WO2008119827A1 - Transreplicase constructs - Google Patents

Abstract

The present invention relates to multifunctional nucleic acid constructs based upon components from an alphavirus, wherein a first expression unit encodes a replicase and a second expression unit encodes a heterologous gene of interest and wherein said expression units are uncoupled with regards to the expression of the replicase and the template-specific RNA synthesis of the heterologous gene of interest providing an amplification in trans by the replicase of the second expression unit. The first expression unit furthermore does not provide for any self-amplification thereof thereby limiting the amount of the replicase in the cell. The present invention also relates to vaccines, such as DNA vaccines comprising these nucleic acid constructs as well as to second medical uses of these vaccines.

Description

TRANSREPLICASE CONSTRUCTS

Field of the invention

The present invention relates to the field of vaccines, and in particular to the field of nucleic acid vector based vaccines encompassing viral components.

Background of the invention.

A majority of viruses infecting vertebrates have RNA genomes. The RNA viruses replicate their genomes and synthesize their mRNAs by the aid of a specific enzyme, replicase, having the essential RNA-dependent RNA polymerase (RdRp) activity, which is encoded by the viral genome. Their replication does not involve DNA intermediates. In general, RNA viruses typically have small genomes, being from 5 to 30 kb or kbp. The genomic RNA can be double-stranded (dsRNA) or single stranded (ssRNA). The viruses with ssRNA genomes are further divided into positive and negative strand RNA viruses. The viruses with single genomic RNA molecule (non-segmented genomes) as well as with several genomic RNA molecules (segmented genomes) are known.

Two features are common for all positive-strand RNA viruses of eukaryotes - they always replicate in the cytoplasm of infected cells and the replication is always membrane- associated. In addition, it is presumed that the replication process of these viruses involves synthesis of dsRNA molecule which is typically localized inside of the membrane bound replicase complex. Replicases of all positive-strand RNA viruses are capable of synthesizing negative strand RNAs on the positive-strand genomic RNAs and new positive strands on the negative strand RNA templates. Replicases of some positive- strand RNA viruses are also capable of synthesizing specific subgenomic mRNAs from the negative strand and use them for expression of certain viral proteins. The mechanisms of the initiation of synthesis of subgenomic RNAs are different for different viruses. The most common mechanism involves the recognition of a specific sequence, a subgenomic promoter, on the negative-strand RNA.

The catalytic part of the replicase, RdRp, is usually a relatively compact protein with a "right hand fold", which is typical for all polymerases. In the case of some viruses, it has been shown that that unit is capable of initiating the synthesis or even synthesize the full length RNA on the template. However, it is not capable to carry out the full set of reactions, required for RNA replication. Therefore functional replicase complexes of positive strand RNA viruses contain also additional to RdRp subunits, other functional activities/domains. The size of virus-encoded part of RdRp complexes varies from approximately 100 kDa to nearly 800 kDa, wherein the number of virus-encoded subunits varies from one to sixteen. In cases of some viruses the replicase complex is formed initially by one virus-encoded protein precursor, which is later converted into smaller, matured protein subunits.

Alphaviruses represent a relatively small group of enveloped positive-strand RNA viruses, which belong to the family Togaviridae. Semliki Forest virus (SFV) is one of the best studied members of this genus. The sequence of a SFV replicase protein is given in SEQ ID NO:1. Alphaviruses infect vertebrate hosts and are generally transmitted by arthropods, mainly mosquitoes. Laboratory stains of SFV, as well as those of related alphavirus - Sindbis virus (SIN), are considered non-pathogenic for humans and have been extensively studied for already more than three decades.

The genomic RNA of alphaviruses (1 1.5 kb for SFV) is a positive single-stranded RNA, often designated as 42S RNA for SFV. It can be divided into two parts: the 5' two-thirds encode for non-structural proteins nsP1 , nsP2, nsP3 and nsP4, which are required for RNA replication; and the 3' one-third of the genome encodes for the structural proteins: C, E3, E2, 6K and E1 , which are expressed exclusively from subgenomic (SG) RNA which is often designated as 26S RNA for SFV. Both 42S and 26S RNA molecules are of a positive polarity having a 5'-terminal cap structure (m7GpppA) and 3'-terminal poly(A) tail structure similar to eukaryotic mRNA molecules (reviewed by Strauss and Strauss, 1994).

Alphaviruses can infect a variety of cell types, including non-dividing cells. Similar to all positive sense RNA viruses, alphaviruses replicate exclusively in the cytoplasm of the infected cells. Upon delivery to the cytoplasm, the viral RNA serves as mRNA for the translation of ns-proteins. In the early phase of infection the 5' two-thirds of the 42S RNA are translated into a precursor polyprotein P1234, which is then autocatalytically cleaved into P123 and nsP4, yielding the early RNA polymerase responsible for the minus-strand RNA synthesis. After cleavage of P123 into nsP1 , nsP2, and nsP3, in turn the minus strand is used as template for the subsequent synthesis of new 42S RNA plus strands, as well as 26S RNAs (reviewed in Kaariainen and Ahola, 2002) (Figure 1 ). This means that the specific post-translational processing by the viral protease modulates the properties of biological functions of the replicase complexes, however, it is unclear how this process is regulated.

The translation of 26S RNA leads to the production of structural proteins, which are synthesized as a single polypeptide precursor C-E3-E2-6K-E1. The final stage of virion assembly and release by budding is triggered by specific interaction between the newly formed capsid and the cytoplasmic tails of the SFV glycoproteins at the plasma membrane of infected cell. Replication cycle ends by release of over 300 new virions and the death of the host cell.

During the whole course of viral infection the replication of alphaviruses is highly regulated. The minus strand RNAs are synthesized only during the first few hours of infection and their synthesis requires continuous translation (Sawicki and Sawicki, 1980). In contrast, positive stranded RNAs are synthesized throughout the infection and their synthesis continues even after the addition of protein synthesis inhibitors (reviewed in Kaariaϊnen et al., 1987). This behaviour was explained by differences in the composition of polymerase complex and thus the switching the template preference. When P123 is cleaved into mature nsP1 , nsP2 and nsP3, they, in turn, together with nsP4 form the late positive-strand RNA synthesizing complex, responsible for the synthesis of full-length genomic RNA and a SG mRNA (Figure 1 , Lemm et al., 1994; Shirako and Strauss, 1994; Lemm et al., 1998; Kim et al., 2004). Thus, alphaviruses encode only four ns-proteins, which are required for the replication of viral genome and transcription of the SG RNA. However, the Replication Complexes appear to include cellular proteins and assemble on cellular organelles. The RNA synthesis takes place in the cytoplasm of infected cells and is associated with endosomal membranes.

At late stages of infection, translation of cellular mRNAs and viral ns-proteins is suppressed (Gorchakov et al., 2004, Mclnerney et al., 2005). The most likely candidate for this function is nsP2 a multifunctional protein, which in SFV is 798aa, 86kDa, which has several important functions in RNA synthesis and polyprotein processing and localizes both in the cytoplasm and nuclei of the infected cells (Peranen et al., 1990). It has been directly shown that nsP2 is also responsible for cytopathogenicity in infected vertebrate cells by inducing transcriptional shut off. Mutations mapped to C-terminus of nsP2 both in SIN and SFV leaded to significant reduction of virus induced cytopathic effect, possible affecting the apoptosis, the basic death mechanism in alphavirus infection (Perri et al., 2000). The pathway(s) by which nsP2 induces these effects are poorly or not at all understood. Typically in infected cells the cellular translation is silenced by 3-4 h post-infection, and a few hours later the translation of viral genomic RNAs is blocked as well. The silencing of the translation of the viral RNA-s is obviously needed in order to block the excess of expression of non-structural proteins from the newly synthesized genomic RNA strands. These molecules are very abundant in host cells and in late infection the copy number is as high as 200 000 molecules per cell. This shutdown does not affect the synthesis of viral RNAs as once formed, the wild type replicase complexes of SFV in vertebrate cells are very stable and facilitates the synthesis and subsequent translation of SG mRNAs. These molecules are also extremely abundant with a copy number over 500 000 molecules per cell and serve as almost the only active mRNAs at the late translation (Figure 2).

The properties of the alphaviruses make them attractive as tools for development of transactive replicase systems. These properties are:

1. Ability to synthesize minus-strand and double-strand RNA from the specific recombinant viral genomic RNA as replication intermediates, which serve as templates for synthesis of the SG and genomic mRNA. Replication intermediates can serve as inductors of innate immune response.

2. Simple, efficient and powerful synthesis of the mRNA(s), which takes place on the cytoplasmic membranes and therefore can be detected by cellular sensors for innate immune response.

3. Ability to bind to mRNAs, containing corresponding sequence elements, activate their translation, stabilize them and/or form complexes, which can also be recognized by components of innate immune response.

Thus, depending of cell type and intent of the users these systems can be used for high level expression of selected proteins, for activation of cellular (and organism level) responses needed for induction of powerful and protective immune response or for both of these purposes.

Alphavirus based vectors demonstrate high expression levels of heterologous proteins in a broad range of host cells. A lot of features, such as rapid production of high-titer virus stocks, broad host range, including a variety of mammalian cell lines and primary cell cultures and high RNA replication rate in the cytoplasm accompanied by extreme transgene expression levels, lead to the development of broad range of vectors from SFV (Liljestrόm and Garoff, 1991), SIN (Xiong et al., 1989) and VEE (Davis et al., 1989).

Typical disadvantages of the alphavirus based vectors are their short-term expression mode and cytotoxic effects on host cells by inducing shutdown of cellular biosynthesis and apoptosis as a result of very aggressive viral replication. On the other hand, these properties can be considered as useful under certain conditions, for example in anti- tumour and anti-microbial immunotherapy (Riezebos-Brilman et al., 2006). The alphavirus induced cell death can also contribute to highly efficient immune response often achieved by the use of alphavirus vectors. It has been demonstrated that efficiency of immune response caused by recombinant alphavirus vector does not necessarily correlate with the level of antigen expression. It has been shown that the activation of the innate immune response, most likely due to the formation of double-stranded RNA replication intermediates in alphavirus infected cells, significantly contributes to the development of strong adaptive immune response (Leitner et al., 2006). It has also been demonstrated that alphavirus vectors induce strong T-cell responses by use of the cross-priming rather than direct priming (Huckriede et al., 2004).

To overcome problems of the short term expression of the gene of interest and cytotoxic effects caused by the alphavirus vectors replication, less cytopathic vectors capable of extended replication have been constructed for both SIN and SFV. So far all mutations resulted in reduced cytotoxicity were located in nsP2 gene (Agapov et al., 1998; Perri et al., 2000, Tamm et al., 2008). However, it is known, that mutations and deletions in nsP3 (Tuittila et al., 2000; Vihinen et al., 2001 ; Galbraith et al., 2006) and mutations in nsP1 (Ahola et al., 2000; Zusinaite et al., 2007) could also be used to create less cytopathogenic vectors.

The naked genomic RNA of positive strand RNA viruses, synthesized in vitro or by DNA dependent RNA polymerases in the cell, is infectious. Therefore, compared to other groups of RNA viruses, the reverse genetics and development of expression vectors, based on positive strand RNA viruses has been relatively straightforward. It has resulted in a large number of expression vectors, which have been used for basic studies of the viruses, for various biological studies and for bio- and gene technology applications. The largest amount of publications in the art is about construction and usage of alphavirus- based expression vectors.

There are today several different commonly used ways for constructing expression vectors based on alphaviruses: 1. Replicon vectors which are also called non-replicating expression vectors. In replicon vectors, the region coding for viral structural proteins has been replaced by a multiple cloning site. As a result, these vectors retain the entire non-structural region as well as the natural SG (subgenomic) promoter. Packaged alphavirus-like particles are produced by co-transfection of in vitro transcribed replicon RNA and a helper-RNA, encoding for structural proteins (Liljestrόm and Garoff, 1991 ; Bredenbeek et al., 1993). 2. Vectors expressing foreign protein as a component of the viral polyprotein, also named replication-competent vectors. An example of such a vector is a SFV vector carrying a marker gene in the nsP3 region (Tamberg et al., 2007).

3. Vectors containing duplicated subgenomic promoter(s) and/or IRES elements for the expression of a set of marker genes. These vectors are constructed either as replicon vectors or as replicating vectors (Boorsma et al., 2003; Kiiver et al., 2008).

4. Viruses with natural segmented genomes represent specific cases in that respect that all (or almost all) coding sequences of some (or several) components can be substituted with a gene of interest rendering them suitable for expressing foreign proteins in a host. Such expression system has been developed for bi-segmented nodaviruses and is disclosed in for example US 6,869,780.

All the four vector systems can be used for the transfection of the cells by three different methods: 1. In the form of plasmids wherein the 5' end of genome is placed at the start site of a strong promoter (often called layered vectors). The original viral RNA is transcribed in the nucleus from the plasmid, but then transported into the cytoplasm, where it is capable of initiating full replication cycle of the viral or replicon genome (DiCiommo et al., 1998; Boorsma et al., 2003, Marillonnet et al., 2005). 2 In the form of in vitro transcribed RNA transcripts (Liljestrόm and Garoff, 1991).

3. In the form of virions (replicating vectors) or packaged replicons (virus like particles (VLP-s), for replicon vectors).

In general the replication of the virus or the replicon vector does not depend on the pathway used for its introduction, but is influenced by other factors. Interaction with the antiviral intracellular defence mechanisms recognizing genomes and/or the intermediates of the viral genome replication can have a considerable impact. In the case of plasmid vectors, using transcription in cellular nucleus, modifications known to affect transcription and nuclear export of the RNA have also been shown to have significant impact on the recombinant protein production (Boorsma et al., 2003).

Most types of alphavirus vectors known in the art are characterized by high levels of transgene expression. However some systems have a relatively low expression level. It is also possible to further enhance the expression of target genes by the use of so called capsid enhancer sequences. Earlier reports noted that in BHK cells, infected with SFV based packaged replicons, the yield of recombinant β-galactosidase was approximately 50 μg per 1000000 cells, which was far below the amount of capsid protein produced in virus-infected cells. This difference was found to be due to the presence of an "enhancer" sequence located in native 26S SG RNA at position 25 nucleotides downstream of the start codon for capsid protein. The use of the same sequence in replicon vectors stimulates translation and the foreign protein expression about 10-fold (Sjoberg et a!., 1994; Sjoberg and Garoff, 1996).

All current alphavirus-based systems represent self-replicating RNA molecules. This means that the viral proteins required for RNA amplification, i.e. the replicase, and for the synthesis of the mRNAs for the genes of interest, are produced from the same RNA molecule, meaning that they act in cis. This system is very attractive and has been repeatedly used for different pre-clinical experiments as a carrier of a recombinant vaccine, carrier of the agents with immuno-modulatory properties (different cytokines, such as lnterleukin (IL) genes), primer or booster for immunization, direct anti-cancer agent, carrier of genes with anti-oncogenic properties etc.

In a large variety of experiments, the alphavirus based systems have produced good results. Despite these apparent successes the use of alphavirus based systems, in living organisms in vivo has, however, remained mostly on the level of academic research. This is due to several factors which, on their own or in combination, hamper the use of this very promising system. These factors amongst others are biological safety issues. Alphaviruses have the potential to cause severe diseases such as rush, arthritis and encephalitis. Due to the current Chikungunya virus outbreak of unprecedented magnitude (causing since 2005 over 2 million infections) which is ongoing in Indian Ocean territories, the safety concerns with any alphavirus based system will be likely to increase. In the case of using replicating vector systems, the safety issue is obvious and can be attributed to the vector as such as the vector represents a recombinant virus capable of replication and spread. Furthermore, in the case of replicon system the main safety risk is genetic recombination between the replicon RNA and RNA(s) from the packaging system which may result in reconstruction of infectious virus.

Another problem is the costs associated with the production of the viral vaccine.

Production of VLP by the use of replicon vectors system is expensive even without GMP facility service. The costs are high because of the costs of RNA synthesis reagents. The reduction of costs by the use of packaging cell lines is generally not possible since no good packaging cell line, certified for production of products for human medicine, is currently available. However even this approach will not solve the basic problems related to the functioning of alphavirus based expression vectors. One of these problems is instability. In theory, the use of packing cell lines or replicating vectors can significantly reduce the cost for particle preparation. However, two new concerns immediately arise. First, during the amplification and especially if multiple amplification cycles is used, all virus vectors and especially those with RNA genomes tend to lose the inserted gene(s), since they have no value for virus replication (Tamberg et al., 2007). Second, since RNA viruses lack proofreading function, the viral RNA itself, and inserted sequences as well, will undergo rapid point-mutagenesis. In the case of inserted genes, it usually means a loss of function. In the case of the alphavirus vectors it can mean reversion or compensation of almost any introduced mutation in the vector. Mutations are usually introduced in order to change the properties of the replicon or replicating vectors. (Zusinaite et al., 2007).

Another problem is pseudotyping. It has been recently described that genomic RNA of alphaviruses self-incorporates itself into the membranous particles generated by membrane proteins of heterologous viruses. This phenomenon has been described for G- protein of vesicular stomatitis virus and for gag-env proteins of several retroviruses, including lentivirus (Piver et al., 2006). This pseudotyping does not depend on any package signal in alphavirus genome and its mechanism is not understood. It could be so that in fact alphavirus replicase complexes, not the genomic RNAs, are packaged and released from infected cells. Due to the lack of requirement of specific signals in the RNA sequence, it is more than likely that alphavirus genomes, and/or replicase complexes, can be pseudotyped with membrane proteins of many, possibly all, enveloped viruses. There is no known way to prevent this co-packaging and as result infected cells do release infectious particles containing alphavirus genetic material. These particles are capable of infecting new cells, e.g. in essence they represent infectious virus and accordingly represent a potential biohazard. Therefore, expression of any envelope protein from any heterologous viruses by an alphavirus self-replicating vector is dangerous and may even become prohibited. This will exclude the possibility to use standard alphavirus systems from a list of potential carriers of influenza virus membrane proteins, or any other enveloped virus.

