WO2008094012A1 - Novel polypeptide having anti-tumor activity - Google Patents

Novel polypeptide having anti-tumor activity Download PDF

Info

Publication number
WO2008094012A1
WO2008094012A1 PCT/KR2008/000621 KR2008000621W WO2008094012A1 WO 2008094012 A1 WO2008094012 A1 WO 2008094012A1 KR 2008000621 W KR2008000621 W KR 2008000621W WO 2008094012 A1 WO2008094012 A1 WO 2008094012A1
Authority
WO
WIPO (PCT)
Prior art keywords
aimpl
seq
polypeptide
amino acid
acid sequence
Prior art date
Application number
PCT/KR2008/000621
Other languages
French (fr)
Inventor
Sunghoon Kim
Jung Min Han
Sang Gyu Park
Yoen Sook Lee
Original Assignee
Imagene Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Imagene Co., Ltd. filed Critical Imagene Co., Ltd.
Priority to JP2009548159A priority Critical patent/JP2010526527A/en
Priority to AU2008211884A priority patent/AU2008211884A1/en
Priority to MX2009008270A priority patent/MX2009008270A/en
Priority to EP08712277A priority patent/EP2121739A4/en
Priority to KR1020097016040A priority patent/KR20090111320A/en
Priority to CA002676640A priority patent/CA2676640A1/en
Publication of WO2008094012A1 publication Critical patent/WO2008094012A1/en
Priority to US12/854,843 priority patent/US20110124582A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747Apoptosis related proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity

