WO2008097366A2 - Metabolically engineered escherichia coli for enchanced production of sialic acid - Google Patents
Metabolically engineered escherichia coli for enchanced production of sialic acid Download PDFInfo
- Publication number
- WO2008097366A2 WO2008097366A2 PCT/US2007/079496 US2007079496W WO2008097366A2 WO 2008097366 A2 WO2008097366 A2 WO 2008097366A2 US 2007079496 W US2007079496 W US 2007079496W WO 2008097366 A2 WO2008097366 A2 WO 2008097366A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sialic acid
- microbe
- enzyme
- molecule
- dna molecule
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
Definitions
- the present invention relates to metabolically engineered Escherichia coli
- E. coli (“E. coli”), and, more specifically, to metabolically engineered E. coli for enhanced production of sialic acid.
- Sialic acid is a biologically complex carbohydrate that plays important roles in cell signaling, bacterial pathogenesis and tumour metastasis.
- the physiochemical properties of sialic acid have made it a valuable resource with an increasing demand in both medicine and biotechnology.
- sialic acid is a general term used to describe a large family of acidic sugars that are predominantly found on the cell surface of eukaryotic cells.
- the most common sialic acid is N-acetylneuraminic acid or ⁇ eu5Ac, an acidic nine-carbon sugar that undergoes several modifications to generate the members of the sialic acid family.
- the diversity of the sialic acid family is represented with over 50 known members.
- Sialic acid represents a large family of cell-surface carbohydrates that are derived from an acidic, nine-carbon parent compound called N-acetylneuraminic acid or ⁇ eu5Ac.
- Neu5Ac is often decorated with acetyl, phosphate, methyl, sulfate and lactyl groups, which are required for desirable cell signaling and cell adhesion events mediated by sialic acid.
- Sialic acid performs a diverse array of functions including important biological processes such as glycoprotein stability, cellular immunity, solute transport, self- recognition, neuronal plasticity and cell signaling. Sialic acid also has a significant role in human disease. For example, cancerous cells have been shown to have elevated sialic acid levels or sialylation on their surfaces. Excess sialylation has been shown to promote invasiveness and reduce intercellular interactions, which are features of tumour metastasis. Sialic acid is currently being researched as a tool for the non-invasive imaging of cancer tissue in vivo. Increased levels of sialic acid have been observed for cardiovascular disease, alcoholism and diabetes, thus making sialic acid a marker for diagnosing and detecting such deadly diseases.
- analogs of sialic acid have found important roles in the pharmaceutical industry as influenza neuraminidase inhibitors, e.g., Relenza ® , stabilizers of therapeutics and diagnostic agents.
- sialic acid has been isolated from egg yolk, milk whey and edible bird nest, which requires a lengthy, cumbersome purification process. The overall yields are typically low (-10-20%) and the purity is marginal.
- Synthetic routes in sialic acid chemistry are challenging, because of the target molecule's complexity.
- enzymatic synthesis is currently the preferred method for sialic acid production.
- the cloning and subsequent isolation of enzymes involved in the biosynthesis and degradation of sialic acid has enabled researchers to produce sialic acid in vitro by a straightforward enzymatic reaction.
- Enzymatic synthesis of sialic acid has a high yield (80%) and generates a pure product through a direct crystallization of the enzymatic mixture.
- the major drawbacks of enzymatic synthesis in sialic acid production are its cost and scalability at the industrial level.
- a metabolically engineered E. coli cell which produces sialic acid and a method of making said cell are provided.
- a metabolically engineered E. coli cell wherein nanT (sialic acid transporter) and nanA (sialic acid adolase) genes have been inactivated, neuC and neuB genes of sialic acid bioysnthesis in Neisseria meningitidis group B have been introduced and overexpressed into the nanT nanA ' E. coli cell, and the glucosamine synthase gene, glmS, of E. coli has been co-overexpressed with neuB and neuC.
- a method of making sialic acid through the use of said metabolically engineered E. coli cell is provided.
- the present invention provides a genetically engineered microbe, comprising: an inactivating mutation in a first DNA molecule in the microbe, wherein the first DNA molecule encodes a sialic acid transporter; an inactivating mutation in a second DNA molecule in the microbe, wherein the second DNA molecule encodes a sialic acid aldolase; and a first enzyme-encoding recombinant DNA molecule, wherein the first enzyme-encoding recombinant DNA molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N-acetylglucosamine 2-epimerase.
- the microbe further comprises a second enzyme-encoding recombinant D ⁇ A molecule, wherein the second enzyme- encoding recombinant D ⁇ A molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N-acetylglucosamine 2-epimerase.
- the microbe further comprises a recombinant D ⁇ A molecule or a mutation in a D ⁇ A molecule in the glm or nag pathway that provides increased UDP-Glc ⁇ Ac levels compared with a wild-type strain.
- the microbe further comprises a recombinant D ⁇ A molecule encoding a glucosamine synthase.
- the recombinant D ⁇ A molecule encoding a glucosamine synthase is a glmS gene.
- the microbe is E. coli.
- the inactivating mutations in the microbe are in the nanT and nanA genes.
- the first and second enzyme-encoding recombinant DNA molecules are the neuC and neuB genes.
- the neuC and neuB genes originate from Neisseria meningitidis.
- the microbes of the present invention are capable of transporting sialic acid out of the cell.
- the present invention also provides a method of forming a genetically engineered microbe for producing sialic acid, comprising the steps of: introducing an inactivating mutation into a first DNA molecule encoding a sialic acid transporter in the microbe; introducing an inactivating mutation into a second DNA molecule encoding a sialic acid aldolase in the microbe; and introducing a first enzyme-encoding recombinant DNA molecule in the microbe, wherein said first enzyme-encoding recombinant DNA molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N- acetylglucosamine 2-epimerase.
- the method of forming a genetically engineered microbe for producing sialic acid further comprises the step of introducing a second enzyme-encoding recombinant D ⁇ A molecule, wherein the second enzyme-encoding recombinant D ⁇ A molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N-acetylglucosamine 2-epimerase.
- methods of the present invention further comprise the step of introducing a recombinant D ⁇ A molecule or a mutation in a D ⁇ A molecule in the glm or nag pathway that provides increased UDP-Glc ⁇ Ac levels compared with a wild-type strain.
