WO2008085605A2 - Backbone-free low transgene copy transgenic plants - Google Patents

Backbone-free low transgene copy transgenic plants Download PDF

Info

Publication number
WO2008085605A2
WO2008085605A2 PCT/US2007/084668 US2007084668W WO2008085605A2 WO 2008085605 A2 WO2008085605 A2 WO 2008085605A2 US 2007084668 W US2007084668 W US 2007084668W WO 2008085605 A2 WO2008085605 A2 WO 2008085605A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
agrobacterium
strain
vector
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/084668
Other languages
French (fr)
Other versions
WO2008085605A3 (en
Inventor
Stanton B. Gelvin
Heiko Oltmanns
Lan-Ying Lee
Bronwyn Frame
Kan Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Iowa State University Research Foundation Inc ISURF
Purdue Research Foundation
Original Assignee
Iowa State University Research Foundation Inc ISURF
Purdue Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Iowa State University Research Foundation Inc ISURF, Purdue Research Foundation filed Critical Iowa State University Research Foundation Inc ISURF
Priority to US12/514,180 priority Critical patent/US8334428B2/en
Publication of WO2008085605A2 publication Critical patent/WO2008085605A2/en
Publication of WO2008085605A3 publication Critical patent/WO2008085605A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation

Definitions

  • Agrobacterium tumefaciens has been widely used for introduction of genes into plants for basic research as well as for generation of commercially used transgenic crops.
  • the gene of interest is placed between the left and right border repeats of Agrobacterium T-(transferred) DNA.
  • T-DNA region harboring the transgene is stably integrated into the plant genome by using an appropriate plant transformation protocol.
  • T-DNA originates from the Agrobacterium Ti-(tumor inducing) plasmid, but because Ti- plasmids are large and difficult to manipulate, smaller T-DNA binary vectors are currently predominately used for generation of transgenic plants.
  • Agrobacterium-mQdiatQd transformation frequently results in unwanted high copy number T-DNA integration events.
  • Agrobacterium-mQdiatQd transformation generally results in lower transgene copy numbers than do other transformation methods such as particle bombardment or polyethylene glycol- mediated transformation.
  • multiple integration events often coupled with inverted repeat T-DNA integration patterns, may affect the stability of transgene expression by silencing mechanisms.
  • An additional problem with Agrobacterium-mQdiatQd transformation is the propensity for DNA sequences "outside" the T-DNA region to be carried along with or transferred independently of T-DNA and integrated into the plant genome.
  • transgenic plants preferably single transgene copy number, and no Agrobacterium T-DNA vector backbone sequence.
  • a major goal of scientists generating transgenic plants is to have a single copy integrated transgene (less likely to have problems with silencing), and no T-DNA vector backbone integration (fewer regulatory problems). Therefore, methods and compositions to generate backbone-free, low transgene copy number plants are desired.
  • T-DNA from the Agrobacterium tumefaciens chromosome reduces integrated transgene copy number and significantly reduces the presence of T-DNA backbone sequences.
  • Providing a low-copy number vector that is capable of replicating in Agrobacterium may also result in transgenic plants with lower transgene copy number and lower vector backbone sequences.
  • a method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant includes:
  • a suitable Agrobacterium strain includes EHAl 01 , GV3101 , and LBA4404 and a suitable plant material includes plant material from monocots and dicots.
  • a method to generate a transgenic plant with a single transgenic copy of the gene of interest includes:
  • a method to generate a transgenic plant without any vector backbone sequence includes: (a) obtaining an Agrobacterium strain including a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence includes the gene of interest; and
  • a method of obtaining an Agrobacterium strain capable of generating a transgenic plant with a single copy of a gene of interest in the absence of any vector backbone sequence includes:
  • a method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant includes:
  • Suitable bacterial strains capable of transforming plant cells are selected from the group of Agrobacterium spp., Bradyrhizobium spp., Rhizobium spp., Mesorhizobium spp., Ochrobactrum spp., Sinorhizobium spp. ,and Phyllobacterium spp. These bacterial species are capable of transferring DNA into a plant cell.
  • An Agrobacterium strain suitable for the methods described herein includes a T-DNA integrated into a chromosome of the Agrobacterium.
  • An Agrobacterium chromosomal integration vector includes a T-DNA and capable of integrating the T-DNA into the chromosome of the Agrobacterium, and for example a T-DNA is inserted into the pic A locus of the Agrobacterium chromosome. Any locus in Agrobacterium chromosome is suitable for use as a launching pad for T-DNA as long as the locus does not affect the growth and transformation ability of the Agrobacterium.
  • FIG. IA shows a schematic map of the T-DNA and neighboring regions used in constructing the various vectors described herein and the results of DNA dot blot analysis for transgene copy number and backbone integration.
  • black lines represent fragments used for hybridization experiments.
  • LB and RB T-DNA left and right borders, respectively; aadA, gene encoding spectinomycin resistance; TEV: enhancer, translational leader from Tobacco Etch Virus.
  • FIG. IB is a map of one of the binary vectors used in Agrobacterium transformation.
  • FIG. 1C is an example of a chromosomal integration vector.
  • FIG. ID shows development of an Agrobacterium strain to facilitate launching T-DNA from the Agrobacterium chromosome.
  • FIG. 2 shows transformation frequencies of Arabidopsis thaliana (A) and maize (B) with different Agrobacterium strain-by-origin of replication origin combinations.
  • Arabidopsis thaliana was transformed by a floral dip protocol, and maize was transformed by embryo inoculation protocol. Error bars represent the standard error among different transformation experiments. At least 5 independent transformation experiments were conducted for both Arabidopsis thaliana and maize. The total number of analyzed seeds for Arabidopsis (A) or infected embryos for maize (B) are indicated above each error bar.
  • FIG. 3 shows the percentage of plants containing a single copy of integrated T-DNA following transformation by the 14 T-DNA replication origin- by-Agrobacterium strain combinations for Arabidopsis thaliana (A) and maize (B). Copy number reconstructions were done by DNA dot blot experiments using T- DNA specific probes (FIG. 1). Analysis was performed on heterozygous Tl generation Arabidopsis thaliana plants and heterozygous regenerated TO generation maize plants. Numbers over the bars represent the number of independent events analyzed.
  • FIG. 4 shows the percentage of plants containing vector backbone sequences following transformation by the 14 T-DNA replication origin-by- Agrobacterium strain combinations for Arabidopsis thaliana (A) and maize (B). Blots were hybridized with a backbone-specific probe, the aadA gene (FIG. 1). Numbers over the bars represent the number of independent events analyzed.
  • FIG. 5 shows average transgene copy number for 14 T-DNA replication origins-by-A tumefaciens strain combinations for Arabidopsis thaliana (A) and maize (B). Numbers over the bars represent the number of independent events analyzed.
  • FIG. 6 is a Southern Blot analysis to determine T-DNA vector copy numbers in Agrobacterium caused by various replication origins.
  • the four T-DNA binary vectors were transformed into an Agrobacterium strain which has the bar gene integrated into its chromosome.
  • Total DNA was extracted from Agrobacterium cells grown under vir gene inducing and non-inducing conditions and subjected to Southern blot analysis using a bar fragment as a probe.
  • Two bands were visible after exposure: A band for the chromosomal integrated bar gene and a band for the bar gene on the binary vector. Copy numbers were calculated in relation to the chromosomal integration band (which represents 1 copy per cell).
  • FIG. 7 is a schematic representation of the experimental design for placing a gene of interest into the pgl/picA region of the A. tumefaciens C58.
  • Step 1 Introduction of the Starting Construction into A. tumefaciens C58 using bacterial mating or transformation.
  • Step 2 Introduction of an eviction plasmid by bacterial conjugation.
  • Step 3 Selection of the final transconjugants.
  • GOI gene of interest; car 1 , carbenicillin resistance gene; gen r , gentamicin resistance gene; tet r , tetracycline resistance gene.
  • FIG. 8 illustrates several maps of the Agrobacterium integration vectors described herein.
  • the plasmids are not necessary drawn to scale. Restriction enzyme sites in bold are unique on the plasmids.
  • B BamRl; Bg, BgIW; Bx, BstXl; Cl, CM; D, Dral; H, HmdIII; K, Kpnl; N, Notl; P, Pstl; RI, EcoKI; RV, EcoRY; SI, Sad; SII, Sacll; Sl, Sail; Sm, Smal; Sp, Spel; Xb, Xbal; Xh, Xhol.
  • FIG. 9 shows an example of a Southern hybridization to verify the integration of the gene of interest into the chromosomal pgl/picA locus of A. tumefaciens. DETAILED DESCRIPTION
  • T-DNA into the Agrobacterium tumefaciens chromosome reduces integrated transgene copy number and significantly reduces the presence of T-DNA backbone sequences.
  • Providing a low-copy number vector that is capable of replicating in Agrobacterium also results in transgenic plants with lower transgene copy number and lower vector backbone sequences.
  • Transformation frequency average integrated transgene copy number, % of transgenic plants with a single inserted transgene, and % of plant with no integrated vector backbone sequences were determined following transformation experiments.
  • Agrobacterium strains containing T-DNA integrated into, and "launched" from, the Agrobacterium chromosome generated lower transgene copy number that were vector backbone-free, as opposed to commonly used T-DNA plasmid binary vectors.
  • T-DNA tagged collections in Arabidopsis This value is similar to that of other T-DNA tagged collections in Arabidopsis.
  • the number of active loci in these plants is generally less than the number of integrated T-DNA molecules.
  • T-DNA insertions are frequently arranged as concatemers in directly or inverted repeat orientation.
  • a report showed that 70% of tested Arabidopsis transformants generated by a vacuum infiltration protocol carried direct or indirect tandem repeat copies of T- DNA.
  • the average T-DNA copy number in Arabidopsis ranged between 1.0 and 5.1, and in maize between 1.3 and 3.9 transgene copies per diploid genome (FIG. 4).
  • Arabidopsis plants that were generated by transformation using A. tumefaciens LBA4404 was lower than that resulting from transformation using the other tested strains.
  • the Agrobacterium strain, transformation method, and plant target tissue may influence the number of integrated T-DNA molecules.
  • T-DNA integration into the plant genome was experimentally shown almost 30 years ago, details are not known about how many T-DNA strands are produced in Agrobacterium and transferred to the plant cell. It is likely that considerably more T-strands are transferred than are integrated. T-DNA copy number in Agrobacterium differs with the various replication origins that were used. The T-DNA copy number of the T-DNA chromosomal integration construction in the bacterial cell is ' 1 ' (except during replication before cell partition). Low integrated transgene copy numbers in plants may result from a limited number of T-strands transferred to the plant cell. A report showed that T- DNA molecules delivered by mixed infection of various Agrobacterium strains could co-integrate.
  • T-DNA The integration of more than one T-DNA likely results from co-delivery of T-DNAs from two different Agrobacterium cells.
  • a low T-DNA copy number in Agrobacterium results in a low integrated transgene copy number in transformed plant cells, it would have been expected to see a correlation between bacterial and plant T-DNA copy number using the different T-DNA replication origins because they replicate to different extents in the bacteria.
  • a correlation was not present, based on the results disclosed herein for the binary vectors tested.
  • Agrobacterium chromosome almost eliminated the presence of T-DNA backbone sequences in both transgenic maize and Arabidopsis plants. Integration of binary vector backbone sequences is a common phenomenon observed in many plant transformations. Almost no backbone DNA was present in plants when plants were transformed with an Agrobacterium strain that carried the T-DNA on the chromosome (FIG. 4A). Similar results were obtained in maize transformation experiments (FIG. 4B). In contrast, 47-67% of the Arabidopsis plants generated by Agrobacterium strains harbouring a T-DNA binary vector contained integrated vector backbone sequences.
  • Vector backbone sequences relate to any portion of the vector sequence that is present outside of either the left border (LB) or the right border (RB) of the T- DNA sequence.
  • the vector backbone sequence that is integrated may be positioned adjacent and contiguous to the LB or the RB or the backbone sequence may be positioned at a certain distance from the LB or the RB, i.e., the vector backbone sequence may be positioned non-adjacent to the T-DNA.
  • the presence of the vector backbone sequence can be verified by dot blot hybridization with appropriate vector-derived probes, or by PCR amplification using appropriate primers, or by sequencing plant genomic DNA with appropriate sequence-specific primers.
  • Methods and compositions described herein generate transgenic plants without any vector backbone sequence or transgenic plants that have vector backbone sequences less than about 1% or less than about 5% or less than about 10% of the transformed plants.
  • the length of the vector backbone may range from 1 or 2 base pairs, or about 100-500 base pairs or to about a few kilo bases.
  • Transformation of plants with an Agrobacterium strain with a T-DNA integrated in the chromosome results in transgenic plants with vector backbone sequence in less than 10% of the transformed plants, or less than about 5% of the transformed plants or less than about 1% of the transformed plants. In preferred embodiments, all of the transformed plants contain transgenic DNA without any vector backbone sequence.
  • the percentage of T-DNA single copy plants obtained using the methodologies disclosed herein range from about 50-60 or about 50-75 or about 75-85 or about 85-90 or about 90.
