WO2008081451A2 - Methods and kits for analyzing genetic material of a fetus - Google Patents

Methods and kits for analyzing genetic material of a fetus Download PDF

Info

Publication number
WO2008081451A2
WO2008081451A2 PCT/IL2008/000019 IL2008000019W WO2008081451A2 WO 2008081451 A2 WO2008081451 A2 WO 2008081451A2 IL 2008000019 W IL2008000019 W IL 2008000019W WO 2008081451 A2 WO2008081451 A2 WO 2008081451A2
Authority
WO
WIPO (PCT)
Prior art keywords
method
analysis
fetal
dna
telomere
Prior art date
Application number
PCT/IL2008/000019
Other languages
French (fr)
Other versions
WO2008081451A3 (en
Inventor
Boris Tartakovsky
Shlomi Lazar
Meital Liberman
Shiri Eckstein
Avi Or-Ortger
Original Assignee
Monaliza Medical Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US87804907P priority Critical
Priority to US60/878,049 priority
Application filed by Monaliza Medical Ltd. filed Critical Monaliza Medical Ltd.
Publication of WO2008081451A2 publication Critical patent/WO2008081451A2/en
Publication of WO2008081451A3 publication Critical patent/WO2008081451A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Abstract

A non-invasive method of analyzing a genetic material of a fetus is provided. The method is effected by identifying a fetal nucleus in a sample such as a transcervical specimen obtained from a pregnant woman by measuring telomere length; and molecularly analyzing the genetic material in the fetal nucleus, thereby analyzing the genetic material of the fetus.

Description

METHODS AND KITS FOR ANALYZING GENETIC MATERIAL

OF A FETUS

FIELD OF THE INVENTION

The present invention relates to the identification of fetal genetic material in samples obtained from pregnant women based on telomere length analysis, and more particularly, to a non-invasive method of prenatal diagnosis using same.

BACKGROUND OF THE INVENTION

Prenatal diagnosis involves the identification of major or minor fetal malformations or genetic diseases present in a human fetus. Ultrasound scans can usually detect structural malformations such as those involving the neural tube, heart, kidney, limbs and the like. On the other hand, chromosomal aberrations such as presence of extra chromosomes [e.g., Trisomy 21 (Down syndrome); Klinefelter's syndrome (47, XXY); Trisomy 13 (Patau syndrome); Trisomy 18 (Edwards syndrome); 47, XYY; 47, XXX], the^bsence of chromosomes [e.g., Turner's syndrome (45, XO)], or various translocations and deletions can be currently detected using fetal tissue derived from chorionic villus sampling (CVS) and/or amniocentesis.

Currently, prenatal chromosomal analysis is usually offered to women over the age of 35, to women with abnormalities in prenatal ultrasound and/or to women which are known carriers of genetic diseases such as balanced translocations or microdeletions (e.g., Di-George syndrome), and the like. Thus, the percentage of women over the age of 35 who give birth to babies with chromosomal aberrations such as Down syndrome has been drastically reduced. However, the infrequent prenatal testing in younger women resulted in the surprising statistics that 80 % of Down syndrome babies are actually born to women under the age of 35.

CVS is usually performed between the 10th and the 13th week of gestation by inserting a catheter through the cervix or a needle through the abdominal wall and removing a small sample of the placenta (i.e., chorionic villus). Fetal karyotype is usually determined within one to two weeks of the CVS procedure. However, since CVS is an invasive procedure it carries about 1 % procedure-related risk of miscarriage and if done earlier, it may be associated with an increased risk of fetal abnormality such as defective limb development, presumably due to hemorrhage or embolism from the aspirated placental tissues.

On the other hand, amniocentesis is performed between the 16th to the 20th week of gestation by inserting a thin needle through the abdomen into the uterus. The amniocentesis procedure carries about 0.5% procedure-related risk of miscarriage. Following aspiration of amniotic fluid, the fetal fibroblast cells are further cultured for 1- 2 weeks, following which they are subjected to cytogenetic (e.g., G-banding) and/or FISH analysis. Thus, fetal karyotype analysis is obtained within 2-3 weeks of sampling the cells. However, in cases of abnormal findings, the termination of pregnancy usually occurs between the 18th to the 22nd week of gestation, involving the Boero technique, a more complicated procedure in terms of psychological and clinical aspects.

The discovery of fetal nucleated erythrocytes in the maternal blood early in gestation has prompted many investigators to develop methods of isolating these cells and subjecting them to genetic analysis (e.g., PCR, FISH). However, since the frequency of nucleated fetal cells in the maternal blood is exceptionally low (0.0035 %), the NRBC cells had to be first purified (e.g., using Ficol-Paque or Percoll-gradient density centrifugation) and then enriched using for example, charge flow separation (Wachtel, S.S. et al., 1996, Hum. Genet. 98:162-166).

U.S. Pat. No. 5,750,339 discloses genetic analysis of fetal nucleated red blood cells (NRBCs) derived from the maternal blood. According to the approach disclosed therein, the fetal cells are enriched using anti CD71, CD36 and/or glycophorin A and the maternal cells are depleted using anti-maternal antibodies such as anti-CD14, CD4, CD8, CD3, CD 19, CD32, CD 16 and CD4. Resultant fetal cells are identified using HLA-G specific detection. Although recovery of fetal NRBCs can be effected using such an approach, inconsistent recovery rates coupled with limited sensitivity prevents clinical application of diagnostic techniques using fetal NRBCs (Bischoff, F. Z. et al., 2002. Hum. Repr. Update 8: 493-500). Various studies attempted to isolate fetal trophoblasts from the maternal blood (WO 9915892A1 Pat. Appl. to Kalionis B; U.S. Pat. Appl. No. 20050049793 to Paterlini- Brechot, P., et al.; US Pat. Appl. Nos. 20020045196Al, 20030013123 and EP Pat. Appl. No. 1154016A2 to Mahoney W. et al.). However, all of these studies resulted in inconsistent results due to the isolation of mixed cells in which the genetic origin (i.e., maternal or fetal) was uncertain.

Other studies describe the identification of trophoblast cells in transcervical specimens using a variety of antibodies such as HLA-G (Bulmer, J.N. et al., 2003. Prenat. Diagn. 23: 34-39), PLAP, FT 1.41.1, NDOG-I, NDOG-5, and 340 (Miller et al., 1999. Human Reproduction, 14: 521-531). In these studies the antibodies truly recognized trophoblasts cells in 30-79 % of the transcervical specimens. In addition, the FISH, PCR and/or quantitative fluorescent PCR (QF-PCR) analysis, which were performed on duplicated transcervical specimens, were capable of identifying approximately 80-90 % of all, male fetuses. However, since the DNA (e.g., FISH and/or PCR) and immunological (e.g., IHC) analysis were performed on separated slides, these methods were impractical for diagnosing fetal chromosomal abnormalities. Other studies utilizing magnetic activating cell sorting on transcervical trophoblasts resulted in mixed populations of fetal and maternal cells, limiting their use in prenatal diagnosis (PCT WO04076653A1 to Irwin DL. et al.).

The present inventors have previously disclosed non-invasive methods for prenatal diagnosis using trophoblast cells present in transcervical specimens (PCT Publication Nos. WO 04087863 and WO 06018849). According to these methods, the trophoblast cells are first identified by immunological or RNA-Zw situ hybridization staining methods using antibodies or probes specific to fetal cells and then are subjected to a molecular analysis (using e.g., FISH, DNA-based analysis) which allows, with high accuracy, the identification of chromosomal and/or DNA abnormalities in the fetus.

Recently, cell-free fetal DNA circulating in the maternal plasma was used for determining fetal gender or Rhesus (Rh)-D (RhD) status (Brojer E., et al., 2005, Transfusion, 45: 1473-80) or point mutations for beta-thalassemia (Li Y,, et al., 2005, JAMA, 293: 843-9). WO 01/81626 proposes a method for the identification of fetal cell nuclei, chromosomes or DNA in a maternal sample which comprises subjecting chromosomes to exonucleolytic digestion by an enzyme in order to remove the end regions of the chromosomes and detecting the presence of a DNA sequence remaining in the fetal DNA but absent in maternal DNA.

Telomeres, or the ends of linear eukaryotic chromosomes, were first described almost 70 years ago. Telomeres are unique structures at the physical ends of linear eukaryotic chromosomes. They are composed of repetitive Guanine-rich sequences and associated proteins which together form a cap that protects chromosome ends. In all vertebrates, telomeres consist of tandem repeats of the hexanucleotide sequence (TTAGGG) n. hi normal human cells, the DNA at each chromosome terminus spans 5-20 kb in length. Telomere length maintenance in replicating cells is a state of equilibrium between telomere loss due to the end processing problem of DNA polymerase and telomere addition by telomerase (Harley et al. (1990) Nature 345, 458-460). Most of the human somatic cells do not express sufficient telomerase activity to prevent telomere loss as they divide. As a result, telomeres eventually will be shortened with cell aging, losing approximately 50-200 base-pairs with every cell doubling. For review on telomeres, see Blackburn, E.H. (1991) Nature 350, 569-573 and Bolzan and Bianchi (2006) Mutation Research 612 189-214).

SUMMARY OF THE INVENTION

The applicants have found that biological specimens obtained from the cervix of pregnant women between gestation week 5 and 12 contain fetal trophoblast cells, but most of these cells are disrupted and lost their cytoplasm as well as most of their proteins and RNA. However, the maternal specimens contain an abundance of cell free fetal nuclei. The present indention therefore provides a method of detecting such fetal cell-free nuclei by using a chromosomal marker which remains detectable even under circumstances in which other fetal markers are lost. The invention takes advantage of the telomere shortening phenomenon which causes fetal telomeres to be much longer than mature maternal telomeres. The difference in their length can be easily visualized, without the use of any modification (e.g. digestion by exonuclease) thereby allowing the identification of fetal chromosomes, cell free fetal nuclei, and fetal cells in a maternal transcervical specimen.

Once a fetal nucleus is identified as described above it can be subjected to further genetic analysis as will be specified in detail below.

