WO2008096370A2

WO2008096370A2 - An efficient and novel purification method of recombinant hg-csf

Info

Publication number: WO2008096370A2
Application number: PCT/IN2008/000069
Authority: WO
Inventors: Venkata Krishna Rao Dasari; Bhujanga Rao Adibhatla Kali Satya; Nannapaneni Venkaiah Chowdary
Original assignee: Natco Pharma Limited
Priority date: 2007-02-05
Filing date: 2008-02-04
Publication date: 2008-08-14
Also published as: WO2008096370A3

Abstract

The present invention relates to Recombinant human Granulocyte Colony Stimulating Factor (G-CSF) and describes a novel purification process for a simple, economically feasible, largely scalable production of pharmaceutically acceptable grade product with high recovery of rhG-CSF expressed from bacterial cells. The invention comprises of the conditions for isolation of protein inclusion bodies; complete refolding in to native form, purification of the protein by two-step chromatography and diafiltration. The end product of this invention viz. high purity G-CSF is suitable for direct injectable use. The efficiency of the protein recovery is 52% with more than 99% of monomer purity.

Description

AN EFFICIENT AND NOVEL PURIFICATION METHOD OF RECOMBINANT hG-CSF

Field of the invention: The present invention relates to a novel purification process of human G-CSF for a simple, economically feasible and largely scalable production of pharmaceutically acceptable grade purity with high recovery of rhG-CSF. The process leads to the expression of G-CSF protein as inclusion bodies in E.coli and purification of protein inclusion bodies for biologically active G-CSF in high recovery free from aggregates, multimeric forms and other host cell impurities. More specifically the invention is directed to study and establishment of high recovery processing method for G-CSF. In this connection high-level expression of protein is performed by suitable genetic engineering and fermentation technology. Simple, economically feasible purification method is established by isolation of protein inclusion bodies, efficient refolding, two- step chromatography and diafiltration for direct formulation. The end product of this invention is biologically active with pharmaceutically acceptable grade purity and high recovery.

Background of the invention: G-CSF is a lineage specific colony-stimulating factor and particularly increases the production of infection fighting white blood cells- neutrophils, by stimulating the specific bone marrow precursor cells and their differentiation into granulocytes. G-CSF is used for granulocytopenic recovery from neutropenia caused by Chemotherapy and Radiation. G-CSF is produced by monocytes, fibroblasts and endothelial cells. A single G-CSF gene exists on human chromosome 17 in region q21-q22 and splits in to four introns of about 2500 nucleotides (Nagata et.al 1986, Nature: 5 (3) 575-81). Generally for many therapeutics, glycosylation of protein is required for bio-potency and stability. Similarly Human G-CSF protein has only one single O-Glycosylation site at Threonine 133. But the O-glycosylated sugar moiety is not required for biological potency and stability. The nonglycosylated E.coli derived human G-CSF is also biologically active as it is produced in mammalian cell lines [Oh-eda et al 1990, J. Biol. Chem. 256, 11452- 11435; Arkowa et.al 1993, J. protein Chem. 12, 525-531 and Hill et al 1993, Proc. Nat. Acad. Sci, USA 90, 5167-5171 J.

Human G-CSF can be produced in eukaryotic organisms (yeast and mammalian cell lines) and prokaryotic organisms like bacteria. The form of G-CSF produced depends on the type of host organism used for expression. If the G-CSF is expressed in eukaryotic cells, it is produced in a soluble form and secreted. When G-CSF is produced in prokaryotic cells, the product is formed as inactive inclusion bodies. Normally inclusion bodies have a secondary structure and are densely aggregated. It is revealed that the combination of so many factors of physiological state of host cell and growth conditions are affected by the formation of inclusion bodies.

The gene encoding G-CSF from a tumor cell line and peripheral blood monocytes can be used for cloning. Production of biologically active human G-CSF protein from inactive inclusion bodies expressed by rDNA technology in commonly used prokaryotic host cells are very difficult. Efficient process methodologies are desirable for ' manufacturing of therapeutically useful G-CSF on industrial scale. Various methods have been reported in scientific literature for the purification of G-CSF expressed in E.coli, .-. yeast, or CHO cells. A method of purification of G-CSF from CHU-2 conditioned . medium (Human Oral Carcinoma cell line) constitutively was developed by Nomura et al, EMBO J 1986, 5, 871. The process described the use of a three-step chromatography procedure after concentration and ultra filtration of the conditioned medium.

Recombinant human G-CSF has been produced by expressing the G-CSF gene in E.coli and purified it to homogeneity. Many earlier U. S patents 4,810,643; 4,999,291; 5,055,555; 5532341; 5,580,755; 5,582,823; 5681720; 5714581; 5,830,705 and 5,849,883. European patents EP0243153; 0215126; 0169566; 0237545; 0272703; 0459630; 0256843 and other patents GB2213821; WO 03/051922; WO8604506; WO8604605; WO8703689; WO2004/001056 and WO2006/097944 describe various aspects of purification of G-CSF protein from different expression systems like prokaryotic and eukaryotic cells.

Purification of G-CSF in bacterial systems is described in U.S Patent 4,810643 and US 4,999,291. In the preferred process, inclusion bodies are extracted and washed with deoxycholate, solubilized with sarkosyl, refolded and purified by three-step chromatography process. However, these patents are not clear with regard to key parameters of purification and many number of steps are involved in purification process. Additionally, the final product yield and purity is not clear in the processes described in the above patents. United States patent, US 5,055,555 describes a simplified process for purification of human G-CSF expressed from eukaryotic cells. After ion exchange chromatography the protein is precipitated by salting out using sodium chloride. But recovery of G-CSF from inclusion bodies expressed in bacteria, precipitation of the protein by sodium chloride salt, increases the aggregation status resulting in loss of yield and activity. This process does not assure pharmaceutical grade purity with high recovery. US 5532341 describes the purification of pluripotent G-CSF from conditioned media using three-step chromatography process. The procedure is applicable to the G- CSF expressed in cell culture supernatants. The factors like solubility and refolding of inclusion bodies are not described.