  • Transfer of binary vector backbone sequences can occur when the T-DNA left border repeat is not recognized by the VirD2 endonuclease during processing of the T-DNA strand. It can also occur as a result of VirD2 linkage to the 5' end of the vector DNA directly outside the T-DNA left border, followed by transfer of the backbone in a manner analogous to that of T-DNA transfer. If the T-DNA strand is derived from a binary plasmid and during T-DNA processing the left border repeat is skipped, T-DNA processing will either end at a sequence in the backbone that resembles a T-DNA border or, due to the circular nature of binary vectors, when the right border repeat is reached.
  • T-DNA is integrated into the bacterial chromosome
  • read-through at the T-DNA left border repeat could result in very long T-DNAs, theoretically as long as the Agrobacterium chromosome itself if no adequate termination site is present. It is not fully known why transfer of long T-DNA, although possible, is less frequent than transfer of small T-DNAs.
  • the right border of a Ti-plasmid was inverted, at low frequency, the entire 190 kbp Ti-plasmid became integrated into the plant genome.
  • T-DNA transfer initiates from sequences directly to the left of the left T-DNA border
  • the resulting T-DNA may be too long for efficient transfer to the plant or integration into the plant genome.
  • sequences from the bacterial chromosome next to the T-DNA right border could be integrated into the plant genome, probing of the DNA membranes with an Agrobacterium aadA fragment failed to detect its presence.
  • Agrobacterium strains that confer high transformation frequencies because this could reduce both personnel and materials costs.
  • A. tumefaciens LBA4404 showed low transformation frequencies for Arabidopsis thaliana but transformed maize efficiently (compare FIG. 2A and 2B).
  • GV3101 showed the lower transformation frequencies for maize, and in contrast it was more efficient for Arabidopsis transformation.
  • a strict correlation between transformation frequency and integrated transgene copy numbers was not observed. This observation contradicts a generally prevalent concept that Agrobacterium strains which mediate high transformation frequencies are likely to cause high integrated transgene copy numbers.
  • Any suitable locus or target on an Agrobacterium chromosome can be used as long as (i) insertion at a locus does not significantly alter bacterial growth and viability, and (ii) insertion at a locus does not significantly impede the transformation process ⁇ e.g., insertion into a chromosomal virulence gene).
  • Agrobacterium spp., Rhizobium spp., Sinorhizobium spp., Mesorhizobium spp., Phyllobacterium spp. Ochrobactrum spp. and Bradyrhizobium spp. are suitable for use in plant transformation employing the methods and compositions described herein.
  • Chromosomal integration vectors are identified based on the known sequences of one or more loci of the bacterial species capable of transforming plants. Many of the non-Agrobacterium spp. may be equipped with one or more genes or plasmids derived from Agrobacterium to render them capable of transforming plants.
  • Agrobacterium tumefaciens strains include for example, EHAlOl, GV3101, LBA4404, EHA105, AGLO, and AGLl, LBA4404.
  • Other Agrobacterium species include for example, Agrobacterium vitis (K252), or Agrobacterium rhizogenes (A4).
  • One or more components of a chromosomal integration vector or any vector used herein may be operatively coupled to one or more promoter sequences.
  • a gene of interest may be linked to a tissue specific promoter and a selectable marker may be operatively coupled to a constitutive promoter. Appropriate translation termination signals can be incorporated into the vector.
  • a "universal recipient strain” (e.g., a universal Agrobacterium recipient strain) is developed, where the T-DNA is already integrated in a suitable chromosomal locus ⁇ e.g., in the picA locus of the Agrobacterium chromosome).
  • This T-DNA may have a suitable selectable marker (e.g., bar gene) and a small portion/fragment/region of a suitable vector sequence (e.g., pbluescript or any other commonly used bacterial cloning vector).
  • This recipient strain is used in conjunction with any suitable vector (e.g., pbluescript/puc-derived cloning vector (such as the pSAT vectors) that has a promoter, gene, and polyA.
  • this cloning vector When this cloning vector is introduced into Agrobacterium, it cannot replicate. However, it can recombine with the small portion of the cloning vector sequence (e.g., pbluescript) that is already inserted into the T-DNA.
  • a promoter- gene-polyA construct is made and is transformed into Agrobacterium and selected for any suitable marker encoded on the cloning vector (e.g., carb-resistance encoded on the pSAT vector). If the Agrobacterium strain is resistant to the marker encoded on the cloning vector, then the cloning vector sequence has co- integrated (recombined) into the T-DNA on the chromosome. Such co-integration can be experimentally verified by DNA blot hybridization.
  • present methods and compositions provide active and direct methods to use Agrobacterium chromosomes as specific launching pads for transferring T-DNA into a plant cell and thereby directly minimizing transgene copy number and reducing vector backbone integration in the transgenic plants.
  • the chromosomal vectors described herein target specific loci in Agrobacterium chromosomes.
  • the T-DNA used herein generally contains one or more genetic elements that are heterologous to Agrobacterium or any other bacterial species used in plant transformations.
  • a transgenic crop plant contains an exogenous polynucleotide molecule or a heterologous transgene either inserted into the genome of a crop plant cell or transiently expressed without stable integration.
  • Suspension cultures, embryos, meristems, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, ovules, pollen and microspores, and seeds, and fruit are generally referred to as plant material.
  • the vectors described herein may also include a coding region for a plant selectable marker gene, which may be located in the T-DNA, to select transformed plant cells with the corresponding reagent.
  • the plant selectable marker may provide resistance to a positive selection compound, for example, antibiotic resistance (e.g., kanamycin, hygromycin), or herbicide resistance.
  • the vectors described herein may also include one or more reporter genes.
  • a reporter gene may be present in addition to a selectable marker.
  • reporter genes include for example, the beta-glucuronidase (GUS), the chloramphenicol acetyl transferase, the green fluorescent protein (GFP) and luciferase.
  • Methods for transforming a plant cell include for example contacting at least a plant cell with a transformation bacteria of the present invention; and selecting the plant cell transformed with one or more heterologous transgenes.
  • Agronomically important traits such as improved nutritional value, increased biomass, resistance to environmental hazards such as drought, salinity, pathogens are engineered into a plant species of interest using the methods described herein. Any agriculturally relevant trait capable of being manipulated genetically is suitable to implement using the methods disclosed herein.
  • Any plant species that can be genetically transformed using a bacterial transformation system e.g., Agrobacterium
  • Suitable plant species include for example, apple, barley, canola, coffee, corn, cotton, grape, lettuce, lemon, lime, maize, mushroom, oat, peanut, pear, pepper, potato, rice, rye, sorghum, soybean, sugarbeet, sugarcane, sunflower, tobacco, tomato, and wheat.
  • Suitable plants include both monocots and dicots.
  • Example 1 A. tumefaciens strains and T-DNA constructions.
  • 83:529-5394 harbours a derivative of the agropine/L, L-succinamopine- type Ti-plasmid pTiBo542, GV3101 (Koncz and Schell, (1986), MoI. Gen. Genet. 204:383-396), a derivative of the nopaline-type Ti-plasmid pTiC58, and LBA4404 (Ooms et al., (1981), Gene 14:33-50) a derivative of the octopine-type Ti-plasmid pTiAch5.
  • the tested T-DNA vectors contain identical T-DNA regions plus an aadA gene for bacterial selection for spectinomycin resistance.
  • T-DNA integration into this locus does not affect transformation and vectors specifically designed to integrate genes into this locus by homologous recombination are described in Lee et al., (2001), incorporated herein by reference (Lee et al., (2001) MoI. Plant-Microbe Interact. 14:577-579).
  • a total of 14 different A. tumefaciens strains were analyzed.
  • the T-DNA region derived from the binary vector pTFlOl.l, harbours a bar gene as a plant selectable marker (de Block et al., (1987), EMBO J. 6:2513-2518) under the control of a CaMV double 35S promoter (FIG. 1).
  • Utilizing identical T-DNA regions with the same plant selectable marker and the identical non-T-DNA sequence proximal to the T-DNA left border in all constructions enabled to compare results obtained for transformation frequencies, integrated transgene copy numbers, and backbone integration for all strain-by- construct combinations.
  • Example 2 Effect of A. tumefaciens strain and T-DNA ori on transformation frequency.
  • FIG. 2A shows the transformation frequencies for Arabidopsis grouped as strain-by- replication origin combinations. Transformation frequency was dependent upon the A. tumefaciens strain utilized.
  • GV3101 resulted in the highest transformation frequencies (0.97-2.11%), whereas EHAlOl and LBA4404 effected medium (0.09-0.58%) and low (0.01-0.12%) transformation frequencies.
  • T-DNA replication origin as part of the binary vector, had little effect on transformation frequency with one significant exemption: Integration of T-DNA into the Agrobacterium chromosome of both EHAlOl and GV3101 resulted in transformation frequencies lower than those of the other four T-DNA binary systems of the respective strain. For EHAlOl the transformation frequency is 4- to 5 -fold lower, whereas for GV3101 the frequency is ⁇ 2-fold lower compared to the binary systems tested (FIG. 2A).
  • Example 3 Bacterial chromosomal integration of T-DNA results in a higher percentage of plants containing a single T-DNA copy.
  • FIG. 3A shows the percentage of plants containing a single transgene copy grouped as various strain-by-replication origin combinations. The percentage of single copy plants spans a wide range between 22% (GV3101, pVSl origin of replication) and 100% (LB4404, RK2 origin of replication). However, because of the extremely low transformation frequency, only two plants were obtained for the LB4404-by-RK2 origin combination.
  • T-DNA into the Agrobacterium chromosomal /?zc.4 locus, rather than on a T-DNA binary vector, resulted in 85% of the plants infected with EHAlOl and 75% of the plants infected with GV3101 containing a single transgene copy.
  • the percentage of T-DNA single copy plants resulting from other EHAlOl and GV3101 replication origin combinations (T- DNA on a binary vector) was much lower. Only 23-33% (EHAlOl) or 22-34% (GV3101) of the plants contained single copy transgenes.
  • LBA4404 (FIG. 2A), only a few plants were obtained for analysis.
  • the percentage of single transgene integration events of three of the four analyzed T-DNA binary vector replication origins in LBA4404 is higher than that of the respective replication origins in the other two bacterial strains (50-100% for LBA4404 versus 22-34% for EHAlOl and GV3101).
  • the average transgene copy number for the 14 analyzed strain-by-origin combinations corresponds to the percentage of single transgene integration events.
  • the average transgene copy number for chromosomal integration constructions is low (EHAlOl : 1.3 copies per diploid genome; GV3101 : 1.6 copies per diploid genome), in contrast to the average integrated transgene copy number using T-DNA binary vectors in EHAlOl and GV3101 (range 3.3-5.1 transgene copies/dip loid genome).
  • the average copy number for the four LBA4044 replication origin combinations is low and lies within a range between 1-2 copies.
  • FIG. 3B shows the percentage of maize plants containing a single transgene following transformation using various strain-by-origin combinations.
  • the percentage of plants carrying a single transgene copy varies significantly among the combinations and lies within a range between 22 and 75%.
  • both T-DNA chromosomal integration strain combinations result in a high percentage of single transgene copy number plants: 63% of the plants transformed using the EHAl 01 -by-chromosomal integration combination and 75% of plants transformed using the GV3101-by-chromosomal integration combination harbour a single integrated T-DNA.
  • only 17-45% of the plants generated using T-DNA binary vectors contain a single transgene copy.
  • FIG. 6 shows the results of the Southern blot analysis. Copy numbers of the analyzed replication origins vary greatly and are independent of the vir gene induction status. The binary vector copy numbers caused by the pVS, the pSa, and the RK2 replication origins correspond to previous reports in the literature. The pRi copy number (-15-20) is higher than previous findings.
  • Example 4 Integration of T-DNA into the Agrobacterium chromosome mitigates integration of T-DNA backbone sequences in transgenic plants.
  • T-DNA backbone sequences are frequently introduced into plants during Agrobacterium-mediated transformation. Such sequences can present regulatory problems, especially when bacterial antibiotic resistance genes are transferred. It was investigated whether the Agrobacterium strain or T-DNA replication origin affects the frequency of backbone integration events. All five analyzed T-DNA constructions contain a bacterial spectinomycin resistance (aadA) gene immediately outside the T-DNA left border, to probe all transgenic plant DNA samples for the presence of backbone sequences with an aadA gene fragment (FIG. 1).
  • aadA bacterial spectinomycin resistance
  • FIGS. 4A and 4B show the percentage of transgenic plants with backbone integration events for the 14 strain-by-origin combinations in Arabidopsis and maize, respectively.
  • Arabidopsis thaliana and maize almost no transgenic plants contained backbone sequences when they were generated by Agrobacterium strains in which the T-DNA was integrated into the chromosome, whereas the use of a T-DNA binary vector resulted in a relatively high percentage of plants containing backbone sequences.
  • Vox Arabidopsis only one out of 40 plants that was generated by using the GV3101-by-chromosomal integration combination contained backbone sequences.
  • T-DNA is processed from a low copy number replicon (such as the chromosome), there are likely to be fewer copies processed in Agrobacterium.
  • Agrobacterium is in a plant environment to transfer, the Ti-plasmid over- replicates 5-10 fold with respect to the chromosome and data indicate that up to 14 copies of T-DNA can be processed (repeatedly) from the same Ti-plasmid. Based on this, when a high copy number binary vector is used, it is expected that a large number of T-strands are processed to be transferred.
