WO2008074115A1 - Nucleic acid constructs and methods for altering plant fiber length and/or plant height - Google Patents
Nucleic acid constructs and methods for altering plant fiber length and/or plant height Download PDFInfo
- Publication number
- WO2008074115A1 WO2008074115A1 PCT/BR2007/000357 BR2007000357W WO2008074115A1 WO 2008074115 A1 WO2008074115 A1 WO 2008074115A1 BR 2007000357 W BR2007000357 W BR 2007000357W WO 2008074115 A1 WO2008074115 A1 WO 2008074115A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- transgenic plant
- fiber length
- nucleic acid
- promoter
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8226—Stem-specific, e.g. including tubers, beets
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present invention relates to the fields of molecular biology and alteration of gene expression in transformed plants. More specifically, this invention relates to the modification of fiber length and/or plant height in plants of industrial interest by regulation of expression of genes encoding wall-associated kinases (WAKs).
- WAKs wall-associated kinases
- Eucalyptus trees represent the largest sources of fibers used globally in the paper industry. Bamber, 1985, Appita 38: 210-216). There are an estimated ten to fifteen million hectares of land planted with Eucalyptus. Verhaegen and Plomion, 1996, Genome 39: 1051- 1061.
- the major advantage of the Eucalyptus tree is its very high growth rate and ability to grow in a wide range of conditions, both tropical and temperate.
- the Eucalyptus fibers have one disadvantage, however, compared to fibers from other sources, such as pine, which is their significantly shorter length.
- Fiber length is controlled by endogenous regulation of cell elongation, a process which results from the interaction between internal turgor pressure and the mechanical strength of the cell wall, but its mechanism and genes involved have not been yet totally discerned.
- Xylem fiber cells develop from already much-elongated fusiform initials located within the vascular cambium. They increase in diameter by extension of their radial walls, and, in addition, developing fiber cells elongate by intrusive tip growth, which results in up to a severalfold increase in cell length. Gray-Mitsumune et al, 2004, Plant Physiol. 135: 1552-1564.
- the rapid expansion of fiber cells may be achieved by concerted action of pushing against the cell wall exerted by turgor and loosening of the cell wall.
- the phase of cell elongation follows a significant rise of turgor, resulted from the observed accumulation of malate, sugars, and K + , the major osmoticum, hence the influx of water and the generation of high turgor in the fiber cells. Ruan et al, 2004, Plant Physiol. 136: 4104-4113.
- Vacuolar invertases can play an Extra role in turgor maintenance and cell wall expansion. Recent work in Arabidopsis thaliana has shown that a wall-associated kinase (WAK) can regulate a vacuolar invertase thus establishing a cross-compartmental link between WAK and vacuolar invertase(s). Kohorn et al, 2006, Plant J. 46: 307-316.
- WAK wall-associated kinase
- WAKs are encoded by five tightly linked and highly similar genes, and are expressed in leaves, meristems, and cells undergoing expansion. Wagner and Kohorn, 2001, Plant Cell 13: 303-318. Mutant seedlings of Arabidopsis thaliana presenting a T-DNA insertion in the WAK2 gene were significantly shorter than wild-type plants, with the roots more affected than the hypocotyls. Kohorn et al, 2006, Plant J. 46: 307-316.
- the wall-associated kinases contain extracellular domains that can be linked to pectin molecules of the cell wall, span the plasma membrane and have a cytoplasmic serine/threonine kinase domain. He et al.,1999, Plant MoI. Biol. 39: 1189-1196.
- Middle lamellae of developing wood cells are rich in pectins, and intrusive tip growth requires the dissolution of the middle lamella. See Berthold et al, WO 2006/068603.
- WAKs may sense a change in the cell wall environment, thus providing a molecular mechanism linking cell wall sensing to regulation of solute metabolism, which in turn is known to be involved in turgor maintenance and cell expansion in growing cells. Such information could be invaluable to adjustment of cell expansion or turgor. Huang et al., 2007, Functional Plant Biology, 34: 499-507.
