WO2008121592A2 - Acetyl coenzyme a carboxylase inhibitors - Google Patents

Acetyl coenzyme a carboxylase inhibitors Download PDF

Info

Publication number
WO2008121592A2
WO2008121592A2 PCT/US2008/057933 US2008057933W WO2008121592A2 WO 2008121592 A2 WO2008121592 A2 WO 2008121592A2 US 2008057933 W US2008057933 W US 2008057933W WO 2008121592 A2 WO2008121592 A2 WO 2008121592A2
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
carbonyl
hetero
substituted
benzo
Prior art date
Application number
PCT/US2008/057933
Other languages
French (fr)
Other versions
WO2008121592A3 (en
Inventor
Edcon Chang
Matthew H. Mcneill
Original Assignee
Takeda Pharmaceutical Company Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Pharmaceutical Company Limited filed Critical Takeda Pharmaceutical Company Limited
Publication of WO2008121592A2 publication Critical patent/WO2008121592A2/en
Publication of WO2008121592A3 publication Critical patent/WO2008121592A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/62—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/68—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a chain containing hetero atoms as chain links

Definitions

  • the present invention relates to compounds that may be used to inhibit acetyl coenzyme-A carboxylase ("ACC"), as well as compositions of matter, kits and articles of manufacture comprising these compounds.
  • ACC acetyl coenzyme-A carboxylase
  • the invention also relates to methods for inhibiting ACC and methods of using compounds according to the present invention to treat, for example, metabolic syndrome, diabetes, obesity, atherosclerosis, and cardiovascular disease in mammals, including humans.
  • the invention relates to methods of making the compounds of the present invention, as well as intermediates useful in such methods.
  • the present invention relates to ACCl and/or ACC2 inhibitors, compositions of matter, kits and articles of manufacture comprising these compounds, methods for inhibiting ACCl and/or ACC2, and methods of making the inhibitors.
  • the invention relates to compounds of the formula:
  • R 1 is selected from the group consisting of oxy, (C].]o)alkoxy, (C 4-I 2 JaTyIoXy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, imino, (C]. t o)alkyl, halo(Ci.] 0 )alkyl, hydroxy(C L . 10 )alkyl, carbonyl(C ⁇ .
  • compositions may be administered or coadministered by a wide variety of routes, including for example, orally, parenterally, intraperitoneal Iy, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomaliy, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticular ⁇ , or intrathecal Iy.
  • the compositions may also be administered or coadministered in slow release dosage forms.
  • the invention is related to kits and other articles of manufacture for treating disease states associated with ACC.
  • an article of manufacture comprises a composition comprising at least one ACC inhibitor of the present invention in combination with packaging materials.
  • the ACC inhibitor is a member selected from an ACCl inhibitor and an ACC2 inhibitor.
  • the packaging material may comprise a container for housing the composition.
  • the container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition.
  • the kit may also optionally comprise additional components, such as syringes for administration of the composition.
  • the kit may comprise the composition in single or multiple dose forms.
  • the compounds, compositions, kits and articles of manufacture are used to inhibit ACC.
  • ACC is a member selected from ACCl and ACC2.
  • the compounds, compositions, kits and articles of manufacture are used to treat a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state.
  • the disease is treated by inhibiting ACCl.
  • the disease is treated by inhibiting ACC2,
  • a compound is administered to a subject wherein ACC activity within the subject is altered, preferably reduced.
  • the administered compound alters and preferably reduces the activity of ACCl in a subject.
  • the administered compound alters and preferably reduces the activity of ACC2 in a subject.
  • a method of inhibiting ACC comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC in vivo.
  • the invention provides a method of inhibiting ACCl that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACCl in vivo.
  • the invention provides a method of inhibiting ACC2 that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC2 in vivo.
  • a method for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state comprising: causing a compound according to the present invention to be present in a subject in a therapeutically effective amount for the disease state.
  • the ACC is a member selected from ACCl and ACC2.
  • a method for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state comprising: administering a first compound to a subject that is converted in vivo to a second compound such that the second compound is present in the subject in a therapeutically effective amount for the disease state.
  • the compounds of the present invention may be the first or second compounds.
  • the ACC is a member selected from ACCl and ACC2.
  • a method for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state comprising: administering a compound according to the present invention to a subject such that the compound is present in the subject in a therapeutically effective amount for the disease state.
  • the ACC is a member selected from ACCl and ACC2.
  • the present invention is intended to encompass all pharmaceutically acceptable ionized forms (e.g., salts) and solvates (e.g., hydrates) of the compounds, regardless of whether such ionized forms and solvates are specified since it is well know in the art to administer pharmaceutical agents in an ionized or solvated form. It is also noted that unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all possible stereoisomers (e.g., enantiomers or diastereomers depending on the number of chiral centers), independent of whether the compound is present as an individual isomer or a mixture of isomers.
  • pharmaceutically acceptable ionized forms e.g., salts
  • solvates e.g., hydrates
  • prodrugs may also be administered which are altered in vivo and become a compound according to the present invention.
  • the various methods of using the compounds of the present invention are intended, regardless of whether prodrug delivery is specified, to encompass the administration of a prodrug that is converted in vivo to a compound according to the present invention.
  • certain compounds of the present invention may be altered in vivo prior to inhibit ACC and thus may themselves be prodrugs for another compound.
  • Such prodrugs of another compound may or may not themselves independently have ACC inhibitory activity.
  • Figure 1 illustrates SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:
  • Alicyclic means a moiety comprising a non-aromatic ring structure. Alicyclic moieties may be saturated or partially unsaturated with one, two or more double or triple bonds. Alicyclic moieties may also optionally comprise heteroatoms such as nitrogen, oxygen and sulfur. The nitrogen atoms can be optionally quaternerized or oxidized and the sulfur atoms can be optionally oxidized. Examples of alicyclic moieties include, but are not limited to moieties with (C 3 .
  • rings such as cyclopropyl, cyclohexane, cyclopentane, cyclopentene, cyclopentadiene, cyclohexane, cyclohexene, cyctohexadiene, cycloheptane, cycloheptene, cycloheptadiene, cyclooctane, cyclooctene, and cyclooctadiene.
  • Alkyl represented by itself means a straight or branched, saturated or unsaturated, aliphatic radical having a chain of carbon atoms, optionally with one or more of the carbon atoms being replaced with oxygen (See “oxaalkyl”), a carbonyl group (See “oxoalkyl”), sulfur (See “thioalkyl”), and/or nitrogen (See “azaalkyl”).
  • oxaalkyl a straight or branched, saturated or unsaturated, aliphatic radical having a chain of carbon atoms, optionally with one or more of the carbon atoms being replaced with oxygen (See “oxaalkyl”), a carbonyl group (See “oxoalkyl”), sulfur (See “thioalkyl”), and/or nitrogen (See “azaalkyl”).
  • (C ⁇ )alkyl and (C ⁇ . ⁇ )alkyl are typically used where X and Y indicate the number of carbon atoms in the chain.
  • alkylene either alone or represented along with another radical, can be a (C ⁇ )alkylene, a (C 2 )alkylene or a (C 3 )alkylene.
  • alkylidene either alone or represented along with another radical, can be a (Ci.2o)alkylidene, a (C[.[ 5 )alkylidene, a (C].]o)alkylidene, a (C ⁇ . 5 )alkylidene or a (C]. 3 )alkylidene.
  • alkylidene either alone or represented along with another radical, can be a (Ci)alkylidene, a (C 2 )alkylidene or a (C 3 )alkylidene.
  • Alkynyl means a straight or branched, carbon chain that contains at least one carbon-carbon triple bond (-C ⁇ C- or -C ⁇ CR, wherein R is hydrogen or a further substituent).
  • alkynyl include ethynyl, propargyl, 3-methyl-l-pentynyl, 2- heptynyl and the like.
  • alkynyl either alone or represented along with another radical, can be a (C 2-2 o)alkynyl, a (C 2- ⁇ alkynyl, a a (C2-5)alkynyl or a (C2. 3 )alkynyl.
  • Amino means a nitrogen moiety having two further substituents where, for example, a hydrogen or carbon atom is attached to the nitrogen.
  • representative amino groups include -NH 3 , -NHCH 3 , -N(CH 3 ) 2 , -NH((C M o)alkyl), -N((C ( .
  • the compounds of the invention containing amino moieties may include protected derivatives thereof. Suitable protecting groups for amino moieties include acetyl, /erf-butoxycarbonyl, benzyloxycarbonyl, and the like.
  • Azaalkyl means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with substituted or unsubstituted nitrogen atoms (-NR- or -NRR', wherein R and R' are each independently hydrogen or further substituents).
  • a (C].] 0 )azaalkyl refers to a chain comprising between 1 and 10 carbons and one or more nitrogen atoms.
  • Carbamoyl means the radical -OC(O)NRR', wherein R and R' are each independently hydrogen or further substituents.
  • Carbocycle means a ring consisting of carbon atoms.
  • Cycloalkyl means a non-aromatic, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly.
  • (C ⁇ )cycloalkyl and (C ⁇ . ⁇ )cycloalkyl are typically used where X and Y indicate the number of carbon atoms in the ring assembly.
  • Cycloalkylene means a divalent, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly.
  • (C ⁇ )cycloalkylene and (Cx- v)cycloalkylene are typically used where X and Y indicate the number of carbon atoms in the ring assembly.
  • "cycloalkylene,” either alone or represented along with another radical can be a (C 3-t4 )cycloalkylene, a (C 3 .io)cycloalkylene, a (C 3-7 )cycloalkylene, a (Cs-]o)cycloalkylene or a (C 5 . 7 )cycloalkylene.
  • cycloalkylene either alone or represented along with another radical, can be a (C 5 )cycloalkylene, a (C6)cycloalkylene, a (C 7 )cycloalkylene, a (Cgjcycloalkylene, a (Cg)cycloalkylene, or a (C )0 )cycloalkylene.
  • Disease specifically includes any unhealthy condition of an animal or part thereof and includes an unhealthy condition that may be caused by, or incident to, medical or veterinary therapy applied to that animal, i.e., the "side effects" of such therapy.
  • EC 50 means the molar concentration of an agonist that produces 50% of the maximal possible effect of that agonist. The action of the agonist may be stimulatory or inhibitory.
  • fused ring refers to a ring that is bonded to another ring to form a compound having a bicyclic structure where the ring atoms that are common to both rings are directly bound to each other.
  • Non-exclusive examples of common fused rings include decalin, naphthalene, anthracene, phenanthrene, indole, furan, benzofuran, quinoline, and the like.
  • Compounds having fused ring systems may be saturated, partially saturated, carbocyclics, heterocyclics, aromatics, heteroaromatics, and the like.
  • "Halo" means fluoro, chloro, bromo or iodo.
  • the bicyclic or tricyclic heteroaryl rings can be attached to the parent molecule through either the heteroaryl group itself or the aryl, cycloalkyl, cycloalkenyl or heterocycloalkyl group to which it is fused.
  • the heteroaryl groups of this invention can be substituted or unsubstituted.
  • "heteroaryl,” either alone or represented along with another radical can be a hetero(Ci.i 3 )aryl, a hetero(C 2 -i 3 )aryl, a hetero(C 2 -e)aryl, a hetero(C 3 - 9 )aryI or a hetero(C 5 .g)aryl.
  • " ⁇ eterobicycloalkyl” means bicycloalkyl, as defined in this Application, provided that one or more of the atoms within the ring is a heteroatom.
  • 2 )bicycloalkyl as used in this application includes, but is not limited to, 3-aza- bicyclo[4.1.0]hept-3-yI, 2-aza-bicyclo[3.1.0]hex-2-yl, 3-aza-bicyclo[3.1.0]hex-3-yl, and the like.
  • heterocycloalkyl either alone or represented along with another radical, can be a hetero(C ⁇ . ⁇ 4 )bicycloalkyl, a hetero(C 4 .] 4 )bicycloalkyl, a hetero(C4.9)bicycloalkyl, or a hetero(C5. 9 )bicycloalkyl.
  • heterocycloalkyl either alone or represented along with another radical, can be a hetero(C5)bicycIoalkyl, hetero(C 6 )bicyck)alkyl, hetero(C 7 )bicycloalkyl, hetero(Cg)bicycloalkyl, or a hetero(C 9 )bicycloa]kyl.
  • heterocycloaryl either alone or represented along with another radical, can be a hetero(C 5 )bicycloaryl, hetero(C 6 )bicycloaryl, hetero(C 7 )bicycloaryl, hetero(C 8 )bicycloaryl, or a hetero(C 9 )bicycloaryl .
  • Heterocycloalkyl means cycloalkyl, as defined in this Application, provided that one or more of the atoms forming the ring is a heteroatom selected independently from N, O, or S.
  • Non-exclusive examples of heterocycloalkyl include piperidyl, 4- morpholyl, 4-piperazinyl, pyrrolidinyl, perhydropyrrolizinyl, 1,4-diazaperhydroepinyl, 1 ,3-dioxanyl, 1,4-dioxanyl and the like.
  • heterocycloalkyl can be a hetero(C 2 )cycloalkyl, a hetero(C 3 )cycloalkyl, a hetero(C 4 )cycloalkyl, a hetero(C 5 )cycloalkyl, a hetero(C 6 )cycloalkyl, hetero(G?)cycloalkyl, hetero(C 8 )cycloaIkyl, or a heteroCC ⁇ cycloalkyl.
  • Heterocycloalkylene means cycloalkylene, as defined in this Application, provided that one or more of the ring member carbon atoms is replaced by a heteroatom.
  • heterocycloalkylene either alone or represented along with another radical, can be a hetero(C]. 13 )cycloalkylene, a a heteroCCi.6)cycloalkylene, a hetero(C 5 . 9 )cycloalkylene, or a hetero(C 2 -o)cycloalkylene.
  • heterocycloalkylene can be a hetero(C 2 )cycloalkylene, a hetero(C 3 )cycloalkylene, a hetero(C 4 )cycloalkylene, a hetero(C s )cycloalkylene, a hetero(C 6 )cycloalkylene, hetero(C7)cycloalkylene, hetero(C 8 )cycloalkylene, or a hetero(C 9 )cycloalkyle ⁇ e.
  • “Hydroxy” means the radical -OH.
  • IC 50 means the molar concentration of an inhibitor that produces 50% inhibition of the target enzyme.
  • Iminoketone derivative means a derivative comprising the moiety -C(NR)-, wherein R is hydrogen or a further substituent.
  • “Isomers” means compounds having identical molecular formulae but differing in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space.
  • Oxaalkyl means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with oxygen atoms (-0- or -OR, wherein R is hydrogen or a further substituent).
  • an oxa(C[. ⁇ o)alkyl refers to a chain comprising between 1 and 10 carbons and one or more oxygen atoms.
  • the carbonyl group may be an aldehyde, ketone, ester, amide, acid or acid halide.
  • an oxo(C].io)alkyl refers to a chain comprising between 1 and 10 carbon atoms and one or more carbonyl groups.
  • "Oxy" means the radical -O- or -OR, wherein R is hydrogen or a further substituent. Accordingly, it is noted that the oxy radical may be further substituted with a variety of substituents to form different oxy groups including hydroxy, alkoxy, aryloxy, heteroaryloxy or carbonyloxy.
  • “Pharmaceutically acceptable salts” means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity.
  • Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as acetic acid, propionic acid, hexanoic acid, heptanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, mafonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, ⁇ -(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid
  • Polycyclic ring includes tricyclic and multi-cyclic rings.
  • the individual rings comprising the polycyclic ring can be fused, spiro or bridging rings.
  • Prodrug means a compound that is convertible in vivo metabolically into an inhibitor according to the present invention.
  • the prodrug itself may or may not also have activity with respect to a given target protein.
  • a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound.
  • esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene- bis-b-hydroxyna ⁇ hthoates, gentisates, isethionates, di-/?-toluoyltartrates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like.
  • a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.
  • Protected derivatives means derivatives of inhibitors in which a reactive site or sites are blocked with protecting groups. Protected derivatives are useful in the preparation of inhibitors or in themselves may be active as inhibitors. A comprehensive list of suitable protecting groups can be found in P.G.M. Wuts and T.W. Greene, "Greene's Protecting Groups in Organic Synthesis, 4th edition, John Wiley & Sons, Inc. 2007.
  • Ring and "ring assembly” means a carbocyclic or a heterocyclic system and includes aromatic and non-aromatic systems.
  • the system can be monocyclic, bicyclic or polycyclic.
  • the individual rings comprising the polycyclic ring can be fused, spiro or bridging rings.
  • Subject and “patient” includes humans, non-human mammals (e.g., dogs, cats, rabbits, cattle, horses, sheep, goats, swine, deer, and the like) and non-mammals (e.g., birds, and the like).
  • substituents include, but are not limited to, aldehyde, alicyclic, aliphatic, (C[.[ 0 )alkyl ( alkylene, alkylidene, amide, amino, aminoalkyl, aromatic, aryl, bicycloalkyl, bicycloaryl, carbamoyl, carbocyclyl, carboxyl, carbonyl group, cycloalkyl, cycloalkylene, ester, halo, heterobicycloalkyl, heterocycloalkylene, heteroaryl, heterobicycloaryl, heterocycloalkyl, oxo, hydroxy, iminoketone, ketone, nitro, oxaalkyl, and oxoalkyl moieties, each of which may optionally also be substituted or unsubstituted.
  • substituents include, but are not limited to, hydrogen, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C
  • the sulfinyl radical may be further substituted with a variety of substituents to form different sulfinyl groups including sulfinic acids, sulfinamides, sulfinyl esters, and sulfoxides.
  • “Sulfonyl” means the radical -SO 2 - and/or -SO 2 -R, wherein R is hydrogen or a further substituent. It is noted that the sulfonyl radical may be further substituted with a variety of substituents to form different sulfonyl groups including sulfonic acids, sulfonamides, sulfonate esters, and sulfones.
  • “Therapeutically effective amount” means that amount which, when administered to an animal for treating a disease, is sufficient to effect such treatment for the disease.
  • Thioalkyl means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with sulfur atoms (-S- or -S-R, wherein
  • a C 1 alkyl indicates that there is one carbon atom but does not indicate what are the substituents on the carbon atom.
  • a (Ci)alkyl comprises methyl (i.e., -CH 3 ) as well as -CRR 1 R" where R, R', and R" may each independently be hydrogen or a further substituent where the atom attached to the carbon is a heteroatom or cyano.
  • CF 3 , CH 2 OH and CH 2 CN for example, are all (Ci)alkyls.
  • terms such as alkylamino and the like comprise dialkylamino and the like.
  • a compound having a formula that is represented with a dashed bond is intended to include the formulae optionally having zero, one or more double bonds, as exemplified and shown below:
  • atoms making up the compounds of the present invention are intended to include all isotopic forms of such atoms.
  • Isotopes include those atoms having the same atomic number but different mass numbers.
  • isotopes of hydrogen include tritium and deuterium
  • isotopes of carbon include 13 C and 14 C.
  • the present invention relates to compounds that may be used to inhibit acetyl - CoA carboxylase (ACC) and, in particular, ACC 1 and/or ACC2.
  • ACC acetyl - CoA carboxylase
  • the present invention also relates to pharmaceutical compositions, kits and articles of manufacture comprising such compounds.
  • the present invention relates to methods and intermediates useful for making the compounds. Further, the present invention relates to methods of using said compounds.
  • the compounds of the present invention may also possess inhibitory activity for other ACC family members and thus may be used to address disease states associated with these other family members.
  • Compound of the Invention may also possess inhibitory activity for other ACC family members and thus may be used to address disease states associated with these other family members.
  • the present invention relates to compounds that are useful as ACC inhibitors.
  • the compounds of the invention consist of the formula:
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;
  • R 1 is selected from the group consisting of oxy, (Ci.io)alkoxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, imino, (C]. ⁇ o)alkyl, hydroxy (C M o)alkyl, carbonyl(C]. !
  • o)alkyl tbiocarbonyl(C].io)aIkyl, sulfonyl(Ci.io)alkyl, suIfmyl(Ci.io)alkyl, aza(C].io)alkyl, (C[. ⁇ o)oxaalkyl, (Ci.io)oxoalkyl, iminofQ. ⁇ o)alkyl, (C 3 .i 2 )cycloalkyl(C
  • R 2 is substituted or unsubstituted alkyl
  • Y is CR 3 or N, where R 3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[o)alkoxy, (Q- ⁇ Jaryloxy, hetero(C M o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamide, imino, sulfonyl, sulfinyl, (C ⁇ .io)alkyl, halo(C[.io)alkyl, hydroxy(C
  • the compounds of the invention consist of the formula:
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 3 is substituted or unsubstituted alkyl
  • Y is CR 3 or N, where R 3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C ⁇ - ⁇ o)alkoxy, (C 4 . 12 )aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]o)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(C].io)alkyl, hydroxy(C[.io)alkyl, carbonylfCi.ioJalkyl, thiocarbonyl(Ci.[o)alkyl, sulfonyl(C].io)alkyl, sulfinyl (C M o)alkyl, aza(C].]o)alkyl, (C ⁇ > ⁇ o)
  • V 2 and V 4 is a sulfur atom.
  • the compounds of the invention consist of the formula:
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 1 is selected from the group consisting of oxy, (C
  • R 2 is substituted or unsubstituted alkyl
  • Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].
  • R 20 and R 21 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[ 0 )alkoxy t (C_,.i 2 )aryloxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-ioJalkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C
  • R 20 and R 21 when present, are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
  • the compounds of the invention consist of the formula:
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 1 is selected from the group consisting of oxy, (C].]o)alkoxy, (Q. ⁇ aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylami ⁇ o, imino, (C M0 )alkyl, halo(C 1- l o)alkyl, hydroxy(Ci.] 0 )alkyl, carbonyl(C (- ⁇ o)alkyl, thiocarbonyl(Ci.io)alkyl, sulfonyl(C M0 )alkyl, sulfinyl(C[. ⁇ o)alkyl, azaCC M 0 )alkyl, (C ⁇ . ⁇ o)oxaalkyl, (C].,o)o
  • Y is CR 3 or N, where R 3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C].]o)alkoxy, (C 4 .] 2 )aryloxy, hetero(C
  • V 5 is selected from the group consisting Of CR 8 R 8' and NR 8' ;
  • V 6 is selected from the group consisting Of CR 9 R 9' and NR 9' ;
  • V 7 is selected from the group consisting Of CR 10 R 10' and NR 10' ;
  • V 8 is selected from the group consisting Of CR 11 R 11 ' and NR 11 ' ; wherein
  • R 8 , R 8' , R 9 , R 9' , R 10 , R 10' , R 1 ' and R 11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy,
  • a is 1 or 2;
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 1 is selected from the group consisting of oxy, (C].]o)alkoxy, (C 4 .i 2 )aryloxy, hetero(C ⁇ .io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]o)alkylamino, imino, (Ci.io)alkyl, halo(C l- l o)alkyl ) hydroxy(C M0 )alkyl, carbonyl(C[.
  • Y is CR 3 or N, where R 3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C M0 )alkoxy, (C 4- i 2 )aryloxy, hetero(C 1- 10 )aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C[.
  • R 1 is selected from the group consisting of oxy, (Ci-ioJalkoxy, (C 4-12 )aryloxy, hetero(C
  • Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C ⁇ . ⁇ o)alkoxy, (C 4 .] 2 )aryloxy, hetero(C M 0 )aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].]o)alkyl, halo(Ci.io)alkyl, hydroxy(Ci.io)alkyl, carbonyl(Ci.io)alkyl, thiocarbonyl(C ⁇ . ⁇ o)alkyl, sulfonyl(C].] 0 )alkyl, SuIFmVl(C 1 .
  • io)alkyl aza(C].] 0 )alkyl, (C[. ⁇ 0 )oxaalkyl, (Q. L oJoxoalkyl, imino(C,. 10 )alkyl, (C 3 -i 2 )cycloalkyl(C t-5 )aIkyl, hetero(C 3 .i2)cycloalkyl(Ci.io)alkyl, aryl(C].]o)alkyl 1 hetero(C[.[ 0 )aryl(C].s)alkyl, (C9-i2)bicycloaryl(C
  • the compounds of the invention consist of the formula:
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 3 -;
  • R 1 is selected from the group consisting of oxy, (Ci- t o)alkoxy, (C 4- 13 JaTyIoXy, hetero(Ci.[o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.io)alkylamino, imino, (C
  • R 3 is substituted or unsubstituted alkyl
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 2 is substituted or unsubstituted alkyl
  • Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, (C 4 . !2 )aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.ioJalkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C] -!0 )alkyl, halo(C
  • V 3 is selected from the group consisting of CR 6 and N;
  • V 4 is selected from the group consisting of CR 7 and N;
  • V 5 is selected from the group consisting of CR 8 R 8' , NR 8' , O, and S;
  • V 6 is selected from the group consisting of CR 9 R 9' , NR 9' , O, and S;
  • V 7 is selected from the group consisting of CR 10 R 10' , NR 10' , O, and S;
  • V 8 is selected from the group consisting Of CR 11 R 11 ' , NR 1 1 ' , O, and S;
  • R 6 , R 7 , R 8 , R 8' , R 9 , R 9' , R 10 , R 10' , R 11 and R 11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C
  • Q is a selected from the group consisting of -S-, -S(O)-, and -S(O) 2 -;
  • R 1 is selected from the group consisting of oxy, (C]. ⁇ o)alkoxy, (C.,.i 2 )aryloxy, hetero(C]. ⁇ o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, imino, (C ⁇ o)alkyl, halo(C[. ⁇ o)alkyl, hydroxy(C ⁇ -io)alkyl, carbonyl (C ]-io)alkyl, thiocarbonyl(Ci.io)alkyl > sulfo ⁇ yl(C] -10 )alkyl, sulfinyl(C
  • Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C ⁇ - ⁇ o)alkoxy, (C ⁇ aryloxy, hetero(C[.[o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].io)alkyl, halo(C].jo)alkyl, hydroxy(C[-io)alkyl, carbonyl(C ⁇ .[ 0 )alkyl, thiocarbonyl(C
  • V 5 is selected from the group consisting of CR 8 R 8' , NR 8' , O, and S
  • V 6 is selected from the group consisting of CR 9 R 9 , NR 9 , O, and S
  • V 7 is selected from the group consisting Of CR 10 R 10' , NR 10' , O, and S
  • V 8 is selected from the group consisting of CR 1 1 R 11 ' , NR 11 ' , O, and S;
  • R 8 , R 9 , R 10 , and R 11 may each be independently absent when the atom to which it is bound forms part of a double bond, or R 8 and R 9 are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R 9 and R are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R 10 and R 1 ' are taken together to form a ring selected from the group consisting of substituted or unsubstituted
  • R 1 is selected from the group consisting of oxy, (C ⁇ - ⁇ o)alkoxy, (C 4 .] 2 )aryloxy, hetero(C
  • R 2 is substituted or unsubstituted alkyl
  • Y is CR 3 or N, where R 3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C M0 )alkoxy, (C 4 .] 2 )aryloxy, hetero(C].] 0 )aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyi, (C[.[ 0 )alkyl, halo(C]-io)alkyl, hydroxy(C 1-10 )alkyl, carbonyl(C 1-10 )alkyl, thiocarbonyl(C].]o)alkyl, sulfonyl(Ci.io)alkyl, sulfinyl(C
  • Q is -S-. In other variations, Q is -S(O)-. In still other variations, Q is - S(O) 2 -.
  • R " is a substituted or unsubstituted (C
  • R 2 is a substituted or unsubstituted methyl.
  • R 2 is a substituted or unsubstituted ethyl.
  • R ! is selected from the group consisting of aminocarbonyl
  • R 1 is selected from the group consisting of (Ci.io)alkyl, hetero(C].io)alkyl, hetero(C ⁇ - ⁇ o)aryl, (C 3 .i 2 )cycloalkyl, hetero(C 3 .i 2 )cycloalkyl,
  • R 1 is a (G ⁇ -] 2 )aryl or a hetero(Ci.jo)aryI, each substituted or unsubstituted.
  • R 1 is a (C 4 .] 2 )aryl or hetero(C l . l0 )aryl
  • R 1 is selected from the group consisting
  • R 1 is a (C 4 .] 2 )aryl or hetero(C[.[ 0 )aryI
  • the (C 4 .i 2 )aryl and the hetero(Ci.io)aryI are each substituted with substituents each independently selected from the group consisting of chloro, bromo, -CN, methyl, methoxy, phenoxy, -C(O)OCH 3 , -C(O)OH 1 -C(O)CH 3 , -C(O)N(CH 2 CH) 3 , - C(O)O(CH 2 CH) 3 , -NHC(O)CH 3 , -N(CH 2 CH 3 ) 2l -N(CH 3 J 2 , -NO 2 , -OCF 3 , -SCH 3 , - S(O) 2 CH 3 , -S(O) 3 NH 2 ,
  • R 1 is a unsubstit ⁇ ted or substituted (Cg.]2)bicycloaryl, or unsubstituted or substituted hetero(C 4 .i 2 )bicycloaryl.
  • the and hetero(C 4 .] 2 )bicycloaryl are selected from the group consisting of:
  • Y is N.
  • Y is -CR 3 -, where R 3 is selected from the group consisting of hydrogen, methyl, ethyl, propyl, and isopropyl. In other variations, R 3 is hydrogen or methyl. In still other variations, R 3 is hydrogen or methyl.
  • Y is -CH-.
  • the compounds of the invention consist of a formula selected from the group consisting of:
  • R 1 is a selected from the group consisting of
  • R 1 is a selected from the group consisting of
  • R 1 is a selected from the group consisting of
  • R 10 and R 1 ' are each independently methyl or methoxy. In other variations, R 10 is methyl. In other variations,
  • R 10 is methoxy.
  • R 1 ' is methyl.
  • R 1 ' is methoxy.
  • the compounds of the present invention may be in the form of a pharmaceutically acceptable salt. It is further note that the compounds of the present invention may be in a mixture of stereoisomers, or the compound may comprise a single stereoisomer.
  • the present invention is related to a pharmaceutical composition
  • a pharmaceutical composition comprising as an active ingredient a compound according to any one of the above embodiments and variations.
  • the composition is a solid formulation adapted for oral administration.
  • the composition is a liquid formulation adapted for oral administration.
  • the composition is a tablet.
  • the composition is a liquid formulation adapted for parenteral administration.
  • the pharmaceutical composition comprises a compound according to any one of the above embodiments and variations, wherein the composition is adapted for administration by a route selected from the group consisting of orally, parenterally, intraperitoneally, intravenously, intraarterial Iy, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposaUy, intraarticular ⁇ , and intrathecally.
  • the invention is related to a kit which comprises a compound of any one of the above embodiments and variations, and instructions which comprise one or more forms of information selected from the group consisting of indicating a disease state for which the composition is to be administered, storage information for the composition, dosing information and instructions regarding how to administer the composition.
  • the kit comprises the compound in a multiple dose form.
  • the invention is related to an article of manufacture comprising a compound of any one of the above embodiments and variations and packaging materials.
  • the packaging material comprises a container for housing the compound.
  • the container comprises a label indicating one or more members of the group consisting of a disease state for which the compound is to be administered, storage information, dosing information and/or instructions regarding how to administer the compound.
  • the article of manufacture comprises the compound in a multiple dose form.
  • the invention is related to a therapeutic method comprising administering a compound of any one of the above embodiments and variations to a subject.
  • the method comprises contacting ACC with a compound of any one of the above embodiments and variations.
  • ACC is a member selected from ACCl and ACC2.
  • ACC is a member selected from ACCl and ACC2.
  • a further embodiment is a method of inhibiting ACC which comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations.
  • ACC is a member selected from ACCl and ACC2.
  • Another further embodiment is a method of treating a disease state for which
  • the method comprises causing a compound of any one of the above embodiments and variations to be present in a subject in a therapeutically effective amount for the disease state.
  • the method comprises administering a compound of any one of the above embodiments and variations to a subject, wherein the compound is present in the subject in a therapeutically effective amount for the disease state.
  • the method comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations.
  • the disease state is selected from the group consisting of metabolic syndrome (also known as insulin resistance syndrome, syndrome X), visceral obesity, hyperlipidemia, dyslipidemia, hyperglycemia, hypertension, hyperuricemia renal dysfunction, atherosclerosis, type-2 diabetes, android obesity, Cushing's disease, cognitive function, and ocular function.
  • the ACC is an ACC 1.
  • the ACC is an ACC2.
  • Another aspect of the invention is directed to methods of preparing the inhibitors of the invention. In one embodiment, the method comprising: coupling a compound of the formula
  • n 4;
  • R is selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[o)alkoxy, (C_,.i 2 )aryloxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci. ⁇ ))alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].]o)alkyl, ImIo(C 1 .
  • l0 )alkyl sulfinyl(C
  • R 1 is selected from the group consisting of oxy, (C].] 0 )alkoxy, (C 4 .i 2 )aryloxy, hetero(C[.
  • R 2 is substituted or unsubstituted alkyl.
  • R 1 is selected from the group consisting of methyl, isobutyl, -(CH 3 )SC(O)OCH 2 CH 3 , -(CH2) 2 C(O)N(CH 2 CH 3 ) 2 , (CH 2 J 2 CF 3 ,
  • the compounds of the present invention may be present and optionally administered in the form of salts, hydrates and prodrugs that are converted in vivo into the compounds of the present invention.
  • Further acid addition salts of the present invention include, but are not limited to: adipate, alginate, arginate, aspartate, bisulfate, bisulfite, bromide, butyrate, camphorate, camphorsulfonate, caprylate, chloride, chlorobenzoate, cyclopentanepropionate, digluconate, dihydrogenphosphate, dinitrobenzoate, dodecylsulfate, fumarate, galacterate (from mucic acid), galacturonate, glucoheptonate, gluconate, glutamate, glycerophosphate, hemisuccinate, hemisulfate, heptanoate, hexanoate, hippurate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, iodide, isethionate, iso-butyrate, lactate, lactobionate, malate, malonate, mandelate
  • a pharmaceutically acceptable base addition salt can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base.
  • bases include alkali metal hydroxides including potassium, sodium and lithium hydroxides; alkaline earth metal hydroxides such as barium and calcium hydroxides; alkali metal alkoxides, e.g., potassium ethanolate and sodium propanolate; and various organic bases such as ammonium hydroxide, piperidine, diethanolamine and /V-methylglutamine.
  • aluminum salts of the compounds of the present invention are also included.
  • ⁇ oxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art.
  • N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent ⁇ e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent ⁇ e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0 0 C.