  • T-DNA is integrated into a very large replicon (the chromosome), for example, if the left border (LB) is "skipped", this may result in a long stretch of transfer DNA (because in a chromosome it may take a long distance to stop at a sequence that resembles the border sequence, i.e., pseudoborder).
  • LB left border
  • Such a long T-strand may not be able to exit the bacterium efficiently and therefore may not transverse the plant cytoplasm and may not integrate into the plant chromosome. Therefore, launching of T-DNA from Agrobacterium chromosome may screen out integration of vector backbone sequences into plant genome.
  • Example 5 Construction of chromosomal integration vectors and integrating a gene of interest into Agrobacterium chromosome.
  • a chromosomal insertion site of a genetic element generally may not affect either bacterial virulence or growth rate of Agrobacterium.
  • a plant- inducible locus on the Agrobacterium chromosome (picA) is not required either for bacterial growth or T-DNA transfer.
  • the picA and neighboring pgl (polygalacturonase like) genes are located on a 3.15-kbp EcoRl fragment of the chromosome of A. tumefaciens C58. A Pstl site exists between these two genes.
  • Insertion of a gene into this Pstl site leaves enough length of DNA sequence on both sides (1.3 kb and 1.8 kb, respectively) to allow efficient double homologous recombination into the bacterial chromosome.
  • This EcoBl fragment was cloned onto an IncP ⁇ plasmid, pLAFRl, to make a basic integration vector pE578.
  • the basic vector was modified and several features were added.
  • FIG. IB-D show examples of illustrations of chromosomal integration vectors and generation of launching pads for T-DNA integration into plant genomes.
  • Groups of vectors may contain a lacZ ⁇ -complementation fragment that has unique restriction enzyme sites (Kpnl, Hindl ⁇ l, EcoKl, Pstl, Ban ⁇ l, Spel, Xbal, and Sad) between the picA and pgl genes and examples are shown in FIG. 8.
  • unique restriction enzyme sites Kpnl, Hindl ⁇ l, EcoKl, Pstl, Ban ⁇ l, Spel, Xbal, and Sad
  • FIG. 8 Using blue -white colony screening these sites are used to clone a gene of interest (GOI) and a selectable antibiotic resistance marker into these sites.
  • the antibiotic resistance marker is used as an indicator of gene replacement in subsequent steps of the procedure.
  • the GOI is cloned into a cloning vector containing a CoIEI replication ori (such as pUC or pBluescript) first, and then cointegrate the entire plasmid into one of the unique restriction enzyme sites in the lacZ ⁇ -complementation fragment.
  • a CoIEI replication ori such as pUC or pBluescript
  • the ⁇ -lactamase (ampicillin/carbenicillin resistance) gene on the backbone of this cloning plasmid can also be used as a selection marker to determine whether the GOI has integrated onto the Agrobacterium chromosome.
  • a ⁇ -lactamase gene can also be inserted into the pgllpicA locus to allow for the introduction of GOI (e.g., pE1931 and pE1963, FIG. 8).
  • the sacR and sacB genes from Bacillus subtilis can also be included on the plasmid backbones instead of a ⁇ -lactamase gene (e.g., pE1962 and pE1963, FIG. 8). Because the sacB gene product metabolizes sucrose to a toxic compound, sucrose containing medium is used to select for double crossover recombinants (and the loss of the sacB containing vector) at the pgllpicA locus of A. tumefaciens C58. Blue-white colony screening can also be used to clone GOI into the plasmids.
  • the GOI is placed between the pgl ⁇ n ⁇ picA genes on any suitable vector to make the "Starting Construction".
  • the Starting Construction is introduced into A. tumefaciens C58 (or any suitable strain) either by bacterial conjugation (triparental mating), transformation, or electroporation to make the "Starting Strain”.
  • Transconjugants which are resistant to both the antibiotic marker introduced near the GOI and the antibiotic resistance marker on the backbone of the eviction plasmid are selected. Because the integration vectors and the eviction plasmids belong to the same IncP ⁇ incompatibility group, they cannot co-reside as replicons in the same bacterial cell. These transconjugants, which are resistant to both antibiotics, will fall into two possible categories. The first category are bacteria that contain the entire starting plasmid integrated into the chromosome DNA through a single crossover recombination event (a plasmid co-integrate).
  • the second category are bacteria with the GOI and selection marker exchanged into the pgllpicA locus through double homologous recombination. Whether these transconjugants are resistant to the antibiotic encoded by the resistance marker on the backbone of the Starting Construction (for these plasmids, tetracycline) can be checked. If the transconjugant is resistant to tetracycline, this indicates that the strain has the entire Starting Construction integrated into the chromosome. This type of transconjugant is generally discarded. Only those transconjugants which are sensitive to tetracycline are kept. Finally, one needs to extract total genomic DNA from these transconjugants.
  • Lane 2-10 are 9 individual clones which may or may not have the integration of the GOI.
  • Lane 11 is A. tumefaciens strain C58. Solid black indicates the intact 3.15-kbp pgllpicA locus from the wild type A. tumefaciens chromosome (Lane 1 and Lane 11). Line arrow indicates DNA fragments from the disrupted pgllpicA locus on the Starting Construction (Lane 1). Note that the intensity of the DNA band from the chromosome (single copy) is lower than that of the disrupted locus from the multiple copy plasmid. Results from the genomic DNA samples of Lane 5 and Lane 8 indicate that these two A.
  • tumefaciens strains contain the GOI integrated in the chromosomal region (note that the intensity of the DNA bands is similar to that of the chromosomal locus).
  • results from Lane 2-4, Lane 6-7 and Lane 10 suggest these A. tumefaciens strains do not have the GOI integrated (same pattern as Lane 11).
  • Lane 9 shows that the A. tumefaciens strain has both a wild-type and a disrupted copy of the pgl/picA locus, indicating that this strain carries the entire Starting construction as a co-integrate in its chromosome.
  • the GOI is stably maintained in this Agrobacterium strain at a single copy per cell without applying selection pressure.
  • Agrobacterium tumefaciens strains were grown either on solidified AB sucrose medium (Lichtenstein and Draper, (1986), In Genetic Engineering of Plants, Vol. 2 (Glover, D.M., ed.). Washington, DC: IRL Press, pp. 67-119) or in yeast extract peptone medium supplemented with appropriate antibiotics (rifampicin, 10 ⁇ g/ml; spectinomycin, 100 ⁇ g/ml; kanamycin, 25 ⁇ g/ml; gentamicin, 25 ⁇ g/ml).
  • solidified AB sucrose medium Liichtenstein and Draper, (1986), In Genetic Engineering of Plants, Vol. 2 (Glover, D.M., ed.). Washington, DC: IRL Press, pp. 67-119) or in yeast extract peptone medium supplemented with appropriate antibiotics (rifampicin, 10 ⁇ g/ml; spectinomycin, 100 ⁇ g/ml;
  • FIG.l used in all T-DNA binary constructions derives from pTFlOl.l, whose DNA sequence is described herein.
  • pTFlOl.l contains a pVSl origin of replication.
  • the pVS 1 replication origin ori
  • the pVSl origin was removed from pTFlOl.l using Seal and Notl and replaced it with a Notl/Nrul fragment from pBIN19, generating pTF::Binl9.
  • the pVSl ori was removed from pTFlOl.l using Seal and Nsil and replaced it with a Pstl/Sac ⁇ l fragment from pUCD2. All overhanging ends were made blunt using T4 DNA polymerase (New England Biolabs, Ipswich, MA, USA) to enable ligation.
  • the resulting plasmid was designated pTF::UCD2.
  • the pRiA4b origin was amplified from A. rhizogenes strain A4 (Jouanin et al., (1986), Plasmid 16:124- 134) using PCR primers.
  • pBluescript::Ri The amplified PCR fragment was cloned into pBluescript SK+ (Stratagene, La Jolla, CA) and designated pBluescript::Ri.
  • pBluescript::Ri was transformed into A. tumefaciens by electroporation (Nagel et al, (1990), FEMS Microbiol. Lett. 67:325-328) and plasmid DNA was isolated from carbenicillin-resistant colonies.
  • pBluescript::pRi was digested with CIaI and the overhanging ends were made blunt using T4 DNA polymerase. The product was subsequently digested with Notl and cloned into pTFlOl.l prior digested with Seal and Notl to remove the pVSl replication origin. The resulting plasmid was designated pTF::Ri.
  • T-DNA vectors pTFlOl.l, pTF::Binl9, pTF::UCD2 and pTF::Ri were separately transformed into A. tumefaciens EHAlOl (Hood et al., 1987), GV3101 (Koncz and Schell, 1986), and LBA4404 (Ooms et al., 1981) by electroporation (Nagel et al., 1990).
  • the T-DNA region plus the aadA gene of pTFlOl .1 (a 4.2 kb Scal-Nsil fragment) was inserted into the blunted Spel site and Pstl site of the integration vector pE1931.
  • This plasmid (pE2759) was separately introduced into A. tumefaciens EHAlOl and GV3101.
  • the eviction plasmid pPHUI was introduced into the resulting strains, and colonies were selected on gentamicin and carbenicillin.
  • Tetracycline-sensitive colonies (which had lost pE2759) were selected, and recombination of the T-DNA region into the pgllpicA locus of the Agrobacterium chromosome was confirmed by DNA blot hybridization (Lee et al., 2001).
  • Agrobacterium-mediated transformation of Arabidopsis thaliana and maize [00078] All 14 Agrobacterium strain-by-replication origin combinations were utilized to transform Arabidopsis thaliana and maize.
  • Arabidopsis thaliana ecotype Wassilewskija, Ws2 was transformed by a floral dip protocol (Clough and Bent, 1998).
  • Phosphinothricin resistant plants were selected on Gamborg's B5 Medium (Caisson Laboratories, Rexburg, ID) supplemented with 10 ⁇ g/ml phosphinothricin and 100 ⁇ g/ml timentin. Transformation frequencies were calculated as follows: [Number of phosphinothricin resistant plants/number of seeds tested] x 100.
  • Genomic DNA was extracted from 3-5 leaves of 3-4 week old Arabidopsis thaliana plants or approximately 100 mg maize leaf tissue (Murray and Thompson (1980), Nucl. Acids Res. 8:4321 4325). Genomic DNA was quantified using a Gemini XPS microplate spectrofluorometer (Molecular Devices, Sunnyvale, CA, USA, excitation: 488 nm emission: 525 nm) and the Quant-iTTM PicoGreen® dsDNA Assay Kit (Invitrogen Inc.; Carlsbad, CA, USA).
  • DNA dot blots were prepared to determine T-DNA copy numbers and the frequency of T-DNA backbone integration events.
  • Arabidopsis (75 ng) or maize (1.5 ⁇ g) genomic DNA samples were denatured by adding NaOH and EDTA to a final concentration of 0.4 M and 10 mM, respectively, followed by 10 min incubation in boiling water.
  • a Hybond N+ nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ, USA) was pre-wetted with water and placed between the layers of the dot blot apparatus. Samples were applied to the wells of the dot blot apparatus, incubated for 30 min, and then drawn onto the nylon membrane using a gentle vacuum.
  • DNA was cross-linked to the membrane by using a CL-1000 UV crosslinker (UVP, Upland, CA). The membranes were incubated in 2xSSC for 10 min and dried.
  • membranes were washed 2 times with 2xSSC, 0.1% (w/v) SDS, 10 mM EDTA (pH 8.0), then 2 times with IxSSC, 0.1% (w/v) SDS, 10 mM EDTA and finally 2 times with O.lxSSC, 0.1% (w/v) SDS, 10 mM EDTA at 65°C.
  • Membranes were exposed at - 80 0 C for autoradiography. Integrated dot density was determined using Labworks 4.6 Image Acquisition and Analysis Software (UVP, Upland, CA). For re-probing, membranes were stripped using boiling 0.1% (w/v) SDS twice.
  • DNA dot blot membranes were hybridized subsequently with various probes.
  • dot blot membranes were hybridized with a 559 bp bar PCR fragment (FIG.l).
  • the PCR fragment was amplified using pTFlOl .1 as template and 5'-GAT CTA CCA TGA GCC CAG AAC G-3' (SEQ ID NO: 1) and 5'-CAG ATC TCG GTG ACG GGC AGG A-3'(SEQ ID NO: 2) as primers.
  • membranes were probed with a 759 bp PstVXhol fragment from pTF 101.1 harbouring the double CaMV 35S promoter (FIG. 1 ) .
  • a 656 bp PCR fragment derived from the non-T-DNA region next to the T-DNA left border of pTFlOl .1 (FIG. 1) was used as a probe.
  • the fragment was amplified using pTFlOl.l as a template and 5'-TCA CCG TAA CCA GC AAA TCA-3' (SEQ ID NO: 3) and 5'-CTC GGC ACA AAA TCA CCA CT-3' (SEQ ID NO: 4) as primers.
  • a 3.1 kb EcoKl fragment containing the pgllpicA locus (Rong et al., (1990), J. Bacteriol. 173, 5110-5120) was used as a probe to check for the presence of contaminating Agrobacterium DNA in plant genomic DNA. All DNA fragments were gel purified prior to labelling using a QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany). In order to normalize amounts of DNA in each dot, membranes were hybridized with genomic Arabidopsis or maize DNA.
  • Triparental mating (conjugation): 1. Grow 5 ml liquid cultures of each bacterial strain overnight: A. tumefaciens containing the C58 chromosomal background (resistant to rifampicin), E. coli strain E9 (resistant to gentamicin), and the E. coli strain containing the Starting Construction (let's assume this strain is resistant to both ampicillin from the selectable marker near the GOI, and tetracycline from the backbone of the integration vector) obtained herein.
  • E. coli strain E618 can be used when an Agrobacterium strain is already resistant to gentamicin. This strain contains pVK102, which carries kanamycin and tetracycline resistance genes.
  • pE1770 or pE1773 can be used. If a GOI needs to be placed into an integration vector that already contains a selectable marker, pE1931 or pE1963 can be used. If the sucrose counter- selection method, pE1963 or pE1962 can be used (FIG. 8). Alternatively, plasmid DNA from the Agrobacterium transconjugant can be extracted and E. coli can be re-transformed with this plasmid DNA. If the new E.
  • coli transformants are now resistant to both markers (in this case, they are ampicillin and tetracycline) from the Starting Construction, this suggests that this Agrobacterium transconjugant does contain the Starting Construction. 10. Dissolving bacterial genomic DNA takes longer at a higher concentration. The tube containing the DNA may be incubated at 37°C for about 30 minutes to dissolve the DNA. Alternatively, more TE buffer can be used to dissolve the DNA. Vortexing the DNA is not recommended as it will shear the DNA.
  • pTFlOl.l FIG. 1 nucleotide sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Methods and compositions reduce copy number of transgenes and minimizing vector backbone sequences in plant transformation. Bacterial strains including Agrobacterium strains with T-DNA integrated into the chromosomal DNA reduce the copy number and vector backbone sequences. Chromosomal integration vectors to integrate T-DNA into a specific locus of Agrobacterium chromosome are disclosed.