- Fiber characteristics are controlled by a complex set of genetic factors and are not easily amenable to classical breeding methods. Through traditional forest tree breeding it is possible to achieve some modification of fiber characteristics. For example, interspecific triploid hybrids of poplar have been developed which have longer fibers than the parental species. Aziz et al, 1996, Wood and pulp properties of aspen and its hybrids. TAPPI Proc. Pulping Conference, p.
- the invention provides a nucleic acid construct comprising a WAK polynucleotide sequence operably linked to a xylem-preferred promoter that causes overexpression of said WAK polynucleotide sequence.
- the xylem-preferred promoter is selected from the group consisting of TUB gene promoter, SuSy gene promoter, COMT gene promoter and C4H gene promoter.
- a transgenic plant comprises the nucleic acid construct and the plant has an increase in fiber length and/or height compared to a non-transgenic plant of the same species.
- the plant is a dicotyledon, monocotyledon, gymnosperm, or hardwood tree.
- the invention further contemplates the progeny of the transgenic plant, as well as wood pulp and wood fiber produced from the transgenic plant.
- the invention provides a method for increasing fiber length and/or plant height, comprising: (a) introducing into a plant cell a nucleic acid construct comprising a WAK polynucleotide sequence operably linked to a xylem-preferred promoter that causes overexpression of said WAK polynucleotide sequence; (b) culturing said plant cell under conditions that promote growth of a plant; and (c) selecting a transgenic plant that has increased fiber length and/or plant height compared to a non-transgenic plant of the same species.
- FIGURE 1 schematically illustrates the plant expression plasmidial vector pALELLYX- WAK of the invention comprising a cambium/xylem preferred promoter driving the expression of a wall-associated kinase nucleotide sequence of the invention.
- FIGURE 2 shows the fiber length of several transgenic lines transformed with the plant expression plasmidial vector pALELLYX-WAK of the invention and respective control non- transgenic plants. Asterisk denotes statistically significant higher mean fiber length values (P ⁇ 0.05, t-test).
- FIGURE 3 shows the fiber length of two genotypes of a Tl transgenic plant (line 51B) transformed with the plant expression plasmidial vector pALELLYX-WAK of the invention. Asterisk denotes statistically significant higher mean fiber length values (P ⁇ 0.05, t-test).
- FIGURE 4 shows the fiber length of two genotypes of a Tl transgenic plant (line 47B) transformed with the plant expression plasmidial vector pALELLYX-WAK of the invention.
- Asterisk denotes statistically significant higher mean fiber length values (P ⁇ 0.05, t-test).
- FIGURE 5 shows the plant height of the three genotypes of a Tl transgenic line (line 51B) transformed with the plant expression plasmidial vector pALELLYX-WAK of the invention.
- Asterisk denotes statistically significant higher mean plant height values (P ⁇ 0.05, litest).
- the present invention relates to processes for genetic manipulation of fiber length in plants and/or an increase in plant height.
- the plant cell wall is a strong fibrillar network that gives each cell its stable shape. To enlarge, cells selectively loose this network, enabling it to yield to the expansive forces generated by cell turgor pressure. As a cell expands, there is increased need for a compensatory adjustment in turgor, which is dependent on cell solute metabolism.
- a wall-associated kinase (WAK) may sense cell wall expansion by its attachment to pectin, thereby providing a mechanism for transducing these signals to systems regulating solute changes, as outlined above.
- a method for modifying the fiber length in plant tissues, such as fiber cells of woody angiosperm xylem, tracheid cells of gymnosperm xylem, and fiber cells of cotton seeds, by controlling the activity of a wall-associated kinase.
- plant cells or whole plants are genetically engineered with a wall-associated kinase coding sequence, which, when expressed in xylary fiber cells of angiosperms, xylary tracheids of gymnosperms, or fiber cells of cotton seeds, causes an increase in cell length.
- PCR-primer pairs can be derived from known sequences by known techniques such as using computer programs intended for that purpose, e.g., Primer, Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, MA. Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and Caruthers, 1981, Tetra. Letts. 22: 1859-1862, and Matteucci and Caruthers, 1981, J Am. Chem. Soc. 103: 3185.
