WO2008103060A1 - A sirna sequence, vector, a molecular target for sirna reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the rnai pathway with transcripts as well as the application of the sirna sequ - Google Patents

A sirna sequence, vector, a molecular target for sirna reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the rnai pathway with transcripts as well as the application of the sirna sequ Download PDF

Info

Publication number
WO2008103060A1
WO2008103060A1 PCT/PL2008/000017 PL2008000017W WO2008103060A1 WO 2008103060 A1 WO2008103060 A1 WO 2008103060A1 PL 2008000017 W PL2008000017 W PL 2008000017W WO 2008103060 A1 WO2008103060 A1 WO 2008103060A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
transcripts
sequence
repeats
mutated
Prior art date
Application number
PCT/PL2008/000017
Other languages
French (fr)
Inventor
Wlodzimierz Krzyzosiak
Jacek Krol
Agnieszka Fiszer
Original Assignee
Instytut Chemiii Bioorganicznej Pan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Instytut Chemiii Bioorganicznej Pan filed Critical Instytut Chemiii Bioorganicznej Pan
Publication of WO2008103060A1 publication Critical patent/WO2008103060A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the subject of the present invention are a siRNA sequence, a vector, a molecular target for siRNA reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of the RNA interference pathway with transcripts containing repeating sequences as well as the application of a siRNA sequence and the vector in the therapy of trinucleotide repeat expansion diseases (TREDs).
  • TREDs trinucleotide repeat expansion diseases
  • TREDs Triplet Repeat Expansion Diseases
  • FXS fragile X-chromosome syndrome
  • DMl myotonic dystrophy type 1
  • HD Huntington's disease
  • SCAs spinocerebellar ataxias
  • TRED-related genes contain CAG repeats in the coding region, and the number of repeats capable of causing the diseases is usually between 40 and 100. Repeat expansions in non-coding regions are larger and more diverse. It is commonly believed that repeats occurring in translated regions cause disease through altering the functioning of proteins, which in most cases contains expanded glutamine repeats. But, their toxic activity may not be the only mechanism responsible for the disruption of neuronal function. Transcripts with extended repeats in non-coding regions do not cause any qualitative changes in the protein, but may be inhibited at the transcription level, or their translation may be repressed. They can also activate other proteogenic mechanisms at the RNA level including the sequestration of specific proteins by mutant transcripts.
  • FXTAS FX associated Tremor Ataxia Syndrome
  • a characteristic of the hairpin formed by identical CNG repeats is an increase in rigidity directly proportional to its length. Structures formed by CUG and CAG repeats assume a geometry typical of A-RNA and may induce cellular responses typical of long, double-stranded RNA. One such response is RNAi, in which short RNA duplexes generated by the Dicer nuclease are used by the RISC complex in the specific silencing of genes containing complementary sequences.
  • TRED therapy is a sizeable challenge due to the sites of occurrence of the main symptoms of the disease meaning the CNS, as well as the need to eliminate the mutated gene products of a specific allele of a specific gene.
  • Patent descriptions CA2565098 (published 2005-12-08), US2004220132 (published 2004-11-04) and WO2004047872 (published 2004-06-10) describe a method of treating neurodegenerative diseases through the intra-cranial administration of siRNA.
  • Those solutions present a method, short interfering RNAs as well as a procedure of treating neurodegenerative diseases which encompass the surgical implantation of a catheter, such that its reagent release site is adjacent to a specific region of cerebral infusion, and releases, through the catheter egress, at least one substance capable of halting the biosynthesis of proteins causing neurodegeneration.
  • That invention also describes vectors encoding short interfering RNAs as well as methods of treating neurodegenerative diseases such as Alzheimer's, Parkinson's, Huntington's, type 1, 2 or 3 spinocerebellar ataxias and/or DRPLA.
  • Patent descriptions US2006270623 (published 2006-11-30), US2005277133 (published 2005-12-15), GB2415961 (published 2006-01-11) and WO2005105995 (published 2005-11-10) describe a RNAi-based method of treating diseases caused by polyQ (polyglutamine) repeats using a short interfering nucleic acid (siNA). That solution relates to compounds, their composition, research and diagnostic methods and treatment methods of diseases, as well as conditions related to allelic variants of polyglutamine repeats responsible for modulating gene expression and/or activity.
  • siNA short interfering nucleic acid
  • Said solution also relates to compounds, their composition, and methods relating to diseases and conditions connected with allelic variants of polyglutamine repeats responsible for the modulation of the expression and/or activity of genes involved in pathways related to genes containing polyQ or with other cellular processes which may influence the course and/or development of diseases related to poly-Q and their symptoms, such as Huntington's disease and its symptoms, such as advancing chorea, stiffness, dementia and seizures, spinocerebellar ataxia, spinal-bulbular muscular atrophy (SBMA), Dentatorubral and Pallidoluysian Atrophy (DRPLA) as well as any other disease or symptom related to the level of proteins containing repeat expansions, in a cell or tissue, individually or in connection with other therapies.
  • diseases related to poly-Q and their symptoms such as Huntington's disease and its symptoms, such as advancing chorea, stiffness, dementia and seizures, spinocerebellar ataxia, spinal-bulbular muscular atrophy (SBMA), Dentatorubral and
  • Patent description CA2526893 (published 2004-11-25) describes a method of inhibiting the expression of a gene related to Huntington's disease through the application of double-stranded RNA (dsRNA).
  • dsRNA double-stranded RNA
  • the authors described the application of an inhibitor of the expression of a Huntington's disease gene as well as a drug counteracting and/or curing Huntington's disease.
  • the specific target mRNA sequence is located upstream of the CAG repeats in the Huntington's gene.
  • the expression of this gene is inhibited through the application of dsRNA, of a sequence homologous with the mRNA sequence. Using this method, one may effectively obtain siRNAs containing from 21 to 23 bp. of dsRNA homologous with the mRNA sequence.
  • Huntington's disease can be counteracted and/or cure through the administration or transfer of the above dsRNA as an inhibitor of the expression of the Huntington's gene, or prophylactically and/or therapeutically into a live mammal or live cells.
  • Patent description US2005255086 (published 2005-11-17) describes an application of nucleic acid molecules for the silencing of the Huntington's disease gene.
  • Said solution relates to siRNAs directed against the Huntington's disease gene, methods of their application as well as vector system for said siRNA molecules.
  • This solution described allele-specific siRNA reagents which effectively silence the mutated transcript, both in experiments on cultured cells as well as studies using the mouse model.
  • RNAi regents Despite the many extant solutions using RNAi regents, applicable in treatment of diseases caused by trinucleotide repeat expansions, which are related to the expansion of unstable repeat regions in individual genes, there still exists a real need to obtain an effective solution facilitating the allele-specific elimination of mutated gene products, taking into account the specific site where the characteristic symptoms of the disease develop, meaning the central nervous system.
  • RNAi reagents i.e. siRNA
  • the subject of the present invention is a siRNA sequence, characterised in that it is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group.
  • its length is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts.
  • it contains chemical modifications in the form of: 2'-O-methyl, T- deoxy-2'-fluoro, oxyethane or LNA.
  • the next subject of invention is a vector, characterised in that it releases a siRNA sequence into a cell which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group.