  • an oxidizing agent e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like
  • a suitable inert organic solvent e.g., a halogenated hydrocarbon such as dichloromethane
  • the ⁇ f-oxides of the compounds can be prepared from the iV-oxide of an appropriate starting material.
  • Protected derivatives of compounds of the present invention can also be made. Examples of techniques applicable to the creation of protecting groups and their removal can be found in P.G.M. Wuts and T.W. Greene in "Greene's Protective Groups in Organic Synthesis” 4th edition, John Wiley and Sons, 2007. [0160] Compounds of the present invention may also be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.
  • a "pharmaceutically acceptable salt”, as used herein, is intended to encompass any compound according to the present invention that is utilized in the form of a salt thereof, especially where the salt confers on the compound improved pharmacokinetic properties as compared to the free form of compound or a different salt form of the compound.
  • the pharmaceutically acceptable salt form may also initially confer desirable pharmacokinetic properties on the compound that it did not previously possess, and may even positively affect the pharmacodynamics of the compound with respect to its therapeutic activity in the body.
  • An example of a pharmacokinetic property that may be favorably affected is the manner in which the compound is transported across cell membranes, which in turn may directly and positively affect the absorption, distribution, biotransformation and excretion of the compound.
  • the solubility of the compound is usually dependent upon the character of the particular salt form thereof, which it utilized.
  • an aqueous solution of the compound will provide the most rapid absorption of the compound into the body of a subject being treated, while lipid solutions and suspensions, as well as solid dosage forms, will result in less rapid absorption of the compound.
  • Metabolic syndrome also known as insulin resistance syndrome, syndrome X
  • syndrome X is a common clinical disorder that is defined as the presence of increased insulin concentrations in association with other disorders including visceral obesity, hyperlipidemia and dyslipidemia, hyperglycemia, hypertension, and sometimes hyperuricemia and renal dysfunction.
  • TAG intramyocellular triacylglyceride
  • malonyl-CoA plays an important role in the overall fatty acid metabolism: malonyl-CoA is an intermediate utilized by fatty acid synthase for de novo lipogenesis, and it also acts as a potent allosteric inhibitor of carnitine palmitoyltransferase 1 (CPTl), a mitochondrial membrane protein that shuttles long chain fatty acyl CoAs into the mitochondria for ⁇ -oxidization.
  • CPTl carnitine palmitoyltransferase 1
  • a small molecule inhibitor of ACC would thus limit de novo lipid synthesis and increase muscle and liver fat oxidation; thus reduce the accumulation of long chain fatty acids.
  • the compounds of the invention are also useful for the prophylaxis or treatment of atherosclerosis, a disease of the arteries.
  • the pathological sequence leading to atherosclerosis and occlusive heart disease is well known. The earliest stage in this sequence is the formation of "fatty streaks" in the carotid, coronary and cerebral arteries and in the aorta. These lesions are yellow in color due to the presence of lipid deposits found principally within smooth-muscle cells and in macrophages of the intima layer of the arteries and aorta.
  • Antiatherosclerosis agents being contemplated for combination therapy with the compounds of the invention include, but are not limited to, lipase inhibitors, HMG-CoA reductase inhibitors, HMG-CoA synthase inhibitors, HMG-CoA reductases, gene expression inhibitors, HMG-CoA synthase gene expression inhibitors, microsomal triglyceride transfer protein (MTP)/ Apo B secretion inhibitors, cholesterol ester transfer protein (CETP) inhibitors, bile acid absorption inhibitors, cholesterol absorption inhibitors, cholesterol synthesis inhibitors, squalene synthetase inhibitors, squalene epoxidase inhibitors, squalene cyclase inhibitors, combined squalene epoxidase/squalene cyclase inhibitors, fibrates, niacin, PPAR agonists, ion-exchange resins, antioxidants, acyl- CoA: cholesterol
  • Diabetes treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, aldose reductase inhibitors, glucocorticoid receptor antagonists, glycogenolysis inhibitors, glycogen phosphorylase inhibitors, sorbitol dehydrogenase inhibitors, insulin, insulin analogs, insulinotropin, sulfonylureas, sulfonylureas analogs, biguanides, imidazolines, insulin secretagogues, linogliride, glitazones, glucosidase inhibitors, acarbose, miglitol, emiglitate, voglibose, camiglibose, ⁇ -agonists, phosphodiesterase inhibitors (e.g., PDE5 or PDEl 1), vanadate, vanadium complexes (e.g.
  • Naglivan® peroxovanadium complexes
  • amylin antagonists amylase inhibitors
  • glucagon antagonists gluconeogenesis inhibitors
  • somatostatin analogs antilipolytic agents
  • nicotinic acid acipimox
  • pramlintide SymlinTM
  • nateglinide activators of AMP-activated protein kinase, PPAR ⁇ agonists, duel PPAR ⁇ or/PPAR- ⁇ agonists, protein kinase C-B inhibitors, PTPlB inhibitors, glycogen synthase kinase-3 inhibitors, GLP-I agonists or soluble guanylate cyclase (sGc) activators.
  • AMP-activated protein kinase PPAR ⁇ agonists
  • duel PPAR ⁇ or/PPAR- ⁇ agonists protein kinase C-B inhibitors
  • PTPlB inhibitors glycogen synthase
  • Specific diabetes treating agents include, but are not limited to, chlorpropamide, glibenclamide, tolbutamide, tolazamide, acetohexamide, Glypizide®, glimepiride, repaglinide, meglitinide, metformin, phenformin, buformin, midaglizole, isaglidole, deriglidole, idazoxan, efaroxan, fluparoxan, ciglitazone, pioglitazone, englitazone, darglitazone, clomoxir or etomoxir.
  • Obesity treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, phenylpropanolamine, ephedrine, pseudoephedrine, phentermine, a neuropeptide Y antagonist, a ⁇ -adrenergic receptor agonist, a cholecystokinin-A agonist, a monoamine reuptake inhibitor, a sympathomimetic agent, a serotonin modulator, a dopamine agonist, a melanocortin receptor modulator, a cannabinoid receptor antagonist, a melanin concentrating hormone antagonist, leptin, a leptin analog, a leptin receptor agonist, a galanin antagonist, a lipase inhibitor, a phosphatase IB inhibitor, a bombesin agonist, dehydroepiandrosternone or analogs thereof, thyroxine, a thyromimetic agent,
  • compositions Comprising ACC Inhibitors
  • compositions and administration methods may be used in conjunction with the compounds of the present invention.
  • Such compositions may include, in addition to the compounds of the present invention, conventional pharmaceutical excipients, and other conventional, pharmaceutically inactive agents. Additionally, the compositions may include active agents in addition to the compounds of the present invention. These additional active agents may include additional compounds according to the invention, and/or one or more other pharmaceutically active agents.
  • the compositions may be in gaseous, liquid, semi-liquid or solid form, formulated in a manner suitable for the route of administration to be used. For oral administration, capsules and tablets are typically used. For parenteral administration, reconstitution of a lyophilized powder, prepared as described herein, is typically used.
  • Co-administration in the context of this invention is intended to mean the administration of more than one therapeutic agent, one of which includes an ACC inhibitor, in the course of a coordinated treatment to achieve an improved clinical outcome.
  • Such co-administration may also be coextensive, that is, occurring during overlapping periods of time.
  • Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application may optionally include one or more of the following components; a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; agents for the adjustment of tonicity such as sodium chloride or dextrose, and agents for adjusting the acidity or alkalinity of the composition, such as alkaline or acidifying agents or buffers like carbonates, bicarbonates, phosphates, hydrochloric acid, and organic acids like acetic and citric acid.
  • Parenteral preparations may optionally be enclosed in ampules
  • compositions according to the present invention are optionally provided for administration to humans and animals in unit dosage forms, such as tablets, capsules, pills, powders, dry powders for inhalers, granules, sterile parenteral solutions or suspensions, and oral solutions or suspensions, and oil-water emulsions containing suitable quantities of the compounds, particularly the pharmaceutically acceptable salts, preferably the sodium salts, thereof.
  • the pharmaceutically therapeutically active compounds and derivatives thereof are typically formulated and administered in unit-dosage forms or multiple-dosage forms.
  • Unit-dose forms refers to physically discrete units suitable for human and animal subjects and packaged individually as is known in the art.
  • Each unit- dose contains a predetermined quantity of the therapeutically active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle or diluent.
  • unit-dose forms include ampoules and syringes individually packaged tablet or capsule.
  • Unit-dose forms may be administered in fractions or multiples thereof.
  • a multiple-dose form is a plurality of identical unit-dosage forms packaged in a single container to be administered in segregated unit-dose form.
  • Examples of multiple-dose forms include vials, bottles of tablets or capsules or bottles of pint or gallons.
  • multiple dose form is a multiple of unit-doses that are not segregated in packaging.
  • the composition may comprise: a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; a lubricant, such as magnesium stearate, calcium stearate and talc; and a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to those of skill in the art.
  • a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose
  • a lubricant such as magnesium stearate, calcium stearate and talc
  • a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to
  • compositions or formulations to be administered will, in any event, contain a sufficient quantity of an inhibitor of the present invention to reduce ACC activity in vivo, thereby treating the disease state of the subject.
  • Dosage forms or compositions may optionally comprise one or more compounds according to the present invention in the range of 0.005% to 100% (weight/weight) with the balance comprising additional substances such as those described herein.
  • a pharmaceutically acceptable composition may optionally comprise any one or more commonly employed excipients, such as, for example pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives, sodium crosscarmellose, glucose, sucrose, magnesium carbonate, sodium saccharin, talcum.
  • excipients such as, for example pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives, sodium crosscarmellose, glucose, sucrose, magnesium carbonate, sodium saccharin, talcum.
  • Such compositions include solutions, suspensions, tablets, capsules, powders, dry powders for inhalers and sustained release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. Methods for preparing these formulations are
  • Salts, preferably sodium salts, of the inhibitors may be prepared with carriers that protect the compound against rapid elimination from the body, such as time release formulations or coatings.
  • the formulations may further include other active compounds to obtain desired combinations of properties.
  • Oral pharmaceutical dosage forms may be as a solid, gel or liquid.
  • solid dosage forms include, but are not limited to tablets, capsules, granules, and bulk powders. More specific examples of oral tablets include compressed, chewable lozenges and tablets that may be enteric -coated, sugar-coated or film-coated.
  • capsules include hard or soft gelatin capsules. Granules and powders may be provided in non- effervescent or effervescent forms. Each may be combined with other ingredients known to those skilled in the art.
  • compounds according to the present invention are provided as solid dosage forms, preferably capsules or tablets.
  • the tablets, pills, capsules, troches and the like may optionally contain one or more of the following ingredients, or compounds of a similar nature: a binder; a diluent; a disintegrating agent; a lubricant; a glidant; a sweetening agent; and a flavoring agent.
  • binders examples include, but are not limited to, microcrystalline cellulose, gum tragacanth, glucose solution, acacia mucilage, gelatin solution, sucrose and starch paste.
  • glidants examples include, but are not limited to, colloidal silicon dioxide.
  • disintegrating agents examples include, but are not limited to, crosscarmellose sodium, sodium starch glycolate, alginic acid, corn starch, potato starch, bentonite, methylcellulose, agar and carboxymethylcellulose.
  • coloring agents examples include, but are not limited to, any of the approved certified water-soluble FD and C dyes, mixtures thereof; and water insoluble FD and C dyes suspended on alumina hydrate.
  • sweetening agents examples include, but are not limited to, sucrose, lactose, mannitol and artificial sweetening agents such as sodium cyclamate and saccharin, and any number of spray-dried flavors.
  • flavoring agents examples include, but are not limited to, natural flavors extracted from plants such as fruits and synthetic blends of compounds that produce a pleasant sensation, such as, but not limited to peppermint and methyl salicylate.
  • film coatings examples include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000 and cellulose acetate phthalate.
  • the salt of the compound may optionally be provided in a composition that protects it from the acidic environment of the stomach.
  • the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine.
  • the composition may also be formulated in combination with an antacid or other such ingredient.
  • Flavoring and sweetening agents may be used in tablets, and are especially useful in the formation of chewable tablets and lozenges.
  • liquid oral dosage forms that may be used include, but are not limited to, aqueous solutions, emulsions, suspensions, solutions and/or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules.
  • aqueous solutions that may be used include, but are not limited to, elixirs and syrups. As used herein, elixirs refer to clear, sweetened, hydroalcoholic preparations.
  • elixirs examples include, but are not limited to solvents.
  • solvents that may be used include glycerin, sorbitol, ethyl alcohol and syrup.
  • syrups refer to concentrated aqueous solutions of a sugar, for example, sucrose. Syrups may optionally further comprise a preservative.
  • Examples of pharmaceutically acceptable substances that may be used in non- effervescent granules, to be reconstituted into a liquid oral dosage form, include diluents, sweeteners and wetting agents.
  • Examples of pharmaceutically acceptable substances that may be used in effervescent granules, to be reconstituted into a liquid oral dosage form, include organic acids and a source of carbon dioxide.
  • preservatives include glycerin, methyl and propylparaben, benzoic add, sodium ben ⁇ oate and alcohol.
  • non-aqueous liquids that may be used in emulsions include mineral oil and cottonseed oil.
  • emulsifying agents include gelatin, acacia, tragacanth, bentonite, and surfactants such as polyoxyethylene sorbitan monooleate.
  • suspending agents include sodium carboxymethylcellulose, pectin, tragacanth, Veegum and acacia.
  • Diluents include lactose and sucrose.
  • Sweetening agents include sucrose, syrups, glycerin and artificial sweetening agents such as sodium cyclamate and saccharin.
  • wetting agents include propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.
  • organic acids that may be used include citric and tartaric acid.
  • flavoring agents include natural flavors extracted from plants such fruits, and synthetic blends of compounds that produce a pleasant taste sensation.
  • the solution e.g., for example, in a polyethylene glycol
  • a pharmaceutically acceptable liquid carrier e.g., water
  • compositions designed to administer the compounds of the present invention by parenteral administration generally characterized by subcutaneous, intramuscular or intravenous injection.
  • injectables may be prepared in any conventional form, for example as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • excipients that may be used in conjunction with injectables according to the present invention include, but are not limited to water, saline, dextrose, glycerol or ethanol.
  • suitable carriers include, but are not limited to physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
  • PBS physiological saline or phosphate buffered saline
  • aqueous vehicles examples include Sodium Chloride Injection, Ringers Injection, Isotonic Dextrose Injection, Sterile Water Injection, Dextrose and Lactated Ringers Injection.
  • nonaqueous parenteral vehicles examples include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil and peanut oil.
  • Antimicrobial agents in bacteriostatic or fungistatic concentrations may be added to parenteral preparations, particularly when the preparations are packaged in multiple-dose containers and thus designed to be stored and multiple aliquots to be removed. Examples of antimicrobial agents that may be used include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl /?-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzetho ⁇ ium chloride.
  • Examples of isotonic agents that may be used include sodium chloride and dextrose.
  • Examples of buffers that may be used include phosphate and citrate.
  • antioxidants that may be used include sodium bisulfate.
  • Examples of local anesthetics that may be used include procaine hydrochloride.
  • Examples of suspending and dispersing agents that may be used include sodium carboxymethylcellulose, hydroxypropyl methylcellulose and polyvinylpyrrolidone.
  • Examples of emulsifying agents that may be used include Polysorbate 80 (TWEEN 80).
  • a sequestering or chelating agent of metal ions includes EDTA.
  • Pharmaceutical carriers may also optionally include ethyl alcohol, polyethylene glycol and propylene glycol for water miscible vehicles and sodium hydroxide, hydrochloric acid, citric acid or lactic acid for pH adjustment.
  • concentration of an inhibitor in the parenteral formulation may be adjusted so that an injection administers a pharmaceutically effective amount sufficient to produce the desired pharmacological effect.
  • concentration of an inhibitor and/or dosage to be used will ultimately depend on the age, weight and condition of the patient or animal as is known in the art.
  • Unit-dose parenteral preparations may be packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile, as is known and practiced in the art.
  • Injectables may be designed for local and systemic administration.
  • a therapeutically effective dosage is formulated to contain a concentration of at least about 0.1% w/w up to about 90% w/w or more, preferably more than 1% w/w of the ACC inhibitor to the treated tissue(s).
  • the inhibitor may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment will be a function of the location of where the composition is parenterally administered, the carrier and other variables that may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the age of the individual treated.
  • the ACC inhibitor may optionally be suspended in micronized or other suitable form or may be derivatized to produce a more soluble active product or to produce a prodrug.
  • the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle.
  • the effective concentration is sufficient for ameliorating the symptoms of the disease state and may be empirically determined,
  • the compounds of the present invention may also be prepared as lyophilized powders, which can be reconstituted for administration as solutions, emulsions and other mixtures.
  • the lyophilized powders may also be formulated as solids or gels.
  • Sterile, lyophilized powder may be prepared by dissolving the compound in a sodium phosphate buffer solution containing dextrose or other suitable excipient. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides the desired formulation.
  • the ACC inhibitors may be formulated as aerosols for topical application, such as by inhalation (see, U.S. Pat. Nos. 4,044,126, 4,414,209, and 4,364,923, which describe aerosols for delivery of a steroid useful for treatment of inflammatory diseases, particularly asthma).
  • These formulations for administration to the respiratory tract can be in the form of an aerosol or solution for a nebulizer, or as a microfine powder for insufflation, alone or in combination with an inert carrier such as lactose.
  • the particles of the formulation will typically have diameters of less than 50 microns, preferably less than 10 microns.
  • Citric Acid Monohydrate 1.05 mg
  • the invention is also directed to kits and other articles of manufacture for treating diseases associated with ACC. It is noted that diseases are intended to cover all conditions for which ACC inhibitors possess activity that contributes to the pathology and/or symptomology of the condition.
  • the container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition.
  • the kit may also optionally comprise additional components, such as syringes for administration of the composition.
  • the kit may comprise the composition in single or multiple dose forms. [0243] It is noted that the packaging material used in kits and articles of manufacture according to the present invention may form a plurality of divided containers such as a divided bottle or a divided foil packet.
  • the container can be in any conventional shape or form as known in the art which is made of a pharmaceutically acceptable material, for example a paper or cardboard box, a glass or plastic bottle or jar, a re-sealable bag (for example, to hold a "refill" of tablets for placement into a different container), or a blister pack with individual doses for pressing out of the pack according to a therapeutic schedule.
  • a pharmaceutically acceptable material for example a paper or cardboard box, a glass or plastic bottle or jar, a re-sealable bag (for example, to hold a "refill" of tablets for placement into a different container), or a blister pack with individual doses for pressing out of the pack according to a therapeutic schedule.
  • the container that is employed will depend on the exact dosage form involved, for example a conventional cardboard box would not generally be used to hold a liquid suspension. It is feasible that more than one container can be used together in a single package to market a single dosage form. For example, tablets may be contained in a bottle that is in
  • kit form is particularly advantageous when the separate components are preferably administered in different dosage forms (e.g., oral, topical, transdermal and parenteral), are administered at different dosage intervals, or when titration of the individual components of the combination is desired by the prescribing physician.
  • dosage forms e.g., oral, topical, transdermal and parenteral
  • Blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process recesses are formed in the plastic foil. The recesses have the size and shape of individual tablets or capsules to be packed or may have the size and shape to accommodate multiple tablets and/or capsules to be packed. Next, the tablets or capsules are placed in the recesses accordingly and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed.
  • kits are a dispenser designed to dispense the daily doses one at a time in the order of their intended use.
  • the dispenser is equipped with a memory-aid, so as to further facilitate compliance with the regimen.
  • a memory-aid is a mechanical counter that indicates the number of daily doses that has been dispensed.
  • a memory-aid is a battery- powered micro-chip memory coupled with a liquid crystal readout, or audible reminder signal which, for example, reads out the date that the last daily dose has been taken and/or reminds one when the next dose is to be taken.
  • Propionamide-containing sulfonamides can be prepared as outlined in Scheme 3.
  • the protected piperazine can be sulfonylated under standard conditions, the Boc group removed by the action of TFA, and the secondary amine TFA salt coupled with the 2- aminobenzo[b]thiophene-3-carboxylic acid.
  • Hydrolysis of the ester function, followed by coupling with a secondary amine, would furnish the penultimate amide which, upon treatment with an isocyanate in the presence of pyridine, would afford the desired urea.
  • 22JJ EEDDaCI 1 HHOOBB 11 wlicru n is 1 , 2, 3, or 4;
  • R" and R b ore H, alky!, ⁇ ryl, hctcroaryl, cycioalky), and Jicter ⁇ cycloaikyl the other variables are as defined herein
  • reaction mixture was then partitioned between water and ethyl acetate and the organics washed with 1.0 M H 3 PO 4 , water, NaHC ⁇ 3 (sat. aq., 2x), water, and brine, dried over Na 2 SO 4 , filtered, and concentrated under reduced pressure. Recrystallization from hot ethanol afforded the alkyl 3-(4-(2-aminobenzo[fr]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)propionate (55%).
  • reaction mixture was acidified (pH 4-6) with 1.0 M H 3 PO 4 , extracted with EtOAc, and the combined organic extracts dried over Na 2 SO 4 , filtered, and concentrated under reduced pressure to afford the 3-(4-(2-aminobenzo[b]thiophene-3- carbonyl) ⁇ iperazin- 1 -ylsulfonyl)propionic acid.
  • R c is a subst ⁇ ucnt as defined in the Application when R 1 is an aryl or heierosryl
  • Z is -S(O)- or -S(O) 2 -;
  • R c is a substitucnt as defined in the Application when R 1 is an aryl or heiero ⁇ ryl.
  • R e is a subsiilucnt on R 1 as defined in the Application when R 1 is an aryl or heiero ⁇ ryl.
  • Compounds according to the present invention can be prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds, separating the diastereomers and recovering the optically pure enantlomer. While resolution of enantiomers can be carried out using covalent diastereomeric derivatives of compounds, dissociable complexes are preferred (e.g., crystalline diastereoisomeric salts).
  • Compounds according to the present invention can also be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid.
  • a pharmaceutically acceptable base addition salt of a compound can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base.
  • inorganic and organic acids and bases suitable for the preparation of the pharmaceutically acceptable salts of compounds are set forth in the definitions section of this Application.
  • the salt forms of the compounds can be prepared using salts of the starting materials or intermediates.
  • the free acid or free base forms of the compounds can be prepared from the corresponding base addition salt or acid addition salt form.
  • a compound in an acid addition salt form can be converted to the corresponding free base by treating with a suitable base (e.g., ammonium hydroxide solution, sodium hydroxide, and the like).
  • a compound in a base addition salt form can be converted to the corresponding free acid by treating with a suitable acid (e.g., hydrochloric acid, etc).
  • a suitable acid e.g., hydrochloric acid, etc.
  • the ⁇ f-oxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art.
  • N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent (e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent ⁇ e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0 0 C.
  • an oxidizing agent e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like
  • a suitable inert organic solvent e.g., a halogenated hydrocarbon such as dichloromethane
  • the /V-oxides of the compounds can be prepared from the ⁇ f-oxide of an appropriate starting material.
  • Compounds in an unoxidized form can be prepared from W-oxides of compounds by treating with a reducing agent (e.g., sulfur, sulfur dioxide, triphenyl phosphine, lithium borohydride, sodium borohydride, phosphorus trichloride, tribromide, or the like) in an suitable inert organic solvent (e.g., acetonitrile, ethanol, aqueous dioxane, or the like) at 0 to 80 0 C.
  • a reducing agent e.g., sulfur, sulfur dioxide, triphenyl phosphine, lithium borohydride, sodium borohydride, phosphorus trichloride, tribromide, or the like
  • an inert organic solvent e.g., acetonitrile, ethanol, aqueous dioxane, or the like
  • Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.
  • MS mass spectra
  • compound purity data were acquired on a Waters ZQ LC/MS single quadrupole system equipped with electrospray ionization (ESI) source, UV detector (220 and 254 nm), and evaporative light scattering detector (ELSD).
  • ESI electrospray ionization
  • ELSD evaporative light scattering detector
  • Thin-layer chromatography was performed on 0,25 mm E. Merck silica gel plates (60F-254), visualized with UV light, 5% ethanolic phosphomolybdic acid, Ni ⁇ hydrin orp-anisaldehyde solution. Flash column chromatography was performed on silica gel (230-400 mesh, Merck).
  • the starting materials and reagents used in preparing these compounds are either available from commercial suppliers such as the Aldrich Chemical Company (Milwaukee, WI), Bachem (Torrance, CA), Sigma (St. Louis, MO), or may be prepared by methods well known to a person of ordinary skill in the art, following procedures described in such standard references as Fieser and Fieser's Reagents for Organic Synthesis, vols. 1-23, John Wiley and Sons, New York, NY, 2006; Rodd's Chemistry of Carbon Compounds, vols. 1-5 and supps., Elsevier Science Publishers, 1998; Organic Reactions, vols.
  • a racemic mixture of a compound may be reacted with an optically active resolving agent to form a pair of diastereoisomeric compounds.
  • the diastereomers may then be separated in order to recover the optically pure enantiomers.
  • Dissociable complexes may also be used to resolve enantiomers (e.g., crystalline diastereoisomeric salts).
  • Diastereomers typically have sufficiently distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities.
  • diastereomers can typically be separated by chromatography or by separation/resolution techniques based upon differences in solubility.
  • separation/resolution techniques A more detailed description of techniques that can be used to resolve stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981).
  • Diastereomers have distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities.
  • the diastereomers can be separated by chromatography or, preferably, by separation/resolution techniques based upon differences in solubility.
  • the optically pure enantiomer is then recovered, along with the resolving agent, by any practical means that would not result in racemization,
  • a more detailed description of the techniques applicable to the resolution of stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981).
  • Chiral components can be separated and purified using any of a variety of techniques known to those skilled in the art.
  • chiral components can be purified using supercritical fluid chromatography (SFC).
  • SFC supercritical fluid chromatography
  • chiral analytical SFC/MS analyses are conducted using a Berger analytical SFC system (AutoChem, Newark, DE) which consists of a Berger SFC dual pump fluid control module with a Berger FCM 1100/1200 supercritical fluid pump and FCM 1200 modifier fluid pump, a Berger TCM 2000 oven, and an Alcott 718 autosampler.
  • the integrated system can be controlled by BI-SFC Chemstation software version 3.4.
  • Detection can be accomplished with a Waters ZQ 2000 detector operated in positive mode with an ESI interface and a scan range from 200-800 Da with 0.5 second per scan.
  • Chromatographic separations can be performed on a ChiralPak AD-H 1 ChiralPak AS-H, ChiralCel OD-H, or ChiralCel OJ-H column (5 ⁇ , 4.6 x 250 mm; Chiral Technologies, Inc. West Chester, PA) with 10 to 40% methanol as the modifier and with or without ammonium acetate (10 mM).
  • Any of a variety of flow rates can be utilized including, for example, 1.5 or 3.5 mLVmin with an inlet pressure set at 100 bar.
  • sample injection conditions can be used including, for example, sample injections of either 5 or lO ⁇ L in methanol at 0.1 mg/mL in concentration.
  • sample injections of either 5 or lO ⁇ L in methanol at 0.1 mg/mL in concentration.
  • preparative chiral separations are performed using a Berger
  • the inhibitory effect of the compound of the invention on ACC may be evaluated by a variety of in vitro and in vivo binding assays and functional assays, e.g., Harwood HJ Jr. et al. J Biol Chem. 2003 278(39):31099-l 1 1 ; Liu Y. et al. Assay Drug Dev Technol. 2007 5(2):225-35; and Seethala R. et al. Anal Biochem. 2006 358(2 ):251 -65.
  • Example A Provided in Example A is an in vitro enzymatic ACC activity assay for activity against ACC, The binding affinity of the test compound to ACCl or ACC2 is determined by the changes in absorbance (at 620 nm); the absorbance is proportional to the fraction of bound inhibitor. It should be noted that a variety of other expression systems and hosts are also suitable for the expression of ACC, as would be readily appreciated by one of skill in the art.
  • the present invention is further exemplified, but not limited by, the following examples that describe the synthesis of particular compounds according to the invention. It will be readily recognized that certain compounds according to the present invention have atoms with linkages to other atoms that confer a particular stereochemistry to the compound (e.g., chiral centers). It is recognized that synthesis of compounds according to the present invention may result in the creation of mixtures of different stereoisomers (i.e., enantiomers and diastereomers). Unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all of the different possible stereoisomers. EXAMPLE 1
  • Human ACCl cDNA was amplified from human liver cDNA by polymerase chain reaction using primers;
  • Eluted protein was dialysed against buffer B (50 mM HEPES (pH 7.5), 300 mM NaCl, 10 mM MgCl 2 , 10 mM tripotassium citrate, 2 mM dithiothreitol) and concentrated using Vivaspin20 ultrafiltration tube (Sartorius).
  • buffer B 50 mM HEPES (pH 7.5), 300 mM NaCl, 10 mM MgCl 2 , 10 mM tripotassium citrate, 2 mM dithiothreitol
  • Human ACC2 cDNA except coding region for mitochondria localization sequence was amplified from human skeletal muscle cDNA by polymerase chain reaction using primers; S'CCAGGTCGACCCGCCAACGGGACTGGGACACAAGGS' (SEQ ID NO: 3) and S'CGCACTCTCAGTTTCCCGGATTCCCS' (SEQ ID NO: 4).
  • the amplified DNA fragment was digested by Sail and AfIII, and cloned into pFAST-BacHTa (Invitrogen). Preparation of recombinant vaculovirus, infection of the virus to SF-9 cells and purification of recombinant ACC2 protein with 6xHis-tag at the N-terminal were performed in the same method as described above.
  • Malachite green solution was prepared by mixing 100 mL of solution A (0.12% malachite green in 5N H 2 SO 4 ), 25 mL of solution B (7.5% ammonium molybdate) and 2 mL of solution C (1 1% TWEEN-20).
  • ACCl was diluted to 8 ⁇ g/mL in reaction buffer (50 mM HEPES pH7.5, 10 mM MgCl 2 , 10 mM tripotassium citrate, 2 mM DTT, 0.75 mg/mL fatty acid free BSA) and 10 ⁇ L diluted enzyme solution was pored into each well of 384-well clear bottom plate.
  • Test compound was diluted in the reaction buffer and 5 ⁇ L of the compound solution was added into each well, and the mixture was incubated at 30 0 C for 60 minutes.
  • ACC2 was diluted to 6.4 ⁇ g/mL in reaction buffer, and the activity was measured by the same method as described for ACCl.