- encoding and coding refer to the process by which a gene, through the mechanisms of transcription and translation, provides information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce an active enzyme. Because of the degeneracy of the genetic code, certain base changes in DNA sequence do not change the amino acid sequence of a protein. It is therefore understood that modifications in the DNA sequence encoding wall-associated kinase which do not substantially affect the functional properties of the protein are contemplated. In this description, "expression” denotes the production of the protein product encoded by a gene.
- expression denotes the combination of intracellular processes, including transcription and translation, undergone by a coding DNA molecule such as a structural gene to produce a polypeptide.
- “Overexpression” refers to the expression of a particular gene sequence in which the production of mRNA or polypeptide in a transgenic organism exceeds the levels of production in non-transgenic organism.
- heterologous nucleic acid refers to a nucleic acid, DNA or RNA, which has been introduced into a cell (or the cell's ancestor) through the efforts of humans. Such exogenous nucleic acid may be a copy of a sequence which is naturally found in the cell into which it was introduced, or fragments thereof.
- endogenous nucleic acid refers to a nucleic acid, gene, polynucleotide, DNA, RNA, mRNA, or cDNA molecule that is present in a plant or organism that is to be genetically engineered. An endogenous sequence is "native" to, i.e., indigenous to, the plant or organism that is to be genetically engineered.
- homologous sequences refers to polynucleotide or polypeptide sequences that are similar due to common ancestry and sequence conservation.
- the term "functional homolog” refers to a polynucleotide or polypeptide sequences that are similar due to common ancestry and sequence conservation and have identical or similar function at the catalytic, cellular, or organismal levels.
- wall-associated kinase polynucleotide sequence denotes any nucleic acid, gene, polynucleotide, DNA, RNA, mRNA, or cDNA molecule that encodes a wall-associated kinase polypeptide whose overexpression alters fiber length and/or plant height.
- the DNA or RNA may be double-stranded or single-stranded.
- Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also called the anti-sense strand.
- Illustrative of this category are polynucleotide molecules that comprise SEQ ID NOs: 1, 3, 5, 7 and 9, identified from Arabidopsis thaliana and that can be employed to enhance fiber length and/or plant height.
- a wall-associated kinase polynucleotide sequence suitable for the present invention may be identified from a myriad of organisms characterized by the presence of a WAK gene. Although the aforementioned nucleotide sequences are disclosed herein, they are not to be taken as limitations on the present invention. Thus, a WAK sequence can be identified and functionally annotated by sequence comparison. The skilled person can readily identify a functionally related WAK sequence in a suitable database, such as GenBank, using publicly available sequence-analysis programs and parameters. Alternatively, screening cDNA libraries or genomic libraries employing suitable hybridization probes or primers based on DNA or protein sequences disclosed herein should lead to the identification of functionally related WAK sequences (functional homolog).
- sequences with reduced levels of identity also can be isolated with the aid of degenerate oligonucleotides and PCR-based methodology. While the polynucleotides of the inventions are isolated from Arabidopsis thaliana, functional homologs from other plants can be employed to produce plants with enhanced fiber length and/or plant height. Examples of plant species from which WAK genes may be isolated include dicotyledons, such as Cucurbitaceae, Solanaceae, Brassicaceae, Papilionaceae such as alfalfa and Vigna unguiculata, Malvaceae, Asteraceae, Malpighiaceae 1
- Populus such as Populus, Myrtaceae such as Eucalyptus, and monocotyledons, such as gramineae, including rice, wheat, sugarcane, barley, and corn.
- Myrtaceae such as Eucalyptus
- monocotyledons such as gramineae, including rice, wheat, sugarcane, barley, and corn.
- the terms “wall-associated kinase polynucleotide sequence,” “WAK polynucleotide sequence” and “WAK DNA sequence” also refer to any nucleic acid molecule with a nucleotide sequence capable of hybridizing under stringent conditions with any of the sequences disclosed herein, and coding for a polypeptide with WAK activity equivalent to the proteins having amino acid sequences disclosed herein under SEQ ID NOs: 2, 4, 6, 8, or 10.
- the terms also include sequences which cross-hybridize with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9, preferably having at least 65% homology or identity with one or more of SEQ ID NO: 1, 3, 5, 7 or 9.