Definitions

  • the present invention relates to a novel polypeptide having anti-tumor activity, and more particularly, to a novel polypeptide having anti-tumor activity through inducing apoptosis of endothelial cell.
  • Apoptosis which is first described by Kerr et al . in 1972, is a physiological phenomenon that is necessary for maintaining homeostasis and developing normal organs in multicellular organisms. It is an intracellular mechanism which happens selectively in cells responding to a certain stimulus. Particularly, cells can induce programmed cell death by various stress such as starvation, virus, oxygen radicals or chromosome damaging agents.
  • the apoptosis can be found by observing chromosomal DNA fragmentation, activation of caspase family and specific morphological changes such as chromatin condensation, blebbing, cell shrinkage and apoptotic body (John D R et al, 2000, J. Structur. Biol.
  • apoptosis not only performs a physiological function for maintaining homeostasis in tissue, but induces various diseases through cell proliferation or cell loss caused by abnormally inhibiting or activating of apoptosis. Also, apoptosis plays an important role in maintaining lymphocyte homeostasis, which is one of mechanisms for regulation of immune response, and killing of target cells by lymphocytes.
  • AIMPl ARS-interacting multi-functional protein 1
  • the AIMPl is a protein consisting of 312 amino acids, which binds to a multi-tRNA synthetase complex to increase the catalytic activity of the multi-tRNA synthetase complex.
  • the AIMPl is highly expressed in microneuron in the resions of autoimmune diseases including encephalomyelitis, neuritis and uveitis in vitro.
  • a peptide consisting of numerous amino acids has shortcomings in that it is metabolized upon in vivo administration, leading to the cleavage of the peptide bond, and tends to decompose in a process of formulation.
  • the pharmacological activity of peptides needs to be kept, it is an important in the development of drugs to find the minimum length peptide (s) with activity comparable to that of a long- chain peptide.
  • a polypeptide including a part of amino acid sequences in the middle region of known AIMPl protein has anti-tumor activity by inducing apoptosis of endothelial cell, thereby completing the present invention.
  • an object of the present invention to provide an isolated polypeptide comprising the amino acid sequence of SEQ ID NO : 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9, or an isolated polynucleotide encoding the polypeptide and use for anti-tumor activity thereof .
  • the present invention provides an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9, and an isolated polynucleotide encoding the polypeptide.
  • the present invention provides a pharmaceutical composition comprising the polypeptide and the polynucleotide encoding the polypeptide.
  • the present invention provides methods for inducing apoptosis of endothelial cell and for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
  • the present invention provides use of the polypeptide or the polynucleotide encoding the polypeptide, for preparation a pharmaceutical composition for treating cancer.
  • the term "effective amount” refers to an amount effective in inducing apoptosis of endothelial cell or showing anti-tumor activity in vivo or in vitro.
  • the term "subject" means mammals, and particularly animals including human beings, or the cells or tissues of animals.
  • the subject may be patients in need of treatment.
  • the cells may preferably be endothelial cell.
  • the polypeptide of the present invention includes 101-170 amino acid sequence of the AIMPl protein.
  • AIMPl ARS-interacting multi-functional protein 1
  • p43 protein was previously known as the p43 protein and renamed by the present inventors (Sang Gyu Park, et al . , Trends in Biochemical Sciences, 30:569-574, 2005).
  • the AIMPl is a protein consisting of 312 amino acids, which binds to a multi-tRNA synthetase complex to increase the catalytic activity of the multi-tRNA synthetase complex. It is known that the AIMPl is secreted from various types of cells, including prostate cancer cells, immune cells and transgenic cells, and the secreted AIMPl works on diverse target cells such as monocytes/macrophages, endothelial cells and fibroblast cells. The following three SNPs of the AIMPl are known (see NCBI SNP database) : substitution of 79th alanine (Ala) to proline (Pro) (SNP accession no.
  • the present inventors constructed a series of deletion fragments of the AIMPl so as to determine a functional domain of AIMPl related to endothelial cell death(see Fig.l and Fig.2), and then examined activity of fragments in inducing apoptosis of endothelial cell death (see ⁇ example 2>) . Consequently, it could be supposed that a region of amino acid 101-192 of the AIMPl would be a domain having the activity of inducing apoptosis of endothelial cell(see Fig.4 and Fig.5).
  • the region of the AIMPl- (101-192) was cleaved to prepare small fragments (see ⁇ exa ⁇ nple 3-l>) and the activities of these fragments in inducing apoptosis of endothelial cell were also examined (see from Fig.8 to Fig.10) .
  • AIMPl- (101-170) mutant can induce apoptosis of endothelial cell
  • the present inventors constructed AIMPl- (101-170) C161S peptide by inducing Cl ⁇ lS point mutation in the AIMPl- (101-170) peptide (see ⁇ example 4-l>) .
  • the present inventors found that the AIMPl- (101-170) C161S had an activity of inducing endothelial cell death in the absence of DTT (see Fig.11) .
  • the present inventors examined whether AIMPl- (101-170) peptide had anti-tumor activity. As a result, the present inventors found that the AIMPl-(IOl- 170) had more effective anti-tumor activity than the AIMPl full length protein (see Fig.14 ) without side effect of body weight loss (see Fig.12 and Fig.13) .
  • the present invention provides a polypeptide comprising the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO : 9.
  • the inventive polypeptide may consist of, but not limited to, the amino acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 8 and SEQ ID NO: 10 to SEQ ID NO: 14.
  • the amino acid sequence select from SEQ ID NO: 11 to SEQ ID NO: 14 is a known SNP of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 10.
  • the inventive polypeptide may consist of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 10.
  • the inventive polypeptide may include functional equivalents of the polypeptide having the amino acid sequence of SEQ ID NO: 9, and preferably functional equivalents of the polypeptide having the amino acid sequence of SEQ ID NO: 9, as well as salts thereof.
  • the term "functional equivalents" refers to polypeptide comprising the amino acid sequence having at least 80% amino acid sequence homology (i .e ., identity), preferably at least 90%, and more preferably at least 95% for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% to the amino acid sequence of SEQ ID NO: 9 that exhibit substantially identical physiological activity to the polypeptide of SEQ ID NO: 9.
  • sequence identity or homology is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with amino acid sequence of SEQ ID NO: 9, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions (as described above) as part of the sequence identity. None of N- terminal, C-terminal, or internal extensions, deletions, or insertions into the amino acid sequence of SEQ ID NO: 9 shall be construed as affecting sequence identity or homology. Thus, sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides.
  • two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences or along a predetermined portion of one or both sequences) .
  • the programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; see Dayhoff et al . , in Atlas of Protein Sequence and Structure, vol. 5, supp. 3 (1978)) can be used in conjunction with the computer program.
  • PAM 250 a standard scoring matrix; see Dayhoff et al . , in Atlas of Protein Sequence and Structure, vol. 5, supp. 3 (1978)
  • the percent identity can be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequences in order to align the two sequences.
  • the scope of the functional equivalents as used herein also encompasses derivatives obtained by modifying a part of the chemical structure of the inventive polypeptide while maintaining the basic framework and the activity inducing endothelial cell death or inhibiting cancer cell proliferation. For example, this includes structural modifications for altering the stability, storage, volatility or solubility of the polypeptide.
  • the polypeptide according to the present invention can be prepared by a genetic engineering method using the expression of recombinant nucleic acid encoding the same.
  • a DNA molecule encoding the AIMPl or its fragment is first constructed according to any conventional method.
  • the DNA molecule may synthesized by performing PCR using suitable primers.
  • the DNA molecule may also be synthesized by a standard method known in the art, for example using an automatic DNA synthesizer (commercially available from Biosearch or Applied Biosystems) .
  • the constructed DNA molecule is inserted into a vector comprising at least one expression control sequence (ex: promoter, enhancer) that is operatively linked to the DNA sequence so as to control the expression of the DNA molecule, and host cells are transformed with the resulting recombinant expression vector.
  • the transformed cells are cultured in a medium and condition suitable to express the DNA sequence, and a substantially pure polypeptide encoded by the DNA sequence is collected from the culture medium.
  • the collection of the pure polypeptide may be performed using a method known in the art, for example, chromatography.
  • the term "substantially pure polypeptide” means the inventive polypeptide that does not substantially contain any other proteins derived from host cells.
  • the reader may refer to the following literatures: Maniatis et al . , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory 1982; Sambrook et al . , supra; Gene Expression Technology, Method in Enzymology, Genetics and Molecular Biology, Method in Enzymology, Guthrie & Fink (eds.), Academic Press, San Diego, Calif. 1991; and Hitzeman et al . , J. Biol. Chem. , 255, 12073-12080 1990.
  • the inventive polypeptide can be chemically synthesized according to any technique known in the art (Creighton, Proteins: Structures and Molecular Principles, W. H. Freeman and Co., NY, 1983). Namely, the inventive polypeptide can be prepared by conventional step-wise liquid or solid phase synthesis, fragment condensation, F-MOC or T-BOC chemistry (Chemical Approaches to the Synthesis of Peptides and Proteins, Williams et al . , Eds., CRC Press, Boca Raton Florida, 1997; A Practical Approach, Atherton & Sheppard, Eds., IRL Press, Oxford, England, 1989) .
  • inventive polypeptide can be synthesized by performing the condensation reaction between protected amino acids by the conventional solid-phase method, beginning with the C-terminal and progressing sequentially with the first amino acid, the second amino acid, the third amino acid, and the like according to the identified sequence. After the condensation reaction, the protecting groups and the carrier connected with the C-terminal amino acid may be removed by a known method such as acid decomposition or aminolysis .
  • the above-described peptide synthesis method is described in detail in the literature (Gross and Meienhofer ' s, The peptides, vol. 2, Academic Press, 1980) .
  • Examples of a solid-phase carrier which can be used in the synthesis of the polypeptide according to the present invention, include polystyrene resins of substituted benzyl type, polystyrene resins of hydroxymethylphenylacetic amide form, substituted benzhydrylpolystyrene resins and polyacrylamide resins, having a functional group capable of bonding to peptides.
  • the condensation of amino acids can be performed using conventional methods, for example dicyclohexylcarbodimide (DDC) method, acid anhydride method and activated ester method.
  • DDC dicyclohexylcarbodimide
  • Protecting groups used in the synthesis of the inventive peptide are those commonly used in peptide syntheses, including those readily removable by conventional methods such as acid decomposition, reduction or aminolysis. Specific examples of such amino protecting groups include formyl; trifluoroacetyl ; benzyloxycarbonyl ; substituted benzyloxycarbonyl such as
  • the carboxyl groups of amino acids can be protected through conversion into ester groups.
  • the ester groups include benzyl esters, substituted benzyl esters such as methoxybenzyl ester; alkyl esters such as cyclohexyl ester, cycloheptyl ester or t-butyl ester.
  • the guanidino moiety may be protected by nitro; or arylsulfonyl such as tosyl, methoxybenzensulfonyl or mesitylenesulfonyl, even though it does not need a protecting group.
  • the protecting groups of imidazole include tosy, benzyl and dinitrophenyl .
  • the indole group of tryptophan may be protected by formyl or may not be protected. Deprotection and separation of protecting groups from carriers can be carried out using anhydrous hydrofluoride in the presence of various scavengers .
  • scavengers examples include those commonly used in peptide syntheses, such as anisole, (ortho-, meta- or para-) cresol, dimethylsulfide, thiocresol, ethanendiol and mercaptopyridine .
  • the recombinant peptide prepared by the genetic engineering method or the chemically synthesizing can be isolated and purified according to methods known in the art, including extraction, recrystallization, various chromatographic techniques (e .g. , gel filtration, ion exchange, precipitation, adsorption, reverse phase, etc.), electrophoresis and counter current distribution.
  • the present invention provides an isolated polynucleotide encoding the isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence.
  • the polynucleotide comprises DNA, cDNA and RNA sequences.
  • the polynucleotide has the base sequence selected from the group consisting of SEQ ID NO: 48 to SEQ ID NO: 58.
  • the polynucleotide of SEQ ID NO: 55 to SEQ ID NO: 58 encodes the known SNP of the polypeptide of SEQ ID NO: 9 or SEQ ID NO: 10.
  • the polynucleotide can be prepared by separating from nature materials or genetic engineering methods known in the art to which the present invention pertains.
  • the present invention provides a vector containing the polynucleotide according to the present invention.
  • the vector may be, but not limited to, a plasmid or viral vector.
  • the inventive polynucleotide can be introduced into a target cell by inserting it into the vector and then introducing the vector into a target cell by any method known in the art, such as infection, transfection and transduction.
  • a gene transfer method using a plasmid expression vector is a method of transferring a plasmid DNA directly to mammalian cells, which is an FDA-approved method applicable to human beings (Nabel, E. G., et al . , Science, 249:1285-1288, 1990).
  • the plasmid DNA has an advantage of being homogeneously purified.
  • Plasmid expression vectors which can be used in the present invention include mammalian expression plasmids known in the pertinent art. For example, they are not limited to, but typically include pRK5 (European Patent No. 307,247), pSV16B (PCT Publication No.
  • the plasmid expression vector containing the polynucleotide according to the present invention may be introduced into target cells by any method known in the art, including, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome- mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun methods, and other known methods for introducing DNA into cells (Wu et al . , J. Bio. Chem. , 267:963-967, 1992; Wu and Wu, J. Bio. Chem. , 263:14621-14624, 1988).
  • virus expression vectors containing the polynucleotide according to the present invention include, but are not limited to, retrovirus, adenovirus, herpes virus, avipox virus and so on.
  • the retroviral vector is so constructed that non-viral proteins can be produced within the infected cells by the viral vector in which virus genes are all removed or modified.
  • the main advantages of the retroviral vector for gene therapy are that it transfers a large amount of genes into replicative cells, precisely integrates the transferred genes into cellular DNA, and does not induce continuous infections after gene transfection (Miller, A. D., Nature, 357:455-460, 1992).
  • the retroviral vector approved by FDA was prepared using PA317 amphotropic retrovirus packaging cells (Miller, A. D.
  • Non-retroviral vectors include adenovirus as described above (Rosenfeld et al . , Cell, 68:143-155, 1992; Jaffe et al . , Nature Genetics, 1:372- 378, 1992; Lemarchand et al . , Proc. Natl. Acad. Sci. USA, 89:6482-6486, 1992).
  • the main advantages of adenovirus are that it transfers a large amount of DNA fragments (36kb genomes) and is capable of infecting non- replicative cells at a very high titer.
  • herpes virus may also be useful for human genetic therapy (Wolfe, J. H., et al., Nature Genetics, 1:379-384, 1992).
  • the lentivirus is a kind of retrovirus and developed to new retroviral vector since the late 1990s.
  • the lentiviral vector is constructed by modifying HIV backbone. It has high transfection efficiency in dividing and non-diving cells since it is not influenced by cell cycle unlike other retroviral vectors. Thus it has been developed as potential vectors for gene transfer in the cell therapy field using hematopoietic and keratinocyte stem cells, since transfection efficiency of the lentiviral vector in slow-dividing cell such as hematopoietic cell is higher than that of other viral vectors.
  • other known suitable viral vectors can be used.
  • the transformation with the vector can be carried out according to any known transformation method in the pertinent art, preferably, microprojectile bombardment, electroporation, CaPO 4 precipitation, CaCl 2 precipitation, PEG-mediated fusion, microinjection and liposome-mediated method, but not limited to.
  • the transformant may be Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis and Staphylococcus, Agrobacterium tumefaciens, but not limited to.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the inventive polypeptide or polynucleotide encoding the same and a pharmaceutically acceptable salt.
  • the inventive pharmaceutical composition can be, but not limited to, the pharmaceutical composition for treating cancer.
  • the inventive pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient .
  • the carrier or excipient can include, but not limited to, dispersing agents, wetting agents, suspension agents, diluents, and fillers.