  • the length of the siRNA fragments it releases into a cell is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts.
  • it is a viral or plasmid vector.
  • the next subject of invention is a molecular target for siRNA reagents and vectors introduced into cells and tissues, characterised in that it is a characteristic hairpin structure formed by a region of trinucleotide repeats, one of CUG, CCG, CGG or CAG, in the transcripts of genes undergoing mutations leading to inheritable neurological diseases of the TRED group.
  • the next subject of invention is a method of evaluating the specificity of the silencing of a mutated transcript, characterised in that in addition to the level of the silenced gene the analysis encompasses the level of the healthy allele as well as the levels of a series of other transcripts containing regions of identical trinucleotide motif repeats, either CUG, CCG, CGG or CAG, by amplifying repeat sequence regions from cDNA using PCR and allelospecific PCR in real time.
  • the next subject of invention is a method of evaluating the interactions of enzymes of the RNA interference pathway, characterised in that the interactions of Dicer and Ago2, enzymes of the RNA interference pathway, with transcripts containing repeat sequences composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, using trancripts generated in vitro as well as recombinant nucleases, in cell extracts and in the cell, are examined, as well as methods of identifying and characterising the products of said interactions.
  • the next subject of invention is use of a siRNA, composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs).
  • TREDs trinucleotide repeat expansion
  • the length of the sequence used is equal to or longer than the length of repeated sequence repeat fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
  • the sequence used contains chemical modifications in the form of: 2'-O- methyl, 2'-deoxy-2'-fluoro, oxyethane or LNA.
  • the next subject of invention is use of a vector, which releases siRNA into cells which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary duplicated sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs).
  • TREDs trinucleotide repeat expansion
  • the length of the sequence released is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
  • the vector is a viral or plasmid vector.
  • Figure 1 represents transcripts containing long CNG repeat sequences as cleaved by the Dicer ribonuclease.
  • X3 and X8 mark three and eight repeats of the CNG triplet in the central region of the structure of CNG25 and CNG35, respectively.
  • Figure 2 represents changes in the levels of mutated cellular transcripts containing CAG and CUG repeats after Dicer knockdown.
  • DMPK mRNA The cellular level of DMPK mRNA was analyzed using RT-PCR in real time using a cDNA template obtained from the cells treated with control siRNA (DMl) or Dicer-specific siRNA (DMl -Dicer), and TaqMan probes for the DMPK and GAPDH cDNA sequences.
  • the DMPK transcript levels have been normalized to GAPDH mRNA levels and compared using a t-test for statistical significance. The results shown represent averages of four independent experiments.
  • the left panel shows an STR region analysis performed in order to determine transcript levels using a semiquantitative RT-PCR protocol, following the treatment of HD and SCAl fibroblasts with Dicer-specific siRNA (lane cDNA-Dicer). PCR products from DNA and cDNA templates obtained from HD and SCAl cells following treatment with control siRNA were used as controls. The lengths of the STR regions for HD and SCAl cells are indicated.
  • the right panel shows an analysis of STR regions to determine transcript levels of HD and SCAl after the silencing of Dicer (lane cDNA- Dicer). The signal intensity is an average of five independent experiments and is proportional to the height of the control (black bars) and mutated (grey bars) of the transcript measured densitometrically.
  • E A schematic representation of STR-SNP haplotypes in transcripts of mutated and normal HD and SCAl alleles.
  • F Analysis of normal and mutated HD and SCAl transcripts using allele-specific RT-PCR in real time. The experiments were performed at least three times. The p value was calculated using a t-test for significance.
  • Figure 3 represents analysis of short products consisting of CNG repeats, produced by Dicer in cells derived from TREDs patients.
  • the levels of expression of let-7, miR-21 and miR-16 were also determined, wherein the hybridization of the U6 probe served as a control for total RNA amounts.
  • Figure 4 represents the silencing of Dicer which demonstrates the downstream effects caused by the siCUGs generated in cells.
  • A SCAl and HD transcript analysis using semi-quantitative RT-PCR following the treatment of DMl cells with control siRNA (lane DMl) as well as Dicer-specific siRNAs (lane DMl -Dicer). Another control used were cells from a healthy individual (WT). The genotypes of STR regions for SCAl and HD in the cells used are shown.
  • Bar graphs represent the cellular levels of the analyzed transcripts, determined using RT-PCR of STRs or Northern blot (for DMPK), measured densitometrically. Signal intensity has been normalized to the GAPDH mRNA level and compared using a t-test.
  • the left panel represents the levels of Ago2 and GAPDH proteins using a Western blot, following the treatment of healthy and DMl cells with control or Ago2 specific siRNA.
  • the DMPK transcript level was determined using RT-PCR in real time, whereas the analysis of HD and SCAl transcripts was performed using semiquantitative RT-PCR.
  • the graphs represent average results from three independent experiments. The p value was calculated using a t-test for statistical significance.
  • Figure 5 represents the cellular effects elicited by exogenous siRNA composed of repeats.
  • a 21 nt siRNA used in the experiment The structure of these reagents in the cell is difficult to determine, and as an alternative to the presented unstable duplex may be single strands or unstable hairpin structures.
  • HD SCAl cells with (CAG)7 or (CUG)7 siRNAs.
  • Figure 6 represents an analysis of the effectiveness and specificity of siRNA activity of various sequence lengths: the effectiveness of silencing of complementary transcripts increases with the increase of siCUG length.
  • O, L and C represent respective controls: untreated cells, cells treated with Lipofectamine alone and cells transfected with control siRNA.
  • Figure 7 represents a schematic showing the Dicer-dependent decrease of mutated transcripts and their silencing by endogenous and exogenous siRNA composed of repeats, along the RNAi pathway.
  • Transcripts containing long CUG and CAG repeat regions which form hairpins are both substrates for Dicer and comprise a target sequence for the RNAi mechanisms, induced by short sequences consisting of complementary repeats.
  • Example 1 is a diagrammatic representation of the present invention described above.
  • Fig. IA represents analysis of the Dicer cleavage of its natural substrate, the miRNA precursor pre-miR-24. Two cuts are made in the stem of the precursor, a 23 nucleotide product is generated from the 5 '-side of the transcript, which corresponds to the mature miRNA. Transcripts composed of 17 CUG trinucleotide repeats form a structure with an unpaired U-U, which results in lower stem stability and resistance to Dicer cleavage.
  • Transcripts composed of 17 repeats of CAG, CCG or CGG, which form similar structures were also not cleaved by Dicer (Fig. IB for CUGl 7_cl).
  • the transcripts contain 5-nucleotide, pairing sequences at either ends, mimicing the base-paired sequences which commonly occur in many natural transcripts.
  • Hairpin structures composed of long sequences of CUG repeats are more stable and susceptible to cleavage by Dicer, as shown for CUG35_cl (Fig.1C) and others (Fig. ID).
  • Transcripts CNG25_cl and CUG25 are also good substrates for Dicer (Fig.
  • IE-G wherein those composed of CUG and CAG repeats are more susceptible than those composed of CCG and CGG.
  • the exact sites of cleavage by Dicer were then analyzed.
  • the primary cut sites generate fragments of 21, 22 and 24 nucleotides long from the 5' end as well as 20 and 22 nt. from the 3' end, and often occur at unpaired nucleotides (Fig. IE).
  • Secondary cut sites shorten the primary cut products to 21 nt fragments.
