermits flavus, respectively).
- a DNA polymerizing agent such as a thermostable DNA polymerase (e.g., the Taq or TfI DNA polymerase enzymes isolated from The ⁇ nus aquaticus or Thermits flavus, respectively).
- oligonudeotide refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 100 residues long (e.g., between 15 and 50), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonudeotide is referred to as a "24-mer”. Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
- the term "primer” refers to an oligonudeotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of nucleic acid synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH).
- the primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
- the primer is an oligodeoxyribonucieotide.
- the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer, and the use of the method.
- target in regards to PCR, refers to the region of nucleic acid bounded by the primers. Thus, the “target” is sought to be sorted out from other nucleic acid sequences. A “segment” is defined as a region of nucleic acid within the target sequence.
- PCR product refers to the resuitant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing, and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
- FIG. 1 is a schematic representation of the protein expression cassette in bait vectors pSMACK ⁇ Ol and pSMACK701, used for galactose -inducible expression of a transcription factor of interest with a C-terminal fusion tag.
- FIG. 2 is a schematic representation of the protein expression cassette in bait vectors pSPANK201 and pSPANK301, used for galactose-inducible expression of a transcription factor of interest with an N-terminal fusion tag.
- FIG. 3 is a map of bait vector pSMACK601, which uses the C-terminal fusion expression cassette and contains the 2 ⁇ high-copy number yeast origin of replication.
- FIG. 4 is a map of bait vector pSMACK701, which uses the C-terminal fusion expression cassette and contains the CEN4/ARS6 low-copy number yeast origin of replication.
- FIG. 5 is a map of bait vector pSPANK201, which uses the N-terminal fusion expression cassette and contains the 2 ⁇ high-copy number yeast origin of replication.
- FIG. 6 is a map of bait vector pSPANK301, which uses the N-terminal fusion expression cassette and contains the CEN4/ARS6 low-copy number yeast origin of replication.
- FIG. 7 is a photograph of yeast cells that have been transformed with pSMACK ⁇ Ol, pSMACK701, pSPANK201, and pSPANK301, respectively, plated on synthetic complete media lacking leucine.
- FIG. 8 is a schematic representation of the HIS3 reporter gene that operably linked to the minimal HIS3 promoter in reporter vector pKAD202.
- FIG. 9 is a map of reporter vector pKAD202, which contains the histidine reporter
- FIG. 10 is a photograph of yeast cells that have been transformed with pKAD202 and plated on synthetic complete media lacking tryptophan.
- FIG. 11 shows yeast one-hybrid control DNA transformations. Yeast were transformed with the indicated pKAD202 constructs and plated onto galactose Synthetic Dropout (SD) media that contained all required amino acids (Complete) or SD media deficient for either tryptophan (- Trp) or tryptophan and histidine (-Trp, -His). The indicated number of yeast were grown for three days at 30°C.
- SD galactose Synthetic Dropout
- FlG. 12 is a schematic representation of the Yeast PORE technique according to the methods of the present invention, using Pax3 as a representative DNA-binding protein.
- FIG. 13 shows the results of an electrophoretic mobility shift assay (EMSA) demonstrating the binding of Pax3 to physiologically relevant promoter elements, which include Msx2, Trp-1 with one Pax3 binding site (Trpl-1) and Trp-1 with two Pax3 binding sites (Trpl-2).
- Msx2 electrophoretic mobility shift assay
- Trp-1 with one Pax3 binding site
- Trpl-2 Trp-1 with two Pax3 binding sites
- FIG. 14 shows the results of an EMSA demonstrating that Pax3 binds oligonucleotide sequences (IX Oligo and 2X Oligo), regions of thcPax3-regulated mouse promoter elements Msx2, Trp-1 (1), which contains one Pax3 recognition sequence and Trp-1 (2), which contains two Pax3 recognition sequences), and the respective promoter deletion mutants that have had the Pax3 recognition sequence specifically deleted (Msx2 ⁇ 10, Trp-1 ⁇ 34, and Trp-1 ⁇ 16) cloned into pKAD202.
- Probes were generated by end-labeling double-stranded oligonucleotides with ⁇ 32 P- dATP or PCR labeling with ⁇ x 32 P-dGTP. Probes were incubated with or without 6x-His-Pax3 or GST-PAX3 at 25°C, and the complexes were resolved on a 6% Tris-glycine polyacrylamide gel. The free probes are designated by the bottom bracket, and the shifted Pax3:DNA complex by the asterisk to the right of each gel.
- FIG. 15 shows that the pSMACK ⁇ Ol vector does not activate the HIS reporter in the presence of the pKAD202 constructs.
- the pSMACK ⁇ Ol plasmid was co- trans formed with all pKAD202 constructs into wild type yeast (W303) and transformants selected on CM-Trp-Leu plates containing dextrose. Positive transformants were then plated on CM-Trp-Leu plates containing dextrose (left) or galactose (middle). Activation of the His reporter was tested by plating on CM- Trp-Leu-His plates containing galactose (right). The pKAD202 constructs used are listed on the left.
- FlG. 16 is a schematic diagram of the yeast one-hybrid screen according to the methods of the present invention.
- FIG. 17 is a schematic diagram of the tests designed to eliminate false positive clones, and is to be read in conjunction with FIG. 16.
- yeast strains used in the invention can be grown and maintained with standard methods. Saccharomyces cerevisiae are particularly useful in the invention. S. cmvisiae strains with functional GAL4 and GAL80 genes and that are auxotrophic for histidine, leucine, and tryptophan are particularly useful in the invention. Examples of such strains include, without exception, strains W303 and K2346.
- bait vectors pSMACK601, pSMACK701, pSPANK201 , and pSPANK301 are derivatives of the pSMART®LC-Amp cloning vector (Lucigen Corp., Middleton, WI), and are designed to allow for galactose-inducible expression of a transcription factor of interest cloned into a multiple cloning ("multi-cloning") site.
- the expressed protein is fused to a tag containing a yeast nuclear localization signal, the B42 acid blob domain, and an HA tag at either the carboxyl- or amino-terminus of the protein (FIGS. 1 and 2, respectively).
- All four plasmids offer the following features: (i) the LEU2 gene, which acts as a selectable marker in yeast; (ii) the Ampicillin resistance gene and Col El origin of replication to allow for selection and propagation in E. coli.; (iii) a protein expression cassette comprising a GALl promoter, which allows for galactose inducible expression, a multiple cloning site, a hemagglutinin (HA) epitope tag, a nuclear localization signal, and a B42 acid blob domain; (iv) an ADHl terminator; (v) TonB, T7, and T3 terminator sequences; (vi) a repressor of primer (ROP) gene; and (vii) either a CEN4/ARS1 yeast origin of replication, which allows the plasmid to be maintained at low copy numbers, or a 2 ⁇ yeast origin of replication, which allows the plasmid to be maintained at high copy number plasmids.
- the LEU2 gene
- pSMACKOOl (FIG. 3, TABLE 1 , and SEQ ID NO: 1)
- pSMACK701 (FIG. 4, TABLE 2, and SEQ ID NO:2) are designed to express the transcription factor of interest with a carboxyl-terminal fusion of the tag described above.
- pSMACK.601 also contains the 2 ⁇ sequence, which allows the plasmid to be maintained at high copy numbers in yeast, while pSMACK701 contains the yeast ARS6 origin of replication and the CEN4 centromeric sequence, yielding a low copy number in yeast.
- Both vectors were constructed by first amplifying the LEU2 gene from the plasmid P G ⁇ DT7-Rec2 using LEU2F primer (5'-CGTCTAGACCTACCCTATGAACATATTCC-S') (SEQ ID NO:3) and LEU2R primer (S'-CGTCTAGACCTATTGTTTTTTCCAATAGG-S') (SEQ ID NO:4), which added an Xbal site to each end of the resulting PCR product.
- the PCR product was digested with Xbal and subsequently ligated into the Xbal site of pSMART LC AMP to generate the intermediate plasmid, pSLIOl.
- an oligonucleotide MPT (S'-AATTGCTGCAGC-S') (SEQ ID NO:5) was self- annealed to create a linker with Mfel ends and an internal Pstl site. This linker was ligated into the EcoRI site of the pSLIOl construct, destroying the EcoRI site and adding a unique Pstl site to generate the intermediate, pSL102.
- oligonucleotide, mHB (S'-AGCTGCGAGATCTCGC-S 1 ) (SEQ ID NO:6) was then self-annealed to create a linker with modified HindIII ends and an internal BgIII site. This linker was ligated into the HindIII site of pSL102, destroying the HindIII site and adding a unique BgIII site resulting in the intermediate, pSL103.
- the protein expression cassette (bp 6446-1330) containing the GALl promoter, fusion region, and ADHl terminator sequence was amplified from pJG4-5 using the primers pJGF (5'- CGGATCCGCTCGGTACCCCATTATCTTAGCG-3 1 ) (SEQ ID NO:7) and pGJR (5'- CGGATCCGTGTGGAAGAACGATTAC-S') (SEQ ID NO:8), which added a BamHI site to each end of the cassette.
- the PCR product was digested and ligated into the BgIII site of pSL103, destroying both the BamHI and BgIII sites and yielding the intermediate, pSMIOl .
- the plasmid pSMIOl was then used as a template to amplify the 300b ⁇ fusion tag described in the first paragraph with primers MCSF: (5'- CGCAAGCTTGGATCCGCGGCCGCCATGGAGCTCCCGGGTCGACGCGTCGAATCCGG TGCTCCTCCAAAAAAGAGAAAGG-S * ) (SEQ ID NO:9) and MCSR (5'- CGCAAGCTTTTAGGGAGAGGCATAATCTGGCACATCATAAGG-S') (SEQ ID NO: 10), which added a HindIII site to each end of the tag and a unique multi-cloning site at the 5' end.
- the plasmid pSMIOl was then digested with HindIII to remove the original fusion tag, and the PCR- generated tag was digested and ligated into the HindIII site resulting in the intermediate, pSMCl 01. Correct orientation of the new fusion tag was determined by PCR using the primers pJGF and MCSR.
- the pSMClOl intermediate is the base vector for both pSMACK601 and pSMACK701, they deviate only in the choice of gene used for yeast replication.
- the 2 ⁇ sequence was isolated from pJG4-5 by digestion with Pstl and ligated into the Pstl site of pSMClOl.
- pSMACK701 (FIG. 4, TABLE 2, and SEQ ID NO:2) was a two-step process.
- the oligonucleotides PEPT (5'-GGATATCCAG-3 t ) (SEQ ID NO:! !)-a ⁇ d PEPE (5 1 - CTGGATATCCTGCA-3') (SEQ ID NO:12) were annealed, digested with Pstl and ligated into the Pstl site of pSMClOl to create pSMC102.
- This construct now contains a unique PvuII site, flanked by EcoRV sites within the original Pstl site.
- pSPANK201 SEQ ID NO:13
- SEQ ID NO:14 SEQ ID NO:14
- the pSMIOl intermediate is the base vector for both plasmids.
- the 2 ⁇ yeast origin of replication sequence was isolated from pJG4-5 by digestion with Pstl and ligated into the Pstl site of pSMIOl. TABLE 3 pSPANK201 (6704bp) Feature Location
- pSPANK301 SEQ ID NO:14
- the oligonucleotides PEPT and PEPB were annealed, digested with Pstl and ligated into the Pstl site of pSMIOl to create pSM102.
- the region containing both the CEN4 and ARS6 genes was removed form the plasmid pHis2 with PvuII and ligated into the PvuII site of pSM102 to yield pSPANK301.
- pSPANK301 (6450bp) Feature Location
- the four bait vectors (pSMACK ⁇ Ol, pSMACKJOl, pSPANK201, and pSPANK301) were transformed by standard methods into the wild-type yeast strain W303, and plated on synthetic complete medium lacking leucine (Sc-L) to test the ability of the plasmid-borne LEU2 gene to express a functional protein, and to test the ability of the 2 ⁇ (pSMACK ⁇ Ol; pSPANK201) or
- FIG. 7 demonstrates that expression of a LEU2 gene can be induced in cells and confers a Leu + phenotype on cells.
- FIG. 7 also demonstrates the ability of the transformed yeast to grow on Sc-L whether the plasmid contains 2 ⁇ or CEN4/ARS6 elements.
- Plasmid pKAD202 also contains: (i) the TRPl gene, which acts as a selectable marker in yeast; (ii) the Kanamycin gene and Col El bacterial origin of replication to allow for selection on plates containing kanamycin and propagation, respectively, in E.
- FIG. 8 shows a schematic representation of the HIS3 reporter gene that operably linked to the minimal HIS3 promoter in reporter vector pKAD202. This sequence also contains a novel multiple cloning site to allow the insertion of a genomic DNA library or sequences with known DNA-binding recognition sequences for use as positive controls.
- the strong termination sequences arc indicated by the arrows and are as follows: 1) the TonB termination sequence is located immediately 3' of the H1S3 gene; 2) the T7 termination sequence is located immediately 3' of the CEN4/ARS6 sequence; and 3) the T3 termination sequence is located between the CoIEl bacterial origin of replication and the multiple cloning site.
- the features of reporter vector pKAD202 and their relative positions are shown in FlG. 9 and TABLE 5.
- the vector was constructed by first amplifying the CEN4/ARS6 region from the plasmid pHR307a (Mastick et al., 1995; Accession #DQ012948) using NCOARSL primer 5'- ACTCACACCATGGCAGACATCTGTGAATCGCTTCACGACCA-S 1 (SEQ ID NO: 16) and APAARSR primer 5 I -ACTCACAGGGCCCATGTGTCAAAGGTTTTCACCGTCATCACCGA-3 I (SEQ ID NO:17). These primers added Ncol (NCOARSL) and Apal (APAARSR) ends to the PCR amplification product, flanking the CEN4/ARS6 region.
- NCOARSL Ncol
- APAARSR Apal
- the TRPl gene was amplified from pHR307a using APATRPL primer 5'- ACTCACAGGGCCCTGGAATTAATTCCACATGTTAAATAGTGA-S' (SEQ ID NO:18) and NCOTRPR primer 5'-ACTGTGCCCTCCATGGAATTAATTCGGTCGA-3 1 (SEQ ID NO: 19). These primers also added Ncol (NCOTRPR) and Apal (APATRPL) ends to the PCR amplification product, flanking the TRPl gene.
- NCOTRPR Ncol
- APATRPL Apal ends to the PCR amplification product, flanking the TRPl gene.
- CEN4/ARS6 and TRPl fragments were digested with Ncol and Apal restriction endonucleases, and a three-way ligation was performed with Apal-digested pSMART®LCKan to generate an intermediate piasmid, denoted pKSlOl.
- the HIS3 reporter cassette which contains the minimal HIS3 promoter sequence, the HIS3 coding sequence, the HIS3 3'-un translated region (UTR), and minimal HIS3 termination sequence, was amplified from the plasmid pHIS2 (BD Biosciences, Palo Alto, CA) using HISF primer 5'-GAATTCCCGGGGAGCTCA-3 I (SEQ ID NO:20) and HISR primer 5'- CAATTGGTCGACGCTCTCCCTTA-S 1 (SEQ ID NO:21). These primers added an EcoRI site to the 5' end (HISF) of the amplified product and a Mfel site to the 3' (HISR) end of the amplified product, flanking the HIS3 reporter cassette. The PCR product was digested with EcoRI and ligated into the EcoRI site of pKSlOl, destroying the EcoRI site at the 3' end of the reporter cassette. This intermediate was denoted pKS102.
- This oligonucleotide was self-annealed to generate a double-stranded DNA fragment that contains EcoRI ends.
- the self-annealed fragment was cloned into the remaining EcoRI site of pKS102 to yield the plasmid pKAD202 (FlG 9; SEQ ID NO:15).
- Reporter vector pKAD202 was transformed into the wild-type yeast strain W303 by standard methods, and plated on synthetic minimal media lacking tryptophan. The result is shown in FIG.
- FIG. 10 is a photograph of yeast cells that have been transformed with pKAD202 and plated on synthetic complete media lacking tryptophan.
- FIG. 10 demonstrates that pKAD202 is functional in yeast; the TRPl gene expresses a functional protein, and that the CEN4/ARS6 allows for replication of the plasmid.
- Pax3 was cloned into the four bait vectors with and without its transcriptional activation domain.
- Full length Pax3 was first cloned into pSMACK ⁇ Ol and pSMACK701 by PCR amplifying the entire Pax3 coding region using PAX3F primer 5'- CGGGATCCATGACCACGCTGGCCGGC-3' (SEQ ID NO:23) and PAX3R primer 5'- GCCGTCGACGTGCAATATCTGGCTTGAGATAATGAAAGGC-S' (SEQ ID NO:24). PCR amplification using these primers added a BamHI and Sail site to the 5' and 3' ends of Pax3, respectively.
- the PAX3R primer was also engineered to create a carboxyl-terminal fusion between Pax3 and the haemagglutinin (HA) epitope tag, yeast nuclear localization sequence, and the yeast transcriptional activation domain present in the pSMACK vectors.
- the resulting Pax3 product was digested with these restriction enzymes and directionally ⁇ gated into BamHI and Sail digested pSMACK ⁇ Ol andpSMACK701.
- PAX3F primer SEQ ID NO:23
- PAX3T primer 5 1 -CGGGTCGACCTG ⁇ ATTCTGAGGTGAGACGCC-3 I SEQ ID NO:25
- PAX3T primer was also engineered to create a carboxyl- terminal fusion between Pax3 and the haemagglutinin (HA) epitope tag, yeast nuclear localization sequence, and the yeast transcriptional activation domain present in the pSMACK vectors.