  • the ratio between the pharmaceutically acceptable carriers and expression vectors included in the inventive pharmaceutical composition is fixed by solubility and chemical properties of the composition or administration ways.
  • the therapeutic or preventive effective amount of the inventive pharmaceutical composition containing the AIMl protein-encoding polynucleotide may be suitably selected depending on the subject to be administered, age, individual variation and disease condition.
  • the term "pharmaceutically acceptable” means what is physiologically acceptable and, when administered to human beings, generally does not cause allergic reactions, such as gastrointestinal disorder and dizziness, or similar reactions thereto.
  • Examples of the pharmaceutically acceptable salt include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids and the like.
  • Examples of the salt with an inorganic acid include alkali metal salts, such as a sodium salt and a potassium salt; an alkaline earth metal salt such as a calcium salt and a magnesium salt; an aluminum salt; and an ammonium salt.
  • Examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, 2 , 6--lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine and N,N' - dibenzylethylenediamine .
  • Examples of the salt with an inorganic acid include salts with hydrochloric acid, boric acid, nitric acid, sulfuric acid and phosphoric acid.
  • Examples of the salt with an organic acid include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid and p- toluenesulfonic acid.
  • Examples of the salt with a basic amino acid include salts with arginine, lysine and ornithine.
  • Examples of the salt with an acidic amino acid include salts with aspartic acid and glutamic acid.
  • inventive pharmaceutical composition may also be formulated, but not limited to, as preparations for oral administration.
  • inventive polypeptide, the polynucleotide coding the same, and the pharmaceutically acceptable salt mixed with the excipients can be formulated in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • These preparations may also comprise diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (e.g., silica, talc, stearic acid and a magnesium or calcium salt thereof, and/or polyethylene glycol) in addition to the active ingredient.
  • diluents e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine
  • lubricants e.g., silica, talc, stearic acid and a magnesium or calcium salt thereof, and/or polyethylene glycol
  • tablets may also comprise binders, such as magnesium aluminum silicate, starch pastes, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone, and, if desired, may further comprise disintegrating agents, such as starches, agar or alginic acid or a sodium salt thereof, absorbents, colorants, flavors and sweeteners.
  • binders such as magnesium aluminum silicate, starch pastes, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone
  • disintegrating agents such as starches, agar or alginic acid or a sodium salt thereof, absorbents, colorants, flavors and sweeteners.
  • the inventive pharmaceutical composition may be administered by various routes according to any method known in the art. Namely, it may be administered by oral or parenteral routes.
  • the parenteral routes include methods for applying to the skin locally, intramuscular, intravenous, intracutaneous, intraarterial, intramarrow, intrathecal, intraperitoneal, intranasal, intravaginal, intrarectal, sublingual and subcutaneous or administering to gastrointestinal tracts, mucosa or respiratory organs systemically.
  • the inventive pharmaceutical composition may be administered by a method of applying the polypeptide directly to the skin or a method comprising formulating the polypeptide in an injectable form, and then, injecting a given amount of the formulation into a subcutaneous layer with a 30 -gauge injection needle or lightly pricking the skin with an injection needle.
  • the inventive polypeptide may be applied directly to the skin.
  • the inventive pharmaceutical composition may also be administered in a form bound to a molecule causing a high-affinity binding to a target cell or tissue (e.g., skin cell or skin tissue) or in a form encapsulated in the molecule.
  • the inventive pharmaceutical composition can be bound to sterol (e.g., cholesterol), a lipid(e.g., a cationic lipid, virosome or liposome), or a target cell-specific binding agent(e.g., a ligand recognized by target cell specific receptor) using the technology known in the art.
  • Suitable coupling agents or crosslinking agents may include, for example, protein A, carbodiimide, and N-succinimidyl-3- (2- pyridyldithio) propionate (SPDP) .
  • the total effective amount of the polypeptide in the inventive pharmaceutical composition can be administered to a subject as a single dose, or can be administered using a fractionated treatment protocol, in which the multiple doses are administered over a more prolonged period of time.
  • the amount of the active ingredient in the composition containing the inventive polypeptide may vary depending on the use of the composition, but the active ingredient may be generally administered at an effective dose of O.l ⁇ g-lg several times daily.
  • the effective dose of the polypeptide may vary depending on many factors, such as the age, body weight, health condition, sex, disease severity, diet and excretion of a subject in need of treatment, as well as administration time and administration route. In view of these factors, any person skilled in the art may determine an effective dose suitable for the above-described specific use of the inventive polypeptide.
  • the inventive composition has no special limitations on its formulation, administration route and administration mode as long as it shows the effects of the present invention.
  • the inventive polypeptide or polynucleotide encoding the polypeptide can be used in a method for inducing apoptosis of endothelial cell. Therefore, the present invention provides a method for inducing apoptosis of endothelial cell, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
  • the present invention provides a method for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
  • the cancers include, but are not limited to, breast cancer, rectal cancer, lung cancer, small -cell lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine carcinoma, ovarian cancer, colorectal cancer, cancer near the anus, colon cancer, oviduct carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulva carcinoma, Hodgkin's disease, esophagus cancer, small intestinal tumor, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft-tissue sarcoma, uterine cancer, penis cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urethra cancer, kidney cell carcinoma, kidney pelvis carcinoma, CNS tumor, primary CNS lymphoma, spinal tumor, brain stem glioma, and pituitary adenoma, and a combination of one or more thereof
  • the present invention provides the polypeptide or the polynucleotide encoding the polypeptide for use as a medicament .
  • the present invention provides use of the polypeptide or the polynucleotide encoding the polypeptide for preparation a pharmaceutical composition for treating cancer.
  • the polypeptide or the polynucleotide encoding the polypeptide has the activity inhibiting cancer cell proliferation by inducing apoptosis of endothelial cell.
  • the polypeptide or the polynucleotide encoding the polypeptide can be effectively used in inducing apoptosis of endothelial cell, or preventing or treating cancer.
  • FIG.l is a schematic drawing of the AIMPl fragments of the present invention.
  • FIG.2 shows the results of SDS-PAGE analysis for the AIMPl fragments of the present invention.
  • FIG.3 is a picture showing the activity of inducing cell death of the AIMPl fragments of the present invention.
  • FIG.4 is a graph showing the activity of inducing cell death of the AIMPl fragments of the present invention.
  • FIG.5 is a graph showing the effect of the AIMPl fragments of the present invention for the activity of caspase-3.
  • FIG.6 is a schematic drawing of the AIMPl- (101-192) fragments of the present invention.
  • FIG.7 shows the result of electrophoresis for the AIMPl- (101-192) fragments of the present invention.
  • FIG.8 is a picture showing the activity of inducing of cell death of the AIMPl- (101-192) fragments of the present invention.
  • FIG.9 is a graph showing the measurement result for cell viability by MTT assay after the treatment of the AIMPl- (101-192) fragments of the present invention.
  • FIG.10 is a graph showing the effect on the activity of caspase-3 of the AIMPl- (101-192) fragments of the present invention.
  • FIG.11 is a graph showing analysis results for activity of endothelial cell apoptosis of the AIMPl- (101- 170)C161S mutant polypeptide of the present invention.
  • FIG.12 is a graph showing analysis results for tumor cell anti-proliferation activity of the AIMPl- (101- 170) polypeptide of the present invention.
  • FIG.13 is a graph showing analysis results for body weight loss after the treatment of the AIMPl- (101-170) polypeptide of the present invention.
  • FIG.14 is a graph showing analysis results for tumor cell anti-proliferation activity of the AIMPl- (101- 170) polypeptide of the present invention in comparison with AIMPl full length protein.
  • FIG.15 is a graph showing analysis results for body weight loss after the treatment of the AIMPl- (101-170) polypeptide of the present invention in comparison with AIMPl full length protein.
  • An AIMPl consisting of 312 amino acids was constructed according to the method of Park et al.(Park S. G. et al . , J. Biol. Chem. , 277 :45243-45248 , 2002) .
  • AIMPl- (1-192) SEQ ID NO: 2
  • AIMPI- (6- 192) SEQ ID NO: 3
  • AIMPl- (30-192) SEQ ID NO: 4
  • AIMPl- (47-192) SEQ ID NO: 5
  • AIMPl- (54-192) SEQ ID NO: 6
  • AIMPl- (101-192) SEQ ID NO: 7
  • AIMPl- (114-192 ) was constructed.
  • Each of the fragments was synthesized by PCR using the cDNA of AIMPl(SEQ ID NO: 1) as a template with specific primer sets (see Table 1).
  • the PCR reaction conditions were as follows: pre-denaturation of template DNA by heating at 95"C for 2min; and then 30 cycles at 95 ° C for 30 sec, 56 ° C for 30 sec and 72 ° C for lmin; followed by final extension at 72 ° C for 5min.
  • Each of the PCR products was digested with EcdRl and Xhol and ligated into a pGEX4T3 vector(Amersham Biosciences) digested with the same restriction enzymes.
  • E.coli BL2KDE3 was transformed with the vector and cultured to induce expression of the polypeptides.
  • Each of the polypeptides was expressed as a GST-tag fusion protein and purified on GSH agarose gel. To remove lipopolysaccharide, protein solution was dialyzed through pyrogen-free buffer(1OmM potassium phosphate buffer, pH 6.0, 10OmM NaCl).
  • AIMPI-C6-192XSEQ ID NO: 3 AIMP1-(3O-192)(SEQ ID NO: 4), AIMPH47- 192XSEQ ID NO: 5), AIMPl-(54-192)(SEQ ID NO: 6), AIMPH101-192)(SEQ ID NO:
  • BAECs Bovine aorta endothelial cells
  • enhanced green fluorescent protein(EGFP) were transfected into BAECs, and expressed for 24h.
  • the transfected cells were treated with the fragments of the AIMPl(50nM) for 24h, and then cell death was determined by counting apoptotic cells using fluorescence microscopy. The percentage of apoptotic cells was determined by dividing the number of green cells with apoptotic morphology by the total number of green cells(see FIG.3 and 4).
  • AIMPl-C1-312 AIMPl-C1-192
  • AIMP1-C6-192 AIMP1-C30-192
  • AIMP1-C47-192) AIMPl- (54-192)
  • AIMPl-C101-192) of the deletion fragments of the AIMPl constructed in the ⁇ Example 1> could induce apoptosis of endothelial cell at high levels, but AIMPl-C114-192), AIMPl-(l-46), AIMPl-(l-53), AIMP1-C30-192) and AIMPl-C193-312) could not induce apoptosis.
  • AIMPl especially AIMPl-(IOl-192)
  • AIMPl-(IOl-192) might be a cell death-indueing domain on endothelial cells.
  • BAECs(2x 10 6 ) were harvest and lysed with 300 ⁇ . of cell lysis buffer(20mM HEPES, pH 7.5, ImM dithiothreitol(DTT),
  • FIG.5 was similar to that shown in FIG.3 and FIG.4. From these results, it was believed that the middle region of AIMPl, especially AIMPl-C101-192) might be a cell death-indueing domain on endothelial cell.
  • the present inventors constructed fragments from the AIMPl-C101-192) by serially deleting C-terminal part of the
  • the purified proteins were identified by SDS-PAGE and the results were shown in FIG.7.
  • AIMPl- (101-192) SEQ ID NO: I
  • AIMPl- (101-180) SEQ ID NO: 8
  • AIMPl- (101-170) SEQ ID NO: 9
  • AIMPl- (101-160) and AIMPl- (101-146) fragments were constructed.
  • each of 5OnM of AIMPl fragments constructed in the ⁇ Example 3-l>, AIMPl protein and AIMPl- (101-192) constructed in the ⁇ Example 3-l> was treated on the BAECs for 24hr, respectively. Then MTT solution (5mg/m£) was added as much as 1/10 of the volume of cell culture solution and was reacted for lhr. Then, after the culture solution was entirely discarded, DMSO (200 ⁇ Jl) was added, absorbance was measured at 570 nm, and the results were shown in FIG.9.
  • AIMPl protein, AIMPl- (101-192) , AIMPl- (101-180) and AIMPl- (101-170) could induce apoptosis of endothelial cell, but AIMPl- (101-160) and AIMPl- (101-146) could not induce apoptosis.
  • the middle region of AIMPl, especially AIMPl- (101-170) might be a cell death-inducing domain on endothelial cell.
  • the present inventors measured the effects of the fragments of AIMPl- (101-192) on caspase-3 activity by the same method as in the ⁇ Example 2-2>. Then the results were shown in FIG.10.
  • AIMPl- (1-312) SEQ. ID NO: 1
  • AIMPl- (101-192) SEQ . ID NO: 7
  • AIMPl- (101-180) SEQ. ID NO: 8
  • AIMPl-(IOl- 170) SEQ. ID NO: 9
  • the middle region of AIMPl especially AIMPl-(IOl- 170) would be a cell death-inducing domain on endothelial cell. Consequently, it was found that the AIMPl- (101- 170) (SEQ. ID NO: 9) domain would be useful and applicable for anti-angiogenic and anti-tumor therapy.
  • AIMPl- (101-170) mutant C161S point mutation in AIMPl- (101-170) polypeptide, which showed cell death inducing activity in the ⁇ Example 3>, was generated by PCR.
  • the AIMPl- (101-170) mutant was synthesized by PCR using the cDNA of AIMPl as a template with the following primer set.
  • reverse primer 5'-
  • PCR reaction conditions were as follows: pre- denaturation of template DNA by heating at 92 ° C for 2min; and then 30 cycles at 92 "C for 30sec, 56 ° C for 30sec and 72 ° C for 20sec; followed by final extension at 72 ° C for
  • the present inventor found that the AIMPl full length protein(SEQ. ID NO: 1) or AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) lost endothelial cell death inducing activity in the absence of powerful reducing agent, DTT (Data not shown) .
  • the AIMPl full length protein (10OnM) and AIMPl- (101-170) polypeptide (10 , 10OnM) constructed in the ⁇ Example 1> were purified in the presence of DTT, but the AIMPl- (101-170) C161S (10, 10OnM) constructed in the ⁇ Example 4-l>, in the absence of DTT. Then the purified products were added to BAECs, and the BAECs were cultured for 24hr. Then MTT assay was performed by the same method as in the ⁇ Example 3>, cell viability was measured and the results were shown in FIG.11. As shown in FIG.11, it was found that the AIMPl- (101-170) C161S (SEQ.
  • AIMPl- (101-170) polypeptide SEQ. ID NO: 9
  • the present inventors used a xenograft system (BALB/c-nu/nu mouse-MKN-45) .
  • 5-week-old male BALB/c-nu/nu nude mice human tumor xenograft experiments
  • the mice were housed in a pathogen-free barrier facility with ambient light controlled automatically to produce 12h light and dark cycles.
  • the MKN-45 (human gastric adenocarcinoma) lines were obtained from the Cell Bank Facility, Korea Research Institute of Biotechnology (KRIBB) .
  • the inventors injected human MKN-45 (gastric cancer) cells adjusted to 2 X 10 5 cells/m ⁇ , subcutaneously into the right scapular region of each mouse in a total volume of 50 ⁇ i of PBS and monitored the tumor growth. Tumor size was measured in three dimensions with calipers, and tumor volume was calculated as Length X Width X Depth X 1/2. When the tumor size was about 50mm 3 in volume, the mice were administered each of 10 ⁇ g/dose and 50/ig/dose of the AIMPl- (101-170) polypeptide constructed in the ⁇ Example 3-l> every day for 7 days and relative tumor volume (RTV) was calculated.
  • RTV relative tumor volume
  • the relative tumor volume (RTV) was calculated as Vi/Vo, where Vi is the tumor volume at any given time and Vo is the volume at the start of treatment.
  • tumor growth inhibition data were analyzed by student' s t-test (p ⁇ 0.01), and the results were shown in FIG.12.
  • the tumor volume increased about 34 fold in the control groups on the seventh day, whereas it increased only about 15 fold in the lO ⁇ g/dose AIMPl- (101-170) polypeptide group and about 5 fold in the 50 ⁇ g/dose AIMPl- (101-170) polypeptide group.
  • the present inventors confirmed whether the body weight of the mice was lost. From a result, it was found that treatment of the AIMPl- (101-170) polypeptide did not induce a loss of body weight (see FIG.13).
  • TGI tumor growth inhibition rate
  • the AIMPl- (101-170) polypeptide had anti-tumor activity without inducing a loss of body weight, and would be useful for anti-tumor therapy.
  • the present inventors confirmed whether body weight of the mice was lost, it was found that treating the protein did not induce a loss of body weight in any of the tested animals (see FIG.15).
  • the lO ⁇ g/dose AIMPl- (101-170) polypeptide group showed a 58.75 % reduction of tumor volume compared to the control group and the 10/zg/dose AIMPl full length protein group showed a 24.75 % reduction. Accordingly, it was showed that the AIMPl- (101-170) polypeptide had more effective anti-tumor activity than the AIMPl full length protein.
  • the polypeptide or the polynucleotide encoding the polypeptide has an activity of inducing apoptosis of endothelial cell, thus inhibiting cancer cell proliferation. Accordingly, the polypeptide or the polynucleotide encoding the polypeptide can be effectively used for inducing apoptosis of endothelial cell, or preventing or treating cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a novel polypeptide having ant i- tumor activity through inducing apoptosis of endothelial cell and use thereof. More particularly, the present invention relates to a method for inducing apoptosis of endothelial cell, and for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of (a) an isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9; or (b) an isolated polynucleotide encoding the polypeptide of (a).