Description

BACKBONE-FREE LOW TRANSGENE COPY TRANSGENIC PLANTS
[0001] The United States Government may have rights to this invention pursuant to NSF Fund No. 501-1392-0542, Award No. NTP0542.
BACKGROUND
[0002] Agrobacterium tumefaciens has been widely used for introduction of genes into plants for basic research as well as for generation of commercially used transgenic crops. For plant transformation, the gene of interest is placed between the left and right border repeats of Agrobacterium T-(transferred) DNA. Generally, the T-DNA region harboring the transgene is stably integrated into the plant genome by using an appropriate plant transformation protocol. T-DNA originates from the Agrobacterium Ti-(tumor inducing) plasmid, but because Ti- plasmids are large and difficult to manipulate, smaller T-DNA binary vectors are currently predominately used for generation of transgenic plants.
[0003] Despite the fact that Agrobacterium has been commonly used for plant transformation for more than two decades, some problems using this bacterium still remain: Agrobacterium-mQdiatQd transformation frequently results in unwanted high copy number T-DNA integration events. Agrobacterium-mQdiatQd transformation generally results in lower transgene copy numbers than do other transformation methods such as particle bombardment or polyethylene glycol- mediated transformation. However, multiple integration events, often coupled with inverted repeat T-DNA integration patterns, may affect the stability of transgene expression by silencing mechanisms. An additional problem with Agrobacterium-mQdiatQd transformation is the propensity for DNA sequences "outside" the T-DNA region to be carried along with or transferred independently of T-DNA and integrated into the plant genome. Integration of such vector "backbone" sequences can occur with high frequency. In one study, backbone sequences were detected in 75% of tested transgenic tobacco plants, and often the entire vector "backbone"' is introduced into the plant genome. Although there is no evidence in the literature that the presence of vector backbone sequences affects transgene expression, T-DNA vector backbones usually harbor bacterial antibiotic resistance genes that can create governmental regulatory problems. [0004] A current goal in agricultural biotechnology is to make plants with low
(preferably single) transgene copy number, and no Agrobacterium T-DNA vector backbone sequence. A major goal of scientists generating transgenic plants is to have a single copy integrated transgene (less likely to have problems with silencing), and no T-DNA vector backbone integration (fewer regulatory problems). Therefore, methods and compositions to generate backbone-free, low transgene copy number plants are desired.
SUMMARY
[0005] Launching of T-DNA from the Agrobacterium tumefaciens chromosome reduces integrated transgene copy number and significantly reduces the presence of T-DNA backbone sequences. Providing a low-copy number vector that is capable of replicating in Agrobacterium may also result in transgenic plants with lower transgene copy number and lower vector backbone sequences.
[0006] A method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant includes:
(a) obtaining an Agrobacterium strain including a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence includes a gene of interest flanked by T-DNA border repeat sequences; and
(b) transforming a suitable host plant material with the Agrobacterium, thereby reducing transgene copy number and minimizing vector backbone sequence in the resulting transgenic plant.
[0007] A suitable Agrobacterium strain includes EHAl 01 , GV3101 , and LBA4404 and a suitable plant material includes plant material from monocots and dicots.
[0008] A method to generate a transgenic plant with a single transgenic copy of the gene of interest includes:
(a) obtaining an Agrobacterium strain including a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence includes the gene of interest; and
(b) transforming a suitable host plant material with the Agrobacterium, thereby generating the transgenic plant with a single copy of the gene of interest.
[0009] A method to generate a transgenic plant without any vector backbone sequence includes: (a) obtaining an Agrobacterium strain including a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence includes the gene of interest; and
(b) transforming a suitable host plant material with the Agrobacterium, thereby generating the transgenic plant without any vector backbone sequence.
[00010] A method of obtaining an Agrobacterium strain capable of generating a transgenic plant with a single copy of a gene of interest in the absence of any vector backbone sequence includes:
(a) obtaining an integration vector including a gene of interest in a T-DNA sequence and a sequence to mediate chromosomal integration into the Agrobacterium chromosome; and
(b) transforming the Agrobacterium with the integration vector; and
(c) obtaining the Agrobacterium strain wherein the T-DNA is integrated into the Agrobacterium chromosome.
[00011] A method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant includes:
(a) obtaining a bacterial strain capable of transforming a plant cell, the bacterial strain comprising a DNA sequence of interest integrated into the bacterial chromosome, wherein the DNA sequence of interest is capable of being delivered into a plant cell; and
(b) transforming a suitable host plant material with the bacterial strain, thereby reducing transgene copy number and minimizing vector backbone sequence in the resulting transgenic plant.
[00012] Suitable bacterial strains capable of transforming plant cells are selected from the group of Agrobacterium spp., Bradyrhizobium spp., Rhizobium spp., Mesorhizobium spp., Ochrobactrum spp., Sinorhizobium spp. ,and Phyllobacterium spp. These bacterial species are capable of transferring DNA into a plant cell.
[00013] An Agrobacterium strain suitable for the methods described herein includes a T-DNA integrated into a chromosome of the Agrobacterium.
[00014] An Agrobacterium chromosomal integration vector includes a T-DNA and capable of integrating the T-DNA into the chromosome of the Agrobacterium, and for example a T-DNA is inserted into the pic A locus of the Agrobacterium chromosome. Any locus in Agrobacterium chromosome is suitable for use as a launching pad for T-DNA as long as the locus does not affect the growth and transformation ability of the Agrobacterium.
BRIEF DESCRIPTION OF THE DRAWINGS
[00015] FIG. IA shows a schematic map of the T-DNA and neighboring regions used in constructing the various vectors described herein and the results of DNA dot blot analysis for transgene copy number and backbone integration. In the vector map, black lines (probes) represent fragments used for hybridization experiments. LB and RB: T-DNA left and right borders, respectively; aadA, gene encoding spectinomycin resistance; TEV: enhancer, translational leader from Tobacco Etch Virus. FIG. IB is a map of one of the binary vectors used in Agrobacterium transformation. FIG. 1C is an example of a chromosomal integration vector. FIG. ID shows development of an Agrobacterium strain to facilitate launching T-DNA from the Agrobacterium chromosome.
[00016] FIG. 2 shows transformation frequencies of Arabidopsis thaliana (A) and maize (B) with different Agrobacterium strain-by-origin of replication origin combinations. Arabidopsis thaliana was transformed by a floral dip protocol, and maize was transformed by embryo inoculation protocol. Error bars represent the standard error among different transformation experiments. At least 5 independent transformation experiments were conducted for both Arabidopsis thaliana and maize. The total number of analyzed seeds for Arabidopsis (A) or infected embryos for maize (B) are indicated above each error bar.
[00017] FIG. 3 shows the percentage of plants containing a single copy of integrated T-DNA following transformation by the 14 T-DNA replication origin- by-Agrobacterium strain combinations for Arabidopsis thaliana (A) and maize (B). Copy number reconstructions were done by DNA dot blot experiments using T- DNA specific probes (FIG. 1). Analysis was performed on heterozygous Tl generation Arabidopsis thaliana plants and heterozygous regenerated TO generation maize plants. Numbers over the bars represent the number of independent events analyzed.
[00018] FIG. 4 shows the percentage of plants containing vector backbone sequences following transformation by the 14 T-DNA replication origin-by- Agrobacterium strain combinations for Arabidopsis thaliana (A) and maize (B). Blots were hybridized with a backbone-specific probe, the aadA gene (FIG. 1). Numbers over the bars represent the number of independent events analyzed.
[00019] FIG. 5 shows average transgene copy number for 14 T-DNA replication origins-by-A tumefaciens strain combinations for Arabidopsis thaliana (A) and maize (B). Numbers over the bars represent the number of independent events analyzed.
[00020] FIG. 6 is a Southern Blot analysis to determine T-DNA vector copy numbers in Agrobacterium caused by various replication origins. To estimate the copy number of the T-DNA binary vectors in the bacterial cell, the four T-DNA binary vectors were transformed into an Agrobacterium strain which has the bar gene integrated into its chromosome. Total DNA was extracted from Agrobacterium cells grown under vir gene inducing and non-inducing conditions and subjected to Southern blot analysis using a bar fragment as a probe. Two bands were visible after exposure: A band for the chromosomal integrated bar gene and a band for the bar gene on the binary vector. Copy numbers were calculated in relation to the chromosomal integration band (which represents 1 copy per cell).
[00021] FIG. 7 is a schematic representation of the experimental design for placing a gene of interest into the pgl/picA region of the A. tumefaciens C58. Step 1 : Introduction of the Starting Construction into A. tumefaciens C58 using bacterial mating or transformation. Step 2: Introduction of an eviction plasmid by bacterial conjugation. Step 3: Selection of the final transconjugants. GOI, gene of interest; car1, carbenicillin resistance gene; genr, gentamicin resistance gene; tetr, tetracycline resistance gene.
[00022] FIG. 8 illustrates several maps of the Agrobacterium integration vectors described herein. The plasmids are not necessary drawn to scale. Restriction enzyme sites in bold are unique on the plasmids. B, BamRl; Bg, BgIW; Bx, BstXl; Cl, CM; D, Dral; H, HmdIII; K, Kpnl; N, Notl; P, Pstl; RI, EcoKI; RV, EcoRY; SI, Sad; SII, Sacll; Sl, Sail; Sm, Smal; Sp, Spel; Xb, Xbal; Xh, Xhol.
[00023] FIG. 9 shows an example of a Southern hybridization to verify the integration of the gene of interest into the chromosomal pgl/picA locus of A. tumefaciens. DETAILED DESCRIPTION
[00024] Integration of T-DNA into the Agrobacterium tumefaciens chromosome reduces integrated transgene copy number and significantly reduces the presence of T-DNA backbone sequences. Providing a low-copy number vector that is capable of replicating in Agrobacterium also results in transgenic plants with lower transgene copy number and lower vector backbone sequences.
[00025] Fourteen combinations of T-DNA binary vector systems with various commonly used Agrobacterium strains were tested in Arabidopsis and maize. Transformation frequency, average integrated transgene copy number, % of transgenic plants with a single inserted transgene, and % of plant with no integrated vector backbone sequences were determined following transformation experiments. Agrobacterium strains containing T-DNA integrated into, and "launched" from, the Agrobacterium chromosome generated lower transgene copy number that were vector backbone-free, as opposed to commonly used T-DNA plasmid binary vectors.
[00026] The effect of three commonly used A. tumefaciens strains and five T-DNA replication origins on transformation efficiency and the "quality" of T-DNA integration events in Arabidopsis thaliana and maize were analyzed. Integration of T-DNA into the Agrobacterium chromosome rather than by use of T-DNA binary vectors, surprisingly, resulted in fewer integrated transgenes and almost eliminated the presence of T-DNA binary backbone sequences in plants. These two aspects of plant transformation were accompanied by a decreased transformation frequency. In Arabidopsis, this decrease is slight (2- to 4-fold), but somewhat more substantial in maize (5- to 10-fold). However, this decrease in transformation frequency or efficiency is generally offset by the increased likelihood of generating single copy transgenic plant that is vector backbone-free.
[00027] Stable and predictable transgene expression has become a major objective for both basic and applied research. Multiple integrated T-DNA copies, especially when combined with complex T-DNA integration patterns, can trigger transgene silencing. The routine generation of single-copy transgenic events is therefore a major goal for agricultural biotechnology. "Launching" T-DNA from the Agrobacterium chromosome, as disclosed herein, thus, provides a novel approach to improve plant biotechnology. [00028] Several studies have analyzed T-DNA locus and/or copy numbers in transgenic Arabidopsis. A report concluded that the average number of independently segregating, active transgene loci in an initial library of T-DNA tagged plants is 1.4. This value is similar to that of other T-DNA tagged collections in Arabidopsis. However, the number of active loci in these plants is generally less than the number of integrated T-DNA molecules. T-DNA insertions are frequently arranged as concatemers in directly or inverted repeat orientation. A report showed that 70% of tested Arabidopsis transformants generated by a vacuum infiltration protocol carried direct or indirect tandem repeat copies of T- DNA. In the present disclosure, the average T-DNA copy number in Arabidopsis ranged between 1.0 and 5.1, and in maize between 1.3 and 3.9 transgene copies per diploid genome (FIG. 4).
[00029] Interestingly, the average transgene copy number of both maize and
Arabidopsis plants that were generated by transformation using A. tumefaciens LBA4404 was lower than that resulting from transformation using the other tested strains. The Agrobacterium strain, transformation method, and plant target tissue may influence the number of integrated T-DNA molecules.
[00030] Although T-DNA integration into the plant genome was experimentally shown almost 30 years ago, details are not known about how many T-DNA strands are produced in Agrobacterium and transferred to the plant cell. It is likely that considerably more T-strands are transferred than are integrated. T-DNA copy number in Agrobacterium differs with the various replication origins that were used. The T-DNA copy number of the T-DNA chromosomal integration construction in the bacterial cell is ' 1 ' (except during replication before cell partition). Low integrated transgene copy numbers in plants may result from a limited number of T-strands transferred to the plant cell. A report showed that T- DNA molecules delivered by mixed infection of various Agrobacterium strains could co-integrate. The integration of more than one T-DNA likely results from co-delivery of T-DNAs from two different Agrobacterium cells. However, if a low T-DNA copy number in Agrobacterium results in a low integrated transgene copy number in transformed plant cells, it would have been expected to see a correlation between bacterial and plant T-DNA copy number using the different T-DNA replication origins because they replicate to different extents in the bacteria. Surprisingly, however, contrary to expectations, such a correlation was not present, based on the results disclosed herein for the binary vectors tested.
[00031] Based on the data presented herein, the integration of T-DNA into the
Agrobacterium chromosome almost eliminated the presence of T-DNA backbone sequences in both transgenic maize and Arabidopsis plants. Integration of binary vector backbone sequences is a common phenomenon observed in many plant transformations. Almost no backbone DNA was present in plants when plants were transformed with an Agrobacterium strain that carried the T-DNA on the chromosome (FIG. 4A). Similar results were obtained in maize transformation experiments (FIG. 4B). In contrast, 47-67% of the Arabidopsis plants generated by Agrobacterium strains harbouring a T-DNA binary vector contained integrated vector backbone sequences. An earlier report detected vector backbone sequences in 62% of the transgenic Arabidopsis plants produced by a vacuum infiltration transformation protocol, and another report detected vector backbone sequences in 68-79% of the transgenic Arabidopsis plants produced using a floral dip transformation protocol.
[00032] Vector backbone sequences relate to any portion of the vector sequence that is present outside of either the left border (LB) or the right border (RB) of the T- DNA sequence. The vector backbone sequence that is integrated may be positioned adjacent and contiguous to the LB or the RB or the backbone sequence may be positioned at a certain distance from the LB or the RB, i.e., the vector backbone sequence may be positioned non-adjacent to the T-DNA. The presence of the vector backbone sequence can be verified by dot blot hybridization with appropriate vector-derived probes, or by PCR amplification using appropriate primers, or by sequencing plant genomic DNA with appropriate sequence-specific primers. Methods and compositions described herein generate transgenic plants without any vector backbone sequence or transgenic plants that have vector backbone sequences less than about 1% or less than about 5% or less than about 10% of the transformed plants. The length of the vector backbone may range from 1 or 2 base pairs, or about 100-500 base pairs or to about a few kilo bases.