  • the CUG25 transcript resulted in fragments of 21, 22 and 24 nucleotides from the 5 '-end as well as 20 and 22 nucleotides from the 3 '-end (Fig. IF).
  • the level of mutated transcripts related to TREDs is lowered in cells by the Dicer ribonuclease.
  • Fig. 2 A In DMl cells using Northern blotting, it was observed that the level of the mutated DMPK allele which was around 40 % higher in cells with silenced Dicer than that in control cells (Fig. 2B), confirmed using RT-PCR analysis in real time (Fig. 2C).
  • transcript levels were analyzed using RT-PCR and it was determined that the mutated allele level was about 50 % higher in cells with silenced Dicer in relation to control cells (Fig. 2D). The levels of normal allele transcripts remained unchanged or was only slightly higher.
  • Short fragments composed of CAG and CUG repeats are detectable in cells.
  • Northern analysis showed that in HD, SCAl and DMl cells, there occur short, ca. 21 nucleotide RNAs composed of CAG (in HD and SCAl) as well as CUG in DMl (Fig. 3). Following the treatment of cells with Dicer-specific siRNA a drop in the level of analyzed miRNAs is observed.
  • Short fragments composed of CUG repeats induce secondary effects in cells.
  • siRNA silencing transcripts containing long complementary repeats.
  • DMl cells 15/1000 CUG repeats
  • SCAl the level of SCAl increases (about 30%) as does HD (about 35%) in comparison to control cells (Fig. 4A, B).
  • Changes in the expression of Dicer did not influence the levels of the other transcripts examined.
  • the siCUG generated in DMl cells are active on the RNAi pathway through analogous experiments performed using Ago2 silencing.
  • the silencing of the Ago2 transcript in DMl cells resulted in the increase of HD and SCAl mRNA by about 45% and 40% respectively, whereas the DMPK level remained unchanged (Fig. 4C).
  • Example 5 Mutated transcripts are silenced by exogenous siRNAs complementary to the repeats contained therein.
  • RNA Longer siCUGs are capable of more effective silencing of mutated alleles. It was shown that in comparison to siCUGs composed of 7 repeats described earlier, RNA consisting of 8 and 9 repeated motifs are capable of greatly enhanced silencing of mutated alleles, which was shown using the HD cell line (Fig. 6A, B). At the same time it was shown that the most effective RNA, (CUG)9, can specifically silence mutated alleles at a concentration as low as 2 nM (Fig. 6C).
  • DNA templates for transcripts of CNGl 7_cl, 25_cl, 35_cl; CUG25; as well as pre-miR- 24 were obtained using chemical synthesis and purification in a polyacrylamide gel.
  • Each oligomer contained a promoter sequence for T7 RNA polymerase (or SP6 for pre- miR-24) on the 3' end.
  • DNA templates for in vitro transcription were obtained through the amplification of gel-purified fragments of SCAl, HD and DMPK, containing different numbers of CNG repeats.
  • primer sequences were used: for SCAl (long flanking sequence) (R 5 'CCGAGGG AC AAAGTGGCTGC; F 5 'TAATACGACTCACTATAGGAACCTATGCCA GCTTCATCC); HD (R 5 'TGCAGCGGCTCCTCAGCC; F 5 'TAATACGACTCACTATAG
  • DMPK R 5 'TGGGGCTCCGAGAGCAGCGCAA; F 5'TAATACGACTCACTATAGGCACAGAAGCCGCGCCCAC); (short flanking sequence) SCAl (R 5'GAACTGGAAATGTGGACGTA; F
  • transcripts 5'TAATACGACTCACTATACAACATG GGCAGTCTGAGC).
  • the transcripts were 5' end labeled using 1OU of T4 polynucleotide kinase (Epicentre) and 50 ⁇ Ci [V 32 P]ATP (4500 Ci/mmol; ICN) at 37 0 C for 10 min.
  • Internally labeled 32 P RNA were obtained during the transcription reaction in vitro using [ ⁇ - 32 P]CTP.
  • the labeled RNA were purified in a gel and stored at -8O 0 C prior to use.
  • RNA was subjected to denaturation and renaturation by heating to 80 0 C for 1 min and the slowly cooling to 37°C for an appropriate time, as shown in the figures. The reactions were stopped through the addition of an equal volume of loading buffer (8 M urea with 20 mM EDTA and dyes).
  • the samples were analysed in a 15% polyacrylamide gel with 7.5 M urea in IX TBE with products of alkaline hydrolysis as well as limited cleavage using Tl ribonuclease of the same RNA molecule.
  • the alkaline lysis marker was obtained by the incubation of the labeled RNA in a formamide buffer containing 0.5 mM MgCl 2 at 100 0 C for 10 min. Partial Tl cleavage of the RNA was performed in semi-denaturing conditions (10 mM sodium citrate pH 4.5, 0.5 mM EDTA, as well as 3.5 M urea) for 10 min at 55 0 C with 0.2 U/ ⁇ l of enzyme. The products were detected using autoradiography.
  • Quantitative analysis of cleavages was performed using a Typhoon Phosphorlmager (Molecular Dynamics).
  • the primary cuts were distinguished from secondary ones through a comparison of hydrolysis patterns of transcripts labelled at either 5' or 3' ends as well as through an analysis of the intensity of signals originating from the cleavage of 5' end-labelled transcripts at different time points of the reactions.
  • RNA was isolated from human fibroblasts (from Coriell Cell Repositories; GM00321 - healthy, GM04033 - DMPK mutant (1000 CUG), GM03991 - DMPK mutant (80 CUG), GM04208 - HD mutant, GM06927 - SCAl mutant) using TRIzol (Invitrogen) according to the manufacturer's instructions.
  • RNA (1 ⁇ g) was used as a template for cDNA synthesis with random hexamer or oligo-dT primers (Promega) using the Superscript II kit (Invitrogen).
  • GAPDH F 5'GAAGGTGAAGGTCGGAGTC; R 5'GAAGATGGTGATGGGATTTC; 30 cycles of 94 0 C for 15s, 6O 0 C for 15s and 72 0 C for 20s
  • ⁇ -actin F 5TTCGCGGGCGACGATGC; R 5'CGTACATGGCTGGGG TGTTG; 30 cycles of 95 0 C for 30 s, 6O 0 C for 30s and 72 0 C for 45 s).
  • HD F 5'ATGGCGACCCTGGAAAAGCTGAT; R 5 'TGAGGC AGC AGCGGCTG T; 25 cycles of 95 0 C for 30 s, 6O 0 C for 20s and 72°C for 45 s
  • SCAl F 5 'CAACATGGGCAGTCTGAGC; R 5 'GAACTGGAAATGTGGACGTA; 25 cycles of 95 0 C for 20 s, 6O 0 C for 20s and 72 0 C for 45 s
  • SCA3 F 5 'GGAAGAGACGAGAAGCCTAC; R 5 'TCACCTAGATCACTCCCAAGT; 25 cycles of 95 0 C for 20 s, 55 0 C for 20s and 72 0 C for 45 s
  • AR F 5 'TGCGCGAAGTGATCCAGAAC; R 5 'CTTGGGGAGAACCATCCTCA; 30 cycles of 95 0 C for 15 s, 57
  • Real-time RT-PCR was performed using the SYBR Green PCR Master Mix kit (Applied Biosystems), with 2 ⁇ l cDNA, which corresponds to 20 ng of total RNA in a total volume of 20 ⁇ l and 0.2 ⁇ M of each primer (for Dicer F 5 'TTAACCAGCTGTGGGGAGAGGGCTG; R 5 'AGCC AGCGATGC AAAGATGGTGTTG).
  • Quantitative RT-PCR was performed in a Rotor-Gene 3000 (Corbett Research) at 95 0 C for 30 s, 61°C for 30s and 72 0 C for 45 s Allele-specif ⁇ c real-time RT-PCR was performed using 0.2 ⁇ M of each allele-specific primer (HD 5'GAGCTTCTGCAAACCCTGATC,
  • siRNA and transfection conditions 5 'GAGCTTCTGCAAACCCTGATT; SCAl 5 'GAGGCC ACC AAGAAAGCTT, 5 'GAGGCCACCAAGAAAGCCT), and the SYBR Green PCR Master Mix kit (Applied Biosystems) with 2 ⁇ l cDNA, which corresponds to 20 ng of total RNA.
  • Human fibroblasts were transfected with siRNA (specific for Dicer: sense strand 5 'GGCACCCAUCUCUAAUUAUUt or for Ago2: sense strand 5 'GCACGGAAGUCCAUCUGAAUt) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
  • the cells were cultured in 24-well plates to 80% confluence. Each well was supplemented with 30 nM Dicer- or Ago2-specific siRNA as well as control siRNA (random 21 nucleotide oligomers; Invitrogen) mixed with 1 ⁇ l of Lipofectamine 2000 in 100 ⁇ l Opti-MEM. The mixture was added to the cells and incubated for 4 hours.
  • the cells were suspended in IX PBS with protease inhibitors (Protease Inhibitor Cocktail; Roche) and the protein was isolated using cycles of freezing/thawing. 20 ⁇ g of lysate proteins were separated using SDS- PAGE, and then electrotransferred onto a nitrocellulose membrane (Sigma). After blocking with 5% milk, the membrane was incubated for 1 hour with one of the primary antibodies: polyclonal antibody against human Dicer (Imgenex; diluted 1 :500), monoclonal antibody against Ago2 (Abnova; dilutedl :500), a monoclonal antibody against GAPDH (Chemicon; diluted 1:500). Following the reaction the membranes were incubated in a secondary anti-rabbit or anti-mouse antibody conjugated with biotin. The chromogenic reaction for the detection of specific was performed using the Fast BCIP/NBT kit (Sigma).
  • DMPK F 5'AGGCTT AAGGAGGTCCGACTG; R 5 'GCGAAGTGCAGCT GCGTGATC; 35 cycles of 95 0 C for 5 s, 6O 0 C for 5s and 72 0 C for 30 s
  • GAPDH F 5 'GAAGGTGAAGGTCGGAGT; R 5'GAAGATGGTGATGGGATTTC; 30 cycles of 95 0 C for 15 s, 6O 0 C for 15s and 72 0 C for 20 s.
  • the membranes were washed with 2x SSC and 0.5% SDS and exposed to X-ray film overnight.