According to one aspect, the present invention provides a method of identifying fetal genetic material in a maternal biological sample comprising:

(a) Staining a maternal biological sample with a telomere specific marker;

(b) Observing said sample under conditions that permit visualization of the telomere specific marker;

(c) Identifying locations that are intensively stained; said locations being characterized as containing the fetal genetic material.

According to one embodiment the differential fluorescence intensity of the telomere-specific probe may be quantitatively analyzed, e.g. using a computer program, and the identification of the fetal genetic material, and recordation of its location may be based on said quantitative analysis and may also be performed automatically using said computer program.

According to another aspect, the present invention provides a method of analyzing a genetic material of a fetus, comprising: a. Staining a maternal biological sample with a telomere specific marker; b. Observing said sample under conditions that permit visualization of the telomere specific marker; c. Identifying locations that are intensively stained; said locations being characterized as containing the fetal genetic material; and d. Performing a molecular analysis of said fetal genetic material at the identified location. According to other embodiments of the invention, the molecular analysis of step

(d) may be performed prior to or simultaneously with the telomere specific staining of step (a).

According to yet another aspect the present invention provides a method of computer-aided analysis of fetal genetic material, comprising

(a) Staining a maternal biological sample with a telomere specific marker;

(b) Observing said sample under conditions that permit visualization of the telomere specific marker;

(c) Performing a computerized scan of said stained biological sample to identify locations that are intensively stained; said locations being characterized as containing the fetal genetic material;

(d) Recording coordinates of said locations;

(e) Performing a molecular analysis of fetal genetic material in said biological sample according to the location coordinates obtained in step (d).

According to other embodiments of the invention, the molecular analysis of step

(e) may be performed prior to or simultaneously with the telomere specific staining of step (a).

According to yet another aspect, the present invention provides a kit for analyzing a genetic material of a fetus, comprising a packaging material packaging a reagent for determining telomere length.

According to one embodiment, the fetal genetic material identifiable by the method of the present invention may be cell nuclei, cell-free nuclei, chromosomes, chromatin or free DNA.

According to one embodiment the maternal biological sample is obtained from a cervix and/or a uterus of a pregnant woman. According to another embodiment the sample is placental villi. According to another embodiment the sample is placental biopsy. According to another embodiment the sample is CVS material. According to another embodiment the sample is amniocytes. According to another embodiment the maternal biological sample is obtained from a blood sample of a pregnant woman. The maternal biological sample is preferably obtained from a pregnant woman at 5 to 15 week of gestation, but may be obtained throughout the pregnancy.

The sample may be obtained using any of the following methods: aspiration, cytobrush, cotton wool swab, endocervical lavage, biopsies (including needle biopsies) and intrauterine lavage.

According to one embodiment, telomere staining is performed by a primary labeled telomere specific probe. In a preferred embodiment, the label is a fluorescent label.

According to one embodiment, the telomere staining comprises in situ hybridization. In a preferred embodiment fluorescent in situ hybridization (FISH) is used. The in situ hybridization is performed using a probe selected from the group consisting of an RNA molecule, a DNA molecule and a PNA oligonucleotide. According to one embodiment the genetic analysis is performed using a probe directed to sites of genetic variations detected by comparative genomic hybridization (CGH) and/or by the identification of at least one nucleic acid substitution. According to another embodiment analysis of the genetic material of the fetus enables the identification of fetal gender, at least one chromosomal abnormality, at least one DNA abnormality and/or a paternity of the fetus. The chromosome abnormality may be selected from the group consisting of aneuploidy, translocation, subtelomeric rearrangement, unbalanced subtelomeric rearrangement, deletion, microdeletion, inversion, duplication, and telomere instability and/or shortening. According to preferred embodiment the chromosomal aneuploidy is a complete and/or partial trisomy. According to another embodiment the chromosomal aneuploidy is a complete and/or partial monosomy. According to yet another embodiment at least one DNA abnormality is selected from the group consisting of single nucleotide substitution, micro-deletion, micro-insertion, short deletions, short insertions, multinucleotide changes, DNA methylation, loss of imprint (LOI) and short or long genomic copy number variation.

According to one embodiment, the method further comprises a step of isolating fetal cell nuclei prior to the molecular analysis of fetal genetic material. The fetal cell nuclei isolation may be effected by microdissection. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is herein described, by way of example only, with reference to the accompanying drawings.

In the drawings:

Figure 1: is a photomicrograph illustrating placental (Fetal and maternal) cells treated with Proteinase K (ProtK) for 5 min and 1% Triton X-IOO for 15 min. The left panel demonstrates FISH analysis of X and Y chromosomes performed using the SatIIIY (green) and CEP X (orange) probes. The right panel presents telomere staining of the same cells using PNA. Arrows with Prefix E Indicate male embryo cells, arrows with prefix M Indicate maternal cells.

Figure 2: is a photomicrograph illustrating Fetal and maternal cells obtained from a cervical (or external uterine-cervix) sample treated with ProtK for 5 min and 1% triton for 15 min. The left panel demonstrates FISH analysis of X and Y chromosomes performed using the SatIII Y (green) and CEP X (orange) probes. The right panel presents telomere staining of the same cells using PNA. Arrows with Prefix E Indicate male embryo cells, arrows with prefix M Indicate maternal cells.

Figure 3: is a photomicrograph illustrating fetal and maternal cells obtained from a cervical (or external uterine-cervix) sample treated with ProtK for 5 min and 1% triton for 15 min. The left panel demonstrates FISH analysis of X and Y chromosomes performed using the SatIII Y (green) and CEP X (orange) probes. The right panel presents telomere staining of the same cells using PNA. Arrows with Prefix E Indicate male embryo cells, arrows with prefix M Indicate maternal cells.

Figure 4: is a photomicrograph illustrating fetal and maternal cell nuclei fluorescently stained using a telomere specific PNA probe diluted 1 :10 (left panel), and FISH analysis of the same cells using probes CEPX and SatIIIY for X and Y chromosomes respectively.

Figure 5: is a photomicrograph illustrating fetal and maternal cell nuclei which were pre incubated with 0.5nM TelX5 oligo

(CCCTAACCCTAACCCTAACCCTAACCCTAA) and then fluorescently stained using a telomere specific PNA probe (left panel), and FISH analysis of the same cells using probes for X and Y chromosomes.

Figure 6: is a photomicrograph illustrating fetal and maternal cell nuclei which were pre incubated with InM TelX5 oligo

(CCCTAACCCTAACCCTAACCCTAACCCTAA) and then fluorescently stained using a telomere specific PNA probe (left panel), and FISH analysis of the same cells using probes for X and Y chromosomes.

Figure 7: is a photomicrograph illustrating fetal and maternal cell nuclei which were pre incubated with 2nM SatIII Y probe and then fluorescently stained using a telomere specific PNA probe (left panel), and FISH analysis of the same cells using probes for X and Y chromosomes.

Figure 8: is a photomicrograph illustrating fetal and maternal cell nuclei fluorescently stained with a telomere specific probe (TelX4: GGGATTGGGATTGGGATTGGGATT) using the PRINS method (left panel), and FISH analysis of the same cells using probes for X and Y chromosomes. Figure 9: is a photomicrograph illustrating fetal and maternal cell nuclei fluorescently stained with a telomere specific probe (TelX6: CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA) using the PRINS method (left panel), and FISH analysis of the same cells using probes for X and Y chromosomes.

Figures 10a-b: are photomicrographs illustrating a mixture of maternal and fetal male cells obtained from placenta. Cells are concomitantly stained for Y (green spot, SatIII probe) and X (red spot, CEPX probe) chromosomes and for human telomeres (fine red spots), and viewed using FISH.

Figure 11: is a graph illustrating the percentage of maternal (XX) vs. male fetal (XY) cells in each grade group. Grade I represents weak telomere staining (short telomeres) while grade IV represents strong telomere staining (long telomeres). Grades II and III represent intermediate degrees of telomere staining.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention relates to the identification of fetal nuclei, chromosomes or DNA in a maternal biological sample which can be used for prenatal diagnosis. Specifically, the present invention uses an agent capable of identifying a marker of fetal genetic material, such as telomere length, for the identification of fetal nuclei, chromosomes or DNA which are further used for molecular and cytogenetic analysis of the fetus in order to determine fetal gender and/or a genetic abnormality.

The principles and operation of the method of analyzing the genetic material of a fetus according to the present invention may be better understood with reference to the drawings and accompanying descriptions.

Following are definitions of terms used in the specification:

"Maternal biological sample" as used herein concerns a sample of biological material (e.g. tissue, cells or cell fragments) obtained from vagina, cervix, uterus, placenta (including placental villi) or blood of a pregnant woman, which contains fetal nucleated erythrocytes, amniocytes, trophoblast cells or trophoblast cell nuclei. "Staining" as used herein concerns the act of marking telomeres by using a "telomere specific marker", i.e. a labeled probe (e.g. PNA or DNA probe) or any other fluorescence or immunohistochemical stain allowing the visualization of telomeres and subsequent identification of fetal cells in the biological sample.

"Intensively stained" as used herein refers to an intensive, rigorous staining that is clearly identified qualitatively upon viewing a sample under the microscope. The intensity of the telomere staining may also be quantitatively analyzed, e.g. using specialized computer software.

"Fetal genetic material" as used herein refers to fetal chromosomes, chromatin, free DNA or cell nuclei comprising same. The fetal genetic material may be detected in intact cells, in cell free nuclei, or even in a nuclei free form. Non-limiting examples of intact fetal cells include trophoblasts, fetal nucleated red blood cells, amniocytes and fetal leukocyte cells. The term "cell-free nuclei" refers to nuclei which have lost their surrounding cytoplasm, such as due to membrane rupture, apoptosis, enhanced osmosis and the like. The term "nuclei free" refers to chromatin, chromosomes or free DNA which is found in the sample and is not associated with a cell nucleus.

""Trophoblasf as used herein refers to an epithelial cell which is derived from the placenta of a mammalian embryo or fetus, which is either intact or disrupted. Trophoblasts typically contact the uterine wall. There are three types of trophoblast cells in the placental tissue: the villous cytotrophoblast, the syncytiotrophoblast, and the extravillous trophoblast, and as such, the term "trophoblast" as used herein encompasses any of these cells. The villous cytotrophoblast cells are specialized placental epithelial cells which differentiate, proliferate and invade the uterine wall to form the villi. Cytotrophoblasts, which are present in anchoring villi can fuse to form the syncytiotrophoblast layer or form columns of extravillous trophoblasts.