- This linker was ligated to the Pax3 BamHI/XhoI fragment containing the Pax3 coding region, resulting in a Pax3 DNA sequence with EcoRI and Xhol ends.
- the ligation reaction was then briefly digested with EcoRI to remove excess linkers and purified using a QIAGEN nucleotide removal kit.
- the resulting Pax3 insert was then ligated into the EcoRI/XhoI sites of ⁇ SPANK201 and ⁇ SPANK301.
- Truncated Pax3 was cloned into pSPANK201 and pSPANK301 by ligating an EcoRI /Xli ⁇ l fragment containing the truncated sequence into the EcoRl/XhoI sites of both vectors.
- Full-length FKHR was cloned into pSMACK ⁇ Ol and pSMACK701 by amplifying the entire coding region using FKF primer 5'-CGGGATCCATGGCCGAAGCGCCCCAGGTG-S' (SEQ ID NO:28) and FKR primer 5'-GCCGTCGACGGCCTGACACCCAGCTATGTCG-S' (SEQ ID NO:29). PCR amplification using these primers added a BamHI and Sail site to the 5' and 3' ends of FKHR, respectively. The resulting FKHR product was digested and ligated into BamHJ and Sail digested pSMACK ⁇ Ol andpSMACK701.
- Full length FKHR was cloned into ⁇ SPANK201 and pSPANK301 using a two-step process.
- oligonucleotides BKET SEQ ID NO:26
- BKEB SEQ ID NO:27
- This linker was ligated to a BamHI/XhoI fragment containing the FKHR coding region, resulting in a FKHR DNA sequence with EcoRI and Xhol ends.
- the ligation reaction was then briefly digested with EcoRI to remove excess linkers, and purified using a QlAGEN nucleotide removal kit.
- the resulting FKHR insert was then ligated into the EcoRI/XhoI sites of pSPANK201 and pSPANK301.
- This yeast strain is auxotrophic for tryptophan, leucine, and histidine and will not grow in the absence of these nutrients or in the absence of the expression of the proper nutritional marker (e.g., the LEU2 gene present on the bait vectors).
- the resulting yeast trans formants were grown on synthetic agar plates lacking leucine to select for yeast that were successfully transformed with the vectors.
- Pax3 Several in vivo targets of Pax3 have been identified including the anti-apoptotic protein BCL-X L (Margue et al., 2000); c-MET, a receptor tyrosine kinase involved in growth and motility signaling (Epstein et al., 1996); and Tyrosinase Related Protein-1 (TRP-I), a molecule involved in the genesis of pigmentation (Galibert et al., 1999).
- BCL-X L the anti-apoptotic protein BCL-X L
- c-MET a receptor tyrosine kinase involved in growth and motility signaling
- TRP-I Tyrosinase Related Protein-1
- the Pax3 reporter control that contains one copy of the Pax3 DNA recognition sequence was created by annealing oligonucleotide IXS 5'-
- oligonucleotide IXAS S'-TCGACATATCAAAGCGTGACGGTGCTAATCGTCACTG-S' SEQ ID NO:31
- the resulting double stranded oligonucleotide has BamHl and Sail ends, and was ligated directly into BamHI/Sal ⁇ digested pKAD202.
- the ligation mix was transformed into chemically competent DH5 ⁇ cells and plated on LB plates containing 10mg/L Kanamycin (LBKan) for selection. Kanamycin resistant colonies were screened for the presence of the appropriate insert by digestion with EcoRI.
- oligonucleotide 2XAS 5'- CGCGTATATCTAAGCGTGACGGTGCTAATCGTCACTATATCTAAGAGTGACGGTGCTAATCGT CACTGAGCT-3 1 SEQ ID NO:33.
- the resulting double stranded oligonucleotide has Xhol and MIuI ends and was ligated directly into Mlul/Sall digested pKAD202. Positive transformants were selected as described above.
- the BcI-XL promoter region (SEQ ID NO:34) was PCR amplified from mouse genomic DNA using BcIF primer S'-CAGGATCCCTGCAGGGGGCTCCAGAAGG-S' (SEQ ID NO:35) and BdR primer S'-GCACGCGTTCATGAATTGCGAAGCTTAGGACCT-S' (SEQ ID NO:36);
- the Msx2 promoter region (SEQ ID NO:37) was PCR amplified from mouse genomic DNA using primer Ms ⁇ 2F 5'-CGGGATCCGATATCTCTACCTAAATTCCCTGCTGAGGAGCTC-S' (SEQ ID NO:38) and primer Msx2R 5'- CGACGCGTGATATCTAACCGTGAAGCGTTGAGCACAGA-S' (SEQ ID NO:39); and the Trpl promoter region (SEQ ID NO:40) was PCR amplified from mouse genomic DNA using primer TrpF 5'-CGGGATCCGATATCAAGCTTTTACCACTGT
- the pCR®II vector is a linearized vector with a one-base deoxythymidine overhang on the 3'-end of each vector strand.
- This vector is engineered to take advantage of the nontemplate- dependent activity of Taq polymerase that adds a single deoxyadenosine (A) to the 3'-ends of PCR products.
- the resulting ligated DNA was transformed into One Shot® Competent Cells (Invitrogen) and bacteria containing the ligated vector were selected on LB plates containing Ampicillin overnight at 37 0 C. Individual clones were picked, analyzed by restriction digest with EcoRV, and subsequently sequenced to confirm the PCR amplification process introduced no mutations. Finally, the regulatory elements were excised from pCR®II by BamHI/Sall digest and cloned into the same site of pKAD202.
- FKHR DNA recognition sites using a systematic evaluation of ligands by exponential enrichment (SELEX) (Bouvet, 2001).
- the three classes of FKHR sites are represented by FBSl S'-GTAAACAACAACATGTTGAC-S' (SEQ ID NO:43), FBS2 5'-ACAACA(N 11 )ATAAACATGTTTAC-S' (SEQ ID NO:44), and FBS3 5'-
- TGTTTAC(N 7 )TGTTTAC-3' (SEQ ID NO:45), wherein "N” indicates any nucleotide A, T, C, or G, and the numeral subscript indicates the number of intervening nucleotides.
- N indicates any nucleotide A, T, C, or G
- the numeral subscript indicates the number of intervening nucleotides.
- Gab-1 was PCR amplified from the genomic DNA fragment present in pSMART LCKan using the SLl (new) primer 5'- CGTGAAGGTGAGCCAGTGAGTTGATTGCAGTCC-3' (SEQ ID NO:47) and SR2(new) primer 5'-CGTGCCGATCAAGTCAAAAGCCTCCGGTCGG-S' (SEQ ID NO:48).
- the resulting PCR amplification product was TA-cloned into pCRII, as described above.
- the Gab-1 sequence was subsequently recovered from pCRII by EcoRI digest, and then cloned into the EcoRI site of pKAD202.
- This yeast strain is auxotrophic for tryptophan, leucine, and histidine and will not grow in the absence of these nutrients or in the absence of the expression of the proper nutritional marker (i.e., the TRPl gene present on pKAD202).
- the resulting yeast transformants were grown on synthetic agar plates lacking tryptophan to select for yeast that were successfully transformed with the vectors, and on synthetic agar plates lacking both tryptophan and histidine to demonstrate the lack of self-activation of the reporter constructs alone.
- FIG. 12 A schematic representation of the Yeast PORE technique according to the methods of the present invention, using Pax3 as a model DNA -binding protein, is shown in FIG. 12.
- a DNA-binding protein e.g., Pax3 expressed as a fusion protein with the yeast acid blob domain
- RNA polymerase is recruited to the protein-DNA complex, transcription of HIS3 is initiated, and survival on plates lacking histidine is enabled.
- FIG. 12 A schematic representation of the Yeast PORE technique according to the methods of the present invention, using Pax3 as a model DNA -binding protein.
- Pax3 binds to physiologically relevant promoter elements, which include Msx2, Trp-1 with one Pax3 binding site (Trpl-1), and Trp-1 with two Pax3 binding sites (Trpl-2).
- Msx2 Msx2
- Trp-1 Trp-1 with one Pax3 binding site
- Trp-1 Trp-1 with two Pax3 binding sites
- TRP-1 and Msx2 gene promoter sequences were demonstrated to be bound and regulated by Pax3, and therefore serve as positive controls for the methods of the present invention.
- Pax3 binds oligonucleotide sequences (IX Oligo and 2X Oligo), regions of thePax3-regulated mouse promoter elements Msx2, Trp-1 (1), which contains one Pax3 recognition sequence and Trp-1 (2), which contains two Pax3 recognition sequences), but not the respective promoter deletion mutants that have had the Pax3 recognition sequence specifically deleted (Msx2 ⁇ 10, Trp-1 ⁇ 34, and Trp-1 ⁇ 16) cloned into pKAD202. Probes were generated by end labeling double-stranded oligonucleotides with ⁇ 32 P-dATP or PCR labeling with oc 32 P-dGTP.
- Probes were incubated with or without 6x-His-Pax3 or GST-PAX3 at 25°C, and the complexes were resolved on a 6% Tris-glycine polyacrylamide gel. The location of the free probes is indicated by the bracket at left, and the shifted Pax3:DNA complexes by the asterisks to the right of each gel.
- empty pSMACK ⁇ Ol bait vector does not activate the HIS reporter of pKAD202 in the presence of the pKAD202 constructs ' listed on the left.
- the pSMACK ⁇ Ol plasmid was co-transformed with all pKAD202 constructs indicated into wild type yeast (W303), and trans formants plated on synthetic complete media lacking tryptophan and leucine (Sc -Trp -Leu) but containing dextrose. Positive transformants were then plated on Sc -Trp -Leu plates containing dextrose (left) or galactose (middle).
- HIS reporter Activation of the HIS reporter was tested by plating on Sc -Trp -Leu plates also lacking histidine (-His) but containing galactose (right). This demonstrates that, in the absence of a DNA-binding protein (which would be encoded by a sequence inserted into the bait vector's multiple cloning site), the HIS reporter of the pKAD202 vector is not activated, as expected.
- Mouse genomic DNA is sheared by sonication, end-repaired with a DNA Terminator® End Repair Kit (Lucigen, Middleton, WI), and separated on a 1% agarose gel.
- Plasmid vector pKAD202 is restriction digested with Sail, and end-repaired with a DNA Terminator® End Repair Kit (Lucigen, Middleton, WI) to create blunt ends.
- Genomic DNA fragments between 0.5 - 2.0kb are gel purified and cloned into the prepared blunt cloning site of pKAD202.
- the resulting ligated DNA is electroporated into ElectroMAX DHlOB E. colt cells (Invitrogen, Carlsbad, CA).
- Sequencing of the inserts with SLt forward primer 5'-CAGTCCAGTTACGCTGGAGTC-S' (SEQ ID NO:49) demonstrates whether the clones isolated are derived from unique pieces of genomic DNA.
- a genomic library created in this manner contains approximately 3 to 8 x 10 6 independent clones, with DNA inserts between 0.65 - 2.0kb, providing an approximate 1.7- to 4.5-fold over- representation of the entire mouse genome. It will be appreciated by those skilled in the art that the above technique, as applied to mouse genomic DNA, is equally applicable to other mammalian genomic DNA, including human genomic DNA.
- a mouse genomic library prepared as described above, is expanded by plating the glycerol stock of bacteria (after determining the library titer as described above), reserved from above and containing the library, onto 24.5 x 24.5 cm LB agar plates containing kanamycin, and incubating the plates at 37 0 C overnight.
- the colony density is limited to approximately 20,000 colonies per plate to avoid overcrowding.
- the resulting colonies are scraped from the plate, and the DNA is isolated using a Qiagen Maxiprep kit (Qiagen, Valencia, CA.). The resulting DNA is aliquoted and stored at -80°C.
- yeast strain W303 (MATa/ MATa ADE2/ade2 CAN 1 /caul -100 C ⁇ 2/cyb2 bis3-11,15/bis3-11,15 LEU1/lnt1-cLEU2/leu2-3,112 l ⁇ p1-1:UR.43:ttp1-3' ⁇ /trp1-1 ura3-1 /t ⁇ ra3-1; ATCC #200060) or K2346 (MATa ade2-1 adr3 trp1-1 Ien2-3,112 bis3-11,15 ura3 ssd1 ⁇ ATCC #200864) were grown in YPD media (6 g yeast extract, 12 g peptone, 12 g glucose, 60 mg adenine hcmisulphate, 600 mL H 2 O, pH 7.0) overnight at 3O 0 C with continual shaking.
- SD Synthetic Dropout
- Trp tryptophan
- the cell pellet was resuspended in 1.5ml of TE buffer (10 mM Tris-Cl to pH7.5, plus 1 mM ethylenediaminetetraacetic acid) containing 0.1M lithium acetate (IiOAc).
- TE buffer 10 mM Tris-Cl to pH7.5, plus 1 mM ethylenediaminetetraacetic acid
- IiOAc lithium acetate
- Into a separate 1.5ml eppendorf tube was added l ⁇ g of the desired yeast vector, and 50 ⁇ g of high-quality sheared salmon sperm carrier DNA. 50 ⁇ l of the yeast/TE/LiOAc solution was then added to the vector/carrier DNA solution.
- Wild-type yeast are first transformed using standard techniques with the chosen bait vector carrying the coding sequence of the DNA-binding protein to be studied (FIG. 16). Positive transformants are selected by plating on synthetic minimal media lacking leucine. One colony is then selected and used to propagate a new batch of cells, which are then transformed with a pool of reporter vectors (pKAD202) containing the randomly generated genomic DNA library. Serial dilutions of yeast containing both the bait and library vectors are then plated on synthetic minimal dextrose media lacking leucine and tryptophan to calculate the transformation efficiency and ensure accurate representation of the genomic library.
- pKAD202 reporter vectors
- the positive colonies are streaked onto dextrose plates lacking leucine, tryptophan, and histidine.
- the pKAD202 vector is then isolated from the colonies that pass the second round of screening. Briefly, the positive colonies are grown in minimal media, and standard techniques are used to isolate plasmid DNA from the yeast. The resulting plasmid DNA — the pKAD202 vector containing a genomic DNA ligand — is transformed into E. coli, which are selected for by growth on LB plates containing kanamycin.
- the isolated reporter vector is re-transformed into yeast alone (i.e., without any other vector).
- the single transformants are tested using the initial screening process (FIG. 16), as described, but with the addition of leucine to all media.
- the pKAD202 vector should not rescue the cells grown under the selective conditions (lacking histidine, but containing 3-AT).
- the isolated reporter vector is then co-transformed with the bait vector into a fresh growth of yeast, and the double transformants arc tested as described previously (FIG. 16). This test confirms that the original ability to grow in the absence of histidine did not result from a yeast reversion.
- Clones that pass all rounds of false-positive tests arc considered true positive interactions.
- the multiple cloning site of the pKAD202 vector from each positive colony is then sequcnced to identify the genomic sequence bound by the transcription factor.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Disclosed are methods for identifying molecular interactions between DNA sequences and proteins in vivo. The methods of the invention employ known or suspected DNA-binding proteins and genomic DNA in a plasmid library. Interacting molecules direct the expression of a reporter gene, the expression of which is then assayed. Also disclosed are genetic constructs useful in practicing the methods of the invention.
Description
UNITED STATES PATENT APPLICATION
TITLE OF THE INVENTION
System for pulling out regulatory elements using yeast
INVENTORS
HOLLENBACH, Andrew D., New Orleans, LA (US); JOHANSON, Kelly E., New Orleans, LA (US).
CROSS-REFERENCE TO RELATED APPLICATIONS [0001] Not applicable.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] Not applicable.
THE NAMES OF THE PARTIES TO AJOINT RESEARCH AGREEMENT [0003] Not applicable.
INCORPORATION -BY-REFERENCE OF MATERIAL SUBMITTED ON COMPACT DISC
[0004| The Sequence Listing, which is a part of the present disclosure and is submitted in conformity with 37 Cl7R §§ 1.821 - 1.825, includes a computer readable form and a written sequence listing comprising nucleotide and/or amino acid sequences of the present invention. The sequence listing information recorded in computer readable form (created: 3 April 2007; filename: Sequence_Listing_Yeast_PORE_ST25; size: 54.3 KB) is identical to the written sequence listing. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION [0005] 1. Field of the Invention
[0006] The present invention relates to processes of using microorganisms to measure or test interaction between nucleic acids and protein. The present invention more specifically relates to an improved method for the in vivo identification and optional characterization of genomic DNA sequences that interact with DNA-binding proteins. The present invention further relates to a kit useful for carrying out the method of the invention. The present invention further provides vectors and vector components configured for expression of fusion proteins in yeast and bacteria, or for cloning of genomic DNA. The present invention also provides vectors and vector components that allow inserted nucleic acid sequences that are deleterious to a host cell to be cloned successfully.
[0007] 2. Description of Related Art
[0008] Numerous biologically important functions involve transient interactions between DNA molecules and proteins, RNA molecules and proteins, two or more proteins or RNA molecules, or ligands and receptors. Recognition and binding of sequence-specific DNA-binding proteins (e.g., transcription factors) to regulatory elements within the genome — which often lie outside the regions of the genome that are contained within cDNA libraries — is a critical component of the spatio- temporal control of gene expression, directing epigenetic controls important for proper cellular function in all organisms. Conservation of these control mechanisms ensures proper replication and cell division. Conversely, their alteration (e.g., modifications causing changes in the expression or binding capacity of transcription factors) is often implicated in a cell's transition to a malignant state.