United States patent, US 5,830,705 describes a process for the purification of G- CSF from COS cell lines. Isolation, solubilization and refolding of G-CSF protein expressed as inclusion bodies in bacteria is different in principle and technology from protein expressed in cell lines. United States patent, US 5,849,883 describes a process for isolation of human and bovine G-CSF as inclusion bodies from recombinant microorganisms. Protein inclusion bodies are solubilized with sarkosyl and purified by CM Sepharose Ion exchange column. Complete purification process, purity and yield are not described. WO03/051922 describes a process, use of an immobilized metal affinity chromatography step in between ion exchange and size exclusion chromatography to get a biologically active and pure protein. This involves three-step chromatography and the conditions of the process and yields are not clearly disclosed. EP 0243153 describes the purification of G-CSF expressed in supernatants of

HBT563 cells by a salting-out technique employing ammonium sulphate followed by two-step chromatography. Isolation, solubilization and refolding of G-CSF protein, expressed as inclusion bodies in bacteria is different in principle and technology from protein expressed in cell lines. US 5,681,720; US 5,714,581 EP0256843, EP0272703, EP0335423 and EP 0459630 patents describe the modifications of amino acid sequence, their purification process and biological activities. Similarly Australian patent publication No: AU A-76380/91 reported the construction of various muteins of G-CSF and their comparative activities. But a number of steps are involved in purification process and crucial parameters like conditions, compositions and process efficiencies are not clear. The final product yield and purity are not mentioned in these patents. WO 2004/001056, describes the protein purification involving isolation of inclusion bodies, three step washings, solubilization at alkaline pH, two-step refolding and further purification by Ion exchange chromatography. Crucial factors like efficiency of inclusion body recovery, protein refolding and ion exchange chromatography are not discussed in this patent either. The end product obtained through the process of this patent is not suitable for direct formulation unless further purification steps like diafiltration, molecular sieving etc are incorporated.

WO2006/097944 describes the use of Hydrophobic Interaction chromatography after Ion exchange chromatography for large-scale purification of G-CSF. Conditions and parameters like efficiency of inclusion body recovery, protein refolding, ion exchange chromatography and Hydrophobic Interaction chromatography are not mentioned. The end product of this patent is also not suitable for direct formulation unless further purification steps like diafiltration, molecular sieving etc are incorporated. Also key factors like purification method, yields and therapeutic quality details have not been disclosed in this patent. Various purification methods discussed in the above patents involve multiple chromatography and other steps for the purification of G-CSF from bacteria. None of the above patents disclosed a simple and viable processing method for production of pharmaceutical grade G-CSF on industrial scale. Since G-CSF is a therapeutic protein, which is hydrophobic in nature and also is temperature sensitive and conductivity sensitive, highly controlled processing parameters are essential to get high recovery with pharmaceutically acceptable purity. Practical enabling conditions and compositions for purification to obtain pharmaceutical grade quality for direct formulation with high recovery of G-CSF were not reported so far.

On a commercial scale, yield losses from an un-established multi step purification process becomes highly significant. Hence simplified and practical enabling procedures with fewer steps are desirable to produce higher yields of the final product with pharmaceutical quality.

In an effort to manufacture recombinant human G-CSF, a simple, industrially viable process for direct formulation with pharmaceutically acceptable grade quality and high yield of G-CSF has been now developed and disclosed through the current invention. SUMMARY OF THE INVENTION:

The present invention relates to Recombinant human Granulocyte Colony

Stimulating Factor (G-CSF) and describes a novel purification process for a simple, economically feasible, largely scalable production of pharmaceutically acceptable grade purity with high recovery of rhG-CSF expressed from bacterial cells. The methodology of the present invention consists of expression of protein in bacteria for maximizing the volumetric product yield, isolation of the protein expressed as inclusion bodies, denaturation , refolding into biologically active form and final purification to get pharmaceutical grade quality of G-CSF.

The said invention comprises of the following discrete steps: a) Synthesis of mutant gene from native G-CSF gene. b) Construction of recombinant clone with mutant G-CSF gene. c) Fed batch fermentation process for volumetric yield of G-CSF. d) Isolation of protein inclusion bodies by cell lysis in enzymatic and mechanical method. e) Washing of isolated inclusion bodies with high recovery and purity. f) Solubilization of washed IB with a chaotrophic environment in the presence of cysteine blocking agent at high alkaline pH. g) Complete refolding of denatured G-CSF protein in a single step. h) Practically enabling conditions and compositions for Ion exchange chromatography. i) Buffer exchanging by diafiltration using tangential flow filtration system. j) Establishing the conditions and compositions for size exclusion chromatography to get high purity with good recovery. k) Dialysis, Sterile filtration and formulation of highly purified protein for therapeutic use.

Preferably, the mutant G-CSF gene is synthesized by site directed mutagenesis from native gene to enhance the expression of protein. Fed batch fermentation process is used to increase the volumetric product yield. The Inclusion bodies (IB) of the G-CSF protein are recovered from the cells by lysing them by enzymatic or sonication or high- pressure homoginization methods and the cell lysate is removed by centrifugation. The pellets are preferably washed with non-ionic detergents like Triton-XIOO, deoxycholic acid and water. The washed IB pellet recovery is more than 90% with more than 98% purity .The IB protein is solubilized in urea or guanidine hydrochloride or Sodium dodecyl sulphate in the presence of cysteine blocking agent, at high alkaline pH (12.0 to 12.8). The denatured and solubilized protein is refolded into native form for its biological activity. This is established by keeping the solubilized protein in diluted form using low concentration of surfactant at a pH of 8.2 to 8.3 for a period of 16-18 hrs at 15-19° C or 18-20 hrs at 2-8° C. The efficiency of protein refolding is 38 to 100% based on the conditions, compositions and concentration of cysteine blocking agent present in the solubilization buffer.

In a preferred embodiment of this invention, the refolded sample is acidified with suitable buffer and subjected to two-step chromatography techniques like Ion exchange and Size exclusion chromatography employing specifically controlled conditions and compositions. Buffer exchange is performed by tangential flow filtration module using 3.0 K.D molecular weight cutoff membrane. The membrane may be regenerated cellulose or polyether sulphone. All the contaminants like host impurities, oligomers and endotoxins are removed by chromatography and diafiltration. The end product can be formulated or directly collected in to formulation buffer or lyophilized in the presence of sorbitol or mannitol. The monomer purity of the purified G-CSF protein is more than 99% with 20-52% recovery based on the efficiency of refolding of the protein.