Abstract

The present invention relates to acetyl coenzyme-A carboxylase ('ACC') inhibiting compounds of the Formula (I), wherein the variables are as defined herein. In particular, the present invention relates to ACC1 and/or ACC2 inhibitors, compositions of matter, kits and articles of manufacture comprising these compounds, methods for inhibiting ACC1 and/or ACC2, and methods of making the inhibitors.

Description

ACETYL COENZYME A CARBOXYLASE INHIBITORS
FIELD OF THE INVENTION
[0001] The present invention relates to compounds that may be used to inhibit acetyl coenzyme-A carboxylase ("ACC"), as well as compositions of matter, kits and articles of manufacture comprising these compounds. The invention also relates to methods for inhibiting ACC and methods of using compounds according to the present invention to treat, for example, metabolic syndrome, diabetes, obesity, atherosclerosis, and cardiovascular disease in mammals, including humans. In addition, the invention relates to methods of making the compounds of the present invention, as well as intermediates useful in such methods. In particular, the present invention relates to ACCl and/or ACC2 inhibitors, compositions of matter, kits and articles of manufacture comprising these compounds, methods for inhibiting ACCl and/or ACC2, and methods of making the inhibitors.
BACKGROUND OF THE INVENTION
[0002] Acetyl coenzyme A carboxylases (ACC) catalyze the rate limiting reaction in fatty acid biosynthesis in plants and animals. ACC is a biotin containing enzyme which catalyzes the carboxylation of acetyl CoA to form malonyl CoA in a two-step reaction. Beaty and Lane, J. Biol. Chem. 1982, 257:924929. The first step is the ATP-dependent carboxylation of biotin covalently linked to the enzyme. In the second step, a carboxyltransferase step, the carboxyl group is transferred to the substrate, acetyl CoA, to form malonyl CoA.
[0003] Malonyl-CoA is an intermediate substrate that plays an important role in the overall fatty acid metabolism: malonyl-CoA is utilized (as C2 donor) by fatty acid synthase for de novo synthesis of long chain fatty acids, and also acts as a potent allosteric inhibitor of carnitine palmitoyltransferase 1 (CPTl), a mitochondrial membrane protein that shuttles long chain fatty acyl CoAs into the mitochondria where they are oxidized. Ruderman N. and Prentki M, Nat Rev Drug Discov. 2004, 3:340-51. An inhibitor of ACC would thus limit de novo lipid synthesis, de-inhibit CPTl and subsequently increase fat oxidation. [0004] In mammals, there are two known isoforms of acetyl CoA carboxylase (ACC) that are encoded by distinct genes and share approximately 70% amino acids identity. ACCl (ACCα.), a 265 KD protein, is highly expressed in the cytosol of lipogenic tissues such as liver and adipose tissue, where fatty acids are synthesized. ACC2 (ACCβ), a 280 KD protein, is expressed mainly in oxidative, non-lipogenic, tissues, such as skeletal muscle and heart muscle, although some is also found in liver. Mao J. et al., Proc Natl Acad Sci U S A, 2003, 700:7515-20; Abu-Elheiga L. et ύ., J Biol Chem 1997, 272: 10669- 77. Malonyl CoA produced by ACCl is preferentially converted into fatty acids by fatty acid synthase. Abu-Elheiga L. et al., Proc Natl Acad Sci USA 2000, 97: 1444-9. [0005] The malonyl CoA postulated to be formed by ACC2 locally on the mitochondrial surface regulates the palmitoyl CoA shuttle system. Abu-Elheiga L. et al., Proc Natl Acad Sci USA 2000; 97: 1444-9. Malonyl CoA is a potent inhibitor of carnitine paimitoyl transferase 1 (CPT-I), and as a consequence, it decreases the fatty acid flux into the mitochondria. Thus, reduction of ACC2 activity would reduce local malonyl CoA levels and increase fatty acid β-oxidation concomitantly reducing triacylglycerol (TAG) synthesis. Mυnday, Biochem Soc Trans. 2001, 30: 1059-64; Yamauchi T. et al. Nat Med 2001, 7:941-6.
[0006] ACC is a potential target in metabolic diseases, such as metabolic syndrome, obesity, insulin resistance, dyslipidemia, diabetes, atherosclerosis, and cardiovascular diseases, which are mediated by abnormal fatty acid metabolism. An inhibitor of ACC would potentially limit de novo lipid synthesis, de-inhibit CPTl and subsequently increase fat oxidation. Increased rates of muscle fatty acid oxidation, a reduced fat content and a reduction in total body fat were observed in ACC-2 knock-out mice (Abu-Elheiga et al., Science 2001, 297:2613 2616; Abu-Elheiga et al., Proc. Natl. Acad. Sci. USA1 2003, 700: 10207 10212). Harwood et al. reported that ACC inhibitors caused reduction in fatty acid synthesis, increase in fatty acid oxidation, and reduction of respiratory quotient in rats. Harwood et al. J. Biol. Chem. 2003, 275:37099 3711 1. Chronic dosing of these compounds resulted in the reduction of whole body fat mass and improvement of insulin sensitivity. Harwood et al. J. Biol. Chem. 2003, 275:37099 3711 1. These observations further validated the enzyme as a drug target.
[0007] Several non-natural product small molecule have been identified which target ACC for the prophylaxis or treatment of metabolic syndrome, atherosclerosis, diabetes, and obesity, see, US Patent No. 6,979,741, US Applications No. 2007/0219258, No. 2007/0219251, and No. 2003/0187254. There is a continuing need and a continuing search in this field of art for more potent therapeutic agents,
SUMMARY OF THE INVENTION
[0008] The present invention relates to compounds that inhibit ACC. The present invention also provides compositions, articles of manufacture and kits comprising these compounds. The invention further provides methods of using, and methods of preparing the compounds of the invention.
[0009] In one aspect, the invention relates to compounds of the formula:
Figure imgf000004_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;
R1 is selected from the group consisting of oxy, (C].]o)alkoxy, (C4-I 2JaTyIoXy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, imino, (C].to)alkyl, halo(Ci.]0)alkyl, hydroxy(CL.10)alkyl, carbonyl(Cι.l0)alkyl, tbiocarbonyl(CM0)alkyl, sulfonyl(CM0)alkyl, sulfmyl(CMo)alkyl, aza(CM0)alkyl, (Cι.m)oxaalkyl, (C]-10)oxoalkyl, imino(Ci.]0)alkyl, (C3.12)cycIoalkyl(C]-5)a]kyl, hetero(C3-i2)cycIoalkyl(Ci.io)alkyl, aryl(CM0)alkyl, hetero(CMo)aryl(C].5)alkyl, (C9.12)bicyc]oaryl(C,-5)alkyl, hetero(CB-i2)bicycloaryl(Ci-5)alkyl, hetero(CMo)alkyl, (Qι-i2)cycloa1kyl, hetero(C3-]2)cycloalkyl, (C9.12)bicycloalkyl, hetero(C3.i2)bicycloalkyl, (C4.[2)aryl, hetero(C].]o)aryl, (C9.i2)bicycloaryl, and hetero(C4-i2)bicycloarylt each substituted or unsubstituted;
R" is substituted or unsubstituted alkyl; and Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, (C4-L 2)aryloxy, hetero(C[.[0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.]0)alkylamino, sulfonamido, imino, sulfonyl, sulfmyl, (CM0)alkyl, halo(C,.10)alkyl, hydroxy(C|-]0)alkyl, carbonyl(C|.[0)alkyI, thiocarbonyl(Ci.io)alkyl, sulfonyl(Ci.]0)alkyl, sulfinyl(C1-10)alkyl, aza(C].10)alkyl, (Ci.io)oxaalkyl, (Ci.]o)oxoalkyl, imino(C].]0)alkyI, (C3.]2)cycIoalkyl(C].5)a]kyI, hetero(C3.i2)cycloaIkyl(C|.10)alkyl, aryl(CMo)alkyl, hetero(Ci.io)aryl(C].s)alkyl, (C9.i2)bicycloaryl(C].5)alkyl, hetero(C8-i2)bicycloaryl(Ci.5)alkyl, hetero(Ct.l0)alkyl, (C3-12)cycloalkyl, hetero(C3.i2)cycloaIkyl, (C9-] 2)bicycloalkyl, hetero(C3.]2)bicycloalkyl, (C-,.i2)ary], HeIeTO(C1.10)aryl, (C9-t2)bicycloaryl, and hetero(C4-i2)bicycloaryl, each substituted or unsubstituted.
[0010] In another aspect, the invention relates to pharmaceutical compositions that comprise an ACC inhibitor according to the present invention as an active ingredient. In one embodiment, the ACC inhibitor is a member selected from an ACCl inhibitor and an ACC2 inhibitor. Pharmaceutical compositions according to the invention may optionally comprise 0.001%- 100% of one or more inhibitors of this invention. These pharmaceutical compositions may be administered or coadministered by a wide variety of routes, including for example, orally, parenterally, intraperitoneal Iy, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomaliy, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticular^, or intrathecal Iy. The compositions may also be administered or coadministered in slow release dosage forms. [0011] In another aspect, the invention is related to kits and other articles of manufacture for treating disease states associated with ACC.
[0012] In one embodiment, a kit is provided that comprises a composition comprising at least one ACC inhibitor of the present invention in combination with instructions. In one embodiment, the ACC inhibitor is a member selected from an ACCl inhibitor and an ACC2 inhibitor. The instructions may indicate the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also comprise packaging materials. The packaging material may comprise a container for housing the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.
[0013] In another embodiment, an article of manufacture is provided that comprises a composition comprising at least one ACC inhibitor of the present invention in combination with packaging materials. In one embodiment, the ACC inhibitor is a member selected from an ACCl inhibitor and an ACC2 inhibitor. The packaging material may comprise a container for housing the composition. The container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms.
[0014] Also provided are methods for preparing compounds, compositions and kits according to the present invention. For example, several synthetic schemes are provided herein for synthesizing compounds according to the present invention. [0015] Also provided are methods for using compounds, compositions, kits and articles of manufacture according to the present invention.
[0016] In one embodiment, the compounds, compositions, kits and articles of manufacture are used to inhibit ACC. In one embodiment, ACC is a member selected from ACCl and ACC2.
[0017] In another embodiment, the compounds, compositions, kits and articles of manufacture are used to treat a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state. In one embodiment, the disease is treated by inhibiting ACCl. In another embodiment, the disease is treated by inhibiting ACC2,
[0018] In another embodiment, a compound is administered to a subject wherein ACC activity within the subject is altered, preferably reduced. In one embodiment, the administered compound alters and preferably reduces the activity of ACCl in a subject. In another embodiment, the administered compound alters and preferably reduces the activity of ACC2 in a subject.
[0019] In another embodiment, a prodrug of a compound is administered to a subject that is converted to the compound in vivo where it inhibits ACC. In one embodiment, the prodrug inhibits ACCl. In another embodiment, the prodrug inhibits ACC2. [0020] In another embodiment, a method of inhibiting ACC is provided that comprises contacting an ACC with a compound according to the present invention. In one embodiment, the invention provides a method of inhibiting ACCl that comprises contacting ACCl with a compound according to the present invention. In another embodiment, the invention provides a method of inhibiting ACC2 that comprises contacting ACC2 with a compound according to the present invention. [0021] In another embodiment, a method of inhibiting ACC is provided that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC in vivo. In one embodiment, the invention provides a method of inhibiting ACCl that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACCl in vivo. In another embodiment, the invention provides a method of inhibiting ACC2 that comprises causing a compound according to the present invention to be present in a subject in order to inhibit ACC2 in vivo. [0022] In another embodiment, a method of inhibiting an ACC is provided that comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo. It is noted that the compounds of the present invention may be the first or second compounds. In one embodiment, the ACC is a member selected from ACCl and ACC2. [0023] In another embodiment, a therapeutic method is provided that comprises administering a compound according to the present invention. [0024] In another embodiment, a method of treating a condition in a patient that is known to be mediated by ACC, or which is known to be treated by ACC inhibitors, comprising administering to the patient a therapeutically effective amount of a compound according to the present invention. In an exemplary embodiment, the ACC is a member selected from ACCl and ACC2.
[0025] In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: causing a compound according to the present invention to be present in a subject in a therapeutically effective amount for the disease state. In an exemplary embodiment, the ACC is a member selected from ACCl and ACC2.
[0026] In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: administering a first compound to a subject that is converted in vivo to a second compound such that the second compound is present in the subject in a therapeutically effective amount for the disease state. It is noted that the compounds of the present invention may be the first or second compounds. In an exemplary embodiment, the ACC is a member selected from ACCl and ACC2. [0027] In another embodiment, a method is provided for treating a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state, the method comprising: administering a compound according to the present invention to a subject such that the compound is present in the subject in a therapeutically effective amount for the disease state. In an exemplary embodiment, the ACC is a member selected from ACCl and ACC2.
[0028] It is noted in regard to all of the above embodiments that the present invention is intended to encompass all pharmaceutically acceptable ionized forms (e.g., salts) and solvates (e.g., hydrates) of the compounds, regardless of whether such ionized forms and solvates are specified since it is well know in the art to administer pharmaceutical agents in an ionized or solvated form. It is also noted that unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all possible stereoisomers (e.g., enantiomers or diastereomers depending on the number of chiral centers), independent of whether the compound is present as an individual isomer or a mixture of isomers. Further, unless otherwise specified, recitation of a compound is intended to encompass all possible resonance forms and tautomers. With regard to the claims, the language "compound comprising the formula" is intended to encompass the compound and all pharmaceutically acceptable ionized forms and solvates, all possible stereoisomers, and all possible resonance forms and tautomers unless otherwise specifically specified in the particular claim.
[0029] It is further noted that prodrugs may also be administered which are altered in vivo and become a compound according to the present invention. The various methods of using the compounds of the present invention are intended, regardless of whether prodrug delivery is specified, to encompass the administration of a prodrug that is converted in vivo to a compound according to the present invention. It is also noted that certain compounds of the present invention may be altered in vivo prior to inhibit ACC and thus may themselves be prodrugs for another compound. Such prodrugs of another compound may or may not themselves independently have ACC inhibitory activity. BRIEF DESCRIPTION OF THE FIGURES
[0030] Figure 1 illustrates SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID
NO: 4, referred to in this application.
DEFINITIONS
[0031] Unless otherwise stated, the following terms used in the specification and claims shall have the following meanings for the purposes of this Application. [0032] It is noted that, as used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Further, definitions of standard chemistry terms may be found in reference works, including Carey and Sundberg "ADVANCED ORGANIC CHEMISTRY 5™ ED." VOIS. A (2007) and B (2007), Springer Science and Business Media, New York. Also, unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art are employed.
[0033] "Alicyclic" means a moiety comprising a non-aromatic ring structure. Alicyclic moieties may be saturated or partially unsaturated with one, two or more double or triple bonds. Alicyclic moieties may also optionally comprise heteroatoms such as nitrogen, oxygen and sulfur. The nitrogen atoms can be optionally quaternerized or oxidized and the sulfur atoms can be optionally oxidized. Examples of alicyclic moieties include, but are not limited to moieties with (C3.8) rings such as cyclopropyl, cyclohexane, cyclopentane, cyclopentene, cyclopentadiene, cyclohexane, cyclohexene, cyctohexadiene, cycloheptane, cycloheptene, cycloheptadiene, cyclooctane, cyclooctene, and cyclooctadiene.
[0034] "Aliphatic" means a moiety characterized by a straight or branched chain arrangement of constituent carbon atoms and may be saturated or partially unsaturated with one, two or more double or triple bonds,
[0035] "Alkenyl" means a straight or branched, carbon chain that contains at least one carbon-carbon double bond (-CR=CR'- or -CR=CR1R", wherein R, R1 and R" are each independently hydrogen or further substituents). Examples of alkenyl include vinyl, allyl, isopropenyl, pentenyl, hexenyl, heptenyl, 1-propenyl, 2-butenyl, 2-methyl-2-butenyl, and the like, In particular embodiments, "alkenyl," either alone or represented along with another radical, can be a (C2-2o)alkenyl, a (C2-ιs)alkenyl, a (C2-io)alkenyl, a (Ci.sJalkenyl, or a (C2-3)aIkenyl. Alternatively, "alkenyl," either alone or represented along with another radical, can be a (C2)alkenyl, a (C3)alkenyl or a (Gt)alkenyl.
[0036] "Alkenylene" means a straight or branched, divalent carbon chain having one or more carbon-carbon double bonds (-CR=CR'-, wherein R and R' are each independently hydrogen or further substituents). Examples of alkenylene include ethene- 1,2-diyl, propene-l,3-diyl, methylene- 1,1-diyl, and the like. In particular embodiments, "alkenylene," either alone or represented along with another radical, can be a (C2-2O) alkenylene, a (C2-L5) alkenylene, a (Co-io) alkenylene, a (C2-5) alkenylene or a (C3^) alkenylene. Alternatively, "alkenylene," either alone or represented along with another radical, can be a (C2) alkenylene, a (C3) alkenylene or a (C4) alkenylene. [0037] "Alkoxy" means an oxygen moiety having a further alkyl substituent. The alkoxy groups of the present invention can be optionally substituted. [0038] "Alkyl" represented by itself means a straight or branched, saturated or unsaturated, aliphatic radical having a chain of carbon atoms, optionally with one or more of the carbon atoms being replaced with oxygen (See "oxaalkyl"), a carbonyl group (See "oxoalkyl"), sulfur (See "thioalkyl"), and/or nitrogen (See "azaalkyl"). (Cχ)alkyl and (Cχ.γ)alkyl are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (C].6)alkyl includes alkyls that have a chain of between 1 and 6 carbons (e.g., methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert~buiy\, vinyl, allyl, 1-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-methylallyI, ethynyl, 1-propynyl, 2-proρynyl, and the like). Alkyl represented along with another radical (e.g., as in arylalkyl, heteroaryl alkyl and the like) means a straight or branched, saturated or unsaturated aliphatic divalent radical having the number of atoms indicated or when no atoms are indicated means a bond (e.g., (C6-io)aryl(Ci-3)alkyl includes, benzyl, phenethyl, 1-phenylethyl, 3-phenylpropyl, 2-thienylmethyl, 2-pyridinylmethyl and the like). In particular embodiments, "alkyl," either alone or represented along with another radical, can be a (C^alkyl, a (C|.ι5)alkyl, a (Ci.io)alkyl, a (C].5)alkyl or a (C1-3)alkyl. Alternatively, "alkyl," either alone or represented along with another radical, can be a (C)alkyl, a (C2)alkyl or a (C3)alkyl.
[0039] "Alkylene", unless indicated otherwise, means a straight or branched, saturated or unsaturated, aliphatic, divalent radical. (Cχ)alkylene and (Cχ.γ)alkylene are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (Ci.6)alkylene includes methylene (-CH2-), ethylene (-CH2CH2-), trimethylene (-CH2CH2CH2-), tetramethylene (-CH2CH2CH2CH2-), 2-butenylene (-CH2CH=CHCH2-), 2-methyltetramethyIene (-CH2CH(CH3)CH2CH3-), pentamethylene (-CH2CH2CHICH2CH2-), and the like. In particular embodiments, "alkylene," either alone or represented along with another radical, can be a (Cj.2o)alkylene, a (Q-^alkylene, a (C[.ιo)alkylene, a (C].s)alkylene or a (C1 ^alkylene. Alternatively, "alkylene," either alone or represented along with another radical, can be a (Cι)alkylene, a (C2)alkylene or a (C3)alkylene.
[0040] "Alkylidene" means a straight or branched, saturated or unsaturated, aliphatic radical connected to the parent molecule by a double bond. (Cχ)alkylidene and (Cx- γ)alkylidene are typically used where X and Y indicate the number of carbon atoms in the chain. For example, (Ci.6)alkylidene includes methylene (=CHΞ), ethylidene (=CHCH3), isopropylidene (=C(CH3)2), propylidene (=CHCH2CH3), allylidene (=CH-CH=CH2), and the like. In particular embodiments, "alkylidene," either alone or represented along with another radical, can be a (Ci.2o)alkylidene, a (C[.[5)alkylidene, a (C].]o)alkylidene, a (Cι.5)alkylidene or a (C].3)alkylidene. Alternatively, "alkylidene," either alone or represented along with another radical, can be a (Ci)alkylidene, a (C2)alkylidene or a (C3)alkylidene.
[0041] "Alkynyl" means a straight or branched, carbon chain that contains at least one carbon-carbon triple bond (-C≡C- or -C≡CR, wherein R is hydrogen or a further substituent). Examples of alkynyl include ethynyl, propargyl, 3-methyl-l-pentynyl, 2- heptynyl and the like. In particular embodiments, "alkynyl," either alone or represented along with another radical, can be a (C2-2o)alkynyl, a (C2- ^
Figure imgf000011_0001
alkynyl, a a (C2-5)alkynyl or a (C2.3)alkynyl. Alternatively, "alkynyl," either alone or represented along with another radical, can be a (C2)alkynyl, a (C3)alkynyl or a (C-Oalkynyl. [0042] "Alkynylene" means a straight or branched, divalent carbon chain having one or more carbon-carbon triple bonds (-CR≡CR1-, wherein R and R' are each independently hydrogen or further substituents). Examples of alkynylene include ethyne-l,2-diyl, propyne-l,3-diyl, and the like. In particular embodiments, "alkynylene," either alone or represented along with another radical, can be a (C2.2o) alkynylene, a (C2-15) alkynylene, a (C2-Io) alkynylene, a (C2-5) alkynylene or a (C3-3) alkynylene. Alternatively, "alkynylene," either alone or represented along with another radical, can be a (C2) alkynylene, a (C3) alkynylene or a (C4) alkynylene. [0043] "Amido" means the radical -Q=O)-NR-, -C(=O)-NRR', -NR-C(=O)- and/or -NR-C(=O)R', wherein each R and R' are independently hydrogen or a further substituent. [0044] "Amino" means a nitrogen moiety having two further substituents where, for example, a hydrogen or carbon atom is attached to the nitrogen. For example, representative amino groups include -NH3, -NHCH3, -N(CH3)2, -NH((CMo)alkyl), -N((C(. io)alkyl)2, -NH(aryl), -NH(heteroaryl), -N(aryl)2, -N(heteroaryl)2, and the like. Optionally, the two substituents together with the nitrogen may also form a ring. Unless indicated otherwise, the compounds of the invention containing amino moieties may include protected derivatives thereof. Suitable protecting groups for amino moieties include acetyl, /erf-butoxycarbonyl, benzyloxycarbonyl, and the like.
[0045] "Animal" includes humans, non-human mammals (e.g., dogs, cats, rabbits, cattle, horses, sheep, goats, swine, deer, and the like) and non-mammals (e.g., birds, and the like).
[0046] "Aromatic" means a moiety wherein the constituent atoms make up an unsaturated ring system, all atoms in the ring system are sp2 hybridized and the total number of pi electrons is equal to 4n+2. An aromatic ring may be such that the ring atoms are only carbon atoms or may include carbon and non-carbon atoms (See "heteroaryl"). [0047] "Aryl" means a monocyclic or polycyclic ring assembly wherein each ring is aromatic or when fused with one or more rings forms an aromatic ring assembly. If one or more ring atoms is not carbon (e.g., N, S), the aryl is a heteroaryl. (Cχ)aryl and (Cχ.γ)aryl are typically used where X and Y indicate the number of carbon atoms in the ring. In particular embodiments, "aryl," either alone or represented along with another radical, can be a (C3-i4)aryl, a (C3.ιo)aryl, a (C3-7JaTyI, a (Cg-io)aryl or a (C5-7)aryl. Alternatively, "aryl," either alone or represented along with another radical, can be a (CaJaryl, a (Ceiaryl, a (C7)aryl, a (C8)aryl, a (C9)aryl or a (C[0)aryl.
[0048] "Azaalkyl" means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with substituted or unsubstituted nitrogen atoms (-NR- or -NRR', wherein R and R' are each independently hydrogen or further substituents). For example, a (C].]0)azaalkyl refers to a chain comprising between 1 and 10 carbons and one or more nitrogen atoms.
[0049] "Bicycloalkyl" means a saturated or partially unsaturated fused, spiro or bridged bicyclic ring assembly. In particular embodiments, "bicycloalkyl," either alone or represented along with another radical, can be a (C4-15)bicycloalkyl, a (C4.[o)bicycloalkyl, a (Q-itObicycloalkyl or a (Cg.ioJbicycloalkyl. Alternatively, "bicycloalkyl," either alone or represented along with another radical, can be a (C8)bicycloalkyl, a (C9)bicycloalkyl or a (Cιo)bicycloalkyl.
[0050] "Bicycloaryl" means a fused, spiro or bridged bicyclic ring assembly wherein at least one of the rings comprising the assembly is aromatic. (Cχ)bicycloaryl and (Cx- γ)bicycloaryl are typically used where X and Y indicate the number of carbon atoms in the bicyclic ring assembly and directly attached to the ring. In particular embodiments, "bicycloaryl," either alone or represented along with another radical, can be a (a (Q.l5)bicycloaryl, a (Gt.[o)bicycloaryl, a (C6.io)bicycloaryl or a (C8.[o)bicycloaryl. Alternatively, "bicycloalkyl," either alone or represented along with another radical, can be a (CaJbicycloaryl, a (Cgjbicycloaryl, or a (CioJbicycloaryl.
[0051] "Bridging ring" and "bridged ring" as used herein refer to a ring that is bonded to another ring to form a compound having a bicyclic or polycyclic structure where two ring atoms that are common to both rings are not directly bound to each other. Nonexclusive examples of common compounds having a bridging ring include borneol, norbornane,
7-oxabicyclo[2.2.1]heptane, and the like. One or both rings of the bicyclic system may also comprise heteroatoms.
[0052] "Carbamoyl" means the radical -OC(O)NRR', wherein R and R' are each independently hydrogen or further substituents. [0053] "Carbocycle" means a ring consisting of carbon atoms.
[0054] "Carbonyl" means the radical -C(=O)- and/or -Cf=O)R, wherein R is hydrogen or a further substituent. It is noted that the carbonyl radical may be further substituted with a variety of substituents to form different carbonyl groups including acids, acid halides, aldehydes, amides, esters, and ketones.
[0055] "Carboxy" means the radical -C(=0)-O- and/or -C(=O)-OR, wherein R is hydrogen or a further substituent. It is noted that compounds of the invention containing carboxy moieties may include protected derivatives thereof, i.e., where the oxygen is substituted with a protecting group. Suitable protecting groups for carboxy moieties include benzyl, rer/-butyl, and the like. [0056] "Cyano" means the radical -CN.
[0057] "Cycloalkyl" means a non-aromatic, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly. (Cχ)cycloalkyl and (Cχ.γ)cycloalkyl are typically used where X and Y indicate the number of carbon atoms in the ring assembly. For example, (C3.io)cycloalkyl includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,5-cyclohexadienyl, bicyclo[2.2.2]octyl, adamantan-1-yl, decahydronaphthyl, oxocyclohexyl, dioxocyclohexyl, thiocyclohexyl, 2-oxobicyclo[2.2.1]hept-l-yl, and the like. In particular embodiments, "cycloalkyl," either alone or represented along with another radical, can be a (C3-u)cycloalkyl, a (C3-io)cycloalkyl, a (C3-7)cycloalkyl, a (C3-io)cycloalkyl or a (C5-7)cycloalkyl. Alternatively, "cycloalkyl," either alone or represented along with another radical, can be a (CsJcycloalkyl, a (CeJcycloalkyl, a (C7)cycloalkyl, a (Cg)cycloalkyl, a (C^cycloalkyl, or a (Cio)cycloalkyl.
[0058] "Cycloalkylene" means a divalent, saturated or partially unsaturated, monocyclic, bicyclic or polycyclic ring assembly. (Cχ)cycloalkylene and (Cx- v)cycloalkylene are typically used where X and Y indicate the number of carbon atoms in the ring assembly. In particular embodiments, "cycloalkylene," either alone or represented along with another radical, can be a (C3-t4)cycloalkylene, a (C3.io)cycloalkylene, a (C3-7)cycloalkylene, a (Cs-]o)cycloalkylene or a (C5.7)cycloalkylene. Alternatively, "cycloalkylene," either alone or represented along with another radical, can be a (C5)cycloalkylene, a (C6)cycloalkylene, a (C7)cycloalkylene, a (Cgjcycloalkylene, a (Cg)cycloalkylene, or a (C)0)cycloalkylene. [0059] "Disease" specifically includes any unhealthy condition of an animal or part thereof and includes an unhealthy condition that may be caused by, or incident to, medical or veterinary therapy applied to that animal, i.e., the "side effects" of such therapy. [0060] "EC50" means the molar concentration of an agonist that produces 50% of the maximal possible effect of that agonist. The action of the agonist may be stimulatory or inhibitory.
[0061] "Fused ring" as used herein refers to a ring that is bonded to another ring to form a compound having a bicyclic structure where the ring atoms that are common to both rings are directly bound to each other. Non-exclusive examples of common fused rings include decalin, naphthalene, anthracene, phenanthrene, indole, furan, benzofuran, quinoline, and the like. Compounds having fused ring systems may be saturated, partially saturated, carbocyclics, heterocyclics, aromatics, heteroaromatics, and the like. [0062] "Halo" means fluoro, chloro, bromo or iodo. [0063] "Heteroalicyclic" means an alicyclic moiety as defined in this Application where at least one of the ring atoms is a heteroatom. The heteroalicylic contemplated in this Application includes, but are not limited to, pyrroline, pyrrolidine, dioxiane, imidazoline, imidazolidine, pyrazoline, pyrazolidine, pyran, poperidine, dioxane, morpholine, dithiane, thiomorpholine, piperazine, trithiane, indoline, quinuclidine, indene, norbornane, fluorine, norbornane, adamantane, and the like.
[0064] "Heteroalkyl" means alkyl, as defined in this Application, provided that one or more of the atoms within the alkyl chain is a heteroatom. In particular embodiments, "heteroalkyl," either alone or represented along with another radical, can be a hetero(C].2o)alkyl, a hetero(Cι.i5)alkyl, a hetero(C].io)alkyl, a hetero(Ci.5)alkyl, a hetero(C|.3)alk:yl or a hetero(C].2)alkyl. Alternatively, "heteroalkyl," either alone or represented along with another radical, can be a hetero(C|)alkyl, a hetero(C2)alkyl or a hetero(C3)alkyl.
[0065] "Heteroaryl" means a monocyclic, bicyclic or polycyclic aromatic group wherein at least one ring atom is a heteroatom and the remaining ring atoms are carbon. Monocyclic heteroaryl groups include, but are not limited to, cyclic aromatic groups having five or six ring atoms, wherein at least one ring atom is a heteroatom and the remaining ring atoms are carbon. The nitrogen atoms can be optionally quaternerized and the sulfur atoms can be optionally oxidized. Heteroaryl groups of this invention include, but are not limited to, those derived from furan, imidazole, isothiazole, isoxazole, oxadiazole, oxazole, 1,2,3-oxadiazole, pyrazine, pyrazole, pyridazine, pyridine, pyrimidine, pyrroline, thiazole, 1,3,4-thiadiazole, triazole and tetrazole. "Heteroaryl" also includes, but is not limited to, bicyclic or tricyclic rings, wherein the heteroaryl ring is fused to one or two rings independently selected from the group consisting of an aryl ring, a cycloalkyl ring, a cycloalkenyl ring, and another monocyclic heteroaryl or heterocycloalkyl ring. These bicyclic or tricyclic beteroaryls include, but are not limited to, those derived from benzo[6] furan, benzo[b]thiophene, benzimidazole, imidazo[4,5- c]pyridine, quinazoline, thieno[2,3-c]pyridine, thieno[3,2-b]pyridine, thieno[2,3- bjpyridine, indolizine, imidazo[l,2α]pyridine, quinoline, isoquinoline, phthalazine, quinoxaline, naphthyridine, quinolizine, indole, isoindole, iπdazole, indoline, benzoxazole, benzopyrazole, benzothiazole, imidazo[l,5-α]pyridine, pyrazolo[l,5-α]pyridine, imidazo[l,2-_7]pyrimidine, imidazo[l,2-c]pyrimidine, imidazo[l,5-a]pyrimidine, imidazo[l,5-c]pyrimidine, pyrrolo[2,3-b] pyridine, ρyrrolo[2,3-c]pyridine, pyrrolo[3,2- c]pyridine, pyrrolo[3, 2 -b] pyridine, pyrrolo[2,3-J]pyrimidine, pyrrolo[3,2--flpyrimidine, pyrrolo[2,3-/>]pyrazine, pyrazolo[l,5-a]pyridine, pyrrolo[l,2-&]pyridazine, pyrrolo[l,2- c]pyrimidine, pyrrolo[l,2-α]pyrimidine, pyrrolo[l,2-«]pyrazine, triazo[l,5-Λ]pyridine, pteridine, purine, carbazole, acridine, phenazine, phenothiazene, phenoxazine, 1,2- dihydropyrrolo[3,2,l-/ii]indole, indolizine, pyrido[l,2-α]indole and 2(7H)-pyridinone. The bicyclic or tricyclic heteroaryl rings can be attached to the parent molecule through either the heteroaryl group itself or the aryl, cycloalkyl, cycloalkenyl or heterocycloalkyl group to which it is fused. The heteroaryl groups of this invention can be substituted or unsubstituted. In particular embodiments, "heteroaryl," either alone or represented along with another radical, can be a hetero(Ci.i3)aryl, a hetero(C2-i3)aryl, a hetero(C2-e)aryl, a hetero(C3-9)aryI or a hetero(C5.g)aryl. Alternatively, "heteroaryl," either alone or represented along with another radical, can be a hetero(C3)aryl, a hetero(C4)aryl, a hetero(Cs)aryl, a heteroCC6)aryl, a hetero(C7)aryl, a hetero(C8)aryI or a hetero(C9)aryl. [0066] "Heteroatom" refers to an atom that is not a carbon atom. Particular examples of heteroatoms include, but are not limited to, nitrogen, oxygen, and sulfur. [0067] "Ηeteroatom moiety" includes a moiety where the atom by which the moiety is attached is not a carbon. Examples of heteroatom moieties include -NR-, -N+(O')=, -O-, -S- or -S(O)2-, wherein R is hydrogen or a further substituent. [0068] "Ηeterobicycloalkyl" means bicycloalkyl, as defined in this Application, provided that one or more of the atoms within the ring is a heteroatom. For example hetero(C9.|2)bicycloalkyl as used in this application includes, but is not limited to, 3-aza- bicyclo[4.1.0]hept-3-yI, 2-aza-bicyclo[3.1.0]hex-2-yl, 3-aza-bicyclo[3.1.0]hex-3-yl, and the like. In particular embodiments, "heterobicycloalkyl," either alone or represented along with another radical, can be a hetero(Cι.ι4)bicycloalkyl, a hetero(C4.]4)bicycloalkyl, a hetero(C4.9)bicycloalkyl, or a hetero(C5.9)bicycloalkyl. Alternatively, "heterobicycloalkyl," either alone or represented along with another radical, can be a hetero(C5)bicycIoalkyl, hetero(C6)bicyck)alkyl, hetero(C7)bicycloalkyl, hetero(Cg)bicycloalkyl, or a hetero(C9)bicycloa]kyl.
[0069] "Ηeterobicycloaryl" means bicycloaryl, as defined in this Application, provided that one or more of the atoms within the ring is a heteroatom. For example, hetero(C4-[2)bicycloaryl as used in this Application includes, but is not limited to, 2-amino-4-oxo-3,4-dihydropteridin-6-yI, tetrahydroisoquinolinyl, and the like. In particular embodiments, "heterobicycloaryl," either alone or represented along with another radical, can be a
Figure imgf000017_0001
a hetero(C_j.i4)bicycloaryl, a hetero(C4.())bicycloarylor a hetero(C5.9)bicycloaryl. Alternatively, "heterobicycloaryl," either alone or represented along with another radical, can be a hetero(C5)bicycloaryl, hetero(C6)bicycloaryl, hetero(C7)bicycloaryl, hetero(C8)bicycloaryl, or a hetero(C9)bicycloaryl .
[0070] "Heterocycloalkyl" means cycloalkyl, as defined in this Application, provided that one or more of the atoms forming the ring is a heteroatom selected independently from N, O, or S. Non-exclusive examples of heterocycloalkyl include piperidyl, 4- morpholyl, 4-piperazinyl, pyrrolidinyl, perhydropyrrolizinyl, 1,4-diazaperhydroepinyl, 1 ,3-dioxanyl, 1,4-dioxanyl and the like. In particular embodiments, "heterocycloalkyl," either alone or represented along with another radical, can be a hetero(C].]3)cycloalkyl, a hetero(Ci.9)cycloalkyl, a hetero(C|.6)cycloalkyl, a hetero(C5.t))cycloalkyl or a hetero(C2-6)cycioalkyl. Alternatively, "heterocycloalkyl," either alone or represented along with another radical, can be a hetero(C2)cycloalkyl, a hetero(C3)cycloalkyl, a hetero(C4)cycloalkyl, a hetero(C5)cycloalkyl, a hetero(C6)cycloalkyl, hetero(G?)cycloalkyl, hetero(C8)cycloaIkyl, or a heteroCC^cycloalkyl. [0071] "Heterocycloalkylene" means cycloalkylene, as defined in this Application, provided that one or more of the ring member carbon atoms is replaced by a heteroatom. In particular embodiments, "heterocycloalkylene," either alone or represented along with another radical, can be a hetero(C].13)cycloalkylene, a
Figure imgf000017_0002
a heteroCCi.6)cycloalkylene, a hetero(C5.9)cycloalkylene, or a hetero(C2-o)cycloalkylene. Alternatively, "heterocycloalkylene," either alone or represented along with another radical, can be a hetero(C2)cycloalkylene, a hetero(C3)cycloalkylene, a hetero(C4)cycloalkylene, a hetero(Cs)cycloalkylene, a hetero(C6)cycloalkylene, hetero(C7)cycloalkylene, hetero(C8)cycloalkylene, or a hetero(C9)cycloalkyleπe. [0072] "Hydroxy" means the radical -OH.
[0073] "IC50" means the molar concentration of an inhibitor that produces 50% inhibition of the target enzyme.
[0074] "Imiπo" means the radical -CR(=NR') and/or -Cf=NR1)-, wherein R and R' are each independently hydrogen or a further substituent.
[0075] "Iminoketone derivative" means a derivative comprising the moiety -C(NR)-, wherein R is hydrogen or a further substituent. [0076] "Isomers" means compounds having identical molecular formulae but differing in the nature or sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereomers" and stereoisomers that are nonsuperimposable mirror images are termed "enantiomers" or sometimes "optical isomers." A carbon atom bonded to four πoπidentical substituents is termed a "chiral center." A compound with one chiral center has two enantiomeric forms of opposite chirality. A mixture of the two enantiomeric forms is termed a "racemic mixture." A compound that has more than one chiral center has 2"' 1 enantiomeric pairs, where n is the number of chiral centers. Compounds with more than one chiral center may exist as ether an individual diastereomer or as a mixture of diastereomers, termed a "diastereomeric mixture." When one chiral center is present a stereoisomer may be characterized by the absolute configuration of that chiral center. Absolute configuration refers to the arrangement in space of the substituents attached to the chiral center. Enantiomers are characterized by the absolute configuration of their chiral centers and described by the R- and S-sequencing rules of Cahn, Ingold and Prelog, Conventions for stereochemical nomenclature, methods for the determination of stereochemistry and the separation of stereoisomers are well known in the art (e.g., see "Advanced Organic Chemistry", 5th edition, March, Jerry, John Wiley & Sons, New York, 2001).
[0077] "Leaving group" means the group with the meaning conventionally associated with it in synthetic organic chemistry, i.e., an atom or group displaceable under reaction (e.g., alkylating) conditions. Examples of leaving groups include, but are not limited to, halo (e.g., F, Cl, Br and I), alkyl (e.g., methyl and ethyl) and sulfonyloxy (e.g., mesyloxy, ethanesulfonyloxy, benzenesulfonyloxy and tosyloxy), thiomethyl, thienyloxy, dihalophosphinoyloxy, tetrahalophosphoxy, benzyloxy, isopropyloxy, acyloxy, and the like.
[0078] "Nitro" means the radical -NO2.