[00033] Transformation of plants with an Agrobacterium strain with a T-DNA integrated in the chromosome results in transgenic plants with vector backbone sequence in less than 10% of the transformed plants, or less than about 5% of the transformed plants or less than about 1% of the transformed plants. In preferred embodiments, all of the transformed plants contain transgenic DNA without any vector backbone sequence.
[00034] The percentage of T-DNA single copy plants obtained using the methodologies disclosed herein range from about 50-60 or about 50-75 or about 75-85 or about 85-90 or about 90.
[00035] Transfer of binary vector backbone sequences can occur when the T-DNA left border repeat is not recognized by the VirD2 endonuclease during processing of the T-DNA strand. It can also occur as a result of VirD2 linkage to the 5' end of the vector DNA directly outside the T-DNA left border, followed by transfer of the backbone in a manner analogous to that of T-DNA transfer. If the T-DNA strand is derived from a binary plasmid and during T-DNA processing the left border repeat is skipped, T-DNA processing will either end at a sequence in the backbone that resembles a T-DNA border or, due to the circular nature of binary vectors, when the right border repeat is reached. However, if T-DNA is integrated into the bacterial chromosome, read-through at the T-DNA left border repeat could result in very long T-DNAs, theoretically as long as the Agrobacterium chromosome itself if no adequate termination site is present. It is not fully known why transfer of long T-DNA, although possible, is less frequent than transfer of small T-DNAs. When the right border of a Ti-plasmid was inverted, at low frequency, the entire 190 kbp Ti-plasmid became integrated into the plant genome.
[00036] If the T-DNA left border is skipped during T-DNA strand processing (or if
DNA transfer initiates from sequences directly to the left of the left T-DNA border), the resulting T-DNA may be too long for efficient transfer to the plant or integration into the plant genome. Although there might be concern that sequences from the bacterial chromosome next to the T-DNA right border could be integrated into the plant genome, probing of the DNA membranes with an Agrobacterium aadA fragment failed to detect its presence.
[00037] It is possible that the integration of vector backbone sequences into plants is a consequence of simplifying Agrobacterium-mediated plant transformation by the use of small T-DNA binary vectors. Transfer of non-T-DNA portions of a large Ti-plasmid to plants is possible but rare: On average only 1 out of 80 transgenic tobacco calli contained a nptll gene positioned outside the T-DNA left border. Vector backbone sequences were detected in -75% of transgenic tobacco plants generated using an Agrobacterium strain carrying a small T-DNA binary vector. These results indicate that backbone integration occurs more frequently when a small T-DNA binary vector is used. T-DNA binary vectors are ubiquitously used because of their ease of handling. Vector systems have been built to simplify integration of T-DNA into the Agrobacterium chromosome (see for example, Lee et al., 2001, the disclosure of which is herein incorporated by reference).
[00038] When generating transgenic plants, it is generally preferred to use
Agrobacterium strains that confer high transformation frequencies because this could reduce both personnel and materials costs. Based on the data presented herein A. tumefaciens LBA4404 showed low transformation frequencies for Arabidopsis thaliana but transformed maize efficiently (compare FIG. 2A and 2B). In addition, GV3101 showed the lower transformation frequencies for maize, and in contrast it was more efficient for Arabidopsis transformation. Interestingly, except for the chromosomal integration constructions, a strict correlation between transformation frequency and integrated transgene copy numbers was not observed. This observation contradicts a generally prevalent concept that Agrobacterium strains which mediate high transformation frequencies are likely to cause high integrated transgene copy numbers.
[00039] Any suitable locus or target on an Agrobacterium chromosome can be used as long as (i) insertion at a locus does not significantly alter bacterial growth and viability, and (ii) insertion at a locus does not significantly impede the transformation process {e.g., insertion into a chromosomal virulence gene).
[00040] Agrobacterium spp., Rhizobium spp., Sinorhizobium spp., Mesorhizobium spp., Phyllobacterium spp. Ochrobactrum spp. and Bradyrhizobium spp. are suitable for use in plant transformation employing the methods and compositions described herein. Chromosomal integration vectors are identified based on the known sequences of one or more loci of the bacterial species capable of transforming plants. Many of the non-Agrobacterium spp. may be equipped with one or more genes or plasmids derived from Agrobacterium to render them capable of transforming plants. Some examples of Agrobacterium tumefaciens strains include for example, EHAlOl, GV3101, LBA4404, EHA105, AGLO, and AGLl, LBA4404. Other Agrobacterium species include for example, Agrobacterium vitis (K252), or Agrobacterium rhizogenes (A4). [00041] One or more components of a chromosomal integration vector or any vector used herein may be operatively coupled to one or more promoter sequences. For example, a gene of interest may be linked to a tissue specific promoter and a selectable marker may be operatively coupled to a constitutive promoter. Appropriate translation termination signals can be incorporated into the vector.
[00042] A "universal recipient strain" (e.g., a universal Agrobacterium recipient strain) is developed, where the T-DNA is already integrated in a suitable chromosomal locus {e.g., in the picA locus of the Agrobacterium chromosome). This T-DNA may have a suitable selectable marker (e.g., bar gene) and a small portion/fragment/region of a suitable vector sequence (e.g., pbluescript or any other commonly used bacterial cloning vector). This recipient strain is used in conjunction with any suitable vector (e.g., pbluescript/puc-derived cloning vector (such as the pSAT vectors) that has a promoter, gene, and polyA. When this cloning vector is introduced into Agrobacterium, it cannot replicate. However, it can recombine with the small portion of the cloning vector sequence (e.g., pbluescript) that is already inserted into the T-DNA. For example, a promoter- gene-polyA construct is made and is transformed into Agrobacterium and selected for any suitable marker encoded on the cloning vector (e.g., carb-resistance encoded on the pSAT vector). If the Agrobacterium strain is resistant to the marker encoded on the cloning vector, then the cloning vector sequence has co- integrated (recombined) into the T-DNA on the chromosome. Such co-integration can be experimentally verified by DNA blot hybridization.
[00043] Unlike accidental or passive integration of T-DNA into Agrobacterium chromosomes, present methods and compositions provide active and direct methods to use Agrobacterium chromosomes as specific launching pads for transferring T-DNA into a plant cell and thereby directly minimizing transgene copy number and reducing vector backbone integration in the transgenic plants. Thus, the chromosomal vectors described herein target specific loci in Agrobacterium chromosomes. The T-DNA used herein generally contains one or more genetic elements that are heterologous to Agrobacterium or any other bacterial species used in plant transformations.
[00044] A transgenic crop plant contains an exogenous polynucleotide molecule or a heterologous transgene either inserted into the genome of a crop plant cell or transiently expressed without stable integration. Suspension cultures, embryos, meristems, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, ovules, pollen and microspores, and seeds, and fruit are generally referred to as plant material.
[00045] The vectors described herein may also include a coding region for a plant selectable marker gene, which may be located in the T-DNA, to select transformed plant cells with the corresponding reagent. The plant selectable marker may provide resistance to a positive selection compound, for example, antibiotic resistance (e.g., kanamycin, hygromycin), or herbicide resistance.
[00046] The vectors described herein may also include one or more reporter genes.
A reporter gene may be present in addition to a selectable marker. Examples of reporter genes include for example, the beta-glucuronidase (GUS), the chloramphenicol acetyl transferase, the green fluorescent protein (GFP) and luciferase.
[00047] Methods for transforming a plant cell include for example contacting at least a plant cell with a transformation bacteria of the present invention; and selecting the plant cell transformed with one or more heterologous transgenes.
[00048] Agronomically important traits such as improved nutritional value, increased biomass, resistance to environmental hazards such as drought, salinity, pathogens are engineered into a plant species of interest using the methods described herein. Any agriculturally relevant trait capable of being manipulated genetically is suitable to implement using the methods disclosed herein.
[00049] Any plant species that can be genetically transformed using a bacterial transformation system (e.g., Agrobacterium) is suitable. Suitable plant species include for example, apple, barley, canola, coffee, corn, cotton, grape, lettuce, lemon, lime, maize, mushroom, oat, peanut, pear, pepper, potato, rice, rye, sorghum, soybean, sugarbeet, sugarcane, sunflower, tobacco, tomato, and wheat. Suitable plants include both monocots and dicots.
EXAMPLES
[00050] The following examples are for illustrative purposes and are not intended to limit the scope of the disclosure. Example 1: A. tumefaciens strains and T-DNA constructions.
[00051] It was investigated whether different Agrobacterium strains and binary vector systems affect transformation frequency, integrated transgene copy number, and the frequency of T-DNA backbone integration events. Investigation utilized various combinations of the commonly used A. tumefaciens strains EHAlOl, GV3101 , and LBA4404 with five different T-DNA binary systems. These Agrobacterium strains are non-oncogenic ("disarmed") and have been used for transformation of a large variety of plants. EHAlOl (Hood et al, (1987), Plant Physiol. 83:529-534) harbours a derivative of the agropine/L, L-succinamopine- type Ti-plasmid pTiBo542, GV3101 (Koncz and Schell, (1986), MoI. Gen. Genet. 204:383-396), a derivative of the nopaline-type Ti-plasmid pTiC58, and LBA4404 (Ooms et al., (1981), Gene 14:33-50) a derivative of the octopine-type Ti-plasmid pTiAch5. The tested T-DNA vectors contain identical T-DNA regions plus an aadA gene for bacterial selection for spectinomycin resistance. However, they contain different origins of replication (ori) resulting in different T-DNA copy numbers in the bacterial cell: the pVS ori ( about 5 copies/ cell), the pSa ori ( about 3 copies/cell), the RK2 ori ( about 5-10 copies/cell), and the pRiA4b ori (15-20 copies/cell for the ori fragment used in these constructions). The effect of integration of T-DNA into the Agrobacterium C58 chromosome at the picA locus in strains EHAlOl and GV3101 were analyzed. T-DNA integration into this locus does not affect transformation and vectors specifically designed to integrate genes into this locus by homologous recombination are described in Lee et al., (2001), incorporated herein by reference (Lee et al., (2001) MoI. Plant-Microbe Interact. 14:577-579).
[00052] A total of 14 different A. tumefaciens strains (by replication origin combinations) were analyzed. The T-DNA region, derived from the binary vector pTFlOl.l, harbours a bar gene as a plant selectable marker (de Block et al., (1987), EMBO J. 6:2513-2518) under the control of a CaMV double 35S promoter (FIG. 1). Utilizing identical T-DNA regions with the same plant selectable marker and the identical non-T-DNA sequence proximal to the T-DNA left border in all constructions enabled to compare results obtained for transformation frequencies, integrated transgene copy numbers, and backbone integration for all strain-by- construct combinations. Example 2: Effect of A. tumefaciens strain and T-DNA ori on transformation frequency.
[00053] The effect of 14 Agrobacterium strain-by-construct combinations on transformation frequency in Arabidopsis thaliana and Zea maize were determined. Arabidopsis thaliana was transformed using a floral dip protocol (Clough and Bent, (1998), Plant J. 16:735-743). At least five transformation experiments were conducted for each vector-by-strain combination, and transformation frequencies were determined by analyzing 1500-4500 seeds for each experiment. FIG. 2A shows the transformation frequencies for Arabidopsis grouped as strain-by- replication origin combinations. Transformation frequency was dependent upon the A. tumefaciens strain utilized. In the data presented herein, GV3101 resulted in the highest transformation frequencies (0.97-2.11%), whereas EHAlOl and LBA4404 effected medium (0.09-0.58%) and low (0.01-0.12%) transformation frequencies. T-DNA replication origin, as part of the binary vector, had little effect on transformation frequency with one significant exemption: Integration of T-DNA into the Agrobacterium chromosome of both EHAlOl and GV3101 resulted in transformation frequencies lower than those of the other four T-DNA binary systems of the respective strain. For EHAlOl the transformation frequency is 4- to 5 -fold lower, whereas for GV3101 the frequency is ~2-fold lower compared to the binary systems tested (FIG. 2A). Integration of the T-DNA region into the picA locus of the Ach5 chromosome of A. tumefaciens LBA4404 was not achieved, probably because the pic A sequence of this chromosome does not share enough similarity with the pic A sequence of the vector that was designed which derives from the C58 chromosome (Lee et al., 2001).
[00054] Maize was transformed by an embryo inoculation protocol, and 5-7 independent transformation experiments were conducted for each strain-by- replication origin combination. Transformation frequencies of the 14 combinations are shown in FIG. 2B, and range between 0.9% and 15%. As seen for Arabidopsis, integration of T-DNA into the chromosomes of EHAlOl and GV3101 resulted in low transformation frequencies (0.9%), whereas transformation frequencies were considerably higher (5-15%) when T-DNA was placed on a binary vector.
[00055] In general, in the data presented herein for maize transformation, A. tumefaciens EHAlOl and LBA4404 effected the highest transformation frequencies (range among the replication origins: 9-15% and 9-12%, respectively), whereas the transformation frequency using GV3101 was lower (5-8%) (FIG. 2B). Except for the two strains in which T-DNA was integrated into the chromosome, the T-DNA binary vector replication origin did not significantly affect transformation frequency under the conditions tested. However, the integration of the T-DNA into a chromosomal locus significantly affected the transformation frequency.
Example 3: Bacterial chromosomal integration of T-DNA results in a higher percentage of plants containing a single T-DNA copy.
[00056] The number of copies of integrated T-DNA in transgenic plants was investigated by DNA dot blot hybridization. Addition of various amounts of pTFlOl .1 DNA to wild-type plant genomic DNA served as copy number reconstruction controls. Calculations for T-DNA copy number standards were based on an Arabidopsis genome size of 125 Mbp (The Arabidopsis genome initiative, 2000) and a maize genome size of 2500 Mbp. The size of pTFlOl.l is 9189 bp.
[00057] Tl generation (heterozygous for T-DNA) Arabidopsis plants were analysed using a bar gene-specific fragment (FIG. 1). FIG. 3A shows the percentage of plants containing a single transgene copy grouped as various strain-by-replication origin combinations. The percentage of single copy plants spans a wide range between 22% (GV3101, pVSl origin of replication) and 100% (LB4404, RK2 origin of replication). However, because of the extremely low transformation frequency, only two plants were obtained for the LB4404-by-RK2 origin combination. Interestingly, placement of T-DNA into the Agrobacterium chromosomal /?zc.4 locus, rather than on a T-DNA binary vector, resulted in 85% of the plants infected with EHAlOl and 75% of the plants infected with GV3101 containing a single transgene copy. The percentage of T-DNA single copy plants resulting from other EHAlOl and GV3101 replication origin combinations (T- DNA on a binary vector) was much lower. Only 23-33% (EHAlOl) or 22-34% (GV3101) of the plants contained single copy transgenes.
[00058] Because of the low transformation efficiency of Arabidopsis thaliana with
LBA4404 (FIG. 2A), only a few plants were obtained for analysis. The percentage of single transgene integration events of three of the four analyzed T-DNA binary vector replication origins in LBA4404 is higher than that of the respective replication origins in the other two bacterial strains (50-100% for LBA4404 versus 22-34% for EHAlOl and GV3101).