DETAILED DESCRIPTION OF THE INVENTION: A simple and innovative method for purification of rhG-CSF to pharmaceutically acceptable grade with high recovery of recombinant Human G-CSF has been developed. In this invention microbial expression (bacterial) systems are used to produce nonglycosylated human G-CSF by genetic engineering technology. The human mutant G-CSF gene is synthesized by site directed mutagenesis from native gene, which is isolated from human peripheral blood monocytes. The mutant gene is cloned into a pET based expression vectors and transformed into BL21 based host strains and the recombinant bacterial clones are screened by antibiotic markers. Culture growth rate based fed batch fermentation process is used for volumetric product yield of G-CSF.The fermented cell mass is harvested and protein inclusion bodies are isolated by different lysis techniques. The protein inclusion bodies are washed thoroughly with nonionic detergents and the washed IB pellet is solubilized in chaotrophic environment in the presence of a cysteine-blocking agent at high alkaline pH. The solubilized and denatured protein is completely refolded into native form and further purification is performed by a two-step chromatography and buffer exchange process employing tangential flow filtration system and 3.0 K.D cutoff membranes. The conditions and compositions of refolding, chromatography techniques and diafiltration are well studied and the procedures thus established are disclosed in the present invention. All the contaminants like host impurities, oligomers and endotoxins are removed by chromatography and diafiltration. The end product can be formulated or lyophilized in the presence of sorbitol or mannitol. The monomer purity of the purified G-CSF protein is more than 99% with 20- 52% recovery based on the efficiency of protein refolding. The G-CSF protein generated by the methods described in the current invention, matches very well with the analytical characteristics & biological activity profile of the native G-CSF protein and the corresponding commercially available drug formulations.

Construction of recombinant clone with mutant G-CSF gene The present invention relates to a novel process for the purification of human G-

CSF protein from transformed E.coli using a mutant gene. Various processing techniques are used to result in a highly efficient and industrially viable process for high recovery of human G-CSF- The present invention is described in detail below.

The human G-CSF gene used in the present invention has resulted by incorporating mutations in the native gene, without changing the amino acid sequence. Eight mutations are incorporated by site directed mutagenesis at N-terminal region of the native gene. Suitable primers are used to amplify the mutant gene including Ndel and BamHl restriction sites by PCR. The PCR amplified each mutant gene (548bp) and pET- 3a vector are digested with Ndel and BamHl restriction enzymes and ligated with T4 DNA ligase. BL21 (DE3) PLysS competent cells are transformed with recombinant vector containing the mutant G-CSF gene and the transformants are screened by antibiotic markers.

Protein expression

Expression of protein can be enhanced by developing the transcriptional and translational conditions of human G-CSF gene. The translational rate is enhanced by adopting the mutations at N-terminal region of gene, while the transcriptional rate is enhanced by inserting the mutant G-CSF gene in expression plasmid vector comprising the T7 promoter and T7 RNA polymerase, which is one of the most important and strong promoters for high-level transcription of heterologous gene in E.coli. The fermentation process is carried out in a 5L fermenter (B.Brown international, Germany) while maintaining the key process parameters throughout the run. The fermentation process is controlled by maintaining the levels of nutrients, dissolved oxygen, pH, temparature etc., by suitable probes incorporated in to fermenter equipment.

The culture medium used in the embodiment of the present invention is, Luria Bertani broth [LB] (bactotryptonelOg/L, yeast extract 5g/L and NaCl 5g/L) for seed development and modified terrific broth medium for preinduction growth medium. Antibiotics used are 100 μg/mL of ampicillin and 34 μg/mL chloramphenicol. The preferred composition of the nutrient feed medium is Tryptone 60 g/L, yeast extract 120 g/L, glucose 120 g/L, 1 M K₂HPO₄IO mL/L, 1 M MgSO₄ 20 mL/L, and trace metal solution 10 mL/L along with suitable antibiotics with desired concentrations. The composition of trace metal solution is (CuSO₄.5H₂O 2 mg/L, Al₂(SO₄O₃ 10 mg/L, MgCl₂.4H₂O 20 mg/L, Sodium molybdate dihydrate 50 mg/L, Boric acid 1 mg/L, Cobalt chloride 2.5 g/L, Zinc sulfate 5 mg/L, Ferrous sulfate 50 mg/L and Nickel chloride hexa hydrate 1 mg/L).

In the present embodiment, culture specific growth rate based fed-batch fermentation process is used. The process key parameters comprise of aeration, temperature, pH, dissolved oxygen, inducer concentration, cell density, and agitation speed. The aeration at 0.8 to 1.2 VVM is maintained. The temperature at 36.5 to 37.5° C is maintained. , The pH is maintained at 6.8 to 7.2 by acid/base addition through automatic feed control. Dissolved oxygen is maintained at 40 to 45%. Nutrient feeding is monitored on the basis of high specific growth rate of culture. The agitation speed is maintained at 300 to 900 RPM based on the dissolved oxygen percentage in fermentation medium. The optical density of culture medium at pre-induction phase is maintained in the range of 30 to 35 at UV 600nm. The preferred inducer is IPTG and is used in a concentration of 1.5 to 2.5 mM. Under the above conditions, the resulting volumetric product yield of G-CSF is 4.2 g/L with 45 % protein expression on total cellular protein. Efficiency of expression is estimated through densitometry using protein bands obtained by SDS-PAGE. The fermented broth is harvested 9-10 hrs of post induction. The harvested cell mass is subjected to down stream process according to the purification techniques described below.