As used herein the term "polynucleotide probe" refers to any polynucleotide which is capable of hybridizing to telomeres. Such a polynucleotide probe can be at any size, including short polynucleotides (e.g., of 15-200 bases), intermediate size polynucleotides (e.g., 100-2000 bases) and/or long polynucleotides (e.g., 2000-5000).

The term "oligonucleotide" as used herein refers to a single stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring bases, sugars and covalent internucleoside linkages (e.g., backbone) as well as oligonucleotides having non-naturally-occurring portions which function similarly to respective naturally- occurring portions.

"Molecular analysis" as used herein refers to the identification of any genetic characteristic of a fetus. In this respect genetic analysis comprises: determining the presence or absence of a chromosomal abnormality, determining the presence or the absence of a DNA abnormality, determining a paternity of the fetus, determining the gender of the fetus, determining the presence or absence of a specific polymorphic allele, and/or analyzing the genetic makeup of the fetus.

The term "genetic analysis" as used herein refers to any chromosomal, DNA and/or RNA - based analysis capable of detecting chromosomal, DNA and/or gene expression abnormalities, respectively in a nucleus of the fetus.

As used herein "gender of a fetus" refers to the presence in the fetal material of two X chromosomes corresponding to a female genotype or the presence of one X and one Y chromosome corresponding to a male genotype.

As used herein "chromosomal abnormality" refers to an abnormal number of chromosomes (e.g., trisomy 21, monosomy X) or to chromosomal structure abnormalities (e.g., deletions, translocations, etc).

As used herein, "paternity" refers to the identification of a biological father of a child.

As used herein, "polymorphic markers" refer to any nucleic acid change (e.g., substitution, deletion, insertion, inversion), variable number of tandem repeats (VNTR), short tandem repeats (STR), minisatellite variant repeats (MVR) and the like.

Prior studies have uncovered the presence of fetal cells in maternal-derived samples. These include fetal nucleated erythrocytes (NRBCs; U.S. Pat. No. 5,750,339; Bischoff, F. Z. et al., 2002. Hum. Repr. Update 8: 493-500), trophoblast cells in the maternal blood (WO 9915892A1 Pat. Appl. to Kalionis B; U.S. Pat. Appl. No. 20050049793 to Paterlini-Brechot, P., et al.; US Pat. Appl. Nos. 20020045196Al, 20030013123 and EP Pat. Appl. No. 1154016A2 to Mahoney W. et al.) and trophoblast cells in transcervical specimens (Miller et al., 1999. Human Reproduction, 14: 521-531).

The present inventors have previously disclosed non-invasive methods for prenatal diagnosis using trophoblast cells present in transcervical specimens (PCT Publication Nos. WO04087863 and WO06018849). According to these methods, the trophoblast cells are first identified by immunological or RNA-ZM situ hybridization staining methods using antibodies or probes specific to fetal cells and are then subjected to a molecular analysis (using e.g., FISH, DNA-based analysis) which allows, with relatively high accuracy, the identification of chromosomal and/or DNA abnormalities in the fetus. However, these methods are limited by the availability of trophoblast cells in transcervical samples.

Recently, cell-free fetal DNA circulating in the maternal plasma was used for determining fetal RhD status (Brojer E., et al., 2005, Transfusion, 45: 1473-80) or point mutations for beta-thalassemia (Li Y, et al., 2005, JAMA, 293: 843-9).

Also, a method was proposed (WO 01/81626) for the identification of fetal cell nuclei, chromosomes or DNA in a maternal sample comprising subjecting chromosomes to exonucleolytic digestion by an enzyme in order to remove the end regions of the chromosomes and detecting the presence of a DNA sequence remaining in the fetal DNA but absent from maternal DNA.

While reducing the present invention to practice, the present inventors have uncovered that multiple cell-free fetal nuclei are present in transcervical specimens obtained from pregnant women, and that the relative representation of the fetal cell-free nuclei in the transcervical specimen is much higher than that of the intact fetal cells.

Moreover, since most of the cells in these specimens are damaged, many of the conventional fetal markers (e.g. protein or RNA markers) are lost and can no longer serve as a reliable tool to distinct between maternal and fetal genetic material. Hence it was of utmost importance to identify a marker which remains detectable even under circumstances in which other fetal markers are lost. Chromosomal elements seem to be more resistant to the harsh cervical environment. One such chromosomal element which may be used to distinct between maternal and fetal cells is the chromosomal telomere. Thus, according to one aspect, the present invention provides a method of identifying fetal genetic material. The method is affected by measuring chromosome- specific telomere length in a biological sample, without prior use of an exonuclease enzyme, whereby intensive telomere staining is indicative of fetal origin of the chromosomal material.

The biological sample is obtained from a pregnant woman at any stage of the pregnancy. Such a sample preferably contains trophoblast genetic material.

The biological sample includes a blood sample, a transcervical and/or intrauterine sample, an amniotic fluid sample and/or a CVS sample. Preferably, the sample is obtained using a non-invasive method, e.g., by drawing maternal blood or obtaining a specimen from the cervix of a pregnant woman.

The biological sample utilized by the method of the present invention can be obtained using any one of numerous well known cell collection techniques.

According to preferred embodiments of the present invention the biological sample is obtained using mucus aspiration, cytobrush, cotton wool swab, endocervical lavage, biopsies, including needle biopsies and intrauterine lavage. See for comparison of the various approaches Adinolfi, M. and Sherlock, J. (J. Hum. Genet. 2001, 46: 99-104). The cytobrush method is the presently preferred method of obtaining the biological sample of the present invention.

Thus, according to preferred embodiments of the present invention the biological sample is obtained from a pregnant woman at 3rd to 15th week of gestation. Preferably, the biological sample is obtained from a pregnant woman between the 4th to 15th week of gestation, more preferably, between the 5th to 15th week of gestation, more preferably, between the 6th to the 13th week of gestation, more preferably, between the 6th to the 11th week of gestation, even more preferably between the 6th to the 10th week of gestation.

It will be appreciated that the determination of the exact week of gestation during a pregnancy is well within the capabilities of one of ordinary skill in the art of Gynecology and Obstetrics.

Notwithstanding the above, it will be appreciated that the biological sample may be obtained throughout the pregnancy. In accordance with one embodiment, the biological sample is obtained by CVS. The use of the methods of the present invention may expedite the time required for analysis of CVS specimen and reduce it to a few hours, while presently the analysis requires a few days (due to the need to culture the cells obtained in the sample).

Chorionic Villous Sampling is currently the earliest prenatal diagnosis technique that allows direct genetic and biochemical diagnoses of embryonic cells. A biopsy from the placenta is usually done via the vagina and is routinely performed between 10-12 weeks of gestation. Although amniocentesis (which is being done between 16-20 weeks of gestation) is less risky than CVS, carrying only 0.5% chance for abortion compared with 1% with CVS, there is a major drive for the pregnant women (couples) to know the status of their embryos as earlier as possible. Such knowledge will allow them to make informed decisions and to avoid further anxiety.

In CVS, a chromosomal G-banding diagnosis is being done in two stages:

• "Direct" - preliminary results from cells that were directly taken from the tissue sample will take 2-3 days.

• "Culture" - final results from cultured cells will take 7-12 days.

One of the main factors that determine the quality and rate of successful CVS diagnosis is the separation of the embryonic villi from the maternal villi. This is a time consuming, error prone procedure done manually by an expert cytogeneticist in order to prevent contamination of embryonic tissue by maternal-derived cell.

The methods of the present invention provide a diagnostic setup that will allow immediate preliminary results from CVS test, within about 3 hours.

According to these aspects of the present invention the identification of the origin of the genetic material (i.e. maternal or fetal) is performed using a telomere-specific probe which enables the visualization of telomere length, whereby intensive telomere staining is indicative of long telomeres and a fetal origin of the chromosomal material.

Telomere visualization can be performed according to any method known in the art, for example, Lansdorp et al. (Hum MoI Genet 5:685-691, 1996) developed a method to measure individual telomeres, using in situ hybridization on metaphase chromosomes, employing peptide nucleic acid (PNA) probes and digital fluorescence microscopy. Poon et al. describe a digital image microscopy system for measurements of the fluorescence intensity derived from telomere repeat sequences in metaphase cells following quantitative fluorescence in situ hybridization (Q-FISH) (Poon et al. (1999) Cytometry 36, 267-278). Fluorescently labeled telomere specific probes are used as well as the DNA dye DAPI. Separate fluorescence images are taken and processed with a dedicated computer program allowing quantitative intensity measurements.

Telomere visualization according to this aspect of the present invention is preferably effected using telomere-specific polynucleotide probes used in an in situ hybridization technique.

According to preferred embodiments the polynucleotide probe used by the present invention can be any directly or indirectly labeled RNA molecule (e.g., RNA oligonucleotide, an in vitro transcribed RNA molecule), DNA molecule (e.g., oligonucleotide, complementary DNA (cDNA) molecule, genomic molecule) and/or an analogue thereof (e.g., peptide nucleic acid {PNA]) which is telomere specific. Methods of preparing such probes are well known in the art.

Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis. Equipment and reagents for executing solid-phase synthesis are commercially available. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies.

Oligonucleotides may be used as such or modified in the backbone, the internucleoside linkages or the bases. Non-limiting examples of modified oligonucleotides include phosphorothioates or methylated oligonucleotides. Other oligonucleotides which can be used according to the present invention are those modified in both sugar and the internucleoside linkage of the nucleotide units and are replaced with novel groups. The base units are maintained for complementation with the appropriate polynucleotide target. An example for such a modified oligonucleotide is a peptide nucleic acid (PNA). A PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Methods for the preparation of PNA compounds are well known in the art, for example as disclosed in U.S. Patent 5,539,082 which is herein incorporated by reference.