[00059] The average transgene copy number for the 14 analyzed strain-by-origin combinations (FIG. 5A) corresponds to the percentage of single transgene integration events. The average transgene copy number for chromosomal integration constructions is low (EHAlOl : 1.3 copies per diploid genome; GV3101 : 1.6 copies per diploid genome), in contrast to the average integrated transgene copy number using T-DNA binary vectors in EHAlOl and GV3101 (range 3.3-5.1 transgene copies/dip loid genome). The average copy number for the four LBA4044 replication origin combinations is low and lies within a range between 1-2 copies.
[00060] Maize T-DNA copy number determinations were made in heterozygous TO generation plants. Because the bar gene probe used to analyze transgene copy number in Arabidopsis resulted in background hybridization signals for wild-type maize DNA, the CaMV double 35S promoter fragment from pTFlOl.l was used as a probe (FIG. 1). Copy numbers are also approximated in dot blots shown in FIG. IA based on the standards. The dot blots were used as a source of data for determining copy number (of each region probed), presence/absence of backbone sequence, and absence of contaminating Agrobacterium DNA in the plant DNA preparations. Sequencing of plant DNA preparations or PCRs can also be performed to verify the presence of absence of vector backbone DNA.
[00061] FIG. 3B shows the percentage of maize plants containing a single transgene following transformation using various strain-by-origin combinations. The percentage of plants carrying a single transgene copy varies significantly among the combinations and lies within a range between 22 and 75%. As with Arabidopsis, both T-DNA chromosomal integration strain combinations result in a high percentage of single transgene copy number plants: 63% of the plants transformed using the EHAl 01 -by-chromosomal integration combination and 75% of plants transformed using the GV3101-by-chromosomal integration combination harbour a single integrated T-DNA. In contrast, only 17-45% of the plants generated using T-DNA binary vectors contain a single transgene copy.
[00062] Although antibiotics were used to kill Agrobacterium after transformation, bacterial cells might still contaminate selected transgenic Arabidopsis and maize plants. The presence of contaminating Agrobacterium DNA would falsely increase the apparent T-DNA copy number. To eliminate this possibility, membranes were hybridized with a fragment containing the picA gene. Hybridization with the picA gene was not detected, indicating that the observed DNA dot blot signals using other probes do not derive from Agrobacterium DNA contamination.
[00063] FIG. 6 shows the results of the Southern blot analysis. Copy numbers of the analyzed replication origins vary greatly and are independent of the vir gene induction status. The binary vector copy numbers caused by the pVS, the pSa, and the RK2 replication origins correspond to previous reports in the literature. The pRi copy number (-15-20) is higher than previous findings.
Example 4: Integration of T-DNA into the Agrobacterium chromosome mitigates integration of T-DNA backbone sequences in transgenic plants.
[00064] T-DNA backbone sequences (i.e., sequences not within the defined T-DNA borders) are frequently introduced into plants during Agrobacterium-mediated transformation. Such sequences can present regulatory problems, especially when bacterial antibiotic resistance genes are transferred. It was investigated whether the Agrobacterium strain or T-DNA replication origin affects the frequency of backbone integration events. All five analyzed T-DNA constructions contain a bacterial spectinomycin resistance (aadA) gene immediately outside the T-DNA left border, to probe all transgenic plant DNA samples for the presence of backbone sequences with an aadA gene fragment (FIG. 1).
[00065] FIGS. 4A and 4B show the percentage of transgenic plants with backbone integration events for the 14 strain-by-origin combinations in Arabidopsis and maize, respectively. For both Arabidopsis thaliana and maize, almost no transgenic plants contained backbone sequences when they were generated by Agrobacterium strains in which the T-DNA was integrated into the chromosome, whereas the use of a T-DNA binary vector resulted in a relatively high percentage of plants containing backbone sequences. Vox Arabidopsis only one out of 40 plants that was generated by using the GV3101-by-chromosomal integration combination contained backbone sequences. None of the plants generated by the EHAl 01 -by-chromosomal integration combination contained vector backbone sequences. In contrast, use of the 12 other combinations harbouring the T-DNA on a binary vector resulted in 47-67% of the plants containing backbone sequences. For maize, backbone sequences were present in only 1 out of 12 plants that were generated using ori-by-strain combinations with a chromosomal integrated T- DNA. The 12 other tested combinations resulted in backbone integration in 19- 55% of the resulting transgenic plants.
[00066] If T-DNA is processed from a low copy number replicon (such as the chromosome), there are likely to be fewer copies processed in Agrobacterium. When Agrobacterium is in a plant environment to transfer, the Ti-plasmid over- replicates 5-10 fold with respect to the chromosome and data indicate that up to 14 copies of T-DNA can be processed (repeatedly) from the same Ti-plasmid. Based on this, when a high copy number binary vector is used, it is expected that a large number of T-strands are processed to be transferred. In the case of chromosomal integration of T-DNA, because the T-DNA is integrated into a very large replicon (the chromosome), for example, if the left border (LB) is "skipped", this may result in a long stretch of transfer DNA (because in a chromosome it may take a long distance to stop at a sequence that resembles the border sequence, i.e., pseudoborder). Such a long T-strand may not be able to exit the bacterium efficiently and therefore may not transverse the plant cytoplasm and may not integrate into the plant chromosome. Therefore, launching of T-DNA from Agrobacterium chromosome may screen out integration of vector backbone sequences into plant genome.
Example 5: Construction of chromosomal integration vectors and integrating a gene of interest into Agrobacterium chromosome.
[00067] A chromosomal insertion site of a genetic element {e.g., a gene) generally may not affect either bacterial virulence or growth rate of Agrobacterium. A plant- inducible locus on the Agrobacterium chromosome (picA) is not required either for bacterial growth or T-DNA transfer. The picA and neighboring pgl (polygalacturonase like) genes are located on a 3.15-kbp EcoRl fragment of the chromosome of A. tumefaciens C58. A Pstl site exists between these two genes. Insertion of a gene into this Pstl site leaves enough length of DNA sequence on both sides (1.3 kb and 1.8 kb, respectively) to allow efficient double homologous recombination into the bacterial chromosome. This EcoBl fragment was cloned onto an IncPα plasmid, pLAFRl, to make a basic integration vector pE578. In order to facilitate integration of the GOI into the Agrobacterium chromosome, the basic vector was modified and several features were added.
[00068] FIG. IB-D show examples of illustrations of chromosomal integration vectors and generation of launching pads for T-DNA integration into plant genomes.
[00069] Groups of vectors (e.g., plasmids pE1770 and pE1773) may contain a lacZ α-complementation fragment that has unique restriction enzyme sites (Kpnl, Hindlϊl, EcoKl, Pstl, BanϊΑl, Spel, Xbal, and Sad) between the picA and pgl genes and examples are shown in FIG. 8. Using blue -white colony screening these sites are used to clone a gene of interest (GOI) and a selectable antibiotic resistance marker into these sites. The antibiotic resistance marker is used as an indicator of gene replacement in subsequent steps of the procedure. Alternatively, the GOI is cloned into a cloning vector containing a CoIEI replication ori (such as pUC or pBluescript) first, and then cointegrate the entire plasmid into one of the unique restriction enzyme sites in the lacZ α-complementation fragment. The β-lactamase (ampicillin/carbenicillin resistance) gene on the backbone of this cloning plasmid can also be used as a selection marker to determine whether the GOI has integrated onto the Agrobacterium chromosome.
[00070] A β-lactamase gene can also be inserted into the pgllpicA locus to allow for the introduction of GOI (e.g., pE1931 and pE1963, FIG. 8). The sacR and sacB genes from Bacillus subtilis can also be included on the plasmid backbones instead of a β-lactamase gene (e.g., pE1962 and pE1963, FIG. 8). Because the sacB gene product metabolizes sucrose to a toxic compound, sucrose containing medium is used to select for double crossover recombinants (and the loss of the sacB containing vector) at the pgllpicA locus of A. tumefaciens C58. Blue-white colony screening can also be used to clone GOI into the plasmids.
[00071] To perform the chromosomal integration (FIG. 7), the GOI is placed between the pgl ΑnάpicA genes on any suitable vector to make the "Starting Construction". Next, the Starting Construction is introduced into A. tumefaciens C58 (or any suitable strain) either by bacterial conjugation (triparental mating), transformation, or electroporation to make the "Starting Strain". An eviction plasmid belonging to the IncPα group, such as pPHUI (Hirsh, 1984) or pVK102 (Knauf, 1982), is then introduced into the Starting Strain by bacterial mating. Transconjugants which are resistant to both the antibiotic marker introduced near the GOI and the antibiotic resistance marker on the backbone of the eviction plasmid (gentamicin resistance for pPHUI or kanamycin resistance for pVK102) are selected. Because the integration vectors and the eviction plasmids belong to the same IncPα incompatibility group, they cannot co-reside as replicons in the same bacterial cell. These transconjugants, which are resistant to both antibiotics, will fall into two possible categories. The first category are bacteria that contain the entire starting plasmid integrated into the chromosome DNA through a single crossover recombination event (a plasmid co-integrate). The second category are bacteria with the GOI and selection marker exchanged into the pgllpicA locus through double homologous recombination. Whether these transconjugants are resistant to the antibiotic encoded by the resistance marker on the backbone of the Starting Construction (for these plasmids, tetracycline) can be checked. If the transconjugant is resistant to tetracycline, this indicates that the strain has the entire Starting Construction integrated into the chromosome. This type of transconjugant is generally discarded. Only those transconjugants which are sensitive to tetracycline are kept. Finally, one needs to extract total genomic DNA from these transconjugants. Following digestion with the appropriate restriction enzymes and Southern blot analysis, one can determine whether the GOI and antibiotic resistance markers have been exchanged into the pgllpicA locus on the chromosome (FIG. 9). DNA from A. tumefaciens strains was digested with EcoRl and blotted onto a nylon membrane. A labeled 3.15-kbp DNA probe containing the pgl/picA locus was used to confirm the disruption of the pgl/picA locus in various A. tumefaciens strains. In FIG. 9, Lane 1 corresponds to the A. tumefaciens strain C58 containing the Starting Construction. Lane 2-10 are 9 individual clones which may or may not have the integration of the GOI. Lane 11 is A. tumefaciens strain C58. Solid black indicates the intact 3.15-kbp pgllpicA locus from the wild type A. tumefaciens chromosome (Lane 1 and Lane 11). Line arrow indicates DNA fragments from the disrupted pgllpicA locus on the Starting Construction (Lane 1). Note that the intensity of the DNA band from the chromosome (single copy) is lower than that of the disrupted locus from the multiple copy plasmid. Results from the genomic DNA samples of Lane 5 and Lane 8 indicate that these two A. tumefaciens strains contain the GOI integrated in the chromosomal region (note that the intensity of the DNA bands is similar to that of the chromosomal locus). However, results from Lane 2-4, Lane 6-7 and Lane 10 suggest these A. tumefaciens strains do not have the GOI integrated (same pattern as Lane 11). Interestingly, Lane 9 shows that the A. tumefaciens strain has both a wild-type and a disrupted copy of the pgl/picA locus, indicating that this strain carries the entire Starting construction as a co-integrate in its chromosome.
[00073] The GOI is stably maintained in this Agrobacterium strain at a single copy per cell without applying selection pressure.
Methods
Agrobacterium tumefaciens strains
[00074] Agrobacterium tumefaciens strains were grown either on solidified AB sucrose medium (Lichtenstein and Draper, (1986), In Genetic Engineering of Plants, Vol. 2 (Glover, D.M., ed.). Washington, DC: IRL Press, pp. 67-119) or in yeast extract peptone medium supplemented with appropriate antibiotics (rifampicin, 10 μg/ml; spectinomycin, 100 μg/ml; kanamycin, 25 μg/ml; gentamicin, 25 μg/ml). T-DNA constructions
[00075] The T-DNA region and the bacterial aadA (spectinomycin resistance) gene
(FIG.l) used in all T-DNA binary constructions derives from pTFlOl.l, whose DNA sequence is described herein. pTFlOl.l contains a pVSl origin of replication. To generate the various binary vectors, the pVS 1 replication origin (ori) was replaced with those from other plasmids. For introducing the RK2 ori, the pVSl origin was removed from pTFlOl.l using Seal and Notl and replaced it with a Notl/Nrul fragment from pBIN19, generating pTF::Binl9. For introducing the pSa ori, the pVSl ori was removed from pTFlOl.l using Seal and Nsil and replaced it with a Pstl/Sacϊl fragment from pUCD2. All overhanging ends were made blunt using T4 DNA polymerase (New England Biolabs, Ipswich, MA, USA) to enable ligation. The resulting plasmid was designated pTF::UCD2. The pRiA4b origin was amplified from A. rhizogenes strain A4 (Jouanin et al., (1986), Plasmid 16:124- 134) using PCR primers. The amplified PCR fragment was cloned into pBluescript SK+ (Stratagene, La Jolla, CA) and designated pBluescript::Ri. To confirm that the cloned pRi replication origin effects replication in Agrobacterium, pBluescript::Ri was transformed into A. tumefaciens by electroporation (Nagel et al, (1990), FEMS Microbiol. Lett. 67:325-328) and plasmid DNA was isolated from carbenicillin-resistant colonies. pBluescript::pRi was digested with CIaI and the overhanging ends were made blunt using T4 DNA polymerase. The product was subsequently digested with Notl and cloned into pTFlOl.l prior digested with Seal and Notl to remove the pVSl replication origin. The resulting plasmid was designated pTF::Ri.
[00076] The four T-DNA vectors pTFlOl.l, pTF::Binl9, pTF::UCD2 and pTF::Ri were separately transformed into A. tumefaciens EHAlOl (Hood et al., 1987), GV3101 (Koncz and Schell, 1986), and LBA4404 (Ooms et al., 1981) by electroporation (Nagel et al., 1990).
[00077] The T-DNA region plus the aadA gene of pTFlOl .1 (a 4.2 kb Scal-Nsil fragment) was inserted into the blunted Spel site and Pstl site of the integration vector pE1931. This plasmid (pE2759) was separately introduced into A. tumefaciens EHAlOl and GV3101. The eviction plasmid pPHUI was introduced into the resulting strains, and colonies were selected on gentamicin and carbenicillin. Tetracycline-sensitive colonies (which had lost pE2759) were selected, and recombination of the T-DNA region into the pgllpicA locus of the Agrobacterium chromosome was confirmed by DNA blot hybridization (Lee et al., 2001).
Agrobacterium-mediated transformation of Arabidopsis thaliana and maize [00078] All 14 Agrobacterium strain-by-replication origin combinations were utilized to transform Arabidopsis thaliana and maize. Arabidopsis thaliana (ecotype Wassilewskija, Ws2) was transformed by a floral dip protocol (Clough and Bent, 1998). Phosphinothricin resistant plants were selected on Gamborg's B5 Medium (Caisson Laboratories, Rexburg, ID) supplemented with 10 μg/ml phosphinothricin and 100 μg/ml timentin. Transformation frequencies were calculated as follows: [Number of phosphinothricin resistant plants/number of seeds tested] x 100. 10 mg of seeds correspond to approximately 500 seeds. [00079] Maize was transformed by infecting immature zygotic embryos (1.2-1.5 mm) of the Hi II genotype with bacterial suspensions (As5o=O.3-0.4) initiated from solid cultures grown for 3 days (190C) on YEP medium containing rifampicin and spectinomycin). Infected embryos were co-cultivated for 3 days (2O0C, dark) on N6 Medium (Phytotechnology Labs, Shawnee Mission KS) containing 300 mg/L L-cysteine. Selection for bialaphos resistant callus events and regeneration of transgenic plants was accomplished as described in Frame et al., 2002, incorporated herein by reference {Plant Physiol. 129: 13-22). Genomic DNA extraction and DNA dot blot preparation
[00080] Genomic DNA was extracted from 3-5 leaves of 3-4 week old Arabidopsis thaliana plants or approximately 100 mg maize leaf tissue (Murray and Thompson (1980), Nucl. Acids Res. 8:4321 4325). Genomic DNA was quantified using a Gemini XPS microplate spectrofluorometer (Molecular Devices, Sunnyvale, CA, USA, excitation: 488 nm emission: 525 nm) and the Quant-iT™ PicoGreen® dsDNA Assay Kit (Invitrogen Inc.; Carlsbad, CA, USA).