Abstract

The subject of the present invention are a siRNA sequence, a vector, a molecular target for siRNA reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of the RNA interference pathway with transcripts containing repeating sequences as well as the application of a siRNA sequence and the vector in the therapy of trinucleotide repeat expansion diseases (TREDs). The solution relates to a new concept in the treatment of inherited neurological diseases caused by the expansion of tri-nucleotide elements using RNA interference and new tools for the embodiment of said concept.

Description

A siRNA sequence, vector, a molecular target for siRNA reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the RNAi pathway with transcripts as well as the application of the siRNA sequence and vector
The subject of the present invention are a siRNA sequence, a vector, a molecular target for siRNA reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of the RNA interference pathway with transcripts containing repeating sequences as well as the application of a siRNA sequence and the vector in the therapy of trinucleotide repeat expansion diseases (TREDs). The solution relates to a new concept in the treatment of inherited neurological diseases caused by the expansion of tri-nucleotide elements using RNA interference and new tools for the embodiment of said concept.
The expansion of unstable regions repeats in individual genes is the cause of over 20 different inheritable diseases collectively dubbed Triplet Repeat Expansion Diseases (TREDs). These include fragile X-chromosome syndrome (FXS), myotonic dystrophy type 1 (DMl), Huntington's disease (HD) and a series of spinocerebellar ataxias (SCAs). Repeat sequences which undergo pathological expansion occur in all genetic regions, both translated and untranslated.
Most TRED-related genes contain CAG repeats in the coding region, and the number of repeats capable of causing the diseases is usually between 40 and 100. Repeat expansions in non-coding regions are larger and more diverse. It is commonly believed that repeats occurring in translated regions cause disease through altering the functioning of proteins, which in most cases contains expanded glutamine repeats. But, their toxic activity may not be the only mechanism responsible for the disruption of neuronal function. Transcripts with extended repeats in non-coding regions do not cause any qualitative changes in the protein, but may be inhibited at the transcription level, or their translation may be repressed. They can also activate other proteogenic mechanisms at the RNA level including the sequestration of specific proteins by mutant transcripts. A wider role of pathogenic mechanisms at the RNA level in TREDs is indicated by the neurodegeneration occurring in a portion of carriers of the pre-mutation alleles of the FMRl gene (Fragile X associated Tremor Ataxia Syndrome, FXTAS). Research shows that the clinical phenotype of FXTAS is a result of not only an extended region of CGG repeats in the FMRl transcript, but also an increased level of said transcript in the carriers.
The stem of the hairpin formed by CNG (N = U, A, C, G) repeats consists of periodically occurring C-G and G-C pairs, as well as unpaired N-N. If no interacting flanking sequences occur in the transcript, then the (CNG)n sequences exhibit a tendency to form several conformational variants. A characteristic of the hairpin formed by identical CNG repeats is an increase in rigidity directly proportional to its length. Structures formed by CUG and CAG repeats assume a geometry typical of A-RNA and may induce cellular responses typical of long, double-stranded RNA. One such response is RNAi, in which short RNA duplexes generated by the Dicer nuclease are used by the RISC complex in the specific silencing of genes containing complementary sequences.
Most diseases caused by the expansion of trinucleotide repeats are autosomal dominant, meaning that they are caused by a mutation in one of two gene variants. The product of a mutated gene, a transcript or protein or both, are cytotoxic. Thus, the removal of a mutated transcript should counteract the disease. TRED therapy is a sizeable challenge due to the sites of occurrence of the main symptoms of the disease meaning the CNS, as well as the need to eliminate the mutated gene products of a specific allele of a specific gene.
Patent descriptions CA2565098 (published 2005-12-08), US2004220132 (published 2004-11-04) and WO2004047872 (published 2004-06-10) describe a method of treating neurodegenerative diseases through the intra-cranial administration of siRNA. Those solutions present a method, short interfering RNAs as well as a procedure of treating neurodegenerative diseases which encompass the surgical implantation of a catheter, such that its reagent release site is adjacent to a specific region of cerebral infusion, and releases, through the catheter egress, at least one substance capable of halting the biosynthesis of proteins causing neurodegeneration. That invention also describes vectors encoding short interfering RNAs as well as methods of treating neurodegenerative diseases such as Alzheimer's, Parkinson's, Huntington's, type 1, 2 or 3 spinocerebellar ataxias and/or DRPLA.
Patent descriptions US2006270623 (published 2006-11-30), US2005277133 (published 2005-12-15), GB2415961 (published 2006-01-11) and WO2005105995 (published 2005-11-10) describe a RNAi-based method of treating diseases caused by polyQ (polyglutamine) repeats using a short interfering nucleic acid (siNA). That solution relates to compounds, their composition, research and diagnostic methods and treatment methods of diseases, as well as conditions related to allelic variants of polyglutamine repeats responsible for modulating gene expression and/or activity. Said solution also relates to compounds, their composition, and methods relating to diseases and conditions connected with allelic variants of polyglutamine repeats responsible for the modulation of the expression and/or activity of genes involved in pathways related to genes containing polyQ or with other cellular processes which may influence the course and/or development of diseases related to poly-Q and their symptoms, such as Huntington's disease and its symptoms, such as advancing chorea, stiffness, dementia and seizures, spinocerebellar ataxia, spinal-bulbular muscular atrophy (SBMA), Dentatorubral and Pallidoluysian Atrophy (DRPLA) as well as any other disease or symptom related to the level of proteins containing repeat expansions, in a cell or tissue, individually or in connection with other therapies.
Patent description CA2526893 (published 2004-11-25) describes a method of inhibiting the expression of a gene related to Huntington's disease through the application of double-stranded RNA (dsRNA). The authors described the application of an inhibitor of the expression of a Huntington's disease gene as well as a drug counteracting and/or curing Huntington's disease. The specific target mRNA sequence is located upstream of the CAG repeats in the Huntington's gene. The expression of this gene is inhibited through the application of dsRNA, of a sequence homologous with the mRNA sequence. Using this method, one may effectively obtain siRNAs containing from 21 to 23 bp. of dsRNA homologous with the mRNA sequence. Huntington's disease can be counteracted and/or cure through the administration or transfer of the above dsRNA as an inhibitor of the expression of the Huntington's gene, or prophylactically and/or therapeutically into a live mammal or live cells. Patent description US2005255086 (published 2005-11-17) describes an application of nucleic acid molecules for the silencing of the Huntington's disease gene. Said solution relates to siRNAs directed against the Huntington's disease gene, methods of their application as well as vector system for said siRNA molecules. This solution described allele-specific siRNA reagents which effectively silence the mutated transcript, both in experiments on cultured cells as well as studies using the mouse model.
Despite the many extant solutions using RNAi regents, applicable in treatment of diseases caused by trinucleotide repeat expansions, which are related to the expansion of unstable repeat regions in individual genes, there still exists a real need to obtain an effective solution facilitating the allele-specific elimination of mutated gene products, taking into account the specific site where the characteristic symptoms of the disease develop, meaning the central nervous system.
The goal of the present invention is to produce effective, allele-specific RNAi reagents (i.e. siRNA), which may be applicable in the therapy of TREDs. The embodiment of such a stated goal and the solution of problems related to the fact that RNAi reagents RNAi (i.e. siRNA) should be designed in a way that their sequence and length corresponds to or are not shorter than the products generated by Dicer ribonuclease from transcripts of the mutated genes containing trinucleotide repeats; have been achieved in the present invention. The subject of the present invention is a siRNA sequence, characterised in that it is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group.
Preferentially, its length is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts. Preferentially, it contains chemical modifications in the form of: 2'-O-methyl, T- deoxy-2'-fluoro, oxyethane or LNA. The next subject of invention is a vector, characterised in that it releases a siRNA sequence into a cell which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group. Preferentially, the length of the siRNA fragments it releases into a cell is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts.
Preferentially, it is a viral or plasmid vector.
The next subject of invention is a molecular target for siRNA reagents and vectors introduced into cells and tissues, characterised in that it is a characteristic hairpin structure formed by a region of trinucleotide repeats, one of CUG, CCG, CGG or CAG, in the transcripts of genes undergoing mutations leading to inheritable neurological diseases of the TRED group.
The next subject of invention is a method of evaluating the specificity of the silencing of a mutated transcript, characterised in that in addition to the level of the silenced gene the analysis encompasses the level of the healthy allele as well as the levels of a series of other transcripts containing regions of identical trinucleotide motif repeats, either CUG, CCG, CGG or CAG, by amplifying repeat sequence regions from cDNA using PCR and allelospecific PCR in real time.
The next subject of invention is a method of evaluating the interactions of enzymes of the RNA interference pathway, characterised in that the interactions of Dicer and Ago2, enzymes of the RNA interference pathway, with transcripts containing repeat sequences composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, using trancripts generated in vitro as well as recombinant nucleases, in cell extracts and in the cell, are examined, as well as methods of identifying and characterising the products of said interactions. The next subject of invention is use of a siRNA, composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs). Preferentially, the length of the sequence used is equal to or longer than the length of repeated sequence repeat fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