The probes can be directly or indirectly labeled using a tag or label molecule. Such labels can be, for example, fluorescent molecules (e.g., Cy2, Cy3, fluorescein or Texas Red), radioactive molecule (e.g., P-γ-ATP or P-α-ATP) and chromogenic substrates (e.g., Fast Red, BCIP/INT). Direct labeling can be achieved by covalently conjugating to the polynucleotide (e.g., using solid-phase synthesis) or incorporating via polymerization (e.g., using an in vitro transcription reaction) the label molecule. Indirect labeling can be achieved by covalently conjugating or incorporating to the polynucleotide a non-labeled tag molecule (e.g., Digoxigenin or biotin) and subsequently subjecting the polynucleotide to a labeled molecule (e.g., anti-Digoxigenin antibody or streptavidin) capable of specifically recognizing the non-labeled tag.

In situ hybridization can utilize a DNA, a cDNA, an RNA or a PNA probe which hybridizes with a DNA sequence specific to telomeres. In situ hybridization is performed according to protocols well known in the art.

Following the in situ hybridization, viewing of the samples is performed using a conventional light microscope, equipped with filters which allow detection of fluorescent signals.

It will be appreciated that once the fetal cell-free nucleus or other form of genetic material is identified it can be subject to genetic analysis enabling prenatal diagnosis of the fetus. This includes determination of fetal gender and/or paternity and identification of chromosomal, or DNA abnormalities. The present invention therefore provides a new and robust method of non- invasive prenatal diagnosis.

Prenatal diagnosis involves the identification of major or minor fetal malformations or genetic diseases present in a human fetus. Chromosomal aberrations such as presence of extra chromosomes [e.g., Trisomy 21 (Down syndrome); Klinefelter' s syndrome (47, XXY); Trisomy 13 (Patau syndrome); Trisomy 18 (Edwards syndrome); 47, XYY; 47, XXX], the absence of chromosomes [e.g., Turner's syndrome (45, XO)], or various translocations and deletions are currently detected using chorionic villus sampling (CVS) or amniocentesis. However, although desired, such invasive procedures carry a procedure-related risk of miscarriage of about 1% or 0.5%, respectively.

Thus, according to another aspect the present invention provides a method of analyzing the genetic material of a fetus. The method is effected by (a) measuring chromosome-specific telomere length in a biological sample, without prior use of an exonuclease enzyme, whereby intensive telomere staining is indicative of fetal origin of the chromosomal material; thereby identifying fetal genetic material; and (b) performing a molecular analysis of the genetic material of the fetus.

Molecular analysis of the genetic material of the fetus refers to the identification of any genetic characteristic of the fetus using genetic material derived from the fetus. For example, analysis of the genetic material of the fetus according to this aspect of the present invention may refer to determining the presence or absence of at least one chromosomal abnormality, determining the presence or the absence of at least one DNA abnormality, determining a paternity of the fetus, determining the gender of the fetus, determining the presence or absence of a specific polymorphic allele, and/or analyzing the genetic makeup of the fetus.

To identify or diagnose chromosomal and/or DNA abnormalities and/or fetal paternity or gender, the identified fetal nuclei and other genetic material of the present invention are preferably subjected to molecular analysis. Preferably, such a molecular analysis utilizes an approach such as in situ chromosomal analysis, in situ DNA analysis and/or genetic analysis.

In situ chromosomal analysis refers to the analysis of the chromosome(s) using fluorescent in situ hybridization (FISH), and/or multicolor-banding (MCB), and/or multicolor-FISH, and/or whole chromosome painting.

Methods of employing FISH analysis on interphase chromosomes are known in the art. A non limiting example of a FISH protocol is provided herein below in the "Materials and Methods" section.

High-resolution multicolor banding (MCB) on interphase chromosomes, which is described in detail by Lemke et al. (Am. J. Hum. Genet. 71: 1051-1059, 2002) uses YAC/BAC and region-specific microdissection DNA libraries as DNA probes for interphase chromosomes. It will be appreciated that although MCB staining on inteφhase chromosomes was documented for a single chromosome at a time, it is conceivable that additional probes and unique combinations of fluorochromes can be used for MCB staining of two or more chromosomes at a single MCB analysis. Thus, this technique can be used along with the present invention to identify fetal chromosomal aberrations, particularly, for the detection of specific chromosomal abnormalities which are known to be present in other family members.

In situ DNA analysis refers to DNA-based analysis (e.g., primer extension) which is performed on the fetal nucleus or chromosomes such as primed in situ labeling (PRINS) or quantitative FISH (Q-FISH).

Methods of performing PRINS analysis are known in the art and include for example, those described in Koch, J (Met.in MoI. Biol. Vol.334 2nd Ed.) and Mennicke, K., et al. (Fetal Diagn. Ther. 2003, 18: 114-121).

It will be appreciated that several primers which are specific for several targets can be used on the same PRINS running using different 5' conjugates. Thus, the PRINS analysis can be used as a multicolor assay for the determination of the presence, and/or location of several genes or chromosomal loci (Pellestor et al. Chromosome Research 10: 359-367, 2002). In addition, the PRINS analysis can be performed on the same slide as the FISH analysis, preferably, prior to FISH analysis.

Quantitative FISH (Q-FISH) can be used to detect chromosomal abnormalities by measuring variations in fluorescence intensity of specific probes which hybridize to chromosomal DNA. Q-FISH can be performed using Peptide Nucleic Acid (PNA) oligonucleotide probes as described hereinabove. The hydrophobic and neutral backbone of PNA probes enables high affinity and specific hybridization to the nucleic acid counterparts (e.g., chromosomal DNA). Q-FISH has been applied on interphase nuclei to monitor telomere stability (Henderson S., et al., 1996; J. Cell Biol. 134: 1-12) and various other genetic abnormalities.

Since the in situ chromosomal and/or DNA analysis is performed on the same fetal nucleus, the method according to this aspect of the present invention can diagnose the fetus, i.e., determine fetal gender and/or paternity and identify at least one chromosomal and/or DNA abnormality of the fetus. According to preferred embodiments of the present invention, the chromosomal abnormality can be chromosomal aneuploidy (i.e., complete and/or partial trisomy and/or monosomy), translocation, subtelomeric rearrangement, deletion, microdeletion, inversion and/or duplication (i.e., complete an/or partial chromosome duplication).

According to preferred embodiments of the present invention the trisomy detected by the present invention can be trisomy 21 [using e.g., the LSI 21q22 orange labeled probe (Abbott cat no. 5J13-02)], trisomy 18 [using e.g., the CEP 18 green labeled probe (Abbott Cat No. 5Jl 0-18); the CEP® 18 (D 18Zl, α satellite) Spectrum Orange™ probe (Abbott Cat No. 5J08-18)], trisomy 13 [using e.g., the LSI® 13 SpectrumGreen™ probe (Abbott Cat. No. 5J14-18)], and the XXY, XYY, or XXX trisomies which can be detected using e.g., the CEP X green and Y orange probe (Abbott cat no. 5J10-51); and/or the CEP®X SpectrumGreen™/ SatIII®Y SpectrumOrange™ probe (Abbott Cat. No. 5Jl 0-51). It will be appreciated that the chromosomal abnormalities mentioned above and other chromosomal abnormalities can be detected using similar chromosome-specific FISH probes that are commercially available.

It will be appreciated that using the chromosome-specific FISH probes, PRINS primers, Q-FISH and MCB staining various other trisomies and partial trisomies can be detected according to the teachings of the present invention. These include, but are not limited to, partial trisomy lq32-44, trisomy 9p with trisomy 1Op, trisomy 4 mosaicism, trisomy 17p, partial trisomy 4q26-qter, trisomy 9, partial 2p trisomy, partial trisomy Iq, and/or partial trisomy 6p/monosomy 6q.

The method of the present invention can be also used to detect several chromosomal monosomies such as, monosomy 22, 16, 21 and 15, which are known to be involved in pregnancy miscarriage.

According to preferred embodiments of the present invention the monosomy detected by the method of the present invention can be monosomy X, monosomy 21, monosomy 22 [using e.g., the LSI 22 (BCR) probe (Abbott, Cat. No. 5Jl 7-24)], monosomy 16 (using e.g., the CEP 16 (D16Z3) Abbott, Cat. No. 6J36-17) and monosomy 15 [using e.g., the CEP 15 (D15Z4) probe (Abbott, Cat. No. 6J36-15)].

It will be appreciated that several translocations and microdeletions can be asymptomatic in the carrier parent, yet can cause a major genetic disease in the offspring. For example, a healthy mother who carries the 15ql l-ql3 micro-deletion can give birth to a child with Angelman syndrome, a severe neurodegenerative disorder. Thus, the present invention can be used to identify such a deletion in the fetus using e.g., FISH probes which are specific for such a deletion.

Thus, the present invention can be also used to detect any chromosomal abnormality if one of the parents is a known carrier of such abnormality. These include, but not limited to, mosaic for a small supernumerary marker chromosome (SMC); t(l l;14)(pl5;pl3) translocation; unbalanced translocation t(8;l l)(p23.2;pl5.5); I lq23 microdeletion; Smith-Magenis syndrome 17p 11.2 deletion; 22ql3.3 deletion; Xp22.3. microdeletion; 10pl4 deletion; 2Op microdeletion, DiGeorge syndrome [del(22)(ql l.2q 11.23)], Williams syndrome [7ql l.23 and 7q36 deletions]; Ip36 deletion; 2p microdeletion; neurofibromatosis type 1 (17ql 1.2 microdeletion); Yq deletion; WoIf- Hirschhorn syndrome (WHS, 4pl6.3 microdeletion); Ip36.2 microdeletion; 1 Iql4 deletion; 19ql3.2 microdeletion; Rubinstein-Taybi (16pl3.3 microdeletion); 7p21 microdeletion; Miller-Dieker syndrome (17pl3.3), 17pl 1.2 deletion; 2q37 microdeletion.

The present invention can be used to detect inversions [e.g., inverted chromosome X, inverted chromosome 10, cryptic subtelomeric chromosome rearrangements, and/or duplications.