[00081] DNA dot blots were prepared to determine T-DNA copy numbers and the frequency of T-DNA backbone integration events. Arabidopsis (75 ng) or maize (1.5 μg) genomic DNA samples were denatured by adding NaOH and EDTA to a final concentration of 0.4 M and 10 mM, respectively, followed by 10 min incubation in boiling water. A Hybond N+ nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ, USA) was pre-wetted with water and placed between the layers of the dot blot apparatus. Samples were applied to the wells of the dot blot apparatus, incubated for 30 min, and then drawn onto the nylon membrane using a gentle vacuum. DNA was cross-linked to the membrane by using a CL-1000 UV crosslinker (UVP, Upland, CA). The membranes were incubated in 2xSSC for 10 min and dried. DNA dot blot hybridization
[00082] Probes for dot blot hybridizations were generated using random prime
Ready-To-Go DNA Labelling Beads and 32P-dCTP (both Amersham Pharmacia Biosciences). Unincorporated radioactive nucleotides were removed by Sephadex G-100 gel filtration. Membranes were pre-hybridized in 7% (w/v) SDS, 0.5 M sodium phosphate (pH 7.2) and 10 mM EDTA (pH 8.0) at 65°C for two hours. Hybridization was done overnight at 65°C. After hybridization membranes were washed 2 times with 2xSSC, 0.1% (w/v) SDS, 10 mM EDTA (pH 8.0), then 2 times with IxSSC, 0.1% (w/v) SDS, 10 mM EDTA and finally 2 times with O.lxSSC, 0.1% (w/v) SDS, 10 mM EDTA at 65°C. Membranes were exposed at - 800C for autoradiography. Integrated dot density was determined using Labworks 4.6 Image Acquisition and Analysis Software (UVP, Upland, CA). For re-probing, membranes were stripped using boiling 0.1% (w/v) SDS twice.
[00083] DNA dot blot membranes were hybridized subsequently with various probes. For determining T-DNA copy numbers of Arabidopsis plants, dot blot membranes were hybridized with a 559 bp bar PCR fragment (FIG.l). The PCR fragment was amplified using pTFlOl .1 as template and 5'-GAT CTA CCA TGA GCC CAG AAC G-3' (SEQ ID NO: 1) and 5'-CAG ATC TCG GTG ACG GGC AGG A-3'(SEQ ID NO: 2) as primers. In order to determine T-DNA copy numbers of maize plants, membranes were probed with a 759 bp PstVXhol fragment from pTF 101.1 harbouring the double CaMV 35S promoter (FIG. 1 ) . To detect vector backbone sequences in both Arabidopsis and maize DNA, a 656 bp PCR fragment derived from the non-T-DNA region next to the T-DNA left border of pTFlOl .1 (FIG. 1) was used as a probe. The fragment was amplified using pTFlOl.l as a template and 5'-TCA CCG TAA CCA GC AAA TCA-3' (SEQ ID NO: 3) and 5'-CTC GGC ACA AAA TCA CCA CT-3' (SEQ ID NO: 4) as primers. A 3.1 kb EcoKl fragment containing the pgllpicA locus (Rong et al., (1990), J. Bacteriol. 173, 5110-5120) was used as a probe to check for the presence of contaminating Agrobacterium DNA in plant genomic DNA. All DNA fragments were gel purified prior to labelling using a QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany). In order to normalize amounts of DNA in each dot, membranes were hybridized with genomic Arabidopsis or maize DNA.
[00084] Subcloning the GOI into the integration vector
1. Choose the appropriate restriction enzyme sites to use for insertion of the GOI into the integration vector.
2. Cut out the insert with appropriate restriction enzyme(s); elute the insert fragment from a gel if it is necessary. Follow the manufacturer's instructions.
3. Ligate the insert DNA to vector DNA and transform an E. coli host to obtain the Starting Construction.
4. Select and analyze the E. coli transformants. The E. coli colony with the correct Starting Construction will be used for the following experiment.
[00085] Introduction of Starting Construction into Agrobacterium:
Triparental mating (conjugation): 1. Grow 5 ml liquid cultures of each bacterial strain overnight: A. tumefaciens containing the C58 chromosomal background (resistant to rifampicin), E. coli strain E9 (resistant to gentamicin), and the E. coli strain containing the Starting Construction (let's assume this strain is resistant to both ampicillin from the selectable marker near the GOI, and tetracycline from the backbone of the integration vector) obtained herein.
2. The next day, transfer 1 ml of each bacterial culture into an individual 1.5- ml microfuge tube. Centrifuge the cell pellets using the maximum microcentrifuge speed for one minute.
3. Wash the cell pellets once with sterile 0.9% NaCl and resuspend the cells in 1 ml 0.9% NaCl.
4. Mix 0.2 ml of each bacterial solution in a 1.5-ml microfuge tube. Take 10 μl of the bacterial mixture and spot on a LB agar plate.
5. Incubate the plate at 300C overnight.
6. The next day, use 1 ml of sterile 0.9% NaCl to wash most of the bacteria from the mating plate. This is the undiluted bacterial conjugation mixture. Make 10-fold serial dilution of this conjugation mixture with sterile 0.9% NaCl. Plate out 100 μl of diluted (10~3 and 10"4 dilutions) conjugation mixture onto the selection medium containing the appropriate antibiotics (AB-Sucrose medium containing rifampicin and carbenicillin).
7. Incubate the plates at 300C for 2-4 days. Colonies appearing on these selection plates are potential transconjugants.
Confirmation of Agro bacterium cells that have received the Starting Construction
8. Re-streak several potential transconjugants grown on an AB-Sucrose agar plate containing tetracycline to check antibiotic sensitivity. Pick one of the transconjugants that is resistant to tetracycline and continue the following experiment.
[00086] Eviction of the Starting Construction from Agrobacterium
1. Inoculate a single colony of the A. tumefaciens strain into 5 -ml YEP liquid medium containing carbenicillin. Also inoculate a single colony of E. coli strain E4 in 5 -ml LB liquid medium containing gentamicin.
2. Grow both cultures at 300C overnight with shaking. 3. The next day, wash 1 ml of each culture once with sterile 0.9% NaCl in a sterile microcentrifuge tube, then resuspend the cell pellets in 1 ml of 0.9% NaCl.
4. Mix 0.2 ml of Agrobacterium cells with 0.2 ml of E. coli strain E4 in a tube. Take out 10 μl of mixture and spot on a LB agar plate.
5. Incubate the plate at 300C overnight. The next day, use 1 ml of sterile 0.9% NaCl to suspend the conjugation mixture. Make 10-fold serial dilutions in 0.9% NaCl and plate 100 μl of each dilution (10~2, 10"3, and 10"4 dilutions) on selection medium (AB-Sucrose agar medium containing carbenicillin and gentamicin) to screen for cells which have the GOI and selection marker integrated onto the chromosomal pgllpicA locus through homologous recombination.
6. Incubate the plate at 300C for 2-3 days. Colonies appearing on selection medium potentially contain the GOI integrated into the Agrobacterium chromosome.
7. Streak several colonies from the previous step on plates containing AB- Sucrose agar medium with either carbenicillin and gentamicin, or tetracycline, respectively. Only keep the strains which are resistant to both carbenicillin and gentamicin and are sensitive to tetracycline.
8. E. coli strain E618 can be used when an Agrobacterium strain is already resistant to gentamicin. This strain contains pVK102, which carries kanamycin and tetracycline resistance genes.
9. If both a GOI and a selectable marker are placed into the integration vector to make the Starting Construction, pE1770 or pE1773 can be used. If a GOI needs to be placed into an integration vector that already contains a selectable marker, pE1931 or pE1963 can be used. If the sucrose counter- selection method, pE1963 or pE1962 can be used (FIG. 8). Alternatively, plasmid DNA from the Agrobacterium transconjugant can be extracted and E. coli can be re-transformed with this plasmid DNA. If the new E. coli transformants are now resistant to both markers (in this case, they are ampicillin and tetracycline) from the Starting Construction, this suggests that this Agrobacterium transconjugant does contain the Starting Construction. 10. Dissolving bacterial genomic DNA takes longer at a higher concentration. The tube containing the DNA may be incubated at 37°C for about 30 minutes to dissolve the DNA. Alternatively, more TE buffer can be used to dissolve the DNA. Vortexing the DNA is not recommended as it will shear the DNA. pTFlOl.l (FIG. 1) nucleotide sequence
AGTACTTTAAAGTACTTTAAAGTACTTTAAAGTACTTTGATCCAACCCCTCCGCTGC TATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACATGTCG CACAAGTCCTAAGTTACGCGACAGGCTGCCGCCCTGCCCTTTTCCTGGCGTTTTCTT GTCGCGTGTTTTAGTCGCATAAAGTAGAATACTTGCGACTAGAACCGGAGACATTAC GCCATGAACAAGAGCGCCGCCGCTGGCCTGCTGGGCTATGCCCGCGTCAGCACCGAC GACCAGGACTTGACCAACCAACGGGCCGAACTGCACGCGGCCGGCTGCACCAAGCTG TTTTCCGAGAAGATCACCGGCACCAGGCGCGACCGCCCGGAGCTGGCCAGGATGCTT GACCACCTACGCCCTGGCGACGTTGTGACAGTGACCAGGCTAGACCGCCTGGCCCGC AGCACCCGCGACCTACTGGACATTGCCGAGCGCATCCAGGAGGCCGGCGCGGGCCTG CGTAGCCTGGCAGAGCCGTGGGCCGACACCACCACGCCGGCCGGCCGCATGGTGTTG ACCGTGTTCGCCGGCATTGCCGAGTTCGAGCGTTCCCTAATCATCGACCGCACCCGG AGCGGGCGCGAGGCCGCCAAGGCCCGAGGCGTGAAGTTTGGCCCCCGCCCTACCCTC ACCCCGGCACAGATCGCGCACGCCCGCGAGCTGATCGACCAGGAAGGCCGCACCGTG AAAGAGGCGGCTGCACTGCTTGGCGTGCATCGCTCGACCCTGTACCGCGCACTTGAG CGCAGCGAGGAAGTGACGCCCACCGAGGCCAGGCGGCGCGGTGCCTTCCGTGAGGAC GCATTGACCGAGGCCGACGCCCTGGCGGCCGCCGAGAATGAACGCCAAGAGGAACAA GCATGAAACCGCACCAGGACGGCCAGGACGAACCGTTTTTCATTACCGAAGAGATCG AGGCGGAGATGATCGCGGCCGGGTACGTGTTCGAGCCGCCCGCGCACGTCTCAACCG TGCGGCTGCATGAAATCCTGGCCGGTTTGTCTGATGCCAAGCTGGCGGCCTGGCCGG CCAGCTTGGCCGCTGAAGAAACCGAGCGCCGCCGTCTAAAAAGGTGATGTGTATTTG AGTAAAACAGCTTGCGTCATGCGGTCGCTGCGTATATGATGCGATGAGTAAATAAAC AAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTAACCAGAAAGGCGGGTC AGGCAAGACGACCATCGCAACCCATCTAGCCCGCGCCCTGCAACTCGCCGGGGCCGA TGTTCTGTTAGTCGATTCCGATCCCCAGGGCAGTGCCCGCGATTGGGCGGCCGTGCG GGAAGATCAACCGCTAACCGTTGTCGGCATCGACCGCCCGACGATTGACCGCGACGT GAAGGCCATCGGCCGGCGCGACTTCGTAGTGATCGACGGAGCGCCCCAGGCGGCGGA CTTGGCTGTGTCCGCGATCAAGGCAGCCGACTTCGTGCTGATTCCGGTGCAGCCAAG CCCTTACGACATATGGGCCACCGCCGACCTGGTGGAGCTGGTTAAGCAGCGCATTGA GGTCACGGATGGAAGGCTACAAGCGGCCTTTGTCGTGTCGCGGGCGATCAAAGGCAC GCGCATCGGCGGTGAGGTTGCCGAGGCGCTGGCCGGGTACGAGCTGCCCATTCTTGA GTCCCGTATCACGCAGCGCGTGAGCTACCCAGGCACTGCCGCCGCCGGCACAACCGT TCTTGAATCAGAACCCGAGGGCGACGCTGCCCGCGAGGTCCAGGCGCTGGCCGCTGA AATTAAATCAAAACTCATTTGAGTTAATGAGGTAAAGAGAAAATGAGCAAAAGCACA AACACGCTAAGTGCCGGCCGTCCGAGCGCACGCAGCAGCAAGGCTGCAACGTTGGCC AGCCTGGCAGACACGCCAGCCATGAAGCGGGTCAACTTTCAGTTGCCGGCGGAGGAT CACACCAAGCTGAAGATGTACGCGGTACGCCAAGGCAAGACCATTACCGAGCTGCTA TCTGAATACATCGCGCAGCTACCAGAGTAAATGAGCAAATGAATAAATGAGTAGATG AATTTTAGCGGCTAAAGGAGGCGGCATGGAAAATCAAGAACAACCAGGCACCGACGC CGTGGAATGCCCCATGTGTGGAGGAACGGGCGGTTGGCCAGGCGTAAGCGGCTGGGT TGTCTGCCGGCCCTGCAATGGCACTGGAACCCCCAAGCCCGAGGAATCGGCGTGAGC GGTCGCAAACCATCCGGCCCGGTACAAATCGGCGCGGCGCTGGGTGATGACCTGGTG GAGAAGTTGAAGGCCGCGCAGGCCGCCCAGCGGCAACGCATCGAGGCAGAAGCACGC CCCGGTGAATCGTGGCAAGCGGCCGCTGATCGAATCCGCAAAGAATCCCGGCAACCG CCGGCAGCCGGTGCGCCGTCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGAT TTTTTCGTTCCGATGCTCTATGACGTGGGCACCCGCGATAGTCGCAGCATCATGGAC GTGGCCGTTTTCCGTCTGTCGAAGCGTGACCGACGAGCTGGCGAGGTGATCCGCTAC GAGCTTCCAGACGGGCACGTAGAGGTTTCCGCAGGGCCGGCCGGCATGGCCAGTGTG TGGGATTACGACCTGGTACTGATGGCGGTTTCCCATCTAACCGAATCCATGAACCGA TACCGGGAAGGGAAGGGAGACAAGCCCGGCCGCGTGTTCCGTCCACACGTTGCGGAC GTACTCAAGTTCTGCCGGCGAGCCGATGGCGGAAAGCAGAAAGACGACCTGGTAGAA ACCTGCATTCGGTTAAACACCACGCACGTTGCCATGCAGCGTACGAAGAAGGCCAAG AACGGCCGCCTGGTGACGGTATCCGAGGGTGAAGCCTTGATTAGCCGCTACAAGATC GTAAAGAGCGAAACCGGGCGGCCGGAGTACATCGAGATCGAGCTAGCTGATTGGATG TACCGCGAGATCACAGAAGGCAAGAACCCGGACGTGCTGACGGTTCACCCCGATTAC TTTTTGATCGATCCCGGCATCGGCCGTTTTCTCTACCGCCTGGCACGCCGCGCCGCA GGCAAGGCAGAAGCCAGATGGTTGTTCAAGACGATCTACGAACGCAGTGGCAGCGCC GGAGAGTTCAAGAAGTTCTGTTTCACCGTGCGCAAGCTGATCGGGTCAAATGACCTG CCGGAGTACGATTTGAAGGAGGAGGCGGGGCAGGCTGGCCCGATCCTAGTCATGCGC TACCGCAACCTGATCGAGGGCGAAGCATCCGCCGGTTCCTAATGTACGGAGCAGATG CTAGGGCAAATTGCCCTAGCAGGGGAAAAAGGTCGAAAAGGTCTCTTTCCTGTGGAT AGCACGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGAACCCGTACATTGGG AACCCAAAGCCGTACATTGGGAACCGGTCACACATGTAAGTGACTGATATAAAAGAG AAAAAAGGCGATTTTTCCGCCTAAAACTCTTTAAAACTTATTAAAACTCTTAAAACC CGCCTGGCCTGTGCATAACTGTCTGGCCAGCGCACAGCCGAAGAGCTGCAAAAAGCG CCTACCCTTCGGTCGCTGCGCTCCCTACGCCCCGCCGCTTCGCGTCGGCCTATCGCG GCCGCTGGCCGCTCAAAAATGGCTGGCCTACGGCCAGGCAATCTACCAGGGCGCGGA CAAGCCGCGCCGTCGCCACTCGACCGCCGGCGCCCACATCAAGGCACCCTGCCTCGC GCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCAC AGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGG TGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTA TACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGG TGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCT TCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAAC ATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCG TTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTC CCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGC TGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCG CCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCT ACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGT ATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCC GGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACG CGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCT CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGCATGATATATCTCCCAAT TTGTGTAGGGCTTATTATGCACGCTTAAAAATAATAAAAGCAGACTTGACCTGATAG TTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCTTGAGTTAAGCCGCGCCG CGAAGCGGCGTCGGCTTGAACGAATTTCTAGCTAGACATTATTTGCCGACTACCTTG GTGATCTCGCCTTTCACGTAGTGGACAAATTCTTCCAACTGATCTGCGCGCGAGGCC AAGCGATCTTCTTCTTGTCCAAGATAAGCCTGTCTAGCTTCAAGTATGACGGGCTGA TACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATT TTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCA TCGCCAGCCCAGTCGGGCGGCGAGTTCCATAGCGTTAAGGTTTCATTTAGCGCCTCA AATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCTACCAAG GCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTG GCTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGT TCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACT TCTACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCG TTGATCAAAGCTCGCCGCGTTGTTTCATCAAGCCTTACGGTCACCGTAACCAGCAAA TCAATATCACTGTGTGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGTACG GCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGA GTCGATACTTCGGCGATCACCGCTTCCCCCATGATGTTTAACTTTGTTTTAGGGCGA CTGCCCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACATCGACCCACGGCG TAACGCGCTTGCTGCTTGGATGCCCGAGGCATAGACTGTACCCCAAAAAAACAGTCA TAACAAGCCATGAAAACCGCCACTGCGCCGTTACCACCGCTGCGTTCGGTCAAGGTT CTGGACCAGTTGCGTGACGGCAGTTACGCTACTTGCATTACAGCTTACGAACCGAAC GAGGCTTATGTCCACTGGGTTCGTGCCCGAATTGATCACAGGCAGCAACGCTCTGTC ATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAG CTTAGTTGCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTAC AACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGA TTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGGCAGGATATATTG TGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAAT GTACTGAATTAACGCCGAATTGCTCTAGCATTCGCCATTCAGGCTGCGCAACTGTTG GGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATG TGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAA AACGACGGCCAGTGCCAAGCTAATTCGCTTCAAGACGTGCTCAAATCACTATTTCCA CACCCCTATATTTCTATTGCACTCCCTTTTAACTGTTTTTTATTACAAAAATGCCCT GGAAAATGCACTCCCTTTTTGTGTTTGTTTTTTTGTGAAACGATGTTGTCAGGTAAT TTATTTGTCAGTCTACTATGGTGGCCCATTATATTAATAGCAACTGTCGGTCCAATA GACGACGTCGATTTTCTGCATTTGTTTAACCACGTGGATTTTATGACATTTTATATT AGTTAATTTGTAAAACCTACCCAATTAAAGACCTCATATGTTCTAAAGACTAATACT TAATGATAACAATTTTCTTTTAGTGAAGAAAGGGATAATTAGTAAATATGGAACAAG GGCAGAAGATTTATTAAAGCCGCGGTAAGAGACAACAAGTAGGTACGTGGAGTGTCT TAGGTGACTTACCCACATAACATAAAGTGACATTAACAAACATAGCTAATGCTCCTA TTTGAATAGTGCATATCAGCATACCTTATTACATATAGATAGGAGCAAACTCTAGCT AGATTGTTGAGCAGATCTCGGTGACGGGCAGGACCGGACGGGGCGGTACCGGCAGGC TGAAGTCCAGCTGCCAGAAACCCACGTCATGCCAGTTCCCGTGCTTGAAGCCGGCCG CCCGCAGCATGCCGCGGGGGGCATATCCGAGCGCCTCGTGCATGCGCACGCTCGGGT CGTTGGGCAGCCCGATGACAGCGACCACGCTCTTGAAGCCCTGTGCCTCCAGGGACT TCAGCAGGTGGGTGTAGAGCGTGGAGCCCAGTCCCGTCCGCTGGTGGCGGGGGGAGA CGTACACGGTCGACTCGGCCGTCCAGTCGTAGGCGTTGCGTGCCTTCCAGGGGCCCG CGTAGGCGATGCCGGCGACCTCGCCGTCCACCTCGGCGACGAGCCAGGGATAGCGCT CCCGCAGACGGACGAGGTCGTCCGTCCACTCCTGCGGTTCCTGCGGCTCGGTACGGA AGTTGACCGTGCTTGTCTCGATGTAGTGGTTGACGATGGTGCAGACCGCCGGCATGT CCGCCTCGGTGGCACGGCGGATGTCGGCCGGGCGTCGTTCTGGGCTCATGGTAGATC CCCCGTTCGTAAATGGTGAAAATTTTCAGAAAATTGCTTTTGCTTTAAAAGAAATGA TTTAAATTGCTGCAATAGAAGTAGAATGCTTGATTGCTTGAGATTCGTTTGTTTTGT ATATGTTGTGTTGAGAATTAATTCTCGAGGTCCTCTCCAAATGAAATGAACTTCCTT ATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAG TGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTT CCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGTAGAGGCAT CTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCT TTTCCACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGT TTCCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTG TATCTTTGATATTTTTGGAGTAGACAAGTGTGTCGTGCTCCACCATGTTATCACATC AATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCG TGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCT TTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCA CAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCC TTTGTTGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTT TGGAGTAGACAAGTGTGTCGTGCTCCACCATGTTGACCTGCAGGCATGCAAGCTTGC ATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCAT GTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACG AGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATT AATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCA TTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGAGCTTGAGCTTG GATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATAT TGGCGGGTAAACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGG GCGTGAAAAGGTTTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCC CCTCGGGATCAA (SEQ ID NO: 5)