[0009] For example, alveolar rhabdomyosarcoma (ARMS) is a form of cancer characterized by a t(2;13)(q35;ql4) chromosomal translocation that results in the fusion of two myogenic transcription factors: Pax3 and FKHR (FOXOIa). The term "transcription factor" describes any protein required to initiate or regulate DNA transcription in eukaryotes. ARMS is an aggressive solid muscle tumor occurring predominantly in children. It has a poor prognosis, and an approximate event-free four- year survival rate of only 17%. Despite the identification and characterization of the oncogenic fusion protein Pax3-FKHR, little is known about the genes directly regulated by Pax3 or FKHR, or how their expression may be altered by the Pax3-FKHR fusion protein.
[0010] While many techniques exist to investigate the possible gene targets and binding specificities of different transcription factors, they either are too labor-intensive to be useful in a
genomic screen, fail to use and cannot be adapted to use genomic DNA, or are subject to such levels of inherent inefficiency as to be inadequate.
[0011] Many genes of higher eukaryotes are transcribed into mRNA only in specific cell-types. For example, reticulocytes (immature red blood cells) contain mRNA for hemoglobin — the iron- containing oxygen-transport metalloprotein in red blood cells — while nerve cells do not. The particular DNA sequences that encode the mRNA in a cell can be cloned by using retroviral reverse transcriptase to make DNA copies of the mRNA (the copies are called "complimentary DNA," or cDNA clones) isolated from the cell. These single-stranded cDNA clones are converted into double-stranded DNAs and cloned into plasmid vectors, creating a cDNA library for that particular cell-type. cDNA libraries contain only sequences expressed as mRNA in the particular cell-type used to generate the library, but they lack the intronic (intragenic), non-coding sequences of genomic DNA, which were spliced out of the transcribed RNA seqeunces by posttranscriptional modification. cDNA libraries also contain 5' and 31 untranslated regions (5'-UTR and 3'-UTR), wluch arc llϋiϊ-COuiiϊg iluclcOtiϋc ϊcgiOiϊS at citllcf ciiCi Oi each iliRNA ϊilolcCUic, ailu ucfiVc from
I DNA adjacent to the gene. The 5'- and 3'-UTRs may contain protein binding sites, and can be involved in regulating expression of the adjacent gene.
[0012] In many eukaryotes, a large percentage of the total genome is comprised of non-coding DNA that does not lie near any gene. It is also clear, however, that gene transcription is often stimulated by DNA regions called "enhancers," which contain protein binding sites and may be located in non-coding regions tens of thousands of base pairs upstream or downstream from the transcriptional start site. Many mammalian genes are regulated by more than one enhancer region, and their identification and characterization represents a difficult problem. While a cDNA library can help identify the chromosomal location of a gene, it cannot reveal the locations of enhancers. A cDNA library is also of limited use in identifying promoter-proximal elements, which are non- coding regions that lie much closer to transcriptional start sites (e.g., 100-200 base pairs upstream) and also provide protein binding sites, but which are not contained within mRNA, and so are not contained in cDNA libraries. Still, the relative proximity of promoter elements makes them easier to find than enhancers. Because enhancer and promoter elements are so fundamental to the regulation of transcription, and because the dysregulation of transcription can lead to disease, methods of identifying and characterizing enhancer and promoter have generated tremendous interest.
[0013] Study of DNA outside the immediate vicinity of genes — outside the regions covered by cDNA libraries — necessitates die use of genomic DNΛ libraries. Genomic DNA is all the DNA
sequences comprising the genome (the total genetic information carried) of a cell or organism, and a genomic DNA library is a collection of clones that contains the entire genome. Like cDNA libraries, genomic DNA libraries are often contained within plasmid vectors. However, genomic DNA libraries are derived directly from genomic DNA, not mRNA, and so contain non-coding DNA (including introns) as well as coding DNA (exons). Creating genomic DNA libraries is difficult, however, because of the relatively low efficiency of E. colt transformation and the number of colonies that can be grown on a culture plate. A genomic DNA library must contain a sufficient number of independently-derived clones that the probability is high (≥ 95%) that every DNA sequence of the organism is contained within the library. The difficulty of creating such libraries is compounded by the effects of some cloned genomic DNA fragments, which may contain promoter or enhancer elements, sequences that encode toxic peptides, or other unstable elements. For example, a clone containing a promoter or enhancer may drive transcription into the plasmid vector, thus interfering with the vector's replication or expression of drug resistance. The resulting library would lack genomic DNA clones bearing those sequences because bacteria bearing those clones would die, yet those are some of the very sequences that are the object of study by the methods of this invention.
[0014] Mutation of either a DNA-binding protein or a genomic regulatory element may disrupt their ability to interact, thereby producing dire consequences by altering the biological processes under their control. Such mutations can form the basis of congenital diseases, or of certain cancers. While many DNA-binding proteins and the nucleic acid sequences they recognize have been identified, there remains a need for improved methods to investigate and identify the manner in which they interact, the genomic contexts of these sequences, the downstream genes they in turn control, the biological processes they regulate.
[0015] Therefore, identifying the regulatory elements in a genomic DNA context is critical not only for understanding their role in normal biological activities but in determining the underlying molecular mechanisms that contribute to genetic disorders and the diseased state.
[0016] Classical methods for identifying interactions between nucleic acids and proteins — e.g., co-immunoprecipitation, cross-linking, or gel-shift mobility assay — are not available for all proteins, and may not be sufficiently sensitive. Furthermore, these methods are difficult, time-consuming, involve hazardous materials, and are not amenable to screening large populations of potentially interacting partners. The yeast two-hybrid (Y2H) system (Fields and Song 1989; see also U.S. Patent No. 5,955,280) represented a ground-breaking development in the identification of novel protein-
protein interactions, and points the way to methods for identifying interactions between nucleic acids and proteins.
[0017] The Y2H system allows rapid demonstration of in vivo interactions between proteins, along with easy isolation of the nucleic acid sequences that encode the interacting proteins. The Y2H system exploits one of the features shared by many eukaryotic transcription factors that carry two separable, functional domains: a first domain serves to recognize and bind to specific DNA sequences (the DNA binding domain, or "DB"); and a second domain activates the RNA- polymerase complex (the activation domain, or "AD"). In a typical Y2H screening paradigm, a "bait" protein is expressed in yeast cells as a fusion protein comprising a DNA binding domain (e.g., the GAL4 DB) and a protein of interest ("X"). Concurrently, the same yeast cell expresses a "fish" protein as a fusion protein comprising an activation domain (e.g., the GAL4 AD) and another protein of interest ("Y"). Any interaction between the X and Y moieties of the bait and fish fusion proteins, respectively, also brings the DNA binding and activation domains of the fusion proteins into close proximity, i ne resun. is a proicm complex Cϋffipiisπϊg Λ., i , a LJVSI\ Dinαing αomain, ana an activation domain. The DNA binding domain of the complex binds a cognate DNA sequence, while the activation domain of that complex triggers expression of a reporter gene (e.g., HIS3 or lacZ).
[0018] Expression of the reporter gene allows identification and selection of yeast cells containing interacting proteins X and Y. For example, by culturing yeast that are auxotrophic for histidine on media lacking histidine, only yeast cells bearing interacting X and Y proteins will grow and form colonies because only those cells will express histidine. Such colonies can be identified visually on solid media, isolated, and subjected to further analysis. For example, the genetic sequence corresponding to protein X may be determined by isolating the corresponding plasmid DNA and subjecting it to sequence analysis. [0019] Many variants of the Y2H system exist (see, e.g., U.S. Pat. No. 5,955,280). For example, a "reverse two-hybrid" (R2H) system permits identification of interaction between proteins (just as with the traditional Y2H system), but through counterselection techniques also allows testing of the relative strength of that interaction. For example, expression of the URA3 gene, which encodes orotidine-5'-ρhosphate, is lethal to yeast in the presence of medium containing 5-fluoroorotic acid (5-FOA). Yeast expressing URA3 can also be identified by growing them on media lacking uracil. Thus, depending on growth medium composition, URA3 can be used either for positive or negative selection — it is a selectable/counterselectable reporter gene.
[0020] Furthermore, expression of a counterselectable reporter gene is useful in identifying mutations that disrupt interactions between proteins. For example, if the interaction of X and Y moieties (on bait and fish fusion proteins, respectively) triggers expression of the URA3 gene, yeast expressing X and Y will not grow on media containing 5-FOA. However, if X and Y can no longer interact (e.g., because of a fortuitous or an intentional mutation in either moiety), yeast expressing the disruptive mutation(s) will now be able to grow on media containing 5-FOA but will not be able to grow on media lacking uracil. Thus, these techniques enable not just identification of interacting proteins, but also the analysis of points of contact between partners.
[0021] Although eukaryotic protein-protein interactions can be studied with relative ease using Y2H systems, identifying interactions between genomic DNA and proteins remains difficult. While many DNA-binding proteins and their cognate nucleic acid sequences are known, the genomic context of these sequences, the genes they regulate, and the biological processes they control remain unknown. Furthermore, screening of genomic libraries for sequences recognized by DNA-binding proteins using conventional techniques is simply loo expensive, cumbersome, time-consuming, and unreliable.
[0022] The yeast one-hybrid (YlH) system (Li and Herskowitz, 1993), derived from the Y2H system for detecting protein-protein interactions, provided the first in vivo method to isolate and identify a protein that interacts with a known DNA sequence. Briefly, a library of genomic yeast DNA sequences was cloned into an expression vector upstream of and in frame with a GAL4 activation domain sequence, producing protein coding sequences fused to the GAL4 AD — an expression library. The expression library was transformed into a yeast reporter strain containing a lacZ reporter gene under the control of four copies of a yeast autonomous replicating sequence (ARS) consensus sequence (ACS). Hybrid proteins that recognized the ACS binding site activated transcription of lacZ, turning the cell blue in a /9-galactosidase assay. [0023] The methods of the present invention bear similarities to the yeast one-hybrid system (Li & Herskowitz, 1993). The yeast one-hybrid system uses an oligonucleotide, containing a known DNA recognition site, as "bait" for unknown DNA-binding proteins. In contrast, the methods of the present invention employ known or putative DNA-binding proteins as "bait" to screen a stable genomic DNA library containing all DNA recognition sites within the genome, both known and unknown. The yeast one-hybrid system described above uses a genomic DNA library contained in an expression vector, a system that inherently introduces bias to the screening method. In contrast, the methods of the present invention use a stable genomic library designed to eliminate such bias.
[0024] While it is theoretically possible to reverse the standard YlH screen, using unknown genomic DNA fragments to identify promoter elements directly bound by a known DNA-binding protein (e.g., a transcription factor), all prior reports of YlH screens have failed to appreciate or anticipate that the expression library used is biased because the plasmid vector itself can drive transcription and translation of the inserted DNA, resulting in sequence rearrangements, small deletions in the insert, or outright loss of the insert. Additionally, the DNA-binding protein expressed from the inserted DNA may be toxic to host cell. Furthermore, fusion of the yeast transcriptional activation domain to the carboxyl terminus of the DNA-binding protein expressed from the DNA inserted in to a vector may inhibit the ability of the DNA-binding protein to interact with its recognition sequence, while its fusion to the amino terminus of the DNA-binding protein expressed from the DNA inserted in to a vector may be toxic to host cells. Alternatively, if genomic DNA inserted into a vector contains a promoter or enhancer sequence itself, it too may drive transcription and result in unintended or toxic effects. Therefore, such genomic DNA sequences will not be identified to any DNA-bindinε protein because the deleterious effects they produce in conventional YlH systems will delete them from the genomic library. Unfortunately, such missing sequences are likely the very objects of a Yl H screen. Thus, the prior art fails to recognize that potentially meaningful and important interaction candidates are eliminated from most Y2H and YlH library screens, for numeous reasons, and fails to teach methods of overcoming this limitation.
[0025] Another conventional method of identifying genomic regulator}7 elements that are recognized and bound by specific DNA-binding proteins is chromatin immunoprecipitation (ChIP), and its variants: ChIP paired-end diTag (ChIP-PET) sequencing; and ChIP microarray (ChIP-chip). ChIP (Orlando et al., 1997) is a procedure used to determine whether a known protein binds to or is localized to a specific genomic DNA sequence in vivo (e.g., in mammalian cells). Using formaldehyde (a process known as "fixation"), DNA-binding proteins are crosslinked to DNA in vivo (i.e., host cells are "fixed" with formaldehyde). Chromatin from the cells is isolated, and the DNA is sheared or restriction-digested into small fragments (some of which are also comprised of crosslinked DNA). Crosslinked DNA-binding proteins are immunoprccipitated using protein- specific antibodies, and so co-immunoprecipitating any attached DNA attached to the proteins. The crosslinking is reversed, and polymerase chain reaction (PCR) is used to amplify specific DNA sequences to identify those that were bound to the protein and co-immunoprecipitnted with the antibody. Alternatively, the isolated fragments can be cloned into a plasmid vector for subsequent sequence analysis. Either method provides a population of DNA fragments that are able to interact with the particular DNA-binding protein used. ChIP-PET (Wei et al., 2006) is an enhanced ChIP
technique whereby two 18 base-pair sequence tags, one from each end of a DNA fragment isolated by ChIP, are extracted and joined together. The joined tags are then sequenced to identify transcription factor binding sites. Finally, ChIP and ChIP-PET techniques may be enhanced further by hybridizing the extracted sequences to a microarray chip (ChIP-chip) (Ren et al., 2000). [0026] While ChIP and its variants can provide valuable information regarding binding sites for DNA-binding proteins — transcription factors in particular — the methods suffer significant limitations. ChIP analysis requires extensive cellular manipulations with multiple steps that must be optimized for each individual DNA-binding protein to be analyzed. ChIP analysis is also dependent on the ability to express the desired DNA-binding protein in a suitable cell type. The major disadvantage of ChIP techniques is the requirement for highly specific antibodies for each protein to be tested. The immunoprecipitation steps of ChIP analysis can be limited severely by the lack of suitable antibodies specific for the DNA-binding protein, and so may require the creation of an epitope-tagged protein (e.g., incorporating an HA or c-Myc moiety at the C- or N-terminus of the DNΛ-binding protein). In Lhe absence of an aiitibudy specific for the protein tested, any epitope tag added may be masked when the DNA-binding protein is bound to the DNA, severely inhibiting the ability of the epitope-specific antibody to immunoprecipitate the DNA-binding protein. Because ChIP is performed in a cellular context, the analysis is limited to identifying regulatory elements active only in that particular cell type. In the ChIP-chip procedure, analysis is limited to the regions of genomic DNA present on the microarray chips. Finally, ChIP-chip analysis requires the purchase and maintenance of expensive microarray systems, in addition to experienced personnel to assist in analyzing the results.
[0027] Therefore, although certain elements of the present invention bear similarities to existing methods, the methods of the present invention are distinct from other methods in that they involve a stable genomic library present in a plasmid vector and are directed at identifying DNA regulatory elements, not just at identifying a synthetic DNA recognition sequence homolog or an unknown DNA-binding protein.
[0028J The technical problem underlying the present invention was therefore to overcome these prior art difficulties, furnishing a system that reliably produces clones bearing interacting DNA- binding proteins and their cognate DNA binding sites, and is suitable for large-scale protein-vcrsus- library screens.
[0029J The solution to the technical problem above is provided by the embodiments characterized in the claims.
BRIEF SUMMARY OF THE INVENTION
[0030] The ability to easily and quickly screen an entire genome for potential targets of a specific transcription factor would provide valuable information about some of the molecular mechanisms behind cancers, such as ARMS, as well as the sequences and genomic locations of the DNA-binding domains. To this end, we developed an improved method for in vivo screening of genomic DNA libraries in yeast — a system for "pulling out regulatory elements" in yeast, or 'Υeast PORE" — starting with Pax3, FKHR, and Pax3-FKHR as a model system. The improved methods of this invention encompass general methods that can be adapted to identify the targets of any known or suspected transcription factor or other DNA-binding protein. Our assay provides a method of identifying specific gene targets of transcription factors or other DNA-binding proteins by testing their ability to directly bind genomic elements in vivo. This method has distinct advantages over other screening methods presently available in that it involves an assay that is directly dependent on the binding of known or suspected DNA-binding proteins (e.g., Pax3, FKHR, or Pax3-FKHR) to the promoter elements that they control, made available in a stable genomic DNA library, and therefore allows for a full examination of the natural, in vivo genomic DNA substrates of any protein.
[0031] Accordingly, the present invention features, in one aspect, a method for determining whether a test protein interacts with a test nucleic acid sequence, the method comprising: (a) providing a population of competent cells wherein a plurality of the cells of said population contain: (i) a reporter gene operably linked to a test nucleic acid sequence; (ii) a fusion gene, wherein the fusion gene expresses a hybrid protein, said hybrid protein comprising a test protein covalently bonded to a gene activating moiety; and (b) detecting expression of the reporter gene as a measure of the ability of the test protein to interact with the test nucleic acid sequence, wherein the test nucleic acid sequence in the population of competent cells is derived from a genomic DNA library.