Yet another problem with alphavirus vectors known in the art is the use of coupled replication and expression. All positive-strand RNA virus vectors ultimately rely on the replication of the RNA molecules. At the same time the replicase itself is expressed from the very same RNA. This property seriously limits the use of mutagenesis of the replicase proteins in order to change the properties of the alphavirus vectors, which is commonly done to limit cytotoxicity or regulate the expression time or the expression level of the vector. This is due to the fact that in self-replicating system, any mutation has inevitably multiple effects wherein even a small change in virus replication may initiate a chain of events. Accordingly, a small reduction of the RNA binding will slightly suppress the RNA replication which in turn will mean less replicase protein which in turn will mean even less replication. Often this may result in drastic changes of the biological properties of the vectors and always generates strong selection pressure towards the elimination of unfavourable changes.

To a certain extent these problems can be solved by the use of DNA based plasmids instead of packaged virions (VLP-s) or infectious RNAs (DiCiommo and Bremner, 1998), however, the use of alphavirus vectors in the form of plasmid DNA-s have been shown to generate other problems with regards to nuclear transcription and splicing. For example, SFV RNA has been adopted for replication in the cytoplasm of infected cells and does not naturally interact with the cellular splicing system. As a result, it contains no natural introns but only a very large number of cryptic splicing sequences. It may be noted that at least 27 splicing donor sites and 24 splicing acceptor sites are found in the SFV replicase region. This has at three important consequences which are that the expression of the full sized mRNA, the replicon itself, is likely to be severely reduced due to the lack of true splicing. Since the RNA is self-replicative, this does not represent a real problem in cells where at least few correct transcripts are produced. However, it has been shown that improvement of the viral RNA processing by adding an intron sequence will significantly increase the number of cells where replication is initiated (Boorsma et al., 2003). It is also logical to assume that a lot of products resulting from cryptic splicing will be generated. They will be released from the nucleus and since they also have sequences required for replicase recognition, they can be amplified by the SFV replicase. This will inevitably reduce replication of the correct RNA sequences and has a potential for generation of RNA molecules, in essence defective interfering (Dl)-genomes, with unpredictable properties. Furthermore, the transport of the transcripts from the nucleus depends upon the presence or absence of splicing. This may result in different, and possibly incorrect, subcellular localization of the transcripts which are not spliced. As a result, the level of transcription may be high, but the replication is initiated by a small fraction of synthesized RNAs.

Hence, it is an object of the present invention to overcome the disadvantages and problems shown to be associated with alphaviral vectors available in the art by providing a vector that is safe to use generating a solid immunological response with less side effects than vectors available in the art, furthermore providing an excellent tool for vaccine technology by assuring high level of expression of the antigen and at the same time activating, through replication intermediates, type I interferons, intracellular antiviral responses as well as activating the innate immune response.

Summary of the invention The aim of the present invention is to provide multifunctional nucleic acid constructs meeting the needs still present in the art. This aim is achieved by providing a nucleic acid construct which comprises a nucleic acid sequence encoding a first and a second expression unit, the first expression unit comprising a functional replicase from an alphavirus, and the second expression unit comprising an heterologous gene of interest, wherein said replicase transcribed and translated from the first expression unit induces template-specific RNA synthesis of the second expression unit, but does not induce amplification of itself. Accordingly, the RNA synthesis from the second expression unit is uncoupled from the expression of the replicase from the first expression unit. These characteristics of the nucleic acid construct according to the invention, provides for a controlled amount of the replicase in the cell reducing any side effects associated with too high amounts thereof, while at the same time ensuring adequate expression levels of the gene of interest resulting in an immune response associated therewith. The present invention also relates to vaccines comprising the nucleic acid constructs according to the invention together with excipients and/or a carriers, as well as to methods for producing the constructs and the vaccines. Medical uses of these constructs and vaccines are also disclosed herein.

Brief description of the drawings

Figure 1 shows a schematic overview of alphavirus genome organization, replication process and protein synthesis. Processing of the non-structural polyprotein results in the formation of a short-living RdRp complex with the ability to synthesize negative strands (RC-minus) and, subsequently, RdRp complex for synthesis of new genomes and subgenomic RNAs (RC-plus).

Figure 2 shows translational shutdown in cells infected with SFV. The high levels of synthesis of viral structural proteins is detected at 3 h post infection, from the 4 h post infections these are almost the only mRNAs used for the protein synthesis (picture from Tamberg et al., 2007).

Figure 3 shows the amino acid sequence of the SFV replicase. The sequences overlapping with those included in some of the replicating template RNAs are underlined. The N-terminal amino acid residues of nsP2, nsP3 and nsP4 are in boldface. Arginine residue 71 , which is selected as site for insertion of intron, is given in bold and underlined.

Figure 4 shows the basic design of Replicating Template (RT) constructs, i.e the second expression unit according to the invention. Open arrow indicates start site of genomic promoter of the virus (5' position of the positive strand of genomic RNA), arrow filled with grey indicates the start site of SG promoter.

A. Construct in its DNA form (the rest of the plasmid, including selection marker, replication origin etc are not shown). Arrows and numbers above the construct indicate the sub-units 1 , 2, 3P and 4 used for construction of this expression unit, these designations of sub-units are used for identification of different Replicating Templates (RT's). For example, the RT-124 indicates that this construct comprises subunits 1 , 2 and 4. Subunit 3 has two different variants: 3P (as shown in figure) comprises SG promoter, capsid enhancer and FMDV 2A component; 3M (not shown specifically in the figure) consists only from sequences of SG promoter.

B. mRNA produced by cellular transcription/splicing system processed by activity of HDV ribozyme. The full-length positive RNA produced by the RdRp from the first expression unit has identical sequence, the full-length negative RNA, produced by RdRp is complementary to that mRNA (except that it may lack polyU sequence, complementary to polyA in mRNA and has one extra G-residue at 3' end)

C. mRNA produced by RdRp from SG promoter (more precisely, by internal initiation on the region, corresponding to subgenomic promoter, in negative strand of the RNA presented at Fig 4B. This RNA is produced only if the sequence corresponding to SG promoter is present in the construct. Used abbreviations: UTR - untranslated region; CSE - conserved sequence element, FMDV - foot and mouth disease virus, HDV - hepatitis delta virus.

Figure 5 shows the basic design of the first expression unit for expression of an alphavirus replicase construct. A. Construct in its DNA form (the rest of the plasmid, including selection marker, replication origin etc are not shown).

B. Corresponding mRNA produced by cellular transcription/splicing system. 5' cap and 3' polyA sequences are indicated.

Figure 6 shows an alignment of artificial wild-type replicase with inserted intron and sequence encoding for native wild type SFV replicase. Example of codon-optimized artificial trans-replicase sequences aligned to native wild-type SFV replicase coding sequence. Heterologous rabbit beta-globin gene derived intron sequence is inserted into the artificial replicase sequence (shown in lowercase).

Figure 7. Immuno-staining of the cells transfected with SFV replicon vector pCMV-SFV-RL and with trans-active replicase construct pRSV-SFV-Rluc. Cells were stained by use of anti nsP1 (upper) or anti nsP3 (lower) antibodies. Note the characteristic peri-nuclear localization of bright dots (SFV induced cytopathic vacuoles) and characteristic plasma- membrane location of nsP1.

Figure 8. Expression of nsP1 by trans-replicase in RD cell line (upper) and in swine epidermis (lower). Expression of nsP1 was revealed by immunostaining with anti-nsP1 antibody, nuclei were stained with DAPI.

Figure 9 shows the Rluc activity of wild type trans-replicase pRSV-Nsp1234 in comparison with the nsP2 NLS-mutated trans-replicase pRSV-AAA. The Rluc activity was measured in RD cell lines 19 h after co-electroporation of replicase vectors and replicative template.

Figure 10 shows a demonstration of the inability of trans-replicases with GAA mutation in nsP4 active site to support SG promoter activation from RT-123M4-Rluc template.

Figure 11 shows a schematic map of the trans-replicase vectors expressing both replicase template (with Renilla luciferase markergene) and the replicase.

Figure 12 shows the expression of Rluc marker by trans-replicases and expression controls. Each time point represent an average of three samples, error bar represents standard deviation.

Figure 13 shows a comparison of Rluc activity by trans-replicase vectors with different promoters in COP-5 cell line 24 h post transfection.

Figure 14 shows a comparison of Rluc activity by trans-replicase vectors with different promoters in B16F0 cell line 24 h post transfection.

Figure 15 shows a comparison of Rluc activity by trans-replicase vectors with different promoters in RD cell line 19 h and 66 h post transfection. Figure 16 shows a comparison of Rluc activity by trans-replicase vectors with different promoters in HaCat cell line 17 h and 41 h post transfection.

Figure 17 shows a comparison of Rluc activity by wild type trans-replicase vectors with different promoters (phEF1 aHTLV-SFV-Rluc, pRSV-SFV-Rluc, phelF4A1-SFV-Rluc), NLS-mutant (phelF4A1-AAA-Rluc) and canonical layered pCMV-SFV-wt1-Rluc-Rz vector in COP-5 cell line 24 h and 48 h post-transfection.

Figure 18 shows a comparison of Rluc activity by Type I and Type Il replication templates in the absence (empty columns) and in the presence of the trans-replicase expressed by pRSV-Nsp1234 (grey columns). Error bars represent standard deviation.

Figure 19 shows the activation of interferon-β synthesis by wild type trans-replicase vectors with different promoters (pRSV-SFV-Rluc, phelF4A1-SFV-Rluc, phEFIaHTLV- SFV-Rluc), NLS-mutant (phelF4A1-AAA-Rluc) and canonical layered pCMV-SFV-wt1- Rluc-Rz vector in COP-5 cell line. 10 ng, 200 ng and I OOOng of vector DNA-s were electroporated and the amount of interferon-β were measured 24 h, 48 h and 72 h post- transfection from collected media.

Figure 20. Co-localization of nsP1 protein and dsRNA in RD cell line. Cells were transfected with phEF1 aHTLV-SFV-Rluc trans-replicase and immunostained 24 h post transfection with anti-nsP1 (upper left panel) and anti-dsRNA (lower left panel) antibodies. DAPI reagent was used for visualization of nuclei (upper right panel). In lower right panel is merged images.

Figure 21 shows IFN-γ ELISPOT values for each individual mouse, designated as G1 M0...G1 M4 for conventional vector and G2M0...G2M4 for trans-replicase vector.

Figure 22 shows IFN-γ ELISPOT mean values for groups of mice immunized with conventional and trans-replicase vectors.

Figure 23 shows mean values of spots produced in ELISPOT test of mice immunized with conventional vector and trans-replicase vector.

Figure 24 shows IFN-γ ELISPOT values for each individual mouse, designated as G1 M0...G1 M4 for conventional vector and G2M0...G2M4 for trans-replicase vector Figure 25 shows IFN-γ ELISPOT mean values for groups of mice immunized with conventional and trans-replicase vectors.

Definitions In the present context, a "nucleic acid construct" refers to one or more DNA or RNA based vectors or plasmids which carries genetic information in the form of a nucleic acid sequence. The terms "plasmid", "vector" and/or "expression vector" may be used interchangeably herein referring to a nucleic acid construct according to the invention. The nucleic acid construct is transformed and/or transfected, meaning that it is in some manner introduced, into a host cell, such as an eukaryotic cell, e.g a human host cell, wherein it may first be transcribed by the cell machinery or by an exogenous component added together with the nucleic acid construct thereby generating a RNA template. This is followed by further transcription and/or replication by the aid of an endogenous and/or exogenous source, such as an enzyme. A nucleic acid construct according to the invention, may encode one or more heterologous and/or homologous genes of interest being also accompanied by various regulatory sequences forming part of such an expression unit, which is named herein the second expression unit. The nucleic acid construct according to the invention also encodes components which will aid in amplifying the one or more gene(s) of interest present therein, such as in the present context a replicase from an alphavirus with an RNA dependent RNA polymerase activity. Also this part of the nucleic acid construct, named herein the first expression unit, may encompass various regulatory sequences to regulate the expression of this component of the construct. Accordingly, the nucleic acid construct according to the present invention, comprises a first and a second expression unit, which are further defined herein.

As used herein, the term "expression unit" or "expression cassette" refers to one or more units present in one or more nucleic acid constructs which are characterised by either comprising nucleic acids encoding one or more heterologous genes of interests accompanied by various regulatory sequences, as further exemplified herein, or by comprising a nucleic acid sequence encoding an element which aids in the amplification of the expression unit comprising the one or more genes of interest. In the present context "the first expression unit" refers to the unit encoding the replicase from an alphavirus, such as Semliki Forest Virus, carrying the activity of a RNA dependent RNA polymerase, and the "second expression unit" refers to the unit encoding the one or more heterologous gene(s) of interest. The second expression unit encoding the heterologous gene of interest is also referred to herein as the "template RNA" or the "replicating template RNA". The second expression unit may or may not further comprise one or more SG promoter(s). Both the first and the second expression units may comprise regulatory sequences aiding in the regulation of the expression from these expression units.

In a nucleic acid construct according to the invention, the expression of the replicase from the first expression unit is uncoupled from the replication of the replicating template from the second expression unit, wherein furthermore the replicase does not amplify its own RNA template transcribed from the first expression unit. Thereby, the levels of expression from the first and the second expression unit may be different and may be regulated separately, as further explained herein.

Accordingly, the replicase expressed from the first expression unit may act in trans to amplify the template RNA generated from the second expression unit this amplification taking place in the cytoplasm of the transfected cells. This also means that the levels of expression from the first expression unit and the second expression unit may be different, as the replicase expressed from the first expression unit appears to facilitate a full or partial replication cycle for the replicating template and thereby aids in the elevation of the expression from the second expression unit, but not in the amplification of itself. This will ensure an adequate level of replicase (having RNA dependent RNA polymerase activity) in the cell as compared to the levels of the protein expressed from the gene of interest which may preferably be higher to produce adequate levels of the antigen to generate an immunological response in the cell.

An "RNA dependent RNA polymerase" or an "RdRp", is an enzyme that catalyzes the replication of RNA from an RNA template. A "functional replicase" is defined herein as an enzyme that is capable of providing this function by having an RdRp activity. A replicase is a polymerase enzyme that catalyzes the replication of specific RNA. They are commonly encoded by the virus genomes which have a RNA genome. Accordingly, a replicase provides the function of an RNA dependent RNA polymerase, but also further comprises additional sub-units providing other functions of the viral replicase to complete the full cycle of replication of the genome. In the context of the present invention, the replicase is sometimes referred to as a "trans-replicase", due to its trans-activity in the nucleic acid construct according to the invention.

An "element required for amplification of transcripts from the first expression unit in the cytoplasm by said replicase" is lacking in the first expression unit of the nucleic acid construct according to the present invention. This means that there are no sequences therein that will aid in the specific binding of the replicase thereto, thereby avoiding that the replicase amplifies itself. Examples of such sequences are given herein, and may be present in the second expression unit.

A "template RNA" or a "replicating template RNA" as defined herein is a nucleic acid sequence encoding one or more heterologous genes of interest optionally accompanied by various regulatory sequences, which template is amplified by RNA synthesis provided by the replicase, and also by the aid of the cell machinery of the host cell to which the nucleic acid construct has been administered. The "template RNA" may also be referred to as the "replicase template". For the RNA synthesis to occur by the aid of the replicase, nucleic acid sequences required for the specific binding of the replicase to the template are required to be present. Such nucleic acid sequences are further exemplified herein. The template RNA is encoded by the second expression unit.

A "gene of interest" as provided herein refers to a gene that encodes a peptide or a protein which is exogenous to the host to which the nucleic acid construct is provided, generating when introduced therein a response such as an immune response to this gene of interest once it is translated. Examples of preferred genes of interest to be included in the nucleic acid construct according to the invention, is further exemplified herein. The gene of interest is also referred to herein as a "heterologous gene of interest", which term is well known to the skilled person. The product obtained from a gene of interest may also be referred to as an "antigen".

The term "template-specific RNA synthesis" refers to the RNA synthesis and amplification of this transcript expressed from the second expression unit provided by the replicase. To aid in the binding of the replicase to the template, specific nucleic acid sequences are provided with the template RNA to induce this binding. These nucleic acid sequences are not present in the first expression unit encoding the replicase, to avoid self-amplification of this expression unit by the replicase.

The term "replication" refers to amplification of a nucleic acid sequence, being in the form of an RNA or DNA, for example mRNA, to yield a second DNA or RNA molecule. Such amplified RNA, e.g. mRNA, can be further translated to yield a protein. Hence, the term "expression" comprises the events of replication and/or transcription, sometimes referred to as amplification of a nucleic acid sequence, being in the form of DNA or RNA which finally ends up in translation yielding a protein. Accordingly, sometimes, the term

"amplification" may be used, and should be interpreted as encompassing amplification of a nucleic acid sequence by transcription, replication and/or production of encoded protein(s) on the level of translation.

A "mutation" as referred to herein, constitutes a deletion, substitution, insertion and/or specific point mutation that has been performed in a nucleic acid sequence to enhance the performance of a nucleic acid construct according to the invention. Specific mutations introduced into the expression units according to the present invention are further exemplified herein.

A "promoter", is a regulatory region located upstream towards the 3' region of the anti- sense strand of a gene, providing a control point for regulated gene transcription. The promoter contains specific DNA sequences, also named response elements that are recognized by transcription factors which bind to the promoter sequences recruiting RNA polymerase, the enzyme that synthesizes the RNA from the coding region of the gene. The term "promoter" should not be confused with the term "SG promoter" or "subgenomic" which is further described herein.