It will be appreciated that once the fetal genetic material is identified in the biological sample, it is preferably photographed using e.g., a CCD camera. In order to subject the fetal nucleus or chromosomes to further chromosomal and/or DNA analysis, the position (i.e., coordinate location) of such a fetal nucleus on the slide is stored in the microscope or the computer connected thereto for later reference. Examples of microscope systems which enable identification and storage of nuclei coordinates include the Bio View Duet™ (Bio View Ltd., Rehovot, Israel), and the Applied Imaging System (Newcastle England), essentially as described in Merchant, F.A. and Castleman K.R. (Hum. Repr. Update, 2002, 8: 509-521).

Most of the in situ chromosomal and DNA analysis methods discussed above require preparatory steps that would result in removal of the telomere staining from the genetic material in the sample. Therefore, the recording of the exact position coordinates of the fetal nuclei or chromosomes allows the performance of subsequent analysis on the genetic material that was previously identified as being of a fetal origin.

According to the present invention in situ chromosomal and/or DNA analysis can be performed on fetal nuclei or chromosomes previously subjected to an in situ staining with a telomere-specific probe.

The signal obtained in the in situ staining using the telomere-specific probe can be developed prior to the in situ chromosomal staining for the genetic analysis. The sequence of events can also be reversed, i.e. the staining for genetic analysis can be performed prior to telomere staining. The signals of both types of staining can also be developed concomitantly.

As is mentioned hereinabove, the method according to this aspect of the present invention can be also used to diagnose at least one DNA abnormality in the fetus.

DNA abnormality refers to a single nucleotide substitution, deletion, insertion, micro-deletion, micro-insertion, short deletion, short insertion, multinucleotide substitution, and abnormal DNA methylation and loss of imprint (LOI). Such a DNA abnormality can be related to an inherited genetic disease such as a single-gene disorder (e.g., cystic fibrosis, Canavan, Tay-Sachs disease, Gaucher disease, Familial Dysautonomia, Niemann-Pick disease, Fanconi anemia, Ataxia telaugiestasia, Bloom syndrome, Familial Mediterranean fever (FMF), X-linked spondyloepiphyseal dysplasia tarda, factor XI), an imprinting disorder [e.g., Angelman Syndrome, Prader-Willi Syndrome, Beckwith-Wiedemann syndrome, Myoclonus-dystonia syndrome (MDS)], predisposition to various cancer diseases (e.g., mutations in the BRCAl and BRCA2 genes), as well as disorders which are caused by minor chromosomal aberrations (e.g., minor trisomy mosaicisms, duplication sub-telomeric regions, interstitial deletions or duplications) which are below the detection level of conventional in situ chromosomal and/or DNA analysis methods (i.e., FISH, Q-FISH, MCB and PRTNS).

According to preferred embodiments of this aspect of the present invention identification of at least one DNA abnormality is performed by a genetic analysis.

As is mentioned hereinabove, major and minor chromosomal abnormalities can be detected in interphase chromosomes using conventional methods such as FISH, Q- FISH, MCB and' PRINS. However, the identification of some subtle chromosomal abnormalities requires the application of DNA-based detection methods such as comparative genome hybridization (CGH).

Comparative Genome Hybridization (CGH) is based on a quantitative two-color fluorescence in situ hybridization (FISH) on metaphase chromosomes. In this method a test DNA (e.g., DNA extracted from the cell-free fetal nucleus of the present invention) is labeled in one color (e.g., green) and mixed in a 1:1 ratio with a reference DNA (e.g., DNA extracted from a control cell-free nucleus) labeled in a different color (e.g., red). Methods of amplifying and labeling whole-genome DNA are well known in the art (see for example, Wells D, et al., 1999; Nucleic Acids Res. 27: 1214-8).

DNA array-based comparative genomic hybridization (CGH-array) (Hu, D. G., et al., 2004, MoI. Hum. Reprod. 10: 283-289) is a modified version of CGH and is based on the hybridization of a 1:1 mixture of the test and reference DNA probes on an array containing chromosome-specific DNA libraries.

The identification of single gene disorders, imprinting disorders, and/or predisposition to cancer can be effected using any method suitable for identification of at least one nucleic acid substitution such as a single nucleotide polymorphism (SNP).

Direct sequencing of a PCR product is based on the amplification of a genomic sequence using specific PCR primers in a PCR reaction followed by a sequencing reaction utilizing the sequence of one of the PCR primers as a sequencing primer. Sequencing reaction can be performed using, for example, the Applied Biosystems (Foster City, CA) ABI PRISM® BigDye™ Primer or BigDye™ Terminator Cycle Sequencing Kits.

Restriction fragment length polymorphism (RFLP) uses a change in a single nucleotide resulting in the modification of a recognition site for a restriction enzyme resulting in the creation or destruction of an RFLP. RFLP can be used on a genomic DNA using a labeled probe (i.e., Southern Blot RFLP) or on a PCR product (i.e., PCR- RFLP).

Allele specific oligonucleotide (ASO) is based on ASO designed to hybridize in proximity to the substituted nucleotide, such that a primer extension or ligation event can be used as the indicator of a match or a mismatch. Hybridization with radioactive labeled ASO also has been applied to the detection of specific SNPs. The method is based on the differences in the melting temperature of short DNA fragments differing by a single nucleotide. Stringent hybridization and washing conditions can differentiate between mutant and wild-type alleles.

It will be appreciated that ASO can be applied on a PCR product generated from genomic DNA. For example, to detect the A455E mutation which causes cystic fibrosis, trophoblast genomic DNA is amplified using PCR primers, and the resultant PCR product is subjected to an ASO hybridization using a specific oligonucleotide probe. Another oligonucleotide probe is applied to detect the presence of the wild-type allele.

Methylation-specific PCR (MSPCR) is used to detect specific changes in DNA methylation which are associated with imprinting disorders such Angelman or Prader- Willi syndromes.

Additional methods are described in the art and include Pyrosequencing™ analysis, Acycloprime™ analysis, reverse dot blot, Multiplex ligation-dependent probe amplification (MLPA), MS-MLPA (methylation specific MLPA), which is based on the MLPA analysis but it designed to detect the methylation status of CpG islands (using methylation sensitive enzymes) as well as the copy number of a gene.

As is mentioned before, diagnosing according to the method of this aspect of the present invention also encompasses determining the paternity of a fetus. Current methods of testing a prenatal paternity involve obtaining DNA samples from CVS and/or amniocentesis cell samples and subjecting them to PCR-based or RFLP analysis.

Paternity testing (i.e., identification of the paternity of a fetus) according to this

Y aspect of the present invention is affected by subjecting fetal genetic material to a genetic analysis capable of detecting polymorphic markers of the fetus, and comparing the fetal polymorphic markers to a set of polymorphic markers obtained from a potential father.

The polymorphic markers can be determined using a variety of methods known in the art, such as RFLP, PCR, PCR-RFLP and any SNP detection method

It will be appreciated that certain genetic analysis methods described hereinabove require the fetal genetic material to be isolated prior to being subjected to the genetic analysis. Thus, according to one embodiment of this aspect of the present invention, the method further comprises isolating the fetal material prior to employing DNA analysis and /or genetic analysis.

The term "isolating" refers to a physical isolation of fetal genetic material or fetal cell nuclei from a heterogeneous population of cells or cell-free nuclei. Fetal nuclei can be isolated from a sample containing maternal cells or nuclei (e.g., maternal blood, transcervical specimens) using e.g. a fluorescence activated cell sorter or coated beads with a magnetic or electric field based on the identification of fetal nucleus markers, e.g. telomere length. Alternatively, cell-free fetal nuclei can be isolated in situ (i.e., from a microscopic slide containing such cell-free nuclei) using, for example, laser-capture microdissection.

Laser-capture microdissection of fetal nuclei is used to selectively isolate a specific cell-free nucleus from a heterogeneous population of cells or cell-free nuclei contained on a slide. Methods of using laser-capture microdissection are well known in the art.

Altogether, the teachings of the present invention can be used to detect chromosomal and/or DNA abnormalities in a fetus, fetal paternity and/or fetal gender by subjecting cell-free fetal nuclei obtained from transcervical or maternal blood specimens to a staining method (e.g. FISH, PRINS) capable of detecting telomere length. Once identified, the cell-free fetal nucleus is subjected to an in situ chromosomal (e.g., FISH, MCB) and/or DNA (e.g., PRTNS, Q-FISH) analysis or to nucleus isolation followed by a genetic analysis method such as CGH or any PCR-based detection method.

Alternatively, in order to determine chromosomal and DNA abnormalities in a fetus, the intensively telomere stained fetal nuclei or chromosomes are viewed under a microscope and the locations of the fetal nuclei in the slide are marked and stored. The slides are further subjected to FISH analysis (which detects chromosomal abnormalities), followed by laser micro-dissection and isolation of fetal DNA which can be further subjected to CGH on either metaphase chromosome derived from a normal individual (i.e., 46, XX or 46, XY) or on a CGH-array. Alternatively, for the detection of a single gene disorder or an imprinting disorder, following FISH analysis the fetal DNA is subjected to any of the PCR-based genetic analysis methods (e.g., ASO, PCR-RPLP, MS- PCR, MLPA and the like).

To determine the paternity of a fetus, fetal nuclei are obtained from a pregnant mother and identified as described hereinabove. Once identified, the fetal nucleus is isolated using laser capture microdissection and the DNA of the isolated fetal nucleus is subjected to a genetic analysis of polymorphic markers such as the D1S80 (MCTl 18) marker, and/or the MS32 and/or the MS3 IA loci. The polymorphic markers of the fetal DNA (i.e., the DNA isolated from the cell-free fetal nucleus of the present invention) are compared to the set of polymorphic markers obtained from the potential father (and preferably also from the mother) and the likelihood of the potential father to be the biological father is calculated using methods known in the art.

Similar analysis can be performed using ethnic-related polymorphic markers (e.g., SNPs in which one allele is exclusively present in a certain ethnic population), which can be used to relate a specific fetus to a potential father of a specific ethnic group (e.g., African Americans) and "not to a second potential father of an entirely different ethnic group (e.g., from Iceland).

The agents of the present invention which are described hereinabove for visualizing the telomeres may be included in a diagnostic kit/article of manufacture preferably along with appropriate instructions for use and labels indicating FDA (or an equivalent authority) approval for use in analyzing the genetic material of the fetus.