[0032] Preferably, the genomic DNA library is a stable genomic DNA library. In addition, the reporter gene may be selected from the group consisting of selectable reporter genes, counterselectable reporter genes, and selectablc/counterselectable reporter genes. The reporter gene may also be selected from the group consisting of amino acid biosynthetic genes, nucleic acid biosynthetic genes, and antibiotic resistance genes. The reporter gene may also be selected from the group consisting of LEU2, H1S3, TRPl, and URA3. Furthermore, the reporter gene and test nucleic acid sequence may be located on a first plasmid, and the first plasmid may comprise one or
more transcription terminators upstream of the test nucleic acid sequence and one or more transcription terminators downstream of the reporter gene. Preferably, the first plasmid is a low copy number plasmid, and may further comprise a first selectable marker. Most preferably, the first plasmid is pKAD202. In yet another embodiment of the invention, the fusion gene may be located on a second plasmid. Preferably, the second plasmid comprises an ADHl terminator and a terminator selected from the group consisting of T3 terminator, T7 terminator, and TonB terminator, downstream of the fusion gene, and wherein the second plasmid further comprises a second selectable marker, wherein the second selectable marker is not the same as the first selectable marker. If desired, the second plasmid may be a high copy number plasmid, or it may be a low copy number plasmid. Preferably, if the second plasmid is a high copy number plasmid, it is pSMACKόOl or pSPANK201. Preferably, if the second plasmid is a low copy number plasmid, it is pSMACK701 or pSPANK301.
[0033] In this aspect of the invention, the test nucleic acid sequence preferably comprises genomic DNA, -wherein the genomic DNΛ is comprised of genomic DNA fragments, and wherein the genomic DNA fragments are cloned into the first plasmid. If desired, the test nucleic acid sequence may comprise a randomly generated sequence and/or an intentionally designed sequence. In yet another embodiment of this aspect of the invention, the test protein comprises an intentionally designed sequence. Preferably, the test protein is selected from the group consisting of known DNA-binding proteins and suspected DNA-binding proteins. Most preferably, the test protein is selected from the group consisting of Pax3, FKHR, and Pax3-FKHR. Preferably, the population of competent cells is yeast cells, and more preferably S. cereviήae cells. Also preferably, the gene activating moiety comprises the transcription activation domain of a protein selected from the group consisting of GAL4 and B42.
[0034] This aspect of the invention further comprises isolating a cell that expresses the reporter gene, thereby producing an isolated cell. Plasmid DNA may be isolated from the isolated cell, at least a portion of a test nucleic acid sequence of the isolated cell may by amplified, and at least a portion of a test nucleic acid sequence of the isolated cell may be sequcnced. If desired, a probe may be hybridized to the DNA of the isolated cell. Genomic DNA of interest derived from the methods and processes of the present invention can be used as a probe in a DNA hybridization assay against DNA extracted from yeast colonies and organized on a solid support (e.g., a nitrocellulose filter). By identifying a yeast colony to which the DNA of interest hybridizes, one immediately has identified a yeast strain containing a molecule which interacts with the protein of
interest encoded by the DNA of interest. The regulatory element that interacts with the protein of interest can then be cloned from a yeast cell derived from a hybridization positive colony.
[0035] In a second aspect, the invention features a cell comprising: (i) a reporter gene operably linked to a test nucleic acid sequence; (ii) a fusion gene, wherein the fusion gene expresses a hybrid protein, said hybrid protein comprising a test protein covalently bonded to a gene activating moiety; and (b) wherein the test nucleic acid sequence in the population of competent cells is derived from a genomic DNA library.
[0036] Preferably, the genomic DNA library is a stable genomic DNA library. In addition, the reporter gene may be selected from the group consisting of selectable reporter genes, counterselectable reporter genes, and selectable/counterselectable reporter genes. The reporter gene may also be selected from the group consisting of amino acid biosynthetic genes, nucleic acid biosynthetic genes, and antibiotic resistance genes. The reporter gene may also be selected from the group consisting of LEU2, HIS3, TRPl, and URA3. Furthermore, the reporter gene and test nucleic acid sequence may be located on a first plasmid, and the first plasmid may comprise one or more transcription terminators upstream of the test nucleic acid sequence and one or more transcription terminators downstream of the reporter gene. Preferably, the first plasmid is a low copy number plasmid, and may further comprise a first selectable marker. Most preferably, the first plasmid is pKAD202. In yet another embodiment of this aspect, the fusion gene may be located on a second plasmid. Preferably, the second plasmid comprises an ADHl terminator and a terminator selected from the group consisting of T3 terminator, T7 terminator, and TonB terminator, downstream of the fusion gene, and wherein the second plasmid further comprises a second selectable marker, wherein the second selectable marker is not the same as the first selectable marker. If desired, the second plasmid may be a high copy number plasmid, or it may be a low copy number plasmid. Preferably, if the second plasmid is a high copy number plasmid, it is pSMACK.601 or pSPANK201. Preferably, if the second plasmid is a low copy number plasmid, it is pSMACK701 or pSPANK301.
[0037] In this aspect of the invention, the test nucleic acid sequence preferably comprises genomic DNA, wherein the genomic DNA is comprised of genomic DNA fragments, and wherein the genomic DNA fragments are cloned into the first plasmid. If desired, the test nucleic acid sequence may comprise a randomly generated sequence and/or an intentionally designed sequence. In yet another embodiment of this aspect of the invention, the test protein comprises an intentionally designed sequence. Preferably, the test protein is selected from the group consisting of
known DNA-binding proteins and suspected DNA-binding proteins. Most preferably, the test protein is selected from the group consisting of Pax3, FKHR, and Pax3-FKHR. Preferably, the cell is a yeast cell, and more preferably an S. cerevisiae cell. Also preferably, the gene activating moiety comprises the transcription activation domain of a protein selected from the group consisting of GAL4 and B42.
[0038] The invention further features several genetic constructs — plasmids — which are useful in practicing various aspects of the invention. In one aspect, the genetic construct comprises a circular plasmid, further comprising: (a) a protein expression cassette, wherein the protein expression cassette comprises: (i) a GALl promoter operably linked to a multiple cloning site, a nuclear localization signal, a B42 acid blob domain, and an epitope tag; (b) a bacterial origin of replication; (c) at least one transcriptional terminator between said protein expression cassette and said origin of replication; (d) a marker gene; (e) a ROP gene between said bacterial origin of replication and said marker gene; (f) a reporter gene; (g) and an element. A preferred 5' to 3' order for the protein expression cassette is: GALl promoter, multiple cluimig Mte, nuclear localization signal, B42 acid blob domain, epitope tag, transcriptional terminator, and another preferred 51 to 3' order is: GALl promoter, nuclear localization signal, B42 acid blob domain, epitope tag, multiple cloning site, transcriptional terminator. Preferably, the at least one transcriptional terminator is configured to terminate RNA transcripts entering said bacterial origin of replication from said protein expression cassette. As desired, the marker gene is selected from the group consisting of ampicillin resistance gene, kanamycin resistance gene, and chloramphenicol acetyltransferase gene. As desired, the reporter gene is selected from the group consisting of LEU2, HIS3, TRPl, and URA 3. As desired, the element may be a 2μ sequence or a CEN4 centromeric sequence and an ARS6 origin of replication (CEN4/ARS6 origin of replication). Preferably, the genetic construct is ρSMACK601, pSMACK701, pSPANK201, or pSPANK301. [0039] In another aspect, the genetic construct comprises a circular plasmid, further comprising: a multiple cloning site (MCS) upstream of a minimal promoter operably linked to a reporter gene; a bacterial origin of replication; a yeast origin of replication; a first marker gene, a repressor of primer (ROP) gene; a second marker gene; and one or more transcription terminatorss. Preferably, the 5' to 3' order of the features is: MCS; minimal promoter operably linked to a reporter gene; first transcription terminator; first marker gene; ROP gene; second marker gene; yeast origin of replication; second transcription terminator; bacterial origin of replication; and third transcription terminator. As desired, the minimal promoter and reporter gene may be a minimal H1S3 promoter
and HIS3, respectively. As desired, the first marker gene may be an ampicillin resistance gene, or a kanamycin resistance gene. As desired, the second marker gene may be selected from the group consisting of LEU2, HIS3, TRPl, and URA 3. The yeast origin of replication may be 2μ, but is preferably CEN4/ARS6. The bacterial origin of replication may be CoIEl; the transcription terminators may be selected from the group consisting of T7, T3, TonB, and ADHl terminator sequences. Most preferably, the genetic construct is pKAD202.
[0040] DEFINITIONS
[0041] In the following description, terms relating to recombinant DNA technology are used. The following definitions are provided to give a clear understanding of the specification and appended claims.
[0042] By "gene" is meant a nucleic acid (e.g., deoxyribonucleic acid, or "DNA") sequence that comprises coding sequences necessary for the production of a polypeptide or precursor (e.g., messenger RNA, or "mRNA"). The polypeptide may be encoded by a full length coding sequence or by any portion of the coding sequence, so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) are retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 51 and 3' ends, for a distance of about 1 kb on either end, such that the gene is capable of being transcribed into a full-length mRNA. The sequences located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences, and form the 51 untranslated region (5' UTR). The sequences located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences, and form the 3' untranslated region (3' UTR). The term "gene" encompasses both cDNA and genomic forms of a gene. The genomic form or done of a gene usually contains the coding region interrupted with non-coding sequences termed "introns" (also called "intervening regions" or "intervening sequences"). Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript, and therefore are absent from the mRNA transcript. mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. [0043] By "nucleotide" is meant a monomeric structural unit of nucleic acid (e.g., DNA or RNA) consisting of a sugar moiety (a pentose: ribose, or deoxyribose), a phosphate group, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via a glycosidic bond (at the 1 '
carbon of the pentose ring) and the combination of base and sugar is called a nucleoside. When the nucleoside contains a phosphate group bonded to the 3' or 51 position of the pentose, it is referred to as a nucleotide. When the nucleotide contains one such phosphate group, it is referred to as a nucleotide monophosphate; with the addition of two or three such phosphate groups, it is called a nucleotide diphosphate or triphosphate, respectively. The most common, nucleotide bases are derivatives of purine or pyrimidine, with the most common purines being adenine and guanine, and the most common pyrimidines being thymidine, uracil, and cytosine. A sequence of operatively linked nucleotides is typically referred to herein as a "base sequence" or "nucleotide sequence" or "nucleic acid sequence," and is represented herein by a formula whose left-to-right orientation is in the conventional direction of 5'-terminus to 3'-terminus. A "test nucleic acid sequence" is a nucleic acid sequence used according to the methods of the present invention to measure or test interaction between said nucleic acid sequence and a protein. The test nucleic acid sequence may be a genomic DNA fragment.
[0044] By "polynucleotide molecule" is mcaiii a molecule comprised of muitipie nucleotides. Nucleotides are the basic unit of DNA, and consist of a nitrogenous base (adenine, guanine, cytosine, or thymine), a phosphate molecule, and a deoxyribose molecule. When linked together, they form polynucleotide molecules.
[0045] DNA molecules are said to have "51 ends" and "3' ends" because mononucleotides are joined to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction, via a phosphodiester linkage. Therefore, an end of an oligonucleotide is referred to as the "5' end" if its 5'-ρhosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. Alternatively, it is the "31 end" if its 3' oxygen is not linked to a 51 phosphate of a subsequent mononucleotide pentose ring. These ends are also referred to as "free" ends because they are not linked to upstream or downstream mononucleotides, respectively. A double stranded nucleic acid molecule may also be said to have 5'- and 3' ends, wherein the "5"' refers to the end containing the accepted beginning of the particular region, gene, or structure, and die "3"' refers to the end downstream of the 5' end. A nucleic acid sequence, even if internal to a larger oligonucleotide, may also be said to have 5' and 3' ends, although these ends are not free ends. In such a case, the 5' and 31 ends of the internal nucleic acid sequence refer to the 51 and 3' ends that said fragment would have were it isolated from the larger oligonucleotide. In either a linear or circular DNA molecule, discrete elements may be referred to as being "upstream" or 51 of the "downstream" or 3' elements. Ends are said to "compatible" if: a)
they are both blunt or contain complementary single strand extensions (such as that created after digestion with a restriction endonuclease); and b) at least one of the ends contains a 5' phosphate group. Compatible ends are therefore capable of being ligated by a double stranded DNA ligase (e.g., T4 DNA ligase) under standard conditions. Nevertheless, blunt ends may also be ligated. [0046] By "promoter" is meant a DNA sequence usually found at the 5' region of a gene, proximal to the start codon. Transcription of an adjacent gene is initiated at the promoter region. If the promoter is an inducible promoter, the rate of transcription increases in response to an inducing agent.
[0047] By "minimal promoter" is meant a promoter is the noncoding sequence upstream (51 direction) of a gene, providing a site for RNA polymerase to bind and initiate transcription. A minimal promoter is the minimal elements of a promoter, including a TATA box and transcription initiation site, and is inactive unless regulatory enhancer elements are situated upstream.
[0048] By "enhancer" is meant a regulatory sequence of DNA that may be located a great distance (thousands of base pairs) upstream or downstream from the gene it controls, or even within an intron of the gene it controls. Binding of DNA-binding proteins to an enhancer influences the rate of transcription of the associated gene.
[0049] By "operably linked" is meant that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein. For example, a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence. As a further example, a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence. Additionally, a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second, separate nucleic acid sequence. Generally, "operably linked" means that the DNA sequences being linked are contiguous, although they need not be, and that a gene and a regulatory sequence or sequences (e.g., a promoter) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins — transcription factors — or proteins which include transcriptional activator domains) arc bound to the regulatory sequence or sequences.
[0050] By "genomic DNA" is meant all the DNA sequences comprising the genome (the total genetic information carried) of a cell or organism
[0051] By "genomic DNA library" is meant a collection of genomic DNA that includes all the DNA sequences of a given species (e.g., a human genomic DNA library, or a simply human genomic library). For example, human genomic double-stranded DNA is cleaved with restriction endonudease or mechanically sheared (e.g., by sonication), generating millions of "genomic DNA fragments." These fragments are cloned (inserted via ligation) into plasmids, thus creating recombinant DNA molecules. The recombinant molecules are introduced in to bacteria by standard means known in the art, generating millions of different colonies of transfected bacterial cells. Each of these colonies is clonally derived from a single ancestor cell, and so contains many copies of a particular region of the fragmented genome. The plasmids are referred to as containing a genomic DNA clone, and the collection of plasmids is a genomic DNA library. A genomic DNA library is said to be "stable" when the library is constructed in such a manner that the genomic DNA insert does not promote unwanted transcription into the vector housing the library, which would induce recombination and destabilizaύ'on of the vector, and the vector is maintained at a low copy number. For example, but without limitation, the vector may lack a promoter upstream of the inserted genomic DNA, it may contain terminator sequences configured to flank the inserted genomic DNA, and it may contain a CEN4/ARS6 low-copy-number yeast origin of replication. A preferred example of such a vector is pKAD202, described more fully below.
[0052] By "genomic DNA ligand" is meant a stretch of genomic DNA that provides or represents a binding site for a DNA-binding protein (i.e., a segment of DNA that is necessary and sufficient to specifically interact with a given polypeptide, such as a DNA-binding protein). The portion of the DNA-binding protein that specifically interacts with the genomic DNA ligand is referred to as a "ligand binding domain" or "DNA-binding domain."
[0053] By "DNA-binding protein" is meant any of numerous proteins which can or may specifically interact with a nucleic acid. For example, a DNA-binding protein used in the invention can be the portion of a transcription factor which specifically interacts with a nucleic acid sequence in the promoter of a gene. Alternatively, the DNA-binding protein can be any protein which specifically interacts with a sequence which is naturally-occurring or artificially inserted into die promoter of a reporter gene. Where protein/DNA interactions are characterized, the DNA-binding protein can be covalcntly bonded to a solid support (e.g., the DNA-binding protein may be expressed as a fusion protein, bearing an epitope tag, which epitope tag may facilitate binding to the solid support, which may be agarose beads). A "test protein" may be shown to be a "DNA-binding protein" by the methods of the invention.
[0054] By "fusion" or "hybrid" protein, DNA molecule, or gene is meant a chimera of at least two covalently bonded polypeptides or DNA molecules
[0055] By "DNA-binding domain" or "DNA-binding moiety" is meant a polypeptide sequence or cluster which is capable of directing specific polypeptide binding to a particular DNA sequence (i.e., to a genomic DNA ligand). The term "domain" in this context is not intended to be limited to a single discrete folding domain. Rather, consideration of a polypeptide as a "DNA-binding domain" for use in the methods of this invention can be made simply by the observation that the polypeptide has specific DNA binding activity or that the polypeptide shares sequence similarity with proteins having known DNA-binding activity. [0056] By "gene activating moiety" or "transcription activation domain" is meant a stretch of amino acids that is covalently bonded to a test protein (i.e., as a fusion protein), wherein the gene activating moiety is capable of inducing the expression of a gene (e.g., a reporter gene) that is operably linked to an upstream test nucleic acid sequence when the test nucleic acid sequence contains a genomic DNA ligand for the test protein and the protein binds to the genomic DNA ligand.
[0057] By "protein" or "polypeptide" is meant a sequence of amino acids of any length, constituting all or a part of a naturally-occurring polypeptide or peptide, or constituting a non- naturally occurring polypeptide or peptide (e.g., a randomly generated peptide sequence or one of an intentionally designed collection of peptide sequences). A "test protein" or "test polypeptide" is a protein used according to the methods of the present invention to measure or test interaction between nucleic acids and said test protein or test polypeptide.
[0058] By "expression" or "gene expression" is meant transcription (e.g., from a gene) and, in some cases, translation of a gene into a protein, or "gene product." In the process of expression, a DNA chain coding for the sequence of gene product is first transcribed to a complementary RNA, which is often a messenger RNA, and, in some cases, the transcribed messenger RNA is then translated into the gene product — a protein. The terms are also used to mean the degree to which a gene is active in a cell or tissue, measured by the amount of mRNA in the tissue and/or the amount of protein expressed.