- the nucleotide sequences of the invention may encode a protein which is homologous to the predicted gene product disclosed herein under any of SEQ ID NOs: 2, 4, 6, 8, or 10. Further, the nucleotide sequences of the invention include those sequences that encode a WAK polypeptide having an amino acid sequence which has at least 55%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90% and most preferably at least 95% sequence identity to an amino acid sequence disclosed herein under any of SED ID NOs: 2, 4, 6, 8 and 10.
- the degeneracy of the genetic code enables major variations in the nucleotide sequence of a polynucleotide while maintaining the amino acid sequence of the encoded protein.
- stringent conditions here connotes parameters with which the art is familiar. Single-stranded polynucleotides hybridize when they associate based on a variety of well- characterized physicochemical forces, such as hydrogen bonding, solvent exclusion, and base stacking.
- the stringency of a hybridization reflects the degree of sequence identity of the nucleic acids involved, such that the higher the stringency, the more similar are the two polynucleotide strands. Stringency is influenced by a variety of factors, including temperature, salt concentration and composition, organic and non-organic additives, solvents, etc. present in both the hybridization and wash solutions and incubations (and number).
- Nucleic acid molecules that hybridize under stringent conditions typically will hybridize to a probe based on either the entire cDNA or selected portions. More preferably, "stringent conditions" here refers to parameters with which the art is familiar, such as hybridization in 3.5 x SSC, 1 x Denhardt's solution, 25 mM sodium phosphate buffer (pH 7.0), 0.5% SDS, and 2mM EDTA for 18 hours at 65 0 C, followed by four washes of the filter, at 65°C for 20 minutes, in 2 x SSC and 0.1% SDS, and a final wash for up to 20 minutes in 0.5 x SSC and 0.1% SDS or 0.3 x SSC and 0.1% SDS for greater stringency, and O.lx SSC and 0.1% SDS for even greater stringency.
- stringent conditions here refers to parameters with which the art is familiar, such as hybridization in 3.5 x SSC, 1 x Denhardt's solution, 25 mM sodium phosphate buffer (pH 7.0), 0.
- the category of suitable wall-associated kinase sequences includes a nucleic acid molecule comprised of a variant of SEQ ID NOs: 1 or 3 or 5 or 7 or 9 with one or more bases deleted, substituted, inserted, or added, which variant codes for a polypeptide when overexpressed results in alteration in fiber length and/or plant height.
- the "base sequences with one or more bases deleted, substituted, inserted, or added" referred to here are widely known by those having ordinary skill in the art to retain physiological activity even when the amino acid sequence of a protein generally having that physiological activity has one or more amino acids substituted, deleted, inserted, or added.
- poly A tail or 5' or 3' end nontranslation regions may be deleted, and bases may be deleted to the extent that amino acids are deleted. Bases may also be substituted, as long as no frame shift results. Bases also may be "added” to the extent that amino acids are added. It is essential, however, that any such modification does not result in the loss of physiological activity.
- a modified DNA in this context can be obtained by modifying the DNA base sequences of the invention so that amino acids at specific sites are substituted, deleted, inserted, or added by site-specific mutagenesis, for example. Zoller & Smith, 1982, Nucleic Acid Res. 10: 6487-6500.
- variant is a nucleotide or amino acid sequence that deviates from the standard, or given, nucleotide or amino acid sequence of a particular gene or protein.
- the variant may have "conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine.
- a variant may have "nonconservative” changes, e.g., replacement of a glycine with a tryptophan.
- Analogous minor variations may also include amino acid deletions or insertions, or both.
- Guidance in determining which amino acid residues may be substituted, inserted, or deleted may be found using computer programs well known in the art such as Vector NTI Suite (InforMax, MD) software. "Variant” may also refer to a "shuffled gene,” as described, for example, in U.S. patents No. 6,506,603, No. 6,132,970, No. 6,165,793 and No. 6,117,679.
- a further way of obtaining a WAK DNA sequence is to synthesize it ab initio from the appropriate bases, for example, by using the appropriate cDNA sequence as a template.
- the present invention includes recombinant constructs comprising one or more of the nucleic acid sequences herein.
- the constructs typically comprise a vector, such as a plasmid, a cosmid, a phage, a virus (e.g., a plant virus), a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), or the like, into which a nucleic acid sequence has been inserted, in a forward or reverse orientation.