[0079] "Oxaalkyl" means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with oxygen atoms (-0- or -OR, wherein R is hydrogen or a further substituent). For example, an oxa(C[.ιo)alkyl refers to a chain comprising between 1 and 10 carbons and one or more oxygen atoms. [0080] "Oxoalkyl" means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with carbonyl groups (-C(=O)- or - C(=O)-R, wherein R is hydrogen or a further substituent). The carbonyl group may be an aldehyde, ketone, ester, amide, acid or acid halide. For example, an oxo(C].io)alkyl refers to a chain comprising between 1 and 10 carbon atoms and one or more carbonyl groups. [0081] "Oxy" means the radical -O- or -OR, wherein R is hydrogen or a further substituent. Accordingly, it is noted that the oxy radical may be further substituted with a variety of substituents to form different oxy groups including hydroxy, alkoxy, aryloxy, heteroaryloxy or carbonyloxy.
[0082] "Pharmaceutically acceptable" means that which is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable and includes that which is acceptable for veterinary use as well as human pharmaceutical use.
[0083] "Pharmaceutically acceptable salts" means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as acetic acid, propionic acid, hexanoic acid, heptanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, mafonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, σ-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-chlorobenzenesulfonic acid, 2-naphthalenesuIfonic acid, /?-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]oct-2-eπe-l-carboxylic acid, glucoheptonic acid, 4,4'-methylenebis(3-hydroxy-2-ene-l-carboxylic acid), 3-phenylpropionic acid, tri methyl acetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid and the like. [0084] Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanol amine, tromethamine, N- methyl glucamine and the like.
[0085] "Polycyclic ring" includes tricyclic and multi-cyclic rings. The individual rings comprising the polycyclic ring can be fused, spiro or bridging rings. [0086] "Prodrug" means a compound that is convertible in vivo metabolically into an inhibitor according to the present invention. The prodrug itself may or may not also have activity with respect to a given target protein. For example, a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene- bis-b-hydroxynaρhthoates, gentisates, isethionates, di-/?-toluoyltartrates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like. Similarly, a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.
[0087] "Protected derivatives" means derivatives of inhibitors in which a reactive site or sites are blocked with protecting groups. Protected derivatives are useful in the preparation of inhibitors or in themselves may be active as inhibitors. A comprehensive list of suitable protecting groups can be found in P.G.M. Wuts and T.W. Greene, "Greene's Protecting Groups in Organic Synthesis, 4th edition, John Wiley & Sons, Inc. 2007.
[0088] "Ring" and "ring assembly" means a carbocyclic or a heterocyclic system and includes aromatic and non-aromatic systems. The system can be monocyclic, bicyclic or polycyclic. In addition, for bicyclic and polycyclic systems, the individual rings comprising the polycyclic ring can be fused, spiro or bridging rings. [0089] "Subject" and "patient" includes humans, non-human mammals (e.g., dogs, cats, rabbits, cattle, horses, sheep, goats, swine, deer, and the like) and non-mammals (e.g., birds, and the like).
[0090] "Substituted or unsubstituted" means that a given moiety may consist of only hydrogen substituents through available valencies (unsubstituted) or may further comprise one or more non-hydrogen substituents through available valencies (substituted) that are not otherwise specified by the name of the given moiety. For example, isopropyl is an example of an ethylene moiety that is substituted by -CH3. In general, a non-hydrogen substituent may be any substituent that may be bound to an atom of the given moiety that is specified to be substituted. Examples of substituents include, but are not limited to, aldehyde, alicyclic, aliphatic, (C[.[0)alkyl( alkylene, alkylidene, amide, amino, aminoalkyl, aromatic, aryl, bicycloalkyl, bicycloaryl, carbamoyl, carbocyclyl, carboxyl, carbonyl group, cycloalkyl, cycloalkylene, ester, halo, heterobicycloalkyl, heterocycloalkylene, heteroaryl, heterobicycloaryl, heterocycloalkyl, oxo, hydroxy, iminoketone, ketone, nitro, oxaalkyl, and oxoalkyl moieties, each of which may optionally also be substituted or unsubstituted. In one particular embodiment, examples of substituents include, but are not limited to, hydrogen, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C|.io)alkoxy, (C4.]2)aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]o)alkylamino, sulfonamide, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(C].ιo)alkyl, hydroxy(C].io)alkyl, carbonyl(C[.10)alkyl, thiocarbonyl(C|-to)alkyl, sulfonyKd.ioJalkyl, suIfinyl(C[.|o)alkyl, (Ci.ιo)azaalkyl, imino(C[.io)alkyl, (C3.]2)cycloa]kyl(Ci.5)alkyl, hetero(C3.i2)cycloalkyl(C[.[0)alkyI, arylCCi.ioJalkyl, hetero(C].io)aryl(C|.5)alkyl, (C9.]2)bicycloaryl(Ci.5)alkyl, hetero(C8.!2)bicycloarylCC].5)alkyl, (C^.πJcycloalkyl, hetero(C3.12)cycloalkyl,
Figure imgf000021_0001
hetero(C3.l2)bicycloalkyl,
Figure imgf000021_0002
hetero(C|.[o)aryl, (C9-i2)bicycloaryl and hetero(C4.[2)bicycloaryl. In addition, the substituent is itself optionally substituted by a further substituent. In one particular embodiment, examples of the further substituent include, but are not limited to, hydrogen, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, (Cd.]2)aryloxy, hetero(Ci.ιo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl , amino, (Cι.10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C|.|0)alkyl, halo(Ci.io)alkyl, hydroxy(CM0)alkyl, carbonyl(C[.ιo)alkyl, thiocarbonyl(C|.io)alkyl, sulfonyl(Cι.|0)alkyl, sulfinyl(Cι.ιo)alkyl, (Ci.io)azaalkyl, imino(Ci.io)alkyl, (C3.[2)cycloaIkyl(C|.5)alkyl, hetero(C3.i2)cycloalkyl(C|.[o)aIkyl, aryl(C].!0)alkyl, hetero(C1.|0)aryl(C].5)alkyl, (C9.]2)bicycloaryt(Cι-5)aIkyl, hetero(C8.i2)bicycloaryl(C[.5)alky], (C3-12)cycloalkyl, hetero(C3.t2)cycloalky], (C9.]2)bicycloalkyl, hetero(C3.]3)bicycloalkyl, (C4- 12JaTyI, hetero(C].ιo)aryl, (Cø.i2)bicycloaryl and hetero(C4.]2)bicycIoaryI. [0091] "Sulfinyl" means the radical -SO- and/or -SO-R, wherein R is hydrogen or a further substituent. It is noted that the sulfinyl radical may be further substituted with a variety of substituents to form different sulfinyl groups including sulfinic acids, sulfinamides, sulfinyl esters, and sulfoxides. [0092] "Sulfonyl" means the radical -SO2- and/or -SO2-R, wherein R is hydrogen or a further substituent. It is noted that the sulfonyl radical may be further substituted with a variety of substituents to form different sulfonyl groups including sulfonic acids, sulfonamides, sulfonate esters, and sulfones.
[0093] "Therapeutically effective amount" means that amount which, when administered to an animal for treating a disease, is sufficient to effect such treatment for the disease.
[0094] "Thio" denotes replacement of an oxygen by a sulfur and includes, but is not limited to, -SR, -S- and =S containing groups.
[0095] "Thioalkyl" means an alkyl, as defined above, except where one or more of the carbon atoms forming the alkyl chain are replaced with sulfur atoms (-S- or -S-R, wherein
R is hydrogen or a further substituent). For example, a thio(C].io)alkyl refers to a chain comprising between 1 and 10 carbons and one or more sulfur atoms.
[0096] "Thiocarbonyl" means the radical -C(=S)- and/or -C(=S)-R, wherein R is hydrogen or a further substituent. It is noted that the thiocarbonyl radical may be further substituted with a variety of substituents to form different thiocarbonyl groups including thioacids, thioamides, thioesters, and thioketones.
[0097] "Treatment" or "treating" means any administration of a compound of the present invention and includes:
(1) preventing the disease from occurring in an animal which may be predisposed to the disease but does not yet experience or display the pathology or symptomatology of the disease,
(2) inhibiting the disease in an animal that is experiencing or displaying the pathology or symptomatology of the diseased (i.e., arresting further development of the pathology and/or symptomatology), or
(3) ameliorating the disease in an animal that is experiencing or displaying the pathology or symptomatology of the diseased (i.e., reversing the pathology and/or symptomatology).
[0098] It is noted in regard to all of the definitions provided herein that the definitions should be interpreted as being open ended in the sense that further substituents beyond those specified may be included. Hence, a C1 alkyl indicates that there is one carbon atom but does not indicate what are the substituents on the carbon atom. Hence, a (Ci)alkyl comprises methyl (i.e., -CH3) as well as -CRR1R" where R, R', and R" may each independently be hydrogen or a further substituent where the atom attached to the carbon is a heteroatom or cyano. Hence, CF3, CH2OH and CH2CN, for example, are all (Ci)alkyls. Similarly, terms such as alkylamino and the like comprise dialkylamino and the like.
[0099] A compound having a formula that is represented with a dashed bond is intended to include the formulae optionally having zero, one or more double bonds, as exemplified and shown below:
Figure imgf000023_0001
represents
F^B F^B F"AsB F^B F^VB
I I l I I Il I I I Il
E. X E. X E. JZ E ^C E^. XH
^ D^ VD^ D^ D^ ^D^ , etc.
[0100] In addition, atoms making up the compounds of the present invention are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include 13C and 14C.
DETAILED DESCRIPTION OF THE INVENTION
[0101] The present invention relates to compounds that may be used to inhibit acetyl - CoA carboxylase (ACC) and, in particular, ACC 1 and/or ACC2. The present invention also relates to pharmaceutical compositions, kits and articles of manufacture comprising such compounds. In addition, the present invention relates to methods and intermediates useful for making the compounds. Further, the present invention relates to methods of using said compounds.
[0102] It is noted that the compounds of the present invention may also possess inhibitory activity for other ACC family members and thus may be used to address disease states associated with these other family members. Compound of the Invention
[0103] In one of its aspects, the present invention relates to compounds that are useful as ACC inhibitors. In one embodiment, the compounds of the invention consist of the formula:
Figure imgf000024_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;
R1 is selected from the group consisting of oxy, (Ci.io)alkoxy,
Figure imgf000024_0002
hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, imino, (C].ιo)alkyl,
Figure imgf000024_0003
hydroxy (C Mo)alkyl, carbonyl(C].!o)alkyl, tbiocarbonyl(C].io)aIkyl, sulfonyl(Ci.io)alkyl, suIfmyl(Ci.io)alkyl, aza(C].io)alkyl, (C[.ιo)oxaalkyl, (Ci.io)oxoalkyl, iminofQ. ιo)alkyl, (C3.i2)cycloalkyl(C|.5)alkyi, hetero(C3.i2)cycloalkyl(Cι.[0)alkyl, aryl(CM0)alkyl, hetero(Ci.io)aryl(C[.5)alkyl, (Cg.]2)bicycloaryl(C|.5)alkyl, hetero(C8.]2)bicycloaryl(C|.5)alkyl, hetero(Ci.io)alkyl, (C3-] 2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9.t2)bicycloalkyl, betero(C;).i2)bicycloalkyl, (C4.i2)aryl, hetero(C].[0)aryl,
Figure imgf000024_0004
and hetero(C4.)2)bicycloaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl; and
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[o)alkoxy, (Q-^Jaryloxy, hetero(CMo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamide, imino, sulfonyl, sulfinyl, (Cι.io)alkyl, halo(C[.io)alkyl, hydroxy(C|-t0)alkyl, carbonyl(Cι.ιo)alkyl, thiocarbonyl(C].]o)alkyl, sulfonyI(C].io)alkyl, sulfmyl(d.]o)alkyl' aza(Ci.io)alkyl, (C[.10)oxaalkyl, (Ci.io)oxoalkyl, imino(C].io)alkyl, (C3-i2)cycloalkyl(Ci.5)alkyl, hetero(C3-i2)cycloalkyl(C].io)alkyi, aryl(C[.io)alkyI, hetero(C[.1o)aryl(C]-5)alkyl, CC9.i2)bicycloaryl(C].5)a]kyl, hetero(Ca-]2)bicycloarylCC].5)alkyl, hetero(CM0)alkyl, (C3.i2)cycloalkyl, hetero(C3.]a)cycloaIkyl,
Figure imgf000025_0001
hetero(C3.i2)bicycloalkyl, (C4.i2)aryl, hetero(Cι.ιo)aryI, (Ctj.]2)bicycloaryl, and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted. [0104] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000025_0002
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (Ci.io)alkoxy, (C4.]2)aryloxy, hetero(C].]o)arytoxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C Mo)a]kyl amino, imino, (Ci.io)alkyl, halo(Cι.ιo)alkyl, hydroxy(C].]0)alkyl, carbonyKCi-ioJalkyl, thiocarbonyl(C].]0)alkyI, sulfonyl(Ci.ιo)alkyl, sulfinyKCuioJalkyl, aza(Ci.]0)alkyl, (C].io)oxaalkyl, (C].]0)oxoalkyl, imino(C[.[0)alkyl, (C3-12)cycloarkyl(Cj.5)alkyl, hetero(C3.L2)cycloalkyl(Ci.io)alky], aryl(Ct-[o)alkyl, hetero(C].]0)aryl(CμS)alkyl, (C9.i2)bicycloaryl(C].5)alkyl, hetero(C8.]2)bicycloaryl(C[.5)alkyl, hetero(Ci.io)alkyl, (C3.[2)cycloalkyl, hetero(C3.]2)cycloalkyl,
Figure imgf000025_0003
hetero(C3.[2)bicycloalkyl, (C4.i2)aryl, hetero(Ct.to)aryl,
Figure imgf000025_0004
and hetero(C4.[2)bicyc]oaryl, each substituted or unsubstituted;
R3 is substituted or unsubstituted alkyl;
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Cι-ιo)alkoxy, (C4.12)aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]o)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(C].io)alkyl, hydroxy(C[.io)alkyl, carbonylfCi.ioJalkyl, thiocarbonyl(Ci.[o)alkyl, sulfonyl(C].io)alkyl, sulfinyl (C Mo)alkyl, aza(C].]o)alkyl, (Cι>ιo)oxaalkyl, (Ci.io)oxoalkyl, imino(C].io)alkyl, (C3.]2)cycloalkyl(C].s)alkyl, hetero(C3.]2)cycloalkyl(CM0)alkyl, aryl(Ci.io)alkyl, hetero(Ci.io)aryl(C|.5)alkyl, (C9.]2)bicycIoaryl(Ci-5)alkyl, hetero(C8.[2)bicycloaryl(Ci.5)alkyl, hetero(C1.io)aikyl, (C3.i2)cycloalkyl, hetero(C3.i2)cycloalkyl, (Cg.^bicycloalkyl, hetero(C3.]2)bicycIoalkyl, (C4.i2)aryl, hetero(C].io)aryl,
Figure imgf000026_0001
and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted; the ring comprising V1, V and V4 is selected from the group consisting of substituted or unsubstituted aryl and substituted or υnsubstituted heteroaryl; V1 is selected from the group consisting of CR10, NR20, N, O and S; V2 is selected from the group consisting of CR21, NR21, N, O and S; V4 is selected from the group consisting of CR22, NR22, N1 O and S; wherein
R20, R21 and R22 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C].io)alkoxy, (GJ- 12) aryl ox y, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.[o)alkylamino, sulfonamide imino, sυlfonyl, sulfinyl, (C]-io)alkyl( halo(Cι.ιo)alkyl, hydroxy (C i.]0)alkyl, carbonyl(Ci.]0)alky], thiocarbonyl(C].]o)alkyl, sulfonyl(C].io)alkyl, sulfinyl(C]-!0)alkyl, aza(C].)o)alkyl, (C].]o)oxaalkyl, (C|.jo)oxoalkyl,
Figure imgf000026_0002
(C3-i2)cycloalkyl(C].s)alkyl, hetero(C3.i2)cycloalkyl(Cι.ιo)alkyl, aryl(CMo)alkyl, hetero(C].io)aryl(C|.5)alkyl, (C9.]2)bicycloaryl(C[.5)aIkyl, hetero(Cs-i2)bicycloaryl(Ci-5)alkyl, hetero(C].]o)alkyl, (C3.[2)cycloalkyl, hetero(C3.[2)cycloalkyl, (C9.]2)bicycloalkyl, hetero(C3.]2)bicycloalkyl,
Figure imgf000026_0003
hetero(C].]o)aryl,
Figure imgf000026_0004
and hetero(C4.[2)bicycloaryl, each substituted or unsubstituted, or R20 and R21 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R21 and R23 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0105] In some variations of the above embodiments and variations, at least one of V ' ,
V2 and V4 is a sulfur atom.
[0106] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000027_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (C|.ιo)alkoxy, (C4.|2)aryloxy, hetero(C|.ιo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.ιo)alkylamino, imino, (Cμio)alkyl, halo(C]-io)alkyI, hydroxy (C i-io)alkyl, carbonyl(C|.io)aIkyl, thiocarbonyl(C].]o)aIkyl, sulfonyl(Ci.10)alkyl, sulfinyl(Cι.ιo)alkyl, aza(C].ιo)alkyl, (Ci.io)oxaalkyl, (C] -1o)oxoalkyl, imino(C1-ι0)alkyl, (C3.i2)cycloalkyl(C].5)alkyl, hetero(C3.12)cycloaIkyl(C]-1o)alkyl, aryl(Ct-t0)alkyl, hetero(C].]o)aryl(C|.5)alkyf, (C9.[2)bicycloaryl(C[.5)alkyl, hetero(C8.i2)bicycloaryl(C].5)alkyl, hetero(C].ιo)alkyl, (C3-i2)cycloalkyl, hetero(C3-i2)cycloalkyl,
Figure imgf000027_0002
hetero(C3.i2)bicycloalkyl, (C4.]2)aryl, hetero(C].10)aryl, (C9.i2)bicycloaryl, and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy,
Figure imgf000027_0003
hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].|o)alkyl, halo(C|.ιo)alkyl, hydroxy(C].io)alkyI, carbonyl(C].io)alkyl, thiocarbonyl(C!-t0)alkyl, sulfonyl (C Mo)alkyl, sulfinyI(Ci.io)alkyl, aza(C|.[o)alkyl, (Ci.joJoxaalkyl, (Cj.jojoxoalkyl, imino(Ci.io)alkyl, (C3.)2)cycloalkyl(C|.5)alkyl, hetero(C3.]2)cycloalkyl(Cι-ιo)alkyl, aryI(Ci.io)alkyl, hetero(Ci.ιo)aryl(C].5)alkyl, (C9.i2)bicycloaryl(Ci.5)alkyl, hetero(C8-i2)bicycloaryl(C[.5)alkyl, hetero(Cι-l0)alkyl, (C3.[2)cycloalkyl, hetero(C3-i2)cycIoalkyl, hetero(C3-i2)bicycloalkyl, (C-J- i2)aryl, hetero(Cι.ιo)aryl, (C9-12)bicycloaryl, and hetero(C4.[2)bicycloaryI, each substituted or unsubstituted;
R20 and R21 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[0)alkoxyt (C_,.i2)aryloxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-ioJalkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C|.|0)alkyl, halo(C].ιo)alkyl, hydroxy(Ci.10)alky], carbonyl(Ci.ιo)aIkyl, thiocarbonyl(Ci-10)alkyl, sulfonyl(C].io)alkyl, sulfinyl(C].]o)alkyl, aza(C|.|o)aIkyl, (Ci.io)oxaalkyl, (CMo)oxoalkyl, imino(C[.io)alkyl, (C3-i2)cycIoalkyl(Ci.5)alkyl, hetero(C3.[2)cycloalkyl(C|-io)alkyl, aryl(C[.[0)alkyl,
Figure imgf000028_0001
hetero(CB.[2)bicycloaryl(Cι-5)alkyl, hetero(Ci.[o)alkyl, (C3.i2)cycloalkyl, hetero(C3.i2)cycloalkyl, (C^^bicycloalkyl, hetero(C3-i2)bicycloalkyl, (Q.^aryl, hetero(C]-10)aryl, (C9.i2)bicycloaryl and hetero(C4-i2)bicycloaryl, each substituted or unsubstituted, or R30 and R21 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0107] In some variations of the above embodiments and variations, R20 and R21, when present, are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0108] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000028_0002
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-; R1 is selected from the group consisting of oxy, (C].]o)alkoxy, (Q.^aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamiπo, imino, (CM0)alkyl, halo(C1- lo)alkyl, hydroxy(Ci.]0)alkyl, carbonyl(C(-ιo)alkyl, thiocarbonyl(Ci.io)alkyl, sulfonyl(CM0)alkyl, sulfinyl(C[.ιo)alkyl, azaCCM 0)alkyl, (Cι.ιo)oxaalkyl, (C].,o)oxoalkyl, iminofCi.ioJalkyl, (C3-i2)cycloalkylCCi.5)alkyl, hetero(C3.[2)cycloalkyl(Ci.io)alkyl, aryl(C|.I0)alkyl,
Figure imgf000029_0001
(C9.|2)bicycloaryl(Ci.5)alkyl, hetero(C8-i2)bicycloaryl(Ci.5)alkyl, heterofCi.ioialkyl, (C3-i2)cycIoalkyl, hetero(C3.[2)cycloalkyl, (C9.]2)bicycloalkyl, hetero(C3-i2)bicycloalky], (C4.i2)aryl, hetero(C|.io)ai*yl,
Figure imgf000029_0002
and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (C].]o)alkoxy, (C4.]2)aryloxy, hetero(C|.l0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.[0)a]kylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(Cι.io)alkyl, hydroxy(C].io)aIkyl, carbonyl(C].]0)alkyl, thiocarbonyl(C].]o)alkyl, sulfonyl(Ct.ιo)alkyl, sulfinyl(C].]o)alkyl, aza(Cμιo)alkyl, (C[.ιo)oxaalkyl, (C].io)oxoalkyl, imino(C|.ιo)alkyl, (C3-t2)cycloalkyl(Ci.5)aIkyl, hetero(C3.i2)cycloalkyl(C].]0)alkyI, aryl(C].ιo)alkyl, hetero(Ci.io)aryl(C]-5)alkyl, (C9.t2)bicycloaryl(Ci.5)alkyl, hetero(Ca-i2)bicycloaryl(C].5)alkyl, hetero(C[.[0)alkyl, (C3-12)cycloalkyl, hetero(C3.[2)cycloalkyl,
Figure imgf000029_0003
lietero(C3.]2)bicycloaIkyl, (C4.]2)aryl( hetero(C|.io)aryl, (C9.l3)bicycloaryl, and hetero(C4-i2)bicycloaryl, each substituted or unsubstituted;
V5 is selected from the group consisting Of CR8R8' and NR8';
V6 is selected from the group consisting Of CR9R9' and NR9';
V7 is selected from the group consisting Of CR10R10' and NR10';
V8 is selected from the group consisting Of CR11R11 ' and NR11 '; wherein
R8, R8', R9, R9', R10, R10', R1 ' and R11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy,
(Ci.io)alkoxy, (C4-t3)aryIoxy, hetero(Ci.[0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl,
(Ci.ιo)alkyl, halo(C].]0)alkyl, hydroxyCC1-1o)alkyl, carbonyl(C].]0)alkyl, thiocarbonyt(Ci.io)aIkyl, sulfonyl(d.io)alkyl, sulfinyl(C[.ιO)alkyl, aza(CMo)alkyl, (C].ιo)oxaalkyl, (C[.|0)oxoalkyl, imino(CMo)alkyl, (C3.]2)cycloalkyl(C].5)alkyl, hetero(C3.i2)cycloalkyl(C].]o)alkyI, aryl(Ci-io)alkyl, hetero(C|-io)aryl(C1.5)alkyl, (C9.]2)bicycIoaryI(Cι-5)alkyl, hetero(Ca-]2)bicycloaryI(Cι-5)aIkyl, hetero(C[.[0)alkyl, (C3.]2)cycloalkyl, hetero(C3.i2)cycloalkyl, (C^bicycloalkyl, hetero(C3.i2)bicycloalkyl, (C4-]2)aryl, hetero(CM0)aryl, (Q>.i2)bicycloaryl, and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted, provided that R8', R9', R10 , and R11 may each be independently absent when the atom to which it is bound forms part of a double bond, or R and R are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R9 and R10 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R10 and R1 1 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0109] In another embodiment, the compounds of the invention consists of the formula:
Figure imgf000030_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2; Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (C].]o)alkoxy, (C4.i2)aryloxy, hetero(Cι.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]o)alkylamino, imino, (Ci.io)alkyl, halo(Cl- lo)alkyl) hydroxy(CM0)alkyl, carbonyl(C[.10)alkyl, thiocarbonyl(Ci.]o)alkyI, sulfonyl(C[.io)alkyl, sulfinyl(C].|0)alkyl, aza(C1 -10)aIkyl, (C|.Lo)oxaalkyl, (C]-]o)oxoalkyl, imino(CMo)alkyl, (C3.]2)cycloalkyl(Ci.5)alkyl, hetero(C3.i2)cycloalkyl(C].]0)alkyl, ai-yl(C].]o)alkyl, hetero(Ci.ιo)aryl(C[-5)alkyl, (C9.!3)bicycIoaryl(C].5)alkyl, hetero(C8.i2)bicycloaryI(Ci.5)alkyl, hetero(C|.io)alkyl, (C3.]2)cycloalkyl, hetero(C3.[2)cycloalkyl, (C9.12)bicyc]oalkyl, hetero(C3.12)bicycloalkyl, (G|.]2)aryl, hetero(C[.[0)aryl, (C9.[2)bicycloaryl, and hetero(C4-12)bicycloarylJ each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (CM0)alkoxy, (C4-i2)aryloxy, hetero(C1- 10)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C[.10)alkyl, halo(C1-)0)alkyl, hydroxy(CM0)alkyl, carbonyI(Ci-10)alkyl, thiocarbonyl(C|.[0)alkyl, sulfonyl(C].]0)alkyl, sulfinylCQ.uOalkyl, aza(Ci.10)alkyl, (C].]o)oxaalkyl, (CMo)oxoalkyI, imino(C|.l0)a1kyl, (C3.[2)cycIoalkyl(C|.s)alkyl, hetero(C3.i2)cycIoalkyl(C|.io)aIkyl, aryl(C|.l0)a]kyl, hetero(Ci.io)aryl(C1 -5)alkyl, (C9.]2)bicycloaryl(Cι-5)alkyl, hetero(C8.i2)bicycloaryl(Cι.5)alkyl, hetero(C1-10)alkyl, (C3.i2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9-i2)bicycloalkyl, hetero(C3.i2)bicycloalkyl, (C4.i2>aryl, hetero(C].ιo)aryI, (Co-nJbicycloaryl, and hetero(C4-12)bicycloaryl, each substituted or unsubstituted; and
R8, R9, R10, and R1 ' are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (C,.6)alkoxy, (C].6)alkyl, halo(Ci.6)alkyl, hydroxy(C[.6)alkyl, aza(C].6)alkyl, (C[.6)oxaalkyl, and (C]-!0)oxoalkyl, each substituted or unsubstituted. [0110] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000032_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (Ci-ioJalkoxy, (C4-12)aryloxy, hetero(C|.]o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.ιo)alkylamino, imino, (CM0)alkyI, haIo(C]-10)alkyl, hydroxy(CM0)alkyl, carbonyl(C].]0)alkyl, thiocarbonyl(C].io)alkyl, sulfonyl(C]-!0)alkyl, sulfinyl(C].io)aIkyl, aza(C[.ιo)aIkyl, (Cι.io)oxaalkyl, (Ci.io)oxoalkyl, imino(C|.I0)alkyl, (C3.12)cycloalkyl(C1.5)alkyl, hetero(C3.i2)cycloaIkyl(CMo)alkyl, aryl(CI-10)alkyI, hetero(C|.io)aryl(Ct.5)alkyl( (C9.i2)bicycloaryl(C|.5)alkyl, hetero(C8.i2)bicycloaryl(Ci.5)alkyl, hetero(CM0)alkyl, (C3-[2)cycloalkyl, hetero(C3.i:>)cycloalkyl, (C9-] 2)bicycloalkyl, heterofC^^bicycloalkyl, (C4.j2)aryl, hetero(C].io)aryl, (C9.[2)bicycloaryl and betero(C4.i2)bicycloaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Cι.ιo)alkoxy, (C4.]2)aryloxy, hetero(CM 0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].]o)alkyl, halo(Ci.io)alkyl, hydroxy(Ci.io)alkyl, carbonyl(Ci.io)alkyl, thiocarbonyl(Cι.ιo)alkyl, sulfonyl(C].]0)alkyl, SuIFmVl(C1. io)alkyl, aza(C].]0)alkyl, (C[.ι0)oxaalkyl, (Q.LoJoxoalkyl, imino(C,.10)alkyl, (C3-i2)cycloalkyl(Ct-5)aIkyl, hetero(C3.i2)cycloalkyl(Ci.io)alkyl, aryl(C].]o)alkyl1 hetero(C[.[0)aryl(C].s)alkyl, (C9-i2)bicycloaryl(C|.s)alkyl, hetero(C8.i2)bicycloaryl(C|.5)alkyl, hetero(Cι.ιo)alkyi, (C3-i2)cycloalkyl, hetero(C3.]2)cycloalkyl, (C9.|2)bicycloalkyl, hetero(C3.]2)bicycloalkyl, (C4.]2)aryl, hetero(C].io)aryI, (C9.[2)bicycloaryl, and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted; and R8, R9 and R10 are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (d.6)alkoxy, (C].6)alkyl, halo(C].6)alkyl, hydroxy(C).6)alkyl, aza(C|.6)alkyl, (C].6)oxaalkyl, and (Cι-ι0)oxoalkyl, each substituted or unsubstituted. [0111] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000033_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is I or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)3-;
R1 is selected from the group consisting of oxy, (Ci-to)alkoxy, (C4- 13JaTyIoXy, hetero(Ci.[o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.io)alkylamino, imino, (C|.]0)alkyl, halo(C].]0)alkyl, hydroxy(Cι.[o)alkyl, carbonyl(Ci.]0)alkyl, thiocarbonyI(C|.io)alkyl, sulfonyl(C[.[0)alkyl, sulfinyl(Cι.ιo)alkyl, 3Za(C1- 10JaIkYl, (Ci.io)oxaalkyl, (C].io)oxoalkyl( imino(C[.io)alkyl, (C3.ι3)cycIoalkyl(C[.5)alkyl, hetero(C3.]2)cycloaIkyl(Cι.ιo)alkyI, aryl(Ci- to)alkyl, heteiO(C|.io)aryl(C]-5)alkyl, (C9.]3)bicycloaryl(Ci.5)alkyl, hetero(C8.]2)bicycloaryl(Cι.5)alkyl, hetero(Ci-10)alkyl, (C3-i2)cycloaIkyl, hetero(C3.]2)cycloalkyl( (C9.[2)bicycloalkyl, hetero(C3.i2)bicycloalkyl, (C4-i2)aryl, hetero(C]-i0)aryl, (Cg-^bicycloaryl, and hetero(C4.]3)bicycloaryl, each substituted or unsubstituted;
R3 is substituted or unsubstituted alkyl;
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, (C4-12)aryloxy, heterotCuuOaryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.10)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Cj.ιo)alkyl, halo(C|-10)alkyl, hydroxy(Ci.io)alkyl, carbonyl(C].10)alkyl, thiocarbonyl(C1-10)alkyl,
Figure imgf000033_0002
sulfinyKCMoJalkyl, aza(C].io)alkyl, (C[.[o)oxaalkyl, (C1-10)oxoalkyl, imino(C).io)alkyl, (C3-i2)cycloalkyl(Ci.5)alkyl, hetero(C3.i2)cycloalkyl(Ci.io)alkyl, aryl(C1 -,o)alkyl) hetero(C,-,o)aryl(Cι.5)alkyl, (C9-[2)bicycloaryl(C].5)alkyI, hetero(C8.i2)bicycloaryl(Ci.5)alkyl, hetero(Ci-ιo)alkyl,
(C3.|2)cycloalkyl, hetero(C3.[2)cycIoalkyl, (C9.i2)bicycloalkyl, hetero(C3-i2)bicycloaIkyl, (C4-L2)aryl, hetero(C].]0)aryl,
Figure imgf000034_0001
and heteroCC4.]2)bicycloaryl, each substituted or unsubstituted; the ring comprising V1, V2, V3, and V4 is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl; V1 is selected from the group consisting of CR4 and N; V2 is selected from the group consisting of CR5 and N; V3 is selected from the group consisting of CR6 and N; V4 is selected from the group consisting of CR7 and N; wherein
R4, R5, R6, and R7 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C].io)alkoxy, (C4- 12JaTyIoXy, hetero(C|.[o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamide, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(C[.ιo)alkyl, hydroxy(C].io)alkyl, carbonyl(Ci.]o)alkyl, thiocarbonyl(Cj.io)alkyl, sulfonyl(C[.ιo)alkyl, sulfinyl(C|.io)aIkyl, aza(C]-)0)alkyl, (C].]0)oxaalkyl, (C].|0)oxoalkyl, imino(Ci.|0)alkyl, (C3.i2)cycloalkyl(C1.5)alkyl1 hetero(C3.]2)cycloalkyI(C[.[o)alkyl, aryl(Cι.|0)alkyl, hetero(C1-[o)aryl(C1.5)alkyI, CC9.i5)bicycloaryI(C[.5)alkyl, hetero(Ca-]2)bicycloaryl(Ci.5)alkyl, hetero(C|.io)alkyl, (C3-12)cycloalkyI, hetero(C3-12)cycloaIkyl, (C9.ι3)bicycloalkyl, hetero(C3.|2)bicycloalkyl, (C4.[2)aryl, hetero(CMo)aryl,
Figure imgf000034_0002
and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted, or R4 and R5 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R5 and R6 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R6 and R7 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0112] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000035_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (Cι.io)alkoxy, (C4-12)aryloxy, hetero(Ct-ιo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C[.[0)alkylamino, imino, (Cι.]0)alkyl, halo(Ci.io)alkyl, hydroxy(CMo)alkyl, carbonyl(C].io)alkyl, thiocarbonyKCt.toJalkyl, sulfonyl(C|-!0)alkyl, sulfϊnyI(Ci.io)a1kyl, aza(Cι- l0)alkyl, (C,.,o)oxaalkyl, (Cι.io)oxoalkyl, imino(C|.|0)alkyl, (C3.]2)cycloalkyl(CL.s)alkyl, hetero(C3.]2)cycIoalkyl(CMo)alkyl, aryl(CM0)alkyl, hetero(Cι.ιo)aryl(C]-s)alkyl, (C9.]2)bicycloaryl(Ci-5)aIkyl, hetero(C8-i2)bicycloaryl(C|.5)alkyl) hetero(Ci.io)alkyl, (C3.i2)cycloalkyl, hetero(C3.]2)cycloaIkyl, (C9-12)bicycloalkyl, hetero(C3.|2)bicycloalkyl, (Q.^aryl, hetero(C].]0)aryl, (Cg-^bicycloaryl, and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy, (C4.!2)aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.ioJalkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C]-!0)alkyl, halo(C|.ιo)alkyl, hydroxy (C Mo)a]kyl, carbonyltCj.ioJalkyl, thiocarbonyl(CMo)alkyl, sulfonyl(C[.|0)alkyl, sulfinyl(C].]o)alkyl, aza(C[.ιo)alkyl, (C].|0)oxaalkyl, (Ci.i0)oxoalkyl, imino(C[.[0)alkyI, (C3.]2)cycloalkyl(C].5)alkyl, hetero(C3-i2)cycloaIkyl(Ci.io)alkyl, aryl(C[.[0)alkyl, hetero(Ci.]o)aryl(Ct-s)alkyl( (C9-]2)bicycloaryl(C[.5)alkyl, hetero(C8-]2)bicycloaryl(Ci..<i)alkyl, hetero(C].io)aIkyl,
(C3.]2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9-) 2)bicycIoalkyl, hetero(C3-l2)bicycloalkyl, (C4-i2)aryl, hetero(CM0)aryl, (Cg.^bicycloaryl, and hetero(G,.[2)bicycloaryl, each substituted or unsubstituted;
V3 is selected from the group consisting of CR6 and N; V4 is selected from the group consisting of CR7 and N; V5 is selected from the group consisting of CR8R8', NR8', O, and S; V6 is selected from the group consisting of CR9R9', NR9', O, and S; V7 is selected from the group consisting of CR10R10', NR10', O, and S; V8 is selected from the group consisting Of CR11R11 ', NR1 1 ', O, and S; wherein
R6, R7, R8, R8', R9, R9', R10, R10', R11 and R11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C|.10)alkoxy, (C4.[2)aryloxy, hetero(C].]0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C|.io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, 1IaIo(C1. ]o)alkyl, hydroxy(C]-]o)alkyl, carbonyl(C|.ιo)alkyl, thiocarbonyl(C1-]o)alkyl( sulfonyl(C].]o)alkyl, sulfϊnyl(C|.io)alkyl, aza(C|.[0)alkyl, (C].]o)oxaalkyl, (C|.t0)oxoalkyl, iminoCC].Lo)alkyl, (C3.13)cycloalkyl(CL.5)alkyl, hetero(C3.i2)cycloalkyI(Ci.,o)alkyl, aryl(CM0)aIkyl, hetero(Cι-10)aryI(Ci.5)alkyl, (C9.t2)bicycIoaryl(Ci-5)a]kyl, hetero(C8.i2)bicycloaryl(Ci-5)alkyl, hetero(C].]o)alkyI, (C3.i2)cycloalkyl, hetero(CM2)cycloalkyl,
Figure imgf000036_0001
hetero(C3-ι2)bicycloalkyl, (C4-i2)aryl, hetero(C|.ιo)aryl,
Figure imgf000036_0002
and hetero(C4.[2)bicycloaryI, each substituted or unsubstituted, provided that R8', R9', R10', and R11 ' may each be independently absent when the atom to which it is bound forms part of a double bond, or R and R are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R9 and R10 are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R10 and R1 ' are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0113] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000037_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (C].ιo)alkoxy, (C.,.i2)aryloxy, hetero(C].ιo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, imino, (Cμιo)alkyl, halo(C[.ιo)alkyl, hydroxy(Cι-io)alkyl, carbonyl (C ]-io)alkyl, thiocarbonyl(Ci.io)alkyl> sulfoπyl(C]-10)alkyl, sulfinyl(C|-ιo)alkyl, aza(Cwo)alkyl, (C].!o)oxaalkyl, (Ci.io)oxoalkyl, imino(CMo)alkyl, (C3.i2)cycloa]kyl(C[.5)alkyl, hetero(C3.[2)cycloalkyl(Ci.io)alkyl, aryl(C].]o)alkyl, hetero(C|.[0)aryl(C].5)alkyl, (C9.]2)bicycloaryl(Ci.5)alkyl, hetero(Cg.i2)bicycloaryl(Ci.5)alkyl, hetero(C[.io)alkyl, (C3-i2)cycloalkyl, hetero(C3.]2)cycIoalkyl,
Figure imgf000037_0002
hetero(C3.]2)bicycloalkyl, (C4- l2)aryl, hetero(C].ιo)aryI, (C9-i2)bicycloaryl, and hetero(C4-i2)bicycloaryI, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR or N, where R is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Cι-ιo)alkoxy, (Cφ^aryloxy, hetero(C[.[o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].io)alkyl, halo(C].jo)alkyl, hydroxy(C[-io)alkyl, carbonyl(Cι.[0)alkyl, thiocarbonyl(C|.ιo)aIkyl, sulfonyl(CMo)alkyl, sulfinyl(C].]o)alkyl, aza(C].]0)alkyl, (Ci.io)oxaalkyl, (C|.i0)oxoalkyl, imino(C].io)alkyI, (C3.]2)cycloalkyl(C].s)alkyl, hetero(C3.i2)cycloaIkyl(Ci.|0)alkyl, aryl(C].io)alkyl, hetero(C].ιo)aryl(C1 -5)alkyl, (C9.i2)bicycloaryl(C|.5)alkyl, hetero(Cg.i2)bicycloaryl(Ci.5)alkyl, hetero(C1-10)alkyl, (C3-i2)cycloaIkyl, hetero(C3-i2)cycloalkyl, (C9.]2)bicycloalkyl, hetero(C3.|2)bicycloalkyl, (C4-i2)aryl, hetero(C[-ιo)aryl, (Cg.^bicycloaryl, and hetero(C4-i2)bicycloaryl, each substituted or unsubstituted;
V5 is selected from the group consisting of CR8R8', NR8', O, and S; V6 is selected from the group consisting of CR9R9 , NR9 , O, and S; V7 is selected from the group consisting Of CR10R10', NR10', O, and S; V8 is selected from the group consisting of CR1 1R11 ', NR11 ', O, and S; wherein
R8, R8', R9, R9', R10, R10', R1 ' and R11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C]-]o)alkoxy, (C4.[2)aryloxy, hetero(C[.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C|.ιo)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].io)alkyl, halo(C[.ιo)alkyl, hydroxy(C[.1o)alkyl, carbonyl(C|.io)alkyl, thiocarbonyl(C[.|o)alkyl, sulfonyl (C ].io)alkyl, suIfinyl(C[.[o)alkyl, aza^MoJalkyl, (C1-1o)oxaalkyl, (C1-io)oxoalkyl, imino(C1.io)alkyl, (C3.i2)cyc]oalkyl(C].5)aIkyl, hetero(C3.]2)cycloalkylCCi.io)alkyl, aryHd-ioJalkyl, hetero(C].]o)aryI(Ci.5)alkyl, (C9-[2)bicycloaryl(C].5)alkyl, hetero(Cg-i2)bicycloaryl(C].5)alkyl, hetero(C|.ιo)alkyl, (C3.]2)cycloalkyl, hetero(C3-]2)cycloalkyI, (Cg-12)bi cycloalkyl, hetero(C3.i2)bicycloalkyl, (C4-i2)aryl, hetero(Ci.io)aryl, (C(M 2)bicycloaryl, and hetero(C4. !2JbICyClOHrYl1 each substituted or unsubstituted, provided that R8 , R9 , R10 , and R11 may each be independently absent when the atom to which it is bound forms part of a double bond, or R8 and R9 are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R9 and R are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R10 and R1 ' are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. [0114] In another embodiment, the compounds of the invention consist of the formula:
Figure imgf000039_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein a is I or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
R1 is selected from the group consisting of oxy, (Cι-ιo)alkoxy, (C4.]2)aryloxy, hetero(C|.ιo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-ioJalkylamino, imino, (C[.io)alkyl, halo(CM0)alkyl, hydroxy(C].]0)alkyl, carbonyl(Cι.ι0)alkyl, thiocarbonyl(C|.]0)alkyl, sulfonyl(C].]o)alkyl, sulfinyl(Ci.io)alkyl, azaCC].]0)alkyl, (C].io)oxaalkyl, (C].io)oxoalkyl, imino(Ci.io)aIkyl, (C3.[2)cycloalkyl(C].5)alkyl, hetero(C3.i2)cycloalkyl(Ci.ιo)alkyl, aryl(C].]0)alkyl, hetero(C|.ιo)aryl(C|.5)alkyl, (C9-i2)bicycloaryl(Ci.5)alkyl, hetero(Cg.[2)bicycloaryl(C|.s)alkyl, hetero(C].io)alkyI, (C3.|2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9.i2)bicycloalkyl, hetero(C3.[2)bicycloalkyl, (Q.[2)aryl, hetero(C]-10)aryl, (C^bicycloaryl, and hetero(Gt.i2)bicycIoaryl, each substituted or unsubstituted;
R2 is substituted or unsubstituted alkyl;
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (CM0)alkoxy, (C4.]2)aryloxy, hetero(C].]0)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyi, (C[.[0)alkyl, halo(C]-io)alkyl, hydroxy(C1-10)alkyl, carbonyl(C1-10)alkyl, thiocarbonyl(C].]o)alkyl, sulfonyl(Ci.io)alkyl, sulfinyl(C|.ιo)alkyl, aza(C|.iO)alkyl, (Ci-io)oxaalkyl, CCi.]0)oxoalkyl, imino(Ci.io)alkyl, (C3-i2)cycloalkyl(C|.5)alkyl, hetero(C3.ι2)cycloalkyl(Ci-ιo)alkyl, aryl(Ci.io)alkyl, hetero(Ci.]o)aryl(C|.5)alkyl, (C9.l2)bicycloaryl(C|.5)alkyl, hetero(C8.12)bicycloaryl(Ci.s)alkyl, hetero(CM0)alkyl, (C3-ι2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9.[2)bicycloalkyl, hetero(C3.i2)bicycloalkyl, (C4-i2)aryl, hetero(C].]o)aryl, (C9.]2)bicycloaryl, and hetero(C4.[2)bicycloaryl, each substituted or unsubstituted. [0115] In some variations of the above embodiments of the compounds of the invention, a is 1. In some other variations, a is 2.
Q
[0116] In some variations of the above embodiments and variations of the compounds of the invention, Q is -S-. In other variations, Q is -S(O)-. In still other variations, Q is - S(O)2-.
[0117] In some variations of the above embodiments and variations of the compounds of the invention, R" is a substituted or unsubstituted (C|.6)alkyl. [0118] In some other variations, R2 is a substituted or unsubstituted methyl. [0119] In still other variations, R2 is a substituted or unsubstituted ethyl.
Figure imgf000040_0001
[0120] In some variations of the above embodiments and variations of the compounds of the invention, R! is selected from the group consisting of aminocarbonyl,
(Ci.io)alkylamino, (Ci.io)alkyl, carbon yl(C i. u>)alkyl, aza(C].]o)alkyl, (Ci.io)oxaalkyl,
(C[.ιo)oxoalkyl, imino(Cι-10)alkyl, hetero(C3.i2)cycloalkyl(C[.io)a]kyl,
(C9.[2)bicycloaryl(C].s)alkyl, hetero(C8.i2)t>icycloaryl(Ci.5)alkyI, hetero(C].[o)alkyl,
(C3-i2)cycloalkyl, hetero(C3.|2)cycloalkyl,
Figure imgf000040_0002
hetero(C].]o)aryl,
Figure imgf000040_0003
and hetero(C4.]2)bicycloaryl, each substituted or unsubstituted.
[0121] In other variations, R1 is selected from the group consisting of (Ci.io)alkyl, hetero(C].io)alkyl,
Figure imgf000040_0004
hetero(Cι-ιo)aryl, (C3.i2)cycloalkyl, hetero(C3.i2)cycloalkyl,
(C9-i2)bicycloaryl and hetero(GM2)bicycloaryl, each substituted or unsubstituted.
[0122] In still other variations, R1 is a (Gι-]2)aryl or a hetero(Ci.jo)aryI, each substituted or unsubstituted.
[0123] In all the above variations where R1 is a (C4.]2)aryl or hetero(Cl.l0)aryl, R1 is selected from the group consisting
of:
Figure imgf000040_0005
, each substituted or unsubstituted. [0124] In all the above variations where R1 is a (C4.]2)aryl or hetero(C[.[0)aryI, the (C4.i2)aryl and the hetero(Ci.io)aryI are each substituted with substituents each independently selected from the group consisting of chloro, bromo, -CN, methyl, methoxy, phenoxy, -C(O)OCH3, -C(O)OH1 -C(O)CH3, -C(O)N(CH2CH)3, - C(O)O(CH2CH)3, -NHC(O)CH3, -N(CH2CH3)2l -N(CH3J2, -NO2, -OCF3, -SCH3, - S(O)2CH3, -S(O)3NH2,
Figure imgf000041_0001
[0125] In the embodiments and variations where R1 is a (C4.]2)aryl or hetero(Ci.i0)aryl, R1 is selected from the group consisting of:
Figure imgf000041_0002
[0126] In other embodiments and variations, R1 is a unsubstitυted or substituted (Cg.]2)bicycloaryl, or unsubstituted or substituted hetero(C4.i2)bicycloaryl. In some of these variations, the
Figure imgf000042_0001
and hetero(C4.]2)bicycloaryl are selected from the group consisting of:
Figure imgf000042_0002
[0127] In other embodiments and variations, R1 is a substituted alkyl selected from the group consisting of methyl, isobutyl, -(CH2)ZC(O)OCH2CH3, -(CH2)2C(O)N(CH2CH3)2, -
Figure imgf000042_0003
[0128] In still other embodiments and variations, R1 is a cycloalkyl or heterocycloalkyl which is selected from the group consisting of
Figure imgf000042_0004
[0129] In some variations of the above embodiments of the compounds of the invention, Y is N.
[0130] In other variations, Y is -CR3-, where R3 is selected from the group consisting of hydrogen, methyl, ethyl, propyl, and isopropyl. In other variations, R3 is hydrogen or methyl. In still other variations, R3 is hydrogen or methyl.
[0131] Y is -CH-.
[0132] The still other embodiments, the compounds of the invention consist of a formula selected from the group consisting of:
Figure imgf000043_0001
or a hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt, thereof, wherein
R1 is a selected from the group consisting of methyl, isobutyl, -(CH2J2CF3, -(CH2J2CCO)OCH2CH3, -(CH2J2C(O)N(CH2CH3J2,
Figure imgf000043_0002
Figure imgf000044_0001
R10 and R11 are each independently selected from the group consisting of (C|.6)alkyl and (Ci-6)alkoxy.
[0133] In some variations of the above embodiments, R1 is a selected from the group consisting of
Figure imgf000044_0002
[0134] In other variations of the above embodiments, R1 is a selected from the group consisting of
Figure imgf000044_0003
[0135] In still other variations of the above embodiments, R1 is a selected from the group consisting of
Figure imgf000045_0001