[0059] As used herein, the terms "vector" or "plasmid" or "plasmid vector" are used in reference to extra-chromosomal nucleic acid molecules capable of replication in a cell and to which an insert sequence can be operatively linked so as to bring about replication of the insert sequence. Vectors are used to transport DNA sequences into a cell, and some vectors may have properties
tailored to produce protein expression in a cell, while others may not. A vector may include expression signals such as a promoter and/or a terminator, a selectable marker such as a gene conferring resistance to an antibiotic, and one or more restriction sites into which insert sequences can be cloned. Vectors can have other unique features (such as the size of DNA insert they can accommodate). A plasmid or plasmid vector is an autonomously replicating, extrachromosomal, circular DNA molecule (usually double-stranded) found mostly in bacterial and protozoan cells. Plasmids are distinct from the bacterial genome, although they can be incorporated into a genome, and are often used as vectors in recombinant DNA technology.
[0060] The term "prokaryotic termination sequence," "transcriptional terminator," "terminator sequence," or "terminator" refers to a nucleic acid sequence, recognized by an RNA polymerase, that results in the termination of transcription. Prokaryotic termination sequences commonly comprise a GC-rich region that has a twofold symmetry, followed by an AT-rich sequence.
Commonly used prokaryotic termination sequences are the ADHl, T7, T3, and TonB termination sequences. A variety of Lcrtrui'ialiύϊϊ sequence., arc known m die art and may be employed in the nucleic acid constructs of the present invention, including the TVn-, TL1, T1^, TR1, RR2, T6^ termination signals derived from the bacteriophage lambda, and termination signals derived from bacterial genes such as the trp gene of E. colt.
[0061] By "reporter gene" is meant a gene whose expression can be assayed as a measure of the ability of two test molecules to interact (i.e., as a measure of protein/DNA interactions). A useful reporter gene is operably linked to an upstream test nucleic acid sequence, which may or may not contain a DNA-binding-protein recognition site, to which a reconstituted transcription factor or DNA-binding protein of interest or test protein binds. Such genes include, without limitation, lacZ, amino acid biosynthetic genes (e.g., the yeast LEU2, HIS3, LYS2, or TRPl), URA3 genes, nucleic acid biosynthetic genes, the bacterial chloramphenicol transacetylase (CAT) gene, and the bacterial gus gene. Certain reporter genes are considered to be "selectable," "counterselectable," or "selectable/countcrselectable" reporter genes, as is described below
[0062] By "selectable" reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, confers a growth advantage on cells containing it. Examples of selectable reporter genes include LEU2 and TRPl. [0063] By "counterselectable" reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, prevents the growth of a cell containing it. Examples of countcrselectable reporter genes include URA3, LYS2, GALl, CYH2, and CANl.
[0064] By "selectable/counterselectable" reporter gene is meant a reporter gene which, when it is expressed under a certain set of conditions, is lethal to a cell containing it, and when it is expressed a different set of conditions, confers a selective growth advantage on cells containing it. Thus, a single gene can be used as both a selectable reporter gene and a counterselectable reporter gene. Examples of selectable/counterselectable reporter genes include URA3, LYS2, and GALl . In each aspect of the invention where a selectable/counterselectable reporter gene is employed, a combination of a selectable reporter gene and a counterselectable reporter gene can be used in lieu of a single selectable/counterselectable reporter gene. For example, yeast cells may first be transfected with plasmid bearing a selectable reporter gene, and transformants identified by their growth on appropriate media (e.g, synthetic complete media lacking leucine). These transformants could then be transformed with a second plasmid bearing a counterselectable reporter gene, and double-transformants identified by their growth on appropriate media (e.g., synthetic complete media lacking leucine and uracil, but containing 5-FOA).
[0065] As used herein, the terms "selectable marker," "selectable marker sequence," "selectable marker gene," or "marker gene" refers to a gene or other DNA fragment that encodes or provides an activity conferring the ability to grow or survive in what would otherwise be a deleterious environment. For example, a selectable marker may confer resistance to an antibiotic or drug (e.g., ampicillin or kanamycin) upon the host cell in which the selectable marker is expressed. An origin of replication (Ori) may also be used as a selectable marker enabling propagation of a plasmid vector. Further examples include, without limitation, kanamycin resistance genes, ampicillin resistance genes, LEU2, TRPl, and HIS3.
[0066] By "ROP gene" is meant a gene encoding the repressor of primer protein, which regulates plasmid DNA replication by modulating the initiation of transcription. It is used to keep plasmid copy number low, thus preventing or minimizing potentially toxic effects to host cells that may arise from cloned genomic DNA fragments.
[0067] The term "expression vector" as used herein refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding sequence (e.g., an insert sequence that codes for a product) in a particular host cell. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences.
[0068] The term "epitope tag" is meant to include, but not be limited to a GST (glutathione-S- transferase) tag, an HA (haemagglutinin) tag, a Myc tag, a FLAG tag, and a His tag. The preceding listing of such epitope tag polypeptides is meant to be illustrative and not limiting, and there is a large and ever-increasing selection of such epitope polypeptides that are substitutable for substitution with those specifically described herein. One skilled in the art is capable of making desired substitutions without undue experimentation.
[0069] As used herein, the term "origin of replication" or "ori" refers to a DNA sequence conferring functional replication capabilities in a host cell. Examples include, but are not limited to, normal or non-conditional origin of replications such as the CoIEl origin, and its derivatives, which are functional in a broad range of host cells. An origin of replication may be a "high copy number" or "low copy number" origin of replication.
[0070] As used herein, the term "non-promoter sequence" refers to any nucleic acid sequence that is unable to serve as an operable promoter element for initiating transcription in a given host cell, such as a bacterial host cell, or a eukaryotic host cell. In preferred embodiments, the host cell in which the non-promoter sequence is unable to serve as an operable promoter is an E. coli host cell.
[0071] As used herein, the terms "insert sequence" or "foreign DNA" refer to any nucleic acid sequences that are capable of being placed in a vector. Examples include, but are not limited to, random DNA libraries and known nucleic acid sequences. A particular "insert sequence" or "foreign DNA" may refer to a pool or a member of a pool of identical nucleic acid molecules, a pool or a member of a pool of non-identical nucleic acid molecules, or a specific individual nucleic acid molecule (e.g., nucleotide sequences encoding Pax3, FKHR, or other proteins).
[0072] By "covalently bonded" is meant that two molecules (e.g., DNA molecules or proteins) arc joined by covalent bonds, directly or indirectly. For example, the "covalently bonded" proteins or protein moieties may be immediately contiguous, or they may be separated by stretches of one or more amino acids within the same hybrid protein.
[0073| By "target protein" or "target DNA molecule" is meant a peptide, protein, domain of a protein, or nucleic acid molecule whose function (i.e., whose ability to interact with a second molecule) is being characterized with the methods of the invention. A target protein may further comprise an epitope tag, and so exist as a fusion protein. Such a fusion protein or target fusion protein may also be "immobilized" on a solid support (e.g., agarose or Sepharose®), which means that the fusion protein has been purified or isolated by affinity chromatography, using a solid
support that has attached to it a moiety (e.g., glutathione) with affinity for the epitope tag (e.g., a GST epitope tag).
[0074] The terms "interact" and "interacting" are meant to include detectable interactions between molecules, and are intended to include protein interactions with nucleic acid, detectable by the methods of the present invention.
[0075] The terms "identification," "identifying," "determining," and "detecting" relate to the ability of the person skilled in the art to detect and distinguish interaction between genomic DNA ligands and target proteins from false positive interactions due to non-specific interaction, and optionally to characterize at least one of said interacting genomic DNA ligands by one or a set of unambiguous features including but not limited to direct sequencing. Preferably, said genomic DNA ligands are characterized by the DNA sequence encoding them, upon isolation, polymerase chain reaction amplification, and sequencing of the respective DNA molecules, according to the methods of the present invention.
[0076] By "putative" or "suspected" is meant that the primary, secondary, or tertiary structure of a DNA fragment or a protein bears regions that match primary, secondary, or tertiary structure of known DNA-binding proteins or DNA ligands.
[0077] As used herein, the term "host cell" or "competent cell" refers to any cell that can be transformed with heterologous DNA (such as a plasmid vector). Examples of host cells include, but are not limited to: Saccharomjces cerevisϊae strains W303 (ATCC #200060), K2346 (ATCC #200864), K2348 (ATCC #200865), DYl 50 (ATCC #96029), K699 (ATCC #200903), K700 (ATCC
#201741), or any other strain that has a functional GAL4 and GAL80 gene and is auxotrophic for histidine, leucine, and tryptophan; and E. coli strains that contain the F or P factor (e.g., DH5αF or DHSaF*) or E. coli strains that lack the F or F factor (e.g., DHlOB).
[0078] The term "population" in the context of competent cells or host cells refers to the whole number of such cells in a given sample, colony, or clone. It may be the total of such cells occupying an area on solid medium or some other limited and separated space (e.g., an eppendorf flask). It may also refer to a body, grouping, or cluster of such cells having a particular characteristic in common (e.g., Leucine auxotrophy), or a group of such cells from which samples are taken for measurement. [0079] The term "isolated cell" as used herein refers to a host cell that is selected from amongst other host cells according to at least one identifiable phenotype (e.g., expression of a reporter gene
confering ability to grow on synthetic medium lacking leucine), and set apart from other host cells (e.g., by manually removing and transfering a colony from a plate on which cultures are grown). The processes involved in identifying, selecting and setting apart an isolated cell comprise "isolating a cell." [0080] The term "isolating plasmid DNA" as used herein refers to removing cellular material, or culture medium when the plasmid DNA is produced by recombinant techniques, or removing chemical precursors or other chemicals when chemically synthesized (e.g., after PCR). An "isolated plasmid DNA," then, is substantially free of culture medium, cellular material, chemical precursors, or other chemicals, depending on the method of production. [0081] The term "transformation" or "transfection" as used herein refers to the introduction of foreign DNA into cells (e.g., prokaryotic cells, or host cells). Transformation may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE- dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics. [0082] By "restriction endonuclease" and "restriction enzyme" is meant enzymes (e.g., bacterial enzymes), each of which cut double-stranded DNA at or near a specific nucleotide sequence (a cognate restriction site). Examples include, but are not limited to, BamHI, EcoRV, Hindlll, Hindi, Ncol, Sail, and Notl.
[0083] By "restriction" is meant cleavage of DNA by a restriction enzyme at its cognate restriction site.
[0084] By "restriction site" is meant a particular DNA sequence recognized by its cognate restriction endonuclease.
[0085] As used herein, the term "purified" or "to purify" refers to the removal of contaminants from a sample. For example, plasmids are grown in bacterial host cells and the plasmids are purified by the removal of host cell proteins, bacterial genomic DNA, and other contaminants. The percent of plasmid DNΛ is thereby increased in the sample. In the case of nucleic acid sequences, "purify" refers to isolation of the individual nucleic acid sequences from each other.
[0086| As used herein, the terms "sequencing" or "DNA sequence analysis" refers to the process of determining the linear order of nucleotides bases in a nucleic acid sequence (e.g., insert sequence) or clone. These units are the C, T, A, and G bases. Generally, to sequence a section of DNA, the DNΛ sequence of a short flanking region, i.e., a primer binding site, must be known
beforehand. One method for sequencing is called dideoxy sequencing (or Sanger sequencing). One example for performing dideoxy sequencing uses the following reagents: 1) the DNA that will be used as a template (e.g., insert sequence); 2) a primer that corresponds to a known sequence that flanks the unknown sequence; 3) DNA nucleotides, to synthesize and elongate a new DNA strand; 4) dideoxynucleotides that mimic the G, A, T, and C building blocks to incorporate into DNA, but that prevent chain elongation, thus acting as termination bases for a DNA polymerase (the four different dideoxynucleotides also may be labeled with different fluorescent dyes for automated DNA sequence analysis); and 5) a nucleic acid polymerizing agent (e.g., DNA polymerase or Taq polymerase, both of which are enzymes that catalyze synthesis of a DNA strand from another DNA template strand). When these reagents are mixed, the primer aligns with and binds the template at the primer binding site. The polymerizing agent then initiates DNA elongation by adding the nucleotide building blocks to the 3' end of the primer. Randomly, a dideoxynucleotide will integrate into a growing chain. When this happens, chain elongation stops and, if the dideoxynucleotide is fluorescently labeled, the label will be also be attached to the newly generated DNA strand. Multiple strands are generated from each template, each strand terminating at a different base of the template. Thus, a population is produced with strands of different sizes and different fluorescent labels, depending on the terminal dideoxynucleotide incorporated as the final base. This entire mix may, for example, be loaded onto a DNA sequencing instrument that separates DNA strands based on size and simultaneously uses a laser to detect the fluorescent label on each strand, beginning with the shortest. The sequence of the fluorescent labels, read from the shortest fragment to the longest, corresponds to the sequence of the template. The reading may be done automatically, and the sequence may be captured and analyzed using appropriate software. The term "shotgun cloning" refers to the multi-step process of randomly fragmenting target DNA into smaller pieces and cloning them en masse into plasmid vectors. [0087] As used herein, the terms "to clone," "cloned," or "cloning" when used in reference to an insert sequence and vector, mean ligation of the insert sequence into a vector capable of replicating in a host cell. The terms "to clone," "cloned," or "cloning" when used in reference to an insert sequence, a vector, and a host cell, refer generally to making copies of a given insert sequence. In this regard, to clone a piece of DNA (e.g., insert sequence), one would insert it into a vector (e.g., ligate it into a plasmid, creating a vector-insert construct) which may then be put into a host (usually a bacterium) so that die plasmid and insert replicate with the host. An individual bacterium is grown until visible as a single colony on nutrient media. The colony is picked and grown in liquid culture, and the plasmid containing the "cloned" DNA (the sequences inserted into the vector) is re-isolated
from the bacteria, at which point there may be many millions of copies of the vector-insert construct. The term "done" can also refer either to a bacterium carrying a cloned DNA, or to the cloned DNA itself.
[0088] As used herein, the term "library" refers to a collection of insert sequences residing in transfected cells, each of which contains a single insert sequence from a genome, sub-doned into a vector.
[0089] The term "electrophoresis" refers to the use of electrical fields to separate charged biomolecules such as DNA, RNA, and proteins. DNA and RNA carry a net negative charge because of the numerous phosphate groups in their structure. Proteins carry a charge that changes with pH, but becomes negative in the presence of certain chemical detergents. In the process of "gel electrophoresis," biomolecules are put into wells of a solid matrix typically made of an inert porous substance such as agarose. When this gel is placed into a bath and an electrical charge applied across the gd, the biomolecules migrate and separate according to size, in proportion to the amount of charge they carry. The biomoiecules can be stained for viewing (e.g., with ethidium bromide or with Coomassie dye) and isolated and purified from the gds for further analysis.
Electrophoresis can be used to isolate pure biomolecules from a mixture, or to analyze biomolecules (such as for DNA sequencing).
[0090] As used herein, the terms "PCR" and "amplifying" refer to the polymerase chain reaction method of enzymatically "amplifying" or copying a region of DNA. This exponential amplification procedure is based on repeated cycles of denaturation, oligonudeotide primer annealing, and primer extension by a DNA polymerizing agent such as a thermostable DNA polymerase (e.g., the Taq or TfI DNA polymerase enzymes isolated from Theπnus aquaticus or Thermits flavus, respectively).
[0091] As used herein, the term "oligonudeotide," refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 100 residues long (e.g., between 15 and 50), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonudeotide is referred to as a "24-mer". Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
[0092J As used herein, the term "primer" refers to an oligonudeotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a
point of initiation of nucleic acid synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucieotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer, and the use of the method. [0093] As used herein, the term "target," in regards to PCR, refers to the region of nucleic acid bounded by the primers. Thus, the "target" is sought to be sorted out from other nucleic acid sequences. A "segment" is defined as a region of nucleic acid within the target sequence.
[0094] As used herein, the terms "PCR product," "PCR fragment," and "amplification product" refer to the resuitant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing, and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
[0095] For a further understanding of the nature, objects, and advantages of the present invention, reference should be had to the following detailed description, read in conjunction with the following drawings, wherein like reference numerals denote like elements and wherein:
[0096] FIG. 1 is a schematic representation of the protein expression cassette in bait vectors pSMACKόOl and pSMACK701, used for galactose -inducible expression of a transcription factor of interest with a C-terminal fusion tag. [0097] FIG. 2 is a schematic representation of the protein expression cassette in bait vectors pSPANK201 and pSPANK301, used for galactose-inducible expression of a transcription factor of interest with an N-terminal fusion tag.
[0098] FIG. 3 is a map of bait vector pSMACK601, which uses the C-terminal fusion expression cassette and contains the 2μ high-copy number yeast origin of replication.
[0099] FIG. 4 is a map of bait vector pSMACK701, which uses the C-terminal fusion expression cassette and contains the CEN4/ARS6 low-copy number yeast origin of replication.
[0100] FIG. 5 is a map of bait vector pSPANK201, which uses the N-terminal fusion expression cassette and contains the 2μ high-copy number yeast origin of replication. [0101] FIG. 6 is a map of bait vector pSPANK301, which uses the N-terminal fusion expression cassette and contains the CEN4/ARS6 low-copy number yeast origin of replication.