- Some methods of the present invention further comprise the step of introducing a recombinant D ⁇ A molecule encoding a glucosamine synthase into the microbe.
- the present invention further provides a method of producing sialic acid, comprising the steps of: providing a genetically engineered microbe, wherein the microbe comprises an inactivating mutation in a first D ⁇ A molecule in the microbe that encodes a sialic acid transporter; an inactivating mutation in a second D ⁇ A molecule in the microbe the encodes a sialic acid aldolase; and a first enzyme-encoding recombinant D ⁇ A molecule in the microbe, wherein the first enzyme-encoding recombinant D ⁇ A molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N-acetylglucosamine 2-epimerase; and culturing the microbe in the presence of a carbon source.
- the carbon source can be, but is not limited to, glucose, glycerol, fructose, or N-acetylglucosamine.
- the present invention further provides a genetically engineered microbe, comprising: an inactivating mutation in a D ⁇ A molecule in the microbe, wherein the D ⁇ A molecule encodes a sialic acid aldolase; a first enzyme-encoding recombinant D ⁇ A molecule, wherein the first enzyme-encoding recombinant D ⁇ A molecule encodes a sialic acid synthase; and a second enzyme-encoding recombinant D ⁇ A molecule, wherein the second enzyme- encoding recombinant D ⁇ A molecule encodes a UDP-N-acetylglucosamine 2-epimerase.
- the present invention also provides a method of producing an N-acyl sialic acid analog, comprising the steps of: providing a genetically engineered microbe, wherein the microbe comprises an inactivating mutation in a first D ⁇ A molecule in the microbe that encodes a sialic acid transporter; an inactivating mutation in a second D ⁇ A molecule in the microbe that encodes a sialic acid aldolase; and a first enzyme-encoding recombinant D ⁇ A molecule in the microbe, wherein the first enzyme-encoding recombinant D ⁇ A molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N-acetylglucosamine 2- epimerase; and culturing the microbe in the presence of a reagent such that intracellular UDP-N- acylglucosamine is generated.
- the reagent can be, but is not limited to, an N-acyl
- Fig. 1 is a high level schematic illustrating the diversity of the sialic acid family.
- FIG. 2 is high level schematic illustrating the production of sialic acid by a metabolically engineered E. coli cell in accordance with an embodiment of the present invention.
- FIG. 3 is a graphical illustration of the effect of a carbon source on sialic acid production in a metabolically engineered E. coli cell, in accordance with an embodiment of the present invention.
- Fig. 4 is a graphical illustration of the optimization of sialic acid production by multiple glucose feedings in accordance with an embodiment of the present invention.
- Fig. 5 is a schematic illustrating pathways involved in the production of sialic acid in accordance with an embodiment of the present invention.
- NanT is not limited to its function in sialic acid catabolism, as it has also been demonstrated to be involved in the synthesis of polysialic acid capsules by mediating uptake of sialic acid and incorporation of the sialic acid into the polysialic acid capsule.
- Escherichia coli Crosses indicate blocks in pathways due to gene inactivation.
- Bold arrows indicate elevated fluxes of metabolism by gene overexpression.
- Sialic acid catabolism was blocked by the inactivation of the nanT (sialic acid transporter) and nanA (sialic acid aldolase) genes (crosses).
- the neuC and neuB genes of sialic acid biosynthesis in Neisseria meningitidis group B were introduced and overexpressed into the nanT nanA ' E. coli strain (bold arrows).
- Increase in the metabolic flux of UPD-GIcNAc, the substrate of the neuBC pathway was achieved by engineering glmS overexpression into the pathway (bold arrows).
- the dotted line represents sialic acid efflux by an undefined mechanism.
- the abbreviations are as follows, Neu5Ac: N-acetylneuraminic acid , Man ⁇ Ac: N-acetylmannosamine, Man ⁇ Ac-6-P: N- acetylmannosamine-6-phosphate, Glc ⁇ Ac-6-P: N-acetylglucosamine-6-phosphate, UDP- Glc ⁇ Ac: uridine diphosphate N-acetylglucosamine, Glc ⁇ -6-P: glucosamine-6-phosphate, Fru-6- P: fructose-6-phosphate, PEP: phosphenolpyruvate, GIn: glutamine, GIu: glutamate, UDP: uridine diphosphate, nanT: sialic acid transporter, nanA: sialic acid aldolase, nanK: Man ⁇ Ac kinase, nanE: Man ⁇ A
- GIcNAc and pyruvate are key molecules in primary metabolism.
- bacterial sialic acid biosynthesis is limited to a subset of pathogenic bacteria, including E. coli Kl and N. meningitidis group B that synthesize a polysialic acid capsule.
- the two proteins that participate in the biosynthesis of sialic acid are ⁇ euC and ⁇ euB.
- ⁇ euC is a hydrolyzing UDP-Glc ⁇ Ac 2-epimerase that generates Man ⁇ Ac.
- ⁇ euB is a synthase that combines Man ⁇ Ac and phosphoenolpyruvate to form sialic acid.
- ⁇ anA has been shown to synthesize sialic acid in the presence of excess pyruvate in vitro, it was hypothesized that the nanAEK pathway could be reversed by supplying excess Glc ⁇ Ac to cultures of metabolically engineered E. coli cells. Glc ⁇ Ac is readily taken up by E. coli cells, and it was expected that intracellular Glc ⁇ Ac would be converted to Man ⁇ Ac through the assistance of the ⁇ anEK proteins.
- N. meningitidis group B which will be discussed infra.
- a benefit of this pathway is the substrate specificity of ⁇ euC, which converts a common bacterial metabolite, UDP-Glc ⁇ Ac, into Man ⁇ Ac, as seen in Figure 2.
- ⁇ euC a hydrolyzing UDP-Glc ⁇ Ac 2-epimerase, is also more efficient than certain other epimerases due to its ability to couple energy from a hydrolysis reaction to drive epimerization. Due to its energetic efficiency through its ability to use energy liberated from a first reaction to drive a subsequent reaction, UDP-Glc ⁇ Ac 2-epimerase is preferred for sialic acid production in accordance with the present invention.