An "intron" as used herein, is defined as a non-coding section of precursor mRNA or other RNAs, that has been removed, i.e. spliced out of the RNA before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are also known as introns.

A "subgenomic promoter" or "SG promoter" is herein defined as a genetic element from a positive strand RNA virus. In contrast to a "promoter", a subgenomic promoter is used by the replicase of the virus and not by the cellular RNA polymerase. A subgenomic promoter of alphaviruses represents an internal region of the viral RNA, which in the negative strand, or possibly in double-stranded replicative form of the genome, binds the replicase and allows internal initiation of the transcription resulting in synthesis of a positive strand RNA molecule 3' co-terminal with positive strand genome of the virus.

The term "capsid enhancer", refers to a RNA sequence encoding the first approximately 30 amino acid residues of the N-terminus of a capsid protein of alphaviruses. This RNA sequence folds into stable hairpin structure and facilitates translation of subgenomic RNA of alphaviruses at the late stages of infection when translation of cellular RNAs and viral genomic RNAs are downregulated by alphavirus. The term "polylinker" refers to a short DNA sequence containing several restriction enzyme recognition sites that is contained in cloning vectors and is used for the possibility to include genes of interests into a vector.

The term "poly(A)tail" refers to a sequence of adenine nucleotides that are added to the 3' end of some primary transcript messenger RNA molecules in eukaryotes during post- transcriptional processing. In the present invention the term "poly(A) tail" also refers to a sequence of adenine nucleotides presented at the 3' end of positive strands of RNAs of alphaviruses.

The term "ribozyme" or an RNA enzyme, is a RNA molecule that acts as an enzyme, and is often found to catalyze cleavage of either its own or other RNAs. It has also been found to catalyze the aminotransferase activity of the ribosome.

The term "eukaryotic termination signal" refers to a nucleic acid sequence found in the end of a gene which when read by the RNA polymerase transcribing the gene, will stop the synthesis of RNA. In case of the synthesis of mRNA the signal activates the release of mRNA from transcription complex and its downstream modifications, including poly(A) tail synthesis. Typically the eukaryotic termination signal comprises an AAATAAA sequence and sequences surrounding that element.

Detailed description of the invention

The problems in the prior art associated with vectors based upon components from RNA viruses have been described in the above. The present invention aims at overcoming these disadvantages by providing novel nucleic acid constructs which are based upon the concept that the amount of the replicase from an alphavirus, such as SFV, expressed from a first expression unit, and the amount of the gene of interest expressed from a second expression unit are kept separate, providing for separate regulation of these units. The replicase will provide for an enhanced expression of the gene of interest, but will not amplify itself.

Accordingly, in the present invention, the advantages and easiness of design, construction and production of a recombinant nucleic acid construct for a genetic vaccine are combined with the ability of a replicase from an alphavirus, such as Semliki Forest Virus, to initiate cytoplasmic replication of a replicating template encoding the gene of interest thereby producing high levels of the mRNA encoding the gene of interest. Furthermore, replication intermediates generated by the replicase from the replicating template encoded by the second expression unit in the form e.g. of double stranded RNA or RNA species with 5'-triphosphate in the cytoplasm trigger the induction of type I interferons, therefore mobilizing cellular antiviral responses which further activate the innate immunity and adaptive immune response against the antigen of a certain pathogen. Another benefit of the system according to the invention is as previously mentioned herein the possibility to use the full coding capacity of the replicating RNA molecule from the second expression unit and separate it from the non-replicating part forming the first expression unit.

One explanation for a mechanism for how the replicase expressed from the first expression unit acts, but without wishing to be bound by this theory, is that it acts in the cytoplasm, finding through 5'- and 3' terminal sequences and internal sequences the template RNA and initiating a complete or partial replication cycle of the template RNA in trans. When the (-)-strand of this template is generated, it forms double stranded RNA with the original template. In the second phase, the replicase uses this double stranded or (-) strand RNA as a template to generate the mRNA(s) encoding the gene(s) of interest. Replicase and/or replication process can further facilitate the translation of these mRNAs by these mechanisms, generating expression of this at the level of protein.

Thus, in essence the nucleic acid constructs according to the invention will rely on the functioning of the a viral replicase, such as a SFV replicase, in trans in contrast to in cis functioning which is common in similar standard systems, such as SFV replicon systems. The role of the replicase is to amplify the mRNA encoding the gene of interest, or mRNAs encoding for different genes of interest. The production of mRNAs will take place at a high level and may occur in the cells where synthesis of other RNA-s and proteins is suppressed. The levels of mRNA expression and the duration of their synthesis may be regulated by changes in the replicase expressing module.

Alphaviruses are RNA viruses which replication often results in the formation of Dl- genomes. Dl genomes do not encode a functional replicase and replicate by using the fra/is-activity of the replicase complex of the full-size virus. Hence, these viruses have a preference for trans replication of its targets, thereby rendering them especially suitable for use in a nucleic acid construct according to the present invention. Furthermore, the replicase of the alphavirus is capable of synthesizing subgenomic RNAs which have additional benefits over these wherein replicase can only synthesize genome-length RNAs. This property provides easy means to express the protein of interest or, if several of such promoters are used, a set of proteins of interest. It also allows making the expression of gene of interest replicase expression dependent, thus contributing to the safety of such vectors.

Accordingly, the present invention will be able to solve essentially all the problems listed in the above. Firstly, since the system may be constructed as a plasmid, then its propagation, production and purification can be done in a GMP facility designed for DNA purification which will reduce the production costs. Furthermore, since the mRNA for replicase is not replicated, then there will be no biosafety concerns. The only replicating molecule will be the template RNA encoded by the second expression unit, and there will be no possibility for its recombination with the replicase encoding RNA due to the change of codon usage. Furthermore, the reconstruction into an infectious virus is not possible as structural proteins of the virus are not part of this system. The co-packaging of the replication complex into pseudotyped virions will no longer represent a problem or danger. Even if these particles are formed they can not initiate productive infection since they lack the ability to encode replicase, but they may have the activity required for synthesis of mRNA for the gene of interest in subsequently infected cells. Thus, if the pseudotyping will still take place, it will only serve as a beneficial property of the system. Furthermore, the mutations introduced in the replicase will be stable since the replicase is only produced by transcription of the DNA template in the nucleus. This excludes the possibility for reversion and/or compensation of any introduced mutation. Also, since the replicase may be produced by transcription of the DNA template then the mutations in the replicase gene will have effects only on the replication and transcription of the template RNAs, but not on the production of the replicase itself. Therefore it will be possible to use a variety of mutations of the replicase to change its activity or its effects on the cellular metabolism.

Problems with cellular shut down will be minimized by using a nucleic acid construct according to the invention due to a variety of reasons. Firstly, replicase complexes of SFV have been shown to be very stable and the synthesis of mRNA by these complexes is not affected by suppression of cellular transcription. Also, in natural infection the expression of the replicase is self-limited as well. In essence, all replicase complexes are formed within the first 3-4 h post-infection, which is before the shutdown of cellular transcription/translation, because: i) expression of replicase proteins is subjected to shutdown as well; ii) change of polyprotein processing pattern will inhibit the replicase complex formation at later times of infection. Additionally, the shutdown, if it takes place, is beneficial for the translation of the template mRNA forming the second expression unit of the nucleic acid construct. Accordingly this phenomenon facilitates the functioning of the system. The production of double stranded RNA molecules in the form of replicating template-RNAs from the second expression unit and the death of transfected cells by apoptosis will be certainly beneficial if the system is used for gene vaccination since it will provide additional effect to immunogenity due to engagement and activation of the innate immune system.

Hence, the difference between vectors available in the art and the vectors according to the invention lies in the fact that as mentioned in the above, expression of the replicase from the first expression unit is separate from the template specific RNA synthesis of the second expression unit furthermore not providing for the replicase to amplify itself. The effect linked with this difference is that the levels of the replicase are kept at levels which will significantly reduce any toxic effects upon the cells of the host to whom the nucleic acid construct has been administered, while at the same time providing ample amount of the gene of interest generating a protein or a peptide, which will provide a solid immune response thereby providing an excellent tool for a vaccine.

Accordingly, in a first aspect, the present invention relates to a nucleic acid construct comprising a first and a second expression unit, wherein the first expression unit comprises a nucleic acid sequence encoding a functional replicase of an alphavirus which expression unit lacks a nucleic acid sequence encoding an element required for amplification of transcripts from said first expression unit by said replicase, and the second expression unit comprises a nucleic acid sequence encoding a template RNA comprising a heterologous gene of interest, which is flanked by elements required for template-specific RNA synthesis of transcripts from said second expression unit by said replicase expressed from said first expression unit and wherein said replicase transcribed from the first expression unit induces template-specific RNA synthesis of an RNA transcribed from the second expression unit, but does not induce amplification of said first expression unit.

By a nucleic acid sequence "corresponding essentially" to a nucleic acid sequence is meant a nucleic acid sequence having at least 80% identity with the specific sequences disclosed herein, such as at least 80, 83, 85, 87, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% identity with the sequences disclosed herein. This means that the sequences may be altered in the manner that they may have been extended by the addition of nucleic acids, or they may have been shortened by the removal of nucleic acids, alternatively the sequence may have been altered by manner of mutations in the sequences in the form of deletions, insertions, substitutions and/or point mutations. All such variations are covered by the present invention. These variations in identity apply also to any amino acid sequences disclosed herein.

"Cis-sequences", also referred to herein as "cis-elements" or "cis-active elements", are needed for the replicase to bind to mRNA to initiate replication and/or transcription thereof. Hence, such a region may be described as a region of specific nucleic acid sequences, which are required for the replicase to bind to this part of the template RNA encoded by the second expression unit. These sequences are not present in the first expression unit. Consequently, the replicase will not bind to the replicase mRNA, and no amplification of the first expression unit by the replicase will take place. This is one of the main characteristics of the present invention aiding in the limitation of the amount of the replicase present in the cell. Hence, these signals are avoided in the first expression unit of the nucleic acid construct according to the invention, so that the replicase will not bind to its own mRNA initiating amplification thereof. Instead, these sequences may be present in the second expression unit of the nucleic acid construct, to encourage binding of the replicase thereto.

The cis-sequences are different for different viruses. However, for all known RNA viruses they comprise unique conserved terminal sequences of the genomic RNAs of particular viruses. They can also comprise sequence elements inside of the genome, wherein in the case of alphaviruses, there are two such sequences, which are the region between 178- 228 bp of SFV which is an activator of replication, and region of SG promoter being needed for 26 SG RNA synthesis.

Examples of c/s-sequences which may be incorporated into the second expression unit of the nucleic acid construct are given below (components 1-3).

Component 1 : A region of 85 b long: 5' end of the SFV genome

ATGGCGGATGTGTGACATACACGACGCCAAAAGATTTTGTTCCAGCTCCTGCCACCT

CCGCTACGCGAGAGATTAACCACCCACG (SEQ ID NO:28) Component 2: 51 b long cis-sequence. For SFV it maps to region 178-228 b from the 5' end of genome and has the following sequence:

GCAGGTCACACCAAATGACCATGCAAATGCCAGAGCATTTTCGCACCTGGC (SEQ ID

NO:29)

This structure folds into two hairpin containing secondary structure elements which are most likely the true sequences required for replicase.

Component 3: 3' end of the SFV genome AGCTTAATTCGACGAATAATTGGATTTTTATTTTATTTTGCAATTGGTTTTTAATATTTC C(A)n (SEQ ID NO:30)

(A)n is a poly(A) track consisting of at least 20 A-residues, wherein in actively replicating sequences it should preferably be longer, such as 40 or more residues. The sequence upstream of this component be can somewhat truncated from the 5' end. In the case of SIN (Sindbis Virus) at least 19 virus-specific residues upstream of poly(A) is preferable.

In a preferred embodiment of the invention, the first expression unit encoding a replicase lacks a region which essentially corresponds to SEQ ID NO:28, 29 and 30. In one embodiment, this region is the 5' untranslated region of the RNA virus genome which is used in a nucleic acid construct according to the invention. This region is also given in component 1 in the above.

The alphavirus Semliki Forest Virus (SFV) is especially preferred in the context of the present invention. In one embodiment, the said alphavirus is an SFV isolate which is SFV4. In one embodiment of the invention, the native sequence encoding a wild type replicase of Semliki Forest virus is used for the first expression unit of a nucleic acid construct according to the invention (SEQ ID NO:7).

In one embodiment of the invention, the first expression unit has the structure as given in Figure 5. In one embodiment of the invention, the second expression unit has the structure as given in Figure 4. Figure 11 shows an exemplary structure of a nucleic acid construct comprising the first and the second expression unit. As the skilled person readily understands, the first and the second expression unit may also be inserted into other nucleic acid vector backbones.

In another embodiment of the invention, the native sequence encoding wild type replicase of Semliki Forest virus with one or more artificially inserted intron(s) is used for the production of a replicase from the first expression unit. Such a sequence is given in SEQ ID NO: 8. Data from BHK cells, demonstrating that both types of replicase expression constructs boost expression from a RT-123M4-Rluc template (see definition in the below) and thereby are capable to replicate and transcribe the RNA template encompassing the gene of interest is provided in the experimental section in the below.

In the present context, the virus-encoded part of an alphavirus replicase is expressed in the form of a P1234 polyprotein by the use of mRNA generated from a cellular promoter. The literature indicates that in the case of self-replicating vectors the use of a strong promoter led to an increase of the number of cell producing protein of interest (Boorsma et al., 2003). However, a key factor of the present invention is that the nucleic acid construct producing the mRNA which encodes the protein P1234 forming the replicase does not contain any sequences responsible for the binding of the replicase thereto, alternatively these will be removed in the process of codon optimization, and therefore does not replicate serving exclusively as template for the transcription and translation of the replicase. This will ensure that the level of the replicase in the cell remain at a suitable level to provide its purpose, but in an amount which would reduce harmful side effects.

SFV replicase can amplify templates up to 13 kb in length. Usually the replicase itself will take more than half of that size. By removal of the replicase region from replicating expression RNA-s it will be possible to clone and express proteins and polyproteins with much larger size than it can be done by use of standard SFV replicon vectors. In a nucleic acid construct according to the present invention, the sequence encoding the replicase can be re-written. It is needed to enhance the protein expression, to reduce the homology with sequences included in the expression mRNAs and to eliminate the problems with cryptic splicing. To enhance the expression of replicase RNA and to facilitate its transport from the nucleus to cytoplasm a strong intron sequence may be included in the replicase region, as further explained herein. The same intron may be introduced in a similar position of the template RNA to achieve similar splicing of these molecules and increase the possibility of co-transport and subsequently their co-localization in cytoplasm of transfected cells.

The ability of the alphavirus replicase to act on the templates provided in trans is well known. The system for VLP production is dependent on that property of the replicase. Similarly, the functioning of existing packaging cell lines use the same phenomenon. It has also been demonstrated already in 1994 that the replicase of SIN expressed in form of P1234 from non-replicating mRNA by the use of a vaccinia virus expression system can efficiently replicate any suitable template containing the appropriate cis-elements provided in trans. (Lemm et al., 1994). In addition, it was demonstrated that when a subgenomic promoter was included in the template RNA then the replicase was capable to synthesize correct mRNA molecules as well. Thus, the replicases of alphaviruses are active in trans. However, all these works were done by use of systems where mRNA for the replicase expression was produced in the cytoplasm of the cell and all these systems involved either the use of self-replicating replicon RNA or recombinant heterologous viruses, capable of replication on their own. Thus, in contrast to the nucleic acid construct according to the present invention, these systems were not virus free.

So far the vaccinia virus based system remains the only system, wherein the expression of replicase and template RNA of alphaviruses has been successfully uncoupled. Since this system contains a heterologous virus it can not be used for any other purposes than just academic research. The use of this system would require co-administration of the recombinant vaccinia virus and a nucleic acid construct or several vaccinia viruses. The problem with the use of that system is that compared with the effects caused by vaccinia virus itself any additive effects from alphavirus based system would be small, if detectable at all. Thus, there would be no additive value, only added biosafety concerns. Additionally the alphavirus replication in this system can not be long term or efficient - vaccinia virus is very toxic to cells and kills them more rapidly than wild type alphavirus does.

Some basic concern with the expression of SFV replicase has been the mRNA modification during its processing and transport out of the nucleus. Most likely this is the reason why the vaccinia based system is the only one which does express artificial and active replicase from non-replicating RNA-s as the vaccinia system does not use nuclear transcription and RNA modification. A way to overcome this problem and to achieve higher and better expression of the gene of interest is to change the codon usage of the replicase protein, by eliminating the cryptic splicing sites and including efficient introns into the coding region of the replicase and template RNA.

High expression level of the replicase may be needed and may be achieved by the use of a strong promoter, codon optimisation, removal of the cryptic introns and/or the use of a standard intron placed in the coding region of the replicase. Examples of such modifications are further exemplified herein.

Our experiments have identified that the SFV replicase has, at least to some extent, cis- preference. In the case of the wild type replicase the synthesis of subgenomic RNAs is about 10-fold higher if the subgenomic promoter is placed inside the template RNA compared to the situation when the same subgenomic promoter is provided by different replicating molecule. The difference increases significantly, if certain mutations are introduced in SFV replicase sequence (see below) (Tamm et al., 2008). To eliminate or rather minimize this effect, the cis-elements for replicase binding are removed from the construct expressing the replicase. Therefore, there will be no competition between cis- and trans- activities since the replicase can not any more bind to its own mRNA and, accordingly, the replicating template RNA represents the only RNA to which replicase can specifically bind.