[0102] FIG. 7 is a photograph of yeast cells that have been transformed with pSMACKόOl, pSMACK701, pSPANK201, and pSPANK301, respectively, plated on synthetic complete media lacking leucine. [0103] FIG. 8 is a schematic representation of the HIS3 reporter gene that operably linked to the minimal HIS3 promoter in reporter vector pKAD202.
[0104] FIG. 9 is a map of reporter vector pKAD202, which contains the histidine reporter
[0105] FIG. 10 is a photograph of yeast cells that have been transformed with pKAD202 and plated on synthetic complete media lacking tryptophan.
[0106] FIG. 11 shows yeast one-hybrid control DNA transformations. Yeast were transformed with the indicated pKAD202 constructs and plated onto galactose Synthetic Dropout (SD) media that contained all required amino acids (Complete) or SD media deficient for either tryptophan (- Trp) or tryptophan and histidine (-Trp, -His). The indicated number of yeast were grown for three days at 30°C.
[0107] FlG. 12 is a schematic representation of the Yeast PORE technique according to the methods of the present invention, using Pax3 as a representative DNA-binding protein.
[0108] FIG. 13 shows the results of an electrophoretic mobility shift assay (EMSA) demonstrating the binding of Pax3 to physiologically relevant promoter elements, which include Msx2, Trp-1 with one Pax3 binding site (Trpl-1) and Trp-1 with two Pax3 binding sites (Trpl-2). The arrow indicates the mobility of the Pax3:DNA complex.
[0109] FIG. 14 shows the results of an EMSA demonstrating that Pax3 binds oligonucleotide sequences (IX Oligo and 2X Oligo), regions of thcPax3-regulated mouse promoter elements Msx2, Trp-1 (1), which contains one Pax3 recognition sequence and Trp-1 (2), which contains two Pax3 recognition sequences), and the respective promoter deletion mutants that have had the Pax3
recognition sequence specifically deleted (Msx2Δ10, Trp-1 Δ 34, and Trp-1 Δ 16) cloned into pKAD202. Probes were generated by end-labeling double-stranded oligonucleotides with γ32P- dATP or PCR labeling with <x32P-dGTP. Probes were incubated with or without 6x-His-Pax3 or GST-PAX3 at 25°C, and the complexes were resolved on a 6% Tris-glycine polyacrylamide gel. The free probes are designated by the bottom bracket, and the shifted Pax3:DNA complex by the asterisk to the right of each gel.
[0110] FIG. 15 shows that the pSMACKόOl vector does not activate the HIS reporter in the presence of the pKAD202 constructs. The pSMACKόOl plasmid was co- trans formed with all pKAD202 constructs into wild type yeast (W303) and transformants selected on CM-Trp-Leu plates containing dextrose. Positive transformants were then plated on CM-Trp-Leu plates containing dextrose (left) or galactose (middle). Activation of the His reporter was tested by plating on CM- Trp-Leu-His plates containing galactose (right). The pKAD202 constructs used are listed on the left.
[0111] FlG. 16 is a schematic diagram of the yeast one-hybrid screen according to the methods of the present invention. [0112] FIG. 17 is a schematic diagram of the tests designed to eliminate false positive clones, and is to be read in conjunction with FIG. 16.
DETAILED DESCRIPTION OF THE INVENTION
[0113] Before the subject invention is further described, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims. [0114] In this specification and the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.
[0115] The following examples are offered by way of illustration and not by way of limitation. [0116] EXAMPLE l
[0117] Yeast Strains
[0118] The yeast strains used in the invention can be grown and maintained with standard methods. Saccharomyces cerevisiae are particularly useful in the invention. S. cmvisiae strains with functional GAL4 and GAL80 genes and that are auxotrophic for histidine, leucine, and tryptophan are particularly useful in the invention. Examples of such strains include, without exception, strains W303 and K2346.
[0119] EXAMPLE 2
[0120] Construction of bait vectors pSMACK601, pSMACK701, pSPANK201 , and pSPANK301 [0121] The four bait vectors are derivatives of the pSMART®LC-Amp cloning vector (Lucigen Corp., Middleton, WI), and are designed to allow for galactose-inducible expression of a transcription factor of interest cloned into a multiple cloning ("multi-cloning") site. The expressed protein is fused to a tag containing a yeast nuclear localization signal, the B42 acid blob domain, and an HA tag at either the carboxyl- or amino-terminus of the protein (FIGS. 1 and 2, respectively). All four plasmids offer the following features: (i) the LEU2 gene, which acts as a selectable marker in yeast; (ii) the Ampicillin resistance gene and Col El origin of replication to allow for selection and propagation in E. coli.; (iii) a protein expression cassette comprising a GALl promoter, which allows for galactose inducible expression, a multiple cloning site, a hemagglutinin (HA) epitope tag, a nuclear localization signal, and a B42 acid blob domain; (iv) an ADHl terminator; (v) TonB, T7, and T3 terminator sequences; (vi) a repressor of primer (ROP) gene; and (vii) either a CEN4/ARS1 yeast origin of replication, which allows the plasmid to be maintained at low copy numbers, or a 2μ yeast origin of replication, which allows the plasmid to be maintained at high copy number plasmids.
[0122] The plasmids pSMACKOOl (FIG. 3, TABLE 1 , and SEQ ID NO: 1) and pSMACK701 (FIG. 4, TABLE 2, and SEQ ID NO:2) are designed to express the transcription factor of interest with a carboxyl-terminal fusion of the tag described above. pSMACK.601 also contains the 2μ sequence, which allows the plasmid to be maintained at high copy numbers in yeast, while pSMACK701 contains the yeast ARS6 origin of replication and the CEN4 centromeric sequence, yielding a low copy number in yeast.
[0123] Both vectors were constructed by first amplifying the LEU2 gene from the plasmid PGΛDT7-Rec2 using LEU2F primer (5'-CGTCTAGACCTACCCTATGAACATATTCC-S') (SEQ ID NO:3) and LEU2R primer (S'-CGTCTAGACCTATTGTTTTTTCCAATAGG-S') (SEQ ID
NO:4), which added an Xbal site to each end of the resulting PCR product. The PCR product was digested with Xbal and subsequently ligated into the Xbal site of pSMART LC AMP to generate the intermediate plasmid, pSLIOl.
[0124] Next, an oligonucleotide MPT (S'-AATTGCTGCAGC-S') (SEQ ID NO:5) was self- annealed to create a linker with Mfel ends and an internal Pstl site. This linker was ligated into the EcoRI site of the pSLIOl construct, destroying the EcoRI site and adding a unique Pstl site to generate the intermediate, pSL102.
[0125] The oligonucleotide, mHB (S'-AGCTGCGAGATCTCGC-S1) (SEQ ID NO:6) was then self-annealed to create a linker with modified HindIII ends and an internal BgIII site. This linker was ligated into the HindIII site of pSL102, destroying the HindIII site and adding a unique BgIII site resulting in the intermediate, pSL103.
[0126] The protein expression cassette (bp 6446-1330) containing the GALl promoter, fusion region, and ADHl terminator sequence was amplified from pJG4-5 using the primers pJGF (5'- CGGATCCGCTCGGTACCCCATTATCTTAGCG-31) (SEQ ID NO:7) and pGJR (5'- CGGATCCGTGTGGAAGAACGATTAC-S') (SEQ ID NO:8), which added a BamHI site to each end of the cassette. The PCR product was digested and ligated into the BgIII site of pSL103, destroying both the BamHI and BgIII sites and yielding the intermediate, pSMIOl .
[0127] The plasmid pSMIOl was then used as a template to amplify the 300bρ fusion tag described in the first paragraph with primers MCSF: (5'- CGCAAGCTTGGATCCGCGGCCGCCATGGAGCTCCCGGGTCGACGCGTCGAATCCGG TGCTCCTCCAAAAAAGAGAAAGG-S*) (SEQ ID NO:9) and MCSR (5'- CGCAAGCTTTTAGGGAGAGGCATAATCTGGCACATCATAAGG-S') (SEQ ID NO: 10), which added a HindIII site to each end of the tag and a unique multi-cloning site at the 5' end. The plasmid pSMIOl was then digested with HindIII to remove the original fusion tag, and the PCR- generated tag was digested and ligated into the HindIII site resulting in the intermediate, pSMCl 01. Correct orientation of the new fusion tag was determined by PCR using the primers pJGF and MCSR.
[0128] The pSMClOl intermediate is the base vector for both pSMACK601 and pSMACK701, they deviate only in the choice of gene used for yeast replication. To generate pSMACK 601, the 2μ sequence was isolated from pJG4-5 by digestion with Pstl and ligated into the Pstl site of pSMClOl.
TABLE 1
pSMACKόOl (6730bp)
Feature Location
GALl minimal promoter 1387 - 851
Multiple Cloning Site 850 - 811
HA-NLS-B42 tag 810 - 480
ADHl Terminator 479 - 21
2μ yeast ori 1414 - 3419
LEU2 5" UTR 4745 - 4633
LEU2 coding sequence 4632 - 3538
LEU2 31 UTR 3537 - 3431
TonB terminator sequence 4788 - 4825
Ampicillin resistance gene 4930 - 5789
Repressor Of Primer (ROP) 5790 - 5981
T7 terminator sequence 5992 - 6033
CoIEl bacterial ori 6458 - 6560
T3 terminator sequence 6654 - 6697
[0129] The creation of pSMACK701 (FIG. 4, TABLE 2, and SEQ ID NO:2) was a two-step process. First, the oligonucleotides PEPT (5'-GGATATCCAG-3t) (SEQ ID NO:! !)-aπd PEPE (51- CTGGATATCCTGCA-3') (SEQ ID NO:12) were annealed, digested with Pstl and ligated into the Pstl site of pSMClOl to create pSMC102. This construct now contains a unique PvuII site, flanked by EcoRV sites within the original Pstl site. Next, the region containing both the CEN4 and ARS6 genes was removed form the plasmid pHis2 with PvuII and ligated into the PvuII site of pSMC102 to yield pSMACK701. TABLE 2 pSMACK701 (6471 bp)
Feature Location
GALl minimal promoter 1387 — 851 Multiple Cloning Site 850 - 811 HA-NLS-B42 tag 810 - 480 ADHl Terminator 479 - 21 CEN4/ARS6 yeast ori 1412 - 3161 LEU2 5' UTR 4486 - 4374 LEU2 coding 4373 - 3279 LEU2 3' UTR 3278 - 3172 TonB terminator sequence 4529 — 4566 Ampicillin resistance gene 4671 — 5530 Repressor Of Primer (ROP) 5531 - 5722 T7 terminator sequence 5733 — 5774 CoIEl bacterial ori 6199 - 6301 T3 terminator sequence 6395 - 6438
[0130] The plasmids pSPANK201 (FIG. 5, TABLE 3, and SEQ ID NO:13) and pSPANK301 (FIG. 6, TABLE 4, and SEQ ID NO:14) contain the original N-terminal fusion tag from pJG4-5 and are high copy and low copy, respectively. The pSMIOl intermediate is the base vector for both plasmids. [0131] To generate pSPANK201 (SEQ ID NO:13), the 2μ yeast origin of replication sequence was isolated from pJG4-5 by digestion with Pstl and ligated into the Pstl site of pSMIOl. TABLE 3 pSPANK201 (6704bp) Feature Location
GALl minimal promoter 1361 - 825
HA-NLS-B42 tag 824 - 504
Multiple Cloning Site 503 - 480
ADH 1 Terminator 479 - 21
2μ yeast ori 1388 - 3393
LEU2 5' UTR 4719 - 4607
LEU2 coding sequence 4606 - 3512
LEU2 3' UTR 3511 - 3405
TonB terminator sequence 4762 - 4799
Ampicillin resistance gene 4904 - 5763
Repressor Of Primer (ROP) 5764 - 5955
T7 terminator sequence 5966 - 6007
CoIEl bacterial ori 6432 - 6534
T3 terminator sequence 6628 - 6671
[0132] The creation of pSPANK301 (SEQ ID NO:14) was again a two-step process. As with pSMACK701, the oligonucleotides PEPT and PEPB were annealed, digested with Pstl and ligated into the Pstl site of pSMIOl to create pSM102. Next, the region containing both the CEN4 and ARS6 genes was removed form the plasmid pHis2 with PvuII and ligated into the PvuII site of pSM102 to yield pSPANK301. TABLE 4 pSPANK301 (6450bp) Feature Location
GALl minimal promoter 1366 - 830
HA-NLS-B42 tag 829 - 504
Multiple Cloning Site 503 - 480
ADM 1 Terminator 479 - 21
CEN4/ΛRS6 yeast ori 1391 - 3140
LEU2 5' UTR 4465 - 4353
LEU2 coding sequence 4352 - 3268
LEU2 3' UTR 3267 - 3151
TonB terminator sequence 4508 - 4545
Ampicillin resistance gene 4650 - 5509
Repressor Of Primer (ROP) 5510 - 5701
T7 terminator sequence 5712 - 5753
CoIEl bacterial on 6178 - 6280
T3 terminator sequence 6374 — 6417
[0133] The four bait vectors (pSMACKόOl, pSMACKJOl, pSPANK201, and pSPANK301) were transformed by standard methods into the wild-type yeast strain W303, and plated on synthetic complete medium lacking leucine (Sc-L) to test the ability of the plasmid-borne LEU2 gene to express a functional protein, and to test the ability of the 2μ (pSMACKόOl; pSPANK201) or
CEN4/ARS6 (pSMACK701; pSPANK301) elements to allow for replication of the plasmid in yeast (FIG. 7). FIG. 7 demonstrates that expression of a LEU2 gene can be induced in cells and confers a Leu+ phenotype on cells. FIG. 7 also demonstrates the ability of the transformed yeast to grow on Sc-L whether the plasmid contains 2μ or CEN4/ARS6 elements. [0134] EXAMPLE 3
[0135] Creation of reporter vector pKAD202
[0136] We designed a novel plasmid, pKAD202 (FIG. 9, TABLE 5, and SEQ ID NO: 15), that contains a histidine reporter gene under the control of the minimal H1S3 promoter. Within the promoter region, a unique multiple cloning site allows for the insertion of genomic sequences or DNA sequences that contain known transcription factor binding sites for use as positive controls (FIG 8). Plasmid pKAD202 also contains: (i) the TRPl gene, which acts as a selectable marker in yeast; (ii) the Kanamycin gene and Col El bacterial origin of replication to allow for selection on plates containing kanamycin and propagation, respectively, in E. coli.; and (iϋ) the yeast ARS6 origin of replication and the CEN4 centromeric sequence (FIG 9). [0137] FIG. 8 shows a schematic representation of the HIS3 reporter gene that operably linked to the minimal HIS3 promoter in reporter vector pKAD202. This sequence also contains a novel multiple cloning site to allow the insertion of a genomic DNA library or sequences with known DNA-binding recognition sequences for use as positive controls. Finally, the strong termination sequences arc indicated by the arrows and are as follows: 1) the TonB termination sequence is located immediately 3' of the H1S3 gene; 2) the T7 termination sequence is located immediately 3' of the CEN4/ARS6 sequence; and 3) the T3 termination sequence is located between the CoIEl bacterial origin of replication and the multiple cloning site. The features of reporter vector pKAD202 and their relative positions are shown in FlG. 9 and TABLE 5.
[0138] The vector was constructed by first amplifying the CEN4/ARS6 region from the plasmid pHR307a (Mastick et al., 1995; Accession #DQ012948) using NCOARSL primer 5'- ACTCACACCATGGCAGACATCTGTGAATCGCTTCACGACCA-S1 (SEQ ID NO: 16) and APAARSR primer 5I-ACTCACAGGGCCCATGTGTCAAAGGTTTTCACCGTCATCACCGA-3I (SEQ ID NO:17). These primers added Ncol (NCOARSL) and Apal (APAARSR) ends to the PCR amplification product, flanking the CEN4/ARS6 region.
[0139] Next, the TRPl gene was amplified from pHR307a using APATRPL primer 5'- ACTCACAGGGCCCTGGAATTAATTCCACATGTTAAATAGTGA-S' (SEQ ID NO:18) and NCOTRPR primer 5'-ACTGTGCCCTCCATGGAATTAATTCGGTCGA-31 (SEQ ID NO: 19). These primers also added Ncol (NCOTRPR) and Apal (APATRPL) ends to the PCR amplification product, flanking the TRPl gene.
[0140] The CEN4/ARS6 and TRPl fragments were digested with Ncol and Apal restriction endonucleases, and a three-way ligation was performed with Apal-digested pSMART®LCKan to generate an intermediate piasmid, denoted pKSlOl. [0141] The HIS3 reporter cassette, which contains the minimal HIS3 promoter sequence, the HIS3 coding sequence, the HIS3 3'-un translated region (UTR), and minimal HIS3 termination sequence, was amplified from the plasmid pHIS2 (BD Biosciences, Palo Alto, CA) using HISF primer 5'-GAATTCCCGGGGAGCTCA-3I (SEQ ID NO:20) and HISR primer 5'- CAATTGGTCGACGCTCTCCCTTA-S1 (SEQ ID NO:21). These primers added an EcoRI site to the 5' end (HISF) of the amplified product and a Mfel site to the 3' (HISR) end of the amplified product, flanking the HIS3 reporter cassette. The PCR product was digested with EcoRI and ligated into the EcoRI site of pKSlOl, destroying the EcoRI site at the 3' end of the reporter cassette. This intermediate was denoted pKS102.