Preferentially, the sequence used contains chemical modifications in the form of: 2'-O- methyl, 2'-deoxy-2'-fluoro, oxyethane or LNA.
The next subject of invention is use of a vector, which releases siRNA into cells which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary duplicated sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs). Preferentially, the length of the sequence released is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
Preferentially, the vector is a viral or plasmid vector.
The attached Figures facilitate a better understanding and present the nature of the present invention.
Figure 1 represents transcripts containing long CNG repeat sequences as cleaved by the Dicer ribonuclease.
Reactions of the 5' -end-labeled pre-miR-24 (A), CUG17_cl (B), and CUG35_cl (C) transcripts with Dicer. Lanes represent: Ci - incubation control without Dicer; F - formamide generated marker; T - guanine-specific ladder. The positions of selected G nucleotides are indicated. It should be underlined that Dicer cleavage products containing a 3 'OH group migrate slower in the gel than Tl and formamide products of the same length, which possess a 2'3'-cyclic phosphate, and that this difference is about 1 nucleotide in the range of 20-40 nt under the conditions used. Primary cleavage sites (black rectangles and arrows) as well as secondary cleavage sites (white arrows) are shown on autoradiograms as well as on models of secondary structure. (D) The half-life (in minutes) of substrates: 32P-labeled transcripts CNG25_cl (white bars) as well as CNG35_cl (grey bars). The presented results are an average of two independent experiments. Dicer cleavage patterns obtained for 5' end-labeled transcripts of CUG_25_cl (E), CUG25 (F), as well as CAG25_cl, CCG25_cl, and CGG25_cl (G). Cleavage products were analyzed as described for (A)-(C). X3 and X8 mark three and eight repeats of the CNG triplet in the central region of the structure of CNG25 and CNG35, respectively. Figure 2 represents changes in the levels of mutated cellular transcripts containing CAG and CUG repeats after Dicer knockdown.
(A) The cellular level of Dicer mRNA was determined using RT-PCR in real time using a cDNA template obtained from the cells treated with control siRNA (black bars) and Dicer-specific siRNA (grey bars). The results presented in the Figure are an average of three independent experiments. The right panel shows an analysis of Dicer and GAPDH protein levels using Western blot, following the silencing of Dicer.
(B) A Northern blot of a mutated (1000 CUG) and normal (15 CUG) transcripts of DMPK following the treatment of fibroblasts with siRNAs specific for Dicer (lane - Dicer) or control siRNA (lane +Dicer). The signal intensity representing levels of normal (black bars) and mutated (grey bars) transcripts have been measured densitometrically (ImageQuant 5.1, Molecular Dynamics) and is proportional to the height of the bars in the graph. The signal intensity has been normalized to GAPDH mRNA and compared using a t-test for statistical significance (Prism v 4, GraphPad Software, San Diego, CA). (C) The cellular level of DMPK mRNA was analyzed using RT-PCR in real time using a cDNA template obtained from the cells treated with control siRNA (DMl) or Dicer-specific siRNA (DMl -Dicer), and TaqMan probes for the DMPK and GAPDH cDNA sequences. The DMPK transcript levels have been normalized to GAPDH mRNA levels and compared using a t-test for statistical significance. The results shown represent averages of four independent experiments.
(D) The left panel shows an STR region analysis performed in order to determine transcript levels using a semiquantitative RT-PCR protocol, following the treatment of HD and SCAl fibroblasts with Dicer-specific siRNA (lane cDNA-Dicer). PCR products from DNA and cDNA templates obtained from HD and SCAl cells following treatment with control siRNA were used as controls. The lengths of the STR regions for HD and SCAl cells are indicated. The right panel shows an analysis of STR regions to determine transcript levels of HD and SCAl after the silencing of Dicer (lane cDNA- Dicer). The signal intensity is an average of five independent experiments and is proportional to the height of the control (black bars) and mutated (grey bars) of the transcript measured densitometrically.
(E) A schematic representation of STR-SNP haplotypes in transcripts of mutated and normal HD and SCAl alleles. (F) Analysis of normal and mutated HD and SCAl transcripts using allele-specific RT-PCR in real time. The experiments were performed at least three times. The p value was calculated using a t-test for significance.
Figure 3 represents analysis of short products consisting of CNG repeats, produced by Dicer in cells derived from TREDs patients. Northern hybridization of total RNA from control, HD, SCAl and DMl fibroblastswith normal and decreased levels of Dicer (lanes marked -Dicer), using complementary oligonucleotide probes against (CAG)7 or (CUG)7. The levels of expression of let-7, miR-21 and miR-16 were also determined, wherein the hybridization of the U6 probe served as a control for total RNA amounts. Figure 4 represents the silencing of Dicer which demonstrates the downstream effects caused by the siCUGs generated in cells.
(A) SCAl and HD transcript analysis using semi-quantitative RT-PCR following the treatment of DMl cells with control siRNA (lane DMl) as well as Dicer-specific siRNAs (lane DMl -Dicer). Another control used were cells from a healthy individual (WT). The genotypes of STR regions for SCAl and HD in the cells used are shown.
(B) Bar graphs represent the cellular levels of the analyzed transcripts, determined using RT-PCR of STRs or Northern blot (for DMPK), measured densitometrically. Signal intensity has been normalized to the GAPDH mRNA level and compared using a t-test.
(C) The left panel represents the levels of Ago2 and GAPDH proteins using a Western blot, following the treatment of healthy and DMl cells with control or Ago2 specific siRNA. The DMPK transcript level was determined using RT-PCR in real time, whereas the analysis of HD and SCAl transcripts was performed using semiquantitative RT-PCR. The graphs represent average results from three independent experiments. The p value was calculated using a t-test for statistical significance. Figure 5 represents the cellular effects elicited by exogenous siRNA composed of repeats. (A) A 21 nt siRNA used in the experiment. The structure of these reagents in the cell is difficult to determine, and as an alternative to the presented unstable duplex may be single strands or unstable hairpin structures.
(B) An analysis of the transcript levels containing trinucleotide repeats using RT-PCR and STR amplification, or Northern blotting (for DMPK) after the treatment of DMl,
HD, SCAl cells with (CAG)7 or (CUG)7 siRNAs.
(C) Bar graphs show the cellular level of the analyzed transcripts determined using RT- PCR or Northern blot protocols, measured densitometrically. The experiments were performed at least thrice, and the signal intensity was compared to GAPDH mRNA levels using a t-test for statistical significance.
(D) A Northern blot of the level of normal and mutated DMPK transcripts following treatment of cells with (CAG)7 or (CUG)7 siRNAs.
Figure 6 represents an analysis of the effectiveness and specificity of siRNA activity of various sequence lengths: the effectiveness of silencing of complementary transcripts increases with the increase of siCUG length.
(A), (B) Analysis of HD transcript levels in cell lines containing mutations in this gene, containing various (indicated) length variants, following the application of siCUGs of varying lengths, from 6 to 9 CUG repeats. O, L and C represent respective controls: untreated cells, cells treated with Lipofectamine alone and cells transfected with control siRNA.
(C) HD transcript levels which show the dose-dependence of the effectiveness and specificity of siRNA activity composed of 9 repeats of CUG.
Figure 7 represents a schematic showing the Dicer-dependent decrease of mutated transcripts and their silencing by endogenous and exogenous siRNA composed of repeats, along the RNAi pathway. Transcripts containing long CUG and CAG repeat regions which form hairpins are both substrates for Dicer and comprise a target sequence for the RNAi mechanisms, induced by short sequences consisting of complementary repeats.
Below are example embodiments of the present invention described above. Example 1
All hairpin structures formed by CNG repeats of sufficient length are Dicer substrates. The relationship between the type and length of trinucleotide repeats and the effectiveness of their binding and cleavage by Dicer were characterized. Fig. IA represents analysis of the Dicer cleavage of its natural substrate, the miRNA precursor pre-miR-24. Two cuts are made in the stem of the precursor, a 23 nucleotide product is generated from the 5 '-side of the transcript, which corresponds to the mature miRNA. Transcripts composed of 17 CUG trinucleotide repeats form a structure with an unpaired U-U, which results in lower stem stability and resistance to Dicer cleavage. Transcripts composed of 17 repeats of CAG, CCG or CGG, which form similar structures were also not cleaved by Dicer (Fig. IB for CUGl 7_cl). In addition to the repeat sequence, the transcripts contain 5-nucleotide, pairing sequences at either ends, mimicing the base-paired sequences which commonly occur in many natural transcripts. Hairpin structures composed of long sequences of CUG repeats are more stable and susceptible to cleavage by Dicer, as shown for CUG35_cl (Fig.1C) and others (Fig. ID). Transcripts CNG25_cl and CUG25 are also good substrates for Dicer (Fig. IE-G), wherein those composed of CUG and CAG repeats are more susceptible than those composed of CCG and CGG. The exact sites of cleavage by Dicer were then analyzed. For the CUG25_cl transcript, the primary cut sites generate fragments of 21, 22 and 24 nucleotides long from the 5' end as well as 20 and 22 nt. from the 3' end, and often occur at unpaired nucleotides (Fig. IE). Secondary cut sites shorten the primary cut products to 21 nt fragments. The CUG25 transcript resulted in fragments of 21, 22 and 24 nucleotides from the 5 '-end as well as 20 and 22 nucleotides from the 3 '-end (Fig. IF).
Example 2
The level of mutated transcripts related to TREDs is lowered in cells by the Dicer ribonuclease.
It was shown in vitro that Dicer is engaged in the regulation of transcripts containing elongated hairpin structures. The levels of control transcripts and ones containing trinucleotide repeats were analyzed in cells from both healthy individuals and those suffering from disorders of HD, SCAl and DMl, both prior to and following the silencing of Dicer. The effectiveness of Dicer silencing at the mRNA and protein level is shown in Fig. 2 A. In DMl cells using Northern blotting, it was observed that the level of the mutated DMPK allele which was around 40 % higher in cells with silenced Dicer than that in control cells (Fig. 2B), confirmed using RT-PCR analysis in real time (Fig. 2C). For HD and SCAl cells, transcript levels were analyzed using RT-PCR and it was determined that the mutated allele level was about 50 % higher in cells with silenced Dicer in relation to control cells (Fig. 2D). The levels of normal allele transcripts remained unchanged or was only slightly higher. Example 3