- BAC bacterial artificial chromosome
- YAC yeast artificial chromosome
- Recombinant nucleic acid constructs may be made using standard techniques.
- a nucleotide sequence for transcription may be obtained by treating a vector containing said sequence with restriction enzymes to cut out the appropriate segment.
- the nucleotide sequence for transcription may also be generated by annealing and ligating synthetic oligonucleotides or by using synthetic oligonucleotides in a polymerase chain reaction (PCR) to give suitable restriction sites at each end.
- the nucleotide sequence then is cloned into a vector containing suitable regulatory elements, such as upstream promoter and downstream terminator sequences.
- plant transformation vectors include one or more cloned plant coding sequence (genomic or cDNA) under the transcriptional control of 5' and 3' regulatory sequences and a selectable marker.
- Such plant transformation vectors typically also contain a promoter, a transcription initiation start site, an RNA processing signal (such as splicing signal sequences), a transcription termination site, and/or a polyadenylation signal. Enhancers and targeting sequences may also be present.
- the invention provides nucleic acid molecules likely to cause altered fiber length and plant height in a transformed plant.
- An important aspect of the present invention is the use of nucleic acid constructs wherein a wall-associated kinase-encoding nucleotide sequence is operably linked to one or more promoters, which drive expression of the wall-associated kinase- encoding sequence in a constitutive manner or in certain cell types, organs, or tissues so as to alter the fiber length of a transformed plant compared to the fiber length of a non-transgenic plant.
- Suitable constitutive plant promoters which can be useful for expressing the wall- associated kinase sequences suitable for the present invention include but are not limited to the cauliflower mosaic virus (CaMV) 35S promoter, the maize and the Populus polyubiquitin promoters, which confer constitutive, high-level expression in most plant tissues (see, e.g., WO 2007/00611, U.S. patent No. 5,510,474; Odell et al, Nature, 1985, 313: 810-812); the nopaline synthase promoter (An et al, 1988, Plant Physiol. 88: 547-552); the FMV promoter from figwort mosaic virus (U.S. patent No. 5,378,619) and the octopine synthase promoter (Fromm et al, 1989, Plant Cell 1: 977-984).
- CaMV cauliflower mosaic virus
- the maize the Populus polyubiquitin promoters, which confer constitutive, high-level expression in most plant tissues
- the promoter can also be chosen so that the expression occurs at a determined time point in the plant's development, or at a time point determined by outside influences, or in a tissue- specific or tissue-preferred manner. For example, it may ensure specific or preferred expression in fibers cells (cotton fiber-, xylem fiber-, or extra xylary fiber-specific or -preferred promoters).
- Exemplary cotton fiber-specific or -preferred promoters include, for example, the cotton
- CFACTl gene promoter U.S. patent No. 6,995,256
- E6 gene promoter U.S. patent No. 6,096,950, John et al., 1996, Plant MoI. Biol. 30: 297-306; John et al, 1996, Proc. Natl Acad. ScL 93: 12768-12773
- H6 gene promoter John et al, 1995, Plant Physiol. 108: 669-676
- GhTUBl gene promoter Li et al, 2002, Plant Physiol. 130: 666-674
- FbL2A Frinehart et al., 1996, Plant Physiol. 112: 1331-1341 and John et al, 1996, Proc. Natl. Acad. Set USA 93: 12768-12773).
- vascular system-preferred or -specific promoters such as xylem-preferred promoters, may be useful for effecting expression of nucleic acid molecules within the invention, specifically in vascular tissue, especially xylem tissue.
- xylem-preferred means that the nucleic acid molecules of the current invention are more active in the xylem than in any other plant tissue.
- the selected promoter should cause the overexpression of the wall-associated kinase, pursuant to the invention, thereby to modify the length of the cell xylem, to modify the height of the host plant, or both.
- Suitable promoters are illustrated by but are not limited to the xylem-preferred tubulin (TUB) gene promoter, the caffeic acid 3-O-methyltransferase gene promoter (COMT), the sucrose synthase gene promoter (SuSy), and the xylem-preferred coumarate-4-hydroxylase (C4H) gene promoter.