[0142] To create the novel multiple cloning site, we engineered MKC oligonucleotide 5'- AATTCCCCGGATCCACGCGTGAGCTCCCGGGTCGACGCGGCCGCGCGGGG-S1 (SEQ ID NO:22). This oligonucleotide was self-annealed to generate a double-stranded DNA fragment that contains EcoRI ends. The self-annealed fragment was cloned into the remaining EcoRI site of pKS102 to yield the plasmid pKAD202 (FlG 9; SEQ ID NO:15). Reporter vector pKAD202 was transformed into the wild-type yeast strain W303 by standard methods, and plated on synthetic minimal media lacking tryptophan. The result is shown in FIG. 10, which is a photograph of yeast cells that have been transformed with pKAD202 and plated on synthetic complete media lacking
tryptophan. FIG. 10 demonstrates that pKAD202 is functional in yeast; the TRPl gene expresses a functional protein, and that the CEN4/ARS6 allows for replication of the plasmid. TABLE 5 ρKAD202 Reporter Vector
Feature Location
Multiple Cloning Site 1 - 56 Minimal HIS3 promoter 57 - 201 HIS3 coding sequence 202 - 861 HIS3 3' UTR 862 - 1508 TonB termination sequences 1558 — 1595 Kanamycin resistance gene 1700 — 2515 Repressor Of Primer (ROP) 2516 - 2707 TRPl 5' UTR 4183 - 4078 TRPl coding sequence 4077 - 3451 TRPl 3' UTR 3450 - 2711 CEN4/ARS6 yeast ori 4184 - 6702 T7 termination sequences 6704 - 6745 CoIE 1 bacterial ori 7170 - 7319 T3 termination sequences 7366 — 7409
[0143] EXAMPLE 4 [0144] Creation of Pax3 bait vector positive controls
[0145] Pax3 was cloned into the four bait vectors with and without its transcriptional activation domain. Full length Pax3 was first cloned into pSMACKόOl and pSMACK701 by PCR amplifying the entire Pax3 coding region using PAX3F primer 5'- CGGGATCCATGACCACGCTGGCCGGC-3' (SEQ ID NO:23) and PAX3R primer 5'- GCCGTCGACGTGCAATATCTGGCTTGAGATAATGAAAGGC-S' (SEQ ID NO:24). PCR amplification using these primers added a BamHI and Sail site to the 5' and 3' ends of Pax3, respectively. The PAX3R primer was also engineered to create a carboxyl-terminal fusion between Pax3 and the haemagglutinin (HA) epitope tag, yeast nuclear localization sequence, and the yeast transcriptional activation domain present in the pSMACK vectors. The resulting Pax3 product was digested with these restriction enzymes and directionally ϋgated into BamHI and Sail digested pSMACKόOl andpSMACK701.
[0146] A truncated version of Pax3 was cloned in a similar fashion. The PAX3F primer (SEQ ID NO:23) and PAX3T primer 51-CGGGTCGACCTGΛATTCTGAGGTGAGACGCC-3I (SEQ ID NO:25) were used to PCR amplify a truncated coding sequence of Pax3 lacking the Pax3 transcriptional activation domain. The PAX3T primer was also engineered to create a carboxyl-
terminal fusion between Pax3 and the haemagglutinin (HA) epitope tag, yeast nuclear localization sequence, and the yeast transcriptional activation domain present in the pSMACK vectors. The resulting PCR fragment was digested with BamHI and Sail and directionally ligated into the BamHI/Sall sites of pSMACKόOl and pSMACK701. [0147] Full length Pax3 was cloned into pSPANK201 and pSPANK301 using a two-step process. First, BKET oligonucleotide 5'-AATCCGGTACCG-S' (SEQ ID NO:26) and BKEB oligonucleotide 5'-GGATCCCGGTACCG-3' (SEQ ID NO:27) were annealed to generate a linker with BamHI and EcoRI ends and an internal Kpnl site. This linker was ligated to the Pax3 BamHI/XhoI fragment containing the Pax3 coding region, resulting in a Pax3 DNA sequence with EcoRI and Xhol ends. The ligation reaction was then briefly digested with EcoRI to remove excess linkers and purified using a QIAGEN nucleotide removal kit. The resulting Pax3 insert was then ligated into the EcoRI/XhoI sites of ρSPANK201 and ρSPANK301.
[0148] Truncated Pax3 was cloned into pSPANK201 and pSPANK301 by ligating an EcoRI /Xliϋl fragment containing the truncated sequence into the EcoRl/XhoI sites of both vectors.
[0149] EXAMPLE 5
[0150] Creation of FKHR bait vector positive controls
[0151] Full-length FKHR was cloned into pSMACKόOl and pSMACK701 by amplifying the entire coding region using FKF primer 5'-CGGGATCCATGGCCGAAGCGCCCCAGGTG-S' (SEQ ID NO:28) and FKR primer 5'-GCCGTCGACGGCCTGACACCCAGCTATGTGTCG-S' (SEQ ID NO:29). PCR amplification using these primers added a BamHI and Sail site to the 5' and 3' ends of FKHR, respectively. The resulting FKHR product was digested and ligated into BamHJ and Sail digested pSMACKόOl andpSMACK701. Full length FKHR was cloned into ρSPANK201 and pSPANK301 using a two-step process. First, oligonucleotides BKET (SEQ ID NO:26) and BKEB (SEQ ID NO:27) were annealed to generate a linker with BamHI and EcoRI ends and an internal Kpnl site. This linker was ligated to a BamHI/XhoI fragment containing the FKHR coding region, resulting in a FKHR DNA sequence with EcoRI and Xhol ends. The ligation reaction was then briefly digested with EcoRI to remove excess linkers, and purified using a QlAGEN nucleotide removal kit. The resulting FKHR insert was then ligated into the EcoRI/XhoI sites of pSPANK201 and pSPANK301.
[0152| EXAMPLE 6
[0153] Transformation of bait vector constructs into yeast
[0154] All of the constructs present in the pSMACK and pSPANK bait vectors were subsequently transformed into yeast strain W303 {MΛTa/MATaΛDE2/ade2 CAN1 / can1 -100 CYH2/cyh2 his3-11 ,151 his3-11 ,15 UBO11 Ieu1 -cUEmi Ieu2-3,112 tτp1-1:URA3:trp1-3'Δ /trp1-1 ura3- 1 /ura3-1) using standard transformation methods (Ausubel, 1996). This yeast strain is auxotrophic for tryptophan, leucine, and histidine and will not grow in the absence of these nutrients or in the absence of the expression of the proper nutritional marker (e.g., the LEU2 gene present on the bait vectors). The resulting yeast trans formants were grown on synthetic agar plates lacking leucine to select for yeast that were successfully transformed with the vectors. [0155] EXAMPLE 7
[0156] Creation of reporter vector positive controls — Pax3 recognition sites
[0157] Several in vivo targets of Pax3 have been identified including the anti-apoptotic protein BCL-XL (Margue et al., 2000); c-MET, a receptor tyrosine kinase involved in growth and motility signaling (Epstein et al., 1996); and Tyrosinase Related Protein-1 (TRP-I), a molecule involved in the genesis of pigmentation (Galibert et al., 1999). In addition, prior investigations have determined a consensus sequence for both the paired (5'-CGTCACGCTTA) and homeodomain (5'-ATTA) binding regions of Pax3 with the following configuration: 5'-ATTA(N4 5)CGTCACGCTTA (Epstein et al., 1994). Using this information, we generated several constructs (pSMACKόOl, pSMACK701, pSPANK201, pSPANK301, and pKAD202) to test the ability of Pax3 to activate the HIS3 reporter in the yeast PORE system.
[0158] The Pax3 reporter control that contains one copy of the Pax3 DNA recognition sequence was created by annealing oligonucleotide IXS 5'-
ATCCAGTGACGATTAGCACCGTCACGCTTAGATATG-3' (SEQ ID NO:30) and oligonucleotide IXAS S'-TCGACATATCAAAGCGTGACGGTGCTAATCGTCACTG-S' (SEQ ID NO:31). The resulting double stranded oligonucleotide has BamHl and Sail ends, and was ligated directly into BamHI/Salϊ digested pKAD202. The ligation mix was transformed into chemically competent DH5α cells and plated on LB plates containing 10mg/L Kanamycin (LBKan) for selection. Kanamycin resistant colonies were screened for the presence of the appropriate insert by digestion with EcoRI. Positive clones were then maxi-prepped and transformed into yeast using standard techniques (Ausubel et al., 1996).
[0159] The Pax3 reporter control that contains two copies of the Pax3 DNA recognition sequence was created by annealing oligonucleotide 2XS 5'-
CAGTGACGATTAGCACCGTCACGCTTAGATATAGTGACGATTAGCACCGTCACGCTTA GATATA-3' (SEQ ID NO:32) and oligonucleotide 2XAS 5'- CGCGTATATCTAAGCGTGACGGTGCTAATCGTCACTATATCTAAGAGTGACGGTGCTAATCGT CACTGAGCT-31 (SEQ ID NO:33). The resulting double stranded oligonucleotide has Xhol and MIuI ends and was ligated directly into Mlul/Sall digested pKAD202. Positive transformants were selected as described above.
[0160] The BcI-XL promoter region (SEQ ID NO:34) was PCR amplified from mouse genomic DNA using BcIF primer S'-CAGGATCCCTGCAGGGGGCTCCAGAAGG-S' (SEQ ID NO:35) and BdR primer S'-GCACGCGTTCATGAATTGCGAAGCTTAGGACCT-S' (SEQ ID NO:36); the Msx2 promoter region (SEQ ID NO:37) was PCR amplified from mouse genomic DNA using primer Msχ2F 5'-CGGGATCCGATATCTCTACCTAAATTCCCTGCTGAGGAGCTC-S' (SEQ ID NO:38) and primer Msx2R 5'- CGACGCGTGATATCTAACCGTGAAGCGTTGAGCACAGA-S' (SEQ ID NO:39); and the Trpl promoter region (SEQ ID NO:40) was PCR amplified from mouse genomic DNA using primer TrpF 5'-CGGGATCCGATATCAAGCTTTTACCACTGTGCCTTCTCC-S' (SEQ ID NO:41) and primer TrpR 5'-CGACGCGTGATATCAGCTGTTAATTGCCCGAAGAG-S' (SEQ ID NO.-42). All of these primers were engineered to contain a unique Bam HI site on the forward primer and a unique MIuI site on the reverse primer. The resulting PCR-amplified products were TA -cloned by incubating 5μl of the amplification product with 50ng of the pCR®II linearized vector (Invitrogen, Carlsbad, CA) and 4.0 Weiss units of T4 DNA Iigase at 14°C for a minimum of four hours. The pCR®II vector is a linearized vector with a one-base deoxythymidine overhang on the 3'-end of each vector strand. This vector is engineered to take advantage of the nontemplate- dependent activity of Taq polymerase that adds a single deoxyadenosine (A) to the 3'-ends of PCR products. The resulting ligated DNA was transformed into One Shot® Competent Cells (Invitrogen) and bacteria containing the ligated vector were selected on LB plates containing Ampicillin overnight at 370C. Individual clones were picked, analyzed by restriction digest with EcoRV, and subsequently sequenced to confirm the PCR amplification process introduced no mutations. Finally, the regulatory elements were excised from pCR®II by BamHI/Sall digest and cloned into the same site of pKAD202.
[0161] EXAMPLE 8
[0162] Creation of reporter vector positive controls - FKHR recognition sites
[0163] We have identified three classes of FKHR DNA recognition sites using a systematic evaluation of ligands by exponential enrichment (SELEX) (Bouvet, 2001). The three classes of FKHR sites are represented by FBSl S'-GTAAACAACAACATGTTGAC-S' (SEQ ID NO:43), FBS2 5'-ACAACA(N11)ATAAACATGTTTAC-S' (SEQ ID NO:44), and FBS3 5'-
TGTTTAC(N7)TGTTTAC-3' (SEQ ID NO:45), wherein "N" indicates any nucleotide A, T, C, or G, and the numeral subscript indicates the number of intervening nucleotides. These classes of sites differ in their affinity for FKHR with relative strength of binding as follows: FBS1>FBS2>FBS3. FBSl, FBS2, and FBS3, present in the pCR®II cloning vector, were released by EcoRI digest and subsequently ligated into EcoRI digested pKAD202.
[0164] EXAMPLE 9
[0165] FKHR regulatory element control
[0166] Sequence analysis of an individual clone isolated from a mouse genomic library present in the pSMART®LCKan vector* (Lucigen Corp., Middleton, WI) fortuitously contained a copy of the FKHR DNA recognition site from class FBS3, listed above as Clone #14 (SEQ ID NO:46). A ' BLAST search of this fragment identified it as being part of intron 1 of the Gab-1 gene, a protein implicated in the regulation of myogenic differentiation (Vasyutina et al., 2005; Mood et al., 2006; and Fan et al., 2001). Taken together, these results suggested that this fragment would serve as a FKHR-dependent regulatory element and was subsequently used to clone into the pKAD202 vector for use as a positive control in the yeast PORE technique. As a negative control, a mouse genomic library clone that did not contain any of the classes of FKHR DNA recognition sequence was also used (Clone #14). Gab-1 was PCR amplified from the genomic DNA fragment present in pSMART LCKan using the SLl (new) primer 5'- CGTGAAGGTGAGCCAGTGAGTTGATTGCAGTCC-3' (SEQ ID NO:47) and SR2(new) primer 5'-CGTGCCGATCAAGTCAAAAGCCTCCGGTCGG-S' (SEQ ID NO:48). The resulting PCR amplification product was TA-cloned into pCRII, as described above. The Gab-1 sequence was subsequently recovered from pCRII by EcoRI digest, and then cloned into the EcoRI site of pKAD202.
[0167| EXAMPLE lO [0168] Transformation of reporter vector positive controls into yeast
[0169] As shown in FIG. 11, all of the positive controls — Pax3 and FKHR recognition sites, detailed above — present in pKAD202were subsequently transformed into yeast strain W303 (MATa/MATΛADE2/aώ2 CAN1 / can1 -100 CYH2/cyb2 bis3-11,15/his3-11,15 LEU1 /Ieu1-c l£U2/ku2-3,112 tτp1-1:URA3:trp1-3'A /trp1-1 ura3-1 /ura3-1) using standard transformation methods (Ausubel et al., 1996). This yeast strain is auxotrophic for tryptophan, leucine, and histidine and will not grow in the absence of these nutrients or in the absence of the expression of the proper nutritional marker (i.e., the TRPl gene present on pKAD202). The resulting yeast transformants were grown on synthetic agar plates lacking tryptophan to select for yeast that were successfully transformed with the vectors, and on synthetic agar plates lacking both tryptophan and histidine to demonstrate the lack of self-activation of the reporter constructs alone.
[0170] A schematic representation of the Yeast PORE technique according to the methods of the present invention, using Pax3 as a model DNA -binding protein, is shown in FIG. 12. In the absence of any DNA-binding protein to recognize and bind to the genomic DNA fragment inserted upstream of the HIS3 promoter, there is no transcription or expression of histidine (as represented schematically in FIG. 12 and as shown in practice in FIG. 11). In the presence of a DNA-binding protein (e.g., Pax3 expressed as a fusion protein with the yeast acid blob domain), RNA polymerase is recruited to the protein-DNA complex, transcription of HIS3 is initiated, and survival on plates lacking histidine is enabled. For the sake of simplicity, FIG. 12 does not show all elements (including, among other things, the vector backbone, the epitope tag, and the NLS) of the technique. [0171] As shown in FIG. 13, Pax3 binds to physiologically relevant promoter elements, which include Msx2, Trp-1 with one Pax3 binding site (Trpl-1), and Trp-1 with two Pax3 binding sites (Trpl-2). We cloned the TRP-1 and Msx2 gene promoter sequences into the pSMART®HC-Kan vector as described above. These promoter elements were demonstrated to be bound and regulated by Pax3, and therefore serve as positive controls for the methods of the present invention. We used site directed mutagenesis to clone deletion mutants of these three promoter elements into pSMART®HC-Kan. These mutants have specifically removed the Pax3 recognition sequences and will serve as the negative control for the methods of the present invention. To confirm that these promoter regions interact with Pax3 in rntro, approximately 80-100 bp surrounding the region of the identified Pax3 binding sites was PCR amplified using [(X-32P] -d CTP. These radioactively amplified fragments were then tested for binding in an elcctrophoretic mobility shift assay, as shown in FIG. 13. We observed a specific shift of the probe in the presence of GST-Pax3 for Msx2 and for both of the identified Pax3 binding sites present in TRPl (FIG. 13, arrow). This shift was not observed
in the presence of the mutated promoter elements, demonstrating that bacterially expressed and purified Pax3 can bind to its DNA recognition sequence in vitro when this sequence is present in a larger promoter context.
[0172] Furthermore, as shown in FIG. 14, Pax3 binds oligonucleotide sequences (IX Oligo and 2X Oligo), regions of thePax3-regulated mouse promoter elements Msx2, Trp-1 (1), which contains one Pax3 recognition sequence and Trp-1 (2), which contains two Pax3 recognition sequences), but not the respective promoter deletion mutants that have had the Pax3 recognition sequence specifically deleted (Msx2Δ10, Trp-1 Δ 34, and Trp-1 Δ 16) cloned into pKAD202. Probes were generated by end labeling double-stranded oligonucleotides with γ32P-dATP or PCR labeling with oc32P-dGTP. Probes were incubated with or without 6x-His-Pax3 or GST-PAX3 at 25°C, and the complexes were resolved on a 6% Tris-glycine polyacrylamide gel. The location of the free probes is indicated by the bracket at left, and the shifted Pax3:DNA complexes by the asterisks to the right of each gel.