- UDP-Glc ⁇ Ac As the direct substrate of the neuBC pathway, intracellular UDP-Glc ⁇ Ac pools control the metabolic flux into the sialic acid synthetic pathway, controlling sialic acid titer.
- Figure 5 shows pathways involved in the maintenance of the UPD-Glc ⁇ Ac pools. Increasing UDP-Glc ⁇ Ac pools increases sialic acid productivity and culture titer.
- UDP-Glc ⁇ Ac is a key component of bacterial cell wall biosynthesis and is linked to central metabolism by the glm pathway, which converts fructose-6-phosphate (Fru-6P) into UDP-Glc ⁇ Ac, and the nag pathway, which returns hydrolyzed UDP-Glc ⁇ Ac to Fru-6P.
- the present invention provides methods for enhancing flux through the glm pathway and/or decreasing flux through the nag pathway to increase UDP-GIcNAc pools, thereby improving sialic acid productivity. Controlling the degree and direction of the cross talk between the key metabolic linchpin Fru-6P and UDP-GIcNAc will enable sialic acid productivity to be optimized.
- the control of the glm and/or the nag pathways and the increase in UDP-GIcNAc levels compared to wild-type strains, as provided by the present invention, are essential to the efficient commercial production of sialic acid.
- E. coli has been successfully engineered to produce sialic acid, a complex, biologically important molecule that has significant applications in both medicine and biotechnology.
- the costs of sialic acid production from metabolically engineered E. coli is substantially lower than that of chemical synthesis, and unlike enzymatic synthesis, metabolically engineered E. coli are more readily scalable for industrial production.
- sialic acid production reached a maximum of 1.5 g I "1 .
- Incorporation of this metabolically engineered strain into high-cell density fermentation in accordance with the present invention will likely increase sialic acid production to several grams per liter.
- a ten- fold increase in sialic acid production is possible from a high-density cell culture, e.g., greater than 15 g I "1 .
- the method of the present invention serves as a cost-effective resource for sialic acid, supplying enough sialic acid to meet the continually increasing demands of the medical, bio technological and scientific communities.
- sialic acid production may further be enhanced by modifying the preexisting engineered neuBCglmS pathway. For example, engineering a GImS protein that has a higher turnover rate in glucosamine synthesis and is more cytosolic soluble may be performed.
- Another key aspect of the present invention is the unexpected efflux of sialic acid from the cytosol to the media.
- Standard teachings in the art regarding transport of sugars across biological membranes suggest that acidic sugars cannot cross membranes. Their high level of hydrophilicity coupled with their negative charge renders them membrane impermeable. This is well documented for phosphorylated and sulfated sugars.
- Nonulosonic acids, such as sialic acid and its analogs are acid sugars and as such the teachings in the art has indicated that these compounds will not be able to cross membranes.
- sialic acid is produced intracellularly, as occurs in the present invention, it will not be able to leave the cell and enter the media.
- the present invention provides microbes and methods for producing sialic acid where high levels of sialic acid can be produced in the cytosol and where the sialic acid does cross the membrane and enters the media.
- This membrane transport dramatically increase the productivity of the system since the producing cells do not have to die and lyse to release the sialic acid, but can rather release sialic acid and continue to produce more product.
- the microbes used to produce sialic acid are capable of transporting sialic acid out of the cell.
- sialic acid production in metabolically engineered E. coli in accordance with an embodiment of the present invention is in the biosynthesis and production of sialic acid analogs (unnatural sialic acids) in significant quantities.
- sialic acid analogs are used as probes in cellular interactions, agents in visualizing cellular surfaces in vivo and as components in pharmaceuticals.
- sialic acid analogs are synthesized and engineered into cellular surfaces from expensive, derivatized mannosamine sugars.
- sialic acid analog production from metabolically engineered E. coli in accordance with the present invention utilizes glucosamine derivatives, which are less expensive than their mannosamine equivalents.
- sialic acid production from metabolically engineered E. coli in accordance with the present invention is a cost-effective and direct route for synthesizing sialic acid and its analogs, such as N-acyl sialic acid analogs.
- N-acyl sialic acid analogs include, but are not limited to, N-azidoacetyl- , N-levulinoyl-, and N-butanoyl sialic acid.
- N-acyl sialic acid analog comprises the steps of: providing a genetically engineered microbe, wherein the microbe comprises an inactivating mutation in a first D ⁇ A molecule in the microbe that encodes a sialic acid transporter; an inactivating mutation in a second D ⁇ A molecule in the microbe the encodes sialic acid aldolase; and a first enzyme-encoding recombinant D ⁇ A molecule in the microbe, wherein the first enzyme-encoding recombinant D ⁇ A molecule encodes an enzyme selected from the group consisting of a sialic acid synthase and a UDP-N- acetylglucosamine 2-epimerase; and culturing the microbe in the presence of a reagent such that intracellular UDP-N-acylglucosamine is generated.
- any suitable reagents may be used, such as any N- acylglucos amine carbon source.
- the reagent is an N-acylglucosamine analog.
- An acyltransferase may also be used to facilitate the formation of a reagent or the generation of intracellular UDP-N-acylglucosamine.
- This example relates to the deletion of a key E. coli gene, nanT, to generate a nanT ⁇ E. coli mutant because nanT is a sialic acid transporter and is responsible for sialic acid uptake.
- a nanrknockout E. coli K-12 strain MG1655 named FB21071 was requested from the Blattner laboratory at the University of Wisconsin, Madison, WI. This strain has a Tn5 insertion into the nanT gene that confers kanamycin resistance.
- a T7 R ⁇ A polymerase gene under a /aopromoter was inserted into the chromosome of FB21071 using the ⁇ DE3 lysogenization kit ( ⁇ ovagen, San Diego, California) to generate the strain BRLOl.
- This example relates to the engineered neuBC pathway, as discussed supra, whose expression was controlled by a Tl lac promoter.
- This experiment describes the introduction of the engineered neuBC pathway into the nanT ⁇ E. coli strain BRLOl that possesses a /aocontrolled T7 R ⁇ A polymerase gene.
- the neuC and neuB genes of Neisseria meningitidis group B which were introduced into the nanT ⁇ E. coli strain BRLOl, as discussed herein, are sialic acid biosynthetic genes.