Purification Recombinant Human G-CSF expressed as inclusion bodies in E.coli by fermentation, constituted 45 % of the total cellular protein. This is recovered by simple, industrially economical, easily scalable, reproducible procedure for getting high recovery with pharmaceutically acceptable grade purity. The purification process involves, either batch or fed batch fermentation culture, and is harvested by centrifugation at 4000 to 10000 RPM in fixed angle rotor or swing out rotor for 15 to 60 min, preferably 30 to 45 min at 2 to 15° C or concentrated by halo fiber column. The cell pellet is washed twice with sodium chloride or water or phosphate buffer, preferably phosphate buffer is used. Isolation of protein inclusion body pellet from washed cell culture is carried out by enzymatic or mechanical lysis methods like high pressure homoginization or sonication followed by washing with Non-ionic detergent buffers like Triton -X and Deoxycholates. For example the cell pellet (isolated from 500 mL of fermented broth is suspended in 100 to 1000 mL, preferably 150 to 750 mL, more preferably 200 to 600 mL of lysis buffer at pH:7.5 to 8.5 (1OmM to 10OmM TrIS-HCl, 1.0 to 2OmM EDTA, 0.02 to 0.2% Lysozyme, 1.0 to 5.OmM PMSF) and sonicated at 4° C till completion of cell breaking. The amplitude of the sonicator is set at 20 to 80 %, preferably at 30 to 60 %. The inclusion bodies are isolated and washed with non-ionic detergent like Triton X-100, and deoxycholic acid. The concentration of detergent is preferably 0.1 to 2.5 %, more preferably 0.2 to 1.0 % .The composition of wash buffer is 5OmM to 10OmM Tris HCl, 2 to 1OmM EDTA and 0.1 to 2.0 mM PMSF at pH: 7.0 to 8.5. Finally the inclusion bodies are washed with water. Under these conditions of lysis and washings, unexpectedly the recovery of the protein IB is more than 90% and the purity of the IB pellet is more than 98%.

The protein IB pellet is solubilized and denatured in suitable buffer in the presence of chaotrophic environment. The solubilization buffer comprises of denaturing agent and a cysteine-blocking agent. The denaturing agent is selected from the group comprising of urea, guanidine HCl, SDS and the like or mixtures there of, the preferred denaturing agent being urea. The cysteine blocking agent is selected from a group consisting of reduced glutathione, cysteine, thioglycolic acid, cysteamine, DTT, 2- mercaptoethanol, cystine, cystamine, oxidized glutathione, dithioglycolic acid, pyridine disulphide, other derivatives of cystine and the like or a mixture of these compounds. The preferred molar concentration of urea is 2 to 10 M, more preferably 4 to 9 M, and most • preferably 6 to 8M. The concentration of cysteine blocking agent is 5 to 500 mM, preferably 10 to 40OmM, more preferably 20 to 30OmM. The pH of the solution is adjusted between 9.0 to 13.0, preferably 10.0 to 13.0, more preferably 12.0 to 12.8 with 1.0 N Sodium Hydroxide. The solubilized and denatured proteins are generally refolded at above or below ^■ isoelectric point. During the refolding, disulphide linkage is formed between the cysteine residues. For example, G-CSF isoelectric point is 5.8, the solubilized and denatured G- CSF is refolded either at acidic or basic pH. Preferably at the pKa value of cysteine. The refolding buffer comprises of Tris-HCl, sodium, ammonium, potassium salts of acetate, citrate, phosphate and Tween-20 or Tween-40 or Tween-60 or Tween-80 or glycerol or urea. Preferably 1OmM to 5OmM Tris -HCl, or 1OmM to 5OmM sodium, ammonium and potassium salts of acetate, citrate, and phosphate, 0.01 to 0.25% Tween-20, or 5.0 to 15 % glycerol or 1.0 to 2.0 M urea is used.

In this invention a single step refolding process is performed. The protein solubilized clear solution is diluted to 10 to 80 fold, preferably 20 to 40 fold with 5 to 10% glycerol or 0.1 to 0.25 % Tween-20. Refolding is performed at a temperature of 2 to 30° C preferably 3 to 25° C, more preferably 4 to 22° C, for duration of 6 to 24 hrs, preferably 12 to 20 hrs. The pH is maintained at 3.0 to 9.0 preferably 7.0 to 8.5, more preferably 8.2 to 8.3. Unexpectedly under these experimental conditions, the efficiency of refolding is 38 to 100%.

The refolded protein is acidified and directly loaded on to pre equilibrated Ion exchange chromatography column. Preparative chromatography columns from XK series or BPG series of GE health care and easy pack series or geltec series of Biorad with suitable preparative chromatography system like AKTA (GE Health) series, BIOLOGIC ( BIO-RAD) series are used. The columns XK 50/500, BPG 100/500 to BPG 300/500 are preferred. The matrix used for ion exchange is carboxy methyl, sulphopropyl or quaternary functional groups attached to resins made of cellulose, agarose, or their derivatives, preferably SP.Sepharose. A column bed height of 2 to 30 cm, preferably 10 to 15 cm is maintained. The protein is isocratically eluted with Tris HCl pH: 8.0,in the concentration range of 25 to250mM, preferably 50 to 200mM,and more preferably 75 to 15OmM. Under these purification conditions, surprisingly the recovery of the protein is 28 to 70% with 98 to 99% monomer purity based on the efficiency of refolding. The protein solution from IEC is acidified to pH 2.0 to 5.0, preferably 3.0 to 4.0 with HCl/Acetate. The acidified protein solution is buffer exchanged and concentrated on tangential flow filtration system using 1.0 to 10.0 K.Da MWCO membranes, preferably 3.0 to 5.0 KDa, more preferably 3.0 K.Da cassettes with membrane made of regenerated cellulose or polyether sulphone. The concentration of protein is rendered 0.5 to 3.5 mg/mL. The concentrated protein solution is loaded on pre equlibrated size exclusion chromatography column Preparative columns from XK series or BPG series of GE health care and easy pack series or geltec series of Biorad with suitable preparative chromatography system like AKTA (GE Health) series, BIOLOGIC (BIO-RAD) series are used. The columns XK 26/700, 26/1000, 50/1000 and BPG 100/950 are preferred. The matrix used for size exclusion is selected from superdex series or sephadex series or sephacryl series or supharose series of resins made of agarose and dextran or their derivatives, preferably superdex-75 or sephdex-G25 or supharose-12. A column bed hight 30 to 90 cm is preferred. More preferably 50 to 85 cm is used. Buffer flow rate is 0.2 to 1.3 cm/min based on the type of resin used. The protein is isocratically eluted with equilibration buffer as explained in examples below. Under these experimental conditions, unexpectedly the recovery of the protein is 20 to 52% with more than 99% monomer purity. The protein solution is diafiltered and sterile filtered for formulation or purification of the protein is performed by size exclusion chromatography using G-CSF formulation buffer. The formulated protein is sterile filtered for injectable use.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig-1: The nucleotide sequence of hG-CSF gene along with derived amino acid sequence.