A nucleic acid construct based upon the alphavirus replicase system according to the invention, have several benefits for immunization and vaccine development. Among these advantages are the generation of the replicating RNA-s and double-stranded RNA molecules which will activate the innate immune response. In this respect the replicase system will be similar to the standard self-replicating, such as a standard alphavirus vector system. Furthermore, alphaviruses do not cause shut-down of glycosylation and transport and processing of glycosylated proteins as these properties will be maintained in the replicase system according to the invention. This feature is important for the expression of highly modified envelope proteins of different viruses. The replicase system can be optimized to achieve the expression conditions, such as expression levels, expression time and metabolic status of the transfected cells, which are optimal for the formation of highly ordered structures from the expressed proteins. Such structures (like VLP (Virus Like Particles)-s) can be accumulated in cells in the case of antigens from non-enveloped viruses or budded out from transfected cells in the case of membrane antigens of enveloped virions.

The replicase according to the invention can be expressed by the use of any DNA dependent RNA polymerase system, including cellular and viral systems. According to the present invention the expression system based on nuclear transcription mediated by cellular RNA polymerase Il are described as they are most straight-forward and best suited for expression of therapeutic genes in in vivo conditions. For cell culture applications, the use of alternative transcription systems, such as T7 RNA polymerase based, can be envisaged.

The RNA transcript, representing the templates for the replicase may represent either positive (sense) strand or negative (antisense) strand RNAs. The positive strand RNA is RNA in which the cis-elements have the same polarity as in the genome of the corresponding virus or DI-RNA. The inserted gene(s) of interest are in a positive orientation, wherein the RNA contains the corresponding open reading frame. This orientation is in most cases the preferred orientation of the primary transcript. These transcripts can be directly translated and if the ORF of the gene of interest is accessible for the translation machinery, the corresponding protein can be produced even in the absence of the replicase. Negative strand RNA is RNA in which the cis-elements have the opposite or the complementary polarity compared to that of the genomic strand of the corresponding virus or DI-RNA. The inserted gene of interest is also presented in complementary orientation (corresponding ORF is not present in negative RNA). Therefore, the primary transcripts made on DNA plasmid can not function as mRNAs for the gene of interest. This property may be useful if the leakage i.e. the expression of the gene of interest from primary transcripts is to be avoided.

Accordingly, in one embodiment of the present invention, a nucleic acid construct is envisaged wherein said first expression unit encodes a replicase obtained from an alphavirus, such as SFV, which comprises a single open reading frame encoding the alphaviral non-structural proteins nsP1 , nsP2, nsP3 and nsP4 preceded by a cellular promoter and ended by a termination signal, wherein the RNA transcribed from said first expression unit does not contain any nucleic acid sequences required for interaction with or binding of said replicase. In one embodiment thereof, said replicase gene expressed generates a single precursor P1234 protein. In another embodiment, said P1234 protein is a wild-type protein. In yet another embodiment, said P1234 protein is mutated.

A variety of cellular, viral and hybrid promoters can be used for the expression of a functional replicase, some examples which are given in the experimental section. The preferred promoter for in vivo applications is selected based on the properties thereof, such as its tissue specificity, strength etc. For some applications, such as in cell culture, inducible/repressable promoters, such as tetracycline regulated promotes, could be used.

Any termination signal, which is compatible with a polymerase used for transcription of the region of the nucleic acid construct comprising the replicase can be used for this first expression unit. Transcription terminators of cellular genes or genes of DNA genomic viruses, transcribed by the use of cellular RNA polymerase Il can be used.

In some embodiments, additional regulatory elements are added into the first expression unit encoding the replicase. These regulatory elements comprise, but are not limited to, a 5' un-translated region between the start site of the promoter region and initiation codon of the replicase. This leader sequence does not originate from the alphavirus used in the nucleic acid construct envisaged, as it is one of replicase binding regions. Alternatively, the leader can be substituted with functional IRES element. The intiation codon for replicase ORF (Open Reading Frame) should be placed in a strong Kozak context, which would ensure the active translation initiation from this codon. In other embodiments, the first expression unit additionally comprises sequences used for stabilization or destabilization of the transcribed RNA, facilitating nuclear-cytoplasmic transport of the produced mRNA and other units, which affect the mRNA synthesis, processing, transport, translation and stability which effects are beneficial for the system.

In one embodiment, an artificially constructed sequence of the replicase is used. An artificial sequence encoding the wild type replicase of SFV (non-structural polyprotein nsP1234) was designed and synthesised from protein sequence data of the SFV replicase (non-structural protein) (Genbank ace no. AJ251359). Among aspects taken in consideration during the design of the DNA sequence was the codon usage which was optimised to human preferred codon usage and heterologous, rabbit beta-globin gene derived intron sequence with a modification in the splice donor site was inserted into the coding sequence. This was done to generally improve mRNA processing and production of the replicase protein. In addition, the same intron inserted into replicating RNA templates could ensure that both the replicase and the template mRNAs are processed and transported by similar ways in the cell. It could increase the probability of co- localization of the replicase protein and the template in the cytoplasmic compartment. Furthermore, TATA-boxes, chi-sites and ribosomal entry sites, AT-rich or GC-rich sequence stretches, ARE, INS, CRS sequence elements, repeat sequences, RNA secondary structures, (cryptic) splice donor and acceptor sites, branch points were avoided in the sequence to enhance expression of the mRNA level encoding the replicase. This is done to ensure for efficient and more controlled expression in mammalian cells. All these elements are avoided because these can downregulate the expression independently of the promoter used. This sequence of resynthesized SFV replicase is provided in SEQ ID NO:9 and its comparison with the native coding sequence in Figure 3.

The second expression unit in a nucleic acid construct according to the present invention, may in other embodiments of the invention, further comprise one or more of the following components: a) a promoter, b) a 5' region of the genomic RNA region from the RNA virus employed, c) an intron sequence, d) a subgenomic promoter region, e) a capsid enhancer, f) a polylinker for the gene of interest, g) a 3' Non Translated Region of the RNA virus employed, h) a poly(A) tail, i) a ribozyme sequence and/or j) an eukaryotic termination signal. In one embodiment, one or more of said components are artificially constructed, such as by recombinant or synthetic technologies. In a preferred embodiment, the second expression unit further comprises at least components a, b and 9-

Component a) may be selected from a variety of promoters, such as a CMV promoter or a LTR promoter of a retrovirus, but is not limited thereto. In a preferred embodiment, the promoter is a CMV promoter.

Component b) is defined as a region to which the replicase has its binding specificity directed to. The structure of this section will vary depending on which alphavirus is used as a basis for the nucleic acid construct according to the invention. In a preferred embodiment, this region corresponds essentially to a region comprising the nucleic acid sequence given in SEQ ID NO:28.

In one embodiment, components a) and b) together correspond to the nucleic acid sequence essentially as disclosed in SEQ ID NO:2.

In preferred embodiments of the invention, the nucleic acid construct also comprises one or more intron(s) obtained from various suitable sources, lntrons may be present in either of or both the first and the second expression unit. When an intron is present in both the first and the second expression unit, they may comprise the same or essentially the same nucleic acid sequence, or they may constitute different nucleic acid sequences. In one embodiment, more than one intron sequence is present in the second expression unit for the gene of interest. In another embodiment, more than one intron sequence is present in the first expression unit. In one embodiment, such an intron is obtained from the rabbit beta-globin gene, such as the large intron sequence. In a preferred embodiment of the invention, component c) corresponds essentially to a nucleic acid sequence encoded by SEQ ID NO:3. It is to be noted that any intron may be used, wherein preferably it is of limited size and well and correctly spliced.

In one embodiment, a subgenomic promoter is added to the second expression unit of a nucleic acid construct according to the invention, wherein the first expression unit encodes a replicase from an alpha virus. The length of the subgenomic promoter affects the expression level, in general truncated promoters produce less mRNA. If several subgenomic-promoters are used to drive synthesis of several mRNA-s, then their relative activities may be fixed by changing the lengths of the SG promoters. Hence, in one embodiment of the invention, the length and the amount of subgenomic promoters are varied. Additionally, the presence or absence of a capsid translational enhancer can be used to change the expression level of protein of interest encoded by the nucleic acid construct according to the invention. Furthermore, in one embodiment IRES elements, Internal Ribosomal Entry Site elements, the sequence elements used by eukaryotic ribosomes and translation initiation factors for initiation of translation in a 5' cap-structure independent manner are used instead of a subgenomic promoter.

In one embodiment, the EMCV (Encephalomyocarditis Virus) IRES is used in the second expression unit according to the invention.

The present inventors have demonstrated that the EMCV IRES is especially active in SFV infected cells (Kiiver et al., 2008). The expression from the subgenomic promoter(s) in a vector according to the invention can also be regulated by changes in the replicase proteins of SFV. Component d) corresponding to a subgenomic promoter region, may also be selected from different alpha viruses for use in the present context. A nucleic acid sequence encoding a capsid enhancer, component e), may also be selected from the same or a closely related alphavirus used in a nucleic acid construct according to the present invention.

A nucleic acid sequence corresponding to the polylinker for cloning the gene of interest, component f) may be designed based on the purpose.

A nucleic acid sequence encoding a 3' Non Translated Region of the alphavirus employed, component g), originates from the same or a closely related virus or from Dl RNA.

A nucleic acid sequence encoding a poly(A) tail, component h) may comprise of as many A residues as one regards suitable for the purpose.

A nucleic acid sequence encoding a ribozyme sequence i) may be selected from Hepatitis Delta Virus (HDV), viroids, satellite RNAs and/or may be artificially designed. In one embodiment, said ribozyme structure is a hepatitis delta virus antisense ribozyme structure.

A nucleic acid sequence encoding an eukaryotic termination signal, component j), may be selected from any terminator of a cellular gene or gene of a DNA virus, transcribed by cellular RNA polymerase. Thus, eukaryotic termination signals from genes of human, or viruses of human and primates (e.g. SV40, retroviruses) may be used. In a preferred embodiment, components d), e) and f) together correspond essentially to a nucleic acid sequence disclosed in SEQ ID NO:4.

In a preferred embodiment of a nucleic acid construct according to the invention, components d) and f) together correspond essentially to the nucleic acid sequence as disclosed in SEQ ID NO:5.

In yet another preferred embodiment according to the invention said components g), h), i) and j) together correspond to the nucleic acid sequence essentially as disclosed in SEQ ID NO:6.

The second expression unit encoding the replicating template RNA comprises at least the minimal set of cis-sequences which are required for the recruitment of a replicase to said second expression unit accompanied by a full RNA replication process, which full RNA replication process comprises at least the synthesis of full-length RNA with opposite polarity and new chains with the same polarity as template. The structure of an embodiment of the second expression unit is given in Figure 4.

In some embodiments, the cis-elements used for template replication of the second expression unit originate from the same virus which replicase is encoded by the first expression unit. In other embodiments, the cis-elements originates from a heterologous virus which may be from the same virus genus or family, such as genus alphavirus for SFV based trans-active RdRp or alternatively from natural or artificially generated Dl- RNA, or they may be synthetic sequences. A combination of elements with different origins can also be used. Thus, the present invention encompasses the use of any sequences which is capable to act as a cis-sequence for replication, which cis-sequence is recognized and used by the replicase for amplifying the second expression unit. Some examples of cis-sequences that may be used in the context of the present invention are described in Frolov et al., 2001 disclosing cis-elements of SIN by the replicase of SFV.

The cis-elements of viral origin may have different length, and may contain any number of changes such as substitutions or deletions, as long as the combination of the length and the introduced changes, such as a mutation, allows for the amplification or replication of the second expression unit by the use of the replicase encoded by the first expression unit.

In addition to the cis-sequences, required for the amplification or the replication of the second expression unit encoding the template, the template may contain a cis-sequence or sequences for the synthesis of additional RNA species, which are hereafter herein named subgenomic promoters and subgenomic RNAs, respectively. Similar to the sequences described in the above, the subgenomic promoters may be of another origin than the replicase encoded by the first expression unit, of a different length and may contain alterations, such as mutations, substitutions and deletions, which do not compromise their ability to function in the replicase system according to the invention. Examples are given in Hertz J. M and Huang, V. H., 1992 and J virol. 66:857-864.

In some embodiments, the RNA template or the second expression unit comprises additional elements required for the expression of the gene of interest as well as and co- and/or post-translational modifications of the translation product obtained therefrom. Such elements comprise, but are not limited to, a capsid enhancer sequence of alphaviruses, foot and mouths disease virus 2A autoprotease, and IRES elements. Examples of sequences of such elements are given herein.

In other embodiments, the cDNA corresponding to the template RNA comprises a polylinker sequence to facilitate the cloning of a gene of interest. In some embodiments, replicating template RNAs are introduced into cells as mature RNAs, in which case they are prepared in vitro, or made by cytoplasmic transcription for example by the use of co-expressed RNA polymerases from bacteriphages. However, in practical gene vaccination approaches the DNA constructs encoding for template RNA usually contains elements required for expression by cellular RNA polymerase II. In some embodiments, it also contains elements which are needed for processing the ends of the transcript and/or intron(s) to facilitate splicing and transport from the nucleus to the cytoplasm. Such elements comprise e.g. a promoter for RNA polymerase II. In theory any element acting as promoter can be used. However, since for the initiation of the replication by trans-replicase the localization of the 5' cis-element in precise positions, which most typically is at the 5' end of RNA, is required, the promoters with fixed initiation site, located downstream from the promoter consensuses, are preferred. However, most viral replicases tolerate a few extra nucleotides at the 5' end of the RNA. Furthermore, transcriptional terminators may be placed downstream of the point corresponding to the 3' end of the replicating template RNA. The distance between the 3' end of the replicating template RNA and the transcription terminator can vary depending on the properties of the trans-replicase and the presence of the other elements for production of the correct 3' ends of the transcript. Additionally, ribozyme sequences, such as hepatitis delta virus ribozyme, can be positioned at the 3' region of the template RNA so that the cleavage by the ribozyme will release the 3' end of the transcript suitable for the replicase. Most typically this represents the exact 3' end of the replicating RNA molecule, however in some cases extra nucleotides at 3' end are permitted.

In some embodiments, intron or introns of different origin(s) are introduced in different positions of the first or the second expression unit. Similar to the ribozyme(s), intron(s) are not obligatory, but may increase the efficiency of the system. Other elements, affecting transport, stability and degradation of the transcripts made in the nucleus can be also included.

In some embodiments, these components optionally forming a part of the nucleic acid construct according to the invention are artificially constructed. This means that they may be produced by any suitable molecular methods method available in the art, such as recombinant techniques.

In one embodiment, wherein the nucleic acid construct according to the invention is based upon an RNA virus which is an alphavirus, such as SFV, the gene of interest is cloned into a second expression unit which comprises c/s-sequences needed for interaction with the replicase expressed from the first expression unit.

In one embodiment, this RNA comprises the 5' end region of the SFV genomic RNA 307 b region or slightly shorter, an intron sequence (SEQ ID NO:34), a subgenomic promoter region of SFV (positions -150/+51 with respect to the start site of transcription (SEQ ID NO:35) and the 3' end of the SFV genome together with a polyA tail comprising preferably at least 20 A-residues (SEQ ID NO:36). This component will be placed under control of a CMV promoter and will be followed by a hepatitis delta virus ribozyme structure (SEQ ID NO:37). The gene of interest in the second expression unit may, but is not required to, be cloned under the control of a subgenomic RNA promoter. Therefore it will not be efficiently translated from the CMV promoter transcript itself but instead it will be expressed by the use of SFV replicase, which will copy first the negative strand of the template RNA and then subgenomic imRNA for the gene of interest. This embodiment is given in Example 1.

The 275 b fragment SEQ ID NO:31 is present only in constructs without intron and sg- promoter. The differences are due the cloning. In most commonly used templates, the RT-123M4- the 5' end of the SFV is finally 307 b long

In constitutes from the following: a. SFV part in fragment 1 (up to EcoRV site used for cloning) ATGGCGGATGTGTGACATACACGACGCCAAAAGATTTTGTTCCAGCTCCTGCCACCT CCGCTACGCGAGAGATTAACCACCCACGATGGCCGCCAAAGTGCATGTTGATATTGA GGCTGACAGCCCATTCATCAAGTCTTTGCAGAAGGCATTTCCGTCGTTCGAGGTGGA GTCATTGCAGGTCACACCAAATGACCATGCAAATGCCAGAGCATTTTCGCACCTGGC TACCAAATTGATCGAGCAGGAGACTGACAAAGACACACTCATCTTGGATATC (SEQ ID NO:32) b SFV part surrounding intron

GGCAGTGCGCCTTCAAG- intron- GAGAATGATG (SEQ ID NO:33)

After joining the cloning fragments and splicing of the intron all sequence gets together into 307 b sequence of SFV. It contains a silent point mutation (in lowercase) made to facilitate the splicing:

ATGGCGGATGTGTGACATACACGACGCCAAAAGATTTTGTTCCAGCTCCTGCCACCT CCGCTACGCGAGAGATTAACCACCCACGATGGCCGCCAAAGTGCATGTTGATATTGA GGCTGACAGCCCATTCATCAAGTCTTTGCAGAAGGCATTTCCGTCGTTCGAGGTGGA GTCATTGCAGGTCACACCAAATGACCATGCAAATGCCAGAGCATTTTCGCACCTGGC TACCAAATTGATCGAGCAGGAGACTGACAAAGACACACTCATCTTGGATATCGGCAG TGCGCCTTCaAGGAGAATGATG (SEQ ID NO:38)

In some embodiments, the second expression unit of an alphavirus based nucleic acid construct according to the invention also comprises: i) a translational enhancer of SFV upstream of the gene of interest ii) multiple subgenomic promoters to achieve simultaneous expression of several proteins and iii) IRES elements for cap-independent translation.