Claims

CLAIMS:
1. A method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant, the method comprising:
(a) obtaining an Agrobacterium strain comprising a T-DNA sequence integrated into an Agrobacterium chromosome, wherein the T-DNA sequence comprises a gene of interest; and
(b) transforming a suitable host plant material with the Agrobacterium, thereby reducing transgene copy number and minimizing vector backbone sequence in the resulting transgenic plant.
2. The method of claim 1 , wherein the Agrobacterium strain is selected from the group consisting of EHAlOl, EHA105, GV3101, and LBA4404.
3. The method of claim 1 , wherein host plant material is from a monocot.
4. The method of claim 1, wherein the T-DNA is integrated into a locus in Agrobacterium chromosome that does not significantly affect the growth of the Agrobacterium.
5. The method of claim 4, wherein the locus is picA/pgl.
6. A method to generate a transgenic plant with a single transgenic copy of a gene of interest, the method comprising:
(a) obtaining an Agrobacterium strain comprising a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence comprises the gene of interest;
(b) transforming a suitable host plant material with the Agrobacterium;
(c) determining the copy number of the gene of interest in the transgenic plant; and
(d) selecting the transgenic plant with a single copy of the gene of interest.
7. A method to generate a transgenic plant without a vector backbone sequence, the method comprising:
(a) obtaining an Agrobacterium strain comprising a T-DNA sequence integrated into the Agrobacterium chromosome, wherein the T-DNA sequence comprises a gene of interest; and
(b) transforming a suitable host plant material with the Agrobacterium, thereby generating the transgenic plant without the vector backbone sequence.
8. A method of obtaining an Agrobacterium strain capable of generating a transgenic plant with a single copy of a gene of interest in the absence of any vector backbone sequence, the method comprising
(a) obtaining an integration vector comprising the gene of interest in a T-DNA sequence and a sequence to mediate chromosomal integration into the Agrobacterium chromosome; and
(b) transforming the Agrobacterium with the integration vector; and
(c) obtaining the Agrobacterium strain wherein the T-DNA is integrated into the Agrobacterium chromosome.
9. A method of reducing transgene copy number and minimizing integration of vector backbone sequence in a transgenic plant, the method comprising:
(a) obtaining a bacterial strain capable of transforming a plant cell, the bacterial strain comprising a DNA sequence of interest integrated into the bacterial chromosome, wherein the DNA sequence of interest is capable of being delivered into a plant cell; and
(b) transforming a suitable host plant material with the bacterial strain, thereby reducing transgene copy number and minimizing vector backbone sequence in the resulting transgenic plant.
10. The method of claim 9, wherein the bacterial strain is selected from the group consisting of Agrobacterium spp., Bradyrhizobium spp., Rhizobium spp., Mesorhizobium spp., Ochrobactrum spp., Sinorhizobium spp. ,and Phyllobacterium spp.
11. An Agrobacterium strain comprising a T-DNA integrated into a chromosomal locus of the Agrobacterium, wherein the T-DNA comprises a gene of interest and a selectable marker.
12. The Agrobacterium strain of claim 11 , wherein the T-DNA is flanked by a portion of a bacterial cloning vector sequence to facilitate homologous recombination.
13. The Agrobacterium strain of claim 11 , wherein the bacterial cloning vector is a plasmid.
14. The Agrobacterium strain of claim 11 , wherein the chromosomal locus is picA/pgl.
15. The Agrobacterium strain of claim 11, wherein the T-DNA is capable of being integrated stably as a single copy in a plant genome.
16. The Agrobacterium strain of claim 11, wherein the T-DNA is capable of being delivered into a plant cell without any vector backbone sequence.
17. An Agrobacterium chromosomal integration vector comprising a portion of an Agrobacterium chromosomal sequence to facilitate integration into the chromosome of the Agrobacterium and a T-DNA.
18. The vector of claim 17, wherein the chromosomal locus is picA/pgl.
19. Use of the strain of claim 11 to generate a transgenic plant with an improved agronomic trait.
20. The use of claim 19, wherein the transgenic plant is selected from the group consisting of corn, canola, cotton, soybean, rice, barley, and wheat.
PCT/US2007/084668 2006-11-15 2007-11-14 Backbone-free low transgene copy transgenic plants Ceased WO2008085605A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/514,180 US8334428B2 (en) 2006-11-15 2007-11-14 Backbone-free low transgene copy transgenic plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US86600606P 2006-11-15 2006-11-15
US60/866,006 2006-11-15

Publications (2)

Publication Number Publication Date
WO2008085605A2 true WO2008085605A2 (en) 2008-07-17
WO2008085605A3 WO2008085605A3 (en) 2008-09-25

Family

ID=39577254

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/084668 Ceased WO2008085605A2 (en) 2006-11-15 2007-11-14 Backbone-free low transgene copy transgenic plants

Country Status (2)

Country Link
US (1) US8334428B2 (en)
WO (1) WO2008085605A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019177976A1 (en) * 2018-03-12 2019-09-19 Pioneer Hi-Bred International, Inc. Methods for plant transformation

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK3341483T3 (en) 2015-08-28 2020-03-16 Pioneer Hi Bred Int OCHROBACTRUM-MEDIATED TRANSFORMATION OF PLANTS
UA129369C2 (en) 2019-03-28 2025-04-02 Байосіріз Елелсі Soybean transgenic event ind-шш41ш-5
CN113736900B (en) * 2021-08-30 2023-07-25 华南农业大学 Method for screening single copy T-DNA transgenic plants

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8993846B2 (en) * 2005-09-06 2015-03-31 Monsanto Technology Llc Vectors and methods for improved plant transformation efficiency

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019177976A1 (en) * 2018-03-12 2019-09-19 Pioneer Hi-Bred International, Inc. Methods for plant transformation
US12344851B2 (en) 2018-03-12 2025-07-01 Pioneer Hi-Bred International, Inc. Use of morphogenic factors for the improvement of gene editing
EP4549576A3 (en) * 2018-03-12 2025-07-30 Pioneer Hi-Bred International, Inc. Methods for plant transformation

Also Published As

Publication number Publication date
US8334428B2 (en) 2012-12-18
US20100005547A1 (en) 2010-01-07
WO2008085605A3 (en) 2008-09-25

Similar Documents

Publication Publication Date Title
EP2597943B1 (en) Strains of agrobacterium modified to increase plant transformation frequency
US10266835B2 (en) Agrobacterium bacterium to be used in plant transformation method
Ghedira et al. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant
EP2274973A1 (en) Agrobacterium-mediated method for producing transformed plant
Cui et al. Efficient shoot regeneration from hairy roots of Antirrhinum majus L. transformed by the rol type MAT vector system
Lee et al. Small high-yielding binary Ti vectors pLSU with co-directional replicons for Agrobacterium tumefaciens-mediated transformation of higher plants
JP2002514927A (en) Plasmids for plant transformation and methods of using the same
US8334428B2 (en) Backbone-free low transgene copy transgenic plants
Alimohammadi et al. Agrobacterium-mediated transformation of plants: Basic principles and influencing factors
Kim et al. Bacterial transposons are co-transferred with T-DNA to rice chromosomes during Agrobacterium-mediated transformation
EP0841402B1 (en) High capacity binary shuttle vector
WO2008095066A2 (en) Auto-regulated expression of bacterial isopentenyltransferase gene promotes t-dna transformaton in soybean
KR100917574B1 (en) Preparation of Transgenic Potato Plants Using Toxoflavin Degrading Enzyme as a Selection Marker
JP2018535667A (en) Transformation method and composition for transformation comprising negative selection marker
JP4595631B2 (en) Method for producing transgenic cell, tissue or plant in which influence of selection marker gene is excluded
Oltmanns et al. Generation of" backbone" free, low transgene copy plants by launching T-DNA from the Agrobacterium chromosome
JP5114161B2 (en) Novel site-specific recombinase recognition sequences and vectors
Xin et al. An efficient marker-free vector for clean gene transfer into plants
Berson Unexpected chromosomal DNA transfer from Agrobacterium tumefaciens to plant cells
Berson Unexpected chromosomal DNA transfer from Agrobacterium tumefaciens to plant cells: mechanisms and solutions
Gelvin Manipulating plant histone genes to improve agrobacterium-and direct DNA-mediated plant genetic transformation
Khomdram et al. Transient GUS assay based quick screening method of genes cloned in a binary vector in tandem for plant transformation
JP2005192551A (en) New vector
Wang et al. A novel double T-DNA system for producing stack and marker-free transgenic plants
Oltmanns et al. Generation of Backbone-Free, Low Transgene Copy Plants by Launching T-DNA from the Agrobacterium Chromosome1 [W][OA]

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07872345

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12514180

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 07872345

Country of ref document: EP

Kind code of ref document: A2