- ⁇ euC is a hydrolyzing epimerase that converts UPD-N-acetylglucosamine (UDP- Glc ⁇ Ac), a common metabolite in bacteria, to Man ⁇ Ac.
- UPD-N-acetylglucosamine UPD-N-acetylglucosamine
- Man ⁇ Ac The siaA gene involved in capsule polysaccharide biosynthesis of Neisseria meningitidis B codes for N-acylglucosamine-6- phosphate 2-epimerase activity.
- ManNAc is subsequently condensed with phospenolpyruvate to generate sialic acid through NeuB catalysis, as seen in Figure 2.
- Genomic DNA from Neisseria meningitidis ATCC ® BAA-335D was used for Polymerase Chain Reaction (PCR).
- Pfu Turbo ® DNA polymerase (Stratagene, La Jolla, California) and the thermocylcer Mastercycler ® personal (Eppendorf, Hamburg, Germany) were used for all PCR reactions.
- the neuB and neuC genes were amplified from N. meningitidis MC58 group B genomic D ⁇ A by PCR.
- Primer sequences with engineered restriction sites (listed below in bold) used for cloning of neuC and neuB genes, were used at 0.1 ⁇ M for PCR reactions. Cut sites listed were those used to clone the respected gene into vector pKH22.
- neuB and neuC primers used for PCR with restriction sites are as follows: neuB (cut site - ⁇ del/EcoRI) cgcacatatgcaaaacaacaacgaatttaaaattgg (forward, SEQ ID NO: 1) cagcgaattcttattcaatatcagtttttttgatttgagca (reverse, SEQ ID NO: 2) neuC (cut site - Nhel/EcoRI ) cgcagctagcaaaaggattctttgcattacaggtacc (forward, SEQ ID No: 3) cagcgaattcctagtcataactggtggtacatt (reverse, SEQ ID NO: 4)
- thermocycler conditions were as follows: one cycle of 95 0 C for 5 min, 15 cycles of 30 s at 95 0 C, 30 s at 72-57 0 C (-1 0 C per cycle), and 90 s at 72 0 C, 15 cycles of 30 s at 95 0 C, 30 s at 57 0 C, and 90 s at 72 0 C, and one cycle of 10 min at 72 0 C.
- the plasmid pBRL22 was inserted into the nanT ⁇ E. coli strain BRLOl to form BRL01/pBRL22, where the neuC and neuB genes were overexpressed, using well known and accepted methods in the art.
- the nanA gene in BRLOl was deleted using the lambda Red system to generate the strain BRL02, as discussed in the following Example.
- an inactivating mutation in the gene encoding a sialic acid aldolase (such as an inactivating mutation or deletion of the nanA gene) of another microbe (such as another E. coli strain) can be used to produce sialic acid, wherein the microbe has a functional sialic acid transporter, as discussed in Examples 5 and 6.
- This example describes the deletion of the nanA gene of BRLOl using a gene replacement strategy to generate the strain BRL02, and the subsequent introduction of plasmid pBRL22 of Example 2 into BRL02 to form BRL02/pBRL22.
- NanT is a sialic acid transporter and is responsible for sialic acid uptake, as noted supra, and NanA is an adolase that cleaves sialic acid into pyruvate and N-acetylmannosamine (Man ⁇ Ac).
- Man ⁇ Ac N-acetylmannosamine
- the lambda Red system was used to knockout the nanA gene of BRLOl to generate the nanT ⁇ nanA ⁇ E. coli mutant, BRL02.
- a cassette encoding tetracycline resistance was amplified from the vector pBR322 (New England Bio Labs, Ipswich, Massachusetts) using the primers 5'- atggcaacgaatttacgtggcgtaatggctgcactcctgactccttttgatcatgtttgacagcttatcatcgat-3' (SEQ ID No: 5) and S'-tcacccgcgctcttgcatcaactgctgggccagcgccttcagttctggcatccaattcttggagtggtgaatccg-S' (SEQ ID No: 6).
- Primers consisted of 50 nt homology with nanA (underlined) and 25 nt with the tetracycline resistance gene (not underlined).
- the thermocycler conditions used are identical to those stated above in Example 2.
- the tetracycline-resistance cassette was gel purified from the PCR reaction and then concentrated by ethanol precipitation.
- the plasmid pBRL22 of Example 2 was inserted into the nanT ' " nanA ' E. coli strain BRL02 to form BRL02/pBRL22, where the neuC and neuB genes were overexpressed, using well known and accepted methods in the art.
- This example describes single feeding shake flask experiments involving the BRL02/pBRL22 strain.
- the BRL02/pBRL22 strain was used to screen carbon source feedstocks including glycerol, maltose, glucose, fructose and GIcNAc, for sialic acid production.
- a single initial carbon source at 0.5% was fed to the culture. Cultures were grown for 48 h post induction, and the sialic acid titers were determined.
- Fl minimal media consisting of per liter, 6.62 g K 2 HPO 4 , 3.0 g KH 2 PO 4 ,
- IPTG isopropyl- ⁇ -D-thiogalactopyranoside
- the induced cultures were grown for 48, and samples of 1 ml were taken at spaced intervals. Cells were removed from the samples by centrifugation, and the supernatants were boiled for 10 minutes.
- Bruker 300MHz instrument Sialic acid was purified from a cultural broth by removing the cells via centrifugation and then isolating the sialic acid in the supernatant by ion-exchange chromatography as described.
- the boiled supernatants as explained, were quantified for sialic acid activity by the NanA/LDH assay. Briefly, sialic acid concentrations were determined using the sialic acid aldolase-lactate dehydrogenase (NanA/LDH) assay as described. LDH was purchased from Roche (Penzberg, Germany), and NanA was isolated from recombinant E. coli.
- NanA increased the titer 5-fold, as compared with the results noted in Example 2.
- GIcNAc as feedstock produced the highest sialic acid titer; intracellular GIcNAc is converted to UDP-GIcNAc, an important cell wall precursor that is, consequently, the substrate of the neuBC pathway.
- GIcNAc biosynthesis in E. coli begins with the conversion of fructose into glucosamine by the action of the glucosamine synthase GImS, which is the key enzyme in GIcNAc metabolism.
- GImS glucosamine synthase
- This example describes the construction of the reagents required for producing sialic acid in E. coli expressing a functional NanT and lacking a functional NanA.