Such a kit can include, for example, at least one container including a detectable diagnostic reagent for staining the telomeres (e.g., a fluorescently- labeled polynucleotide probe) and supporting reagents packed in another container (e.g., enzymes, buffers, chromogenic substrates, fluorogenic material). Preferably, the kit may further include a second reagent for a molecular analysis of the genetic material of the fetus. Such a reagent can be a FISH probe, a PCR primer for genetic analysis, a PNA probe for Q-FISH and the like. The kit may also include appropriate buffers and preservatives for improving the shelf life of the kit. Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate the invention in a non-limiting fashion.

Materials and Experimental Methods

Study subjects - Pregnant women between 5 th and 12th week of gestation, which were scheduled to undergo a pregnancy termination were enrolled in the study after giving their informed consent.

Sampling of transcervical cells - A Pap smear cytobrush (MedScand-AB, Malmδ, Sweden) was inserted through the external os to a maximum depth of 2 cm (the brush's length), and removed while rotating it a full turn (i.e., 360 °). In order to remove the transcervical cells caught on the brush, the brush was shaken into a test tube containing 2-3 ml of 2% Paraformaldehyde (PFA) in PBS (Sigma, Israel).

Transcervical cells harvesting- The above mentioned transcervical cell samples were then centrifuged (200Og) for 6min. at room temperature (RT). Supernatant was removed and 2-3ml Trypsin-EDTA (0.05% Trypsin-EDTA 1:5000, Biological Industries, Israel) was added to the pellet for 25min. at 37°C. The reaction was stopped by addition of 0.5ml Fixer solution (3:1 Methanol: Acetic acid glacial respectively). Centrifugation and addition of Fixer was repeated twice. Fixer is then added according to pellet size. lOOμl of transcervical cell suspension was loaded into the Cyto funnel Chamber Cytocentrifuge (Wescore, USA) and centrifuged at 1500 RPM for 5min. Slides were unloaded and washed with PBS (Sigma, Israel) for lOmin. at room temperature (RT). Next, the samples were treated with Proteinase K (Sigma) lμg/ml in PBS for 5min. at RT, washed with PBS for lOmin. at RT, the samples may optionally be treated with 1% Triton X-100 (Sigma) in PBS for 15min. at RT and washed again with PBS for lOmin. at RT. FISH Analysis

Slides were immersed in cold ethanol series 70%, 80%, 100% for 2min. each. The slides were dried for 2min at RT and incubated at 75°C for 5min.

The probe mixture was prepared as follows (Per one slide): 0.5μl probe (1:1 ratio CepX SatIIIY Vysis, USA), lμl DDW (Sigma, Israel), 3.5μl Hybrisol buffer. The probe was added immediately after aging and the slide was covered with 18X18mm coverslip. The slides are then loaded on HYBrite (Vysis, USA) using the following setup; Denaturation- 750C 3 min.; Hybridization- 370C 2-16h. The coverslip was then removed and the slide was washed in 0.4XSSC at 730C for lmin. followed by 2XSSC/0.1% IGEPAL for lmin. at RT. The slides were dried and covered with 1 drop of mounting medium supplemented with DAPI (Vector, USA) before covering with a 24X24mm coverslip. The staining is observed under Fluorescence microscope.

Telomeres Analysis using PNA probe

An area of approx. 20 x 20 mm was marked on the slides. The pre-treatment solutions were prepared according to manufacturer's protocol (Telomere PNA FISH Kit/Cy3, Dako, Denmark). The slides were immersed in TBS 1~2 min, then in 3.7% formaldehyde in TBS for 2 min exactly. The slides were washed twice in TBS for 5 min. and then transferred to Pre-Treatment Solution (vial 1 diluted 1:2000 in TBS) for 10 min. 37°C. After pretreatment the slides were washed twice for 5 min. in TBS and immersed in cold ethanol series (70%, 85% and 100%) 3 x 2 min. The slides were located in a vertical position until they are dry- 5 min. 5 μL of Telomere PNA Probe/Cy3 were added to the marked area on the slides and covered with 18 x 18 mm coverslip. Slides were placed in HYBrite adjusted to 800C for 5 min. followed by 30 min. incubation at room temperature. The slides were rinsed by immersing in Rinse Solution to remove coverslips (briefly ~1 min.). In the next step slides were subjected to preheated (65°C) wash solution for 5 min. and then dehydrated in cold ethanol series (70%, 85% and 95%) 3 x 2 min. Slides were air dried vertically ~ 5 min. For microscopy analysis 10 μL of DAPI (0.07 mg/ml) containing mounting solution (Vector) were added to each slide and slides were coversliped with 24 x 24mm coverslip. Slides were left in the dark for 15 min before performing fluorescence microscopy. Combined Telomere and XY FISH Analysis

The protocols described above for FISH and Telomere analysis were used sequentially.

EXAMPLE l

Identification of fetal nuclei by telomere-staining - To detect fetal nuclei, the inventors visualized chromosomal telomeres in cell nuclei present in transcervical specimens using telomere-specific probes. Due to telomere loss caused by the end processing problem of DNA polymerase and insufficient telomere addition by telomerase, telomeres of adult cells are significantly shorter than those found in fetal chromosomes. This significant difference is used in the present invention to distinguish between maternal adult cells or nuclei (i.e. cells or nuclei possessing chromosomes with short telomere endings) and fetal cells or nuclei (i.e. cells or nuclei possessing long telomere endings). Specific staining of telomeres produces faint staining of maternal chromosomes compared to an intensive staining of fetal chromosomes.

Placental and endocervical specimens obtained from pregnant women at the 4th- 15th week of gestation (as described in materials and methods above) were subjected to FISH analysis using Cep X SG/ SatIIIY (a) probes capable of staining the X and Y chromosomes, respectively. The stained chromosomes were visualized using a fluorescent microscope, and the staining results were scanned, and recorded using the Bio View Duet™ software.

The stained specimens were next subjected to telomere analysis. Telomere analysis was performed using telomere PNA FISH as described in materials and methods, and visualized under a fluorescent microscope. The coordinates previously recorded allowed dual analysis of single nuclei. Such matching revealed, as shown in figures 1-3, that intensive telomere staining indicative of fetal origin of the genetic material correlated with XY FISH staining reflecting the male gender of the fetus.

Moreover, as can be seen in Fig. 4, when the PNA probe is diluted 1:10 staining of fetal nuclei can still be observed while staining of maternal nuclei is almost undetectable. In addition, prior incubation of the sample with 0.5nM TelX5 oligo (a nucleotide molecule consisting of 5 repeats of CCCTAA, which is the telomere complementary sequence) which partially blocks the telomeres, reduced slightly the staining of fetal nuclei, but eliminated almost completely the staining of maternal nuclei (Fig. 5). As can be seen in Fig. 6, use of InM of the TelX5 oligo resulted in complete elimination of staining in both fetal and maternal nuclei. As a control, a non specific oligo was used, 2nM of SatHIY. As can be seen in Fig. 7 use of such an oligo had no effect on the intensity of the PNA telomere staining.

This finding demonstrates the specificity of the PNA telomere staining.

As shown above, the use of a diluted PNA probe and the use of prior incubation with a telomere specific oligo which partially blocks the telomeres, largely reduce staining of maternal nuclei. These techniques may thus be used to enhance the difference in staining intensity between the fetal and maternal nuclei, but are not obligatory for the identification of fetal nuclei.

Telomere staining can also be performed using the PRTNS method. The PRINS protocol was used as previously described (Orsetti et al. (1998) Prenat. Diag. 18: 1014- 1022) using nucleotide probes comprising 4 or 6 repeats of CCCTAA complementary to the telomere sequence (TelX4 or TelX6). As can be seen in Figs. 8 and 9 intensive, granulated staining of telomeres can be observed and correlated with FISH staining of X and Y chromosomes, confirming the fetal source of the intensively stained nuclei.

Thus the data demonstrate the quality of telomere staining in predicting the fetal origin of the genetic material, and the feasibility of using telomere staining in conjunction with genetic analysis, in this case gender determination.

EXAMPLE 2 Simultaneous FISH analysis of telomeres and XY chromosomes

Placental specimens obtained from pregnant women at the 4th - 15th week of gestation were subjected to FISH analysis using a human DNA telomere probe together with Cep X SG/SatIII Y (a) probes capable of staining the X and Y chromosomes (as described in materials and methods above). The stained chromosomes were visualized using a fluorescent microscope. As shown in figures 10a-b, intensive telomere staining which is indicative of fetal origin of the genetic material correlated with XY FISH staining reflecting the male gender of the fetus.

Thus the data demonstrate that telomere staining can be performed concomitantly with specific chromosomal staining, in this case XY determination.

EXAMPLE 3

Grading of telomere staining intensity in maternal vs. male fetal nuclei

A mixture of maternal (XX) and male fetal (XY) cells obtained from placenta (first trimester) was stained for telomeres as explained above. Three separate experiments were performed and a total of about 500 cells were stained. The cells equally segregated as maternal and fetal. The intensity of the telomere staining that correlates to the telomere length was recorded and ranked into four grades, 1 to 4 according to increased intensity. The telomere staining was washed from the slides, the cells were subjected to X probe, and Y probe FISH. Using the computerized microscopy system, the telomere staining was correlated to the XY FISH results.

Figure 11, demonstrates the percentage of maternal XX (white bars) or fetal XY (black bars) nuclei in the mixture at a certain telomere intensity grade.

Results demonstrate clearly that the vast majority of the maternal nuclei displayed a low-grade intensity of telomeres (indicative of a short telomere), whereas the highest grade of telomeres was exclusively demonstrated in fetal nuclei.

EXAMPLE 4 Identification of fetal genetic material in CVS specimen

CVS is done as previously described in the art (see for example, Brambati B and Tului L. Prenatal genetic diagnosis through chorionic villus sampling. In: Milunsky A, editor. Genetic disorders and the fetus, 5th ed. Baltimore and London: The Johns Hopkins University Press; 2004. pp.179-213). A mixed maternal/embryonic CVS cell specimen is prepared using mechanical, chemical or enzymatic procedure. No separation of the embryonic villi from the maternal villi is required. The embryonic cells are stained with a specific PNA or DNA telomere probe as described above and are identified based on their significantly higher telomere staining intensity.