[0173] EXAMPLE I l [0174] Empty bait vector does not activate pKAD202 HIS reporter
[0175] As shown in FIG. 15, empty pSMACKόOl bait vector does not activate the HIS reporter of pKAD202 in the presence of the pKAD202 constructs' listed on the left. The pSMACKόOl plasmid was co-transformed with all pKAD202 constructs indicated into wild type yeast (W303), and trans formants plated on synthetic complete media lacking tryptophan and leucine (Sc -Trp -Leu) but containing dextrose. Positive transformants were then plated on Sc -Trp -Leu plates containing dextrose (left) or galactose (middle). Activation of the HIS reporter was tested by plating on Sc -Trp -Leu plates also lacking histidine (-His) but containing galactose (right). This demonstrates that, in the absence of a DNA-binding protein (which would be encoded by a sequence inserted into the bait vector's multiple cloning site), the HIS reporter of the pKAD202 vector is not activated, as expected.
[0176] EXAMPLE 12
[0177] Preparation of mouse genomic DNA library
[0178] Mouse genomic DNA is sheared by sonication, end-repaired with a DNA Terminator® End Repair Kit (Lucigen, Middleton, WI), and separated on a 1% agarose gel. Plasmid vector pKAD202 is restriction digested with Sail, and end-repaired with a DNA Terminator® End Repair Kit (Lucigen, Middleton, WI) to create blunt ends. Genomic DNA fragments between 0.5 - 2.0kb
are gel purified and cloned into the prepared blunt cloning site of pKAD202. The resulting ligated DNA is electroporated into ElectroMAX DHlOB E. colt cells (Invitrogen, Carlsbad, CA). An aliquot of the transformed bacteria is plated onto Luria broth (LB) agar plates containing kanamycin, and the remainder of the cells are saved as a frozen glycerol stock. A representative sample of colonies (about twenty) are selected and cultured separately in liquid LB medium containing kanamycin. Plasmid DNA is isolated from each liquid culture, subjected to restriction digest with Smal, and separated on a 1 % agarose gel to determine insert frequency and size. This analysis demonstrates the prevalence of clones containing genomic DNA inserts between 0.65 - 2.0kb. Sequencing of the inserts with SLt forward primer 5'-CAGTCCAGTTACGCTGGAGTC-S' (SEQ ID NO:49) demonstrates whether the clones isolated are derived from unique pieces of genomic DNA. A genomic library created in this manner contains approximately 3 to 8 x 106 independent clones, with DNA inserts between 0.65 - 2.0kb, providing an approximate 1.7- to 4.5-fold over- representation of the entire mouse genome. It will be appreciated by those skilled in the art that the above technique, as applied to mouse genomic DNA, is equally applicable to other mammalian genomic DNA, including human genomic DNA.
[0179] EXAMPLE 13
[0180] Expansion of a genomic DNA library
[0181] A mouse genomic library, prepared as described above, is expanded by plating the glycerol stock of bacteria (after determining the library titer as described above), reserved from above and containing the library, onto 24.5 x 24.5 cm LB agar plates containing kanamycin, and incubating the plates at 370C overnight. The colony density is limited to approximately 20,000 colonies per plate to avoid overcrowding. The resulting colonies are scraped from the plate, and the DNA is isolated using a Qiagen Maxiprep kit (Qiagen, Valencia, CA.). The resulting DNA is aliquoted and stored at -80°C. [0182] EXAMPLE 14
[0183] Yeast Transformation
[0184] Yeast were transformed using an established protocol (Ausubel et al., 1996). Briefly, yeast strain W303 (MATa/ MATa ADE2/ade2 CAN 1 /caul -100 CϊΗ2/cyb2 bis3-11,15/bis3-11,15 LEU1/lnt1-cLEU2/leu2-3,112 lτp1-1:UR.43:ttp1-3'Δ /trp1-1 ura3-1 /tιra3-1; ATCC #200060) or K2346 (MATa ade2-1 adr3 trp1-1 Ien2-3,112 bis3-11,15 ura3 ssd1\ ATCC #200864) were grown in YPD media (6 g yeast extract, 12 g peptone, 12 g glucose, 60 mg adenine hcmisulphate, 600 mL
H2O, pH 7.0) overnight at 3O0C with continual shaking. Alternatively, to create bait-plus-library vector double-transformants, yeast previously transformed with one of the bait vectors were grown in Synthetic Dropout (SD) media (see Ausubel) lacking tryptophan (Trp). The next morning the yeast culture was diluted to an optical density (OD600) of 0.10 (late lag phase of growth) and incubated at 3O0C with continual shaking until the cells reach mid-log phase growth (OD600 = 0.4 - 0.6). The cells were harvested by centrifugation for five minutes at 1500 x g and washed two times by resuspending the cell pellet in 30ml of water and centrifuging again as just described. After the second water wash, the cell pellet was resuspended in 1.5ml of TE buffer (10 mM Tris-Cl to pH7.5, plus 1 mM ethylenediaminetetraacetic acid) containing 0.1M lithium acetate (IiOAc). Into a separate 1.5ml eppendorf tube was added lμg of the desired yeast vector, and 50μg of high-quality sheared salmon sperm carrier DNA. 50μl of the yeast/TE/LiOAc solution was then added to the vector/carrier DNA solution. 300μl of sterile 40% PEG 4000 in TE buffer (pH7.5) containing 0.1 M LiOAc was then added, the sample mixed thoroughly by inversion, and then incubated at 300C foi" 30 minutes. After incubation, DIvISO was added to 10% final volume (approximately 4Uμϊ) and mixed thoroughly by inversion. This mixture was then heat shocked at 420C for 10 minutes. The heat shocked yeast were then plated on SD media lacking amino acid(s) required for the selection process (e.g., lacking Trp if transformation was performed with a bait vector alone; lacking leucine (Leu) if transformation was performed with a library vector; and lacking both Leu and Trp if transformation was performed with both bait and library vectors). [0185] EXAMPLE 15
[0186] Yeast PORE genomic screen, including elimination or reduction of false positives
[0187] Wild-type yeast are first transformed using standard techniques with the chosen bait vector carrying the coding sequence of the DNA-binding protein to be studied (FIG. 16). Positive transformants are selected by plating on synthetic minimal media lacking leucine. One colony is then selected and used to propagate a new batch of cells, which are then transformed with a pool of reporter vectors (pKAD202) containing the randomly generated genomic DNA library. Serial dilutions of yeast containing both the bait and library vectors are then plated on synthetic minimal dextrose media lacking leucine and tryptophan to calculate the transformation efficiency and ensure accurate representation of the genomic library. Once the optimal number of transformations necessary to saturate the library is calculated, the double transformation is repeated, and the yeast are plated on synthetic minimal galactose media lacking leucine, tryptophan, and histidinc. The resulting colonies are then replica-plated onto plates containing an optimal concentration of 3-aminotriazolc
("3-AT," where the optimal concentration is determined in control experiments). Only those colonies that grow under these conditions will be considered putative interacting clones, or "positive" (FIG. 16).
[0188] The putative positives identified in the first round of the Yeast PORE process are further tested according to the steps below, and represented schematically in FIG. 17, to reduce or eliminate the number of false positives.
[0189] First, activation of the HIS3 reporter, resulting from the binding of Pax3 or FKHR to genomic DNA cloned into pKAD202, is confirmed. This is accomplished by re-plating the putative positive clones onto galactose plates lacking leucine, tyrptophan, and histidine, and supplemented with the optimal 3-AT concentration, to verify the results form the first screen.
[0190] Second, the positive colonies are streaked onto dextrose plates lacking leucine, tryptophan, and histidine. As the expression of Pax3 and FKHR is under the control of a galactose- inducible promoter, the positive clones should not grow on the dextrose plates. The pKAD202 vector is then isolated from the colonies that pass the second round of screening. Briefly, the positive colonies are grown in minimal media, and standard techniques are used to isolate plasmid DNA from the yeast. The resulting plasmid DNA — the pKAD202 vector containing a genomic DNA ligand — is transformed into E. coli, which are selected for by growth on LB plates containing kanamycin.
[0191] Third, the isolated reporter vector is re-transformed into yeast alone (i.e., without any other vector). The single transformants are tested using the initial screening process (FIG. 16), as described, but with the addition of leucine to all media. The pKAD202 vector should not rescue the cells grown under the selective conditions (lacking histidine, but containing 3-AT). Finally, the isolated reporter vector is then co-transformed with the bait vector into a fresh growth of yeast, and the double transformants arc tested as described previously (FIG. 16). This test confirms that the original ability to grow in the absence of histidine did not result from a yeast reversion.
[0192] Clones that pass all rounds of false-positive tests arc considered true positive interactions. The multiple cloning site of the pKAD202 vector from each positive colony is then sequcnced to identify the genomic sequence bound by the transcription factor.
[0193] All references cited in this specification are herein incorporated by reference as though each reference was specifically and individually indicated to be incorporated by reference. The citation of any reference is for its disclosure prior to the filing date and should not be construed as
an admission that the present invention is not entitled to antedate such reference by virtue of prior invention.
[0194] It will be understood that each of the elements described above, or two or more together may also find a useful application in other types of methods differing from the type described above. Without further analysis, the foregoing will so fully reveal the gist of the present invention that others can, by applying current knowledge, readily adapt it for various applications without omitting features that, from the standpoint of prior art, fairly constitute essential characteristics of the generic or specific aspects of this invention set forth in the appended claims. The foregoing embodiments are presented by way of example only; the scope of the present invention is to be limited only by the following claims.
Claims
1. A method for determining whether a test protein interacts with a test nucleic acid sequence, the method comprising:
(a) providing a population of competent cells wherein a plurality of the cells of said population contain:
(i) a reporter gene operably linked to a test nucleic acid sequence;
(ii) a fusion gene, wherein the fusion gene expresses a hybrid protein, said hybrid protein comprising a test protein covalently bonded to a gene activating moiety; and
(b) detecting expression of the reporter gene as a measure of the ability of the test protein to interact with the test nucleic acid sequence, wherein the test nucleic acid sequence in the population of competent cells is derived from a genomic DNA library.
2. The method of claim 1 , wherein the genomic DNA library is a stable genomic DNA library.
3. The method of claim 2, wherein the reporter gene is selected from the group consisting of selectable reporter genes, counterselectable reporter genes, and selectable/counterselectable reporter genes.
4. The method of claim 2, wherein the reporter gene is selected from the group consisting of amino acid biosynthetic genes, nucleic acid biosynthetic genes, and antibiotic resistance genes.
5. The method of claim 2, wherein the reporter gene is selected from the group consisting of LEU2, HlS3, TRPl, and URA 3.
6. The method of claim 2, wherein the reporter gene and test nucleic acid sequence are located on a first plasmid.
7. The method of claim 6, wherein the first plasmid is a low copy number plasmid.
8. The method of claim 7, wherein die first plasmid comprises one or more transcription terminators upstream of the test nucleic acid sequence and one or more transcription terminators downstream of the reporter gene, and wherein the first plasmid further comprises a first selectable marker.
9. The method of claim 8, wherein the first plasmid is pKAD202.
10. The method of claim 2, wherein the fusion gene is located on a second plasmid. 8 004474
11. The method of claim 10, wherein the second plasmid comprises an ADHl terminator and a terminator selected from the group consisting of T3 terminator, T7 terminator, and TonB terminator, downstream of the fusion gene, and wherein the plasmid further comprises a second selectable marker, wherein the second selectable marker is not the same as the first selectable marker.
12. The method of claim 11, wherein the second plasmid is a low copy number plasmid.
13. The method of claim 12, wherein the second plasmid is pSMACK701 or pSPANK301.
14. The method of claim 11, wherein the second plasmid is a high copy number plasmid.
15. The method of claim 14, wherein the second plasmid is pSMACKόOl or pSPANK201.
16. The method of claim 2, wherein the test nucleic acid sequence comprises genomic DNA.
17. The method of claim 2, wherein the test nucleic acid sequence comprises a randomly generated sequence.
18. The method of claim 2, wherein the test nucleic acid sequence comprises an intentionally designed sequence.
19. The method of claim 2, wherein the test protein comprises an intentionally designed sequence.
20. The method of claim 19, wherein the test protein is selected from the group consisting of known DNA-binding proteins and suspected DNA-binding proteins.
21. The method of claim 20, wherein the test protein is selected from the group consisting of Pax3, FKHR, and Pax3-FKHR.
22. The method of claim 2, wherein the population of competent cells is yeast cells.
23. The method of claim 22, wherein the yeast cells are S. cerevisiae cells.
24. The method of claim 2, wherein the gene activating moiety comprises the transcription activation domain of a protein selected from the group consisting of GAL4 and B42.
25. The method of claim 2, further comprising isolating a cell that expresses the reporter gene, thereby producing an isolated cell.
26. The method of claim 25, further comprising isolating plasmid DNA from the isolated cell.
27. The method of claim 25, further comprising amplifying at least a portion of a test nucleic acid sequence of die isolated cell.
28. The method of claim 25, further comprising sequencing at least a portion of a test nucleic acid sequence of the isolated cell.
29. The method of claim 25, further comprising hybridizing a probe to the DNA of the isolated cell.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/697,113 | 2007-04-05 | ||
| US11/697,113 US7932030B2 (en) | 2007-04-05 | 2007-04-05 | System for pulling out regulatory elements using yeast |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008124109A2 true WO2008124109A2 (en) | 2008-10-16 |
| WO2008124109A3 WO2008124109A3 (en) | 2008-12-11 |
Family
ID=39734184
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/004474 Ceased WO2008124109A2 (en) | 2007-04-05 | 2008-04-07 | System for pulling out regulatory elements using yeast |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US7932030B2 (en) |
| WO (1) | WO2008124109A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080248958A1 (en) * | 2007-04-05 | 2008-10-09 | Hollenbach Andrew D | System for pulling out regulatory elements in vitro |
| WO2012005595A2 (en) * | 2010-07-09 | 2012-01-12 | Wouter Leonard De Laat | V3-d genomic region of interest sequencing strategies |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5024941A (en) * | 1985-12-18 | 1991-06-18 | Biotechnica International, Inc. | Expression and secretion vector for yeast containing a glucoamylase signal sequence |
| NZ306767A (en) | 1995-04-11 | 2000-03-27 | Univ Johns Hopkins | Method of identifying molecular interactions employing counterselection and at least two hybrid molecules or two hybrid systems |
| JP2001525186A (en) | 1997-11-27 | 2001-12-11 | マックス−プランク−ゲゼルシャフト ツール フォルデルング デル ヴィッセンシャフテン エー.ファウ. | Identification and characterization of interacting molecules |
| US7001733B1 (en) | 1998-05-12 | 2006-02-21 | Rigel Pharmaceuticals, Inc. | Methods and compositions for screening for modulations of IgE synthesis, secretion and switch rearrangement |
| AU2001263155A1 (en) | 2000-05-16 | 2001-11-26 | Massachusetts Institute Of Technology | Methods and compositions for interaction trap assays |
| US6709861B2 (en) | 2000-11-17 | 2004-03-23 | Lucigen Corp. | Cloning vectors and vector components |
-
2007
- 2007-04-05 US US11/697,113 patent/US7932030B2/en not_active Expired - Fee Related
-
2008
- 2008-04-07 WO PCT/US2008/004474 patent/WO2008124109A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| US20080248467A1 (en) | 2008-10-09 |
| WO2008124109A3 (en) | 2008-12-11 |
| US7932030B2 (en) | 2011-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5885779A (en) | Repressed trans-activator system for characterization of protein-protein interactions | |
| US6913886B2 (en) | Fast and exhaustive method for selecting a prey polypeptide interacting with a bait polypeptide of interest: application to the construction of maps of interactors polypeptides | |
| US5695941A (en) | Interaction trap systems for analysis of protein networks | |
| EP1259597B1 (en) | Zinc finger domains and methods of identifying same | |
| US20260117282A1 (en) | High Throughput Cell-Based Screening For Aptamers | |
| US6951725B2 (en) | In vitro protein interaction detection systems | |
| Nair et al. | Multiplexed mRNA assembly into ribonucleoprotein particles plays an operon-like role in the control of yeast cell physiology | |
| EP2190989B1 (en) | Method for manufacturing a modified peptide | |
| WO1999035256A1 (en) | Screening interactor molecules with whole genome oligonucleotide or polynucleotide arrays | |
| US7932030B2 (en) | System for pulling out regulatory elements using yeast | |
| US20080248958A1 (en) | System for pulling out regulatory elements in vitro | |
| Pillutla et al. | Target validation and drug discovery using genomic and protein–protein interaction technologies | |
| Zhang et al. | [27] Yeast three-hybrid system to detect and analyze RNA-protein interactions | |
| JP2002514441A (en) | Gene identification method | |
| US20100203509A1 (en) | Inducible fluorescently-tagged protein expression system | |
| CA2586182A1 (en) | Method of gene screening with yeast that inducibly expresses ergosterol biosynthetic enzyme | |
| Cher et al. | United States Patent po | |
| Svetlov | Functional characterization and interactions between yeast Saccharomyces cerevisiae transcription factors involved in regulation of nitrogen metabolism | |
| HK40007960B (en) | High throughput cell-based screening for aptamers | |
| HK40007960A (en) | High throughput cell-based screening for aptamers | |
| Jones | A study into the conserved nature of yeast and mammalian transcription factors | |
| EA047916B1 (en) | HIGH-THROUGHPUT CELL SCREENING FOR APTAMERS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08727310 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08727310 Country of ref document: EP Kind code of ref document: A2 |