- the gene encoding the sialic acid transporter, NanT was amplified from the genomic DNA of XLlBlue E. coli by Polymerase Chain Reaction (PCR).
- Primers used for PCR were 5'- GACGC ⁇ GGGCATCGCCCACCG-3' (SEQ ID NO: 7) and 5'-
- the introduced Nde I site is indicated in italics.
- the amplified nanT PCR product was gel-purified and cloned into pCR- Blunt (Invitrogen) according to the manufacturer's instructions to generate plasmid pBRL50.
- the internal EcoR I site in nanT was removed using QuikChange to generate plasmid pBRL54.
- the n ⁇ nT gene was subsequently cloned into the Nde I and EcoR I sites of pKH22 using standard molecular cloning procedures to generate plasmid pBRL55.
- the plasmid pBRL55 was digested with Avr II and Xb ⁇ I, and the Avr II-Xb ⁇ I n ⁇ nT fragment was cloned in the forward direction into the Avr II site of pBRL47. This generated plasmid pBRL57, which encodes a polycistronic transcript (5 '-3' direction) neuB-neuC-glmS-n ⁇ nT.
- This example describes the production of sialic acid in E. coli expressing a functional NanT and lacking a functional NanA.
- BRL02/pBRL47 or BRL02/pBRL57 cells were grown in 50 mL of Fl minimal media supplemented with 50 ⁇ g mL "1 carbenicillin, 50 ⁇ g mL "1 kanamycin, 10 ⁇ g mL "1 tetracycline and 0.5% (w/v) glucose in 250-mL shake flask at 30 °C/150 r.p.m. When the optical densities (OD 6 oo) were 0.7- 0.9 AU, cultures were induced with 0.1 mM IPTG and allowed to grow for 72 h.
- BRL02/pBRL57 cells generated an average sialic acid titer of 315 mg L "1 of sialic acid whereas BRL02/pBRL47 cells yielded an average titer of 568 mg L "1 .
- sialic acid per cell wet weight was greater for BRL02/pBRL57 cells, 515 mg (mg cell wet weight) "1 , than that of BRL02/pBRL47, 64 mg (mg cell wet weight) "1 .
- This example describes the engineering of the glucosamine synthase gene, glmS, of E. coli into the neuBC pathway.
- this experiment relates to the co- overexpression of the glucosamine synthase gene, glmS, of E. coli (amplified by PCR and cloned into pBRL22 to generate plasmid pBRL47) to increase the sialic acid yield from low-cost sugar feedstocks, including glucose and fructose.
- GImS is the key enzyme in the biosynthesis of UDP- GIcNAc, the substrate of the neuBC pathway, and glmS overexpression was expected to direct more of the available feedstock sugar into UDP-GIcNAc biosynthesis.
- This example incorporates the methods and materials of Example 2 with respect to the amplification and cloning of the neuB and neuC genes to generate the plasmid pBRL47 (pKH22-neuBneuCglmS), along with the following: denomic DNA from XLl Blue Escherichia coli (Stratagene, La Jolla, California) was used for PCR. Pfu Turbo ® DNA polymerase (Stratagene, La Jolla, California) and the thermocylcer Mastercycler ® personal (Eppendorf, Hamburg, Germany) were used for all PCR reactions. The glmS gene was amplified from E. coli genomic DNA by PCR.
- glmS primers used for PCR with restriction sites are as follows: glmS (cut site - Ndel/EcoRI) gcgccatatgtgtggaattgttggcgcg (forward, SEQ ID NO: 9) gcgcgaattcttactcaaccgtaaccgattttgc (reverse, SEQ ID NO: 10)
- thermocycler conditions were as follows: one cycle of 95 0 C for 5 min, 15 cycles of 30 s at 95 0 C, 30 s at 72-57 0 C (-1 0 C per cycle), and 90 s at 72 0 C, 15 cycles of 30 s at 95 0 C, 30 s at 57 0 C, and 90 s at 72 0 C, and one cycle of 10 min at 72 0 C. Cloned genes were sequenced.
- Plasmids have ampicillin resistance markers.
- the plasmid pBRL47 was inserted into the na ⁇ T nanPC E. coli strain
- BRL02 to form BRL02/ pBRL47, where the glmS gene was co-overexpressed with the neuC and neuB genes, using well known and accepted methods in the art.
- Example 8
- BRL02/pBRL47 generated a sialic acid titer of 130 mg I "1 .
- g ImS added to the engineered pathway
- a 3-fold increase in sialic acid production, 40 to 130 mg I "1 was observed for fructose feeding.
- BRU02/neuBCglmS cells were fed 0.5% glucose and ammonium hydroxide (indicated by markers) at 0, 12, 24, 36 and 48 h past induction. Sialic acid production continued to climb during the course of the experiment whereas the growth ceased at 48 h past induction. This figure suggested that the engineered E. coli cells were able to continually produce sialic acid if growth requirements are met.
- This example describes only multiple feeding shake flask experiments involving the BRL02/pBRL47 strain with glucose as the carbon feeding source. It was expected that a comparable sialic acid titer by single glucose feedings, to that listed in Example 6, would be produced. The same methods and materials were followed and used here as in Example 6, including the shake flask experiments, confirmation of production of sialic acid, and measuring of sialic acid concentration, except as noted in the following paragraph.
- Sialic acid production was optimized for BRL02/pBRL47 through multiple feedings of glucose as the carbon source feedstock. Doses of 0.5% of glucose and ammonium hydroxide were added at 0, 12, 24, 36 and 48 h post induction, and the induced BRL02/pBRL47 cells were grown for 98 h (as opposed to 48 h as discussed in Example 4) and the sialic acid titers were determined. The ammonium hydroxide served to maintain the pH 6.9-7.1 and as a nitrogen source.
- N-butanoyl sialic acid an analog of sialic acid.
- N-butanoyl sialic acid an N-butanoylglucos amine was first synthesized. Glucosamine hydrochloride (5.0 g, 23 mmol, 1.0 equiv) and triethylamine (16 mL, 115 mmol, 4.8 equiv) were suspended in DMF (48 mL) at room temperature. The reaction mixture was stirred for 30 minutes at which butyric anhydride (4.5 mL, 27 mmoL, 1.2 equiv) was added dropwise. The reaction was stirred for 18 h at room temperature.