Subsequently, specific chromosomal FISH probes are used to detect numerical chromosomal aberrations.

Claims

WHAT IS CLAIMED IS:
1. A method of identifying fetal genetic material in a maternal biological sample comprising:
(a) staining a maternal biological sample with a telomere specific marker;
(b) observing said sample under conditions that permit visualization of the telomere specific marker;
(c) identifying locations that are intensively stained; said locations being characterized as containing the fetal genetic material.
2. The method of claim 1, wherein said fetal genetic material is selected from the group consisting of cell nuclei, cell-free nuclei, chromosomes, chromatin or free DNA.
3. The method of claim 1, wherein said maternal biological sample is obtained from a cervix, a placenta, placental villi, amniotic fluid and/or a uterus of a pregnant woman.
4. The method of claim 3, wherein said maternal biological sample is obtained using a method selected from the group consisting of aspiration, cytobrush, cotton wool swab, endocervical lavage, biopsy and intrauterine lavage.
5. The method of claim 1, wherein said maternal biological sample is a blood sample obtained from a pregnant woman.
6. The method of claim 1, wherein said maternal biological sample comprises chorionic villus sampling (CVS).
7. The method of claim 3, wherein said maternal biological sample is obtained from a pregnant woman at 5th to 15th week of gestation.
8. The method of claim 1, wherein said staining is performed by a primary labeled telomere specific probe.
9. The method of claim 8, wherein said label is a fluorescent label.
10. The method of claim 1, wherein said staining comprises in situ hybridization.
11. The method of claim 10, wherein said in situ hybridization comprises using fluorescent in situ hybridization (FISH), PNA, PRTNS, Q-FISH.
12. The method of claim 11, wherein said in situ hybridization comprises using a probe selected from the group consisting of an RNA molecule, a DNA molecule and a PNA oligonucleotide.
13. The method of claim 12, wherein said RNA molecule is an RNA oligonucleotide and/or an in vitro transcribed RNA.
14. The method of claim 12, wherein said DNA molecule is an oligonucleotide and/or a cDNA molecule.
15. A method of analyzing a genetic material of a fetus, comprising:
(a) staining a maternal biological sample with a telomere specific marker;
(b) observing said sample under conditions that permit visualization of the telomere specific marker;
(c) identifying locations that are intensively stained; said locations being characterized as containing the fetal genetic material; and (d) performing a molecular analysis of said fetal genetic material at the identified location.
16. A method of computer-aided analysis of fetal genetic material, comprising
(a) staining a maternal biological sample with a telomere specific stain;
(b) viewing said sample under conditions that permit visualization of the telomere specific stain;
(c) performing a computerized scan of said stained biological sample to identify locations that are intensively stained; said locations being characterized as containing the fetal genetic material;;
(d) recording coordinates of said locations;
(e) performing a molecular analysis of fetal genetic material in said biological sample according to the location coordinates obtained in step (d).
17. The method of claims 15 or 16 wherein said step of staining is performed after said step of molecular analysis.
18. The method of claim 15, wherein said step of staining and said step of molecular analysis are performed simultaneously.
19. The method of claim 15 or 16, wherein said fetal genetic material is selected from the group consisting of cell nuclei, cell-free nuclei, chromosomes, chromatin or free DNA.
20. The method of claim 15 or 16, wherein said maternal biological sample is obtained from a cervix, a placenta, placental villi, amniotic fluid and/or a uterus of a pregnant woman.
21. The method of claim 20, wherein said maternal biological sample is obtained using a method selected from the group consisting of aspiration, cytobrush, cotton wool swab, endocervical lavage, biopsy and intrauterine lavage.
22. The method of claim 15 or 16, wherein said maternal biological sample is a blood sample obtained from a pregnant woman.
23. The method of claim 15 or 16, wherein said maternal biological sample comprises chorionic villus sampling (CVS).
24. The method of claim 15 or 16, wherein said telomere staining comprises in situ hybridization.
25. The method of claim 24, wherein said in situ hybridization comprises using a probe selected from the group consisting of an RNA molecule, a DNA molecule and a PNA oligonucleotide.
26. The method of claim 25, wherein said RNA molecule is an RNA oligonucleotide and/or an in vitro transcribed RNA.
27. The method of claim 25, wherein said DNA molecule is an oligonucleotide and/or a cDNA molecule.
28. The method of claim 20, wherein said maternal biological sample is obtained from a pregnant woman at 5th to 15th week of gestation.
29. The method of claim 15 or 16, wherein said molecularly analyzing said genetic material comprises using an approach selected from the group consisting of an in situ chromosomal analysis, an in situ DNA analysis and a genetic analysis.
30. The method of claim 29, wherein said in situ chromosomal analysis comprises using fluorescent in situ hybridization (FISH) and/or multicolor-banding (MCB).
31. The method of claim 30, wherein said in situ DNA analysis comprises using primed in situ labeling (PRTNS) and/or quantitative FISH (Q-FISH).
32. The method of claim 31, wherein said Q-FISH comprises using a peptide nucleic acid (PNA) oligonucleotide probe.
33. The method of claim 29, wherein said genetic analysis utilizes at least one method selected from the group consisting of comparative genome hybridization (CGH) and identification of at least one nucleic acid substitution.
34. The method of claim 15 or 16, further comprising a step of isolating said fetal cell nuclei prior to said molecular analysis of fetal genetic material
35. The method of claim 34, wherein said isolating said fetal cell nuclei is affected using laser microdissection.
36. The method of claim 33, wherein said identification of at least one nucleic acid substitution is effected using a method selected from the group consisting of DNA sequencing, restriction fragment length polymorphism (RFLP analysis), allele specific oligonucleotide (ASO) analysis, methylation-specific PCR (MSPCR), pyrosequencing analysis, acycloprime analysis, Reverse dot blot, GeneChip microarrays, Dynamic allele-specific hybridization (DASH), Peptide nucleic acid (PNA) and locked nucleic acids (LNA) probes, TaqMan, Molecular Beacons, Intercalating dye, FRET primers, AlphaScreen, SNPstream, genetic bit analysis (GBA), Multiplex minisequencing, SNaPshot, MassEXTEND, MassArray, GOOD assay, Microarray miniseq, arrayed primer extension (APEX), Microarray primer extension, Tag arrays, Coded microspheres, Template-directed incorporation (TDI), fluorescence polarization, Colorimetric oligonucleotide ligation assay (OLA), Sequence-coded OLA, Microarray ligation, Ligase chain reaction, Padlock probes, Rolling circle amplification, Invader assay, MLPA and MS-MLPA.
37. The method of claim 15 or 16, wherein analysis of the genetic material of the fetus enables the identification of fetal gender, at least one chromosomal abnormality, at least one DNA abnormality and/or a paternity of the fetus.
38. The method of claim 37, wherein said at least one chromosomal abnormality is selected from the group consisting of aneuploidy, translocation, subtelomeric rearrangement, unbalanced subtelomeric rearrangement, deletion, microdeletion, inversion, duplication, and telomere instability and/or shortening.
39. The method of claim 38, wherein said chromosomal aneuploidy is a complete and/or partial trisomy.
40. The method of claim 39, wherein said trisomy is selected from the group consisting of trisomy 21, trisomy 18, trisomy 13, trisomy 16, XXY, XYY, and XXX.
41. The method of claim 38, wherein said chromosomal aneuploidy is . a complete and/or partial monosomy.
42. The method of claim 41, wherein said monosomy is selected from the group consisting of monosomy X, monosomy 21, monosomy 22, monosomy 16 and monosomy 15.
43. The method of claim 37, wherein said at least one DNA abnormality is selected from the group consisting of single nucleotide substitution, micro- deletion, micro-insertion, short deletions, short insertions, multinucleotide changes, DNA methylation and loss of imprint (LOI).
44. A kit for analyzing a genetic material of a fetus, comprising a packaging material packaging a reagent for determining telomere length.
45. The kit of claim 44, wherein said telomere staining comprises in situ hybridization.
46. The kit of claim 45, wherein said in situ hybridization comprises using a probe selected from the group consisting of an RNA molecule, a DNA molecule and a PNA oligonucleotide.
47. The kit of claim 45, wherein said RNA molecule is an RNA oligonucleotide and/or an in vitro transcribed RNA.
48. The kit of claim 46, wherein said DNA molecule is an oligonucleotide and/or a cDNA molecule.
49. The kit of claim 44, further comprising a second reagent suitable for a molecular analysis of the genetic material of the fetus, said molecular analysis is selected from the group consisting of an in situ chromosomal analysis, an in situ DNA analysis and a genetic analysis.
50. The kit of claim 49, wherein said in situ chromosomal analysis comprises using fluorescent in situ hybridization (FISH) and/or multicolor-banding (MCB).
51. The kit of claim 49, wherein said in situ DNA analysis comprises using primed in situ labeling (PRINS) and/or quantitative FISH (Q-FISH).
52. The kit of claim 51, wherein said Q-FISH comprises using a peptide nucleic acid (PNA) oligonucleotide probe.
53. The kit of claim 49, wherein said genetic analysis utilizes at least one method selected from the group consisting of comparative genome hybridization (CGH) and identification of at least one nucleic acid substitution.
54. The kit of claim 53, wherein said identification of at least one nucleic acid substitution is effected using a method selected from the group consisting of DNA sequencing, restriction fragment length polymorphism (RFLP analysis), allele specific oligonucleotide (ASO) analysis, methylation- specific PCR (MSPCR), pyrosequencing analysis, acycloprime analysis, Reverse dot blot, GeneChip microarrays, Dynamic allele-specific hybridization (DASH), Peptide nucleic acid (PNA) and locked nucleic acids (LNA) probes, TaqMan, Molecular Beacons, Intercalating dye, FRET primers, AlphaScreen, SNPstream, genetic bit analysis (GBA), Multiplex minisequencing, SNaPshot, MassEXTEND, MassArray, GOOD assay, Microarray miniseq, arrayed primer extension (APEX), Microarray primer extension, Tag arrays, Coded microspheres, Template-directed incorporation (TDI), fluorescence polarization, Colorimetric oligonucleotide ligation assay (OLA), Sequence-coded OLA, Microarray ligation, Ligase chain reaction, Padlock probes, Rolling circle amplification, Invader assay, MLPA and MS-MLPA.
PCT/IL2008/000019 2007-01-03 2008-01-03 Methods and kits for analyzing genetic material of a fetus WO2008081451A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US87804907P true 2007-01-03 2007-01-03
US60/878,049 2007-01-03