- TLB tubulin
- COT sucrose synthase gene promoter
- C4H xylem-preferred coumarate-4-hydroxylase
- Other suitable xylem-preferred promoters are disclosed in international patent application WO 2005/096805, which is incorporated here by reference. Synthetic promoters including specific nucleotide regions conferring tissue-specific or tissue-preferred expression may also be used, as exemplified by identification of regulatory elements within larger promoters conferring xylem-preferred expression.
- the gene expression rate is mainly modulated by the promoter
- improvement in expression may also be achieved by the identification and use of enhancer sequences, such as intronic portions of genes, which elevate the expression level of the nearby located genes in an independent manner orientation.
- enhancer sequences such as intronic portions of genes, which elevate the expression level of the nearby located genes in an independent manner orientation.
- introns known to elevate expression in plants have been identified in maize genes, for example, hsp70, tubAl, Adhl, ShI, UbH (Brown and Santino, U.S. patent Nos. 5,424,412 and 5,859,347; Jeon et al, 2000, Plant Physiol.
- a wall-associated kinase sequence is incorporated into a nucleic acid construct that is suitable for plant transformation.
- nucleic acid constructs comprising a wall-associated kinase sequence, under the control of a transcriptional initiation region operative in a plant, so that the construct can generate RNA in a host plant cell.
- the transcriptional initiation region is part of a vascular or xylem-preferred promoter, such as any of those mentioned above.
- Such a nucleic acid construct can be used to modify wall-associated kinase gene expression in plants, as described above.
- Expression vectors may also contain a selection marker by which transformed cells can be identified in culture.
- the marker may be associated with the heterologous nucleic acid molecule, i.e., the gene operably linked to a promoter.
- the term "marker” refers to a gene encoding a trait or a phenotype that permits the selection of, or the screening for, a plant or cell containing the marker. In plants, for example, the marker gene will encode antibiotic or herbicide resistance. This allows for selection of transformed cells from among cells that are not transformed or transfected.
- Suitable selectable markers include adenosine deaminase, dihydrofolate reductase, hygromycin-B-phosphotransferase, thymidine kinase, xanthine-guanine phospho- ribosyltransferase, glyphosate and glufosinate resistance, and amino-glycoside 3'-O- phosphotranserase (kanamycin, neomycin and G418 resistance). These markers may include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin.
- the construct also may contain the selectable marker gene Bar, which confers resistance to herbicidal phosphinothricin analogs like ammonium gluphosinate. Thompson et al, EMBO J 6: 2519-23 (1987). Other suitable selection markers are known as well.
- Visible markers such as green florescent protein (GFP) may be used.
- GFP green florescent protein
- Replication sequences may also be included to allow the vector to be cloned in a bacterial or phage host.
- a broad host range prokaryotic origin of replication is used.
- a selectable marker for bacteria may be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers also include resistance to antibiotics such as kanamycin or tetracycline.
- T-DNA sequences may be included to facilitate the subsequent transfer to and incorporation into plant chromosomes.
- the present invention comprehends the genetic manipulation of plants, especially hardwood trees, to overexpress a wall-associated kinase in vascular tissues via introducing a wall-associated gene, preferably under the control of a xylem-preferred or xylem-specific promoter.
- the result is enhanced fiber length and plant height.
- plant denotes any fiber-containing plant material that can be genetically manipulated, including but not limited to differentiated or undifferentiated plant cells, protoplasts, whole plants, plant tissues, or plant organs, or any component of a plant such as a leaf, stem, root, bud, tuber, fruit, rhizome, or the like.
- Plants that can be engineered in accordance with the invention include but are not limited to trees, such as Eucalyptus species (E. alba, E. albens, E. amygdalina, E. aromaphloia, E. baileyana, E. balladoniensis, E. bicostata, E. botryoides, E. brachyandra, E.