In yet another embodiment, the first expression unit further comprises a human herpesvirus thymidine kinase mRNA leader sequence.

In other aspects of the present invention, mutations have been introduced into the amino acid sequence of the replicase forming the first expression unit of the nucleic acid construct. These mutations may be in the form of substitutions, deletions and/or insertions and/or their combinations These mutations can be functionally neutral or they can change the properties of the replicase according to the invention. The properties of the replicase, which can be changed by mutations comprises, but are not limited to, changes its affinity for the template(s) provided in trans, i.e. the gene of interest, changes in the recognition of the subgenomic promoter sequence, changes in the working temperature of the replicase (temperature sensitive mutations), changes in the effect of the replicase on the host cell biosynthesis and/or survival due to the changes of cytotoxic properties of the replicase, changes in the maturation of the replicase due to formation of temporary and/or stably active conformations etc. A mutation can be introduced on its own or in combination with other approaches described herein, e.g. mutations can be introduced into a codon-optimized replicase sequence.

In some embodiments, mutations are introduced into the sequence of the native, wild type replicase encoding region of SFV with an intron forming the first expression unit according to the present invention. The following mutations are encompassed by the present invention:

Native-PG (N-PG) which contains mutation CCC^4349"4351 to GGA (Pro to GIy in corresponding aa sequence)

Native-PD (N-PD) which contains two mutations: 1. TCC^2972"2974 to CCC (Ser to Pro in corresponding aa sequence) 2. AGG^4145"4147 to GAC (Arg to Asp in corresponding aa sequence)

Native-HT (N-HT) which contains two mutations: 1. CGC^4142"4144 to CAC (Arg to His in corresponding aa sequence) 2. CCC^4349"4351 to ACC (Pro to Thr in corresponding aa sequence)

Mutations introduced in the sequence of the resynthesized replicase encoding region of SFV with intron encoded by the first expression unit are also disclosed herein and encompassed by the present invention. The following mutations are encompassed by the present invention.

Resynthesis-PG (R-PG) contains mutation CCT^4349"4351 to GGT (Pro to GIy in corresponding aa sequence) and silent mutation G⁴³⁴⁵ to T.

Resynthesis-AAA (R-AAA) contains mutation CGGCGGAGG^4139"4147 to GCCGCCGCG (Arg-Arg-Arg to Ala-Ala-Ala in corresponding aa sequence) The use of mutant replicases in a system according to the invention is shown by the example of several non-cytotoxic mutations in SFV, some examples which are provided herein. The mutations may be introduced into the native or codon-optimised artificial replicase sequence, as exemplified in the above. Non-wild type replicases are illustrated in SEQ ID NO:8-9.

The shutdown of the cellular metabolism can be changed by introducing mutations in the replicase region, which in one embodiment of the invention comprises a region of a SFV replicase. Hence, in one embodiment of the invention, a nucleic acid construct is envisaged wherein the first expression unit is mutated.

In such embodiments of the invention, several different mutations may be introduced to obtain this purpose. In one embodiment, 5 combinations of mutations are introduced into the nsP1 region of an alpha virus replicase, such as SFV replicase. Such mutations slow down the virus replication at the early hours of infection and reduce the cytotoxic effects on the cells (Zusinaite et al., 2007). In another embodiment, 8 mutations in the C-terminal domain of nsP2 are introduced. Such mutations reduce the cytotoxicity caused by SFV replication and two of them, mutation RRR to RDD (amino acid position 648-650 of nsP2) and P to G (amino acid position 718 of nsP2) completely abolish virus induced shutdown (Tamm et al., 2008).

In yet another embodiment, mutations affecting the processing pattern of SFV replicase are introduced into the nucleic acid constructs of the invention. Such mutations have been studied and we have demonstrated that the speed of the processing on different sites of P1234 polyprotein does effect the growth of the virus. Particularly, the activation of the cleavage at the 2/3 site, lead to more rapid growth of virus suggesting more efficient synthesis of positive strand RNAs (LuIIa et al., 2006).

The invention also relates to a nucleic acid construct, wherein said first expression unit essentially corresponds to a nucleic acid sequence selected from the group consisting of: SEQ ID NO:8 and 9.

In one aspect of the invention, a nucleic acid construct is envisaged wherein one or more of the following mutations have been introduced into SEQ ID NO:8: CCC^4349"4351 to GGA, TCC^2972"2974 to CCC, and/or AGG^4145"4147 to GAC. In yet another aspect, a nucleic acid construct is envisaged wherein one or more of the following mutations have been introduced into SEQ ID NO:9:CCT^4349"4351 to GGT, G⁴³⁴⁵ to T, and/or CGGCGGAGG^{4139 4147} to GCCGCCGCG.

In a preferred embodiment of the invention, the nucleic acid construct is a single plasmid system. In another embodiment of the invention, the nucleic acid construct comprises two separate plasmids encoding the first and the second expression unit respectively. The second option is not possible for standard alphavirus systems available in the prior art. As a result thereof, the standard vector plasmids are all rather large. While the large sizes may not represent a problem for plasmid purification it may however severely affect the efficiency of the plasmid uptake by transfected cells, or in the case of immunization. There is experimental data available that the efficacy of transfection in vitro and in vivo is in negative correlation with plasmid size. The two plasmid system will also offer the possibility to change the composition of the transfection mixture, i.e. the molar ratio of the first expression unit, i.e. the replicase encoding unit as compared to the second expression unit i.e. the template encoding plasmid. This may be beneficial for the functioning of the system.

In one embodiment the following construction of the nucleic acid construct is envisaged. It is however to be noted that the present invention is not limited thereto. Such a nucleic acid construct comprises two expression units wherein the first expression unit encodes the replicase (approximately 9 kbp including promoter, terminator and, in same cases an intron or any other additional elements mentioned herein) and the second expression unit encodes the replicating template RNA which encompasses the gene of interest. This second expression unit has a length of approximately 2,5 kbp including the promoter and terminator for the cellular RNA polymerase Il to provide for transcription of the vector. In a nucleic acid construct according to the invention, these expression units may be combined together in one expression vector (an empty vector will have a size which is close to 15 kbp) or are present in separate vectors, as mentioned in the above. In one embodiment of the present invention, the expression units are present in one and the same vector. The details of some preferred nucleic acid constructs according to the invention are given in the experimental section.

In addition to the expression units for the replicase and the gene of interest, the system according to the present invention may in some embodiments be complemented by additional expression units which may facilitate its functioning. Such units may be selected from cellular co-factors for replicase, factors altering, such as suppressing or activating cellular responses to the functioning of the trans-replicase including short-hairpin RNAs against anti-viral genes or repressors of anti-viral systems, such as protein kinase R (PKR).

The present invention also relates to a nucleic acid construct, wherein said second expression unit corresponds essentially to a nucleic acid sequence selected from the group consisting of: SEQ ID NO:10, 11 , 12, 13, 14, 15, 16, 17, 18 and 19.

In another aspect of the invention the nucleic acid construct as described herein further comprises (a) a DNA sequence encoding a nuclear-anchoring protein operatively linked to a heterologous promoter, said nuclear-anchoring protein comprising a. a DNA binding domain which binds to a specific DNA sequence, and b. a functional domain that binds to a nuclear component, or a functional equivalent thereof; and (b) a multimerized DNA binding sequence for the nuclear anchoring protein, wherein said nucleic acid construct lacks a papilloma virus origin of replication.

The term "nuclear-anchoring protein" as used herein refers to a protein, which binds to a specific DNA sequence and is capable of providing a nuclear compartmentalization function to the vector, i. e., to a protein, which is capable of anchoring or attaching the vector to a specific nuclear compartment.

In one preferred embodiment of the invention, the construct lacks an origin of replication functional in mammalian cells. In another especially preferred embodiment, said nuclear- anchoring protein is the E2 protein of Bovine Papilloma Virus type 1. In another embodiment, either the DNA binding domain or the functional domain is obtained from the E2 protein.

In another aspect of the present invention, said nucleic acid construct further comprises a selection marker comprising an araD gene. In a preferred embodiment, said araD gene encodes L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4.).

The present invention also relates to nucleic acid constructs comprising various heterologous genes of interest, forming the second expression unit. This heterologous gene of interest may be any suitable gene which encodes a peptide or a protein to be expressed in the host to whom the nucleic acid construct is administered. In a preferred embodiment said heterologous gene of interest forming part of the second expression unit is that of an infectious pathogen. In one embodiment, the infectious pathogen is a virus. Said virus may be selected from the group consisting of Human Immunodeficiency Virus(HIV), Herpex Simplex Virus (HSV), Hepatitis C Virus, Influenzae Virus, and Enterovirus. In another embodiment, said gene of interest is that of a bacterium. Said bacterium may be selected from the group consisting of Chlamydia trachomatis,

Mycobacterium tuberculosis, Salmonella and Mycoplasma pneumonia, but is not limited thereto.

Examples of genes of interest which may be included into the nucleic acid construct according to the invention are also given in Blazevic V, Mannik A, Malm M, Sikut R, Valtavaara M, Toots U, Ustav M, Krohn K, 2006.

In yet another embodiment, said gene of interest is that of a fungal pathogen. Said fungal pathogen is in one embodiment Candida albicans.

In a preferred embodiment said gene of interest is of HIV origin, which gene may be encoding a non-structural regulatory protein of HIV, optionally selected from Nef, Tat or Rev. Said gene of interest may also encode a structural protein of HIV. In one embodiment, said gene of interest is the gene encoding HIVgp120/gp160. In another embodiment a first expression cassette comprises a gene of interest which encodes Nef, Tat or Rev, and a second expression cassette comprises a gene of interest which encodes Nef, Tat or Rev. In another embodiment a first expression cassette comprises a gene of interest which encodes Nef, Tat or Rev, and a second said expression cassette comprises a gene of interest which encodes a structural protein of HIV.

In another preferred embodiment of the invention, the gene of interest encodes a protein associated with cancer. In another embodiment, the gene of interest encodes a protein associated with immune maturation, regulation of immune responses, or regulation of autoimmune responses. In yet another embodiment, the gene of interest is the Aire gene, encoding a protein which is APECED. The AIRE gene coding for the AIRE protein (AIRE = autoimmune regulator) is mutated in an autosomally heredited syndrome APECED

(Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy). AIRE is expressed in rare epithelial cells in the medulla of thymus and in the dendritic cells in peripheral blood and in peripheral lymphoid organs. APECED could thus in one embodiment be treated by transferring the non-mutated AIRE gene ex vivo to peripheral blood dendritic cells, followed by the introduction of the corrected dendritic cells back to the patient. The gene of interest may also encode a protein that is defective in any hereditary single gene disease, or a macromolecular drug. The gene of interest may also encode a cytokine, wherein said cytokine is an interleukin which may be selected from the group consisting of IL1 , IL2, IL4, IL6 and IL12. The gene of interest may also encode an interferon or a biologically active RNA molecule. Said biologically active RNA molecule may be selected from the group consisting of inhibitory antisense and ribozyme molecules. Said inhibitory antisense or ribozyme molecules may antagonize the function of an oncogene.

Another aspect of the present invention relates to a nucleic acid construct as disclosed herein for use as a medicament. The nucleic acid construct according to the invention may also in one embodiment be used in the prevention and/or treatment of inherited or acquired genetic defects. The invention also relates to the use of a nucleic acid construct as disclosed herein for the manufacture of a medicament for the prevention and/or treatment of an inherited or acquired genetic defect.

The nucleic acid construct according to the invention may also in one embodiment be used in the prevention and/or treatment of an infectious disease. The invention also relates to the use of a nucleic acid construct as disclosed herein for the manufacture of a medicament for the prevention and/or treatment of an infectious disease.

The nucleic acid construct according to the invention may also in one preferred embodiment be used in the prevention and/or treatment of HIV. The invention also relates to the use of a nucleic acid construct as disclosed herein for the manufacture of a medicament for the prevention and/or treatment of HIV.

In another aspect, the invention relates to a method for treating an infectious disease in a subject, said method comprising administering a therapeutically effective amount of a nucleic acid construct as disclosed herein to a patient in need thereof.

In yet another aspect, the invention relates to a method for treating HIV in a subject, said method comprising administering a therapeutically effective amount of a nucleic acid construct as disclosed herein to a patient in need thereof.

In yet another aspect, the invention relates to a method for treating an inherited or acquired genetic defect, said method comprising administering a therapeutically effective amount of nucleic acid construct as disclosed herein, to a patient in need thereof. In yet another aspect, the invention relates to a host cell, characterized by containing the nucleic acid construct as disclosed herein.

The invention also relates to a pharmaceutical composition comprising the nucleic acid construct as disclosed herein and a suitable pharmaceutical carrier and/or excipient.

A pharmaceutical excipient and/or constituent may be selected from any suitable compositions known in the art. Examples of such excipients and/or constituents are phosphate buffered saline (PBS), saline solutions, different lipopeptide complexes, and stabilizers, but are not limited thereto.

The nucleic acid constructs of the invention are formulated using standard methods of pharmaceutical formulation to produce nucleic acid constructs to be used as vaccines to be administered by any conventional route of administration, i. e. intramuscularly, intradermal^ or with or without electroporation or other suitable devices and the like.

Accordingly, the invention relates to a vaccine, such as a DNA vaccine comprising a nucleic acid construct as disclosed herein and a suitable pharmaceutical carrier and/or excipient. The invention relates to a vaccine which is in the form of a preventive and/or a therapeutic vaccine. Hence, the vaccines of the invention can be used in a conventional preventive manner to protect an individual from infections, Alternatively, the vaccines of the invention can be used as therapeutical vaccines, especially in the case of viral infections, together with a conventional medication.

In yet another aspect, the invention relates to a method for the preparation of the vaccine as disclosed herein, said method comprising combining the nucleic acid construct with a suitable pharmaceutical carrier and/or excipient.

In yet another aspect, the invention relates to a selection system comprising a bacterial cell deficient of an araD gene into which a nucleic acid construct as disclosed herein has been transformed.

In yet another aspect, the invention relates to a method for selecting for cells which have been transformed with a nucleic acid construct as disclosed herein, comprising growing the cells in a growth medium containing arabinose, and thereafter selecting the surviving cells. Experimental section

Vectors/Plasmids used

pRSV-Nsp1234 is a 10342bp plasmid vector (SEQ ID NO:20) which expresses codon optimised SFV replicase from RSV LTR promoter. Heterologous rabbit beta-globin gene derived intron is introduced into the replicase coding sequence.

Main features:

Start-End Description 9933-268 pUCori

437-963 RSV LTR

1001-8869 nsP1234 (replicase) coding sequence with intron

1213-1785 intron

8878-9090 bgh pA 9204-9899 araD selection marker

phelF4A1 -Nsp1234 is 10248bp plasmid vector (SEQ ID NO:21) which expresses codon optimised SFV replicase from human elF4A1 promoter promoter. Heterologous rabbit beta-globin gene derived intron is introduced into the replicase coding sequence. Main features:

Start-End Description

9839-268 pUCori

367-894 helF4A1 promoter

907-8775 Nsp1234 (replicase) coding sequence with intron 1 1 19-1691 intron

8784-8996 bgh pA

9110-9805 araD selection marker

phEF1 aHTLV-Nsp1234 is 10258bp plasmid vector (SEQ ID NO:22) which expresses codon optimised SFV replicase from human EF1 a promoter plus HTLV UTR.

Heterologous rabbit beta-globin gene derived intron is introduced into the replicase coding sequence.

Main features:

Start-End Description 9849-268 pUCori

372-903 hEF1 a/HTLV

917-8785 Nsp1234 (replicase) coding sequence with intron 1 129-1701 intron

8794-9006 bgh pA

9120 9815 araD selection marker

pRSV-SFV-Rluc is s 13850bp plasimid vector (SEQ ID NO:23) which expresses both codon optimised SFV replicase from RSV LTR promoter and replicase template 123M4 RNA with luciferase markergene from CMV promoter.

Main features: Start-End Description

13441-268 pUCori

437-963 RSV LTR

1001-8869 Nsp1234 cds with intron

1213-1785 intron 8878-9090 bgh pA

9104-9686 CMV

9687-10572 SFV5'+intron

10579-10779 SG

10817-11752 Renilla luciferase 11768-12619 HDVrz+pA

12712-13407 araDselection marker

pRSV-SFV-Han(-H2D) is s 15853bp plasmid vector (SEQ ID NO:24) which expresses both codon optimised SFV replicase from RSV LTR promoter and replicase template 123M4 RNA with MultiHIV antigene from CMV promoter.

Main features:

Start-End Description

13441-268 pUCori 437-963 RSV LTR

1001 -8869 Nsp1234 cds with intron

1213-1785 intron

8878-9090 bgh pA

9104-9686 CMV 9687-10572 SFV5'+intron

10579-10779 SG

10787-13762 MultiHIV antigen 13771-14622 HDVrz+pA

14715-15410 araD selection marker

pEF1 aHTLV-SFV-Rluc is s 13766bp plasmid vector (SEQ ID NO:25) which expresses both codon optimised SFV replicase from human EF1 alpha promoter plus HTLV UTR and replicase template 123M4 RNA with luciferase markergene from CMV promoter.