[0136] In any one of the above embodiments and variations, R10 and R1 ' are each independently methyl or methoxy. In other variations, R10 is methyl. In other variations,
R10 is methoxy. In still other variations, R1 ' is methyl. In yet other variations, R1 ' is methoxy.
[0137] Particular examples of compounds according to the present invention include, but are not limited to, the following:
2-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-l-ylsulfonyl)benzonitrile; l-(3-(4-(2-cyanophenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2-yl)-3- ethylurea;
1 -ethyl -S-tS-^-tphenylsulfonylJpiperazine-l-carbonylJbenzotblthiophen^- yl)urea;
1 ~(3-(4-(benzo[d] [ 1 ,3]dioxol-5-ylsulfonyl)piperazine- 1 - carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(3-(methylsulfonyl)ρhenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-(3-(4-(benzo[c][l,2,5]thiadiazoI-5-y!sulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea; l-ethyI-3-(3-(4-(3-methoxyphenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
N-(3-(4-(2-(3-ethyIureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)phenyl)acetamide;
2-chloro-5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)benzenesulfonamide;
1 -ethyl-3-(3-(4-(3-(2-methylthiazol-4-yl)phenylsulfonyl)piperazine- 1 - carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(5-methyl-l,3,4-oxadiazol-2-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(2-methylpyrimidin-4-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(5-methyl-l,2,4-oxadiazoI-3-yl)phenylsuIfonyl)piperazine-l- carbonyl)benzo[b]tbiophen-2-yl)urea; l-ethyl-3-(3-(4-(6-morphoHnopyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyi)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-nitrophenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea;
1 -ethyl-3-(3-(4-( 1 , 1 -dioxotetrahydrothiophen-3-ylsulfonyl)piperazine- 1 - carbonyl)benzo[b]thiophen-2-yl)urea;
1 -(3-(4-(3,4-dihydro-2H-benzo[b] [ 1 ,4]dioxepin-7-ylsulfonyl)piperazine- 1 - carbonyl)benzo[b]thioρhen-2-yl)-3-ethylurea;
N-(5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyI)piperazin-l-ylsulfonyl)- 2-methoxyphenyl)acetamide; l-(3-(4-(3-acetylphenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2-yl)-3- ethylurea; l-(3-(4-(benzo[d]thiazol-6-y]sulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)-3-ethylurea; l-ethyl-3-(3-(4-(4-(2-oxopyrrolidin-l-yl)phenylsulfonyI)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-(3-(4-(3,4-dimethoxyphenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)-3-ethylυrea;
N-(4-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)phenyl)acetamide;
Ethyl 3-(4-(2-(3-ethyIureido)benzo[b]thioρhene-3-carbonyl)piperazin-l- y] su lfon yl)propanoate; l-ethyl-3-(3-(4-(isobutylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(3,3,3-trifluoropropylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(methyisulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(4-(methylsulfonyl)phenylsulfonyl)piperazine-I- carbonyl)benzo[b]thiophen-2-yl)urea;
1 -ethyl -3-(3-(4-(2-oxoindolin-6-ylsulfonyl)piperazine-l- carbonyl)benzo [b] thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydro-lH-benzo[d]imidazol~5-ylsulfonyl)piperazine- l-carbonyI)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]oxazol-5-ylsuIfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]thiazol-5-ylsuIfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
N,N-diethyl-3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)propanamide; l-ethyl-3-(3-(4-(3-oxo-3-(pyrrolidin-l-yl)propylsulfonyl)piperazine-l- carbonyl)beπzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-moφholino-3-oxopropylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenyIsulfonyl)piperidine-l- carbonyl)benzo [b] thiophen-2-yl)urea;
1 -(3-(4-(benzo[d] [ 1 ,3]dioxol-5-ylsulfonyl)piperidine- 1 - carbonyl)beπzo[b]thiophen-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(3-methoxyphenylthio)piperidine-l-carbonyl)benzo[b]thiophen-2- yl)urea;
1 -ethyl -3-(3-(4-(3-(trifluoromethoxy)phenylthio)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(trifluoromethoxy)ρhenylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(pyridin-3-ylsulfoπyl)piperazine-l-carbonyl)benzo[ύ]thiophen-2- yl)urea; l-ethyl-3-(7-methoxy-3-(4-(6-methoxypyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(6-phenoxypyridin~3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
HS-^-^-fdiethylaminoJpyridinO-ylsulfonyOpiperazine-l-carbonylJthieno^.S- b]pyridin-2-yl)-3-ethylurea; l-(3-(4-(6-chloropyridin-3-ylsulfonyl)pipera2ine-l-carbonyl)benzo[&]thiophen-2- yl)-3-ethylurea; l-(3-(4-(2-chloropyrimidin-5-ylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen- 2-yl)-3-ethylurea; l-(3-(4-(5-bromo-6-(diethylamino)pyridin-3-ylsulfonyI)piperazine-l- carbonyl)benzo[/?]thiophen-2-yl)-3-ethylurea; l-(7-cyano-3-(4-(6-(diethylamino)pyridin-3-ylsulfonyI)piperazine-l- carbonyI)benzo[b]thiophen-2-yl)-3-ethylurea; l-(3-(4-(2-(diethylamino)pyrimidin-5-ylsulfonyl)piperazine-l-carbonyl)-6~ methyl thieno[2 ,3 -b]pyridin-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(quinolin-8-yIsuIfonyl)piperazine-l-carbonyl)benzo[δ]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(2-(naphthalen-l-yl)ethylsulfonyl)piperazine-l- carbonyl)benzo[6]thiophen-2-yl)urea; l-(3-(4-((7,7-dimethyl-3-oxobicyclo[2.2.1]heρtan-l-yl)methylsulfonyl)piperazine- l-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea; methyl 2-(4-(2~(3-ethylureido)benzo[t]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)benzoate;
2-(4-(2-(3-ethylureido)benzo[6]thiophene-3-carbonyl)piperazin-l- ylsυlfonyl)benzoic acid;
Λr,Λr-diethyl-2-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3- carbonyl)piperaziπ-l-ylsulfonyl)benzamide;
3-(4-(2-(3-ethylureido)benzo[&]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)benzoic acid; methyl 3-(4-(2-(3-ethylureido)benzo[&]thiophene-3-carbonyl)piρerazin-l- ylsulfonyl)benzoate; iV,J/V-diethyl-3-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)benzamide;
Λr-(5-(4-(2-(3-ethylureido)benzo[&]thioρhene-3-carbonyl)piperazin-l- yIsulfonyl)thiazol-2-yl)acetamide; ethyl 2-(4-(2-(3-ethylureido)thieno[2,3-b]pyridine-3-carbonyl)piperazin-l- ylsulfonyl)-4-methylthiazole-5-carboxylate; l-ethyl-3-(7-methoxy-3-(4-(5-(oxazol-5-yl)thiazol-2-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-methyl-4,5t-bithiazol-2'-ylsulfonyI)piperazine-l- carbonyl)benzo[£]thiophen-2-yl)urea; l-ethyl-3-C6-methyl-3-(4-(4-methyl-3,4-dihydro-2H-benzo[b][l,4]oxazin-7- yIsulfonyl)piρerazine-l-carbonyl)thieno[2,3-b]pyridin-2-yl)urea; l-ethyl-3-(3-(4-(3-oxo-3,4-dihydro-2H-benzo[b][l,4]oxazin-6- ylsulfonyl)piperazine-l-carbonyl)benzo[&]thiophen-2-yl)urea; l-(3-(4-(3,5-dimethoxyphenylsulfonyl)piperidine-l-carbonyl)-7- methoxybenzo[b]thiophen-2-yl)-3-ethylurea; l-(3-(4-(3-(dimethylamino)phenylsulfonyl)piperidine-l-carbonyl)-6- methylthieno[2,3-b]pyridin-2-yl)-3-ethylurea; l-(3-(4-(3,5-dimethoxyphenylsulfonyl)piperidine-l-carbonyl)benzo[b]thioρhen-2- yl)-3-ethylurea; l-ethyl-3-(3-(4-(3-(moφholinomethyl)phenylsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyl)piperidiπe-l- carbonyl)thieno[2,3-b]pyridin-2-yl)urea; l-ethyl-3-(3-(4-(3-(methylthio)phenylsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(pyridin-3-ylsulfonyl)piperidine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-(3-(4-(benzo[d][l,3]dioxol-5-ylsulfinyl)ρiperidine-l-carbonyl)-7- methoxybenzo[b]thioρhen-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(methylthio)phenylsυlfiny])piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(6-methyl-3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-l- carbonyl)thieno[2,3-b]pyridin-2-yl)urea; and l-ethyl-3-(7-methoxy-3-(4-(pyridin-3-ylsuIfinyl)piperidine-l- carbonyI)benzo[b]thiophen-2-yl)urea.
[0138] It is noted that the compounds of the present invention may be in the form of a pharmaceutically acceptable salt. It is further note that the compounds of the present invention may be in a mixture of stereoisomers, or the compound may comprise a single stereoisomer.
[0139] In another aspect, the present invention is related to a pharmaceutical composition comprising as an active ingredient a compound according to any one of the above embodiments and variations. In one embodiment, the composition is a solid formulation adapted for oral administration. In another embodiment, the composition is a liquid formulation adapted for oral administration. In yet another embodiment, the composition is a tablet. In still another embodiment, the composition is a liquid formulation adapted for parenteral administration.
[0140] In another embodiment, the pharmaceutical composition comprises a compound according to any one of the above embodiments and variations, wherein the composition is adapted for administration by a route selected from the group consisting of orally, parenterally, intraperitoneally, intravenously, intraarterial Iy, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposaUy, intraarticular^, and intrathecally. [0141] In another aspect, the invention is related to a kit which comprises a compound of any one of the above embodiments and variations, and instructions which comprise one or more forms of information selected from the group consisting of indicating a disease state for which the composition is to be administered, storage information for the composition, dosing information and instructions regarding how to administer the composition. In one particular variation, the kit comprises the compound in a multiple dose form.
[0142] In still another aspect, the invention is related to an article of manufacture comprising a compound of any one of the above embodiments and variations and packaging materials. In one embodiment, the packaging material comprises a container for housing the compound. In another embodiment, the container comprises a label indicating one or more members of the group consisting of a disease state for which the compound is to be administered, storage information, dosing information and/or instructions regarding how to administer the compound. In another embodiment, the article of manufacture comprises the compound in a multiple dose form.
[0143] In a further aspect, the invention is related to a therapeutic method comprising administering a compound of any one of the above embodiments and variations to a subject.
[0144] In one embodiment, the method comprises contacting ACC with a compound of any one of the above embodiments and variations. In an exemplary embodiment, ACC is a member selected from ACCl and ACC2.
[0145] In yet another embodiment is a method of inhibiting ACC which comprises causing a compound of any one of the above embodiments and variations to be present in a subject in order to inhibit ACC in vivo. In an exemplary embodiment, ACC is a member selected from ACCl and ACC2.
[0146] A further embodiment is a method of inhibiting ACC which comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations. In an exemplary embodiment, ACC is a member selected from ACCl and ACC2.
[0147] Another further embodiment is a method of treating a disease state for which
ACC possesses activity contributes to the pathology and/or symptomology of the disease state. In one variation, the method comprises causing a compound of any one of the above embodiments and variations to be present in a subject in a therapeutically effective amount for the disease state. In another variation, the method comprises administering a compound of any one of the above embodiments and variations to a subject, wherein the compound is present in the subject in a therapeutically effective amount for the disease state. In a further variation, the method comprises administering a first compound to a subject that is converted in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of the above embodiments and variations.
[0148] In one variation of the above embodiments and variations, the disease state is selected from the group consisting of metabolic syndrome (also known as insulin resistance syndrome, syndrome X), visceral obesity, hyperlipidemia, dyslipidemia, hyperglycemia, hypertension, hyperuricemia renal dysfunction, atherosclerosis, type-2 diabetes, android obesity, Cushing's disease, cognitive function, and ocular function. [0149] In a further embodiment of the method of the invention, the ACC is an ACC 1. In another variation of the method, the ACC is an ACC2. [0150] Another aspect of the invention is directed to methods of preparing the inhibitors of the invention. In one embodiment, the method comprising: coupling a compound of the formula
Figure imgf000052_0001
to a compound of the formula R1S(O)2Cl, under conditions that form a reaction product of the formula
Figure imgf000052_0002
wherein n is 4;
R is selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C[.[o)alkoxy, (C_,.i2)aryloxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.κ))alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].]o)alkyl, ImIo(C1. ιO)alkyl, hydroxy(Ci-l0)alkyl, carbonyl(C].io)alkyl, thiocarbonyl(CM0)alkyl, sulfonyI(C1.l0)alkyl, sulfinyl(C|.ιo)alkyI, aza(C,.[0)alkyl, (Ci.io)oxaalkyl, (CM0)oxoalkyl, imino(CM0)alkyl, (C3-i2)cycloalkyl(C1 -5)alkyl, hetero(C3.]2)cycloalkyl(C|.to)alkyl, aryl(Cι-10)alkyl, hetero(C]-10)aryl(Cι.5)alkyI, (C9-i2)bicycloaryl(C].5)aIkyl, hetero(C8-]2)bicycloaryl(C|-5)alkyl, hetero(C].io)alkyl, (C3.i2)cycloalkyl, hetero(C3-i2)cycloalkyl, (C9-12)bicycloalkyl, hetero(C3.|2)bicycloalkyl, (C4.[2>aryl, hetero(Ci.]0)aryl,
Figure imgf000052_0003
each substituted or unsubstituted,
R1 is selected from the group consisting of oxy, (C].]0)alkoxy, (C4.i2)aryloxy, hetero(C[.|o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C ].]0)alkyl amino, imino, (CMo)alkyl, halo(C|.ιo)aIkyl, hydroxy(C].]0)alkyl, carbonyl(Cj.]o)alkyl, thiocarbonyl(C]-]o)alkyl, sulfonyl(Ci.io)alkyl, suIfinyl(C|.ιo)alkyl, aza(CM0)alkyl, (Cι.io)oxaalkyl, CC|.|0)oxoalkyl, imino(Ci.io)aIkyl, (C3.i2)cycloalkyl(Ci,5)alkyl, heteroCCs.^JcycloalkylfCMoJalkyl, aryI(C].io)aIkyl, hetero(C].]o)aryl(C].s)alkyl, CC9-l2)bicycloaryl(C|.5)alkyl, hetero(C8-!2)bicycloaryl(C]-5)alkyl, hetero(CM0)alkyI, (C3.i2)cycloalkyl( hetero(C3.i2)cycloalkyl, (C9-] 2)bicycloalkyl, hetero(C3.,2)bicycloalkyl, (C4-i2)aryl, hetero(C|.ιo)aryl, (C9.|3)bicycloaryl, and hetero(C4-i2)bicycloaryl, each substituted or unsubstituted; and
R2 is substituted or unsubstituted alkyl.
[0151] In some variation of the above method of preparation, R1 is selected from the group consisting of methyl, isobutyl, -(CH3)SC(O)OCH2CH3, -(CH2)2C(O)N(CH2CH3)2, (CH2J2CF3,
Figure imgf000053_0001
Figure imgf000054_0001
[0152] In some other variations, R2 is ethyl.
Salts, Hydrates, and Prodrugs of ACC Inhibitors
[0153] It should be recognized that the compounds of the present invention may be present and optionally administered in the form of salts, hydrates and prodrugs that are converted in vivo into the compounds of the present invention. For example, it is within the scope of the present invention to convert the compounds of the present invention into and use them in the form of their pharmaceutically acceptable salts derived from various organic and inorganic acids and bases in accordance with procedures well known in the art.
[0154] When the compounds of the present invention possess a free base form, the compounds can be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid, e.g., hydrohalides such as hydrochloride, hydrobromide, hydroiodide; other mineral acids and their corresponding salts such as sulfate, nitrate, phosphate, etc.; and alkyl and monoarylsulfonates such as ethanesulfonate, tolυenesulfonate and benzenesulfonate; and other organic acids and their corresponding salts such as acetate, tartrate, maleate, succinate, citrate, benzoate, salicylate and ascorbate. Further acid addition salts of the present invention include, but are not limited to: adipate, alginate, arginate, aspartate, bisulfate, bisulfite, bromide, butyrate, camphorate, camphorsulfonate, caprylate, chloride, chlorobenzoate, cyclopentanepropionate, digluconate, dihydrogenphosphate, dinitrobenzoate, dodecylsulfate, fumarate, galacterate (from mucic acid), galacturonate, glucoheptonate, gluconate, glutamate, glycerophosphate, hemisuccinate, hemisulfate, heptanoate, hexanoate, hippurate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, iodide, isethionate, iso-butyrate, lactate, lactobionate, malate, malonate, mandelate, metaphosphate, methanesulfonate, methylbenzoate, monohydrogenphosphate, 2-naphthalenesuIfonate, nicotinate, nitrate, oxalate, oleate, pamoate, pectinate, persulfate, phenylacetate, 3-phenylpropionate, phosphate, phosphonate and phthalate. It should be recognized that the free base forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free base forms for the purposes of the present invention.
[0155] When the compounds of the present invention possess a free acid form, a pharmaceutically acceptable base addition salt can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. Examples of such bases are alkali metal hydroxides including potassium, sodium and lithium hydroxides; alkaline earth metal hydroxides such as barium and calcium hydroxides; alkali metal alkoxides, e.g., potassium ethanolate and sodium propanolate; and various organic bases such as ammonium hydroxide, piperidine, diethanolamine and /V-methylglutamine. Also included are the aluminum salts of the compounds of the present invention. Further base salts of the present invention include, but are not limited to: copper, ferric, ferrous, lithium, magnesium, manganic, manganous, potassium, sodium and zinc salts. Organic base salts include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, e.g., arginine, betaine, caffeine, chloroprocaine, choline, Λf.ΛT-dibenzylethylenediamine (benzathine), dicyclohexylamine, diethanolamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, W-ethylmorphoIine, yV-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, iso-propylamine, lidocaine, lysine, meglumine, Λf-methyl-D- glucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethanolamine, triethylamine, trimethyl amine, tripropylamine and tris- (hydroxymethyl)-methylamine (tromethamine). It should be recognized that the free acid forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid forms for the purposes of the present invention. [0156] Compounds of the present invention that comprise basic nitrogen containing groups may be quaternized with such agents as (Ci-4) alkyl halides, e.g., methyl, ethyl, iso- propyl and tert-butyl chlorides, bromides and iodides; di (C1-4) alkyl sulfates, e.g., dimethyl, diethyl and diamyl sulfates; (Cio-is) alkyl halides, e.g., decyl, dodecyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; and aryl (Ci-4) alkyl halides, e.g., benzyl chloride and phenethy] bromide. Such salts permit the preparation of both water- soluble and oil-soluble compounds of the present invention.
[0157] ΛΛoxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art. For example, N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent {e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent {e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0 0C. Alternatively, the Λf-oxides of the compounds can be prepared from the iV-oxide of an appropriate starting material.
[0158] Prodrug derivatives of compounds according to the present invention can be prepared by modifying substituents of compounds of the present invention that are then converted in vivo to a different substituent. It is noted that in many instances, the prodrugs themselves also fall within the scope of the range of compounds according to the present invention. For example, prodrugs can be prepared by reacting a compound with a carbamylating agent {e.g., U-acyloxyalkylcarbonochloridate, para-nitrophenyl carbonate, or the like) or an acylating agent. Further examples of methods of making prodrugs are described in Saulnier et «/.(1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985.
[0159] Protected derivatives of compounds of the present invention can also be made. Examples of techniques applicable to the creation of protecting groups and their removal can be found in P.G.M. Wuts and T.W. Greene in "Greene's Protective Groups in Organic Synthesis" 4th edition, John Wiley and Sons, 2007. [0160] Compounds of the present invention may also be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.
[0161] A "pharmaceutically acceptable salt", as used herein, is intended to encompass any compound according to the present invention that is utilized in the form of a salt thereof, especially where the salt confers on the compound improved pharmacokinetic properties as compared to the free form of compound or a different salt form of the compound. The pharmaceutically acceptable salt form may also initially confer desirable pharmacokinetic properties on the compound that it did not previously possess, and may even positively affect the pharmacodynamics of the compound with respect to its therapeutic activity in the body. An example of a pharmacokinetic property that may be favorably affected is the manner in which the compound is transported across cell membranes, which in turn may directly and positively affect the absorption, distribution, biotransformation and excretion of the compound. While the route of administration of the pharmaceutical composition is important, and various anatomical, physiological and pathological factors can critically affect bioavailability, the solubility of the compound is usually dependent upon the character of the particular salt form thereof, which it utilized. One of skill in the art will appreciate that an aqueous solution of the compound will provide the most rapid absorption of the compound into the body of a subject being treated, while lipid solutions and suspensions, as well as solid dosage forms, will result in less rapid absorption of the compound.
Uses for the Compounds of the Invention
[0162] Compounds of the invention are ACC inhibitors useful in the treatment, control and/or prevention of metabolic diseases and conditions that are mediated by abnormal fatty acid metabolism. These diseases and conditions include obesity, an overweight condition, hypertriglyceridemia, hyperlipidemia, hypoalphalipoproteinemia, metabolic syndrome, diabetes mellitus (especially Type II), hyperinsulinemia, impaired glucose tolerance, insulin resistance, diabetic complication, atherosclerosis, hypertension, coronary heart disease, hypercholesterolemia, stroke, polycystic ovary disease, cerebrovascular disease and congestive heart failure. In particularly, metabolic syndrome, atherosclerosis, and non-insulin dependent diabetes mellitus (NIDDM).
[0163] Metabolic syndrome (also known as insulin resistance syndrome, syndrome X) is a common clinical disorder that is defined as the presence of increased insulin concentrations in association with other disorders including visceral obesity, hyperlipidemia and dyslipidemia, hyperglycemia, hypertension, and sometimes hyperuricemia and renal dysfunction. Recent studies have suggested that abnormal fatty acid metabolism may be at the core of metabolic syndrome. It is now well established that the development of insulin resistance and type 2 diabetics are tightly associated with excess intramyocellular triacylglyceride (TAG) in nonadipose tissues such as in skeletal muscle, liver and pancreas. Krissak et al., Diabetologia 1999, 42: 113-6; Hulver, M. W. et al., Am J Physiol Endocrinol Metab 2003; 2S4:E741-7; Sinha R. et al., Diabetes 2002; 51: 1022-7. The precise mechanism of how increased intracellular lipid content exacerbates whole body insulin sensitivity is unclear at present but it has been postulated that increased long chain fatty acyl-CoAs, ceramide or diacylglycerol, whose contents are proportional to the accumulation of intramyocellular triglyceride, antagonizes metabolic actions of insulin, reduces muscle glucose uptake and inhibits hepatic glucose production. Sinha R. et al., Diabetes 2002; 57:1022-7; Friedman J. Nature 2002; 4/5:268-9). As muscle is the primary site of metabolic action of insulin, the development of muscle insulin resistance along with liver insulin resistance are thus inherently linked to the development of whole body insulin resistance.
[0164] Inhibiting the activity of acetyl CoA carboxylase (ACC) would reduce the production of malonyl-CoA from acetyl-CoA. Malonyl-CoA plays an important role in the overall fatty acid metabolism: malonyl-CoA is an intermediate utilized by fatty acid synthase for de novo lipogenesis, and it also acts as a potent allosteric inhibitor of carnitine palmitoyltransferase 1 (CPTl), a mitochondrial membrane protein that shuttles long chain fatty acyl CoAs into the mitochondria for β-oxidization. Ruderman N. and Prentki M. Nat Rev Drug Discov 2004; 3: 340-51. A small molecule inhibitor of ACC would thus limit de novo lipid synthesis and increase muscle and liver fat oxidation; thus reduce the accumulation of long chain fatty acids.
[0165] The compounds of the invention are also useful for the prophylaxis or treatment of atherosclerosis, a disease of the arteries. The pathological sequence leading to atherosclerosis and occlusive heart disease is well known. The earliest stage in this sequence is the formation of "fatty streaks" in the carotid, coronary and cerebral arteries and in the aorta. These lesions are yellow in color due to the presence of lipid deposits found principally within smooth-muscle cells and in macrophages of the intima layer of the arteries and aorta. Further, it is postulated that most of the cholesterol found within the fatty streaks, in turn, gives rise to development of the "fibrous plaque," which consists of accumulated intimal smooth muscle cells laden with lipid and surrounded by extra-cellular lipid, collagen, elastin and proteoglycans. These cells plus matrix form a fibrous cap that covers a deeper deposit of cell debris and more extracellular lipid. The lipid is primarily free and esterified cholesterol. The fibrous plaque forms slowly, and is likely in time to become calcified and necrotic, advancing to the "complicated lesion," which accounts for the arterial occlusion and tendency toward mural thrombosis and arterial muscle spasm that characterize advanced atherosclerosis. The ACC inhibitors reduce the formation of the fatty streaks and lower the chance of atherosclerosis.
Combination Therapy
[0166] The ACC inhibitors according to the present invention may have a therapeutic additive or synergistic effect with a wide variety of therapeutic agents. Combination therapies that comprise one or more compounds of the present invention with one or more other therapeutic agents can be used, for example, to: 1) enhance the therapeutic effect(s) of the one or more compounds of the present invention and/or the one or more other therapeutic agents; 2) reduce the side effects exhibited by the one or more compounds of the present invention and/or the one or more other therapeutic agents; and/or 3) reduce the effective dose of the one or more compounds of the present invention and/or the one or more other therapeutic agents. It is noted that combination therapy is intended to cover when agents are administered before or after each other (sequential therapy) as well as when the agents are administered at the same time.
[0167] Examples of such therapeutic agents that may be used in combination with ACC inhibitors include, but are not limited to, antiatherosclerosis agents, a diabetes treating agents, obesity treating agents, and cardiovascular agents.
[0168] Antiatherosclerosis agents being contemplated for combination therapy with the compounds of the invention include, but are not limited to, lipase inhibitors, HMG-CoA reductase inhibitors, HMG-CoA synthase inhibitors, HMG-CoA reductases, gene expression inhibitors, HMG-CoA synthase gene expression inhibitors, microsomal triglyceride transfer protein (MTP)/ Apo B secretion inhibitors, cholesterol ester transfer protein (CETP) inhibitors, bile acid absorption inhibitors, cholesterol absorption inhibitors, cholesterol synthesis inhibitors, squalene synthetase inhibitors, squalene epoxidase inhibitors, squalene cyclase inhibitors, combined squalene epoxidase/squalene cyclase inhibitors, fibrates, niacin, PPAR agonists, ion-exchange resins, antioxidants, acyl- CoA: cholesterol acyl transferase (ACAT) inhibitors, bile acid sequestrants, antiplatelet agents, antithrombotic agents or estrogen receptor modulators. HMG-CoA reductases and CETP inhibitors are preferred antiatherosclerosis agents for use with the compounds of the invention. Examples of HMG-CoA reductase inhibitor which may be used with the compounds of the invention include lovastatin, rosuvastatin, itavastatin, simvastatin, pravastatin, fluvastatin, atorvastatin (and its hemicalcium salt) or rivastatin. [0169] Diabetes treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, aldose reductase inhibitors, glucocorticoid receptor antagonists, glycogenolysis inhibitors, glycogen phosphorylase inhibitors, sorbitol dehydrogenase inhibitors, insulin, insulin analogs, insulinotropin, sulfonylureas, sulfonylureas analogs, biguanides, imidazolines, insulin secretagogues, linogliride, glitazones, glucosidase inhibitors, acarbose, miglitol, emiglitate, voglibose, camiglibose, β-agonists, phosphodiesterase inhibitors (e.g., PDE5 or PDEl 1), vanadate, vanadium complexes (e.g. Naglivan®), peroxovanadium complexes, amylin antagonists, amylase inhibitors, glucagon antagonists, gluconeogenesis inhibitors, somatostatin analogs, antilipolytic agents, nicotinic acid, acipimox, pramlintide (Symlin™), nateglinide, activators of AMP-activated protein kinase, PPARδ agonists, duel PPARα or/PPAR-δ agonists, protein kinase C-B inhibitors, PTPlB inhibitors, glycogen synthase kinase-3 inhibitors, GLP-I agonists or soluble guanylate cyclase (sGc) activators. Specific diabetes treating agents include, but are not limited to, chlorpropamide, glibenclamide, tolbutamide, tolazamide, acetohexamide, Glypizide®, glimepiride, repaglinide, meglitinide, metformin, phenformin, buformin, midaglizole, isaglidole, deriglidole, idazoxan, efaroxan, fluparoxan, ciglitazone, pioglitazone, englitazone, darglitazone, clomoxir or etomoxir.
[0170] Obesity treating agent being contemplated for combination therapy with the compounds of the invention include, but are not limited to, phenylpropanolamine, ephedrine, pseudoephedrine, phentermine, a neuropeptide Y antagonist, a β-adrenergic receptor agonist, a cholecystokinin-A agonist, a monoamine reuptake inhibitor, a sympathomimetic agent, a serotonin modulator, a dopamine agonist, a melanocortin receptor modulator, a cannabinoid receptor antagonist, a melanin concentrating hormone antagonist, leptin, a leptin analog, a leptin receptor agonist, a galanin antagonist, a lipase inhibitor, a phosphatase IB inhibitor, a bombesin agonist, dehydroepiandrosternone or analogs thereof, thyroxine, a thyromimetic agent, dehydroepiandrosterone or an analog thereof, a glucocorticoid receptor modulator, an orexin receptor antagonist, a urocortin binding protein antagonist, a glucagon-like peptide-1 receptor agonist, an eating behavior modifying agent, a ciliary neurotrophic factor, a neurokinin receptor antagonist, a noradrenalin transport modulator or a dopamine transport modulator. Specific examples of obesity treating agents include orlistat, sibutramine or bromocriptine. [0171] Cardiovascular agents being contemplated for combination therapy with the compounds of the invention include, but are not limited to, calcium channel blockers, angiotensin converting enzyme (ACE) inhibitors or diuretics.
Compositions Comprising ACC Inhibitors
[0172] A wide variety of compositions and administration methods may be used in conjunction with the compounds of the present invention. Such compositions may include, in addition to the compounds of the present invention, conventional pharmaceutical excipients, and other conventional, pharmaceutically inactive agents. Additionally, the compositions may include active agents in addition to the compounds of the present invention. These additional active agents may include additional compounds according to the invention, and/or one or more other pharmaceutically active agents. [0173] The compositions may be in gaseous, liquid, semi-liquid or solid form, formulated in a manner suitable for the route of administration to be used. For oral administration, capsules and tablets are typically used. For parenteral administration, reconstitution of a lyophilized powder, prepared as described herein, is typically used. [0174] Compositions comprising compounds of the present invention may be administered or coadministered orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneously, intraadiposally, intraarticular^, or intrathecally. The compounds and/or compositions according to the invention may also be administered or coadministered in slow release dosage forms. [0175] The ACC inhibitors and compositions comprising them may be administered or coadministered in any conventional dosage form. Co-administration in the context of this invention is intended to mean the administration of more than one therapeutic agent, one of which includes an ACC inhibitor, in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time.
[0176] Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application may optionally include one or more of the following components; a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; agents for the adjustment of tonicity such as sodium chloride or dextrose, and agents for adjusting the acidity or alkalinity of the composition, such as alkaline or acidifying agents or buffers like carbonates, bicarbonates, phosphates, hydrochloric acid, and organic acids like acetic and citric acid. Parenteral preparations may optionally be enclosed in ampules, disposable syringes or single or multiple dose vials made of glass, plastic or other suitable material.
[0177] When compounds according to the present invention exhibit insufficient solubility, methods for solubilizing the compounds may be used. Such methods are known to those of skill in this art, and include, but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants, such as TWEEN, or dissolution in aqueous sodium bicarbonate. Derivatives of the compounds, such as prodrugs of the compounds may also be used in formulating effective pharmaceutical compositions. [0178] Upon mixing or adding compounds according to the present invention to a composition, a solution, suspension, emulsion or the like may be formed. The form of the resulting composition will depend upon a number of factors, including the intended mode of administration, and the solubility of the compound in the selected carrier or vehicle. The effective concentration needed to ameliorate the disease being treated may be empirically determined.
[0179] Compositions according to the present invention are optionally provided for administration to humans and animals in unit dosage forms, such as tablets, capsules, pills, powders, dry powders for inhalers, granules, sterile parenteral solutions or suspensions, and oral solutions or suspensions, and oil-water emulsions containing suitable quantities of the compounds, particularly the pharmaceutically acceptable salts, preferably the sodium salts, thereof. The pharmaceutically therapeutically active compounds and derivatives thereof are typically formulated and administered in unit-dosage forms or multiple-dosage forms. Unit-dose forms, as used herein, refers to physically discrete units suitable for human and animal subjects and packaged individually as is known in the art. Each unit- dose contains a predetermined quantity of the therapeutically active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle or diluent. Examples of unit-dose forms include ampoules and syringes individually packaged tablet or capsule. Unit-dose forms may be administered in fractions or multiples thereof. A multiple-dose form is a plurality of identical unit-dosage forms packaged in a single container to be administered in segregated unit-dose form. Examples of multiple-dose forms include vials, bottles of tablets or capsules or bottles of pint or gallons. Hence, multiple dose form is a multiple of unit-doses that are not segregated in packaging.
[0180] In addition to one or more compounds according to the present invention, the composition may comprise: a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; a lubricant, such as magnesium stearate, calcium stearate and talc; and a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polyvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to those of skill in the art. Liquid pharmaceutically administrable compositions can, for example, be prepared by dissolving, dispersing, or otherwise mixing an active compound as defined above and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, glycerol, glycols, ethanol, and the like, to form a solution or suspension. If desired, the pharmaceutical composition to be administered may also contain minor amounts of auxiliary substances such as wetting agents, emulsifying agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents. Actual methods of preparing such dosage forms are known in the art, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practices of Pharmacy, Lippincott Williams, and Wilkins Publisher, 21st edition, 2005. The composition or formulation to be administered will, in any event, contain a sufficient quantity of an inhibitor of the present invention to reduce ACC activity in vivo, thereby treating the disease state of the subject. [0181] Dosage forms or compositions may optionally comprise one or more compounds according to the present invention in the range of 0.005% to 100% (weight/weight) with the balance comprising additional substances such as those described herein. For oral administration, a pharmaceutically acceptable composition may optionally comprise any one or more commonly employed excipients, such as, for example pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives, sodium crosscarmellose, glucose, sucrose, magnesium carbonate, sodium saccharin, talcum. Such compositions include solutions, suspensions, tablets, capsules, powders, dry powders for inhalers and sustained release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. Methods for preparing these formulations are known to those skilled in the art. The compositions may optionally contain 0.01%- 100% (weight/weight) of one or more ACC inhibitors, optionally 0.1-95%, and optionally 1-95%.
[0182] Salts, preferably sodium salts, of the inhibitors may be prepared with carriers that protect the compound against rapid elimination from the body, such as time release formulations or coatings. The formulations may further include other active compounds to obtain desired combinations of properties.
A. Formulations for Oral Administration
[0183] Oral pharmaceutical dosage forms may be as a solid, gel or liquid. Examples of solid dosage forms include, but are not limited to tablets, capsules, granules, and bulk powders. More specific examples of oral tablets include compressed, chewable lozenges and tablets that may be enteric -coated, sugar-coated or film-coated. Examples of capsules include hard or soft gelatin capsules. Granules and powders may be provided in non- effervescent or effervescent forms. Each may be combined with other ingredients known to those skilled in the art.
[0184] In certain embodiments, compounds according to the present invention are provided as solid dosage forms, preferably capsules or tablets. The tablets, pills, capsules, troches and the like may optionally contain one or more of the following ingredients, or compounds of a similar nature: a binder; a diluent; a disintegrating agent; a lubricant; a glidant; a sweetening agent; and a flavoring agent.
[0185] Examples of binders that may be used include, but are not limited to, microcrystalline cellulose, gum tragacanth, glucose solution, acacia mucilage, gelatin solution, sucrose and starch paste.
[0186] Examples of lubricants that may be used include, but are not limited to, talc, starch, magnesium or calcium stearate, lycopodium and stearic acid.