- E. jacksonii E. lansdowneana, E. latisinensis, E. leucophloia, E. leucoxylon, E. lockyeri, E. lucasii, E. maidenii, E. marginata, E. megacarpa, E. melliodora, E. michaeliana, E. microcorys,
- kitakamiensis P. lasiocarpa, P. laurifolia, P. maximowiczii, P. maximowiczii x P. balsamifera subsp. trichocarpa, P. nigra, P. sieboldii x P. grandidentata, P. suaveolens, P. szechuanica, P. tomentosa, P. tremula, P. tremula x P. tremuloides, P. tremuloides, P. wilsonii, P. canadensis, P.
- Conifers such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood
- true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar
- Fiber-producing plants also are included in this context.
- Illustrative crops are cotton
- transgenic plant refers to a plant that has incorporated a nucleic acid sequence, including but not limited to genes that are not normally present in a host plant genome, nucleic acid sequences not normally transcribed into RNA or translated into a protein, or any other genes or nucleic acid sequences that one desires to introduce into the wild- type plant, such as genes that normally may be present in the wild-type plant but that one desires either to genetically engineer or to have altered expression.
- the "transgenic plant” category includes both a primary transformant and a plant that includes a transformant in its lineage, e.g., by way of standard introgression or another breeding procedure.
- hybrid plant refers to a plant or a part thereof resulting from a cross between two parent plants, wherein one parent is a genetically engineered plant of the invention. Such cross can occur naturally by, for example, sexual reproduction, or artificially by, for example, in vitro nuclear fusion. Methods of plant breeding are well-known and within the level of one of ordinary skill in the art of plant biology.
- Non-transgenic plant can be a plant which genome is neither modified by the introduction of a construct comprising the polynucleotide sequences or fragment thereof of the present invention. It can also be a plant regenerated from cultured cells or tissues without prior modification by the introduction of a construct comprising the polynucleotide sequence of the invention, or may comprise a homozygote recessive progeny
- an inventive transgenic plant will have been augmented through the stable introduction of a transgene.
- the introduced gene will replace an endogenous sequence.
- a preferred gene in the regard, pursuant to the present invention is a wall-associated kinase DNA sequence, for example, one obtained from Arahidopsis thaliana.
- Methods for Genetic Engineering Constructs according to the invention may be introduced into any plant cell, using a suitable technique.
- Both monocotyledonous and dicotyledonous angiosperm or gymnosperm plant cells may be genetically engineered in various ways known to the art. For example, see Klein et al, 1993, Biotechnology 4: 583-590; Bechtold et al, 1993, C. R. Acad. Sci. Paris 316:
- Agrobacterium species such as A. tumefaciens and A. rhizogenes can be used, for example, in accordance with Nagel et al., 1990, Microbiol Lett 67: 325.
- Agrobacterium may be used with a plant expression vector via, e.g., electroporation, after which the Agrobacterium is introduced to plant cells via, e.g., the well known leaf-disk method.
- Additional methods for accomplishing this include, but are not limited to, transformation by Rhizobium, Sinorhizobium or Mesorhizobium (Broothaerts et al., 2005, Nature 433: 629-633), electroporation, particle gun bombardment, calcium phosphate precipitation, and polyethylene glycol fusion, transfer into germinating pollen grains, direct transformation (Lorz et al., 1985, MoI. Genet. 199: 179-182), and other methods known to the art. If a selection marker, such as kanamycin resistance, is employed, it makes it easier to determine which cells have been successfully transformed.
- the Agrobacterium transformation methods discussed above are known to be useful for transforming dicots.
- a protein, polypeptide, or nucleic acid molecule in a particular cell can be measured to determine if, for example, a cell has been successfully transformed or transfected.
- the ability to carry out such assay is well known and need not be reiterated here.
- Fiber is often used to unify a diverse group of plant cell types that share in common the features of having an elongated shape and abundant cellulose in thick cell walls, usually, but not always, described as secondary walls. Such walls may or may not be lignified, and the protoplast of such cells may or may not remain alive at maturity.
- the term "fiber” is usually inclusive of thick-walled conducting cells such as vessels and tracheids and to fibrillar aggregates of many individual fiber cells.
- fiber includes: (a) conducting and non-conducting cells of the xylem; (b) fibers of extraxylary origin, including those from phloem, bark, ground tissue, and epidermis; and (c) fibers from stems, leaves, roots, seeds, and flowers or inflorescences.