Main features:

Start-End Description

268-13357 pUCori 372-903 hEFIaHTLV

917-8785 Nsp1234 cds with intron

1 129-1701 intron

8794-9006 bgh pA

9020-9602 CMV 9603-10488 SFV5'+intron

104959-10695 SG

10733-1 1668 Renilla luciferase

11684-12535 HDVrz+pA

12628-13323 araD selection marker

phelF4A1-SFV-Rluc is s 13756bp plasmid vector (SEQ ID NO:26) which expresses both codon optimised SFV replicase from human elF4A1 promoter and replicase template

123M4 RNA with luciferase markergene from CMV promoter

Main features: Start-End Description

268-13347 pUCori

367-894 hEFI aHTLV

907-8775 Nsp1234 cds with intron

1 1 19-1691 intron 8784-8996 bgh pA

9010-9592 CMV

9593-10478 SFV5'+intron

104949-10685 SG

10723-11658 Renilla luciferase 1 1674-12525 HDVrz+pA pRSV-N-wt is 10348bp plasmid vector (SEQ ID NO:27) which expresses SFV replicase under control of the RSV LTR promoter from native coding sequence with rabbit beta- globin gene intron inserted into the same position as in codon-optimised synthetic DNA sequence. Main features:

Start-End Description

9939-268 pUCori

437-963 RSV LTR

1001-8869 nsP1234 (replicase) native coding sequence with intron 1213-1785 intron

8884-9096 bgh pA

9210-9905 araD selection marker

pRSV-AAA is identical to pRSV-Nsp1234 but contains RRR to AAA mutation in the aa 1185-1187 of Nsp1234 : the nucleotide sequence in positions 5126-5133 is mutated CGGCGGAG to GCCGCCGC.

pRSV- PG is identical to pRSV-Nsp1234 but contains P to G mutation in the aa 718 of Nsp1234 : the nucleotide sequence in positions 5332-5338 is mutated GAAGCCT to TAAGGGT.

pRSV- GAA is identical to pRSV-Nsp1234 but contains GDD to GAA mutation in the aa 2283-2285 of Nsp1234 : the nucleotide sequence in positions 8424-8427 is mutated ACGA to CCGC.

pRSV- AAA-GAA is identical to pRSV-Nsp1234 but contains RRR to AAA mutation in the aa 1185-1187 of Nsp1234 : the nucleotide sequence in positions 5126-5133 is mutated CGGCGGAG to GCCGCCGC; and GDD to GAA mutation in the aa 2283-2285 of Nsp1234 : the nucleotide sequence in positions 8424-8427 is mutated ACGA to CCGC.

phelF4A1 - AAA is identical to phelF4A1-Nsp1234 but contains RRR to AAA mutation in the aa 1185-1187 of Nsp1234 : the nucleotide sequence in positions 5032-5039 is mutated CGGCGGAG to GCCGCCGC.

phelF4A1- PG is identical to phelF4A1-Nsp1234 but contains P to G mutation in the aa 718 of Nsp1234 : the nucleotide sequence in positions 5238-5244 is mutated GAAGCCT to TAAGGGT. phEFI aHTLV- AAA is identical to phEF1 aHTLV-Nsp1234 but contains RRR to AAA mutation in the aa 1185-1187 of Nsp1234 : the nucleotide sequence in positions 5042- 5049 is mutated CGGCGGAG to GCCGCCGC.

phEFIaHTLV - PG is identical to phEFI aHTLV -Nsp1234 but contains P to G mutation in the aa 718 of Nsp1234 : the nucleotide sequence in positions 5248-5254 is mutated GAAGCCT to TAAGGGT.

pRSV-AAA-Han (-H2D) is identical to pRSV-SFV-Han (-H2D) but contains RRR to AAA mutation in the aa 1185-1187 of Nsp1234 : the nucleotide sequence in positions 5126- 5133 is mutated CGGCGGAG to GCCGCCGC.

phelF4A1-AAA-Rluc is identical to phelF4A1-SFV-Rluc but contains RRR to AAA mutation in the aa 1 185-1 187 of Nsp1234 : the nucleotide sequence in positions 5032-5039 is mutated CGGCGGAG to GCCGCCGC.

pRSV-N-PG is identical to pRSV-N-wt but contains P to G mutation in aa 718 of the nsp1234: the nucleotide sequence in positions 5336 to 5338 is mutated CCC to GGA.

pRSV-N-PD is identical to pRSV-N-wt but contains S to P mutation in position 259 (the nucleotide sequence in positions 3959 to 3961 is mutated TCC to CCC) and R to D mutation in position 650 of Nsp1234 (the nucleotide sequence in positions 5132 to 5134 is mutated AGG to GAC).

Example 1. The designs of the replicase template constructs (RT -s)

In general, two basic types of replicase templates encoded by the second expression unit for use in the nucleic acid construct according to the invention, are given herein. The first type relies on the use of both replicase mediated replication and transcription. The corresponding constructs comprises the sequence of a subgenomic promoter (SG) and the gene of interest cloned under the control of this element. As a consequence, the expression of the gene of interest takes place via synthesis of the subgenomic mRNA from the negative strand generated by the replicase from the positive strand replicon expressed from the second expression unit (figure 4). Thus, expression of the gene of interest is largely dependent on the ability of the replicase to perform synthesis of subgenomic RNAs. The expression of the gene of interest from the transcripts produced by nuclear transcription of corresponding expression unit as well as from full-length transcripts (genomic transcripts) made by the replicase is minimized due to the present of numerous ALJG codons and terminators upstream of the initiation codon of the gene of interest, Examples are provided herein of constructs with 11 upstream AUG codons.

The second type being encompassed by the present invention relies on the use of replication of the template by the action of the replicase, but not on transcription from SG promoter by the replicase. These constructs do not contain the sequence of a SG promoter and the gene of interest is expressed directly from the full-length transcript, produced by nuclear transcription or amplified by the replicase in the cytoplasm. The production of a protein of interest may take the form of a fusion protein. An example of such a fusion protein is a protein with up to 70 residues from the nsP1 of SFV fused to the N-terminus of the protein of interest. The protein of interest may also be produced as an individual protein by co-translational processing of the fusion protein. Examples of such design are provided below and in figure 4.

Both types of templates encoded by the second expression unit envisaged herein have potential benefits and may be used for different applications. The first type of template benefits from the specific replicase-dependent high levels of transcription from the subgenomic promoter and generating subgenomic mRNA encoding the gene of interest. In virus infection process the transcription from the subgenomic promoter gene rates several folds more subgenomic RNA as an action of replicase compared to the genomic RNAs, subgenomic promoter lack repression of transcription and subgenomic mRNA lack translation repression in infected/transfected cells. The second type of templates have the benefit of the expression of the gene of interest from both nuclear and replicase-made transcripts and is independent from the activity of the subgenomic promoter. The later aspect may be important since the synthesis of subgenomic RNAs may be inefficient in some types of cells or be inactivated by some mutations in the trans-active replicase region. Since the expression of subgenomic RNAs is a relatively late process in alphavirus infection cycle, it may also be more susceptible to the antiviral effects induced by the innate immune system, including the interferon response.

The replicase templates encoded by the second expression unit according to the present invention, can comprise several components in addition to the gene of interest. In the below are given examples of components which may form part of a replicase template, i.e. the second expression unit according to the present invention, when the alphavirus is SFV. The symbols used to designate the components are the same in case of all templates (with or without the subgenomic promoter). These components are also illustrated in Figure 4.

Component 1 (1) CMV promoter precisely fused with 5' end of SFV. The sequence corresponding to the 5' end of SFV genome contains two conserved regions identified in the genomes of all known alphaviruses, the 5' conserved sequence element (5' CSE) and 51 nucleotide conserved sequence element (51 b CSE). The first element is predicted to fold as stem-loop structure (SL1), the second forms two stem-loop structures (SL3 and SL4). Two CSE are separated form each other by large stem-loop structure (SL2) which contains also the initiation codon for SFV replicase ORF. The two conserved sequence elements have been shown to be important for replication (represent cis-signals for replicase), however their precise roles and significance are dependent from host cell type, virus species and strains and mutations, introduced in the replicase region (SEQ ID N0:2)

Component 2 (2). lntron flanked with short fragments of SFV ns-region. Resulting fragment will have intron inserted in Arg codon 71 and two artificial terminator codons after codon 74 of SFV nsP1. To make better splicing consensus synonymous mutation TCC to TCA (Ser to Ser) is introduced into codon 70 of SFV (SEQ ID NO:3).

Component 3P (3P). -150/+51 subgenomic promoter with SFV capsid enhancer element, foot and mouth disease 2A autoprotease sequence and polylinker for the gene of interest. The sequence of subgenomic promoter in this and 3M element is larger than minimal active promoter and contains all conserved elements so far identified in subgenomic promoters of alphaviruses. The subgenomic promoters with smaller sizes (-36/+18 etc) are functional as well, but tend to be less active than full-size promoter in 3P and 3M elements (SEQ ID NO:4).

Component 3M (3M). -150/+51 subgenomic promoter (without SFV capside enhancer element, foot and mouth disease 2A autoprotease sequence) and polylinker for the gene of interest (SEQ ID NO:5).

Component 4 (4). 3' UTR of SFV with poly(A), HDV ribozyme sequence, spacer and SV40 terminator signal. Complete sequence of 3' UTR of SFV followed by polyA sequence. The minimal 3' conserved sequence element of alphaviruses, required for RNA replication is much shorter (19 3' nucleotides of UTR and at least 12 A residues); the full length UTR and poly(A) from 69 A-residues is used in order to obtain maximal efficiency of replication, stabilization of the synthesized transcripts and maximize their translation. Hepatitis delta virus antisense ribozyme sequence is placed so that it cleaves immediately after last nucleotide of poly(A) sequence producing authentic poly(A) tail of alphavirus. SV40 terminator is used to terminate the transcription in cellular nucleus. However, any other element, used as termination sequence for RNA polymerase Il can be used as well. The fragment ends with Asc I and Kpn I restriction sites added for cloning purposes (SEQ ID NO:6).

Type-I RT constructs:

Altogether four type-l replicase templates were constructed, all of them contained components 1 and 4 (RNA polymerase Il promoter + 5' end of SFV genome and 3' UTR of SFV + poly(A) + ribozyme + terminator for RNA polymerase II). Their sequences are given is "sequences" section; the short description is given below. 1. RT-123P4. Contains intron and subgenomic promoter with capsid enhancer element (SEQ ID NO:10)

2.RT-123M4. Contains intron and subgenomic promoter but not capsid enhancer (SEQ ID NO:1 1)

3. RT-13P4. Contains subgenomic promoter with capsid enhancer but no intron (SEQ ID NO:12)

4. RT-13M4. Contains subgenomic promoter but does not contain capsid enhancer and intron. (SEQ ID NO: 13)

These four constructs were tested for functionality and their efficiencies were compared with each other.

Type-ll RT constructs.

Altogether six type-ll constructs were constructed. Their sequences are given in the sequence listing and short descriptions are also given below. All constructs contain a CMV promoter from component 1 (SFV 5' end is modified in some constructs as described below) and full component 4. All constructs lack a subgenomic promoter sequence.

5. RT-14. This construct contains wild type 5' end of SFV, but does not contain the intron. The polylinker is placed so that any gene of interest is expressed as a fusion protein containing a 64 N-terminal amino acid from SFV nsP1 at its N-terminus (translation starts on the native AUG codon of nsP1) (SEQ ID NO:14) 6. RT-124. This construct contains the wild type 5' end of SFV and intron. The polylinker is placed so that any gene of interest is expressed as a fusion protein containing a 64 N- terminal amino acid from SFV nsP1 at its N-terminus (translation starts on the native AUG codon of nsP1 ). (SEQ ID NO: 15) 7. RT-1(2A)4. This construct contains the wild type 5' end of SFV, but does not contain the intron. The polylinker is placed so that any gene of interest is expressed as a fusion protein containing 64 N-terminal amino acid from SFV nsP1 at its N-terminus (translation starts on the native AUG codon of nsP1). The 2A element of foot-and mouth disease virus placed before the polylinker for the gene of interest will the perform separation of itself and the nsP1 (64 aa) from the expressed protein of interest (SEQ ID NO: 16)

8. RT-12(2A)4. This construct contains the wild type 5' end of SFV and intron. The polylinker is placed so that any gene of interest is expressed as a fusion protein containing a 64 N-terminal amino acid from SFV nsP1 at its N-terminus (translation starts on the native AUG codon of nsP1 ). The 2A element of foot-and mouth disease virus placed before the polylinker for the gene of interest will perform separation of itself and the nsP1 (64 aa) from the expressed protein of interest. (SEQ ID NO:17)

9. RT-1 (SL2-PL)24. In this construct the stem-loop structure 2 from 5'-end of SFV is substituted with a polylinker for the gene of interest. The AUG of the gene of interest will become the first active ATG in the synthesized RNA (first two ATG codons of SFV RNA are not used for initiation of translation), so the protein of interest will be expressed as an individual protein. The cloning of the gene of interest will cause a change of the distance between the two conserved elements from the 5' end of SFV genome. (SEQ ID NO: 18)

10. RT-1(AUGminus)24. In this construct the 5 ATG codons in the 5' end of the SFV genome (Component 1 , SEQ ID NO:2) are removed by point mutagenesis. The AUG of the gene of interest will become the first active ATG in the synthesized RNA (first two ATG codons of SFV RNA, which were not eliminated by mutagenesis, are not used for initiation of translation in SFV infection), so the protein of interest will be expressed as an individual protein. (SEQ ID NO:19). Example 2. Native wild type replicase of SFV activates subgenomic promoter, in replicase template RT-123M4-Rluc and induces expression of Renilla luciferase (Rluc) reporter

For demonstration that the replicase expression vectors are capable to activate subgenomic promoter, 1000000 BHK-21 cells were transfected by electroporation: 1. with 1 microgram pBluescript® Il KS(+) phagemid (Stratagene ##212207) containing RT-123M4-Rluc replicase template and 1 microgram of plasmid, expressing mutation- inactivated, replicase of SFV by use of cytomegalovirus IE promoter . 2. with 1 microgram plasmid, containing RT-123M4-Rluc replicase template and 1 microgram plasmid, expressing native wild-type replicase of SFV by use of cytomegalovirus IE promoter.

Cells were lysed at 24 h post transfection and Rluc activity was measured in 6 microliter cell lysate (ca 50,000 cells). Results:

Luciferase activity in sample 1 was 5 884 relative luciferase units

Luciferase activity in sample 2 was 28 798 236 relative luciferase units.

Active wild type native replicase of SFV amplified the luciferase expression more than

4000 fold compared to the inactive replicase Conclusions.

1. Wild type native replicase of SFV is capable to make negative strand on the positive strand of the RNA template and transcribe RT-123M4-Rluc template (synthesizes subgenomic RNA) while inactivated replicase of SFV is not (or does it at extremely low efficiency) 2. Cis- elements incorporated in RT-123M4-Rluc are sufficient to interact with functional replicase expressed in trans. This interaction results in replication of the template and synthesis of the subgenomic mRNA from which high-levels of luciferase are expressed.

Example 3. Re-synthesis and intron insertion into the SFV replicase. The SFV replicase protein sequence was back-translated and codon-optimised synthetic cDNA with heterologous rabbit beta-globin gene derived intron (introduced into the coding sequence) (figure 5) was synthesised (SEQ ID NO 9). The comparison of wt SFV and codon-optimised coding sequences are shown in Figure.6.

Example 4. Construction of the expression vectors containing either native or artificial coding sequence of SFV replicase Different heterologous RNA Polymerase Il promoter and 5' UTR elements were used for expression of SFV replicase from either native or codon-optimised coding sequence (figure 5). Particularly, 1. Rous sarcoma virus LTR, 2. human elF4A1 promoter and

3. chimeric promoter consist human EF1 a promoter plus HTLV UTR were utilised.

The vectors were named pRSV-Nsp1234 (SEQ ID NO 20), phelF4A1-Nsp1234 (SEQ ID NO 21) and phEF1aHTLV-Nsp1234 (SEQ ID NO 22).

In addition, vector pRSV-N-wt (SEQ ID NO 27) was constructed similar to pRSV-Nsp1234 (SEQ ID NO 20) but the replicase is expressed from native coding sequence with rabbit beta-globin gene intron inserted into the same position as in codon-optimised synthetic DNA sequence.

Example 5. Construction of the vectors expressing SFV replicase protein with mutations nsP2 NLS region

It is known by literature data that mutations in the amino acid triplet RRR in the nsP2 NLS region (aa. 1185-1187) of SFV replicase or Pro to GIy mutation in position 718 of nsP2 of SFV decreased the cytotoxisity of the SFV virus and replicon vectors (Tamm et al., 2008). Because in pilot experiments the toxic effects of the replicase expression to the cells were observed, mutation RRR>AAA were done in the vectors pRSV-Nsp1234, phelF4A1- Nsp1234, and phEF1 aHTLV-Nsp1234. The plasmids were named pRSV-AAA, phelF4A1 - AAA, and phEF1 aHTLV-AAA, respectively. Finally, a mutation changing Pro 718 to GIy was constructed in the context of codon optimised SFV replicase and introduced into the vectors pRSV-Nsp1234, phelF4A1- Nsp1234, and phEF1 aHTLV-Nsp1234 (resulting vectors were named pRSV-PG, phelF4A1-PG, and phEF1 aHTLV-PG). The nsP2 mutants are expressed from the similar expression cassettes as described in example 4. In addition to the mutations in codon-optimised replicase expressing constructs the P>G mutation was also introduced in the context of RSV-N-wt into native coding sequence of the replicase (except that intron was inserted in the same position as in artificial replicase expressing construct) resulting plasmid pRSV-N-PG. In addition, double mutant expressing plasmid RSV-N-PD was constructed based on RSV-N-wt: contains Ser to Pro mutation in position 259 of nsP2 and Arg to Asp mutation in position 650 of nsP2. This combination of mutations was described by Lundstrom et al. (ref). Example 6. Analysis of the expression of the SFV replicase from the artificial coding sequence containing vectors

The expression of the replicase from artificial codon optimised coding sequence was analysed by Western blotting and immunofluorescence (IF) methods. In BHK-21 cells using antibodies against different parts of the replicase, it was revealed that all replicase proteins were expressed and localized in the same compartments as corresponding proteins expressed by infectious SFV or SFV based replicon vector; typically reduced levels of expression (compared to SFV-infected cells) were detected (Fig.7 shows this for nsP1 and nsP3. ). The same phenomenon (lower expression levels) was documented by Western blot analysis (data not shown).