Description

Invention Title
NOVEL POLYPEPTIDE HAVING ANTI -TUMOR ACTIVITY
Technical Field The present invention relates to a novel polypeptide having anti-tumor activity, and more particularly, to a novel polypeptide having anti-tumor activity through inducing apoptosis of endothelial cell.
Background Art
Various types of cells which form living organisms can die through various processes. Apoptosis, which is first described by Kerr et al . in 1972, is a physiological phenomenon that is necessary for maintaining homeostasis and developing normal organs in multicellular organisms. It is an intracellular mechanism which happens selectively in cells responding to a certain stimulus. Particularly, cells can induce programmed cell death by various stress such as starvation, virus, oxygen radicals or chromosome damaging agents. The apoptosis can be found by observing chromosomal DNA fragmentation, activation of caspase family and specific morphological changes such as chromatin condensation, blebbing, cell shrinkage and apoptotic body (John D R et al, 2000, J. Structur. Biol. 129, 346-358; Takeuchi M et al , 1999, Apoptosis, 4, 461-468) . It is known that the apoptosis not only performs a physiological function for maintaining homeostasis in tissue, but induces various diseases through cell proliferation or cell loss caused by abnormally inhibiting or activating of apoptosis. Also, apoptosis plays an important role in maintaining lymphocyte homeostasis, which is one of mechanisms for regulation of immune response, and killing of target cells by lymphocytes.
Recently, since apoptosis plays an important role in maintaining tissue homeostasis and proliferation of cell, novel examples show that many diseases including immune diseases and tumor are caused by abnormal regulation of apoptosis. Therefore, understanding of mechanisms for regulation of apoptosis becomes an important issue in order to understand mechanisms of many human disease and develop treatment protocols thereof. And apoptosis becomes a higher value-added part in Medicinal Pharmaceutical industry.
Meanwhile, AIMPl (ARS-interacting multi-functional protein 1) was previously known as the p43 protein and renamed by the present inventors (Kim S. H. et al . , Trends in Biochemical Sciences, 30:569-574, 2005). The AIMPl is a protein consisting of 312 amino acids, which binds to a multi-tRNA synthetase complex to increase the catalytic activity of the multi-tRNA synthetase complex. The AIMPl is highly expressed in microneuron in the resions of autoimmune diseases including encephalomyelitis, neuritis and uveitis in vitro. This phenomenon where the AIMPl is highly expressed in a certain development stage and tissue suggests that the AIMPl is related to inflammatory responses and cell apoptosis (Berger, A. C. et al . , J. Iπununother. 23:519-527, 2000). The present inventors have previously found that the AIMPl and its N-terminal fragment can be used as effective cytokine, anti-tumor agents and angiogenesis inhibitors (Park H. et al . , J". Leukoc. Biol., 71:223-230, 2002; Park S. G. et al . , J. Biol. Chem. , 277:45243-45248, 2002; Park H. et al . , Cytokine, 21:148-53, 2002).
Meanwhile, a peptide consisting of numerous amino acids has shortcomings in that it is metabolized upon in vivo administration, leading to the cleavage of the peptide bond, and tends to decompose in a process of formulation. Thus, it is generally preferable to keep the length of peptides as short as possible for use as drugs. However, because the pharmacological activity of peptides needs to be kept, it is an important in the development of drugs to find the minimum length peptide (s) with activity comparable to that of a long- chain peptide. Accordingly, during the development of a novel anti-tumor agent, the present inventors have found that a polypeptide including a part of amino acid sequences in the middle region of known AIMPl protein, has anti-tumor activity by inducing apoptosis of endothelial cell, thereby completing the present invention.
Disclosure Technical Problem
Therefore, it is an object of the present invention to provide an isolated polypeptide comprising the amino acid sequence of SEQ ID NO : 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9, or an isolated polynucleotide encoding the polypeptide and use for anti-tumor activity thereof .
Technical Solution To achieve the above object, the present invention provides an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9, and an isolated polynucleotide encoding the polypeptide.
In another aspect, the present invention provides a pharmaceutical composition comprising the polypeptide and the polynucleotide encoding the polypeptide.
In still another aspect, the present invention provides methods for inducing apoptosis of endothelial cell and for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
In still another aspect, the present invention provides use of the polypeptide or the polynucleotide encoding the polypeptide, for preparation a pharmaceutical composition for treating cancer.
Hereinafter, the present invention will be described in detail.
Definition Unless otherwise stated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention pertains.
As used herein, the term "effective amount" refers to an amount effective in inducing apoptosis of endothelial cell or showing anti-tumor activity in vivo or in vitro.
As used herein, the term "subject" means mammals, and particularly animals including human beings, or the cells or tissues of animals. The subject may be patients in need of treatment. Also, the cells may preferably be endothelial cell.
The polypeptide of the present invention includes 101-170 amino acid sequence of the AIMPl protein. Meanwhile, AIMPl (ARS-interacting multi-functional protein 1) was previously known as the p43 protein and renamed by the present inventors (Sang Gyu Park, et al . , Trends in Biochemical Sciences, 30:569-574, 2005).
The AIMPl is a protein consisting of 312 amino acids, which binds to a multi-tRNA synthetase complex to increase the catalytic activity of the multi-tRNA synthetase complex. It is known that the AIMPl is secreted from various types of cells, including prostate cancer cells, immune cells and transgenic cells, and the secreted AIMPl works on diverse target cells such as monocytes/macrophages, endothelial cells and fibroblast cells. The following three SNPs of the AIMPl are known (see NCBI SNP database) : substitution of 79th alanine (Ala) to proline (Pro) (SNP accession no. rs3133166) ; substitution of 104th threonine (Thr) to alanine (Ala) (SNP accession no. rsl7036670) ; and substitution of 117th threonine (Thr) to alanine (Ala) (SNP accession no. rs2230255) in the amino acid sequence of the full-length AIMPl(SEQ ID NO: 1) .
The present inventors constructed a series of deletion fragments of the AIMPl so as to determine a functional domain of AIMPl related to endothelial cell death(see Fig.l and Fig.2), and then examined activity of fragments in inducing apoptosis of endothelial cell death (see <example 2>) . Consequently, it could be supposed that a region of amino acid 101-192 of the AIMPl would be a domain having the activity of inducing apoptosis of endothelial cell(see Fig.4 and Fig.5).
In order to more particularly determine the functional domain of AIMPl related to endothelial cell death, the region of the AIMPl- (101-192) was cleaved to prepare small fragments (see <exaτnple 3-l>) and the activities of these fragments in inducing apoptosis of endothelial cell were also examined (see from Fig.8 to Fig.10) .
Also, in order to confirm whether AIMPl- (101-170) mutant can induce apoptosis of endothelial cell, the present inventors constructed AIMPl- (101-170) C161S peptide by inducing ClβlS point mutation in the AIMPl- (101-170) peptide (see <example 4-l>) . As a result of comparing endothelial cell death activity of AIMPl full length, AIMPl- (101-170) polypeptide and AIMPl- (101-170) mutant polypeptide, the present inventors found that the AIMPl- (101-170) C161S had an activity of inducing endothelial cell death in the absence of DTT (see Fig.11) .
Moreover, the present inventors examined whether AIMPl- (101-170) peptide had anti-tumor activity. As a result, the present inventors found that the AIMPl-(IOl- 170) had more effective anti-tumor activity than the AIMPl full length protein (see Fig.14 ) without side effect of body weight loss (see Fig.12 and Fig.13) .
Therefore, the present invention provides a polypeptide comprising the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO : 9.
Preferably, the inventive polypeptide may consist of, but not limited to, the amino acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 8 and SEQ ID NO: 10 to SEQ ID NO: 14. The amino acid sequence select from SEQ ID NO: 11 to SEQ ID NO: 14 is a known SNP of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 10. Most preferably, the inventive polypeptide may consist of the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 10.
Also, the inventive polypeptide may include functional equivalents of the polypeptide having the amino acid sequence of SEQ ID NO: 9, and preferably functional equivalents of the polypeptide having the amino acid sequence of SEQ ID NO: 9, as well as salts thereof. More particularly, the term "functional equivalents" refers to polypeptide comprising the amino acid sequence having at least 80% amino acid sequence homology (i .e ., identity), preferably at least 90%, and more preferably at least 95% for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% to the amino acid sequence of SEQ ID NO: 9 that exhibit substantially identical physiological activity to the polypeptide of SEQ ID NO: 9. The sequence identity or homology is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with amino acid sequence of SEQ ID NO: 9, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions (as described above) as part of the sequence identity. None of N- terminal, C-terminal, or internal extensions, deletions, or insertions into the amino acid sequence of SEQ ID NO: 9 shall be construed as affecting sequence identity or homology. Thus, sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides. Using a computer program such as BLAST or FASTA, two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences or along a predetermined portion of one or both sequences) . The programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (a standard scoring matrix; see Dayhoff et al . , in Atlas of Protein Sequence and Structure, vol. 5, supp. 3 (1978)) can be used in conjunction with the computer program. For example, the percent identity can be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequences in order to align the two sequences.
The scope of the functional equivalents as used herein also encompasses derivatives obtained by modifying a part of the chemical structure of the inventive polypeptide while maintaining the basic framework and the activity inducing endothelial cell death or inhibiting cancer cell proliferation. For example, this includes structural modifications for altering the stability, storage, volatility or solubility of the polypeptide.
The polypeptide according to the present invention can be prepared by a genetic engineering method using the expression of recombinant nucleic acid encoding the same. For this purpose, a DNA molecule encoding the AIMPl or its fragment is first constructed according to any conventional method. The DNA molecule may synthesized by performing PCR using suitable primers. Alternatively, the DNA molecule may also be synthesized by a standard method known in the art, for example using an automatic DNA synthesizer (commercially available from Biosearch or Applied Biosystems) . The constructed DNA molecule is inserted into a vector comprising at least one expression control sequence (ex: promoter, enhancer) that is operatively linked to the DNA sequence so as to control the expression of the DNA molecule, and host cells are transformed with the resulting recombinant expression vector. The transformed cells are cultured in a medium and condition suitable to express the DNA sequence, and a substantially pure polypeptide encoded by the DNA sequence is collected from the culture medium. The collection of the pure polypeptide may be performed using a method known in the art, for example, chromatography.
In this regard, the term "substantially pure polypeptide" means the inventive polypeptide that does not substantially contain any other proteins derived from host cells. For the genetic engineering method for synthesizing the inventive polypeptide, the reader may refer to the following literatures: Maniatis et al . , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory 1982; Sambrook et al . , supra; Gene Expression Technology, Method in Enzymology, Genetics and Molecular Biology, Method in Enzymology, Guthrie & Fink (eds.), Academic Press, San Diego, Calif. 1991; and Hitzeman et al . , J. Biol. Chem. , 255, 12073-12080 1990.
Alternatively, the inventive polypeptide can be chemically synthesized according to any technique known in the art (Creighton, Proteins: Structures and Molecular Principles, W. H. Freeman and Co., NY, 1983). Namely, the inventive polypeptide can be prepared by conventional step-wise liquid or solid phase synthesis, fragment condensation, F-MOC or T-BOC chemistry (Chemical Approaches to the Synthesis of Peptides and Proteins, Williams et al . , Eds., CRC Press, Boca Raton Florida, 1997; A Practical Approach, Atherton & Sheppard, Eds., IRL Press, Oxford, England, 1989) .
It is particularly preferred to use the solid phase synthesis to prepare the inventive peptide. The inventive polypeptide can be synthesized by performing the condensation reaction between protected amino acids by the conventional solid-phase method, beginning with the C-terminal and progressing sequentially with the first amino acid, the second amino acid, the third amino acid, and the like according to the identified sequence. After the condensation reaction, the protecting groups and the carrier connected with the C-terminal amino acid may be removed by a known method such as acid decomposition or aminolysis . The above-described peptide synthesis method is described in detail in the literature (Gross and Meienhofer ' s, The peptides, vol. 2, Academic Press, 1980) . Examples of a solid-phase carrier, which can be used in the synthesis of the polypeptide according to the present invention, include polystyrene resins of substituted benzyl type, polystyrene resins of hydroxymethylphenylacetic amide form, substituted benzhydrylpolystyrene resins and polyacrylamide resins, having a functional group capable of bonding to peptides. Also, the condensation of amino acids can be performed using conventional methods, for example dicyclohexylcarbodimide (DDC) method, acid anhydride method and activated ester method.
Protecting groups used in the synthesis of the inventive peptide are those commonly used in peptide syntheses, including those readily removable by conventional methods such as acid decomposition, reduction or aminolysis. Specific examples of such amino protecting groups include formyl; trifluoroacetyl ; benzyloxycarbonyl ; substituted benzyloxycarbonyl such as
(ortho- or para-) chlorobenzyloxycarbonyl and (ortho- or para-) bromobenzyloxycarbonyl ; and aliphatic oxycarbonyl such as t-butoxycarbonyl and t-amiloxycarbonyl . The carboxyl groups of amino acids can be protected through conversion into ester groups. The ester groups include benzyl esters, substituted benzyl esters such as methoxybenzyl ester; alkyl esters such as cyclohexyl ester, cycloheptyl ester or t-butyl ester. The guanidino moiety may be protected by nitro; or arylsulfonyl such as tosyl, methoxybenzensulfonyl or mesitylenesulfonyl, even though it does not need a protecting group. The protecting groups of imidazole include tosy, benzyl and dinitrophenyl . The indole group of tryptophan may be protected by formyl or may not be protected. Deprotection and separation of protecting groups from carriers can be carried out using anhydrous hydrofluoride in the presence of various scavengers . Examples of the scavengers include those commonly used in peptide syntheses, such as anisole, (ortho-, meta- or para-) cresol, dimethylsulfide, thiocresol, ethanendiol and mercaptopyridine .