Fig-2: The nucleotide sequence of hG-CSF mutant gene in the cloned fragment along with derived amino acid sequence.

Fig-3: Restriction map of E.coli expression vector containing the mature coding sequence of human mutant G-CSF gene Example-l

Fig-4 (a): RP-LC chromatogram of G-CSF at initial stage of refolding reaction.

Fig-4 (b): RP-LC chromatogram of G-CSF at middle stage of refolding reaction.

Fig-4 (c): RP-LC chromatogram of G-CSF at ending stage of refolding reaction.

Fig-5: RP-LC chromatogram of G-CSF (after IEC) Fig-6 (a): RP-LC chromatogram of G-CSF (before formulation)

Fig-6 (b): SDS-PAGE of G-CSF at different stages.

ExampIe-2

Fig-7: RP-LC chromatogram of G-CSF at ending stage of refolding.

Fig-8 (a): RP-LC chromatogram of G-CSF (formulation) Fig-8 (b): Non -reduced PAGE of G-CSF (formulation)

Example-4

Fig-9 (a): RP-LC chromatogram of G-CSF at initial stage of refolding.

Fig-9 (b): RP-LC chromatogram of G-CSF at middle stage of refolding reaction.

Fig-9 (c): RP-LC chromatogram of G-CSF at ending stage of refolding reaction. Fig-10 (a): RP-LC chromatogram of G-CSF (formulation)

Fig-10 (b): Non -reduced PAGE of G-CSF (formulation) Technical abbreviations used in the text:

1. PCR: Polymerase chain reaction.

2. WCB : Working cell bank.. 3. LB: Luria Bertani Brot

4. MTB: Modified Terrific Broth .

5. VVM: volume of air per unit volume of mass per minute.

6. RPM: Revolutions per minute.

7. OD:Optical density. 8. IPTG : Iso propyl thio galactosidase.

9. TRJS-HCl: Tris (hydroxymethyl) aminomethane Hydrochloride.

10. EDTA : Ethylene diamine tetra acetic acid.

11. PMSF: Polymethoxy sulphonyl fluoride.

12. DOC : Deoxycholic acid. 13. IB : Inclusion bodies.

14. DTT: Dithiothreitol

15. MWCO: Molecular weight cut off.

16. BPG: Bioprocess glass

17. IEC: Ion exchange chromatography. 18. SP.Sepharose: sulpha propyl sepharose.

19. SEC: Size exclusion chromatography.

20. HETP : Hight equivalent theoretical plates. 21. K.Da: Kilodaltons.

22. TFF: Tangential flow filtration. 23. RP-HPLC: Reverse phase high-performance liquid chromatography.

24. SDS-PAGE: Sodium dodecyl sulphate polyacrylamide gelelectrophorisis.

Example -1 Construction of clone: This example describes the synthesis of a mutant gene, construction of clone, expression, purification with high recovery and purity of Human G-CSF. Eight mutations are incorporated at N-terminal region of native gene by site directed mutagenesis. "GCGCCATATGACACCATTAGGA CCTGCCAGCTCCTTAC CCCAG" as final forward primer and "GCGCGGATCCT TATCAGGG CTGGGCAAGGT" as reverse primer are used to amplify the mutant gene including Ndel and BamHl restriction sites (indicated by underlines) by PCR. The PCR amplified mutant gene (548bp) and pET-3a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase. The recombinant vector is transformed into BL21 (DE3) PLysS competent cells and is plated on LB agar with lOOμg/mL of ampicillin and 34μg/mL of chloramphenicol. The transformants are screened by antibiotic markers. Results:

Fig-1: The nucleotide sequence of hG-CSF gene along with derived amino acid sequence Fig-2: The nucleotide sequence of hG-CSF mutant genein the cloned fragment along with derived amino acid sequence.

Fig-3: Restriction map of E.coli expression vector containing the mature coding sequence of human mutant G-CSF gene Protein expression:

Seed culture is prepared from 300μL of glycerol stock (WCB) of BL21 (DE3)

PlysS harboring pET-3a-G-CSF recombinant vector by inoculating into 300 mL of LB medium containing both antibiotics. The culture is grown on orbital shaker at 150 RPM for 15 hrs at 37⁰C. The culture is aseptically isolated by centrifugation at 8000 RPM for 15 min at 4⁰C. MTB medium (3L) along with antibiotics are taken into 5 L Biostat fermentor (B.Brown International, Germany). The medium is aseptically inoculated with the above described seed culture pellet. Aeration is maintained at 0.8 to 1.2 VVM, pH is maintained constantly at 6.8 by acid/base addition through automatic feed control. Dissolved oxygen is maintained at 42 to 44%. A nutrient is fed on the basis of high specific growth rate of culture. The culture is induced with 2.OmM IPTG when the optical density of culture (OD_6Oo) reaches 30. Maximum cell density is observed (OD₆oo: 62) at 7 hrs of post induction. The volumetric product yield is 4.2 g/L. The fermented broth is harvested 9.0 hrs of post induction.

Purification:

Fermented broth (500 mL from fed batch fermentation of G-CSF) is harvested by centrifugation at 6000 RPM for 30 min at 4° C. The cell pellet is washed twice with phosphate buffer. The bacterial cell pellet is suspended in 20OmL of 10OmM Tris HCl buffer at pH 8.0 (3mM EDTA, ImM PMSF and 0.1% Lysozyme). The cell lysis is carried out at 4° C by sonication using 5 sec ON/OFF programme at 40% amplitude of power till completion of cell lysis. The inclusion bodies are separated from lysate by centrifugation at 8000 RPM for 30 min at 4° C .The protein inclusion body pellet is washed twice with non-ionic detergents like Triton-XlOO and DOC. The composition of wash buffer is 5OmM Tris HCl at pH 7.5, 2mM EDTA, ImM PMSF and 0.25% detergent per each wash. Finally the pellet is washed with water to remove metal ions present in the protein pellet, if any. Results:

Recovery of protein as IB : 1.89 g.