Short fragments composed of CAG and CUG repeats are detectable in cells. Northern analysis showed that in HD, SCAl and DMl cells, there occur short, ca. 21 nucleotide RNAs composed of CAG (in HD and SCAl) as well as CUG in DMl (Fig. 3). Following the treatment of cells with Dicer-specific siRNA a drop in the level of analyzed miRNAs is observed.
Example 4
Short fragments composed of CUG repeats induce secondary effects in cells.
It was shown that short siCUG fragments generated in DMl cells enter the RNAi pathway and act as siRNA, silencing transcripts containing long complementary repeats. The levels of transcripts containing CAG or CUG repeats, which were potential siRNA targets, were analyzed. In DMl cells (15/1000 CUG repeats), it was shown that along with a decreased level of Dicer, the level of SCAl increases (about 30%) as does HD (about 35%) in comparison to control cells (Fig. 4A, B). Changes in the expression of Dicer did not influence the levels of the other transcripts examined. It was shown that the siCUG generated in DMl cells are active on the RNAi pathway through analogous experiments performed using Ago2 silencing. The silencing of the Ago2 transcript in DMl cells resulted in the increase of HD and SCAl mRNA by about 45% and 40% respectively, whereas the DMPK level remained unchanged (Fig. 4C).
Example 5 Mutated transcripts are silenced by exogenous siRNAs complementary to the repeats contained therein.
We achieved effective and specific silencing of mutated transcripts of HD, SCAl and DMPK following the treatment of cells with 5 nM siRNA composed of complementary trinucleotide repeats. (CUG)7 and (CAG)7 RNA reagents transfected using Lipofectamine 2000 were designed based on the analysis of CUG35_cl transcript cleavage products generated by Dicer. The level of the selected transcripts following siRNA treatment were analyzed using RT-PCR and Northern blot. DMl cells exhibited considerable silencing of the mutated DMPK allele using (CAG)7 as well as a slight decrease of the levels of normal long alleles of HD and SCAl. Using (CUG)7, the earlier described endogenous effect was slightly enhanced (Fig. 5). Likewise for the HD and SCAl cells, we showed the specific silencing of the mRNA of HD and SCAl mutated alleles respectively, following transfection with (CUG)7. Example 6
Longer siCUGs are capable of more effective silencing of mutated alleles. It was shown that in comparison to siCUGs composed of 7 repeats described earlier, RNA consisting of 8 and 9 repeated motifs are capable of greatly enhanced silencing of mutated alleles, which was shown using the HD cell line (Fig. 6A, B). At the same time it was shown that the most effective RNA, (CUG)9, can specifically silence mutated alleles at a concentration as low as 2 nM (Fig. 6C).
Methods
Preparation of RNA substrates
DNA templates for transcripts of CNGl 7_cl, 25_cl, 35_cl; CUG25; as well as pre-miR- 24 were obtained using chemical synthesis and purification in a polyacrylamide gel. Each oligomer contained a promoter sequence for T7 RNA polymerase (or SP6 for pre- miR-24) on the 3' end. DNA templates for in vitro transcription were obtained through the amplification of gel-purified fragments of SCAl, HD and DMPK, containing different numbers of CNG repeats. The following primer sequences were used: for SCAl (long flanking sequence) (R 5 'CCGAGGG AC AAAGTGGCTGC; F 5 'TAATACGACTCACTATAGGAACCTATGCCA GCTTCATCC); HD (R 5 'TGCAGCGGCTCCTCAGCC; F 5 'TAATACGACTCACTATAG
GACGGCCGCTCAGGTTC); DMPK (R 5 'TGGGGCTCCGAGAGCAGCGCAA; F 5'TAATACGACTCACTATAGGCACAGAAGCCGCGCCCAC); (short flanking sequence) SCAl (R 5'GAACTGGAAATGTGGACGTA; F
5 'TAATACGACTCACTATACAACATG GGCAGTCTGAGC). The transcripts were 5' end labeled using 1OU of T4 polynucleotide kinase (Epicentre) and 50 μCi [V32P]ATP (4500 Ci/mmol; ICN) at 370C for 10 min. Internally labeled 32P RNA were obtained during the transcription reaction in vitro using [α-32P]CTP. The labeled RNA were purified in a gel and stored at -8O0C prior to use. RNA cleavage assay using recombinant Dicer
To cleave RNA, we used commercially available Dicer from Stratagene as well as from Ambion, respectively containing -20% and -60% of full length protein (which was evaluated using SDS-PAGE) as well as a highly purified enzyme, for which no degradation products were observed. No differences were observed in the cleavage pattern for the enzymes used. Prior to the reaction with Dicer, the RNA was subjected to denaturation and renaturation by heating to 800C for 1 min and the slowly cooling to 37°C for an appropriate time, as shown in the figures. The reactions were stopped through the addition of an equal volume of loading buffer (8 M urea with 20 mM EDTA and dyes). The samples were analysed in a 15% polyacrylamide gel with 7.5 M urea in IX TBE with products of alkaline hydrolysis as well as limited cleavage using Tl ribonuclease of the same RNA molecule. The alkaline lysis marker was obtained by the incubation of the labeled RNA in a formamide buffer containing 0.5 mM MgCl2 at 1000C for 10 min. Partial Tl cleavage of the RNA was performed in semi-denaturing conditions (10 mM sodium citrate pH 4.5, 0.5 mM EDTA, as well as 3.5 M urea) for 10 min at 550C with 0.2 U/μl of enzyme. The products were detected using autoradiography. Quantitative analysis of cleavages was performed using a Typhoon Phosphorlmager (Molecular Dynamics). The primary cuts were distinguished from secondary ones through a comparison of hydrolysis patterns of transcripts labelled at either 5' or 3' ends as well as through an analysis of the intensity of signals originating from the cleavage of 5' end-labelled transcripts at different time points of the reactions.
RNA isolation, RT-PCR and real-time PCR
Total RNA was isolated from human fibroblasts (from Coriell Cell Repositories; GM00321 - healthy, GM04033 - DMPK mutant (1000 CUG), GM03991 - DMPK mutant (80 CUG), GM04208 - HD mutant, GM06927 - SCAl mutant) using TRIzol (Invitrogen) according to the manufacturer's instructions. In order to determine the effectiveness of silencing using siRNA, RNA (1 μg) was used as a template for cDNA synthesis with random hexamer or oligo-dT primers (Promega) using the Superscript II kit (Invitrogen). To amplify the GAPDH and β-actin fragments, we used the following primers and RT-PCR conditions: GAPDH (F 5'GAAGGTGAAGGTCGGAGTC; R 5'GAAGATGGTGATGGGATTTC; 30 cycles of 940C for 15s, 6O0C for 15s and 720C for 20s), β-actin (F 5TTCGCGGGCGACGATGC; R 5'CGTACATGGCTGGGG TGTTG; 30 cycles of 950C for 30 s, 6O0C for 30s and 720C for 45 s). To amplify the STR region we used the following primers and RT-PCR conditions: HD (F 5'ATGGCGACCCTGGAAAAGCTGAT; R 5 'TGAGGC AGC AGCGGCTG T; 25 cycles of 950C for 30 s, 6O0C for 20s and 72°C for 45 s), SCAl (F 5 'CAACATGGGCAGTCTGAGC; R 5 'GAACTGGAAATGTGGACGTA; 25 cycles of 950C for 20 s, 6O0C for 20s and 720C for 45 s), SCA3 (F 5 'GGAAGAGACGAGAAGCCTAC; R 5 'TCACCTAGATCACTCCCAAGT; 25 cycles of 950C for 20 s, 550C for 20s and 720C for 45 s), AR (F 5 'TGCGCGAAGTGATCCAGAAC; R 5 'CTTGGGGAGAACCATCCTCA; 30 cycles of 950C for 15 s, 570C for 15s and 720C for 20 s), MAB21L1 (F 5'GGCTGG GCTCAAAGATAAAA; R 5 'TAGAGCTGGAGCCAACTTCG; 25 cycles of 950C for 20 s, 550C for 20s and 720C for 45 s), DMPK (F 5 'AGGCTT AAGGAGGTCCGACTG; R 5 'GCGAAGTGCAGCTGCGTGATC; 25 cycles of 950C for 20 s, 6O0C for 20s and 720C for 45 s), SCA8 (F 5 'TTTGAGAAAGGCTTGTGAGGACTGAGAATG; R 5 'GGTCCTTCATGTTAGAAAACCTGGCT; 25 cycles of 950C for 20 s, 530C for 20s and 720C for 45 s).
Real-time RT-PCR was performed using the SYBR Green PCR Master Mix kit (Applied Biosystems), with 2 μl cDNA, which corresponds to 20 ng of total RNA in a total volume of 20 μl and 0.2 μM of each primer (for Dicer F 5 'TTAACCAGCTGTGGGGAGAGGGCTG; R 5 'AGCC AGCGATGC AAAGATGGTGTTG). Quantitative RT-PCR was performed in a Rotor-Gene 3000 (Corbett Research) at 950C for 30 s, 61°C for 30s and 720C for 45 s Allele-specifϊc real-time RT-PCR was performed using 0.2 μM of each allele-specific primer (HD 5'GAGCTTCTGCAAACCCTGATC,
5 'GAGCTTCTGCAAACCCTGATT; SCAl 5 'GAGGCC ACC AAGAAAGCTT, 5 'GAGGCCACCAAGAAAGCCT), and the SYBR Green PCR Master Mix kit (Applied Biosystems) with 2 μl cDNA, which corresponds to 20 ng of total RNA. siRNA and transfection conditions
Human fibroblasts were transfected with siRNA (specific for Dicer: sense strand 5 'GGCACCCAUCUCUAAUUAUUt or for Ago2: sense strand 5 'GCACGGAAGUCCAUCUGAAUt) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The cells were cultured in 24-well plates to 80% confluence. Each well was supplemented with 30 nM Dicer- or Ago2-specific siRNA as well as control siRNA (random 21 nucleotide oligomers; Invitrogen) mixed with 1 μl of Lipofectamine 2000 in 100 μl Opti-MEM. The mixture was added to the cells and incubated for 4 hours. After 24 hours a second transfection was performed in the same way. Total RNA was isolated after 48 hours from the second transfection and used in RT-PCR and real-time RT-PCRas well as Northern blotting. The RNA used for transfection, containing a 5 'monophosphate group, with a sequence of: (CAG)7 5 'AGC AGCAGC AGC AGC AGC AGC, and (CUG)7:
5 'UGCUGCUGCUGCUGCUGCUGC or 5'CUGCUGCUGCUGCUGCUGCUG as well as (CUG)6, (CUG)8 and (CUG)9 with appropriate numbers of CUG repeats were synthesized by CureVac (Germany) . Western blotting
48 hours following the second transfection, the cells were suspended in IX PBS with protease inhibitors (Protease Inhibitor Cocktail; Roche) and the protein was isolated using cycles of freezing/thawing. 20 μg of lysate proteins were separated using SDS- PAGE, and then electrotransferred onto a nitrocellulose membrane (Sigma). After blocking with 5% milk, the membrane was incubated for 1 hour with one of the primary antibodies: polyclonal antibody against human Dicer (Imgenex; diluted 1 :500), monoclonal antibody against Ago2 (Abnova; dilutedl :500), a monoclonal antibody against GAPDH (Chemicon; diluted 1:500). Following the reaction the membranes were incubated in a secondary anti-rabbit or anti-mouse antibody conjugated with biotin. The chromogenic reaction for the detection of specific was performed using the Fast BCIP/NBT kit (Sigma).
Northern hybridization
To analyze DMPK niRNA, 10 μg of total RNA was separated on a 1.2 % agarose gel with formaldehyde. The RNA was electrotransferred onto a Hybond-N+ membrane (Amersham Pharmacia Biotech). The membranes were then hybridized using a 5' end labeled probe, specific for DMPK or GAPDH transcripts in a buffer containing 200 mM Na2PO4 pH 7.0, 5% SDS and 50 μg/ml denatured herring sperm DNA at 400C overnight. To amplify the DMPK and GAPDH fragments to be used as probes, using the following primers and PCR conditions: DMPK (F 5'AGGCTT AAGGAGGTCCGACTG; R 5 'GCGAAGTGCAGCT GCGTGATC; 35 cycles of 950C for 5 s, 6O0C for 5s and 720C for 30 s), GAPDH (F 5 'GAAGGTGAAGGTCGGAGT; R 5'GAAGATGGTGATGGGATTTC; 30 cycles of 950C for 15 s, 6O0C for 15s and 720C for 20 s). The membranes were washed with 2x SSC and 0.5% SDS and exposed to X-ray film overnight. The detection of short RNA was performed using 30 μg total RNA isolated from healthy, HD, SCAl and DMl fibroblasts. Electrophoresis was performed in 10% polyacrylamide gels with 7 M urea in IX TBE. The RNA was then electrotransferred onto a Hybond-N+ membrane and hybridized with a specific probe in a buffer containing 5X SSPE, 5X Denhardt's solution, 0,2% SDS, 25% formamide and 50 μg/ml denatured herring sperm DNA at 37°C overnight. 5' end-labeled RNA and DNA probes were used to detect siCNG and miRNA respectively.