[0187] Examples of diluents that may be used include, but are not limited to, lactose, sucrose, starch, kaolin, salt, mannitol and dicalcium phosphate.
[0188] Examples of glidants that may be used include, but are not limited to, colloidal silicon dioxide.
[0189] Examples of disintegrating agents that may be used include, but are not limited to, crosscarmellose sodium, sodium starch glycolate, alginic acid, corn starch, potato starch, bentonite, methylcellulose, agar and carboxymethylcellulose.
[0190] Examples of coloring agents that may be used include, but are not limited to, any of the approved certified water-soluble FD and C dyes, mixtures thereof; and water insoluble FD and C dyes suspended on alumina hydrate.
[0191] Examples of sweetening agents that may be used include, but are not limited to, sucrose, lactose, mannitol and artificial sweetening agents such as sodium cyclamate and saccharin, and any number of spray-dried flavors.
[0192] Examples of flavoring agents that may be used include, but are not limited to, natural flavors extracted from plants such as fruits and synthetic blends of compounds that produce a pleasant sensation, such as, but not limited to peppermint and methyl salicylate.
[0193] Examples of wetting agents that may be used include, but are not limited to, propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.
[0194] Examples of anti-emetic coatings that may be used include, but are not limited to, fatty acids, fats, waxes, shellac, ammoniated shellac and cellulose acetate phthalates.
[0195] Examples of film coatings that may be used include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000 and cellulose acetate phthalate.
[0196] If oral administration is desired, the salt of the compound may optionally be provided in a composition that protects it from the acidic environment of the stomach. For example, the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine. The composition may also be formulated in combination with an antacid or other such ingredient.
[0197] When the dosage unit form is a capsule, it may optionally additionally comprise a liquid carrier such as a fatty oil. In addition, dosage unit forms may optionally additionally comprise various other materials that modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents.
[0198] Compounds according to the present invention may also be administered as a component of an elixir, suspension, syrup, wafer, sprinkle, chewing gum or the like. A syrup may optionally comprise, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors. [0199] The compounds of the present invention may also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as antacids, H2 blockers, and diuretics. For example, if a compound is used for treating asthma or hypertension, it may be used with other bronchodilators and antihypertensive agents, respectively.
[0200] Examples of pharmaceutically acceptable carriers that may be included in tablets comprising compounds of the present invention include, but are not limited to binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, and wetting agents. Enteric-coated tablets, because of the enteric-coating, resist the action of stomach acid and dissolve or disintegrate in the neutral or alkaline intestines. Sugar- coated tablets may be compressed tablets to which different layers of pharmaceutically acceptable substances are applied. Film-coated tablets may be compressed tablets that have been coated with polymers or other suitable coating. Multiple compressed tablets may be compressed tablets made by more than one compression cycle utilizing the pharmaceutically acceptable substances previously mentioned. Coloring agents may also be used in tablets. Flavoring and sweetening agents may be used in tablets, and are especially useful in the formation of chewable tablets and lozenges. [0201] Examples of liquid oral dosage forms that may be used include, but are not limited to, aqueous solutions, emulsions, suspensions, solutions and/or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules. [0202] Examples of aqueous solutions that may be used include, but are not limited to, elixirs and syrups. As used herein, elixirs refer to clear, sweetened, hydroalcoholic preparations. Examples of pharmaceutically acceptable carriers that may be used in elixirs include, but are not limited to solvents. Particular examples of solvents that may be used include glycerin, sorbitol, ethyl alcohol and syrup. As used herein, syrups refer to concentrated aqueous solutions of a sugar, for example, sucrose. Syrups may optionally further comprise a preservative.
[0203] Emulsions refer to two-phase systems in which one liquid is dispersed in the form of small globules throughout another liquid. Emulsions may optionally be oil-in- water or water-in-oil emulsions. Examples of pharmaceutically acceptable carriers that may be used in emulsions include, but are not limited to non-aqueous liquids, emulsifying agents and preservatives.
[0204] Examples of pharmaceutically acceptable substances that may be used in non- effervescent granules, to be reconstituted into a liquid oral dosage form, include diluents, sweeteners and wetting agents.
[0205] Examples of pharmaceutically acceptable substances that may be used in effervescent granules, to be reconstituted into a liquid oral dosage form, include organic acids and a source of carbon dioxide.
[0206] Coloring and flavoring agents may optionally be used in all of the above dosage forms.
[0207] Particular examples of preservatives that may be used include glycerin, methyl and propylparaben, benzoic add, sodium benεoate and alcohol. [0208] Particular examples of non-aqueous liquids that may be used in emulsions include mineral oil and cottonseed oil.
[0209] Particular examples of emulsifying agents that may be used include gelatin, acacia, tragacanth, bentonite, and surfactants such as polyoxyethylene sorbitan monooleate.
[0210] Particular examples of suspending agents that may be used include sodium carboxymethylcellulose, pectin, tragacanth, Veegum and acacia. Diluents include lactose and sucrose. Sweetening agents include sucrose, syrups, glycerin and artificial sweetening agents such as sodium cyclamate and saccharin. [0211] Particular examples of wetting agents that may be used include propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.
[0212] Particular examples of organic acids that may be used include citric and tartaric acid.
[0213] Sources of carbon dioxide that may be used in effervescent compositions include sodium bicarbonate and sodium carbonate. Coloring agents include any of the approved certified water soluble FD and C dyes, and mixtures thereof.
[0214] Particular examples of flavoring agents that may be used include natural flavors extracted from plants such fruits, and synthetic blends of compounds that produce a pleasant taste sensation.
[0215] For a solid dosage form, the solution or suspension, in for example propylene carbonate, vegetable oils or triglycerides, is preferably encapsulated in a gelatin capsule.
Such solutions, and the preparation and encapsulation thereof, are disclosed in U.S. Pat.
Nos. 4,328,245; 4,409,239; and 4,410,545. For a liquid dosage form, the solution, e.g., for example, in a polyethylene glycol, may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid carrier, e.g., water, to be easily measured for administration.
[0216] Alternatively, liquid or semi-solid oral formulations may be prepared by dissolving or dispersing the active compound or salt in vegetable oils, glycols, triglycerides, propylene glycol esters (e.g., propylene carbonate) and other such carriers, and encapsulating these solutions or suspensions in hard or soft gelatin capsule shells.
Other useful formulations include those set forth in U.S. Pat. Nos. Re 28,819 and
4,358,603.
B. Iπjectables, Solutions, and Emulsions
[0217] The present invention is also directed to compositions designed to administer the compounds of the present invention by parenteral administration, generally characterized by subcutaneous, intramuscular or intravenous injection. Injectables may be prepared in any conventional form, for example as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. [0218] Examples of excipients that may be used in conjunction with injectables according to the present invention include, but are not limited to water, saline, dextrose, glycerol or ethanol. The injectable compositions may also optionally comprise minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, stabilizers, solubility enhancers, and other such agents, such as for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate and cyclodextrins. Implantation of a slow-release or sustained-release system, such that a constant level of dosage is maintained (see, e.g., U.S. Pat. No. 3,710,795) is also contemplated herein. The percentage of active compound contained in such parenteral compositions is highly dependent on the specific nature thereof, as well as the activity of the compound and the needs of the subject.
[0219] Parenteral administration of the formulations includes intravenous, subcutaneous and intramuscular administrations. Preparations for parenteral administration include sterile solutions ready for injection, sterile dry soluble products, such as the lyophilized powders described herein, ready to be combined with a solvent just prior to use, including hypodermic tablets, sterile suspensions ready for injection, sterile dry insoluble products ready to be combined with a vehicle just prior to use and sterile emulsions. The solutions may be either aqueous or nonaqueous.
[0220] When administered intravenously, examples of suitable carriers include, but are not limited to physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
[0221] Examples of pharmaceutically acceptable carriers that may optionally be used in parenteral preparations include, but are not limited to aqueous vehicles, nonaqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, sequestering or chelating agents and other pharmaceutically acceptable substances.
[0222] Examples of aqueous vehicles that may optionally be used include Sodium Chloride Injection, Ringers Injection, Isotonic Dextrose Injection, Sterile Water Injection, Dextrose and Lactated Ringers Injection.
[0223] Examples of nonaqueous parenteral vehicles that may optionally be used include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil and peanut oil. [0224] Antimicrobial agents in bacteriostatic or fungistatic concentrations may be added to parenteral preparations, particularly when the preparations are packaged in multiple-dose containers and thus designed to be stored and multiple aliquots to be removed. Examples of antimicrobial agents that may be used include phenols or cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl /?-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethoπium chloride. [0225] Examples of isotonic agents that may be used include sodium chloride and dextrose. Examples of buffers that may be used include phosphate and citrate. Examples of antioxidants that may be used include sodium bisulfate. Examples of local anesthetics that may be used include procaine hydrochloride. Examples of suspending and dispersing agents that may be used include sodium carboxymethylcellulose, hydroxypropyl methylcellulose and polyvinylpyrrolidone. Examples of emulsifying agents that may be used include Polysorbate 80 (TWEEN 80). A sequestering or chelating agent of metal ions includes EDTA.
[0226] Pharmaceutical carriers may also optionally include ethyl alcohol, polyethylene glycol and propylene glycol for water miscible vehicles and sodium hydroxide, hydrochloric acid, citric acid or lactic acid for pH adjustment.
[0227] The concentration of an inhibitor in the parenteral formulation may be adjusted so that an injection administers a pharmaceutically effective amount sufficient to produce the desired pharmacological effect. The exact concentration of an inhibitor and/or dosage to be used will ultimately depend on the age, weight and condition of the patient or animal as is known in the art.
[0228] Unit-dose parenteral preparations may be packaged in an ampoule, a vial or a syringe with a needle. All preparations for parenteral administration should be sterile, as is known and practiced in the art.
[0229] Injectables may be designed for local and systemic administration. Typically a therapeutically effective dosage is formulated to contain a concentration of at least about 0.1% w/w up to about 90% w/w or more, preferably more than 1% w/w of the ACC inhibitor to the treated tissue(s). The inhibitor may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment will be a function of the location of where the composition is parenterally administered, the carrier and other variables that may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the age of the individual treated. It is to be further understood that for any particular subject, specific dosage regimens may need to be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the formulations. Hence, the concentration ranges set forth herein are intended to be exemplary and are not intended to limit the scope or practice of the claimed formulations.
[0230] The ACC inhibitor may optionally be suspended in micronized or other suitable form or may be derivatized to produce a more soluble active product or to produce a prodrug. The form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. The effective concentration is sufficient for ameliorating the symptoms of the disease state and may be empirically determined,
C. Lyophilized Powders
[0231] The compounds of the present invention may also be prepared as lyophilized powders, which can be reconstituted for administration as solutions, emulsions and other mixtures. The lyophilized powders may also be formulated as solids or gels. [0232] Sterile, lyophilized powder may be prepared by dissolving the compound in a sodium phosphate buffer solution containing dextrose or other suitable excipient. Subsequent sterile filtration of the solution followed by lyophilization under standard conditions known to those of skill in the art provides the desired formulation. Briefly, the lyophilized powder may optionally be prepared by dissolving dextrose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose or other suitable agent, about 1-20%, preferably about 5 to 15%, in a suitable buffer, such as citrate, sodium or potassium phosphate or other such buffer known to those of skill in the art at, typically, about neutral pH. Then, a ACC inhibitor is added to the resulting mixture, preferably above room temperature, more preferably at about 30-35 0C, and stirred until it dissolves. The resulting mixture is diluted by adding more buffer to a desired concentration. The resulting mixture is sterile filtered or treated to remove particulates and to insure sterility, and apportioned into vials for lyophilization. Each vial may contain a single dosage or multiple dosages of the inhibitor.
D. Formulation for Topical Administration
[0233] The compounds of the present invention may also be administered as topical mixtures. Topical mixtures may be used for local and systemic administration. The resulting mixture may be a solution, suspension, emulsions or the like and are formulated as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures, pastes, foams, aerosols, irrigations, sprays, suppositories, bandages, dermal patches or any other formulations suitable for topical administration.
[0234] The ACC inhibitors may be formulated as aerosols for topical application, such as by inhalation (see, U.S. Pat. Nos. 4,044,126, 4,414,209, and 4,364,923, which describe aerosols for delivery of a steroid useful for treatment of inflammatory diseases, particularly asthma). These formulations for administration to the respiratory tract can be in the form of an aerosol or solution for a nebulizer, or as a microfine powder for insufflation, alone or in combination with an inert carrier such as lactose. In such a case, the particles of the formulation will typically have diameters of less than 50 microns, preferably less than 10 microns.
[0235] The inhibitors may also be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application. Topical administration is contemplated for transdermal delivery and also for administration to the eyes or mucosa, or for inhalation therapies. Nasal solutions of the ACC inhibitor alone or in combination with other pharmaceutically acceptable excipients can also be administered.
E. Formulations for Other Routes of Administration
[0236] Depending upon the disease state being treated, other routes of administration, such as topical application, transdermal patches, and rectal administration, may also be used. For example, pharmaceutical dosage forms for rectal administration are rectal suppositories, capsules and tablets for systemic effect. Rectal suppositories are used herein mean solid bodies for insertion into the rectum that melt or soften at body temperature releasing one or more pharmacologically or therapeutically active ingredients. Pharmaceutically acceptable substances utilized in rectal suppositories are bases or vehicles and agents to raise the melting point. Examples of bases include cocoa butter (theobroma oil), glycerin-gelatin, carbowax, (polyoxyethylene glycol) and appropriate mixtures of mono-, di- and triglycerides of fatty acids. Combinations of the various bases may be used. Agents to raise the melting point of suppositories include spermaceti and wax. Rectal suppositories may be prepared either by the compressed method or by molding. The typical weight of a rectal suppository is about 2 to 3 gm. Tablets and capsules for rectal administration may be manufactured using the same pharmaceutically acceptable substance and by the same methods as for formulations for oral administration.
F. Examples of Formulations
[0237] The following are particular examples of oral, intravenous and tablet formulations that may optionally be used with compounds of the present invention. It is noted that these formulations may be varied depending on the particular compound being used and the indication for which the formulation is going to be used,
ORAL FORMULATION
Compound of the Present Invention 10- 100 mg
Citric Acid Monohydrate 105 mg
Sodium Hydroxide 18 mg
Flavoring
Water q.s. to lOO mL
INTRAVENOUS FORMULATION
Compound of the Present Invention 0.1-10 mg
Dextrose Monohydrate q.s. to make isotonic
Citric Acid Monohydrate 1.05 mg
Sodium Hydroxide 0.18 mg
Water for Injection q.s. to 1.0 mL
TABLET FORMULATION
Compound of the Present Invention 1%
Microcrystalline Cellulose 73%
Stearic Acid 25%
Colloidal Silica 1%.
Dosage. Host and Safety
[0238] The compounds of the present invention are stable and can be used safely. In particular, the compounds of the present invention are useful as ACC inhibitors for a variety of subjects (e.g., humans, non-human, mammals, and non-mammals). [0239] The optimal dose may vary depending upon such conditions as, for example, the type of subject, the body weight of the subject, on the severity of the condition, the route of administration, and specific properties of the particular compound being used. Generally, acceptable and effective daily doses are amounts sufficient to effectively slow or eliminate the condition being treated. Typically, the daily dose for oral administration to an adult (body weight of about 60 kg) is about 1 to 1000 mg, about 3 to 300 mg, or about 10 to 200 mg. It will be appreciated that the daily dose can be given in a single administration or in multiple (e.g., 2 or 3) portions a day.
Kits and Articles of Manufacture Comprising ACC Inhibitors
[0240] The invention is also directed to kits and other articles of manufacture for treating diseases associated with ACC. It is noted that diseases are intended to cover all conditions for which ACC inhibitors possess activity that contributes to the pathology and/or symptomology of the condition.
[0241] In one embodiment, a kit is provided that comprises a composition comprising at least one inhibitor of the present invention in combination with instructions. The instructions may indicate the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also comprise packaging materials. The packaging material may comprise a container for housing the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms. [0242] In another embodiment, an article of manufacture is provided that comprises a composition comprising at least one inhibitor of the present invention in combination with packaging materials. The packaging material may comprise a container for housing the composition. The container may optionally comprise a label indicating the disease state for which the composition is to be administered, storage information, dosing information and/or instructions regarding how to administer the composition. The kit may also optionally comprise additional components, such as syringes for administration of the composition. The kit may comprise the composition in single or multiple dose forms. [0243] It is noted that the packaging material used in kits and articles of manufacture according to the present invention may form a plurality of divided containers such as a divided bottle or a divided foil packet. The container can be in any conventional shape or form as known in the art which is made of a pharmaceutically acceptable material, for example a paper or cardboard box, a glass or plastic bottle or jar, a re-sealable bag (for example, to hold a "refill" of tablets for placement into a different container), or a blister pack with individual doses for pressing out of the pack according to a therapeutic schedule. The container that is employed will depend on the exact dosage form involved, for example a conventional cardboard box would not generally be used to hold a liquid suspension. It is feasible that more than one container can be used together in a single package to market a single dosage form. For example, tablets may be contained in a bottle that is in turn contained within a box. Typically the kit includes directions for the administration of the separate components. The kit form is particularly advantageous when the separate components are preferably administered in different dosage forms (e.g., oral, topical, transdermal and parenteral), are administered at different dosage intervals, or when titration of the individual components of the combination is desired by the prescribing physician.
[0244] One particular example of a kit according to the present invention is a so-called blister pack. Blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process recesses are formed in the plastic foil. The recesses have the size and shape of individual tablets or capsules to be packed or may have the size and shape to accommodate multiple tablets and/or capsules to be packed. Next, the tablets or capsules are placed in the recesses accordingly and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed. As a result, the tablets or capsules are individually sealed or collectively sealed, as desired, in the recesses between the plastic foil and the sheet. Preferably the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess. The tablet or capsule can then be removed via said opening. [0245] Another specific embodiment of a kit is a dispenser designed to dispense the daily doses one at a time in the order of their intended use. Preferably, the dispenser is equipped with a memory-aid, so as to further facilitate compliance with the regimen. An example of such a memory-aid is a mechanical counter that indicates the number of daily doses that has been dispensed. Another example of such a memory-aid is a battery- powered micro-chip memory coupled with a liquid crystal readout, or audible reminder signal which, for example, reads out the date that the last daily dose has been taken and/or reminds one when the next dose is to be taken. Preparation of ACC Inhibitors
Synthetic Schemes for Compounds of the Present Invention
[0246] Various methods may be developed for synthesizing compounds according to the present invention. The following reaction schemes may be used for the preparation of the compounds according to the present invention. Representative methods for synthesizing these compounds are provided in the Examples. It should be appreciated that a variety of different solvents, temperatures and other reaction conditions can be varied to optimize the yields of the reactions. It should also be appreciated that compounds of the present invention may also be synthesized by other synthetic routes that others may devise.
[0247] In the reactions described hereinafter it may be necessary to protect reactive functional groups, for example hydroxy, amino, imino, thio or carboxy groups, where these are desired in the final product, to avoid their unwanted participation in the reactions. Conventional protecting groups may be used in accordance with standard practice, for examples see T.W. Greene and P. G. M. Wuts in "Protective Groups in Organic Chemistry" John Wiley and Sons, 1991.
[0248] A general synthetic route for producing compounds of the present invention is shown in Scheme 1. Coupling of a 2-aminobenzo[b]thiophene-3-carboxylic acid to tert- butyl piperazine-1-carboxylate would afford the tertiary amide, which could then be converted to the urea by treatment with the corresponding alkyl isocyanate in the presence of pyridine. Removal of the ter/-butyl carbamate protecting group with TFA would afford the ammonium trifluoroacetate, which would subsequently be converted to the desired sulfonamide under standard conditions.
Scheme 1:
Figure imgf000077_0001
where n is 1 , 2, 3, or 4 and the other variables are as defined in the Application
[0249] A solution of /erf-butyl piperazine-1-carboxylate (1.2 equivalents) and a 2- aminobenzo[£>]thiophene-3-carboxylic acid (1.0 equivalent) in DMF (0.2 M) was treated with EDCI (1.5 equivalents) and HOBt (1.1 equivalents) at it. The reaction mixture was stirred until the reaction was complete as determined by LCMS analysis and then partitioned between ethyl acetate and water. The organics were subsequently washed with 1.0 M H3PO4, water, NaHCOj (sat. aq.), and brine, then dried over Na2SO4, filtered, and the volatiles removed under reduced pressure. The residue was purified by Siθ2 chromatography (25% - 50% - 75% ethyl acetate/hexanes gradient) to afford the terf-butyl 4-(2-aminobenεo[b]thiophene-3-carbonyl)piperazine- 1 -carboxylates (76%). [0250] A solution of a før/-butyl 4-(2-aminobenzo[&]thiophene-3-carbonyl)piperazine- 1-carboxylate (1.0 equivalent), the requisite alkyl isocyanate (10 equivalents), and pyridine (0.5 M) was prepared in a sealed tube and warmed to 61°C for 17h, The reaction mixture was then cooled to rt, the volatiles removed under reduced pressure, and the residue purified by SiO3 chromatography (25% - 30% - 40% - 75% ethyl acetate/hexanes gradient) to afford the terf-butyl 4-(2-(3-alkylureido)benzo[b]thiophene-3- carbonyl)piperazine-l-carboxylates (63%).
[0251] The tørt-butyl 4-(2-(3-alkylureido)benzo[b]thiophene-3-carbonyl)piperazine-l- carboxylate (1.0 equivalent) was dissolved in CH2Cl2 and slowly treated with a 2: 1 solution of CH2CI2/TFA (3: 1 final ratio, 0.17 M) and stirred at rt until the reaction was complete as determined by LCMS analysis. The voladles were removed under reduced pressure and the l-alkyl-3-(3-(piperazine-l-carbonyl)benzo[b]thiophen-2-yl)urea TFA salts were used without further purification. ESI-MS: m/z 332.1 (M+H)+. [0252] A mixture of the l-alkyI-3-(3-(piperazine-l-caτbonyl)benzo[έ]thiophen-2- yl)urea TFA salt ( 1 equivalent) and the corresponding sulfonyl chloride (1-1.2 equivalents) in either CH2Cl2 or DMF (0.1 - 0.2 M) was treated with N,N- diisopropylethylamine (4 equivalents) at rt. After the reaction was complete as determined by LCMS analysis, the reaction mixture was diluted with ethyl acetate, washed with 1.0 M H3PO4, NaHCO3 (sat. aq.), and brine, dried over Na2SC^, filtered, concentrated under reduced pressure, and purified by SiO2 chromatography (ethyl acetate/hexanes gradient or CHiCb/MeOH gradient) to afford the desired sulfonamide (10-80% yield). [0253] Alternatively, compounds presented in this invention could be synthesized as outlined in Scheme 2 below. The monoprotected piperazine can be sulfonylated and the carbamate function unmasked by the action of trifiuoroacetic acid to afford the piperazinesulfonamide as its TFA salt. Amide bond formation can be affected by treatment with the desired carboxylic acid in the presence of EDCI. The resultant amino amide can be converted to the corresponding urea by treatment with an isocyanate under standard conditions.
Scheme 2:
Figure imgf000078_0001
where the variables are as defined in the Application [0254] A solution of tert-butyl piperazine- 1 -carboxylate ( 1.0 equivalent) and the corresponding sulfonyl chloride (1.0 equivalent) in ethyl acetate (0.25 M in sulfonyl chloride) was treated with triethylamine (1.1 equivalents) at rt. Once the reaction was complete as determined by TLC or LCMS analysis, the reaction mixture was washed with water, brine, dried over MgSO4, filtered, and the volatiles removed under reduced pressure. The residue obtained was used without further purification. [0255] A solution of the tert-bulyl 4-(arylsulfonyl)pϊperazine-l-carboxylate (1.00 equivalents) and methylene chloride was treated with a trifluoroacetic acid/methylene chloride solution (10 equivalents TFA; 3: 1 CH2C12/TFA final ratio). Once the deprotection was complete, the volatiles were removed under reduced pressure and the TFA salt of the l-(arylsulfonyl)piperazine carried on to the next step as is. [0256] A solution of the l-(arylsulfonyl)piperazine TFA salt (1.00 equivalents), 2- aminobenzo[&]thiophene-3-carboxylic acid (1.00 equivalents), DMF (0.2 M), EDCI (1.50 equivalents), and HOBt (1.05 equivalents) was treated with iV,iV-diisopropyl ethyl amine (5.00 equivalents) and the reaction mixture stirred until the reaction was complete, as determined by LCMS analysis. The reaction mixture was then partitioned between ethyl acetate and water and the separated organics washed with water, brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to afford a pale brown solid. Purification by silica gel chromatography (ethyl acetate/hexanes gradient) afforded the desired (2-aminobenzo[&]thiophen-3-yl)(4-(alkylsulfonyl)piperazin-l-yl)methanone. [0257] A solution of the (2-aminobenzo[6]thiophen-3-yl)(4-(alkylsulfonyl)piperazin-l- yl)methanone (1.0 equivalents) and pyridine (0.05 M) was treated with an alkylisocyanate (10 equivalents) in a sealed tube and the reaction mixture warmed to 600C for 18 h. The volatiles were removed under reduced pressure and the residue purified by silica gel chromatography to afford the desired l-alkyl-3-(3-(4-(alkylsulfonyl)piperazine-l- carbonyl)benzo[£]thiophen-2-yl)urea.
[0258] Propionamide-containing sulfonamides can be prepared as outlined in Scheme 3. The protected piperazine can be sulfonylated under standard conditions, the Boc group removed by the action of TFA, and the secondary amine TFA salt coupled with the 2- aminobenzo[b]thiophene-3-carboxylic acid. Hydrolysis of the ester function, followed by coupling with a secondary amine, would furnish the penultimate amide which, upon treatment with an isocyanate in the presence of pyridine, would afford the desired urea. Scheme 3:
Figure imgf000080_0001
22JJ EEDDaCI1 HHOOBB11
Figure imgf000080_0002
wlicru n is 1 , 2, 3, or 4; R1 Is (Ci-6)DlUy];
R" and Rb ore H, alky!, αryl, hctcroaryl, cycioalky), and Jicterσcycloaikyl the other variables are as defined herein
[0259] A solution of the alkyl-3-(chlorosulfonyl)propionate (1.00 equivalent) in ethyl acetate (0.6 M) was treated with tert-butyl piperazine-1-carboxylate (1.25 equivalents) in the presence of MW-diisopropylethylamine (2.50 equivalents) at rt. After 14 h, the reaction mixture was washed consecutively with water, 1.0 M H3PO4 (2x), water (2x), NaHCθ3 (sat. aq., 2x), water, and brine, dried over Na2SO3, filtered, and concentrated under reduced pressure to afford the tert-butyl 4-(3-alkoxy-3- oxopropylsulfonyl)piperazine-l-carboxylate (80%) as a pale yellow solid, which was used without further purification.
[0260] A solution of tert-butyl 4-(3-alkoxy-3-oxopropylsulfonyl)piperazine-l- carboxylate (1.0 equivalent) in CH2Cl2 was treated with a 1:1 solution of CH2C12/TFA (2:1 final ratio of CH2C12/TFA, 0.3 M) and the reaction mixture stirred for 2 h. The volatiles were removed under reduced pressure to afford the tert-butyl 4-(3-alkoxy-3- oxopropylsulfonyl)piperazine-l-carboxylate TFA salt, which was carried on without further purification.
[0261] A solution of the tert-butyl 4-(3-alkoxy-3-oxopropylsulfony])piperazine-l- carboxylate (1.2 equivalents), ΛyV-diisopropylethylamine (3.6 equivalents), and DMF, was added to a solution of the 2-aminobenzo[ύ]thiophene-3-carboxylic acid (1.0 equivalent), EDCI (1.20 equivalents), HOBt (1.05 equivalents), and DMF (0.15 M). The reaction mixture was stirred at rt until the reaction was complete as determined by LCMS analysis. The reaction mixture was then partitioned between water and ethyl acetate and the organics washed with 1.0 M H3PO4, water, NaHCθ3 (sat. aq., 2x), water, and brine, dried over Na2SO4, filtered, and concentrated under reduced pressure. Recrystallization from hot ethanol afforded the alkyl 3-(4-(2-aminobenzo[fr]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)propionate (55%).
[0262] A solution of alkyl 3-(4-(2-aminobenzo[ύ]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)propionate (1.0 equivalent) in 1:1 EtOH/THF (3.6 mL/mmoI) was treated with 2.0 M LiOH (1 1 equivalents). Once the reaction was complete as determined by LCMS analysis, the reaction mixture was acidified (pH 4-6) with 1.0 M H3PO4, extracted with EtOAc, and the combined organic extracts dried over Na2SO4, filtered, and concentrated under reduced pressure to afford the 3-(4-(2-aminobenzo[b]thiophene-3- carbonyl)ρiperazin- 1 -ylsulfonyl)propionic acid. [0263] The 3-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)propionic acid (1.00 equivalent) was dissolved in DMF (0.14 - 0.19 M), treated with EDCI ( 1.2 equiv), stirred at rt for 5 min, treated with HOBt ( 1.05 equiv), stirred for 10 min, and then treated with the corresponding secondary amine (2.00 - 3.00 equivalents). Once the reaction was complete as determined by LCMS analysis, the reaction mixture was partitioned between water and EtOAc, the organics washed with 1.0 M H3PO4 (2x), water, NaHCO3 (sat. aq.), and brine, dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 chromatography (CH2Cl2/Me0H gradient) to afford the desired 3-(4-(2-aminobenzo[b]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)-Λr,/V-dialkylpropionamide (43-77%). [0264] A solution of the 3-(4-(2-aminobenzo[£>]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)-N,/V-dialkyrpropionamide (1.00 equivalent) and pyridine (0.05 M - 0.14 M) was treated with an alkylisocyanate (10.0 equivalents) in a sealed tube and warmed to 62°C for 12 h. The residue was purified by SiO2 chromatography (CH2Cl2/Me0H gradient) to afford the desired 3-(4-(2-(3-alkylureido)benzo[£]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)-N,/V-dialkylpropionamide (22% - 77%). [0265] For example, the above reaction schemes, and variations thereof, can be used to prepare the following:
Figure imgf000082_0001
l-(3-(4-(2-(diethylamino)pyrimidin-5- ylsulfonyl)piperazine-l-carbonyl)-6-
Figure imgf000083_0001
1 -
Figure imgf000084_0001
[0266] Another general synthetic route for producing compounds of the present invention is shown in Scheme 4. Alkylation of a thiophenol with tert-butyl A- bromopiperidine-1-carboxylate would furnish sulfide 2. Oxidation with one equivalent of an oxidant such as m-CPBA will produce the sulfoxide 3A while 2 equivalents of oxidant will result in formation of the sulfone 3B. .
Scheme 4:
Figure imgf000085_0001
where Rc is a substπucnt as defined in the Application when R1 is an aryl or heierosryl
[0267] A solution of /er/-butyl 4-bromoρiperidine-l-carboxylate (1.0 equivalent), the requisite thiophenol (1.2 equivalents), and acetonitrile (0.5 M) was treated with K2CO3 (1.6 equivalents) and warmed to 500C for 24 h. The reaction mixture was cooled to rt and partitioned between brine and ethyl acetate. The organics were then washed with NaHCO3 (sat, aq.), water, 1.0 M H3PO4, water, and brine and dried (Na2SO4), filtered, and concentrated under reduced pressure to afford the desired /er/-butyl 4-(arylthio)piperidine- 1-carboxylate 2 as a yellow to brown oil, which was used without further purification. [0268] The før/-butyl 4-(arylthio)piρeridine-l-carboxylate (2, 1.0 equivalent) was dissolved in CH2Cl2 (0.25 M), cooled to 00C, then treated with m-CPBA (1.1 equivalents [for the sulfoxide] or 2.2 equivalents [for the sulfone]). After the reaction was complete as determined by LCMS analysis, the reaction mixture was diluted with ethyl acetate and washed with NaHCO3 (sat. aq.), water, and brine. The organics were then dried over Na2SO4, filtered, and concentrated under reduced pressure to afford either the sulfoxide 3A or the sulfone 3B, each of which was carried on to the next step without further purification.
[0269] Either the sulfoxide (3A) or sulfone (3B) could be elaborated to the desired urea end products using the protocol shown in Scheme 5. Removal of the tørt-butyl carbamate protecting group with TFA would afford the corresponding secondary amine TFA salt (4A or 4B), which could then be coupled with the 2-aminobenzo[&]thiophene-3-carboxylic acid to afford the desired amide 5A or 5B. Urea formation with an isocyanate could then produce the desired sulfoxide (6A) or sulfone (6B) products. Scheme 5:
Figure imgf000086_0001
where GA or 6B
Z is -S(O)- or -S(O)2-;
Rc is a substitucnt as defined in the Application when R1 is an aryl or heieroπryl.
[0270] A solution of either the sulfoxide (3A, 1 equivalent) or sulfone (3B, 1 equivalent) in CH2Cl2 was treated with a 1:1 solution of TFA/CH2C12 (1:2 final ratio of TFA/CH2C12, 0.10 - 0.20 M). After the reaction was complete as determined by LCMS analysis, the volatiles were removed under reduced pressure to afford either the tert-butyl 4-(arylsuIfinyI)piperidine-l-carboxylate TFA salt (4A) or the tert-butyl 4- (arylsulfonyl)piperidine-l-carboxylate TFA salt (4B), which were used without further purification.
[0271] A solution of the sulfone TFA salt 4B (1.00 equivalent), the 2- aminobenzo[b]thiophene~3-carboxylic acid (1.00 equivalent), EDCI (1.60 equivalents), HOBt (1.20 equivalents), N,/V-diisopropylethyl amine (4.00 equivalents), and DMF (0.20 M) was stirred at rt until the reaction was complete as determined by LCMS analysis. The reaction mixture was then partitioned between ethyl acetate and water and the organics washed with NaHCO3 (sat. aq.), water, and brine and then dried (Na2SO4), filtered, and concentrated under reduced pressure to afford a residue, which was purified by silica gel chromatography (ethyl acetate/hexanes gradient) to provide the (2- aminobenzo[ύ]thiophen-3-yl)(4-(arylsulfonyl)piperidin-l-yi)methanone 5B. [0272] A solution of the (2-aminobenzo[£]thiophen-3-yl)(4-(arylsulfonyl)piperidin-l- yl)methanone (5B, 1.00 equivalent), pyridine (0.13 M), and the corresponding alkyl isocyanate (3.00 equivalents) was placed in a sealed tube and warmed to 62°C for 18h. The reaction mixture was then cooled to rt and the volatiles removed under reduced pressure. The residue was purified by silica gel chromatography (ethyl acetate/hexaπes gradient) to afford the l-ethyl-3-(3-(4-(arylsulfonyl)piperidine-l- carbonyl)benzo[fc]tbiophen-2-yl)urea 6B.
[0273] Compounds presented in this invention could also be prepared as outlined in the general synthetic scheme presented below (Scheme 6). Alkylation of an appropriate thiophenol with tert-butyl 4-bromopiperidine-l-carboxylate could provide the corresponding sulfide, which could then be deprotected with TFA. The resultant amino function could be coupled with a 2-aminobenzo[b]thiophene-3-carboxylic acid to provide the corresponding amide. Urea formation would furnish the fully elaborated sulfide, which could then be oxidized to provide the desired sulfoxide or sulfone.