The recombinant peptide prepared by the genetic engineering method or the chemically synthesizing can be isolated and purified according to methods known in the art, including extraction, recrystallization, various chromatographic techniques (e .g. , gel filtration, ion exchange, precipitation, adsorption, reverse phase, etc.), electrophoresis and counter current distribution.
Moreover, the present invention provides an isolated polynucleotide encoding the isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence. The polynucleotide comprises DNA, cDNA and RNA sequences. Preferably, the polynucleotide has the base sequence selected from the group consisting of SEQ ID NO: 48 to SEQ ID NO: 58. The polynucleotide of SEQ ID NO: 55 to SEQ ID NO: 58 encodes the known SNP of the polypeptide of SEQ ID NO: 9 or SEQ ID NO: 10. The polynucleotide can be prepared by separating from nature materials or genetic engineering methods known in the art to which the present invention pertains.
Also, the present invention provides a vector containing the polynucleotide according to the present invention. The vector may be, but not limited to, a plasmid or viral vector. The inventive polynucleotide can be introduced into a target cell by inserting it into the vector and then introducing the vector into a target cell by any method known in the art, such as infection, transfection and transduction.
Therefore, the present invention provides a transformant transformed with the vector. Particularly, a gene transfer method using a plasmid expression vector is a method of transferring a plasmid DNA directly to mammalian cells, which is an FDA-approved method applicable to human beings (Nabel, E. G., et al . , Science, 249:1285-1288, 1990). Unlike viral vectors, the plasmid DNA has an advantage of being homogeneously purified. Plasmid expression vectors which can be used in the present invention include mammalian expression plasmids known in the pertinent art. For example, they are not limited to, but typically include pRK5 (European Patent No. 307,247), pSV16B (PCT Publication No. 91/08291) and pVL1392 (PharMingen) . The plasmid expression vector containing the polynucleotide according to the present invention may be introduced into target cells by any method known in the art, including, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome- mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun methods, and other known methods for introducing DNA into cells (Wu et al . , J. Bio. Chem. , 267:963-967, 1992; Wu and Wu, J. Bio. Chem. , 263:14621-14624, 1988).
In addition, virus expression vectors containing the polynucleotide according to the present invention include, but are not limited to, retrovirus, adenovirus, herpes virus, avipox virus and so on. The retroviral vector is so constructed that non-viral proteins can be produced within the infected cells by the viral vector in which virus genes are all removed or modified. The main advantages of the retroviral vector for gene therapy are that it transfers a large amount of genes into replicative cells, precisely integrates the transferred genes into cellular DNA, and does not induce continuous infections after gene transfection (Miller, A. D., Nature, 357:455-460, 1992). The retroviral vector approved by FDA was prepared using PA317 amphotropic retrovirus packaging cells (Miller, A. D. and Buttimore, C, Molec. Cell Biol., 6:2895-2902, 1986). Non-retroviral vectors include adenovirus as described above (Rosenfeld et al . , Cell, 68:143-155, 1992; Jaffe et al . , Nature Genetics, 1:372- 378, 1992; Lemarchand et al . , Proc. Natl. Acad. Sci. USA, 89:6482-6486, 1992). The main advantages of adenovirus are that it transfers a large amount of DNA fragments (36kb genomes) and is capable of infecting non- replicative cells at a very high titer. Moreover, herpes virus may also be useful for human genetic therapy (Wolfe, J. H., et al., Nature Genetics, 1:379-384, 1992). The lentivirus is a kind of retrovirus and developed to new retroviral vector since the late 1990s. The lentiviral vector is constructed by modifying HIV backbone. It has high transfection efficiency in dividing and non-diving cells since it is not influenced by cell cycle unlike other retroviral vectors. Thus it has been developed as potential vectors for gene transfer in the cell therapy field using hematopoietic and keratinocyte stem cells, since transfection efficiency of the lentiviral vector in slow-dividing cell such as hematopoietic cell is higher than that of other viral vectors. Besides, other known suitable viral vectors can be used.
The transformation with the vector can be carried out according to any known transformation method in the pertinent art, preferably, microprojectile bombardment, electroporation, CaPO4 precipitation, CaCl2 precipitation, PEG-mediated fusion, microinjection and liposome-mediated method, but not limited to. The transformant may be Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis and Staphylococcus, Agrobacterium tumefaciens, but not limited to.
Also, the present invention provides a pharmaceutical composition comprising the inventive polypeptide or polynucleotide encoding the same and a pharmaceutically acceptable salt. Preferably, the inventive pharmaceutical composition can be, but not limited to, the pharmaceutical composition for treating cancer.
The inventive pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient . The carrier or excipient can include, but not limited to, dispersing agents, wetting agents, suspension agents, diluents, and fillers. The ratio between the pharmaceutically acceptable carriers and expression vectors included in the inventive pharmaceutical composition, is fixed by solubility and chemical properties of the composition or administration ways. The therapeutic or preventive effective amount of the inventive pharmaceutical composition containing the AIMl protein-encoding polynucleotide may be suitably selected depending on the subject to be administered, age, individual variation and disease condition.
As used herein, the term "pharmaceutically acceptable" means what is physiologically acceptable and, when administered to human beings, generally does not cause allergic reactions, such as gastrointestinal disorder and dizziness, or similar reactions thereto.
Examples of the pharmaceutically acceptable salt include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids and the like. Examples of the salt with an inorganic acid include alkali metal salts, such as a sodium salt and a potassium salt; an alkaline earth metal salt such as a calcium salt and a magnesium salt; an aluminum salt; and an ammonium salt. Examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, 2 , 6--lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine and N,N' - dibenzylethylenediamine . Examples of the salt with an inorganic acid include salts with hydrochloric acid, boric acid, nitric acid, sulfuric acid and phosphoric acid. Examples of the salt with an organic acid include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid and p- toluenesulfonic acid. Examples of the salt with a basic amino acid include salts with arginine, lysine and ornithine. Examples of the salt with an acidic amino acid include salts with aspartic acid and glutamic acid. The list of suitable salts is disclosed in Remington' s Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, pl418, 1985, the entire disclosure of which is incorporated herein by reference. Also, the inventive pharmaceutical composition may also be formulated, but not limited to, as preparations for oral administration. For oral administration, the inventive polypeptide, the polynucleotide coding the same, and the pharmaceutically acceptable salt mixed with the excipients, can be formulated in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. These preparations may also comprise diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (e.g., silica, talc, stearic acid and a magnesium or calcium salt thereof, and/or polyethylene glycol) in addition to the active ingredient. Among various preparations, tablets may also comprise binders, such as magnesium aluminum silicate, starch pastes, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone, and, if desired, may further comprise disintegrating agents, such as starches, agar or alginic acid or a sodium salt thereof, absorbents, colorants, flavors and sweeteners. These formulations may be prepared by a conventional mixing, granulation or coating method. The inventive pharmaceutical composition may be administered itself or in the form of various formulations as described above, and preferably it may be administered until the desired effect, i.e., effect of endothelial cell death and/or anti-tumor. The inventive pharmaceutical composition may be administered by various routes according to any method known in the art. Namely, it may be administered by oral or parenteral routes. For example, the parenteral routes include methods for applying to the skin locally, intramuscular, intravenous, intracutaneous, intraarterial, intramarrow, intrathecal, intraperitoneal, intranasal, intravaginal, intrarectal, sublingual and subcutaneous or administering to gastrointestinal tracts, mucosa or respiratory organs systemically. For example, The inventive pharmaceutical composition may be administered by a method of applying the polypeptide directly to the skin or a method comprising formulating the polypeptide in an injectable form, and then, injecting a given amount of the formulation into a subcutaneous layer with a 30 -gauge injection needle or lightly pricking the skin with an injection needle. Preferably, the inventive polypeptide may be applied directly to the skin.
Also, The inventive pharmaceutical composition may also be administered in a form bound to a molecule causing a high-affinity binding to a target cell or tissue (e.g., skin cell or skin tissue) or in a form encapsulated in the molecule. The inventive pharmaceutical composition can be bound to sterol (e.g., cholesterol), a lipid(e.g., a cationic lipid, virosome or liposome), or a target cell-specific binding agent(e.g., a ligand recognized by target cell specific receptor) using the technology known in the art. Suitable coupling agents or crosslinking agents may include, for example, protein A, carbodiimide, and N-succinimidyl-3- (2- pyridyldithio) propionate (SPDP) .
The total effective amount of the polypeptide in the inventive pharmaceutical composition can be administered to a subject as a single dose, or can be administered using a fractionated treatment protocol, in which the multiple doses are administered over a more prolonged period of time. The amount of the active ingredient in the composition containing the inventive polypeptide may vary depending on the use of the composition, but the active ingredient may be generally administered at an effective dose of O.lμg-lg several times daily. However, the effective dose of the polypeptide may vary depending on many factors, such as the age, body weight, health condition, sex, disease severity, diet and excretion of a subject in need of treatment, as well as administration time and administration route. In view of these factors, any person skilled in the art may determine an effective dose suitable for the above-described specific use of the inventive polypeptide. The inventive composition has no special limitations on its formulation, administration route and administration mode as long as it shows the effects of the present invention.
In another aspect, the inventive polypeptide or polynucleotide encoding the polypeptide can be used in a method for inducing apoptosis of endothelial cell. Therefore, the present invention provides a method for inducing apoptosis of endothelial cell, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
Also, the present invention provides a method for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of the polypeptide or the polynucleotide encoding the polypeptide.
The cancers include, but are not limited to, breast cancer, rectal cancer, lung cancer, small -cell lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine carcinoma, ovarian cancer, colorectal cancer, cancer near the anus, colon cancer, oviduct carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulva carcinoma, Hodgkin's disease, esophagus cancer, small intestinal tumor, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft-tissue sarcoma, uterine cancer, penis cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urethra cancer, kidney cell carcinoma, kidney pelvis carcinoma, CNS tumor, primary CNS lymphoma, spinal tumor, brain stem glioma, and pituitary adenoma, and a combination of one or more thereof.
In still another aspect, the present invention provides the polypeptide or the polynucleotide encoding the polypeptide for use as a medicament .
Also, the present invention provides use of the polypeptide or the polynucleotide encoding the polypeptide for preparation a pharmaceutical composition for treating cancer.
Advantageous Effects
The polypeptide or the polynucleotide encoding the polypeptide has the activity inhibiting cancer cell proliferation by inducing apoptosis of endothelial cell.
Therefore, the polypeptide or the polynucleotide encoding the polypeptide can be effectively used in inducing apoptosis of endothelial cell, or preventing or treating cancer.
Description of Drawings
FIG.l is a schematic drawing of the AIMPl fragments of the present invention. FIG.2 shows the results of SDS-PAGE analysis for the AIMPl fragments of the present invention.
FIG.3 is a picture showing the activity of inducing cell death of the AIMPl fragments of the present invention. FIG.4 is a graph showing the activity of inducing cell death of the AIMPl fragments of the present invention.
FIG.5 is a graph showing the effect of the AIMPl fragments of the present invention for the activity of caspase-3.
FIG.6 is a schematic drawing of the AIMPl- (101-192) fragments of the present invention. FIG.7 shows the result of electrophoresis for the AIMPl- (101-192) fragments of the present invention.
FIG.8 is a picture showing the activity of inducing of cell death of the AIMPl- (101-192) fragments of the present invention.
FIG.9 is a graph showing the measurement result for cell viability by MTT assay after the treatment of the AIMPl- (101-192) fragments of the present invention.
FIG.10 is a graph showing the effect on the activity of caspase-3 of the AIMPl- (101-192) fragments of the present invention.
FIG.11 is a graph showing analysis results for activity of endothelial cell apoptosis of the AIMPl- (101- 170)C161S mutant polypeptide of the present invention. FIG.12 is a graph showing analysis results for tumor cell anti-proliferation activity of the AIMPl- (101- 170) polypeptide of the present invention.
FIG.13 is a graph showing analysis results for body weight loss after the treatment of the AIMPl- (101-170) polypeptide of the present invention.
FIG.14 is a graph showing analysis results for tumor cell anti-proliferation activity of the AIMPl- (101- 170) polypeptide of the present invention in comparison with AIMPl full length protein. FIG.15 is a graph showing analysis results for body weight loss after the treatment of the AIMPl- (101-170) polypeptide of the present invention in comparison with AIMPl full length protein.