Percentage of recovery : 90%

Purity : 98%

The washed IB pellet is dissolved in urea (125 g) and thiol agent (6 g) is added. The concentration of protein is adjusted to 7 to 8 mg/mL. The pH is adjusted to 12.0 to 12.5 by adding NaOH (8.OmL of 1.0N). The reaction is maintained at 20 to 25° C for 30 min. The undissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate -20(10.5L) .The pH of the diluted reaction mass is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12 mL). The protein is allowed to undergo single step refolding by keeping the solution at 2 to 8° C for 18 to 20 hrs. The protein is found to be completely refolded into native form during this period. Results:

Efficiency of refolding: 100%. Fig-4 (a): RP- LC chromatogram of G-CSF at initial stage of refolding reaction Fig-4 (b): RP- LC chromatogram of G-CSF at middle stage of refolding reaction. Fig-4 (c): RP- LC chromatogram of G-CSF at ending stage of refolding reaction. The pH of the refolded protein is adjusted to 4.5 with acetic acid /acetate. Chromatographic purification of refolded protein is performed by AKTA pilot, and buffer exchange is carried out by Tangential flow filtration module using 3.0 K.Da cassettes. BPG 140/500 column is packed with 2L of SP.Sepharose fast flow matrix for IEC. The column temperature is maintained at about 20° C and flow rate is maintained as 500 mL/min through out the process. The column is equilibrated with 10 bed volumes of 25mM sodium acetate buffer at pH: 4.5 and 0.1% Tween-20. The refolded sample is directly loaded on the column with same flow rate and the column is washed with 5 bed volumes of same buffer with out Tween-20. The protein is isocratically eluted with 10OmM Tris HCl at pH: 8.0. Results:

Recovery of protein : 1.47 g.

Percentage of recovery : 70%

Monomer Purity : 99% (RP-LC) Fig-5: RP-LC chromatogram of G-CSF (after IEC)

The pH of protein (eluted from IEC) is adjusted to 3.0 to 3.5 with 50OmM acetic acid (2.0 L). The protein is buffer exchanged against ImM acetic acid by TFF module using 3.0 K.Da, MWCO polyether sulphone membrane. After completion of buffer exchange, the sample is concentrated to 2.0 mg/mL for carrying size exclusion chromatography.

XK 50/1000 column is packed with 1.5 L of superdex-75 preparative grade matrix for size exclusion chromatography. The column temperature is maintained at about 20° C and HETP value is maintained at 0.009 to 0.015 cm/plate. The column flow rate is maintained at 0.2 to 0.22 cm /min through out the process. The column is equilibrated with 5 bed volumes of 20OmM sodium acetate buffer at pH: 4.0 .The concentrated sample is loaded on the column with same flow rate. The sample volume is 6% of the bed volume. Column is washed with Equilibration buffer and protein is isocratically eluted with same buffer. Results: Recovery of protein : 1.09 g.

Percentage of recovery : 52% Monomer Purity : 99.9% (RP-LC)

Fig-6(a): RP-LC chromatogram of G-CSF( before formulation) Fig-6(b): SDS-PAGE of G-CSF at different stages.

The protein (eluted from size exclusion chromatography) is buffer exchanged against 1OmM sodium acetate till conductivity reaches 0.35 to 0.36 ms/cm by

TFF module using 3.0 K.Da, MWCO polyether sulphone membrane. The sample is sterile filtered through 0.2 micron filter and formulated with 5% sorbitol and 0.004%

Tween -80 for injectable use.

Example-2

The washed IB pellet (obtained as in example- 1) is dissolved in urea (125 g) and DTT (6g) is added. The concentration of protein is adjusted to 7 to 8 mg/mL. The pH is adjusted to 12.0 tol2.5 by adding NaOH (8mL of IN). The reaction mass is maintained at 20 to 25° C for 30 min. The undissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate -20(10.5L). The pH of the diluted reaction mass is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12mL). The protein is allowed to undergo single step refolding by keeping the solution at 2 to 8° C for 18 to 20 hrs. The protein is refolded into native form. Results: Efficiency of refolding: 80. %.

Fig-7 : RP- LC chromatogram of G-CSF at ending stage of refolding reaction.

The pH of the refolded protein is adjusted to 4.5 with acetic acid /acetate .The Ion exchange chromatography is performed as in example- 1.

Results:

Recovery of protein : 1.05 g.

Percentage of recovery : 50%

Monomer Purity : 98% (RP-LC)

The pH of protein (eluted from IEC) is adjusted to 3.0 to 3.5 with 0.5M acetic acid (1.4L). The protein is buffer exchanged against ImM acetic acid by TFF module using 3.0 K.Da, MWCO polyether sulphone membrane. After completion of buffer exchange, the sample is concentrated to 2.0 mg/mL for carrying size exclusion chromatography.

XK 50/1000 column is packed with supharose-12 preparative grade matrix for size exclusion chromatography. Bed height is maintained as 75% of column length and the column temperature is maintained at 20° C .The column flow rate is maintained at 25 to 30 mL/min and is equilibrated with 5 bed volumes of G-CSF formulation buffer

(1OmM sodium acetate, 5% sorbitol and 0.004% Tween-80) at pH: 4.0(7.5L). The concentrated sample is loaded on the column with same flow rate. Sample volume is used as 8% of the bed volume. The column is washed with same buffer and protein is isocratically eluted with same buffer. The eluted protein is sterile filtered through 0.2- micron filter for injectable use.

Results:

Recovery of protein : 725 mg.

Percentage of recovery : 34% Monomer Purity : 99.9% (RP-LC)

Fig-8(a): RP-LC chromatogram of G-CSF (formulation)

Fig-8(b): Non-reduced PAGE of G-CSF (formulation)

ExampIe-3 The washed IB pellet (obtained as in example- 1) is dissolved in urea (125 g).