- N-butanoly sialic acid production from BRL02/ pBRL47 was carried out as described in previous shake flask experiments and was optimized by multiple feedings of 0.3% glycerol and either 0.3% N-butanyolglucosamine or N- acetylglucos amine (negative control). Doses of feedstock and ammonium hydroxide were added at 0, 12, 24, 36, and 48 hour post induction, and the induced BRL02/pBRL47 cells were grown for 98 hours. The ammonium hydroxide served to maintain the pH 6.9 - 7.1 and as a nitrogen source. Combined sialic acid and N-butanoyl sialic acid titers were determined by the ⁇ anA/LDH assay. Average combined titer from N-butanoylglucos amine feedings was 67 ⁇ 26 mg/L. Average combined titer from N- acetylglucosamine feedings was 822 ⁇ 23 mg/L. Example 11
- This example describes the construction of an E. coli strain that does not possess functional NanT, NanA and NagA enzymes.
- the nagA gene in BRL02 was deleted using the Red recombinase system.
- a chloramphenicol-cassette was amplified from the plasmid pKD3 via Polymerase Chain Reaction (PCR) using primers 5'-
- CTGGAGCTGCTTC-y (SEQ ID No: 11) and 5'-
- TTATTGAGTTACGACCTCGTTACCGTTAACGATGGTCTTGGTGATTTT AACATATGAA TATCCTCCTTAG (SEQ ID NO: 12).
- Primers consisted of priming sites to pKD3 (italics) and 50 bp homology to nagA.
- the PCR-amplified cassette was gel-purified, concentrated by ethanol precipitation and suspended in 10 mM Tris buffer, pH 8.0, to a concentration of 40 ng ⁇ L "1 .
- Approximately 80 ng of the chloramphenicol-cassette was electroporated into BRL02/pKD46 cells, which were prepared according to literature procedure.
- Chloramphenciol-resistant clones were selected and screened by PCR for replacement at the nagA locus; this generated the strain BRL03. Removal of the chloramphenicol marker in BRL03 was performed by transformation with the plasmid pCP20, which encodes a FLP recombinase. Transformants were selected for ampicillin resistance and not for chloramphenicol resistance. BRL03/pCP20 cells were colony- purified at 43° C for 18 h. Clones were tested for chloarmphenicol sensitivity and screened by PCR for removal of the chlroamphenicol marker. The removal of the chloramphenicol marker generated the nagA ' strain BRL04.
- This example describes production of sialic acid from an E. coli strain that does not possess functional NanT, NanA and NagA enzymes. This work demonstrates that down regulating of the nag pathway can be used to optimize sialic titer and per cell per unit time sialic acid productivity.
- BRL04 cells were transformed with pBRL47, which encodes the neuB- neuC-glmS polycistronic transcript. Sialic acid production experiments were conducted in triplicate.
- BRL4/pBRL47 cells were grown in 2 mL of F2 minimal media supplemented with 100 ⁇ g mL "1 ampicillin, 50 ⁇ g mL "1 kanamycin, 10 ⁇ g mL "1 tetracycline, and 0.5% (w/v) glucose in a 16 x 125 mm sterile test-tube.
- F2 minimal media is identical to Fl minimal media except the former has twice the concentration of phosphate buffer.
- Cultures were grown for 6 h, induced with 0.5 mM IPTG and grown for 36 h.
- Sialic acid titers were determined from cell-free supernatants via NanA/LDH assay.
- BRL04/pBRL47 cells generated an average titer of 0.46 g L " 1 sialic acid per liter of culture broth.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
MX2009003212A MX2009003212A (en) | 2006-09-26 | 2007-09-26 | Metabolically engineered escherichia coli for enchanced production of sialic acid. |
BRPI0715253-1A BRPI0715253A2 (en) | 2006-09-26 | 2007-09-26 | genetically engineered microbe, method for the production of sialic acid and method for the production of a n-acyl sialic acid analogue |
EP07872770A EP2082029A2 (en) | 2006-09-26 | 2007-09-26 | Metabolically engineered escherichia coli for enchanced production of sialic acid |
JP2009530570A JP2010517509A (en) | 2006-09-26 | 2007-09-26 | E. coli metabolically engineered for enhanced production of sialic acid |
AU2007346659A AU2007346659A1 (en) | 2006-09-26 | 2007-09-26 | Metabolically engineered Escherichia coli for enhanced production of sialic acid |
CN200780042941A CN101809143A (en) | 2006-09-26 | 2007-09-26 | Metabolically engineered escherichia coli for enchanced production of sialic acid |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US82691906P | 2006-09-26 | 2006-09-26 | |
US60/826,919 | 2006-09-26 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2008097366A2 true WO2008097366A2 (en) | 2008-08-14 |
WO2008097366A3 WO2008097366A3 (en) | 2009-03-26 |
Family
ID=39682270
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2007/079496 WO2008097366A2 (en) | 2006-09-26 | 2007-09-26 | Metabolically engineered escherichia coli for enchanced production of sialic acid |
Country Status (10)
Country | Link |
---|---|
US (2) | US8722365B2 (en) |
EP (1) | EP2082029A2 (en) |
JP (1) | JP2010517509A (en) |
KR (1) | KR20090077782A (en) |
CN (1) | CN101809143A (en) |
AU (1) | AU2007346659A1 (en) |
BR (1) | BRPI0715253A2 (en) |
MX (1) | MX2009003212A (en) |
RU (1) | RU2009113700A (en) |
WO (1) | WO2008097366A2 (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011130836A1 (en) * | 2010-04-20 | 2011-10-27 | National Research Council Of Canada | Cell-based production of nonulosonates |
WO2018122225A1 (en) | 2016-12-27 | 2018-07-05 | Inbiose N.V. | In vivo synthesis of sialylated compounds |
EP3473644A1 (en) | 2017-10-17 | 2019-04-24 | Jennewein Biotechnologie GmbH | Fermentative production of n-acetylneuraminic acid |
EP3486326A1 (en) | 2017-11-21 | 2019-05-22 | Jennewein Biotechnologie GmbH | Method for the purification of n-acetylneuraminic acid from a fermentation broth |