Mode for Invention
Reference will now be made in detail to the preferred embodiments of the present invention. It is to be understood that the following examples are illustrative only and the present invention is not limited thereto.
<Example 1>
Construction of AIMPl protein or its fragments
An AIMPl consisting of 312 amino acids (SEQ ID NO: 1) was constructed according to the method of Park et al.(Park S. G. et al . , J. Biol. Chem. , 277 :45243-45248 , 2002) .
Also, Each of deletion fragments of AIMPl shown in FIG.l, i.e., AIMPl- (1-192) (SEQ ID NO: 2), AIMPI- (6- 192) (SEQ ID NO: 3), AIMPl- (30-192) (SEQ ID NO: 4), AIMPl- (47-192) (SEQ ID NO: 5), AIMPl- (54-192) (SEQ ID NO: 6), AIMPl- (101-192) (SEQ ID NO: 7), AIMPl- (114-192 ), AIMPl-(I- 46), AIMPl- (1-53) and AIMPl- (193-312) fragments was constructed. Each of the fragments was synthesized by PCR using the cDNA of AIMPl(SEQ ID NO: 1) as a template with specific primer sets (see Table 1). The PCR reaction conditions were as follows: pre-denaturation of template DNA by heating at 95"C for 2min; and then 30 cycles at 95°C for 30 sec, 56°C for 30 sec and 72°C for lmin; followed by final extension at 72 °C for 5min.
[Table l]
Figure imgf000030_0001
Figure imgf000031_0001
Primer sets used for preparing AIMPl fragments
Each of the PCR products was digested with EcdRl and Xhol and ligated into a pGEX4T3 vector(Amersham Biosciences) digested with the same restriction enzymes. E.coli BL2KDE3) was transformed with the vector and cultured to induce expression of the polypeptides. Each of the polypeptides was expressed as a GST-tag fusion protein and purified on GSH agarose gel. To remove lipopolysaccharide, protein solution was dialyzed through pyrogen-free buffer(1OmM potassium phosphate buffer, pH 6.0, 10OmM NaCl). After the dialysis, the solution was loaded onto polymyxin resin (Bio-Rd) pre-equilibrated with the same buffer and then incubated for 20 minutes followed by elution. Concentration of residual lipopolysaccharide(LPS) was below 20ρg/m# when determined using a Limulus Amebocyte Lysate QCL-IOOO kit. Each of the purified peptides was analyzed by SDS-PAGE and the result was shown in FIG.2.
As a result shown in FIG.2, AIMPl-C1-192)(SEQ ID NO: 2),
AIMPI-C6-192XSEQ ID NO: 3), AIMP1-(3O-192)(SEQ ID NO: 4), AIMPH47- 192XSEQ ID NO: 5), AIMPl-(54-192)(SEQ ID NO: 6), AIMPH101-192)(SEQ
ID NO: 7), AIMPl-C114-192), AIJIPH1-46), AIMPl-C1-53) and AIMPl-
(193-312) fragments could be constructed.
<Example 2> Identification of AIMPl domain having activity of inducing cell death
<2-l> Identification of fragments having activity of inducing apoptosis endothelial cell To confirm whether the deletion fragments of the AIMPl constructed in the <Example 1> had cell death-indueing activity, the present inventors investigated the effect on cell death by treating BAECs(Bovine aorta endotheilial cells) with the fragments of AIMP.
BAECs(Bovine aorta endothelial cells) were isolated from descending thoracic aortas and grown in Dulbecco's modified Eagle's medium containing 20% fetal bovine serum at 37° C in a 5% CO2 atmosphere. The cultured BAECs were treated with the deletion fragments of the AIMPl(50nM) for 24h, and apoptotic cells were counted.
Concretely, enhanced green fluorescent protein(EGFP) were transfected into BAECs, and expressed for 24h. The transfected cells were treated with the fragments of the AIMPl(50nM) for 24h, and then cell death was determined by counting apoptotic cells using fluorescence microscopy. The percentage of apoptotic cells was determined by dividing the number of green cells with apoptotic morphology by the total number of green cells(see FIG.3 and 4).
As shown in FIG.3 and FIG.4, it was found that AIMPl-C1-312) , AIMPl-C1-192), AIMP1-C6-192) , AIMP1-C30-192), AIMP1-C47-192) , AIMPl- (54-192), and AIMPl-C101-192) of the deletion fragments of the AIMPl constructed in the <Example 1>, could induce apoptosis of endothelial cell at high levels, but AIMPl-C114-192), AIMPl-(l-46), AIMPl-(l-53), AIMP1-C30-192) and AIMPl-C193-312) could not induce apoptosis.
From the result, it was believed that the middle region of AIMPl, especially AIMPl-(IOl-192) , might be a cell death-indueing domain on endothelial cells.
<2-2> Measurement of caspase-3 activation
Since AIMPl induced endothelial cell apoptosis through caspase-3 activationCS.G. Park, et . al . , J. Biol.Chem., 277:4524345248, 2002), the present inventors reconfirmed whether the fragments of AIMP had cell death-indueing activity through measuring caspase-3 activity.
Concretely, BAECs(2x 106) were harvest and lysed with 300 ≠. of cell lysis buffer(20mM HEPES, pH 7.5, ImM dithiothreitol(DTT),
O.lmM EDTA, 0.5% NP-40, and O.lmM PMSF). The cell lysates were centrifuged at 15,00Ox g for 5 min and the supernatant fractions were used to measure caspase activity. Aliquots of 40 μi of cell lysate protein were incubated for 2h at 30° C in an assay buffer(20mM HEPES at pH 7.5, 2mM DTT, 10% glycerol) containing lOOuM Ac-DEVD-p- nitroanilide for a caspase-3 substrate or Ac-YVAD-p-nitroanilide for caspase-1 substrate. The amount of p-nitroaniline released by caspase activity was quantitated by measuring the optical density at 405nm(see FIG.5).
The result shown in FIG.5 was similar to that shown in FIG.3 and FIG.4. From these results, it was believed that the middle region of AIMPl, especially AIMPl-C101-192) might be a cell death-indueing domain on endothelial cell.
<Example 3>
Construction of additional deletion fragments of AIMPl-(IOl- 192) and measurement of their activity
<3-l> Construction of additional deletion fragments of AIMPl- (101-192)
In order to more particularly determine cell death-indueing domain of AIMPl-(101-192) estimated to be a cell death-indueing domain in endothelial cell from the results in the <Example 2>, the present inventors constructed additional deletion fragments of AIMPl-
(101-192).
As shown in FIG.6, the present inventors constructed fragments from the AIMPl-C101-192) by serially deleting C-terminal part of the
AIMPl-(101-192) with primers shown in Table.2. Particularly, the same method as in the <Example 1> was performed so as to construct and purify the above fragments. The purified proteins were identified by SDS-PAGE and the results were shown in FIG.7.
[Table 2]
Figure imgf000035_0001
Primer sets used for constructing AIMPl-(101-192) fragments.
As shown in FIG.7, AIMPl- (101-192) (SEQ ID NO: I)1 AIMPl- (101-180) (SEQ ID NO: 8), AIMPl- (101-170) (SEQ ID NO: 9), AIMPl- (101-160) and AIMPl- (101-146) fragments were constructed.
<3-2> Examination of endothelial cell death-inducing activity of additional deletion fragments of AIMPl-(IOl- 192) The BAECs cultured by the same method as in the <Example 2-l> were treated with each 5On of MAIMPl fragments constructed in the <Example 3-l>, AIMPl protein and AIMPl- (101-192) fragment constructed in the <Example 1>. The present inventors examined endothelial cell death through morphological change with a light microscope (CX31, OLYMPUS) and the results were shown in FIG.8. Also, each of 5OnM of AIMPl fragments constructed in the <Example 3-l>, AIMPl protein and AIMPl- (101-192) constructed in the <Example 3-l> was treated on the BAECs for 24hr, respectively. Then MTT solution (5mg/m£) was added as much as 1/10 of the volume of cell culture solution and was reacted for lhr. Then, after the culture solution was entirely discarded, DMSO (200μJl) was added, absorbance was measured at 570 nm, and the results were shown in FIG.9.
As shown in FIG.8 and FIG.9, it was found that AIMPl protein, AIMPl- (101-192) , AIMPl- (101-180) and AIMPl- (101-170) could induce apoptosis of endothelial cell, but AIMPl- (101-160) and AIMPl- (101-146) could not induce apoptosis. From the result, it was believed that the middle region of AIMPl, especially AIMPl- (101-170) , might be a cell death-inducing domain on endothelial cell. Also, in order to verify the above results, the present inventors measured the effects of the fragments of AIMPl- (101-192) on caspase-3 activity by the same method as in the <Example 2-2>. Then the results were shown in FIG.10.
As shown in FIG.8 to FIG.10, it was found that AIMPl- (1-312) (SEQ. ID NO: 1), AIMPl- (101-192) (SEQ . ID NO: 7), AIMPl- (101-180) (SEQ. ID NO: 8) and AIMPl-(IOl- 170) (SEQ. ID NO: 9) could induce apoptosis of endothelial cell at high levels, but AIMPl- (101-160) and AIMPl-(IOl- 146) could not induce. From the result, it was believed that the middle region of AIMPl, especially AIMPl-(IOl- 170) would be a cell death-inducing domain on endothelial cell. Consequently, it was found that the AIMPl- (101- 170) (SEQ. ID NO: 9) domain would be useful and applicable for anti-angiogenic and anti-tumor therapy.
<Example 4> <4-l> Construction of AIMPl- (101-170) C161S protein
In order to construct AIMPl- (101-170) mutant, C161S point mutation in AIMPl- (101-170) polypeptide, which showed cell death inducing activity in the <Example 3>, was generated by PCR. Particularly, the AIMPl- (101-170) mutant was synthesized by PCR using the cDNA of AIMPl as a template with the following primer set. forward primer: δ'-CGCATATGGCAGTAACAACCGTATCTTCTGGT- 3 (SEQ ID NO: 43) , reverse primer: 5'-
CGCTCGAGTTAATCAGGGTGTTTTCTAGCAGTTATGATGCTACCAATTCGAAGATCC AGACGGGA-3 (SEQ ID NO: 44)
The PCR reaction conditions were as follows: pre- denaturation of template DNA by heating at 92 °C for 2min; and then 30 cycles at 92 "C for 30sec, 56°C for 30sec and 72°C for 20sec; followed by final extension at 72°C for
5min.
After the synthesis, Each of PCR products was digested with iVdel and Xhol and cloned by ligating into a pET49b vector (Novagen) digested with the same restriction enzymes, and AIMPl- (101-170) C161S (SEQ ID NO: 10) was constructed by purifying with the same manner as in
<Example 1>.
<4-2> Analysis of cell death effects of AIMPl full length, AIMPl- (101-170) polypeptide and AIMPl- (101-170) mutant
The present inventor found that the AIMPl full length protein(SEQ. ID NO: 1) or AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) lost endothelial cell death inducing activity in the absence of powerful reducing agent, DTT (Data not shown) .
Accordingly, the AIMPl full length protein (SEQ. ID NO: 1) and AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) constructed in the <Example 1>, were examined about endothelial cell death activities in the presence of DTT, but the AIMPl- (101-170) C161S (SEQ. ID NO: 10) constructed in the <Example 4-l>, in the absence of DTT.
Particularly, the AIMPl full length protein (10OnM) and AIMPl- (101-170) polypeptide (10 , 10OnM) constructed in the <Example 1> were purified in the presence of DTT, but the AIMPl- (101-170) C161S (10, 10OnM) constructed in the <Example 4-l>, in the absence of DTT. Then the purified products were added to BAECs, and the BAECs were cultured for 24hr. Then MTT assay was performed by the same method as in the <Example 3>, cell viability was measured and the results were shown in FIG.11. As shown in FIG.11, it was found that the AIMPl- (101-170) C161S (SEQ. ID NO: 10) had comparable cell death activity with the AIMPl full length protein (SEQ. ID NO: 1) or the AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) in spite of the condition of the absence of powerful reducing agent, DTT.
<Example 5>
Anti-tumor activity of AIMPl- (101-170) polypeptide
In order to confirm whether AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) has anti-tumor activity, the present inventors used a xenograft system (BALB/c-nu/nu mouse-MKN-45) . 5-week-old male BALB/c-nu/nu nude mice (human tumor xenograft experiments) were obtained from Harlan Co. Ltd. (USA) . The mice were housed in a pathogen-free barrier facility with ambient light controlled automatically to produce 12h light and dark cycles. The MKN-45 (human gastric adenocarcinoma) lines were obtained from the Cell Bank Facility, Korea Research Institute of Biotechnology (KRIBB) .
The inventors injected human MKN-45 (gastric cancer) cells adjusted to 2 X 105 cells/mβ, subcutaneously into the right scapular region of each mouse in a total volume of 50μi of PBS and monitored the tumor growth. Tumor size was measured in three dimensions with calipers, and tumor volume was calculated as Length X Width X Depth X 1/2. When the tumor size was about 50mm3 in volume, the mice were administered each of 10μg/dose and 50/ig/dose of the AIMPl- (101-170) polypeptide constructed in the <Example 3-l> every day for 7 days and relative tumor volume (RTV) was calculated. The relative tumor volume (RTV) was calculated as Vi/Vo, where Vi is the tumor volume at any given time and Vo is the volume at the start of treatment. Based on the result, tumor growth inhibition data were analyzed by student' s t-test (p < 0.01), and the results were shown in FIG.12. As shown in the Fig 12, the tumor volume increased about 34 fold in the control groups on the seventh day, whereas it increased only about 15 fold in the lOμg/dose AIMPl- (101-170) polypeptide group and about 5 fold in the 50μg/dose AIMPl- (101-170) polypeptide group. And, the present inventors confirmed whether the body weight of the mice was lost. From a result, it was found that treatment of the AIMPl- (101-170) polypeptide did not induce a loss of body weight (see FIG.13).
On the other hand, the tumors were excised and weighed on day 7. Then tumor growth inhibition rate (TGI) was calculated by the following math expression 1, and the results were shown in the Table 3.
[Math Expression l] TGI = (1-T/C) X 100,
T:thβ mean final tumor weight of the treated group C; the mean final tumor weight of the control group
[Table 3] average tumor treatment dose TGI (%) t-test weight (g)
Vehicle 5.96± 1.64
AIMPl- (101-170)
10//g/dose 2.36 ± 0.78 60. 4 p=0 023 polypeptide
AIMPl- (101-170)
50μg/dose 1.30± 0.43 78. 2 p<0 01 polypeptide
Anti-tumor activity of AIMPl- (101-170) polypeptide
As shown in the Table 3, it was found that the AIMPl- (101-170) polypeptide had anti-tumor activity without inducing a loss of body weight, and would be useful for anti-tumor therapy.
<Example 6>
Comparison of anti-tumor activity between the AIMPl- (101- 170) polypeptide and the AIMPl full length protein
In order to comparison of anti-tumor activity between the AIMPl- (101-170) polypeptide (SEQ. ID NO: 9) and the AIMPl full length protein, the present inventors performed the same method as in the <Example 5>. But each mouse was administered with lOμg/dose AIMPl- (101-170) polypeptide and AIMPl full length protein respectively. Tumor volume was calculated for 10 days and the results were shown in FIG.14.
The tumor volume increased about 12.3 fold in the vehicle treatment group on day 10 whereas it increased only about 5 fold in the 10//g/dose AIMPl- (101-170) polypeptide group (p=0.0052) and about 9.2 fold in the 10//g/dose AIMPl full length group (p=0.022) (see FIG.14).
And from the result that the present inventors confirmed whether body weight of the mice was lost, it was found that treating the protein did not induce a loss of body weight in any of the tested animals (see FIG.15). The lOμg/dose AIMPl- (101-170) polypeptide group showed a 58.75 % reduction of tumor volume compared to the control group and the 10/zg/dose AIMPl full length protein group showed a 24.75 % reduction. Accordingly, it was showed that the AIMPl- (101-170) polypeptide had more effective anti-tumor activity than the AIMPl full length protein.
Industrial Applicability
The polypeptide or the polynucleotide encoding the polypeptide has an activity of inducing apoptosis of endothelial cell, thus inhibiting cancer cell proliferation. Accordingly, the polypeptide or the polynucleotide encoding the polypeptide can be effectively used for inducing apoptosis of endothelial cell, or preventing or treating cancer.