The concentration of protein is adjusted to 7 to 8 mg/mL. The pH is adjusted to 12.0 to 12.5 by adding NaOH (8mL of IN solution). The reaction is maintained at 20-25° C for 30 min. The un-dissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate -20(10.5L). The pH of the diluted reaction mass is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12 mL). The protein is allowed to undergo single step refolding by keeping the solution at 2 to 8⁰C for 18 to 20 hrs. The protein is refolded into native form. Results; Efficiency of refolding : 38%. The pH of the refolded protein is adjusted to 4.5 with acetic acid /acetate.The Ion exchange chromatography is performed as in example- 1. Results:

Recovery of protein : 588 mg.

Percentage of recovery : 28%

Monomer Purity : 98% (RP-LC) The pH of protein (eluted from IEC) is adjusted to 3.0 to 3.5 with 50OmM acetic acid (0.8L). The protein is buffer exchanged against ImM acetic acid by TFF module using 3.0 K.Da, MWCO polyether sulphone membrane. After completion of buffer exchange, the sample is concentrated to 2.0 mg/mL for size exclusion chromatography.

XK 50/1000 column is packed with sephadex-G-25 fine grade matrix for size exclusion chromatography. Bed height is maintained as 75% of column length and the column temperature is maintained at 20° C .The column flow rate is maintained at 1.25 to 1.30 cm/min and is equilibrated with 5 bed volumes of G-CSF formulation buffer (1OmM sodium acetate, 5% sorbitol and 0.004% Tween-80) at pH: 4.0 (7.5L) .The concentrated sample is loaded on the column with same flow rate. Sample volume is used as 8% of the bed volume. Column is washed with same buffer and protein is isocratically eluted with same buffer. The eluted protein is sterile filtered through 0.2micron filter for injectable use.

Results: Recovery of protein : 420 mg:

Percentage of recovery : 20%

Monomer Purity : 99.9% (RP-LC)

Example -4 The washed inclusion body pellet (obtained as in example- 1) is dissolved in urea

(125g) and thiol agent (6g) is added. The protein concentration is maintained as 7 to 8 mg/mL. The pH is adjusted to 12.0 to 12.5 by adding NaOH (8mL of IN solution). The reaction mass is maintained at 20 to 25° C for 30 min. The undissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate -20(10.5L). The pH of diluted reaction mass is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12 mL). The protein is allowed to undergo single step refolding by keeping the solution at 16 to 19° C for 16 to 18 hrs. The protein is found to be completely refolded into native form during this period. Results:

Efficiency of refolding: 100%. Fig-9 (a) : RP-LC chromatogram of G-CSF at initial stage of refolding reaction. Fig-9 (b) : RP-LC chromatogram of G-CSF at middle stage of refolding reaction. Fig-9 (c) : RP-LC chromatogram of G-CSF at ending stage of refolding reaction.

The pH of the refolded protein is adjusted to 4.5 with acetic acid /acetate The Ion exchange Chromatography purification is performed as in example- 1 ,

Results;

Recovery of protein : 1.47g.

Percentage of recovery : 70%

Monomer Purity : 99% (RP-LC) The pH of protein (eluted from IEC) is adjusted to 3.0 to 3.5 with 50OmM acetic acid (2L). The protein is buffer exchanged against ImM acetic acid by TFF module using

3.0 K.Da, MWCO polyether sulphone membrane. After completion of buffer exchange, the sample is concentrated to 2.0 mg/mL for carrying size exclusion chromatography.

The size exclusion chromatography purification is performed as in example- 1. Results:

Recovery of protein : 1.07 g.

Percentage of recovery : 52%

Monomer Purity : 99.5% (RP-LC) Fig-lO(a): RP-LC chromatogram of G-CSF (before formulation) Fig-lO(b): Non-reduced PAGE of G-CSF (before formulation).

The protein (eluted from SEC) is buffer exchanged against 1OmM sodium acetate till conductivity reaches 0.35 to 0.36 ms/cm by tangential flow filtration module using 3.0 K.Da cutoff regenerated cellulose or polyether sulphone membrane. The sample is sterile filtered through 0.2 micron filter and formulated with 5% sorbitol and 0.004% Tween -80 for injectable use.

Example-5

The washed inclusion body pellet (obtained as in example- 1) is dissolved in urea (125 g) and DTT (6 g) is added. The protein concentration is adjusted to 7 to 8 mg/mL. The pH is adjusted to 12.0 to 12.5 by adding lN.NaOH (8 mL). The reaction mass is maintained at 20 to 25° C for 30 min. The undissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate - 20(10.5L). The pH of the diluted sample is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12 mL). The protein is allowed to undergo single step refolding by keeping the solution at 16 to 19⁰C for 16 to 18 hrs. The protein is refolded into native form. Results:

Efficiency of refolding: 80%.

The pH of refolded protein is adjusted to 4.5 with acetic acid /acetate.The Ion exchange chromatography is performed as in example- 1. Results:

Recovery of protein : 1.05 g.

Percentage of recovery : 50%

Monomer Purity : 98% (RP-LC) The pH of the protein eluted from IEC is adjusted to 3.0 to 3.5 with 50OmM acetic acid. The protein is buffer exchanged against ImM acetic acid by TFF module using 3.0

K.Da,MWCO polyether sulphone membranes. After completion of buffer exchange, the sample is concentrated to 2.0mg/mL for carrying size exclusion chromatography .The size exclusion chromatography is performed as in example-2. Results:

Recovery of protein : 720 mg. Percentage of recovery : 34%

Monomer Purity : 99.9% (RP-LC)

ExampIe-6 The washed inclusion body pellet (obtained as in example- 1) is dissolved in urea

(125 g). The concentration of Protein is adjusted to 7 to 8 mg/mL. The pH is adjusted to

12.0 to 12.5 by adding lN.NaOH(8mL). The reaction mass is maintained at 20 to 25⁰C for 30 min. The undissolved particles are removed by centrifugation and the clear solution is diluted to 40 fold with 0.1% polysorbate -20(10.5 L). The pH of the diluted sample is adjusted to 8.2 to 8.3 with 50OmM acetic acid (12 mL). The protein is allowed to undergo single step refolding by keeping the solution at 16 to 19° C for 16 to 18 hrs.