Claims

Patent Claims
1. A siRNA sequence, characterised in that it is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group.
2. A sequence according to Claim 1, characterised in that its length is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts.
3. A sequence according to Claim 1 or 2, characterised in that it contains chemical modifications in the form of: 2'-O-methyl, 2'-deoxy-2'-fluoro, oxyethane or
LNA.
4. A vector, characterised in that it releases a siRNA sequence into a cell which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group.
5. A vector according to Claim 4, characterised in that the length of the siRNA fragments it releases into a cell is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts.
6. A vector according to Claim 4 or 5, characterised in that it is a viral or plasmid vector.
7. A molecular target for siRNA reagents and vectors introduced into cells and tissues, characterised in that it is a characteristic hairpin structure formed by a region of trinucleotide repeats, one of CUG, CCG, CGG or CAG, in the transcripts of genes undergoing mutations leading to inheritable neurological diseases of the TRED group.
8. A method of evaluating the specificity of the silencing of a mutated transcript, characterised in that in addition to the level of the silenced gene the analysis encompasses the level of the healthy allele as well as the levels of a series of other transcripts containing regions of identical trinucleotide motif repeats, either CUG, CCG, CGG or CAG, by amplifying repeat sequence regions from cDNA using
PCR and allelospecific PCR in real time.
9. A method of evaluating the interactions of enzymes of the RNA interference pathway, characterised in that the interactions of Dicer and Ago2, enzymes of the RNA interference pathway, with transcripts containing repeat sequences composed of the repeats of one type of trinucleotide motif, either CUG, CCG,
CGG or CAG, using trancripts generated in vitro as well as recombinant nucleases, in cell extracts and in the cell, are examined, as well as methods of identifying and characterising the products of said interactions.
10. Use of a siRNA, composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary repeat sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs).
11. Use according to Claim 10, characterised in that the length of the sequence used is equal to or longer than the length of repeated sequence repeat fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
12. Use according to Claim 10 or 1 1, characterised in that the sequence used contains chemical modifications in the form of: 2'-O-methyl, 2'-deoxy-2'-fluoro, oxyethane or LNA.
13. Use of a vector, which releases siRNA into cells which is composed of the repeats of one type of trinucleotide motif, either CUG, CCG, CGG or CAG, occurring in the form of a single strand, a hairpin structure or an unstable duplex with periodically occurring unpaired bases, wherein the siRNA is directed against a complementary duplicated sequence occurring in the transcripts of mutated genes which cause inheritable neurological diseases of the TRED group, in the treatment of diseases caused by trinucleotide repeat expansion (TREDs).
14. Use according to Claim 13, characterised in that in that the length of the sequence released is equal to or longer than the length of repeated sequence fragments generated by the Dicer ribonuclease from mutated transcripts associated with TREDs.
15. Use according to Claim 13 or 14, characterised in that the vector is a viral or plasmid vector.
PCT/PL2008/000017 2007-02-22 2008-02-15 A sirna sequence, vector, a molecular target for sirna reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the rnai pathway with transcripts as well as the application of the sirna sequ WO2008103060A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PLP381824 2007-02-22
PL381824A PL381824A1 (en) 2007-02-22 2007-02-22 The sequence of siRNA, vector, molecular target for siRNA reagents and vectors introduced to cells and tissues, the manner of assessment of specifity of silencing of a mutated transcript, the manner of testing of influences of RNA interference route of enz