US10378034B2 (en) | 2014-05-27 | 2019-08-13 | Universitetet I Tromsø—Norges Arktiske Universitet | Use of a N-acetylneuraminate lyase derived from the bacterium Aliivibrio salmonicida in the production of neuraminic acid and derivatives thereof |
EP3467100B1 (en) | 2013-03-14 | 2022-09-21 | Glycosyn LLC | Microorganisms and methods for producing sialylated and n-acetylglucosamine-containing oligosaccharides |
WO2023058772A1 (en) | 2021-10-08 | 2023-04-13 | 協和発酵バイオ株式会社 | Microorganism having ability to produce n-acetylneuraminic acid and/or n-acetylneuraminic acid-containing carbohydrate and method for producing n-acetylneuraminic acid and/or n-acetylneuraminic acid-containing carbohydrate using said microorganism |
Families Citing this family (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102154163A (en) * | 2010-12-31 | 2011-08-17 | 朱莉 | Preparation method of 3'-sialic acid lactose |
CN103923869A (en) * | 2014-03-19 | 2014-07-16 | 武汉中科光谷绿色生物技术有限公司 | Bacillus subtilis gene engineering bacterial producing Neu5Ac, construction method and application thereof |
CN104059872B (en) * | 2014-07-16 | 2017-01-11 | 华东理工大学 | High-yield N-acetylglucosamine metabolic engineering bacterium, as well construction method and applications thereof |
CN104988108A (en) * | 2015-05-27 | 2015-10-21 | 武汉中科光谷绿色生物技术有限公司 | High-yield N-acetylneuraminic acid metabolic engineering bacterium and construction method and application |
CN108265094B (en) * | 2017-01-04 | 2021-03-19 | 河南科技学院 | Preparation method of alpha-2, 3 deaminated sialyllactulose |
CN110812370A (en) * | 2018-08-14 | 2020-02-21 | 皇家燕窝私人有限公司 | Method for extracting cubilose extract by using customized equipment |
CN112553120B (en) * | 2020-12-25 | 2021-09-14 | 华熙生物科技股份有限公司 | Escherichia coli and application thereof in production of polysialic acid |
CN113122491B (en) * | 2021-03-26 | 2022-08-02 | 清华大学 | Recombinant microorganism for producing N-acetylneuraminic acid and application thereof |
CN113249285A (en) * | 2021-05-13 | 2021-08-13 | 浙江工业大学 | Recombinant bacillus subtilis for high yield of N-acetylneuraminic acid and construction method and application thereof |
CN115125278B (en) * | 2022-08-25 | 2022-11-18 | 山东合成远景生物科技有限公司 | Feed supplement liquid for producing polysialic acid and preparation method of polysialic acid |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008040717A2 (en) * | 2006-10-03 | 2008-04-10 | Centre National De La Recherche Scientifique (Cnrs) | High yield production of sialic acid (neu5ac) by fermentation |
-
2007
- 2007-09-26 KR KR1020097007775A patent/KR20090077782A/en not_active Application Discontinuation
- 2007-09-26 EP EP07872770A patent/EP2082029A2/en not_active Withdrawn
- 2007-09-26 CN CN200780042941A patent/CN101809143A/en active Pending
- 2007-09-26 BR BRPI0715253-1A patent/BRPI0715253A2/en not_active Application Discontinuation
- 2007-09-26 RU RU2009113700/10A patent/RU2009113700A/en not_active Application Discontinuation
- 2007-09-26 AU AU2007346659A patent/AU2007346659A1/en not_active Abandoned
- 2007-09-26 JP JP2009530570A patent/JP2010517509A/en active Pending
- 2007-09-26 US US11/861,496 patent/US8722365B2/en active Active
- 2007-09-26 MX MX2009003212A patent/MX2009003212A/en not_active Application Discontinuation
- 2007-09-26 WO PCT/US2007/079496 patent/WO2008097366A2/en active Application Filing
-
2014
- 2014-02-28 US US14/193,585 patent/US9243240B2/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008040717A2 (en) * | 2006-10-03 | 2008-04-10 | Centre National De La Recherche Scientifique (Cnrs) | High yield production of sialic acid (neu5ac) by fermentation |
Non-Patent Citations (5)
Title |
---|
DENG ET AL: "Engineering a new pathway for N-acetylglucosamine production: Coupling a catabolic enzyme, glucosamine-6-phosphate deaminase, with a biosynthetic enzyme, glucosamine-6-phosphate N-acetyltransferase" ENZYME AND MICROBIAL TECHNOLOGY, STONEHAM, MA, US, vol. 39, no. 4, 2 August 2006 (2006-08-02), pages 828-834, XP005512496 ISSN: 0141-0229 * |
LUNDGREN B R AND BODDY C: "Sialic acid overproduction by metabolic engineering of Escherichia coli" 24TH ANNUAL GRADUATE STUDENT SYMPOSIUM, [Online] 17 May 2006 (2006-05-17), - 18 May 2006 (2006-05-18) pages 1-66, XP002500324 Retrieved from the Internet: URL:http://wings.buffalo.edu/chem-gss/2006_abstracts.pdf> [retrieved on 2008-10-16] * |
LUNDGREN BENJAMIN R ET AL: "Sialic acid and N-acyl sialic acid analog production by fermentation of metabolically and genetically engineered Escherichia coli." ORGANIC & BIOMOLECULAR CHEMISTRY 21 JUN 2007, vol. 5, no. 12, 21 June 2007 (2007-06-21), pages 1903-1909, XP002500326 ISSN: 1477-0520 * |
PLUMBRIDGE J A O COCHET ET AL: "Coordinated regulation of amino sugar-synthesizing and -degrading enzymes in Escherichia coli K-12" JOURNAL OF BACTERIOLOGY, vol. 175, no. 16, 1993, pages 4951-4956, XP002500325 ISSN: 0021-9193 * |
TANNER M E: "The enzymes of sialic acid biosynthesis" BIOORGANIC CHEMISTRY, ACADEMIC PRESS INC., NEW YORK, NY, US, vol. 33, no. 3, 1 June 2005 (2005-06-01), pages 216-228, XP004879644 ISSN: 0045-2068 * |
Cited By (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8841099B2 (en) | 2010-04-20 | 2014-09-23 | National Research Council Of Canada | Cell-based production of nonulosonates |
US9512455B2 (en) | 2010-04-20 | 2016-12-06 | National Research Council Of Canada | Cell-based production of nonulosonates |
WO2011130836A1 (en) * | 2010-04-20 | 2011-10-27 | National Research Council Of Canada | Cell-based production of nonulosonates |
EP3666900A2 (en) | 2010-04-20 | 2020-06-17 | University of Ottawa | Cell-based production of nonulosonates |