Scheme 6:
Figure imgf000087_0001
where Re is a subsiilucnt on R1 as defined in the Application when R1 is an aryl or heieroαryl.
[0274] A solution of a thiophenol (0.9 - 1.1 equivalents), tert-butyl 4-bromopiρeridine- 1-carboxylate, and acetonitrile (0.5 M) was treated with K2CO3 and the reaction mixture warmed to 50 - 55°C for 12-24 h. The reaction mixture was cooled to rt, partitioned between water and ethyl acetate, and the organics washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford the crude tørz-butyl 4- (arylthio)piperidine-l-carboxylate, which was used without further purification. [0275] A solution of the /erf-butyl 4-(arylthio)piperidine-l-carboxylate (1.0 equiv) and methylene chloride (1/2 of total volume used) was treated with a solution of 1:1 TFA/methylene chloride (such that final ration of TFA/methylene chloride was 1:2 and TFA equivalents are ≥ 10). The reaction mixture was stirred at rt until the reaction was complete, as determined by LCMS analysis. The volatiles were then removed under reduced pressure, the residue dissolved in ethyl acetate and washed with NaHCθ3 (sat. aq., 2x), water, and brine, and the organic solution dried over Na2SO4, filtered, and concentrated under reduced pressure to afford the desired 4-(arylthio)pi peri dine, which was used in the next step as is.
[0276] A solution of the 2-aminobenzo[b]thiophene-3-carboxylic acid (1.0 equivalent) and acetonitrile was treated with EDCI (1.2 equivalents) and acetonitrile, stirred for 5 min, treated with HOBt ( 1.2 equivalents), stirred for 5 min, then treated with a solution of the A- (arylthio)piperidine (1.2 equivalents) and acetonitrile (0.5 M final concentration). The reaction progress was monitored by LCMS analysis and, once the reaction was complete, the reaction mixture was partitioned between ethyl acetate and water. The organics were separated and washed with NaHCO3 (sat. aq.), water, and brine then dried (Na2SO4), filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography (25% - 50% - 75% - 100% ethyl acetate/hexanes gradient) to afford the (2-aminobenzo[&]thiophen-3-yI)(4-(aryIylthio)piperidin-l-yl)methanone as an off white to pale brown solid.
[0277] A solution of the (2-amiπobenzo[6]thiophen-3-yl)(4-(arylylthio)piperidin-l- yl)methanone (1.00 equivalents) and pyridine (0.25M) was treated with an alkyl isocyanate (4.00 equivalents) and the reaction mixture warmed to 600C for 16h then cooled to rt. The volatiles were removed under reduced pressure and the residue was purified by silica gel chromatography (0% - 25% - 50% ethyl acetate/hexanes gradient) to afford the l-alkyl-3-(3-(4-(aryIthio)piperidine-l-carbonyl)benzo[b]thiophen-2-yl)urea as a pale brown solid.
[0278] A solution of the l-alkyl-3-(3-(4-(arylthio)piperidine-l- carbonyl)benzo[£>]thiophen-2-yl)urea (1.00 equivalent) in mehtylene chloride (0.10 M) was cooled to -5°C and treated with m-CPBA (1.00 - 1.10 equivalents). The reaction mixture was allowed to warm to rt slowly over Ih, after which TLC analysis indicated the reaction was complete. The reaction was quenched by the addition of NaHCOs (sat. aq.). The organics were subsequently washed with NaHCθ3 (sat. aq.), water, and brine, dried over Na2SO4, filtered, and concentrated under reduced pressure and the residue purified by silica gel chromatography (50% - 75% - 100% ethyl acetate hexanes gradient) to afford the desired I-alkyl-3-(3-(4-(arylsuIfinyl)piperidine-l-carbonyl)benzo[b]thiophen-2- yl)urea.
[0279] The l-alkyl-3-(3-(4-(arylsulfonyl)piperidine-l-carbonyl)benzo[/;]thiophen-2- yl)urea compounds were prepared from the corresponding l-alkyl-3-(3-(4- (arylsulFinyl)piperidine-l-cai'bonyl)benzo[b]thiophen-2-yl)ureas following the procedure given above for preparation of the latter or from the l-alkyl-3-(3-(4-(arylthio)piperidine-l- carbonyl)benzo[ύ]thiophen-2-yl)ureas following the procedure given in Scheme 4 using 2.20 equivalents of m-C?BA,
[0280] For example, the above reaction schemes, and variations thereof, can be used to prepare the following:
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
[0281] In each of the above reaction procedures or schemes, the various substituents may be selected from among the various substituents otherwise taught herein.
General Procedures
[0282] It will be readily recognized that certain compounds according to the present invention have atoms with linkages to other atoms that confer a particular stereochemistry to the compound (e.g., chiral centers). It is recognized that synthesis of compounds according to the present invention may result in the creation of mixtures of different stereoisomers (i.e., enantiomers and diastereomers). Unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all of the different possible stereoisomers.
[0283] Compounds according to the present invention can be prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds, separating the diastereomers and recovering the optically pure enantlomer. While resolution of enantiomers can be carried out using covalent diastereomeric derivatives of compounds, dissociable complexes are preferred (e.g., crystalline diastereoisomeric salts). [0284] Compounds according to the present invention can also be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid. Alternatively, a pharmaceutically acceptable base addition salt of a compound can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. Inorganic and organic acids and bases suitable for the preparation of the pharmaceutically acceptable salts of compounds are set forth in the definitions section of this Application. Alternatively, the salt forms of the compounds can be prepared using salts of the starting materials or intermediates.
[0285] The free acid or free base forms of the compounds can be prepared from the corresponding base addition salt or acid addition salt form. For example, a compound in an acid addition salt form can be converted to the corresponding free base by treating with a suitable base (e.g., ammonium hydroxide solution, sodium hydroxide, and the like). A compound in a base addition salt form can be converted to the corresponding free acid by treating with a suitable acid (e.g., hydrochloric acid, etc). [0286] The Λf-oxides of compounds according to the present invention can be prepared by methods known to those of ordinary skill in the art. For example, N-oxides can be prepared by treating an unoxidized form of the compound with an oxidizing agent (e.g., trifluoroperacetic acid, permaleic acid, perbenzoic acid, peracetic acid, meta-chloroperoxybenzoic acid, or the like) in a suitable inert organic solvent {e.g., a halogenated hydrocarbon such as dichloromethane) at approximately 0 0C. Alternatively, the /V-oxides of the compounds can be prepared from the Λf-oxide of an appropriate starting material.
[0287] Compounds in an unoxidized form can be prepared from W-oxides of compounds by treating with a reducing agent (e.g., sulfur, sulfur dioxide, triphenyl phosphine, lithium borohydride, sodium borohydride, phosphorus trichloride, tribromide, or the like) in an suitable inert organic solvent (e.g., acetonitrile, ethanol, aqueous dioxane, or the like) at 0 to 80 0C.
[0288] Prodrug derivatives of the compounds can be prepared by methods known to those of ordinary skill in the art (e.g., for further details see Saulnier ef al. (1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985). For example, appropriate prodrugs can be prepared by reacting a non-derivatized compound with a suitable carbamylating agent (e.g., lj-acyloxyalkylcarbonochloridate, para-nitrophenyl carbonate, or the like).
[0289] Protected derivatives of the compounds can be made by methods known to those of ordinary skill in the art. A detailed description of the techniques applicable to the creation of protecting groups and their removal can be found in P.G.M. Wuts and T.W. Greene, "Greene 's Protecting Groups in Organic Synthesis", 4lh edition, John Wiley & Sons, Inc. 2007.
[0290] Compounds according to the present invention may be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention may be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol.
[0291] As used herein the symbols and conventions used in these processes, schemes and examples are consistent with those used in the contemporary scientific literature, for example, the Journal of the American Chemical Society or the Journal of Biological Chemistry. Standard single-letter or three-letter abbreviations are generally used to designate amino acid residues, which are assumed to be in the L-configuration unless otherwise noted. Unless otherwise noted, all starting materials were obtained from commercial suppliers and used without further purification. Specifically, the following abbreviations may be used in the examples and throughout the specification:
Figure imgf000094_0001
[0292] All references to ether or Et2O are to diethyl ether; and brine refers to a saturated aqueous solution of NaCl. Unless otherwise indicated, all temperatures are expressed in 0C (degrees Centigrade). All reactions are conducted under an inert atmosphere at RT unless otherwise noted.
[0293] 1H NMR spectra were recorded on a Bruker Avance 400. Chemical shifts are expressed in parts per million (ppm). Coupling constants are in units of Hertz (Hz). Splitting patterns describe apparent multiplicities and are designated as s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad).
[0294] Low-resolution mass spectra (MS) and compound purity data were acquired on a Waters ZQ LC/MS single quadrupole system equipped with electrospray ionization (ESI) source, UV detector (220 and 254 nm), and evaporative light scattering detector (ELSD). Thin-layer chromatography was performed on 0,25 mm E. Merck silica gel plates (60F-254), visualized with UV light, 5% ethanolic phosphomolybdic acid, Niπhydrin orp-anisaldehyde solution. Flash column chromatography was performed on silica gel (230-400 mesh, Merck).
[0295] The starting materials and reagents used in preparing these compounds are either available from commercial suppliers such as the Aldrich Chemical Company (Milwaukee, WI), Bachem (Torrance, CA), Sigma (St. Louis, MO), or may be prepared by methods well known to a person of ordinary skill in the art, following procedures described in such standard references as Fieser and Fieser's Reagents for Organic Synthesis, vols. 1-23, John Wiley and Sons, New York, NY, 2006; Rodd's Chemistry of Carbon Compounds, vols. 1-5 and supps., Elsevier Science Publishers, 1998; Organic Reactions, vols. 1-68, John Wiley and Sons, New York, NY, 2007; March J.: Advanced Organic Chemistry, 5th ed., 2001, John Wiley and Sons, New York, NY; and Larock: Comprehensive Organic Transformations, 2nά edition, John Wile and Sons, New York, 1999. The entire disclosures of all documents cited throughout this application are incorporated herein by reference.
[0296] Various methods for separating mixtures of different stereoisomers are known in the art. For example, a racemic mixture of a compound may be reacted with an optically active resolving agent to form a pair of diastereoisomeric compounds. The diastereomers may then be separated in order to recover the optically pure enantiomers. Dissociable complexes may also be used to resolve enantiomers (e.g., crystalline diastereoisomeric salts). Diastereomers typically have sufficiently distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities. For example, diastereomers can typically be separated by chromatography or by separation/resolution techniques based upon differences in solubility. A more detailed description of techniques that can be used to resolve stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981).
[0297] Diastereomers have distinct physical properties (e.g., melting points, boiling points, solubilities, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities. The diastereomers can be separated by chromatography or, preferably, by separation/resolution techniques based upon differences in solubility. The optically pure enantiomer is then recovered, along with the resolving agent, by any practical means that would not result in racemization, A more detailed description of the techniques applicable to the resolution of stereoisomers of compounds from their racemic mixture can be found in Jean Jacques, Andre Collet, and Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley & Sons, Inc. (1981). [0298] Chiral components can be separated and purified using any of a variety of techniques known to those skilled in the art. For example, chiral components can be purified using supercritical fluid chromatography (SFC). In one particular variation, chiral analytical SFC/MS analyses are conducted using a Berger analytical SFC system (AutoChem, Newark, DE) which consists of a Berger SFC dual pump fluid control module with a Berger FCM 1100/1200 supercritical fluid pump and FCM 1200 modifier fluid pump, a Berger TCM 2000 oven, and an Alcott 718 autosampler. The integrated system can be controlled by BI-SFC Chemstation software version 3.4. Detection can be accomplished with a Waters ZQ 2000 detector operated in positive mode with an ESI interface and a scan range from 200-800 Da with 0.5 second per scan. Chromatographic separations can be performed on a ChiralPak AD-H1 ChiralPak AS-H, ChiralCel OD-H, or ChiralCel OJ-H column (5μ, 4.6 x 250 mm; Chiral Technologies, Inc. West Chester, PA) with 10 to 40% methanol as the modifier and with or without ammonium acetate (10 mM). Any of a variety of flow rates can be utilized including, for example, 1.5 or 3.5 mLVmin with an inlet pressure set at 100 bar. Additionally, a variety of sample injection conditions can be used including, for example, sample injections of either 5 or lOμL in methanol at 0.1 mg/mL in concentration. [0299] In another variation, preparative chiral separations are performed using a Berger
MultiGram II SFC purification system. For example, samples can be loaded onto a ChiralPak AD column (21 x 250 mm, lOμ). In particular variations, the flow rate for separation can be 70 mlVmin, the injection volume up to 2 mL, and the inlet pressure set at 130 bar. Stacked injections can be applied to increase the efficiency. [0300] Descriptions of the syntheses of particular compounds according to the present invention based on the above reaction schemes and variations thereof are set forth in the Example section.
Assaying the Biological Activity of the Compounds of the Invention
[0301] The inhibitory effect of the compound of the invention on ACC may be evaluated by a variety of in vitro and in vivo binding assays and functional assays, e.g., Harwood HJ Jr. et al. J Biol Chem. 2003 278(39):31099-l 1 1 ; Liu Y. et al. Assay Drug Dev Technol. 2007 5(2):225-35; and Seethala R. et al. Anal Biochem. 2006 358(2 ):251 -65. [0302] Provided in Example A is an in vitro enzymatic ACC activity assay for activity against ACC, The binding affinity of the test compound to ACCl or ACC2 is determined by the changes in absorbance (at 620 nm); the absorbance is proportional to the fraction of bound inhibitor. It should be noted that a variety of other expression systems and hosts are also suitable for the expression of ACC, as would be readily appreciated by one of skill in the art.
[0303] Using the procedure described in Example A, some of the exemplified compounds were shown to have ACC inhibitory activity at an IC50 of less than 10 μM, some others less than about 1 μM. The IC50 values of the exemplified compounds of the present invention are given in Table 1.
EXAMPLE
[0304] The present invention is further exemplified, but not limited by, the following examples that describe the synthesis of particular compounds according to the invention. It will be readily recognized that certain compounds according to the present invention have atoms with linkages to other atoms that confer a particular stereochemistry to the compound (e.g., chiral centers). It is recognized that synthesis of compounds according to the present invention may result in the creation of mixtures of different stereoisomers (i.e., enantiomers and diastereomers). Unless a particular stereochemistry is specified, recitation of a compound is intended to encompass all of the different possible stereoisomers. EXAMPLE 1
2-(4-(2-aminobenzofblthiophene-3-carbon\l)mOerazin'l~\lsulfonyl)benzonitrile
Figure imgf000098_0001
[0305] The title compound was prepared as described in Scheme 2. 1H NMR (400 MHz, chloroform-^/) 5 ppm 3.12 (ddd, /=12.00, 8.59, 2.91 Hz, 2 H), 3.48 (td, 7=8.53, 3.41 Hz, 2 H), 3.54 - 3.64 (m, 2 H), 3.74 - 3.84 (m, 2 H), 5.44 (s, 2 H), 7.10 (ddd, 7=8.02, 6.38, 2.02 Hz, 1 H), 7.21 - 7.31 (m, 2 H), 7.51 (d, 7=7.83 Hz, 1 H), 7.74 (dq, 7=13.45, 6.80 Hz, 2 H), 7.89 (dd, 7=7.45, 1.39 Hz, 1 H), 8.04 (dd, 7=7.83, 1.26 Hz, 1 H); ESI-MS: m/z 426.1 (M+H)+.
EXAMPLE 2 l-P-tø-fl-cvanophenylsulfonvDpwerazine-l-carbonvDbenzofblthiovhen-l-vD-S- ethylurea
Figure imgf000098_0002
[0306] The title compound was prepared as described in Scheme 2. H NMR (400 MHz, chloroform -d) 5 ppm 1.18 (t, 7=6.69 Hz, 3 H), 3.10 - 3.22 (m, 2 H), 3.26 - 3.36 (m, 2 H), 3.45 - 3.56 (m, 2 H), 3.61 - 3.70 (m, 2 H), 3.71 - 3.82 (m, 2 H), 5.60 (d, 7=5.31 Hz, 1 H), 7.17 - 7.26 (m, 1 H), 7.30 - 7.39 (m, 2 H), 7.67 - 7.84 (m, 3 H), 7.87 - 7.96 (m, 1 H), 8.05 - 8.13 (m, I H), 9.36 (br. s., 1 H); ESI-MS: m/z 497.1 (M+H)+. EXAMPLE 3 ethyl-3-(3-(4-(phenylsulfonvt)piperazine-l-carboiiyl)benzo[b]thiophen-2-yl)urea
Figure imgf000099_0001
[0307] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, chloroform -d) δ ppm 0.90 (t, 7=7.07 Hz, 3 H), 2.83 - 2.99 (m, 2 H), 3.09 (dq, 7=7.07, 5.56 Hz, 2 H), 3.17 - 3.27 (m, 2 H), 3.56 - 3.67 (m, 2 H)1 3.67 - 3.80 (m, 2 H), 5.49 (br. s., 1 H), 7.20 (td, 7=5.31, 3.03 Hz, 1 H), 7.25 - 7.30 (m, 2 H), 7.54 - 7.62 (m, 2 H), 7.62 - 7.73 (m, 2 H), 7.74 - 7.80 (m, 2 H), 9.27 (br. s., 1 H); ESI-MS: m/z 472.1 (M+H)+.
EXAMPLE 4 l-(3~(4- (benzofd]fl,3]dioxol-5-ylsulfonyl)piperaziiιe-I-carbonyl)benzofb lthiouhen-2-yl)-
3-ethylurea
Figure imgf000099_0002
[0308] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, chloroform -d) δ ppm 1.00 (t, 7=7.20 Hz, 3 H), 2.90 (t, 7=8.08 Hz, 2 H), 3.13 - 3.23 (m, 2 H), 3.27 (dd, 7=11.62, 4.80 Hz, 2 H), 3.59 - 3.68 (m, 2 H), 3.71 - 3.84 (m, 2 H), 5.40 (br. s., 1 H), 6.13 (s, 2 H), 6.96 (d, 7=8.34 Hz, 1 H), 7.19 (d, 7=1.77 Hz, 1 H), 7.23 (ddd, 7=8.02, 4.29, 4.1 1 Hz, 1 H), 7.30 - 7.38 (m, 3 H), 7.73 (d, 7=7.83 Hz, 1 H), 9.36 (br. s., 1 H); ESI-MS: m/z 516.1 (M+H)+. EXAMPLE 5 ethyl-3-(3-(4-(3-(methylsιιlfonyl)plιenylsulfonyl)piperazine-l- carbonvDbenzofb lthioph en-2-yl)ιιrea
Figure imgf000100_0001
[0309] The title compound was prepared as described in Scheme 1. IH NMR (400 MHz, DMSO-d6) 5 ppm 1.04 (t, 7=7.20 Hz, 3 H), 2.91 (br. s., 2 H), 3.05 - 3.15 (m, 2 H), 3.16 - 3.24 (m, 2 H), 3.35 (s, 3 H), 3.40 - 3.81 (m, 4 H), 6.90 (t, 7=5.56 Hz, 1 H), 7.14 - 7.19 (m, 1 H), 7.25 (td, 7=7.52, 1.14 Hz, 1 H), 7.30 - 7.36 (m, 1 H), 7.78 (d, 7=7.33 Hz, 1 H), 7.97 (t, 7=7.96 Hz, 1 H), 8.08 - 8.12 (m, 1 H), 8.17 (t, 7=1.64 Hz, 1 H), 8.32 (ddd, 7=8.21, 1.39, LOl Hz, 1 H), 9.19 (s, 1 H); ESI-MS: m/z 550.1 (M+H)\
EXAMPLE 6 l-(3- (4-(benzofc Ml,2,5]thiadiazol-5-ylsulfonyl)piperazine-l-carbonyl)benzo[b Ithiophen-
2-yl)-3-ethylurea
Figure imgf000100_0002
[0310] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 5 ppm 0.97 (t, 7=7.20 Hz1 3 H), 2.86 - 3.00 (m, 2 H), 3.00 - 3.09 (m, 2 H), 3.40 - 3.91 (m, 6 H), 6.74 (t, 7=5.43 Hz, 1 H), 7.12 - 7.18 (m, 1 H), 7.21 (td, 7=7.45, 1.26 Hz, 1 H), 7.32 (d, 7=7.33 Hz, 1 H), 7.77 (d, 7=7.33 Hz, 1 H), 7.96 (dd, 7=9.09, 1.77 Hz, 1 H)1 8.36 (d, 7=8.59 Hz, 1 H), 8.55 (d, 7=1.01 Hz, 1 H), 9.06 (s, 1 H); ESI-MS: m/z 530.1 (M+H)+. EXAMPLE 7 ethyl-3-(3-(4-(3-methoxyphenvϊsulfonyl)piperazine-l-carbonyl}benzofblthiophen-2- vDurea
Figure imgf000101_0001
[03H] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSOd6) δ ppm 1.05 (t, /=7.20 Hz, 3 H), 2.84 (br. s., 2 H), 3.05 - 3.20 (m, 4 H), 3.52 (br. s., 2 H), 3.58 - 3.74 (m, 2 H), 3.84 (s, 3 H), 6.91 (t, 7=5.43 Hz, 1 H), 7.12 - 7.20 (m, 2 H), 7.25 (td, 7=7.45, 1.26 Hz, 1 H)1 7.28 - 7.35 (m, 3 H), 7.58 (d, 7=8.08 H2, 1 H), 7.78 (d, 7=7.33 Hz, 1 H), 9.20 (s, 1 H); ESI-MS: m/z 502.1 (M+H)+.
EXAMPLE 8 iV- (3-(4-(2-(3*etkylureido )benzofb ]thiophene~3-carbon\l)pwerazin-l- ylsulfon \l)ph envDacetamide
Figure imgf000101_0002
[0312] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSOd6) δ ppm 1.04 (t, 7=7.20 Hz, 3 H), 2.07 (s, 3 H), 2.82 (br. s., 2 H), 3.05 - 3.16 (m, 4 H), 3.40 - 3.59 (m, 2 H), 3.79 (br. s., 2 H), 6.88 (t, 7=5.43 Hz, 1 H), 7.17 (t, 7=6.82 Hz, 1 H), 7.24 (td, 7=7.52, 1.14 Hz, 1 H), 7.28 - 7.32 (m, 1 H), 7.37 (d, 7=8.59 Hz, 1 H), 7.58 (t, 7=7.96 Hz, 1 H), 7.78 (d, 7=7.83 Hz, 1 H), 7.86 - 7.92 (m, 1 H), 8.03 (t, 7=1.89 Hz, 1 H), 9.20 (s, 1 H), 10.34 (s, 1 H); ESI-MS: m/z 529.2 (M+H)+. EXAMPLE 9
2-chloro-5-(4-(2-(3-eth\lureido)benzo[b]thiophene-3-carbonyl)pwerazin-l- ylsulfonvDbenzenesulfonamide
Figure imgf000102_0001
[0313] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 δ ppm 1.05 (t, 7=7.20 Hz, 3 H), 2.90 (br. s., 2 H), 3.12 (ddd, 7=7.26, 5.37, 3.03 Hz, 2 H), 3.17 - 3.26 (m, 2 H), 3.40 - 3.59 (m, 2 H), 3.59 - 3.88 (m, 2 H), 6.86 - 6.92 (m, 1 H), 7.14 - 7.21 (m, 1 H), 7.26 (td, 7=7.58, 1.26 Hz, 1 H), 7.35 (d, 7=7.83 Hz, 1 H), 7.78 (d, 7=7.58 Hz, 1 H), 7.92 - 7.96 (m, 4 H), 8.22 (t, 7=1.26 Hz1 1 H), 9.20 (s, 1 H); ESI-MS: m/z 585.1 (M+H)+.
EXAMPLE 10 eth yl-3-(3- (4-(3-(2-methylthiazol-4-yl)phenylsulfon vDpiperazine-l- carbon vDbenzofb }thiophen-2~vl)urea
Figure imgf000102_0002
[0314] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, OMSO-Cl6) δ ppm 0.99 (t, 7=7.20 Hz, 3 H), 2.74 (s, 3 H), 2.76 - 2.97 (m, 2 H), 3.05 (dd, 7=7.20, 5.68 Hz, 2 H), 3.14 - 3.27 (m, 2 H), 3.51 (br. s., 2 H), 3.66 (q, 7=7.07 Hz, 2 H), 6.8 l (t, 7=5.31 Hz, 1 H), 7.16 (td, 7=7.83, 1.26 Hz, 1 H), 7.21 (td, 7=7.52, 1.14 Hz, 1 H), 7.27 - 7.32 (m, 1 H)1 7.66 - 7.70 (m, 1 H), 7.73 (t, 7=7.71 Hz, 1 H), 7.77 (d, 7=7.83 Hz, I H), 8.21 (s, 1 H), 8.25 - 8.27 (m, 1 H), 8.30 (ddd, 7=7.71, 1.52, 1.39 Hz, I H), 9.16 (s, 1 H); ESI-MS: m/z 569.1 (M+H)+. EXAMPLE 11 ethyl-3-(3-(4-(3-(5-methyl-l,3,4'θxadiazol-2-yl)phenylsulfonyi)pwerazine-J- carbonvl)benzo[blthiophen-2-yl)urea
Figure imgf000103_0001
[0315] The title compound was prepared as described in Scheme 1. 1H NMR (400
MHz, DMSO-rfβ) 5 ppm 1.01 (t, 7=7.20 Hz, 3 H), 2.62 (s, 3 H), 2.88 (br. s., 2 H), 2.99 - 3.12 (m, 2 H), 3.20 (br. s., 2 H), 3.38 - 3.57 (m, 2 H), 3.57 - 3.87 (m, 2 H), 6.84 (t, 7=5.31 Hz, 1 H), 7.12 - 7.19 (m, 1 H), 7.23 (td, 7=7.45, 1.26 Hz, 1 H), 7.28 - 7.34 (m, 1 H), 7.77 (d, 7=7.33 Hz, 1 H), 7.90 (t, 7=7.58 Hz, 1 H), 7.94 - 8.01 (m, 1 H), 8.19 (t, 7=1.52 Hz, 1 H), 8.34 (dt, 7=7.77, 1.42 Hz, I H), 9.13 (s, 1 H); ESI-MS: m/z 554.1 (M+H)+.
EXAMPLE 12 eth yl-3- (3-(4- (3-(2-methvIι?yrimidin~4~yl)phenvIsulfonyl)piperazine-l - carbonyl)benzofb]thiophen-2-\l)urea
Figure imgf000103_0002
Me [0316] The title compound was prepared as described in Scheme 1. 1H NMR (400
MHz, DMSO-t/ό) δ ppm 0.99 (t, 7=7.20 Hz, 3 H), 2.72 (s, 3 H), 2.87 (br. s., 2 H), 2.97 - 3.13 (m, 2 H), 3.20 (br. s., 2 H), 3.40 - 3.57 (m, 2 H), 3.56 - 3.90 (m, 2 H), 6.81 (t, 7=5.43 Hz, I H), 7.16 (td, 7=7.83, 1.26 Hz, 1 H), 7.21 (td, 7=7.45, 1.26 Hz, 1 H), 7.26 - 7.33 (m, 1 H), 7.77 (d, 7=7.83 Hz, 1 H), 7.85 (t, 7=7.96 Hz, 1 H), 7.89 - 7.94 (m, 1 H), 8.04 (d, 7=4.80 Hz, 1 H), 8.48 (t, 7=1.64 Hz, 1 H), 8.55 (dt, 7=7.83, 1.52 Hz, 1 H), 8.84 (d, 7=5.31 Hz, 1 H), 9.14 (s, 1 H); ESI-MS: m/z 564.2 (M+H)+. EXAMPLE 13 ethvi-3-(3-(4-(3-(5-jnethyl-l,2,4-oxadiazol-3-yl)phen\Isulfonyl)mρerazine-l' carbonyl)benzo[blthioDhen-2-\l)urea
Figure imgf000104_0001
[0317] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 δ ppm 1.00 (t, 7=7.20 Hz, 3 H), 2.71 (s, 3 H), 2.75 - 2.94 (m, 2 H), 2.97 - 3.12 (m, 2 H), 3.18 (br. s., 2 H), 3.39 - 3.57 (m, 2 H), 3.75 (br. s., 2 H), 6.80 (t, 7=5.56 Hz, 1 H), 7.17 (td, 7=7.83, 1.26 Hz, 1 H), 7.22 (td, 7=7.58, 1.26 Hz, 1 H), 7.28 - 7.33 (m, 1 H), 7.77 (d, 7=7.83 Hz, 1 H), 7.88 (t, 7=7.83 Hz, 1 H), 7.93 - 7.98 (m, 1 H), 8.24 (t, 7=1.52 Hz, 1 H), 8.36 (dt, 7=7.58, 1.39 Hz, 1 H), 9.13 (s, 1 H); ESI-MS: m/z 554.1 (M+H)+.
EXAMPLE 14 ethyl-3'(3-(4-(6-morϋholinoj)yridin-3-ylsulfonyl)møerazine-l- carbonyl)benzofb]thiophen-2-yl)urea
Figure imgf000104_0002
[0318] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, OMSO-d6) δ ppm 1.05 (t, 7=7.20 Hz1 3 H), 2.80 (br. s., 2 H), 3.05 - 3.18 (m, 5 H), 3.51 (br. s., 2 H), 3.61 - 3.67 (m, 5 H), 3.67 - 3.74 (m, 4 H), 6.92 - 6.98 (m, 1 H), 7.18 (t, 7=6.95 Hz, 1 H), 7.26 (td, 7=7.52, 1.14 Hz, 1 H), 7.32 - 7.37 (m, 1 H), 7.71 - 7.83 (m, 2 H), 8.19 - 8.28 (m, I H), 8.38 (d, 7=2.53 Hz, 1 H), 9.22 (s, 1 H); ESI-MS: m/z 558.2 (M+H)+. EXAMPLE 15 ethyl-3-(3-(4-(3~(trifluoromethoxy)ohenylsulfonyl)piperazine-l- carbon vDbenzofb 1thioyhen-2-vl)urea
Figure imgf000105_0001
[0319] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSCM6) δ ppm 1.05 (t, 7=7.20 Hz, 3 H), 2.89 (br. s., 2 H), 3.02 - 3.26 (m, 4 H), 3.41 - 3.74 (m, 4 H), 6.91 (t, 7=5.43 Hz, 1 H), 7.18 (td, 7=7.83, 1.26 Hz, 1 H), 7.24 (td, 7=7.45, 1.26 Hz, 1 H), 7.29 - 7.34 (m, 1 H), 7.69 (s, 1 H), 7.74 - 7.88 (m, 4 H), 9.18 (s, 1 H); ESI-MS: m/z 556.1 (M+H)+.
EXAMPLE 16 ethyl-3-(3-(4-(3-nitropheiiylsulfonyl)piperazine-l-carbonyl)benzo[b]tkwphen-2-yl)urea
Figure imgf000105_0002
[0320] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 δ ppm 1.04 (t, 7=7.20 Hz, 3 H), 2.89 (br. s., 2 H), 3.04 - 3.14 (m, 2 H), 3.22 (br. s., 2 H), 3.41 - 4.05 (m, 4 H), 6.87 (t, 7=5.43 Hz, 1 H), 7.17 (td, 7=6.95, 1.26 Hz1 1 H), 7.24 (td, 7=7.58, 1.26 Hz, 1 H), 7.30 - 7.36 (m, 1 H), 7.78 (d, 7=7.33 Hz, 1 H), 7.97 (t, 7=8.08 Hz, 1 H), 8.19 (ddd, 7=8.21, 1.39, 1.01 Hz, 1 H), 8.39 (t, 7=1.89 Hz, 1 H), 8.59 (dd, 7=7.71, 1.89 Hz, 1 H), 9.1 1 (s, 1 H); ESI-MS: m/z 517.1 (M+H)+. EXAMPLE 17 ethyl-3-(3-(4-(l,l-dioxotetrahvdrothiophen-3-yl$ulfonyl)ρiρerazine-l- carbonyl)benzofbJthiophen-2-yl)urea
Figure imgf000106_0001
[0321] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-rf6) δ ppm 1.08 (t, 7=7.20 Hz, 3 H), 2.14 - 2.32 (m, 1 H), 3.06 - 3.21 (m, 4 H), 3.22 - 3.40 (m, 7 H), 3.41 - 3.56 (m, 2 H), 3.56 - 3.65 (m, 1 H), 3.69 (dd, 7=13.52, 8.97 Hz, 1 H), 4.23 - 4.33 (m, 1 H), 7.15 - 7.23 (m, 2 H), 7.33 (t, 7=7.07 Hz, 1 H), 7.49 (d, 7=7.83 Hz, I H), 7.81 (d, 7=8.08 Hz, 1 H), 9.31 (s, 1 H); ESI-MS: m/z 514.1 (M+H)+.
EXAMPLE 18 l-(3'<4~ (3,4-dih ydro-2H-benzofb ]Fl,4]dioxepin-7-ylsulfonyl)ρiρerazine-l- carbonyDbenzofb )tkiophen-2-yl)-3-eth ylurea
Figure imgf000106_0002
[0322] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, OMSO-dβ) δ ppm 1.06 (t, 7=7.20 Hz, 3 H), 2.10 - 2.24 (m, 2 H), 2.79 (br. s., 2 H)1 2.99 - 3.23 (m, 4 H), 3.50 (br. s., 2 H), 3.75 (br. s., 2 H), 4.24 (t, 7=5.68 Hz, 2 H), 4.28 (t, 7=5.56 Hz, 2 H), 6.94 (t, 7=5.43 Hz, 1 H), 7.13 - 7.20 (m, 2 H), 7.24 (d, 7=2.27 Hz, 1 H), 7.25 - 7.35 (m, 3 H), 7.78 (d, 7=7.83 Hz, 1 H), 9.20 (s, 1 H); ESI-MS: m/z 544.2 (M+H)\ EXAMPLE 19
N-(5-(4-(2-(3-etk\lureido)benzofb]thiophene-3-carbonyl)piperazin-l-vIsulfonyl)-2- methoxwhenypacetamide
Figure imgf000107_0001
[0323] The title compound was prepared as described in Scheme 1. !H NMR (400 MHz, DMSO-40 5 ppm 1.04 (t, 7=7.20 Hz, 3 H), 2.13 (s, 3 H), 2.82 (br. s., 2 H), 3.04 (br. s., 2 H), 3.06 - 3.15 (m, 2 H), 3.54 (br. s., 4 H), 3.95 (s, 3 H), 6.97 (t, 7=5.43 Hz, 1 H), 7.17 (td, 7=7.96, 1.39 Hz, 1 H), 7.20 - 7.33 (m, 3 H), 7.43 (dd, 7=8.72, 2.40 Hz, 1 H), 7.78 (d, 7=7.83 Hz, 1 H), 8.44 (d, 7=2.02 Hz, 1 H), 9.21 (s, 1 H), 9.49 (s, 1 H); ESI-MS: m/z 559.2 (M+H)+.
EXAMPLE 20 l-(3-(4-(3-acetylphenylsulfonyl}piperazine-l-carbonyl)benzo[b1thiopken~2-yl)-3- ethvlurea
Figure imgf000107_0002
[0324] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 5 ppm 1.03 (t, 7=7.20 Hz, 3 H), 2.67 (s, 3 H), 2.84 (br. s., 2 H)1 3.04 - 3.14 (m, 2 H), 3.15 (br. s., 2 H), 3.53 (br. s., 2 H), 3.70 (br. s., 2 H), 6.89 (t, 7=5.43 Hz, 1 H), 7.17 (td, 7=7.83, 1.26 Hz, I H), 7.23 (td, 7=7.58, 1.26 Hz, 1 H), 7.28 - 7.34 (m, 1 H), 7.78 (d, 7=7.83 Hz, 1 H), 7.83 (t, 7=7.71 Hz, 1 H), 7.99 (dd, 7=7.33, 2.53 Hz, 1 H), 8.16 (t, 7=1.64 Hz, 1 H), 8.32 (ddd, 7=7.96, 1.39, 1.26 Hz, 1 H), 9.16 (s, 1 H); ESI-MS: m/z 514.1 (M+H)+. EXAMPLE 21 l-(3-(4-(benzo[d]thiazol- 6-ylsulfonyl)mperazine-l-carbonyl)benzofb Hhiophen-2-yl)-3- ethylurea
Figure imgf000108_0001
[0325] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSOd6) δ ppm 0.97 (t, 7=7.20 Hz, 3 H), 2.84 (br. s., 2 H), 2.98 - 3.09 (m, 2 H), 3.20 (br. s., 2 H), 3.50 (br. s., 2 H), 3.68 (br. s.( 2 H), 6.73 (t, 7=5.43 Hz, 1 H), 7.09 - 7.24 (m, 7=18.76, 7.39, 7.20, 1.26 Hz, 2 H), 7.28 (d, 7=7.58 Hz, 1 H), 7.77 (d, 7=7.58 Hz, 1 H), 7.85 (dd, 7=8.59, 1.77 Hz, 1 H), 8.32 (d, 7=8.59 Hz, 1 H), 8.73 (d, 7=1.52 Hz, 1 H), 9.10 (s, 1 H), 9.68 (s, 1 H); ESI-MS: m/z 529.1 (M+H)+.
EXAMPLE 22 ethyt-3-(3-(4-(4-(2-oxopyrrolidin-l-yl)phenylsulfθ7iyl)piperaziiιe~I- carbonvl)benzo[blthiophen-2-yl)urea
Figure imgf000108_0002
[0326] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 δ ppm 1.03 (t, 7=7.20 Hz, 3 H), 1.99 - 2.17 (quintet, 7=7.52 Hz, 2 H), 2.56 (t, 7=8.08 Hz, 2 H), 2.81 (br. s., 2 H), 3.10 (dd, 7=7.07, 5.56 Hz, 4 H), 3.52 (br. s., 2 H), 3.67 (br. s., 2 H), 3.89 (t, 7=6.95 Hz, 2 H), 6.94 (t, 7=5.31 Hz, 1 H), 7.17 (t, 7=7.45 Hz, 1 H), 7.25 (t, 7=6.95 Hz, 1 H), 7.28 - 7.35 (m, 1 H), 7.73 (d, 7=8.84 Hz, 2 H), 7.78 (d, 7=7.83 Hz, 1 H), 7.94 (d, 7=8.84 Hz, 2 H), 9.21 (s, 1 H); ESI-MS: m/z 555.2 (M+H)+. EXAMPLE 23 l-(3-(4-(3Λ-dime£hoxwhenvIsulfonyl)pwerazine-l-carbonyl)benzofbHhioj)hen-2-'yl)-3- ethylurea
Figure imgf000109_0001
[0327] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-40 δ ppm 1.04 (t, 7=7.20 Hz, 3 H), 2.82 (br. s., 2 H), 3.02 - 3.19 (m, 4 H), 3.37 - 3.77 (m, 4 H), 3.83 (s, 3 H), 3.86 (s, 3 H), 6.94 (t, 7=5.43 Hz, 1 H), 7.14 (d, 7=2.02 Hz, 1 H), 7.16 - 7.21 (m, 2 H), 7.25 (td, 7=7.52, 1.14 Hz, 1 H), 7.30 (d, 7=2.02 Hz, 2 H), 7.78 (d, 7=7.58 Hz, I H), 9.19 (s, 1 H); ESI-MS: m/z 532.2 (M+H)+.
EXAMPLE 24
N-(4-(4-(2-(3-eth ylureido)benzofb lthiovhene-3-carbonyl)viyerazin-l- vlsulfonyl)pkenyl)acetamide
Figure imgf000109_0002
[0328] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, DMSO-(Z6) δ ppm 1.03 (t, 7=7.20 Hz, 3 H), 2.10 (s, 3 H), 2.77 (br. s., 2 H), 3.02 - 3.19 (m, 4 H), 3.46 (br. s., 2 H), 3.64 (br. s., 2 H), 6.86 (t, 7=5.43 Hz, 1 H), 7.16 (dt, 1 H), 7.24 (dt, 7=7.52, 1.14 Hz, 1 H), 7.30 (d, 1 H), 7.63 - 7.70 (m, 2 H), 7.78 (d, 7=7.58 Hz, 1 H), 7.80 - 7.87 (m, 2 H), 9.19 (s, 1 H), 10.42 (s, 1 H); ESI-MS: m/z 529.2 (M+H)\ EXAMPLE 25
Ethyl 3-(4-(2-(3-ethylιιreido)benzofblthiophene-3-carbonyl)piperazin-l~ ylsulfon vDoropanoate
Figure imgf000110_0001
[0329] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, cbloroform-J) δ ppm 1.05 (t, 7=7.20 Hz, 3 H), 1.29 (t, 7=7.07 Hz, 3 H), 2.82 (t, /=7,45 Hz, 2 H), 3.07 - 3.35 (m, 6 H), 3.41 - 3.52 (m, 2 H)1 3.54 - 3.67 (m, 2 H), 3.68 - 3.94 (m, 2 H), 4.19 (q, 7=7.07 Hz, 2 H), 5.39 (t, 7=5.18 Hz, I H), 7.19 - 7.29 (m, 1 H), 7.37 (dt, 7=15.92, 7.45 Hz, 2 H), 7.74 (d, 7=8.08 Hz, 1 H), 9.42 (br. s., 1 H); ESI-MS: m/z 496.2 (M+H)+.
EXAMPLE 26 ethyl-3-(3-(4-(isobutylsulfonyl)pwerazine-l-carbonyl)benzofbJthiophen-2-yl)urea
Figure imgf000110_0002
[0330] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, chloroform-^/) δ ppm 0.95 (t, 7=7.20 Hz, 3 H), 1.1 1 (d, 7=6.82 Hz, 6 H), 2.21 - 2.36 (m, 1 H), 2.79 (d, 7=6.57 Hz, 2 H), 3.05 - 3.29 (m, 4 H), 3.33 - 3.49 (m, 2 H), 3.58 - 3.70 (m, 2 H), 3.79 (br. s., 2 H), 5.68 (br. s., 1 H), 7.20 - 7.26 (m, 1 H), 7.32 - 7.37 (m, 1 H), 7.37 - 7.42 (m, 1 H), 7.73 (d, 7=8.08 Hz, 1 H), 9.38 (br. s., 1 H); ESI-MS: m/z 452.2 (M+H)+. EXAMPLE 27 etkyl-3-(3-(4-(3J,3-trifluoropropylsulfonyl)mperazine-l-carbonyl)benzo[b]thiophen-2- ypurea
Figure imgf000111_0001
[0331] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz1 CHLOROFORM-^ δ ppm 0.98 (t, 7=7.07 Hz, 3 H), 2.55 - 2.72 (m, 2 H)1 3.09 - 3.21 (m, 4 H), 3.22 - 3.35 (m, 2 H), 3.38 - 3.53 (m, 2 H), 3.59 - 3.71 (m, 2 H), 3.75 (q, 7=6.91 Hz, 2 H), 5.59 - 5.71 (m, 1 H)1 7.24 (t, 7=7.45 Hz, 1 H), 7.32 - 7.42 (m, 2 H), 7.73 (d, 7=8.08 Hz, 1 H), 9.41 (br. s., 1 H); ESI-MS: m/z 492.1 (M+H)+.
EXAMPLE 28 ethyl-3-(3-(4-(methylsulfonyl)piperazme-l-carbonyl)benzofb]thwphen-2-yl)urea
Figure imgf000111_0002
[0332] The title compound was prepared as described in Scheme 1. 1H NMR (400 MHz, chloroform-*/) δ ppm 1.08 (t, 7=7.20 Hz, 3 H), 2.82 (s, 3 H), 3.05 - 3.17 (m, 2 H), 3.18 - 3.31 (m, 2 H), 3.32 - 3.48 (m, 2 H), 3.58 - 3.71 (m, 2 H), 3.79 (br. s., 2 H), 5.52 (t, 7=5.43 Hz, 1 H), 7.23 (t, 7=6.95 Hz, 1 H), 7.32 - 7.42 (m, 2 H), 7.74 (d, 7=7.83 Hz, 1 H), 9.44 (br. s., 1 H). EXAMPLE 29 eth\l-3"(3'(4- (4- (methylsutfon yl)phenylsulfonyl)piperazine-l- carbonyl)benzofb]thiophen-2-vl)urea
Figure imgf000112_0001
[0333] The title compound was prepared as described in Scheme 1. ESI-MS: m/z 550.1 (M+H)+.
EXAMPLE 30 ethyl-3-(3-(4-(2-oxoindolin-6-ylsιdfonyl}pwerazine-l-carbonyl)benzofb]thiophen-2- yl)urea.
Figure imgf000112_0002
[0334] The title compound was prepared as described in Scheme 1. ESI-MS: m/z 527.1 (M+H)+.
EXAMPLE 31 ethyl-3-(3-(4-(2'θxo-2t3-dikydro-lH-benzo[d]imidazol-5-ylsulfonyl)j?werazine-l- carbonypbenzofb lthioph en-2-\l)urea
Figure imgf000112_0003
[0335] The title compound was prepared as described in Scheme 1. ESI-MS: m/z 528.1 (M+H)+.
I l l EXAMPLE 32 ethvt-3-(3-(4-(2-oxo-2,3-dikvdrobenzo[d]oxazol-5-yl$ulfonyl)ρiρerazine-l- carbonyl)benzofb]tkiophen-2-yl)urea
Figure imgf000113_0001
[0336] The title compound was prepared as described in Scheme 1. ESI-MS: m/z 529.1 (M+H)+.
EXAMPLE 33 ethyl-3-(3-(4-(2-oxo-2,3-dilιydrobenzoϊdlthiazol-S-ylsιιlfonyl)pwerazine-l- carbon\l)benzofb]thiophen-2-yl)urea
Figure imgf000113_0002
[0337] The title compound was prepared as described in Scheme 1. ESI-MS: m/z 545.1 (M+H)+.
EXAMPLE 34
N,N-dieth yl-3-(4-(2-(3-ethylureido )benzofb ]thiophene-3~carbon \l)pwerazin-l~ ylsulfonyl)propanamide
Figure imgf000113_0003
[0338] The title compound was prepared as described in Scheme 3. 1H NMR (400 MHz, chloroform -d) B ppm 1.12 (t, 7=7.07 Hz, 6 H), 1.20 (t, 7=7.07 Hz, 3 H), 2.85 (t, 7=7.33 Hz, 2 H)1 3.07 - 3.22 (m, 2 H), 3.26 (dd, 7=7.07, 5.56 Hz, 2 H), 3.29 - 3.36 (m, 4 H), 3.39 (q, 7=7.16 Hz, 2 H), 3.46 (td, 7=8.15, 3.66 Hz, 2 H), 3.57 (td, 7=8.21, 5.18 Hz, 2 H), 3.81 (d, 7=12.63 Hz1 2 H), 5.55 (1, 7=5.31 Hz, 1 H), 7.17 - 7.25 (m, I H), 7.35 (td, 7=7.58, 1.26 Hz, 1 H), 7.38 - 7.45 (m, 1 H), 7.73 (d, 7=7.83 Hz, 1 H), 9.36 (br. s., 1 H); ESI-MS: m/z 523.2 (M+H)+.
EXAMPLE 35 eth yl-3-(3- (4-(3-oxo-3-(pyrroUdin-l-yl)propylsulfonyl)piρerazine-l- carbonyl)benzo[b]thiophen-2-yl)urea
Figure imgf000114_0001
[0339] The title compound was prepared as described in Scheme 3. 1H NMR (400 MHz, CHLOROFORM-rf) δ ppm 1.13 (t, 7=7.20 Hz, 3 H)1 1.83 - 1.93 (m, 2 H), 1.98 (q, 7=6.48 Hz, 2 H), 2.80 (t, 7=7.33 Hz, 2 H), 3.10 - 3.25 (m, 4 H), 3.25 - 3.35 (m, 4 H), 3.40 ■ 3.50 (m, 4 H), 3.55 (td, 7=8.34, 5.05 Hz, 2 H), 3.79 (br. s., 2 H), 6.22 (br. s., 1 H), 7.21 (t, 7=6.95 Hz, 1 H), 7.33 (t, 7=7.07 Hz, 1 H), 7.38 - 7.44 (m, 1 H), 7.72 (d, 7=8.08 Hz, 1 H), 9.42 (br. s., 1 H); ESI-MS: m/z 521.2 (M+H)+.
EXAMPLE 36 ethyl-3-(3-(4-(3-morpholino-3-oxoρroyytsulfonyl)piperazine-l- carbonyl)benzofbϊthiopken-2-yl)urea
Figure imgf000114_0002
[0340] The title compound was prepared as described in Scheme 3. 1H NMR (400 MHz, chloroform-rf) δ ppm 1.08 (t, 7=7.20 Hz1 3 H)1 2.80 - 2.89 (m, 2 H), 3.13 - 3.24 (m, 4 H), 3.26 - 3.33 (m, 2 H), 3.35 - 3.45 (m, 2 H)1 3.48 (m, 2 H), 3.57 - 3.65 (m, 4 H), 3.65 - 3.72 (m, 4 H), 3.79 (br. s., 2 H)1 6.31 (br. s., 1 H), 7.16 - 7.24 (m, 1 H), 7.30 - 7.37 (m, 1 H), 7.37 - 7.44 (m, 1 H)1 7.72 (d, 7=8.08 Hz, 1 H), 9.47 (br. s., 1 H); ESI-MS: m/z 537.2 (M-I-H)+.
EXAMPLE 37 eth yl-3- (3-(4-(3-methoxwhenyIsulfon yl)piDeridine-l-carbonyl)benzofb Hhiophen-2- vDurea
Figure imgf000115_0001
[0341] The title compound was prepared as described in Schemes 4 and 5. ESI-MS: m/z 501.1 (M+H)+.
EXAMPLE 38 l-(3-(4-(benzofdlfl,3]dioxol-5-ylsulfon yl)mmridine~l-carbon vDbenzofb Ithioyh en-2-vD-
3-ethylurea
Figure imgf000115_0002
[0342] The title compound was prepared as described in Schemes 4 and 5. ESI-MS: m/z 515.1 (M+H)+.
EXAMPLE 39 eth yl-3- (3-(4-(3-methoxwhenylthio )piperidine-l'Carbonyl)benzofb lthiouhen-2-\l)urea
Figure imgf000115_0003
[0343] The title compound was prepared as described in Scheme 6. ESI-MS: m/z 469.2
(M+H)+. EXAMPLE 40 ethyl-3-(3-(4-(3-(trifluoromethoxy)vhenyHhio )piperidine~l-carbonyl)benzofb lthiophen*
2-yl)urea
Figure imgf000116_0001
[0344] The title compound was prepared as described in Scheme 6. ESI-MS: m/z 523.1 (M+H)+.
EXAMPLE 41 ethyl-3-(3-(4-(3-methoxyphen\lsulfinyl)piperidine-l-carbonyl)benzofbHhioDhen-2- yliurea
Figure imgf000116_0002
[0345] The title compound was prepared as described in Scheme 6. ESI-MS: m/z 485.1 (M+H)+.
EXAMPLE 42 eth yl-3- (3-(4-(3-(trifluoromethoxy)yhen ylsulfjnyl)piperidme-l- carbonvDbenzofb ]th iophen-2-yl)urea
Figure imgf000116_0003
[0346] The title compound was prepared as described in Scheme 6. ESI-MS: m/z 539.1 (MH-H)+.
[0347] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
EXAMPLE A Enzyme Binding Assay for Hsp90 inhibitors.
A. Purification of human ACCl
[0348] Human ACCl cDNA was amplified from human liver cDNA by polymerase chain reaction using primers;
5ΑAAAGTCGACCCACCATGGATGAACCTTCTCCCTTGGCCC31 (SEQ ID NO: I) and S'AAAAGCGGCCGCCTACGTAGAAGGGGAGTCCATAGTGS' (SEQ ID NO: 2). The amplified DNA fragment was digested by restriction enzyme Sail and Notl, and cloned into pFAST-BacHTc (Invitrogen). This plasmid DNA was used for preparation of recombinant vaculovirus with BAC-TO-BAC Baculovirus Expression System (Invitrogen).
[0349] SF-9 cells were infected with the vaculovirus and cultured at 27°C for 3 days. Harvested cells were homogenized in buffer A (25 mM HEPES (pH7.5), 130 mM NaCl, 1 mM EDTA, 25 mM sodium glycerophosphate, 1 mM sodium orthovaπadate, 10% glycerol, complete protease inhibitor), and subjected to ultracentrifuge at 185700xg for 50 min at 4 0C. ACCl protein with 6xHis-tag at the N-terminal was purified from the supernatant using Ni-NTA Super Flow Gel (QIAGEN). Eluted protein was dialysed against buffer B (50 mM HEPES (pH 7.5), 300 mM NaCl, 10 mM MgCl2, 10 mM tripotassium citrate, 2 mM dithiothreitol) and concentrated using Vivaspin20 ultrafiltration tube (Sartorius).
B. Purification of human ACC2
[0350] Human ACC2 cDNA except coding region for mitochondria localization sequence was amplified from human skeletal muscle cDNA by polymerase chain reaction using primers; S'CCAGGTCGACCCGCCAACGGGACTGGGACACAAGGS' (SEQ ID NO: 3) and S'CGCACTCTCAGTTTCCCGGATTCCCS' (SEQ ID NO: 4). The amplified DNA fragment was digested by Sail and AfIII, and cloned into pFAST-BacHTa (Invitrogen). Preparation of recombinant vaculovirus, infection of the virus to SF-9 cells and purification of recombinant ACC2 protein with 6xHis-tag at the N-terminal were performed in the same method as described above.
C. Measurement of ACC activity
[0351] Malachite green solution was prepared by mixing 100 mL of solution A (0.12% malachite green in 5N H2SO4), 25 mL of solution B (7.5% ammonium molybdate) and 2 mL of solution C (1 1% TWEEN-20).
[0352] ACCl was diluted to 8 μg/mL in reaction buffer (50 mM HEPES pH7.5, 10 mM MgCl2, 10 mM tripotassium citrate, 2 mM DTT, 0.75 mg/mL fatty acid free BSA) and 10 μL diluted enzyme solution was pored into each well of 384-well clear bottom plate. Test compound was diluted in the reaction buffer and 5 μL of the compound solution was added into each well, and the mixture was incubated at 30 0C for 60 minutes.
Reaction was initiated by addition of 5 μL substrate solution (50 mM KHCO3, 200 μM
ATP, 200 μM acetyl-CoA). After incubation at 30 0C for 20 minutes, reaction was terminated by addition of 5 μL malachite green solution and absorbance at 620 nm was measured.
[0353] ACC2 was diluted to 6.4 μg/mL in reaction buffer, and the activity was measured by the same method as described for ACCl.
[0354] Percent activity at each concentration of compound was calculated from the following equation:
AbSfcnZyme + inhibitor) " ^Vg AbS^ no enZyme)
X lOO
Avg Abs(no intlibilor} - Avg Abs{ no en2yme) where Abs is absorbance, Avg is average.
[0355] Data were subjected to nonlinear regression analysis using GraphPad Prism Software (GraphPad Software Inc.) to obtain IC50 values. Enzymatic activities of selected compounds are reported in TABLE 1.
TABLE 1:
Figure imgf000118_0001
Figure imgf000119_0001