Publications (1)

Publication Number Publication Date
WO2008103060A1 true WO2008103060A1 (en) 2008-08-28

Family

ID=39472552

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/PL2008/000017 WO2008103060A1 (en) 2007-02-22 2008-02-15 A sirna sequence, vector, a molecular target for sirna reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the rnai pathway with transcripts as well as the application of the sirna sequ

Country Status (2)

Country Link
PL (1) PL381824A1 (en)
WO (1) WO2008103060A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9139828B2 (en) 2008-05-14 2015-09-22 Prosensa Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US9499818B2 (en) 2007-10-26 2016-11-22 BioMarin Technologies, B.V. Methods and means for efficient skipping of at least one of the exons 51-53, 55, 57 and 59 of the human duchenne muscular dystrophy gene
US10533171B2 (en) 2009-04-24 2020-01-14 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US10913946B2 (en) 2012-01-27 2021-02-09 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2004239114A1 (en) * 2003-05-14 2004-11-25 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
WO2005027980A1 (en) * 2003-09-12 2005-03-31 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2004239114A1 (en) * 2003-05-14 2004-11-25 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
WO2005027980A1 (en) * 2003-09-12 2005-03-31 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
BONINI N.M. ET AL.: "Silencing polyglutamine degeneration with RNAi", NEURON, vol. 48, 8 December 2005 (2005-12-08), pages 715 - 718, XP002484835 *
CAPLEN N.J. ET AL.: "Rescue of polyglutamine-mediated cytotoxicity by double-stranded RNA-mediated RNA interference", HUMAN MOLECULAR GENETICS, vol. 11, no. 2, 2002, pages 175 - 184, XP002484837 *
CAPLEN N.J.: "RNAi quashes polyQ", NATURE MEDICINE, vol. 10, no. 8, August 2004 (2004-08-01), pages 775 - 776, XP002484834 *
FURLING D. ET AL.: "Viral vector producing antisense RNA restores myotonic dystrophy myoblast functions", GENE THERAPY, vol. 10, no. 9, May 2003 (2003-05-01), pages 795 - 802, XP002484831 *
HARPER S.Q. ET AL.: "RNA interference improves motor and neuropathological abnormalities in a Huntington's disease mouse model", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 102, no. 16, 19 April 2005 (2005-04-19), pages 5820 - 5825, XP002484833 *
JASINSKA A. ET AL.: "Structures of trinucleotide repeats in human transcripts and their functional implications", NUCLEIC ACIDS RESEARCH, vol. 31, no. 19, 2003, pages 5463 - 5468, XP002484841 *
KROL J. ET AL.: "Ribonuclease Dicer cleaves triplet repeat hairpins into shorter repeats that silence specific targets", MOLECULAR CELL, vol. 25, 22 February 2007 (2007-02-22), pages 575 - 586, XP002484844 *
LI Y. ET AL.: "Sequence-dependent and independent inhibition specific for mutant Ataxin-3 by small interfering RNA", ANNALS OF NEUROLOGY, vol. 56, 2004, pages 124 - 129, XP002484836 *
MALININA L.: "Possible involvement of the RNAi pathway in trinucleotide repeat expansion diseases", JOURNAL OF BIOMOLECULAR STRUCTURE AND DYNAMICS, vol. 23, no. 3, 2005, pages 233 - 235, XP002484839 *
MILLER V.M. ET AL.: "Allele-specific silencing of dominant disease genes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 100, no. 12, 10 June 2003 (2003-06-10), pages 7195 - 7200, XP002484838 *
MITAS M.: "Trinucleotide repeats associated with human disease", NUCLEIC ACIDS RESEARCH, vol. 25, no. 12, 1997, pages 2245 - 2253, XP002484842 *
SASAGAWA N. ET AL.: "An expanded CTG trinucleotide repeat causes trans RNA interference: a new hypothesis for the pathogenesis of Myotonic Dystrophy", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 264, 1999, pages 76 - 80, XP002484840 *
SOBCZAK K. ET AL.: "RNA structure of trinucleotide repeats associated with human neurological diseases", NUCLEIC ACIDS RESEARCH, vol. 31, no. 19, 2003, pages 5469 - 5482, XP002484843 *
XIA H. ET AL.: "RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia", NATURE MEDICINE, vol. 10, no. 8, August 2004 (2004-08-01), pages 816 - 820, XP002484832 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9499818B2 (en) 2007-10-26 2016-11-22 BioMarin Technologies, B.V. Methods and means for efficient skipping of at least one of the exons 51-53, 55, 57 and 59 of the human duchenne muscular dystrophy gene
US9926557B2 (en) 2007-10-26 2018-03-27 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in Duchenne muscular dystrophy pre-mRNA
US10876114B2 (en) 2007-10-26 2020-12-29 Biomarin Technologies B.V. Methods and means for efficient skipping of at least one of the following exons of the human Duchenne muscular dystrophy gene: 43, 46, 50-53
US11427820B2 (en) 2007-10-26 2022-08-30 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in Duchenne muscular dystrophy pre-mRNA
US9139828B2 (en) 2008-05-14 2015-09-22 Prosensa Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US10246707B2 (en) 2008-05-14 2019-04-02 Biomarin Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US10533171B2 (en) 2009-04-24 2020-01-14 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US11034956B2 (en) 2009-04-24 2021-06-15 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US11634714B2 (en) 2009-04-24 2023-04-25 Biomarin Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
US10913946B2 (en) 2012-01-27 2021-02-09 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy

Also Published As

Publication number Publication date
PL381824A1 (en) 2008-09-01

Similar Documents

Publication Publication Date Title
AU2020260479B2 (en) Methods and Compositions for the Specific Inhibition of Alpha-1 Antitrypsin by Double-Stranded RNA
ES2373246T3 (en) COMPLEMENTARY MONOCATENARY OLIGONUCLEOTIDES OF REPETITIVE ELEMENTS FOR THE TREATMENT OF GENETIC DISORDERS ASSOCIATED WITH THE INSTABILITY OF DNA REPETITIONS.
US5624803A (en) In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
KR101854926B1 (en) Treatment of sex hormone binding globulin (shbg) related diseases by inhibition of natural antisense transcript to shbg
JP6025567B2 (en) Treatment of MBTPS1-related diseases by inhibition of the natural antisense transcript against the membrane-bound transcription factor peptidase, site 1 (MBTPS1)
CA2746001C (en) Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirtuin 1
CA2752237C (en) Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
RU2611192C2 (en) TREATMENT OF RNase H1 RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO RNase H1
RU2610661C2 (en) Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21
TWI645036B (en) Treatment of sialidase 4 (neu4) related diseases by inhibition of natural antisense transcript to neu4
WO2005078095A1 (en) SNP DISCRIMINATORY siRNA
AU2009322290A1 (en) Una oligomer structures for therapeutic agents
TW201731516A (en) Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
TW201143781A (en) Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
TW201143782A (en) Treatment of LIM homeobox 2 (LHX2) related diseases by inhibition of natural antisense transcript to LHX2
WO2008103060A1 (en) A sirna sequence, vector, a molecular target for sirna reagents and vectors introduced into cells and tissues, a method of evaluating the specificity of the silencing of the mutated transcript, a method of examining the interactions of enzymes on the rnai pathway with transcripts as well as the application of the sirna sequ
B Santos-Reboucas et al. MicroRNAs: macro challenges on understanding human biological functions and neurological diseases
Tang et al. Upregulation of PHLDA2 in Dicer knockdown HEK293 cells
WO2015030616A2 (en) Nucleic acid molecule, expression cassette, expression vector, eukaryotic host cell, induction method of rna interference in eukaryotic host and use of nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide cag repeats
JP2021534759A (en) MICRORNA-134 biomarker
WO2011010737A1 (en) Guide nucleic acid for cleavage of micro-rna
CN115551519A (en) Complement component C1S inhibitors for treating neurological diseases and related compositions, systems and methods of using the same
CN115605592A (en) Complement component C1R inhibitors for treating neurological diseases and related compositions, systems and methods of using the same
CN116694638A (en) Circular nucleic acid application-miRNA inhibitors
WO2007113784A2 (en) Methods for modulating the levels and effects of thyrotropin-releasing hormone (trh) and trh-related petides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08712683

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08712683

Country of ref document: EP

Kind code of ref document: A1