In addition, the expression of the replicase was analysed by IF in cultured cell lines RD, Cos-7 and Cop5. The cells were transfected with 0.5 or 1 ug expression vectors of Nsp1234 or the replicase containing AAA mutation by PEI-DNA complex or by electroporation. Transfected cells were grown on coverslips ~24h. Thereafter the cells were fixed with paraformaldehyde, and the replicase expression was visualised using antibody against nsP1 part of the replicase. In all cases IF images revealed partial localization of nsP1 at the plasmamembrane and extensive filopodia-like structure formation (figure 8 upper). Both of these phenomena are described for SFV infected cells and cell, expressing individual nsP1 of SFV (Spuul et al., 2007; Kiiver et al., 2008B).

In addition, the expression of the replicase was demonstrated in vivo: two hundred micrograms of the expression plasmid expressing the replicase from RSV-nsp1234 promoter was injected into superficial porcine skin. Again, ~24h after transfection, punch biopsy was taken, 7μm frozen sections were prepared, and the replicase expression in the injection site was proved by IF with anti-nsP1 antibody (Fig 8 lower).

Example 7. Expression vectors of codon-optimised SFV replicase are capable to activate expression from RT-123M4-Rluc, RT-123P4-Rluc, RT-13M4-Rluc and RT- 13P4-Rluc replicase templates.

To analyze if the codon-optimised replicase expression vectors are capable to activate expression from RT-123M4-Rluc, RT-123P4-Rluc, RT-13M4-Rluc and RT-13P4-Rluc replicase templates 1000000 BHK-21 cells were transfected by electroporation by combination of: 1 ) 2 microgram of pRSV-Nsp1234, phelF4A1-Nsp1234, phEF1 aHTLV-Nsp1234 or control plasmid, containing no SFV replicase expression unit. 2) with 0.7-0.8 microgram pBluescript® Il KS(+) phagemid (Stratagene ##212207) containing RT-123M4-Rluc, RT-123P4-Rluc, RT-13M4-Rluc or RT-13P4-Rluc replicase templates.

Altogether 16 combinations were prepared, cells were lysed at 24 h post transfection and

Rluc activity in 6 microliter cell lysate (ca 50,000 cells).

Results (measured Rluc activities in relative luciferase units) are presented in following table (Table 1):

Table 1 :

Conclusions.

1 . Codon-optimized SFV replicase is highly active and is capable to enhance the marker gene expression from all four templates

2. Replicase, expressed by use of RSV promoter has highest trans-activity in BHK-21 cells.

3. Replicase templates, resulting from constructs containing an intron (RT-123M4 and RT- 123P4) result in higher marker protein expression (compared to their intronless counterparts)

4. Replicase templates, containing SFV capsid enhancer elements express less marker protein than those without capsid enhancer element (RT-123M4 and RT13M4) in co- transfected BHK-21 cells.

Example 8. Analysis of activation of luciferase markergene expression from RT- 123M4-Rluc replicase template by SFV replicase vectors expressing the replicase proteins with mutations nsP2 NLS region.

To analyze if the replicase expression vectors carrying the nsP2 mutations are capable to activate expression from replicase templates, RD cells were transfected by electroporation with replicase template RT-123M4-Rluc alone or co-transfected with replicase expression vectors pRSV-Nsp1234 (wt replicase), or pRSV-AAA. Mock transfection and transfection was used as negative control. 19h later the cells were lysed and Renilla luciferase activities were measured. As seen on figure 9, wt replicase efficiently activates Rluc expression but no activation was seen by AAA mutant replicase.

Example 9. Construction and testing of the negative control vectors expressing SFV replicase protein with mutation in the nsP4 region encoding a RNA dependent RNA polymerase (RdRp).

It is known by literature data that mutation GDD>GAA in the highly conserved GDD motif of the nsP4 (aa 2283-2285 of the Nsp1234) completely abolishes the RNA dependent

RNA polymerase activity of the replicase. Thus the control vectors were cloned by introducing the GDD>GAA in the codon-optimised replicase coding sequence. The mutation was introduced in the context of the pRSV-Nsp1234, and pRSV-AAA, and the cloned vectors were named as pRSV-GAA, and pRSV-AAA-GAA, respectively. The general building of the mutated constructs is similar to the wt and nsP2 replicase expression vectors described in examples 4 and 5

Experiment: RD cells were electroporated with following combinations of constructs: 1. 1ug pRSV-Nsp1234+0.5ug KS123M4-Rluc (RT123M4-RL in pBluescript® Il KS(+) phagemid (Stratagene ##212207). 2. 1 ug pRSV-GAA+0.5ug KS123M4-Rluc

3. 0.5ug KS123M4-Rluc

4. neg

Results: Rluc assay was done at 24 h post-transfection; results are presented in Fig 10 As expected no increase of Rluc expression by presence of pRSV-GAA, instead slight decrease of Rluc expression is observed. At the same time their non-mutated counterpart activated Rluc expression approximately 20 fold.

Conclusion: The RdRp activity of nsP4 is necessary for activation of Rluc expression by SFV replicase.

Example 10. Construction of the SFV trans-replicase vectors containing expression cassettes of for artificial SFV replicase as well as for replicase template RNA.

Full-size SFV trans-replicase vectors containing both expression units for the replicase as well as for the replicating RNA template were cloned. The replicase template unit 123M4-

Rluc encodes Renilla luciferase (Rluc) or MultiHIV antigen as gene of interest. It was cloned into the Pad and Sgsl sites of the expression vectors containing an artificial gene for the SFV replicase or mutant forms of the replicase. The members of the trans- replicase construct family was named as pRSV-SFV-RIuc, phelF4A1-AAA-MultiHIV etc. The first part of the name indicates the promoter used for the replicase expression, the second part indicates if the wt (SFV) replicase or the replicase with AAA mutation in nsP2 was used, and the third part indicates the gene of interest. The general structure of these vectors is illustrated in Fig 11.

Example 11. Comparison of trans-replicases with alternative systems of expression in BHK-21 cells.

Experiment: 100000 BHK-21 cells were transfected with equal amount (0.04 pmol) of constructs

1. pCMV-SFV1-RLuc (plasmid producing standard layered SFV replicon vector)

2. Trans-replicon plasmids (pRSV-SFV-RLuc (SEQ ID NO 23), phEF1 HTLV-SFV-RLuc (SEQ ID NO 25) or phelF4A1-SFV-RLuc (SEQ ID NO 26))

3. pCMV-RL (Promega) as regular CMV promoter driven plasmid

4. RT-123M4-Rluc plasmid in pBluescript® Il KS(+) phagemid (Stratagene ##212207) (replicative template without trans-replicase)

Rluc reporter expression was monitored for 48 h; experiment was carried out in triplicates. Results are shown in Fig 12:

1. Among trans-replicases the highest expression of Rluc was observed for pRSV-SFV- RLuc, and phEF1 HTLV-SFV-RLuc, phelF4A1-SFV-RLuc was slightly less efficient at all timepoints

2. At all-timepoints the trans-replicases expressed 2-5 times more Rluc marker than control plasmid, containing Rluc under control of strong CMV promoter

3. At all timepoints RLuc expression by trans-replicases was 30-60% of that achieved by use of control replicon vector.

4. The maximal expression efficiency was observed between 24-30 h post-transfection for all expression constructs and controls.

Example 12. Analysis of the expression properties of the SFV trans-replicase vectors in different cell lines.

We made systematic analysis for expression properties of the gene of interest from trans- replicase vectors compared to equimolar amount of the template RNA vector alone. In these experiments Renilla luciferase was used as markergene. In the replicase template RT-123M4-Rluc configuration, the luciferase is expressed from SFV subgenomic promoter (SG), thus the activation of the luciferase expression in the presence of the replicase could suggest that there is activity of the replicase to the template RNA. The assays were performed in several human and mouse cell lines (RD, Cos-7, HaCAT, Cop5, B16). The results are indicated in figures 13-17.

As supposed, the transfection with the template vector RT-123M4-Rluc alone showed very low luciferase activities as it uses SFV replicase dependent SG promoter for markergene expression. Compared to transfection with the template alone, trans-replicase vectors showed higher luciferase activity in all cell lines tested (Figures13-16). The trans- replicase vectors expressing replicases with mutated nsP2 NLS (AAA) do not activate the luciferase expression (Fig 17).

In conclusion, in trans-replicase vector system, both the replicase and the replicating RNA template are expressed in the cells. Also, the activation of the expression of gene of interest from the SG promoter was demonstrated in different cell lines derived from mouse and human origin.

Example 13. Comparison of expression of the marker proteins by Type-I RT and Type-ll RT constructs in presence and absence of by trans-active replicase expression.

The comparison of expression of the marker proteins by Type-I RT and Type-ll RT constructs was made both in presence and in absence of by trans-active replicase. 100000 BHK-21 cells were transfected by lipofection with 0,2 microgram of RT-123M4-RL, RT-123P4-RL, RT-13M4-RL and RT-13P4-RL (Type-I RT constructs with RLuc marker) or with type-ll RT constructs (RT-14-RL, RT-1 (2A)4-RL, RT-124-RL, RT-12(2A)4-RL, RT- 1 (SL2-PL)24-RL and RT-1(AUGminus)24-RL) with marker Rluc marker. In parallel a transfection was made, where the same amount of BHK21 cells were transfected by the same reporter constructs together with replicase expressing construct, pRSV-Nsp1234 (0,33 microgram of per transfection). At 24 h post-transfection cells were lysed and the Rluc activity was measured. Experiment was performed in triplicate. Results of the experiments, presented at Figure 18 indicate that Rluc expression in case of type-l RT constructs (RT-123M4-RL, RT-123P4-RL, RT-13M4-RL and RT-13P4-RL) in the absence of replicase is very low and is activated 1800 - 31000 fold in presence of the replicase. In contrast, the Rluc expression in case of type-ll RT constructs (RT-14-RL, RT-1 (2A)4-RL, RT-124-RL, RT-12(2A)4-RL, RT-1 (SL2-PL)24-RL and RT-1 (AUGminus)24-RL) in the absence of replicase is (with exception of the RT-1 (SL2-PL)24-RL) several orders in magnitude higher than for type-l RT reportes and is only moderately activated in presence of the replicase. The addition of replicase increased the expression of reporter proteins by RT-14-RL and RT-1 (2A)4-RL (intronless constructs) 8-66 folds, and expression of reporter proteins by RT-124-RL, RT-12(2A)4-RL or RT-1 (AUGminus)24-RL 1.2-1.3 fold. Expression of the reporter protein by RT-1 (SL2-PL)24-RL was not affected by the presence of the replicase.

Thus, the co-expression with trans-replicase causes low to moderate activation of reporter expression by type-ll RT reporters. In contrast to the situation with type-l RT reporters, where enhancement of Rluc expression can only be explained by the synthesis of the subgenomic RNAs by trans-activate replicase the small activation of reporter expression, observed for type-ll RT reporters, can also result from other effects of the trans-replicase on the replicating template RNA, including its stabilization, enhancement of its translation and so on. Regardless of the exact nature of the activation effect, this example reveals that the trans-active replicase can be used for activation of expression from Type-ll RT-s and for boosting of the replicase activated biological responses.

Example 14. Induction of the type I interferon expression by trans-replicase vector system

To explore the transreplicase system ability to induce type I interferon response in the cells, the transreplicase plasmids pRSV-SFV-Rluc, pheiF4A1 -SFV-Rluc, phelF4A1-AAA- Rluc, and phEF1αHTLV-SFV-Rluc were transfected into Cop-5 mouse fibroblasts cells by electroporation. As controls, mock transfection with carrier DNA only, conventional SFV replicon vector pCMV-SFV-wt1-Rluc-Rz, replicase template RT-123M4-RL were used. Cell culture supernatants were harvested 24h, 48h, and 72h after transfection and frozen at -2O⁰C until further analysis using interferon-α and -β kits. Cell culture supernatants were appropriately diluted and used in the enzyme-linked immunosorbent assay according to manufacturer's instructions (PBL Biomedical Laboratories).

Results are shown in figure 19: Interferon-β induction was induced after transfection of trans-replicase vectors. The wt replicase and AAA mutant expressing trans-replicase vectors also induce interferon-β at level comparable to the conventional SFV replicon.

Much lower IFN-b is induced by transfection with replicase template vector alone or regular pCMV expression vector pRL-CMV (data not shown). Thus it was concluded that trans-replicase vector system has additional IFN induction ability compared to regular DNA expression vectors. Example 15. Induction of the dsRNA accumulation in the cytoplasm of the cells transfected with the trans-replicase vectors

During the replication cycle of the SFV genome, also proposed for replicating RNA template, dsRNA intermediates are produced by RdRp activity of the replicase. It is well known that normally there is no RdRp activity in the cytoplasm of mammalian cells. Thus presence of the dsRNA in the cytoplasmatic compartment signalling the viral infection to the cell and may lead of the antiviral response cascade (references). This cascade include the type I interferon response, observed after transfection of the cop5 cell with trans- replicase vectors. Thus, we investigated the presence and localization of dsRNA in cells transfected with the trans-replicase vectors. For this purpose IF analysis using anti-dsRNA monoclonal antibody J2 (Scicons, Hungary) was utilised in the cells. This approach was previously used for detection of dsRNA in the cells after infection with ÷strand RNA viruses (Weber et al 2006). The RD cells were transfected by PEI-DNA complex with 0.5 or 1 ug of phEFI aHTLV- SFV-Rluc, CMV123wt (express the wt coding sequence of the SFV nsP1 +nsP2+nsP3 but no nsP4, negative control for dsRNA), RT-123M4 template vector alone (negative control for dsRNA and nsP1) or canonical SFV DNA replicon vector pCMV-SFVwt1_RI_uc_Rz (positive control for nsP1 and dsRNA ). Next day after transfection, the IF analysis of paraformaldehyde fixed cells were performed with anti-Nsp1 and anti-dsRNA antibodies (mixed). The results clearly demonstrated that the Nsp1 signal were observed in all cultures except the RT-123M4. The dsRNA was detected in the cytoplasm of the cells transfected with the phEF1aHTLV-SFV-Rluc or with the pCMV-SFVwt1_RLuc_Rz vectors but not in the negative control samples. The dsRNA signal often co-localized with anti- nsP1 stained spheres in the cytoplasm, we interpreted as replication centres. The results are shown in Figure 20.

Examples 16. Testing the ability of the trans-replicase vectors to induce the cellular immune response in comparison with regular DNA vaccine vector. Different groups of mice (Balb/c, 5 mice per group) were immunized by gene gun with different MultiHIV antigen Han(-H2D) expressing plasmid vectors

Plasmids:

1)p2RNT-optp17/24-CTL as conventional GTU® technology based DNA vaccine vector expressing MultiHIV antigen Han(-H2D) from the CMV promoter 2)pRSV-SFV-Han(-H2D) (SEQ ID NO: 24) is s 15853bp plasmid vector expresses both codon optimised SFV replicase from RSV LTR promoter and replicase template 123M4

RNA with MultiHIV antigene Han(-H2D) from CMV promoter 3) pRSV-AAA-Han(-H2D) is identical to pRSV-SFV-Han (-H2D) but contains RRR to AAA mutation in the aa 1185-1 187 of Nsp1234 : the nucleotide sequence in positions 5126-

5133 is mutated CGGCGGAG to GCCGCCGC.

4)non-immunised animals were used as controls

Each animal received a 1 μg plasmid dose per immunization with on Weeks 0 and 2, resulting in a cumulative dose of 2 μg. Mice were sacrificed 10 days after the 2nd immunization. Interferon- y ELISPOT analysis was done with freshly isolated splenocytes, rest of the cells was frozen for furter analyses. For stimulating the splenocytes overlapping peptide pools were used covering Rev protein (included into the antigen) and the single peptide AMQMLKETI (included in the p24 part of the antigen; known to be presented by

MHC class I antigens of Balb/c mice).

Two independent experiments were performed to study imunnogenicity of the transreplicase vectors. The results of the Experiment 1 are shown on figure 21-23

The results of the Experiment 2 are shown on figure 24-25

Conclusions:

1. The results indicate that number of antigen-specific T-cells (detected by IFN-γ

ELISPOT test) is increased almost 2 fold when transreplicase vector was used for immunizing mice.

2. The average spot size, which reflects the amount of IFN-γ secreted after immunological stimulation, is increased when trans-replicase vector was used for immunization.

3. Mutated transreplicase vector (pRSV-AAA-han(-H2D) performs weaker in immunogenicity experiments compared to wild-type vector, which is in concordance with the expression studies shown in Example 12 (figure 17). List of references

Agapov, E. V., Frolov, I., Lindenbach, B. D., Pragai, B. M., Schlesinger, S. and Rice, C. M.

(1998) Noncytopathic Sindbis virus RNA vectors for heterologous gene expression. Proc Natl Acad Sci U S A, 95, 12989-94.

Ahola, T., Kujala, P., Tuittila, M., Blom, T., Laakkonen, P., Hinkkanen, A. and Auvinen, P.

(2000) Effects of palmitoylation of replicase protein nsP1 on alphavirus infection. J Virol,

74, 6725-33.

Boorsma, M., Saudan, P., Pfruender, H., Bailey, J. E., Schlesinger, S., Renner, W.A. and Bachmann, M. F. (2003). Alphavirus cDNA-based expression vectors. Biotechnology and

Bioengineering, 81 , 553-62.