Claims

WHAT IS CLAIMED IS:
1. A compound having the formula:
Figure imgf000120_0001
or hydrate, solvate, tautomer, enandomer, or pharmaceutically acceptable salt, thereof, wherein a is 1 or 2;
Q is a selected from the group consisting of -S-, -S(O)-, and -S(O)2-;
Ring A is selected from five or six membered, substituted or unsubstituted aryl and five or six membered, substituted or unsubstituted heteroaryl;
R1 is selected from the group consisting of oxy, (Cμιo)alkoxy,
Figure imgf000120_0002
hetero(C].]o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Cj-iojalkylamino, imino, (Ci.jo)alkyl, halofCi-uOalkyl, hydroxy(C|-ιo)alkyl, carbon yl(C|-ιo)alkyl, thiocarbonyl(Cj.io)alkyl, sulfonyl(C[.ιo)alkyI, sulfmyl(Ci-ιo)alkyl, aza(C].jo)alkyl, (Ci.io)oxaalkyl, (Cι.ιo)oxoalkyl, imino(C|.ιo)alkyl, (C3.]2)cycloalkyl(Ci.5)alkyl, hetero(C3.]2)cycloalkyl(C].io)alkyl, aryl(CMo)alkyl, hetero(C].io)aryl(C|.5)alkyl, (C9-i2)bicycIoaryl(C].5)alkyl, hetero(Ca-i2)bicycloaryI(C].5)a]kyl, hetero(C].io)alkyl, (C3-i2)cycloalkyl, hetero(C3.]2)cycloalkyI, (Cg.izJbicycloalkyl, hetero(C3-i2)bicycloalkyl, (C4.]2)aryl, hetero(Cι.ιo)aryl, (C9.[2)bicycloaryl and hetero(C_).i2)bicycloaryl, each substituted or unsubstituted;
R" is substituted or unsubstituted alkyl; and
Y is CR3 or N, where R3 is selected from the group consisting of H, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci-ioJalkoxy, (Q.^aryloxy, hetero(C].io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci-ioJalkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (C].io)alkyl, haloCCMoJalkyl, hydroxyfCj-ioJalkyl, carbonyl(C].jo)alkyl, thiocarbonyl(C|.[o)alkyl, sulfonyl(C|.ιo)alkyl, suIfinyKCj.ioialkyl, aza(C[.ιo)alkyl, (Ci-io)oxaalkyl, (C|.]o)oxoalkyl, imino(C].]o)alkyl, (C3.|2)cycloalkyl(C].5)alkyl, hetero(C3.]2)cycloalkyl(C|.|o)alkyl, aryl(Ci.ιo)alkyl, hetero(C[.[o)aryl(Ci-5)alkyl, (CcMzJbicycloaryKCi-sialkyl, hetero(C8-]2)bicycloaryl(Cι-5)alkyl, hetero(Ci.io)alkyl, (C3-i2)cycIoalkyl, hetero(C3>[2)cycloalkyl,
Figure imgf000121_0001
hetero(C3-i2)bicycloalkyl, (C4.i2)aryl, hetero(C[.io)aryl,
Figure imgf000121_0002
and hetero(C4.]2)bicycloaryl, each substituted or unsubstituted.
2. The compound according to claim 1 having the formula:
Figure imgf000121_0003
wherein the ring comprising V1, V2 and V4 is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl; V1 is selected from the group consisting of CR20, NR20, N, O and S; V2 is selected from the group consisting of CR21, NR21, N, O and S; V4 is selected from the group consisting of CR22, NR22, N, O and S; wherein
R20, R21 and R22 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci-]o)alkoxy, (C4.]2)aryloxy, hetero(Ci.io)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C |.ιo)alkyl amino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(Ci.io)alkyl, hydroxy (C uiojalkyl, carbonyl(Cι.ιo)alkyl, thiocarbonyl(Cι-io)alkyl, sulfonyl(CMo)alkyl, sulfinyl(Cι-ιo)alkyl, aza(Ci.io)alkyl, (C]-!0)oxaalkyl, (Cι- 10)oxoalkyl, imino(C].]o)alkyl,
Figure imgf000121_0004
hetero(C3.]2)cycloalkyl(CMo)alkyl, aryl(C].io)alkyl, hetero(C].io)aryl(C].5)aIkyl, (Cg.πJbicycloaryKCj-sJalkyl, hetero(C8-i2)bicycloaryl(C].5)alkyl, hetero(C[.io)a!kyl, (C3.i2)cycloalkyl, hetero(C3.]2)cycloalkyl, (C9-i2)bicycloalkyl, hetero(C3.)2)bicycloalkyl, (C^^aryl, hetero(Cμιo)aryl, (C9.]2)bicycloaryl and hetero(C4.]2)bicycloaryl, each substituted or unsubstituted, or R" and R"' are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsυbstituted heteroaryl, or R" and R are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl.
3. The compound according to claim 2, wherein at least one of V1, V2 and V4 is sulfur.
4. The compound according to claim 3 having the formula: 1
Figure imgf000122_0001
5. The compound according to claim 4, wherein R30 and R21 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
6. The compound according to claim 5 having the formula:
Figure imgf000122_0002
wherein
V5 is selected from the group consisting of CR8R8' and NR8'; V6 is selected from the group consisting of CR9R9' and NR9'; V7 is selected from the group consisting Of CR10R10' and NR10'; Vs is selected from the group consisting Of CR1 1R11' and NR12'; wherein
R8, R8', R9, R9', R10, R10', R1 ' and R11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (Cj.ιo)alkoxy, (C4-] 2)aryloxy, hetero(C Mo)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (C].]0)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Cι.ιo)alkyl, halo(C].)0)alkyl, hydroxy(Cι-10)alkyl, carbonyl(CM0)alkyI, thiocarbonyl(Ci-K))aikyl, suIfonyl(Ci.[0)alkyl, sulfinyl(C].]0)alkyl, aza(C]-10)alkyl, (CM0)oxaalkyl, (Ci.10)oxoalkyl, imino(Ci.io)alkyl, (C3.i2)cycloalkyl(Cμ5)aIkyl, heteiO(C3.i2)cycloalkyl(CMo)alkyl, aryl(Ci.io)alkyl, hetero(C[.[o)arylCCi.5)alkyI, (Cg.!2)bicycloaryl(C|.5)alkyI, hetero(C8.]2)bicycloarylCC].5)alkyl, hetero(C[.[0)alkyl, (C3. ] 3)cycloalky 1 , hetero(C3.12)cycloalkyl , (C5. ] 2)bicycloalkyl , hetero(C3-i2)bicycloalkyl, (C4-12)aryl, hetero(C!.io)aryl, (C9-l2)bicycloaryl and hetero(C4-]2)bicycloaryl, each substituted or unsubstituted, provided that R8 , R9', R10 , and R1 ' may each be independently absent when the atom to which it is bound forms part of a double bond, or RB and R9 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R9 and R10 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl, or R10 and R11 are taken together, along with the atoms to which they attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
7. The compound according to claim 6, having the formula:
Figure imgf000124_0001
wherein
R , R9, R10, and R11 are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (Cι.6)alkoxy, (Ci.6)alkyl, halo(Ci-6)alkyl, hydroxy(C|-6)alkyl, aza(C].6)alkyl, (C].6)oxaalkyl, (Ci.io)oxoalkyl, each substituted or unsubstituted.
8. The compound according to claim 7 having a formula selected from the group consisting of
Figure imgf000124_0002
wherein
R8, R9 and R10 are each independently selected from the group consisting of H, halo, nitro, cyano, hydroxy, (Cι.ό)alkoxy, (Ci-eJalkyl, halo(C[.6)alkyl, hydroxy(C|.6)alkyl, aza(C[.6)alkyl, (C|.6)oxaalkyl, (CMo)oxoalkyl, each substituted or unsubstituted.
9. The compound according to claim 1 having the formula:
Figure imgf000124_0003
wherein the ring comprising V1, V2, V3, and V4 is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl; V1 is selected from the group consisting of CR4 and N; V2 is selected from the group consisting of CR5 and N; V3 is selected from the group consisting of CR6 and N; V4 is selected from the group consisting of CR7 and N; wherein
R4, R5, R6, and R7 are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (C].]o)alkoxy, (Q.i2)aryloxy, hetero(C].]o)aryloxy, carbonyl, oxycarbonyl, aminocarbonyl, amino, (Ci.io)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Ci.io)alkyl, halo(Ci.io)alkyl, hydroxy(CM0)alkyl, carbonyl(C].io)alkyl, thiocarbonyl(C[.ιo)alkyl, sulfonyl(Cl-10)alkyl, sulfinyl(CM0)alkyl, aza(Ci.]0)alkyl, (C[.[0)oxaalkyl, (Cι.io)oxoalkyl, imino(C].]0)alkyl, (C3.]2)cycloalkyl(Ci.5)alkyI, hetero(C3-i2)cycloalkyl(Ci.io)alkyl, aryl(C].]0)alkyl, hetero(C].)o)aryi(C|.5)alkyl, (Cg.]2)bicycloaryl(C[.5)alkyl, hetero(C3.]2)bicycloaryl(Ci.5)alkyl, heteiO(C].]o)alkyl, (C3-i2)cycloalkyl, hetero(C3.]2)cycloalkyl, (C9.]2)bicycloalkyl, heterofCa.^ibicycloalkyl, (G(-i2)aryl, hetero(C1-!o)aryl, (C9.i2)bicycloaryl and hetero(C4.[2)bicycloaryl, each substituted or unsubstituted, or R4 and R5 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl, or R5 and R6 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl, or R6 and R7 are taken together, along with the atoms to which they are attached, to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl.
0. The compound according to claim 9 having the formula:
Figure imgf000126_0001
wherein
V5 is selected from the group consisting of CR8R8', NR8', O, and S; V5 is selected from the group consisting of CR9R9', NR9', O, and S; V7 is selected from the group consisting of CR10R10', NR10', O, and S; V8 is selected from the group consisting Of CR11R11 ', NR1 1 ', O, and S; wherein
Ra, R8', R9, R9', R!0, R10', R" and R11 ' are each independently selected from the group consisting of H, halo, nitro, cyano, thio, oxy, hydroxy, carbonyloxy, (Ci.io)alkoxy,
Figure imgf000126_0002
hetero(C].]o)aryloxy, carbonyl, oxycarboπyl, aminocarbonyl, amino, (Cι.ιo)alkylamino, sulfonamido, imino, sulfonyl, sulfinyl, (Cj.]o)alkyl, halo(C|.|0)alkyl, hydroxy(Ci.io)alkyl, carbonyl(Ci.io)alkyl, thiocarbonyl(C]-]o)alkyl, sulfonyl (C i.10)alkyl, sulfinyl(CMo)alkyl, aza(C].]o)alkyl, (C[.[0)oxaalkyl, (C].I0)oxoalkyl, imino(C].]o)alkyl, (C3.i2)cycloalkyl(C].s)alkyl, hetero(C3.i2)cycIoalkyl(C].]0)alkyl, aryI(C].]0)alkyl, hetero(C].]o)aryl(Ci.5)a]kyl, (C9.i2)bicycloaryl(C].5)alkyl, hetero(Cg.ι2)bicycloaryl(Cι.5)aIkyl, hetero(C|.ιo)alkyl, (C3-i2)cycloalkyI, hetero(C.i.i2)cycloalkyl, (C9.i2)bicycloalkyl, hetero(C3-i2)bicycloalkyI, (C4.i3)aryl, hetero(Ci.]0)aryl, (Cg.^bicyeloaryl and hetero(Gt.i2)bicycloaryl, each substituted or unsubstituted, provided that R8 , R9 , R10 , and R11 may each be independently absent when the atom to which it is bound forms part of a double bond, or R and R are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl, or R9 and R10 are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl, or R!0 and R1 ' are taken together to form a ring selected from the group consisting of substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl.
1 1. The compound according to claim 10 having the formula:
Figure imgf000127_0001
12. The compound according to claim 10 having the formula:
Figure imgf000127_0002
13. The compound according to any one of claims 1-12, wherein a is 1.
14. The compound according to any one of claims 1-12, wherein a is 2.
15. The compound according to any one of claims 1-14, wherein Q is -S(O)2-.
16. The compound according to any one of claims 1-14, wherein Q is -S(O)-.
17. The compound according to any one of claims 1-14, wherein Q is -S-.
18. The compound according to any one of claims 1-17, wherein R2 is a substituted or unsubstituted Cj-C6 alkyl.
19. The compound according to any one of claims 1-17, wherein R2 is a substituted or unsubstituted methyl.
20. The compound according to any one of claims 1-17, wherein R2 is a substituted or unsubstituted ethyl.
21. The compound according to any one of claims 1-20, wherein R1 is selected from the group consisting of aminocarbonyl, (Ci.ιo)alkylamino, (Ci.io)alkyl, carbonyl(C].]o)alkyl, aza(Cι.]0)alkyl, (CM0)oxaalkyl, (Cι.ιo)oxoalkyl, imino(C|.l0)alkyl, hetero(C3.]2)cycloalkyl(C].|0)alkyl, (C9.]2)bicycloaryI(C].5)alkyl, hetero(Ca.]2)bicycloaryl(Ci.5)alkyl1 hetero(Cι.io)alkyl, (C3-i2)cycloalkyl, hetero(C3.]2)cycloalkyl, (C.j.]2)aryl, heteroCCμioJaryl, (C9.i2)bicycloaryl and hetero(C4.i2)bicycloaryl, each substituted or unsubstituted.
22. The compound according to any one of claims 1-20, wherein R1 is selected from the group consisting of (C1-io)alkyl, hetero(C].io)alkyl, (C4-i2)aτyl, hetero(C].]0)aryl, (C3.]2)cycloalkyl, hetero(C3-i2)cycloalkyl, (Ct).]2)bicycloaryl and heteroCC4.]2)bicycloaryI, each substituted or unsubstituted,
23. The compound according to any one of claims 1-20, wherein R1 is a (C4-i2)aryl or a hetero(Cu]o)aryl, each substituted or unsubstituted.
24. The compound according to any one of claims 21-24, wherein the (C4.i2)aryl or hetero(C].]0)aryl is selected from the group consisting of:
Figure imgf000128_0001
each substituted or unsubstituted.
25. The compound according to claim 23, wherein the (C^Jaryl and the hetero(C].io)aryl are each independently substituted with substituents independently selected from the group consisting of chloro, bromo, -CN, methyl, methoxy, phenoxy, - C(O)OCH3, -C(O)OH, -C(O)CH3, -C(O)N(CH2CH)3, -C(O)O(CH2CH)3, -NHC(O)CH3, - N(CH2CH3)3, -N(CH3J2, -NO2, -OCF3, -SCH3, -S(O)2CH3, -S(O)2NH2,
Figure imgf000128_0002
26. The compound according to any one of claims 1-20, wherein R1 is selected from the group consisting of:
Figure imgf000129_0001
27. The compound according to any one of claims 1-20, wherein R1 is selected from the group consisting of (C^bicycloaryl and hetero(C4-12)bicycloaryl, each unsubstituted or substituted.
28. The compound according to claim 26, wherein R1 is selected from the group consisting of:
Figure imgf000130_0001
29. The compound according to any one of claims 1-20, wherein R1 is a substituted alkyl selected from the group consisting of methyl, isobutyl, - CCH3)IC(O)OCH2CH3, -(CH2)2C(O)N(CH2CH3)2, -(CH2J2CF3,
Figure imgf000130_0002
30. The compound according to any one of claims 1-20, wherein R1 is a cycloalkyl or heterocycloalkyl which is selected from the group consisting of
Figure imgf000130_0003
31. The compound according to any one of claims 1-31, where in Y is N.
32. The compound according to any one of claims 1-31, where in Y is CH.
33. The compound according to claim 1 having a formula selected from the group consisting of
Figure imgf000131_0001
wherein
R1 is a selected from the group consisting of methyl, isobutyl, -(CH2J2CF3, -(CH2)2C(O)OCH2CH3, -(CH2)2C(O)NCCH2CH3)2,
Figure imgf000131_0002
Figure imgf000132_0001
R10 and R11 are each independently selected from the group consisting of (C|.6)alkyl and (Cι.6)alkoxy.
34. The compound according to claim 33, wherein R1 is a selected from the group consisting of
Figure imgf000132_0002
35. The compound according to claim 33, wherein R1 is a selected from the group consisting of
Figure imgf000132_0003
36. The compound according to claim 33, wherein R1 is a selected from the group
Figure imgf000133_0001
37. The compound according to any one of claims 33-36, wherein R10 and R1 ' are each independently methyl or methoxy.
38. A compound, or hydrate, solvate, tautomer, enantiomer, or pharmaceutically acceptable salt thereof, selected from the group consisting of
2-(4-(2-aminobenzo[b]thiophene-3-carbonyl)piperazin-l-ylsulfonyl)benzonitrile; l-(3-(4-(2-cyanophenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2-yl)-3- ethylurea; l-ethyl-S-tS-^-φhenylsulfonylJpiperazine-l-carbony^benzoCbJthiophen^- yl)urea; l-(3-(4-(benzo[d][l,3]dioxol-5-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(3-(methylsulfonyl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
1 -(3-(4-(benzo[c] [ 1 ,2,5] thiadiazol-5-y!sulfonyI)piperazine- 1 - carbon yI)benzo[b]thiophen-2-yl)-3-ethyIurea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yI)urea;
N-(3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)phenyl)acetamide;
2-chloro-5-(4-(2-(3-ethylυreido)benzo[b]thiophene-3-carbonyl)piperazin-l- yl su lfonyl)benzenesul fonamide ; l-ethyl-3-(3-(4-(3-(2-methylthiazol-4-yl)phenylsulfonyl)piperazine-l- carbon y l)benzo [b] thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(5-methyl-l,3,4-oxadiazol-2-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-C3-(2-methylpyrimidin-4-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yI)urea; l-ethyl-3-(3-(4-(3-(5-methyl-l,2,4-oxadiazol-3-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(6-morpholinopyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfonyI)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-nitrophenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(l,l-dioxotetrahydrothiophen-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-(3-(4-(3,4-dihydro-2H-benzo[b][l,4]dioxepin-7-ylsulfonyl)piperazine-l- carbonyl)beπzo[b]thiophen-2-yl)-3-ethylurea;
N-(5-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)pipera2in-l-ylsulfonyl)- 2-methoxyphenyl)acetamide; l-(3-(4-(3-acetylphenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2-yl)-3- ethylurea; l-(3-(4-(benzo[d]thiazol-6-ylsulfonyl)piperazine-l-carbonyl)benzo[b]thioρhen-2- yl)-3-ethylurea; l-ethyl-3-(3-(4-(4-(2-oxopyrrolidin-l-yl)phenylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
I-(3-(4-(3,4-dimethoxyphenylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)-3-ethylurea;
N-(4-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)phenyl)acetamide;
Ethyl 3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piρerazin-l- ylsulfonyl)propanoate; l-ethyl-3-(3-(4-(isobutylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(3,3,3-trifluoropropylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-C3-(4-(methylsulfonyl)piperazine-l-carbonyI)benzo[b]thiophen-2- yl)urea; 1 -ethyl-S-tS-C^C^tmethylsulfoπyliphenylsulfonylJpiperazine- 1 - carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyI-3-(3-(4-(2-oxoindolin-6-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydro-lH-benzo[d]imidazol-5-ylsulfonyl)ρiperazine- l-carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]oxazol-5-yIsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-oxo-2,3-dihydrobenzo[d]thiazol-5-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea;
N,N-diethyl-3-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)propanamide; l-ethyl-3-(3-(4-(3-oxo-3-(pyrrolϊdin-l-yI)propyIsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-morpholino-3-oxopropylsuIfonyI)piperazine-l- carbonyI)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfonyI)piperidine-l- carbonyl)benzo[b]thiophen-2-yI)urea; l-(3-(4-(benzo[d][l,3]dioxol-5-ylsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yI)-3-ethylurea; l-ethyl-3-(3-C4-(3-methoxyphenylthio)piperidine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-eLhyI-3-(3-(4-(3-(trifluoromethoxy)phenylthio)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-l- carbonyl)benzo[b]thioρhen-2-yl)urea; l-ethyl-3-(3-(4-(pyridin-3-ylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen-2- yl)urea; l-ethyl-3-(7-methoxy-3-(4-(6-methoxypyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(6-phenoxypyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[ύ]thiophen-2-yl)urea; l-(3-(4-(5-(diethylamino)pyridin-3-ylsulfonyl)piperazine-l-carbonyl)thieno[2,3- b]pyridin-2-yl)-3-ethylurea; l-(3-(4-(6-chloropyridin-3-ylsulfonyl)piρerazine-l-carbonyl)ben2θ[&]thiophen-2- yl)-3-ethylurea; l-(3-(4-(2-chloropyrimidin-5-ylsulfonyl)piperazine-l-carbonyl)benzo[b]thiophen- 2-yl)-3-ethylurea; l-(3-(4-(5-bromo-6-(diethylamino)pyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[ύ]thiophen-2-yl)-3-ethylurea; l-(7-cyano-3-(4-(6-(diethylamino)pyridin-3-ylsulfonyl)piperazine-l- carbonyl)benzo[b]tbiophen-2-yl)-3-ethylurea; l-(3-(4-(2-(diethylamino)pyrimidiπ-5-ylsulfonyl)piperazine-l-carbonyl)-6- methylthieno[2,3-b]pyridin-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-(quinolin-8-ylsulfonyl)piperazine-l-carbonyl)beπzo[b]thiophen-2- yl)urea; l-ethyl-3-(3-(4-(2-(naphthalen-l-yl)ethylsulfonyl)piperazine-l- carbon yl )benzo[£]thiophen-2-yl)urea; l-C3-(4-((7,7-dimethyl-3-oxobicyclo[2.2.1]heptan-l-yl)methylsulfonyl)piperazine- l-carbonyl)benzo[b]thiophen-2-yl)-3-ethylurea; methyl 2-(4-(2-(3-ethylureido)benzo[b]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)benzoate;
2-(4-(2-(3-ethylureido)benzo[ά]thiophene-3-carbonyl)piperazin-l- ylsulfonyl)benzoic acid;
MN-diethyl-2-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)benzamide;
3-(4-(2-(3-ethylureido)benzo[ύ]thiophene-3-carbonyl)piperazin-l- ylsulfonyljbenzoic acid; methyl 3-(4-(2-(3-ethyIυreido)benzo[ύ]thioρhene-3-carbonyl)piperazin-l- ylsulfonyl)benzoate;
/V,/V-diethyl-3-(4-(2-(3-ethylureido)-7-methoxybenzo[b]thiophene-3- carbonyl)piperazin-l-ylsulfonyl)benzamide;
Λr-(5-(4-(2-(3-ethylureido)benzo[i>]thiophene-3-carbonyl)piperazin-l- ylsuIfonyl)thiazol-2-yl)acetamide; ethyl 2-(4-(2-(3-ethylureido)thieno[2,3-b]pyridine-3-carbonyl)pipera2in-l- ylsulfonyl)-4-methylthiazole-5-carboxylate; l-ethyl-3-(7-methoxy-3-(4-(5-(oxazol-5-yl)thiazol-2-ylsulfonyl)piperazine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(2-methyl-4,5'-bithiazol-2'-ylsulfonyl)piperazine-l- carbonyl)benzo [b] thiophen-2-yl)urea; l-ethyl-3-(6-methyl-3-(4-(4-methyl-3,4-dihydro-2H-benzo[b][l,4]oxazin-7- ylsulfonyl)piperazine-l-carbonyI)thieno[2,3-b]pyridin-2-yl)urea; l-ethyl-3-(3-(4-(3-oxo-3,4-dihydro-2//-benzo[b][l,4]oxazin-6- ylsulfonyl)piperazine-l-carbonyI)benzo[&]thiophen-2-yl)urea; l-(3-(4-(3,5-dimethoxyρhenylsulfonyl)piperidine-l-carbonyl)-7- methoxybenzo[b]thiophen-2-yl)-3-ethylurea; l-(3-(4-(3-(dimethylamino)phenylsulfonyl)piperidine-l-carbonyl)-6- methylthieno[2,3-b]pyridin-2-yl)-3-ethylurea; l-(3-(4-(3,5-dimethoxyphenylsulfonyl)ρiperidine-l-carbonyl)benzo[b]thiophen-2- yl)-3-ethylurea; l-ethyl-3-(3-C4-(3-(morpholinomethyl)phenylsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-(3-methoxyphenylsυlfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-C4-(3-(trifluoromethoxy)phenylsulfonyl)piperidine-l- carbonyl)thieno[2,3-b]pyridin-2-yl)urea; l-ethyl-3-(3-(4-(3-(methylthio)phenyIsulfonyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-(4-Cρyridin-3-ylsulfonyl)ρiperidine-l-carbonyl)benzo[b]thiophen-2- yl)urea;
1 -(3-(4-(benzo[d] [ 1 ,3]dioxol-5-ylsulfinyl)piperidine- 1 -carbonyl)-7- methoxybenzo[b]thiophen-2-yl)-3-ethylurea; l-ethyl-3-(3-(4-C3-methoxyphenylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(3-C4-(3-(methylthio)phenyIsulFinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea; l-ethyl-3-(6-methyl-3-(4-(3-(trifluoromethoxy)phenylsulfinyl)piperidine-l- carbonyl)thieno[2,3-b]pyridin-2-yl)urea; and l-ethyl-3-(7-methoxy-3-(4-(pyridin-3-ylsulfinyl)piperidine-l- carbonyl)benzo[b]thiophen-2-yl)urea.
39. The compound according to any one of claims 1-38, wherein the compound is in the form of a pharmaceutically acceptable salt.
40. The compound according to any one of claims 1-38, wherein the compound is present in a mixture of stereoisomers.
41. The compound according to any one of claims 1-38, wherein the compound comprises a single stereoisomer.
42. A pharmaceutical composition comprising as an active ingredient a compound according to any one of claims 1-41 and a pharmaceutically acceptable excipient.
43. The pharmaceutical composition according to claim 42, wherein the composition is adapted for administration by a route selected from the group consisting of orally, parenterally, intraperitoneal^, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery, subcutaneously, intraadiposally, intraarticularly, and intrathecally.
44. A method of inhibiting acetyl CoA carboxylase (ACC) in vitro comprising: contacting ACC with the compound according to any one of claims 1-41.
45. Use of a compound according to any one of claims 1-41 for the manufacture of a medicament for inhibiting ACC
46. Use of a compound or composition according to any one of claims 1-41 for the preparation of a medicament for the treatment of a disease state
47. Use of a first compound for the manufacturing of a medicament for treating a disease state for which ACC possess activity that contributes to the pathology and/or symptomology of the disease state, wherein the first compound is convertible in vivo to a second compound wherein the second compound inhibits ACC in vivo, the second compound being a compound according to any one of claims 1-41.
48. Use of a compound according to any one of claims 1-41 for the preparation of a medicament for the treatment of a disease state for which ACC possesses activity that contributes to the pathology and/or symptomology of the disease state.
49. The use according to any one of claims 46-48, wherein the disease state is selected from the group consisting of metabolic syndrome (also known as insulin resistance syndrome, syndrome X), visceral obesity, hyperlipidemia, dysHpidemia, hyperglycemia, hypertension, hyperuricemia renal dysfunction, atheroschlerosis, type-2 diabetes, android obesity, Cushing's disease, cognitive function and ocular function.
50. The use according to any one of claims 44-45, 47-48, wherein the ACC is ACCl.
51. The use according to any one of claims 44-45, 47-48, wherein the ACC is ACC2.
52. The use according to any one of claims 44-45, 47-48, wherein the ACC is both ACCl and ACC2.
53. Use of a compound or composition according to any one of claims 1-41 for the preparation of a medicament for the treatment of metabolic syndrome.
54. Use of a compound or composition according to any one of claims 1-41 for the preparation of a medicament for the treatment of type II diabetes.
PCT/US2008/057933 2007-03-30 2008-03-21 Acetyl coenzyme a carboxylase inhibitors WO2008121592A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US90931707P 2007-03-30 2007-03-30
US60/909,317 2007-03-30

Publications (2)

Publication Number Publication Date
WO2008121592A2 true WO2008121592A2 (en) 2008-10-09
WO2008121592A3 WO2008121592A3 (en) 2009-04-09

Family

ID=39580169

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/057933 WO2008121592A2 (en) 2007-03-30 2008-03-21 Acetyl coenzyme a carboxylase inhibitors

Country Status (2)

Country Link
US (1) US20090005375A1 (en)
WO (1) WO2008121592A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102153884A (en) * 2011-02-16 2011-08-17 连云港清泰化工有限公司 Ink-type dye, and preparation method and application thereof
WO2011157827A1 (en) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
US8093248B2 (en) 2007-12-05 2012-01-10 Astrazeneca Ab (Publ) Compounds useful for the treatment of conditions associated with weight gain
EP2567959A1 (en) 2011-09-12 2013-03-13 Sanofi 6-(4-Hydroxy-phenyl)-3-styryl-1H-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
WO2015036892A1 (en) 2013-09-12 2015-03-19 Pfizer Inc. Use of acetyl-coa carboxylase inhibitors for treating acne vulgaris
EP2598486B1 (en) * 2010-07-29 2017-06-28 Novartis AG Bicyclic acetyl-coa carboxylase inhibitors

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019099457A1 (en) * 2017-11-14 2019-05-23 Quixgen, Inc. Benzodioxinone compounds

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005016909A1 (en) * 2003-08-15 2005-02-24 Astrazeneca Ab Substituted thiophenes and uses thereof
EP1911753A1 (en) * 2005-07-29 2008-04-16 Takeda Pharmaceutical Company Limited Spiro-cyclic compound
EP2009011A1 (en) * 2006-04-14 2008-12-31 Takeda Pharmaceutical Company Limited Nitrogen-containing heterocyclic compound

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005016909A1 (en) * 2003-08-15 2005-02-24 Astrazeneca Ab Substituted thiophenes and uses thereof
EP1911753A1 (en) * 2005-07-29 2008-04-16 Takeda Pharmaceutical Company Limited Spiro-cyclic compound
EP2009011A1 (en) * 2006-04-14 2008-12-31 Takeda Pharmaceutical Company Limited Nitrogen-containing heterocyclic compound

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8093248B2 (en) 2007-12-05 2012-01-10 Astrazeneca Ab (Publ) Compounds useful for the treatment of conditions associated with weight gain
WO2011157827A1 (en) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-one derivatives as inhibitors of lipases and phospholipases
EP2598486B1 (en) * 2010-07-29 2017-06-28 Novartis AG Bicyclic acetyl-coa carboxylase inhibitors
CN102153884A (en) * 2011-02-16 2011-08-17 连云港清泰化工有限公司 Ink-type dye, and preparation method and application thereof
CN102153884B (en) * 2011-02-16 2013-06-19 连云港清泰化工有限公司 Ink-type dye, and preparation method and application thereof
EP2567959A1 (en) 2011-09-12 2013-03-13 Sanofi 6-(4-Hydroxy-phenyl)-3-styryl-1H-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
WO2015036892A1 (en) 2013-09-12 2015-03-19 Pfizer Inc. Use of acetyl-coa carboxylase inhibitors for treating acne vulgaris

Also Published As

Publication number Publication date
US20090005375A1 (en) 2009-01-01
WO2008121592A3 (en) 2009-04-09

Similar Documents

Publication Publication Date Title
US7981904B2 (en) Acetyl CoA carboxylase inhibitors
JP5386350B2 (en) Indazole and isoindole derivatives as glucokinase activators
US8669249B2 (en) Poly (ADP-ribose) polymerase (PARP) inhibitors
US8530499B2 (en) Glucokinase activators
JP5513492B2 (en) Glucokinase activator
EP1812439B1 (en) Kinase inhibitors
US8173645B2 (en) Glucokinase activators
JP5140577B2 (en) Hydroxysteroid dehydrogenase inhibitor
JP5302012B2 (en) Glucokinase activator
EP2133349B1 (en) Kinase inhibitors
JP5363350B2 (en) MAPK / ERK kinase inhibitor
US20050250829A1 (en) Kinase inhibitors
WO2007075847A2 (en) Glucokinase activators
WO2008121592A2 (en) Acetyl coenzyme a carboxylase inhibitors
WO2009146034A2 (en) Mapk/erk kinase inhibitors and methods of use thereof
US7550598B2 (en) Kinase inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08744227

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08744227

Country of ref document: EP

Kind code of ref document: A2