EP3467100B1 (en) | 2013-03-14 | 2022-09-21 | Glycosyn LLC | Microorganisms and methods for producing sialylated and n-acetylglucosamine-containing oligosaccharides |
US10378034B2 (en) | 2014-05-27 | 2019-08-13 | Universitetet I Tromsø—Norges Arktiske Universitet | Use of a N-acetylneuraminate lyase derived from the bacterium Aliivibrio salmonicida in the production of neuraminic acid and derivatives thereof |
US11535878B2 (en) | 2016-12-27 | 2022-12-27 | Inbiose N.V. | In vivo synthesis of sialylated compounds |
CN110114469A (en) * | 2016-12-27 | 2019-08-09 | 因比奥斯公司 | The internal synthesis of sialylated compounds |
WO2018122225A1 (en) | 2016-12-27 | 2018-07-05 | Inbiose N.V. | In vivo synthesis of sialylated compounds |
WO2019076941A1 (en) | 2017-10-17 | 2019-04-25 | Jennewein Biotechnologie Gmbh | Fermentative production of n-acetylneuraminic acid |
EP3473644A1 (en) | 2017-10-17 | 2019-04-24 | Jennewein Biotechnologie GmbH | Fermentative production of n-acetylneuraminic acid |
US11920173B2 (en) | 2017-10-17 | 2024-03-05 | Chr Hansen Hmo Gmbh | Fermentative production of N-acetylneuraminic acid |
WO2019101489A1 (en) | 2017-11-21 | 2019-05-31 | Jennewein Biotechnologie Gmbh | Process for the purification of a sialic acid from a fermentation broth |
EP3486326A1 (en) | 2017-11-21 | 2019-05-22 | Jennewein Biotechnologie GmbH | Method for the purification of n-acetylneuraminic acid from a fermentation broth |
US11834691B2 (en) | 2017-11-21 | 2023-12-05 | Chr. Hansen HMO GmbH | Process for purification of a sialic acid from a fermentation broth |
WO2023058772A1 (en) | 2021-10-08 | 2023-04-13 | 協和発酵バイオ株式会社 | Microorganism having ability to produce n-acetylneuraminic acid and/or n-acetylneuraminic acid-containing carbohydrate and method for producing n-acetylneuraminic acid and/or n-acetylneuraminic acid-containing carbohydrate using said microorganism |
Also Published As
Publication number | Publication date |
---|---|
AU2007346659A1 (en) | 2008-08-14 |
CN101809143A (en) | 2010-08-18 |
US20080153133A1 (en) | 2008-06-26 |
EP2082029A2 (en) | 2009-07-29 |
RU2009113700A (en) | 2010-11-10 |
MX2009003212A (en) | 2009-08-12 |
US8722365B2 (en) | 2014-05-13 |
AU2007346659A8 (en) | 2009-05-21 |
KR20090077782A (en) | 2009-07-15 |
BRPI0715253A2 (en) | 2013-06-04 |
US20140273162A1 (en) | 2014-09-18 |
WO2008097366A3 (en) | 2009-03-26 |
JP2010517509A (en) | 2010-05-27 |
US9243240B2 (en) | 2016-01-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9243240B2 (en) | Metabolically engineered escherichia coli for enhanced production of sialic acid | |
CN107267575B (en) | Method for producing N-acetyl-D-glucosamine and/or D-glucosamine salt by microbial fermentation | |
US8124381B2 (en) | Process and materials for production of glucosamine and N-acetylglucosamine | |
JP2023093683A (en) | Improved process for production of fucosylated oligosaccharides | |
JP2020537530A (en) | Fermentative production of N-acetylneuraminic acid | |
JP2020526200A (en) | Its use in the production of fucosyltransferases and fucosylated oligosaccharides | |
US20060094085A1 (en) | Process and materials for production of glucosamine | |
Lin et al. | Enhanced production of N-acetyl-D-neuraminic acid by multi-approach whole-cell biocatalyst | |
JP2020528280A (en) | Its use in the production of sialyltransferases and sialylated oligosaccharides | |
CN114774343B (en) | Coli engineering strain for producing 2' -fucosyllactose and application thereof | |
US11278610B2 (en) | Glycosylation method | |
CA2665332A1 (en) | High yield production of sialic acid (neu5ac) by fermentation | |
JP2023506287A (en) | Alpha-1,2-fucosyltransferase enzyme that converts lactose | |
CN113366005A (en) | Biosynthesis of Compounds in Yeast | |
WO2017174036A1 (en) | Method for producing n-acetyl-d-glucosamine and/or d-glucosamine hydrochloride by microbial fermentation | |
WO2017174040A1 (en) | Method for producing n-acetyl-d-glucosamine and/or d-glucosamine salt by microbial fermentation | |
CN114806991A (en) | Engineering escherichia coli for improving yield of fucosyllactose and production method | |
CN113684163A (en) | Genetically engineered bacterium for improving yield of lactoyl-N-tetrasaccharide and production method thereof | |
CN115725535B (en) | N-deoxyribotransferase and application thereof in preparation of deoxynucleosides | |
DK202200591A1 (en) | New sialyltransferases for in vivo synthesis of lst-c | |
WO2023166034A1 (en) | New sialyltransferases for in vivo synthesis of lst-a | |
CN116676288A (en) | Alpha-1, 2-fucosyltransferase mutant and application thereof | |
CN116004599A (en) | Microbial cell transformation method for irreversibly synthesizing nidus Collocaliae acid |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780042941.X Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07872770 Country of ref document: EP Kind code of ref document: A2 |
|
ENP | Entry into the national phase |
Ref document number: 2009530570 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/003212 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12009500556 Country of ref document: PH |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007346659 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1020097007775 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 576403 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007872770 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2007346659 Country of ref document: AU Date of ref document: 20070926 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2009113700 Country of ref document: RU Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: PI0715253 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090326 |