The protein is refolded into native form

Results:

Efficiency of refolding: 38%. The pH of refolded protein is adjusted to 4.5 with acetic acid /acetate.The Ion exchange chromatography is performed as in example- 1.

Results:

Recovery of protein : 630 mg.

Percentage of recovery : 30% Monomer Purity : 98% (RP-LC)

The pH of protein eluted from Ion exchange chromatography is adjusted to 3.0 to

3.5 with 50OmM acetic acid. The protein is buffer exchanged against ImM acetic acid by

TFF module using 3.0 K.Da, MWCO polyether sulphone membrane. After completion of buffer exchange, the sample is concentrated to 2.0 mg/mL for carrying size exclusion chromatography. The size exclusion chromatography is performed as in example-3.

Results:

Recovery of protein : 420 mg.

Percentage of recovery : 20%

Monomer Purity : 99.5% (RP-LC)

Claims

We claim:

1. A novel method for purification of recombinant human granulocyte colony stimulating factor (rhG-CSF) to pharmaceutically acceptable grade, comprising of: a) Isolation and washing of G-CSF protein inclusion bodies from bacterial cells. b) Solubilizing the said washed inclusion body pellet. c) Complete refolding of G-CSF into native form by a one step method. d) Subjecting to two-step chromatography, where the first step is cation exchange followed by size exclusion. e) Buffer exchanging by diafϊltration to remove salts for formulation of lyophilization. f) Recovering the pharmaceutical grade human G-CSF.

2. A method as in claim 1, wherein the inclusion bodies are isolated by lysing the cells through high-pressure homogenization or sonication followed by centrifugation.

3. A method as in claim 2, the sonication program is 3.5 min with 5.0 sec ON/OFF mode and amplitude is 40% for complete cell lysis.

4. A method as in claim 1, wherein the inclusion body pellet is washed with nonionic detergents like TRITON-X 100 and D.O.C.

5. A method as in claim 4, wherein the concentration of non-ionic detergents are 0.25% only.

6. A method as in claim 4, wherein the inclusion body purity is more than 98% and recovery is about 90%.

7. A method as in claim 1, wherein solubilization of G-CSF inclusion body pellet is effected by urea and cysteine blocking agent at high alkaline pH.

8. A method as in claim 7, wherein concentration of G-CSF in solubilization step is 2 to 8 mg/mL.

9. A method as in claim 7, wherein concentration of urea and cysteine-blocking agent is 2 to 8M and 10 to 60OmM.

10. A method as in claim 1, wherein refolding of the solubilized G-CSF is effected by keeping the diluted sample at pH 8.2 to 8.3 for a period of 16 to 18 hrs at 15 to 19 0C or for a period of 18 to 20 hrs at 2 to 8° C.

11. A method as in claim 10, wherein the refolding efficiency is about 99%.

12. A method as in claim 1, wherein purification of refolded protein is effected by two-step chromatography and diafiltration.

13. A method as in claim 12, wherein the first step chromatography is Ion Exchange chromatography and SP.Sepharose is used as matrix. /

14. A method as in claim 13, wherein the column used for IEC is BPG 140/500, and the bed volume was 2.0L.

15. A method as in claim 14, wherein the optimum flow rate in the column is 500 mL/min and the protein is eluted by Tris buffer.

16. A method as in claim 15, wherein the purity of the protein is about 99 % and the recovery is about 70%.

17. A method as in claim 1, wherein the IEC pooled protein is acedified to pH 3.0 to

3.5 with acetic acid / HCl.

18. A method as in claim 17, wherein the acedified protein is Buffer exchanged with acetic acid and concentrated by Tangential flow filtration system (pall life science) using 3.0 K.D cassette.

19. A method as in claim 18, wherein the concentration of the protein sample was 1.0 to 3.5mg/mL.

20. A method as in claim 1, wherein the second step chromatography is size

Exclusion chromatography and superdex-75, sephadex-G25 and supharose-12 are used as matrix.

21. A method as claimed in claim 20, where in the column used for SEC is XK

50/1000, and the bed volume is about 1.5 L .

22. A method as in claim 21, wherein the optimum flow rate in the column is 4.0 mL/min and the protein is eluted by 0.2m sodium acetate buffers.

23. A method as in claim 22, wherein the purity of the protein is about 99.9 % and the recovery is about 52%.

24. A method as in claim 1, wherein the SEC pooled protein is Buffer exchanged with 1OmM sodium acetate and concentrated by Tangential flow filtration method (pall /milliporore) using 3.0 K.D cassette.

25. A method as in claim 24, wherein the concentration of the protein sample was 0.3 to 0.5 mg/mL.

26. A method as in claim 1, wherein the concentrated protein solution is sterile filtered through 0.2 micron and formulated with 5% sorbitol and 0.004% Tween - 80.

27. A method as in claim 1 , wherein the second step chromatography is size Exclusion chromatography, and sephadex-G25 is used as matrix.

28. A method as in claim 27, wherein the column used for SEC is XK 50/1000, and the bed height is about 75 % of column length.

29. A method as in claim 28, wherein the optimum flow rate in the column is 1.25- tol.30 cm/min.

30. A method as in claim 29, wherein the column equilibration, washing and protein elution is done by G-CSF formulation buffer.

31. A method as in claim 1, wherein the second step of chromatography is size Exclusion chromatography, and supharose-12 is used as matrix.

32. A method as in claim 31, wherein the column used for SEC is XK 50/1000, and the bed height is about 75 % of column length.

33. A method as claimed in claim 32, where in the optimum flow rate in the column is 25 to 30 mL/min.

34. A method as in claim 33, wherein the column equlibration, washing and protein elution is done by G-CSF formulation buffer.

35. A method as in claim 34, wherein the formulated protein is sterile filtered for directly inj actable usage.

36. A novel method for purification of recombinant human G-CSF to pharmaceutically acceptable grade essentially as described in examples 1-5.