Publications (2)

Publication Number Publication Date
WO2008081451A2 true WO2008081451A2 (en) 2008-07-10
WO2008081451A3 WO2008081451A3 (en) 2008-11-06

Family

ID=39589083

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2008/000019 WO2008081451A2 (en) 2007-01-03 2008-01-03 Methods and kits for analyzing genetic material of a fetus

Country Status (1)

Country Link
WO (1) WO2008081451A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009138117A1 (en) * 2008-05-12 2009-11-19 Fundación Centro Nacional De Investigaciones Oncológicas Carlos Iii Methods and reagents for the determination of telomere length in a semi-automatic manner of every single cell in a immobilized cell population
WO2011075774A1 (en) * 2009-12-23 2011-06-30 Genetic Technologies Limited Methods of enriching and detecting fetal nucleic acids
US8084203B2 (en) 2008-05-12 2011-12-27 Fundacion Centro Nacional De Investigaciones Oncologicas Carlos Iii Methods for the determination of telomere length in a semi-automatic manner of every single cell in a immobilized cell population
EP2458365A1 (en) * 2010-11-24 2012-05-30 Milestone S.r.l. A two-step cold formalin fixation of organic tissue samples
WO2013074601A1 (en) 2011-11-14 2013-05-23 Carnegie Mellon University Center For Technology Transfer & Enterprise Gamma-pna miniprobes for fluorescent labeling
CN103608466A (en) * 2010-12-22 2014-02-26 纳特拉公司 Methods for non-invasive prenatal paternity testing
US9163282B2 (en) 2010-05-18 2015-10-20 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US9228234B2 (en) 2009-09-30 2016-01-05 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US9334541B2 (en) 2010-05-18 2016-05-10 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9447467B2 (en) 2009-04-21 2016-09-20 Genetic Technologies Limited Methods for obtaining fetal genetic material
US9499870B2 (en) 2013-09-27 2016-11-22 Natera, Inc. Cell free DNA diagnostic testing standards
US9639657B2 (en) 2008-08-04 2017-05-02 Natera, Inc. Methods for allele calling and ploidy calling
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US10179937B2 (en) 2014-04-21 2019-01-15 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001081626A2 (en) * 2000-04-20 2001-11-01 Simeg Limited Methods for clinical diagnosis
WO2004035597A2 (en) * 2002-10-16 2004-04-29 Women And Infants Hospital Of Rhode Island, Inc. Methods of assessing the risk of reproductive failure by measuring telomere length
WO2006119569A1 (en) * 2005-05-11 2006-11-16 Genetic Technologies Limtied Methods of enriching fetal cells
WO2007010528A2 (en) * 2005-07-15 2007-01-25 Yeda Research And Development Co. Ltd. Methods and kits for identifying nucleic acid sequences
WO2007106838A2 (en) * 2006-03-13 2007-09-20 Ikonisys, Inc. A non-invasive method for diagnosing fetal cells and cancer cells

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001081626A2 (en) * 2000-04-20 2001-11-01 Simeg Limited Methods for clinical diagnosis
WO2004035597A2 (en) * 2002-10-16 2004-04-29 Women And Infants Hospital Of Rhode Island, Inc. Methods of assessing the risk of reproductive failure by measuring telomere length
WO2006119569A1 (en) * 2005-05-11 2006-11-16 Genetic Technologies Limtied Methods of enriching fetal cells
WO2007010528A2 (en) * 2005-07-15 2007-01-25 Yeda Research And Development Co. Ltd. Methods and kits for identifying nucleic acid sequences
WO2007106838A2 (en) * 2006-03-13 2007-09-20 Ikonisys, Inc. A non-invasive method for diagnosing fetal cells and cancer cells

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US10266893B2 (en) 2005-07-29 2019-04-23 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10260096B2 (en) 2005-07-29 2019-04-16 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10227652B2 (en) 2005-07-29 2019-03-12 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9430611B2 (en) 2005-11-26 2016-08-30 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10240202B2 (en) 2005-11-26 2019-03-26 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9695477B2 (en) 2005-11-26 2017-07-04 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
WO2009138117A1 (en) * 2008-05-12 2009-11-19 Fundación Centro Nacional De Investigaciones Oncológicas Carlos Iii Methods and reagents for the determination of telomere length in a semi-automatic manner of every single cell in a immobilized cell population
US8084203B2 (en) 2008-05-12 2011-12-27 Fundacion Centro Nacional De Investigaciones Oncologicas Carlos Iii Methods for the determination of telomere length in a semi-automatic manner of every single cell in a immobilized cell population
US9639657B2 (en) 2008-08-04 2017-05-02 Natera, Inc. Methods for allele calling and ploidy calling
US9447467B2 (en) 2009-04-21 2016-09-20 Genetic Technologies Limited Methods for obtaining fetal genetic material
US9228234B2 (en) 2009-09-30 2016-01-05 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10216896B2 (en) 2009-09-30 2019-02-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10061889B2 (en) 2009-09-30 2018-08-28 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10061890B2 (en) 2009-09-30 2018-08-28 Natera, Inc. Methods for non-invasive prenatal ploidy calling
WO2011075774A1 (en) * 2009-12-23 2011-06-30 Genetic Technologies Limited Methods of enriching and detecting fetal nucleic acids
US9334541B2 (en) 2010-05-18 2016-05-10 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10113196B2 (en) 2010-05-18 2018-10-30 Natera, Inc. Prenatal paternity testing using maternal blood, free floating fetal DNA and SNP genotyping
US9163282B2 (en) 2010-05-18 2015-10-20 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10174369B2 (en) 2010-05-18 2019-01-08 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10017812B2 (en) 2010-05-18 2018-07-10 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci
EP2458365A1 (en) * 2010-11-24 2012-05-30 Milestone S.r.l. A two-step cold formalin fixation of organic tissue samples
US8845982B2 (en) 2010-11-24 2014-09-30 Milestone S.R.L. Two-step cold formalin fixation of organic tissue samples
CN103608466A (en) * 2010-12-22 2014-02-26 纳特拉公司 Methods for non-invasive prenatal paternity testing
AU2011348100B2 (en) * 2010-12-22 2016-08-25 Natera, Inc. Methods for non-invasive prenatal paternity testing
EP2656263A4 (en) * 2010-12-22 2015-06-24 Natera Inc Methods for non-invasive prenatal paternity testing
RU2620959C2 (en) * 2010-12-22 2017-05-30 Натера, Инк. Methods of noninvasive prenatal paternity determination
US9926592B2 (en) 2011-11-14 2018-03-27 Carnegie Mellon University Gamma-PNA miniprobes for fluorescent labeling
WO2013074601A1 (en) 2011-11-14 2013-05-23 Carnegie Mellon University Center For Technology Transfer & Enterprise Gamma-pna miniprobes for fluorescent labeling
EP2780480A4 (en) * 2011-11-14 2015-06-10 Univ Carnegie Mellon Gamma-pna miniprobes for fluorescent labeling
US9499870B2 (en) 2013-09-27 2016-11-22 Natera, Inc. Cell free DNA diagnostic testing standards
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10179937B2 (en) 2014-04-21 2019-01-15 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules

Also Published As

Publication number Publication date
WO2008081451A3 (en) 2008-11-06

Similar Documents

Publication Publication Date Title
Bejjani et al. Application of array-based comparative genomic hybridization to clinical diagnostics
Cheung et al. Prenatal diagnosis of sickle cell anaemia and thalassaemia by analysis of fetal cells in maternal blood
Cirigliano et al. Rapid prenatal diagnosis of common chromosome aneuploidies by QF‐PCR, results of 9 years of clinical experience
Alberry et al. Free fetal DNA in maternal plasma in anembryonic pregnancies: confirmation that the origin is the trophoblast
Harper et al. Preimplantation genetic diagnosis: state of the art 2011
US8431343B2 (en) Methods for detecting DNA originating from different individuals
US7651838B2 (en) Prenatal diagnosis method on isolated foetal cell of maternal blood
Wells et al. Use of comprehensive chromosomal screening for embryo assessment: microarrays and CGH
Sherlock et al. Assessment of diagnostic quantitative fluorescent multiplex polymerase chain reaction assays performed on single cells
JP6328934B2 (en) Non-invasive prenatal paternity testing method
JP6039034B2 (en) Processes and compositions for the enrichment based on the methylation of fetal nucleic acid from useful maternal sample noninvasive prenatal diagnosis
EP2379746B1 (en) Methods and genotyping panels for detecting alleles, genomes, and transcriptomes
US8682594B2 (en) Noninvasive diagnosis of fetal aneuploidy by sequencing
JP5923571B2 (en) Useful for prenatal diagnosis of non-invasive, processes and compositions for the enrichment based on the methylation of fetal nucleic acid from maternal samples
EP2602321B1 (en) Methods and compositions for the extraction and amplification of nucleic acid from a sample
Benkhalifa et al. Array comparative genomic hybridization profiling of first‐trimester spontaneous abortions that fail to grow in vitro
EP2195452B1 (en) Methods and compositions for universal size-specific polymerase chain reaction
US20020045176A1 (en) Non-invasive prenatal monitoring
EP0430402A2 (en) Methods and compositions for chromosome-specific staining
JP5032304B2 (en) Detection of chromosomal abnormalities
US20070134658A1 (en) Identification of fetal dna and fetal cell markers in maternal plasma or serum
US20130210644A1 (en) Fetal aneuploidy detection by sequencing
US7732143B2 (en) Method for the diagnosis of genetic diseases by molecular combing and diagnostic kit
US20160002737A1 (en) Analysis of Rare Cell-Enriched Samples
US20080026390A1 (en) Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08702609

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08702609

Country of ref document: EP

Kind code of ref document: A2