Claims

CLAIMS Claim 1
An isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9.
Claim 2
The isolated polypeptide of claim 1, which consists of amino acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 8 and SEQ ID NO: 10 to SEQ ID NO: 14.
Claim 3 An isolated polynucleotide having the base sequence encoding the polypeptide of claim 1.
Claim 4
The isolated polynucleotide of claim 3, which has the base sequence selected from the group consisting of SEQ ID NO: 48 to SEQ ID NO: 58.
Claim 5
A vector comprising the polynucleotide of claim 3.
Claim 6
A transformant transformed with the vector of claim
5 .
Claim 7
A pharmaceutical composition comprising (a) an isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9; or
(b) an isolated polynucleotide encoding the polypeptide of (a) and a pharmaceutically acceptable carrier.
Claim 8
The pharmaceutical composition of claim 7, which is pharmaceutical composition for treating cancer.
Claim 9
A method for inducing apoptosis of endothelial cell, comprising administering to a subject in need thereof an effective amount of (a) an isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9; or (b) an isolated polynucleotide encoding the polypeptide of (a) .
Claim 10 A method for preventing or treating cancer, comprising administering to a subject in need thereof an effective amount of (a) an isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9; or (b) an isolated polynucleotide encoding the polypeptide of (a) .
Claim 11 An isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9 for use as a medicament.
Claim 12
An isolated polynucleotide encoding the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9 for use as a medicament.
Claim 13
Use of (a) an isolated polypeptide having the amino acid sequence of SEQ ID NO: 9 or the amino acid sequence having at least 90% sequence homology to the amino acid sequence of SEQ ID NO: 9; or (b) an isolated polynucleotide encoding the polypeptide of (a) , for preparation a pharmaceutical composition for treating cancer.
PCT/KR2008/000621 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity WO2008094012A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2009548159A JP2010526527A (en) 2007-02-01 2008-02-01 Novel polypeptide having antitumor activity
AU2008211884A AU2008211884A1 (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity
MX2009008270A MX2009008270A (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity.
EP08712277A EP2121739A4 (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity
KR1020097016040A KR20090111320A (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity
CA002676640A CA2676640A1 (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity
US12/854,843 US20110124582A1 (en) 2007-02-01 2010-08-11 Novel polypeptide having anti-tumor activity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US89870807P 2007-02-01 2007-02-01
US60/898,708 2007-02-01