Bredenbeek, P. J., Frolov, I., Rice, C. M. and Schlesinger, S. (1993) Sindbis virus expression vectors: packaging of RNA replicons by using defective helper RNAs. J Virol,

67, 6439-46. Davis, N. L., Willis, L. V., Smith, J. F. and Johnston, R. E. (1989) In vitro synthesis of infectious Venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant. Virology, 171 , 189-204.

DiCiommo, D. P. and Bremner, R. (1998). Rapid, high level protein production using DNA- based Semliki Forest Virus vectors. J Biol Chem, 273, 18060-6. Galbraith, S. E., Sheahan, B. J. and Atkins, G. J. (2006) Deletions in the hypervariable domain of the nsP3 gene attenuate Semliki Forest virus virulence. J Gen Virol, 87, 937-

47.

Gorchakov, R., Frolova, E., Williams, B. R., Rice, C. M. and Frolov, I. (2004) PKR- dependent and -independent mechanisms are involved in translational shutoff during Sindbis virus infection. J Virol, 78, 8455-67.

Huckriede, A., Bungener, L., Holtrop, M., de Vries, J., Waarts, B. L., Daemen, T. and

Wilschut, J. (2004). Induction of cytotoxic T lymphocyte activity by immunization with recombinant Semliki Forest virus: indication for cross-proming. Vaccine, 22, 1 104-13.

Kim, K. H., Rumenapf, T., Strauss, E. G. and Strauss, J. H. (2004) Regulation of Semliki Forest virus RNA replication: a model for the control of alphavirus pathogenesis in invertebrate hosts. Virology, 323, 153-63.

Kaariainen, L., Takkinen, K., Keranen, S. and Soderlund, H. (1987) Replication of the genome of alphaviruses. J Cell Sci Suppl, 7, 231-50.

Kaariainen, L. and Ahola, T. (2002) Functions of alphavirus nonstructural proteins in RNA replication. Prog Nucleic Acid Res MoI Biol, 71 , 187-222. Leitner, W.W., Bergmann-Leitner, E. S., Hwang, L.N. and Restifo, N. P. (2006). Type I interferons are essential for the efficacy of replicase-based DNA vaccines. Vaccine, 24,

5110-8.

Lemm, J. A., Bergqvist, A., Read, C. M. and Rice, C. M. (1998) Template-dependent initiation of Sindbis virus RNA replication in vitro. J Virol, 72, 6546-53.

Lemm, J. A., Rumenapf, T., Strauss, E. G., Strauss, J. H. and Rice, C. M. (1994)

Polypeptide requirements for assembly of functional Sindbis virus replication complexes: a model for the temporal regulation of minus- and plus-strand RNA synthesis. Embo J, 13,

2925-34. Liljestrόm, P. and Garoff, H. (1991 ) A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology (N Y), 9, 1356-61.

LuIIa, A., LuIIa, V., Tints, K., Ahola, T. and Merits, A. (2006) Molecular determinants of substrate specificity for Semliki Forest virus nonstructural protease. J Virol, 80, 5413-22.

Mclnerney, G. M., Kedersha, N. L., Kaufman, R. J., Anderson, P. and Liljestrom, P. (2005) Importance of elF2alpha phosphorylation and stress granule assembly in alphavirus translation regulation. MoI Biol Cell, 16, 3753-63.

Peranen, J., Rikkonen, M., Liljestrόm, P. and Kaariainen, L. (1990) Nuclear localization of

Semliki Forest virus-specific nonstructural protein nsP2. J Virol, 64, 1888-96.

Perri, S., Driver, D. A., Gardner, J. P., Sherrill, S., Belli, B. A., Dubensky, T. W., Jr. and Polo, J. M. (2000) Replicon vectors derived from Sindbis virus and Semliki forest virus that establish persistent replication in host cells. J Virol, 74, 9802-7.

Piver, E., CoINn, C, Renault, N., Bru, T. and Pages, J. -C. (2006). Mobilization of full- length Semliki Forest Virus replicon by retrovirus particles. J Virol, 80, 9889-95.

Riezebos-Brilman, A., de Mare, A., Bungener, L., Huckriede, A., Wilschut, J. and Daemen, T. (2006) Recombinant alphaviruses as vectors for anti-tumour and anti-microbial immunotherapy. J Clin Virol, 35, 233-43.

Sawicki, D. L. and Sawicki, S. G. (1980) Short-lived minus-strand polymerase for Semliki

Forest virus. J Virol, 34, 108-18.

Shirako, Y. and Strauss, J. H. (1994) Regulation of Sindbis virus RNA replication: uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis. J Virol, 68, 1874-

85.

Sjoberg, E. M. and Garoff, H. (1996) The translation-enhancing region of the Semliki

Forest virus subgenome is only functional in the virus-infected cell. J Gen Virol, 77 ( Pt 6), 1323-7. Sjoberg, E. M., Suomalainen, M. and Garoff, H. (1994) A significantly improved Semliki

Forest virus expression system based on translation enhancer segments from the viral capsid gene. Biotechnology (N Y)₁ 12, 1127-31.

Strauss, J. H. and Strauss, E. G. (1994) The alphaviruses: gene expression, replication, and evolution. Microbiol Rev, 58, 491-562.

Tamberg, N., LuIIa, V., Fragkoudis, R., LuIIa, A., Fazakerley, J. K. and Merits, A. (2007).

Insertion of EGFP into the replicase gene of Semliki Forest virus results in novel, genetically stable marker virus. J Gen Virol., 88, 1225-1230.

Tuittila, M. T., Santagati, M. G., Roytta, M., Maatta, J. A. and Hinkkanen, A. E. (2000) Replicase complex genes of Semliki Forest virus confer lethal neurovirulence. J Virol, 74,

4579-89.

Vihinen, H., Ahola, T., Tuittila, M., Merits, A. and Kaariainen, L. (2001 ) Elimination of phosphorylation sites of Semliki Forest virus replicase protein nsP3. J Biol Chem, 276,

5745-52. Xiong, C, Levis, R., Shen, P., Schlesinger, S., Rice, C. M. and Huang, H. V. (1989)

Sindbis virus: an efficient, broad host range vector for gene expression in animal cells.

Science, 243, 1188-91.

Zusinaite, E., Tints, K., Kiiver, K., Spuul, P., Karo-Astover, L., Merits, A and Sarand, I.

(2007) Mutations at the palmitoylation site of non-structural protein nsP1 of Semliki Forest virus attenuate viral replication and cause accumulation of compensatory mutations. J

Gen Virol., 88, 1977-1985

Kiiver, K., Merits, A. and Sarand, I. (2008). Novel vectors expressing anti-apoptotic protein

Bcl-2 to study cell death in Semliki Forest virus-infected cells. Virus Research, 131 , 54-64.

Marillonnet, S., Thoeringer, C, Kandzia, R., Klimyuk, V. and Gleba, Y. (2005). Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. Nat Biotechnol, 23, 718-723.

Tamm, K., Merits, A. and Sarand, I. (2008). Mutations in the nuclear localization signal of nsP2 influencing RNA synthesis, protein expression and cytotoxicity of Semliki Forest virus.

J Gen Virol, 89, 676-686. Frolov, I., Hardy, R. and Rice, CM. (2001 ). Cis-acting RNA elements at the 5' end of

Sindbis virus genome RNA regulate minus- and plus-strand RNA synthesis. RNA, 7, 1638-

1651.

Spuul, P., Salonen, A., Merits, A., Jokitalo, E., Kaariainen, L. and Ahola, T. (2007). Role of the amphipathic peptide of Semliki Forest virus replicase protein nsP1 in membrane association and virus replication. J Virol, 81 , 872-883.

Hertz, J. M. and Huang, H. V. (1992). Utilization of heterologous alphavirus junction sequences as promoters by Sindbis virus. J Virol. 66, 857-864. Blazevic V₁ Mannik A, Malm M, Sikut R, Valtavaara M, Toots U, Ustav M, Krohn K. Induction of human immunodeficiency virus type-1 -specific immunity with a novel gene transport unit (GTU)-MultiHIV DNA vaccine. AIDS Res Hum Retroviruses. 2006 July;22(7):667-77.

Claims

Claims

1. A nucleic acid construct comprising a first and a second expression unit, wherein i. the first expression unit comprises a nucleic acid sequence encoding a functional replicase of an alphavirus virus which expression unit lacks a nucleic acid sequence encoding an element required for amplification of transcripts from said first expression unit by said replicase, and ii. the second expression unit comprises a nucleic acid sequence encoding a template RNA comprising a heterologous gene of interest, which is preceded by elements required for template- specific RNA synthesis of transcripts from said second expression unit by said replicase expressed from said first expression unit; wherein said replicase transcribed from the first expression unit induces template- specific RNA synthesis of an RNA transcribed from the second expression unit, but does not induce amplification of said first expression unit.

2. A nucleic acid construct according to claim 1 , wherein the first expression unit encoding a replicase further lacks a region essentially corresponding to any of SEQ ID NO:28-30.

3. A nucleic acid construct according to any of claims 1 or 2, wherein said alphavirus is Semliki Forest Virus (SFV).

4. A nucleic acid construct according to any of the preceding claims, wherein said second expression unit comprising the gene of interest further comprises one or more of the following components: a) a promoter, b) a 5' region of the genomic RNA region from the RNA virus employed, c) an intron sequence, d) a subgenomic promoter region, e) a capsid enhancer, f) a polylinker for the gene of interest, g) a 3' Non Translated Region of the RNA virus employed, h) a poly(A) tail, i) a ribozyme sequence and/or j) an eukaryotic termination signal.

5. A nucleic acid construct according to claim4, wherein one or more of said components are artificially constructed.

6. A nucleic acid construct according to claim 4, wherein component c) corresponds essentially to a nucleic acid sequence as disclosed in SEQ ID NO:3.

7. A nucleic acid construct according to claim 4, wherein component c) is obtained from the rabbit beta-globin gene corresponding essentially to a nucleic acid sequence as disclosed in SEQ ID NO:34.

8. A nucleic acid construct according to claim 4, wherein components a) and b) together correspond to the nucleic acid sequence essentially as disclosed in SEQ ID NO:2.

9. A nucleic acid construct according to claim 4, wherein components d), e) and f) together correspond to the nucleic acid sequence essentially as disclosed in SEQ

ID NO:4.

10. A nucleic acid construct according to claim 4, wherein said components d) and f) together correspond to the nucleic acid sequence essentially as disclosed in SEQ ID NO:5.

11. A nucleic acid construct according to claim 4, wherein said components g), h), I) and j) together correspond to the nucleic acid sequence essentially as disclosed in

SEQ ID NO:6.

12. A nucleic acid construct according to any of the preceding claims, wherein an intron sequence is inserted into the first expression unit.

13. A nucleic acid construct according to claim 12, wherein said intron sequence is obtained from the rabbit beta-globin gene corresponding essentially to a nucleic acid sequence as disclosed in SEQ ID NO:34.

14. A nucleic acid construct according to any of the preceding claims, wherein the first expression unit is mutated.

15. A nucleic acid construct according to claim 1 , wherein said first expression unit essentially corresponds to a nucleic acid sequence selected from the group consisting of: SEQ ID NO:8, and 9.

16. A nucleic acid construct according to claim 15, wherein one or more of the following mutations have been introduced into SEQ ID NO:8: CCC^4349"4351 to GGA, T_CC2972-2974 _{tø C∞ and/or}

Q^

17. A nucleic acid construct according to claim 15, wherein one or more of the following mutations have been introduced into SEQ ID NO:9:, G⁴³⁴⁵ to T, and/or CGGCGGAGG^{4139 4147} to GCCGCCGCG.

18. A nucleic acid construct according to claim 1 , wherein said second expression unit corresponds essentially to a nucleic acid sequence selected from the group consisting of: SEQ ID NO:10, 11 , 12, 13, 14, 15, 16, 17, 18 and 19.

19. A nucleic acid construct according to any of the preceding claims, further comprising:

(a) a DNA sequence encoding a nuclear-anchoring protein operatively linked to a heterologous promoter, said nuclear-anchoring protein comprising a. a DNA binding domain which binds to a specific DNA sequence, and b. a functional domain that binds to a nuclear component, or a functional equivalent thereof; and

(b) a multimerized DNA binding sequence for the nuclear anchoring protein, wherein said nucleic acid construct lacks a papilloma virus origin of replication.

20. A nucleic acid construct according to claim 19, wherein the construct lacks an origin of replication functional in mammalian cells.

21. A nucleic acid construct according to any of claims 19-20, wherein said nuclear- anchoring protein is the E2 protein of Bovine Papilloma Virus type 1.

22. A nucleic acid construct according to any of the preceding claims, further comprising a selection marker comprising an araD gene.

23. A nucleic acid construct according to claim 22, wherein the araD gene encodes L- ribulose-5-phosphate 4-epimerase (EC 5.1.3.4.).

24. A nucleic acid construct according to any of the preceding claims, wherein said heterologous gene of interest forming part of the second expression unit is that of an infectious pathogen.

25. A nucleic acid construct according to claim 24, wherein said infectious pathogen is a virus.

26. A nucleic acid construct according to claim 25, wherein said virus is selected from the group consisting of Human Immunodeficiency Virus(HIV), Herpex Simplex Virus (HSV), Hepatitis C Virus, Influenzae Virus, and Enterovirus.

27. A nucleic acid construct according to any of claims 1-24, wherein said gene of interest is that of a bacterium.

28. A nucleic acid construct according to claim 27, wherein said bacterium is selected from the group consisting of Chlamydia trachomatis, Mycobacterium tuberculosis, Salmonella and Mycoplasma pneumonia.

29. A nucleic acid construct according to any of claims 1-24, wherein said gene of interest is that of a fungal pathogen.

30. A nucleic acid construct according to claim 29, wherein said fungal pathogen is Candida albicans.

31. A nucleic acid construct according to any of claims 1-26, wherein said gene of interest is of HIV origin.

32. A nucleic acid construct according to claim 31 , wherein said gene of interest encodes a non-structural regulatory protein of HIV.

33. A nucleic acid construct according to claim 32, wherein said non-structural regulatory protein of HIV is Nef, Tat or Rev.

34. A nucleic acid construct according to claim 31 , wherein said gene of interest encodes a structural protein of HIV.

35. A nucleic acid construct according to claim 34, wherein said gene of interest is the gene encoding HIVgp120/gp160.

36. A nucleic acid construct according to claim 33, wherein a first expression cassette comprises a gene of interest which encodes Nef, Tat or Rev, and wherein a a second expression cassette comprises a gene of interest which encodes Nef, Tat or Rev.

37. A nucleic acid construct according to claim 33, wherein a first expression cassette comprises a gene of interest which encodes Nef, Tat or Rev, and a second said expression cassette comprises a gene of interest which encodes a structural protein of HIV.

38. A nucleic acid construct according to claims 1-23, wherein the gene of interest encodes a protein associated with cancer.

39. A nucleic acid construct according to claims 1-23, wherein the gene of interest encodes a protein associated with immune maturation, regulation of immune responses, or regulation of autoimmune responses.

40. A nucleic acid construct according to claim 1 -23, wherein the gene of interest is the Aire gene.

41. A nucleic acid construct vector according to claims 1-23, wherein the gene of interest encodes a protein that is defective in any hereditary single gene disease.

42. A nucleic acid construct according to claims 1-23, wherein the gene of interest encodes a macromolecular drug.

43. A nucleic acid construct according to claims 1-23, wherein the gene of interest encodes a cytokine.

44. A nucleic acid construct according to claim 44, wherein said cytokine is an interleukin selected from the group consisting of IL1 , IL2, IL4, IL6 and IL12.

45. A nucleic acid construct according to claims 1-23, wherein the gene of interest encodes an interferon.

46. A nucleic acid construct according to claims 1-23, wherein said gene of interest encodes a biologically active RNA molecule.

47. A nucleic acid construct according to claim 46, wherein said biologically active RNA molecule is selected from the group consisting of inhibitory antisense and ribozyme molecules.

48. A nucleic acid construct according to any of the preceding claims, for use as a medicament.

49. Use of a nucleic acid construct according to any of claims 1-23 for the manufacture of a medicament for the prevention and/or treatment of inherited or acquired genetic defects.

50. Use of a nucleic acid construct according to any of claims 1-23 in the manufacture of a medicament for the prevention and/or treatment of an infectious disease.

51. Use of a nucleic acid construct according to any of claims 1-24 in the manufacture of a medicament for the prevention and/or treatment of HIV.

52. A method for treating an infectious disease in a subject, said method comprising administering a therapeutically effective amount of a nucleic acid construct according to any of claims 1-37, to a patient in need thereof.

53. A method for treating HIV in a subject, said method comprising administering a therapeutically effective amount of a nucleic acid construct according to any of claims 1-26 and/or 31-37, to a patient in need thereof.

54. A method for treating an inherited or acquired genetic defect, said method comprising administering a therapeutically effective amount of nucleic acid construct according to any of claims 1-23, to a patient in need thereof.

55. A host cell, characterized by containing the nucleic acid construct according to claims 1-48.

56. A pharmaceutical composition comprising the nucleic acid construct according to any of claims 1 -48 and a suitable pharmaceutical carrier and/or excipient.

57. A vaccine comprising a nucleic acid construct of any of claims 1-48 and a suitable pharmaceutical carrier and/or excipient.

58. A vaccine according to claim 57, which is a DNA vaccine.

59. A method for the preparation of the vaccine according to claim 57 or 58, said method comprising combining the nucleic acid construct of any of claims 1-47 with a suitable pharmaceutical carrier.

60. A selection system comprising a bacterial cell deficient of an araD gene into which a nucleic acid construct according to claim 22 has been transformed.

61. A method for selecting for cells which have been transformed with a nucleic acid construct according to claim 62, comprising growing the cells in a growth medium containing arabinose, and thereafter selecting the surviving cells.