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12525524 A-371-Of-International 2008-02-01
US12/854,843 Continuation US20110124582A1 (en) 2007-02-01 2010-08-11 Novel polypeptide having anti-tumor activity

Publications (1)

Publication Number Publication Date
WO2008094012A1 true WO2008094012A1 (en) 2008-08-07

Family

ID=39674265

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2008/000621 WO2008094012A1 (en) 2007-02-01 2008-02-01 Novel polypeptide having anti-tumor activity

Country Status (8)

Country Link
US (1) US20110124582A1 (en)
EP (1) EP2121739A4 (en)
JP (1) JP2010526527A (en)
KR (1) KR20090111320A (en)
AU (1) AU2008211884A1 (en)
CA (1) CA2676640A1 (en)
MX (1) MX2009008270A (en)
WO (1) WO2008094012A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2717913A2 (en) * 2011-06-08 2014-04-16 Indiana University Research and Technology Corporation Monoclonal antibody and antigens for diagnosing and treating lung disease and injury
US8835387B2 (en) 2012-02-16 2014-09-16 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US9422539B2 (en) 2010-07-12 2016-08-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US9587235B2 (en) 2013-03-15 2017-03-07 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US11767520B2 (en) 2017-04-20 2023-09-26 Atyr Pharma, Inc. Compositions and methods for treating lung inflammation

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100903984B1 (en) * 2005-02-01 2009-06-25 주식회사 이매진 Cosmetic composition for preventing skin aging, treating wrinkled skin, promoting smoothing and firming of the skin comprising AIMP1 polypeptide or fragments thereof as an active ingredient
JP5002603B2 (en) * 2006-01-23 2012-08-15 イマジェネ カンパニー リミテッド Novel peptides and uses thereof
WO2010099477A2 (en) 2009-02-27 2010-09-02 Atyr Pharma, Inc. Polypeptide structural motifs associated with cell signaling activity
DK3255146T3 (en) 2009-03-16 2019-08-19 Pangu Biopharma Ltd Compositions and Methods comprising Histidyl-tRNA Synthetase Splicing Variants with Non-Canonical Biological Activities
CA2783731C (en) 2009-12-11 2018-03-27 Atyr Pharma, Inc. Aminoacyl trna synthetases for modulating inflammation
US9714419B2 (en) 2011-08-09 2017-07-25 Atyr Pharma, Inc. PEGylated tyrosyl-tRNA synthetase polypeptides
US9822353B2 (en) 2011-12-06 2017-11-21 Atyr Pharma, Inc. PEGylated aspartyl-tRNA synthetase polypeptides
US9816084B2 (en) 2011-12-06 2017-11-14 Atyr Pharma, Inc. Aspartyl-tRNA synthetases
CA2858613A1 (en) 2011-12-29 2013-08-08 Atyr Pharma, Inc. Aspartyl-trna synthetase-fc conjugates
KR102292069B1 (en) * 2020-10-19 2021-08-20 대한민국 Pharmaceutical composition for cancer treatment comprising antimicrobial peptide derived from rock bream phospholipase as an active ingredient

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001095927A1 (en) * 2000-06-14 2001-12-20 Imagene Co., Ltd. P43 anti-tumor therapeutic agent and three dimensional structure of its cytokine domain
KR20020092596A (en) * 2001-06-05 2002-12-12 주식회사 이매진 Immunological enhancement agent comprising N-terminal peptide of p43 as an effective component
EP1384486A1 (en) * 2002-07-22 2004-01-28 Seoul National University Industry Foundation Use of p43 for stimulating wound healing
WO2006083087A1 (en) * 2005-02-01 2006-08-10 Imagene Co., Ltd. Method for stimulation collagen synthesis and/or kgf expression

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5155214A (en) * 1984-03-05 1992-10-13 The Salk Institute For Biological Studies Basic fibroblast growth factor
US5556645A (en) * 1990-01-12 1996-09-17 Bockman; Richard Methods of enhancing wound healing and tissue repair
US5981606A (en) * 1991-03-01 1999-11-09 Warner-Lambert Company Therapeutic TGF-beta-wound healing compositions and methods for preparing and using same
US5641867A (en) * 1993-09-29 1997-06-24 The Trustees Of Columbia University In The City Of New York Antibody which specifically binds to endothelial-monocyte activating polypeptide II
US6391311B1 (en) * 1998-03-17 2002-05-21 Genentech, Inc. Polypeptides having homology to vascular endothelial cell growth factor and bone morphogenetic protein 1
US6800286B1 (en) * 1998-08-19 2004-10-05 The Regents Of The University Of Colorado Chimeric fibroblast growth factor proteins, nucleic acid molecules, and uses thereof
US6306612B1 (en) * 1998-11-13 2001-10-23 Children Hospital Los Angeles Methods of facilitating vascular growth
JP5002603B2 (en) * 2006-01-23 2012-08-15 イマジェネ カンパニー リミテッド Novel peptides and uses thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001095927A1 (en) * 2000-06-14 2001-12-20 Imagene Co., Ltd. P43 anti-tumor therapeutic agent and three dimensional structure of its cytokine domain
KR20020092596A (en) * 2001-06-05 2002-12-12 주식회사 이매진 Immunological enhancement agent comprising N-terminal peptide of p43 as an effective component
EP1384486A1 (en) * 2002-07-22 2004-01-28 Seoul National University Industry Foundation Use of p43 for stimulating wound healing
WO2006083087A1 (en) * 2005-02-01 2006-08-10 Imagene Co., Ltd. Method for stimulation collagen synthesis and/or kgf expression

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAN J.M. ET AL.: "Structural separation of different extracellular activities in aminoacyl-tRNA synthetase-interacting multi-functional protein", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 342, no. 1, 31 March 2006 (2006-03-31), pages 113 - 118, XP005291574 *
PARK H. ET AL.: "Monocyte cell adhesion induced by a human aminoacyl-tRNA synthetase-assocated factor, p43: identification of the related adhesion molecules and signal pathways", J. LEUKOC. BIOL., vol. 71, no. 2, February 2002 (2002-02-01), pages 223 - 230, XP008110898 *
PARK S.G. ET AL.: "Dose-dependent biphasic activity of RNA synthetase-associating factor, p43, in angiogenesis", J. BIOL. CHEM., vol. 277, no. 47, 22 November 2002 (2002-11-22), pages 45243 - 45248, XP002261380 *
PARK S.G. ET AL.: "Functional and expansion of aminoacyl-tRNA synthetases and their interacting factors: new perspectives on housekeepers", TRENDS BIOCHEM. SCI., vol. 30, no. 10, October 2005 (2005-10-01), pages 569 - 574, XP005090075 *
See also references of EP2121739A4 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9422539B2 (en) 2010-07-12 2016-08-23 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US10669533B2 (en) 2010-07-12 2020-06-02 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Histidyl-tRNA synthetases
US10196628B2 (en) 2010-07-12 2019-02-05 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US9637730B2 (en) 2010-07-12 2017-05-02 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of histidyl-tRNA synthetases
US10450371B2 (en) 2011-06-08 2019-10-22 Indiana University Research And Technology Corporation Monoclonal antibody and antigens for diagnosing and treating lung disease and injury
EP2717913A4 (en) * 2011-06-08 2014-11-26 Univ Indiana Res & Tech Corp Monoclonal antibody and antigens for diagnosing and treating lung disease and injury
EP2717913A2 (en) * 2011-06-08 2014-04-16 Indiana University Research and Technology Corporation Monoclonal antibody and antigens for diagnosing and treating lung disease and injury
US9273302B2 (en) 2012-02-16 2016-03-01 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US8835387B2 (en) 2012-02-16 2014-09-16 Atyr Pharma, Inc. Histidyl-tRNA synthetases for treating autoimmune and inflammatory diseases
US9587235B2 (en) 2013-03-15 2017-03-07 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US10093915B2 (en) 2013-03-15 2018-10-09 Atyr Pharma Inc. Histidyl-tRNA synthetase-Fc conjugates
US10472618B2 (en) 2013-03-15 2019-11-12 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US10711260B2 (en) 2013-03-15 2020-07-14 Atyr Pharma, Inc. Histidyl-tRNA synthetase-Fc conjugates
US11072787B2 (en) 2013-03-15 2021-07-27 Atyr Pharma Inc. Histidyl-tRNA synthetase-Fc conjugates
US11767520B2 (en) 2017-04-20 2023-09-26 Atyr Pharma, Inc. Compositions and methods for treating lung inflammation

Also Published As

Publication number Publication date
AU2008211884A1 (en) 2008-08-07
CA2676640A1 (en) 2008-08-07
JP2010526527A (en) 2010-08-05
EP2121739A1 (en) 2009-11-25
MX2009008270A (en) 2009-08-12
EP2121739A4 (en) 2010-03-10
KR20090111320A (en) 2009-10-26
US20110124582A1 (en) 2011-05-26

Similar Documents

Publication Publication Date Title
US20110124582A1 (en) Novel polypeptide having anti-tumor activity
EP1811033B1 (en) Cell-permeable peptide inhibitors of the JNK signal transduction pathway
JP2022166225A (en) Peptides with anti-inflammatory activity, and composition comprising the same
EP1991560B1 (en) Peptide having cell membrane penetrating activity
KR102373603B1 (en) Peptide having fibrosis inhibitory activity and composition containing same
KR20220061282A (en) Anti-inflammatory Peptides and Composition comprising the same
US9409961B2 (en) Cell penetrating peptides to target EIF4E
WO2019118893A1 (en) Stabilized peptide-mediated targeted protein degradation
US9567369B2 (en) Method of treating metastatic cancer
WO2015055148A1 (en) Yap protein inhibiting polypeptide and application thereof
EP1403365B1 (en) Polypeptide unstabilizing protein in cells under aerobic conditions and dna encoding the same
JP2018504381A (en) Cell penetrating peptide
CN106589062B (en) Anti-tumor covalent polypeptide inhibitor targeting Grb2 protein and preparation method and application thereof
KR100843634B1 (en) Transmembrane Delivery Peptide and Bio-material Comprising the Same
JP2023520864A (en) COMPOSITION FOR CANCER TREATMENT CONTAINING VGLL1 PEPTIDE
US20090075948A1 (en) Compositions and methods for regulating cellular protection
CN115397513A (en) Improved anti-aging compounds and uses thereof
WO2020147508A1 (en) Polypeptide for inhibiting tumor metastasis and bone tumors, and use thereof
US20030224992A1 (en) Transcription factor modulators and uses thereof
WO2000017351A1 (en) New human hepatoma-derived growth factor encoding sequence and polypeptide encoded by such dna sequence and producing method thereof
AU2022201911A1 (en) Peptides targeting macrophages, and conjugates, compositions, and uses thereof
EP0963999A1 (en) E2f activity inhibitory compounds
Islam et al. Enhanced Translation of Rat β-Glucuronidase cDNA Is Conferred by 155-bp Segment of Internal Coding Sequence
CA2391881A1 (en) Transfer compounds, production and use thereof
WO2003057883A1 (en) The human hepatoma-derived growth factor 5, its coding sequence, the method of producing it and the uses of it

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08712277

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2676640

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1020097016040

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2009548159

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008211884

Country of ref document: AU

Ref document number: MX/A/2009/008270

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008712277

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008211884

Country of ref document: AU

Date of ref document: 20080201

Kind code of ref document: A