- Transgenic plants of the invention are characterized by increased fiber length and preferably increased height as well.
- Increased fiber length in the genetically engineered plant is preferably achieved via WAK overexpression in the plant tissues wherein cell expansion occurs.
- "increased fiber length” refers to a quantitative augmentation in the length of fiber cells in the plant when compared to the length of fiber cells in a wild-type plant”.
- a quantitative increase of fiber length can be measured by several techniques, such as digitizing, the Kajaani procedure, and the Fiber Quality Analyzer. Han et al., 1999, In: Kenaf Properties, Processing and Products, Mississipi State University, Ag & Bio Engineering, pp 149-167.
- the fiber length in the engineered plant of the invention is at least from 5 to 15% longer, preferably at least 10-30% and most preferably at least from 20-50% longer than the fiber length of the wild-type plant. Because increased fiber length can be followed by an increase in plant height, transgenic plants of the invention may have increase fiber length and height. In this description, therefore, the phrase "increased plant height" connote a quantitative increase in plant height, when compared to the height of a wild-type plant.
- the height in the engineered plant of the invention can be increased to levels of about 5% to about 90%, preferably about 10% to about 75%, even more preferably about 15% to about 65% of the height of the wild-type plant.
- RNA extraction via the cetyltrimethyl-ammonium bromide (CTAB) extraction method. Aldrich and Cullis, 1993, Plant MoI. Biol. Report, 11:128- 141.
- CTCAB cetyltrimethyl-ammonium bromide
- a cDNA pool was used in RT-PCR experiments in which the isolated total RNA was used as template, and Superscript II reverse transcriptase (Invitrogen) and oligo(dT) primer were used to synthesize the first-strand cDNA. Double-stranded cDNA was obtained by the subsequent polymerase reaction, using gene-specific primers, as described below.
- WAK_NDE Length 23 SEQ ID NO: 11 CATATGAAAGTGCAGCGTCTGTT
- the cDNA sample obtained in (a) was used as template, and the primers designed in (b) were used for PCR.
- the PCR steps involved 40 cycles of 1 minute at 94°C, 1 minute at 50 0 C, and 2 minutes at 72 0 C followed by an extra step of elongation at 72 0 C for 7 minutes.
- the PCR products were isolated by gel electrophoresis on 1.0% agarose followed by ethidium bromide staining of the electrophoresed gel and detection of amplified bands on a UV transilluminator. The detected amplified band was verified and cut out of the agarose gel with a razor.
- the pieces of gel were transferred to 1.5 mL micro tubes, and the DNA fragments were isolated and purified using a GFX PCR clean-up and gel band purification kit (Amersham).
- the recovered DNA fragments were subcloned to the pGEM-T cloning vector (Promega), transformed into E. coli, and then used to prepare plasmid DNA in the usual manner, which was then sequenced by the dideoxy method (Messing, 1983, Methods in Enzymol. 101: 20-78), using BigDye chemistry (Applied Biosystems), to yield the DNA sequence disclosed here as SEQ ID NO: 1, for use pursuant to the present invention.
- PCR can be used to verify the integration of the gene construct in the genome of transgenic plants.
- the PCR reaction mixture contained 100 ng genomic DNA of transformed plant, and 0.2 ⁇ M of each primer described above, 100 ⁇ M of each deoxyribonucleotide triphosphate, 5 ⁇ L PCR buffer and 2.5 Units of AmpliTaq DNA polymerase (Applied Biosystems) in a total volume of 50 ⁇ L.
- the cycling parameters were as follows: 94°C for 1 minute, 50 0 C for 1 minute and 72°C for 3 minutes, for 40 cycles, with 5 minutes at 72°C extension.
- the PCR products were electrophoresized on a 1% agarose gel.
- GPDH glyceraldehyde-3-phosphate dehydrogenase
- PCR was done with a 12.5- fold dilution of the first-strand cDNA under the following conditions: 94°C for 3 minutes and 27 cycles of 94°C for 1 minute, 52 to 6O 0 C for 45 seconds, and 72°C for 1 minute and 30 seconds.
- Transgenic event 43B exhibits an increase of 21% in fiber length as compared to the control plants (P ⁇ 0.05, t-test).
- Transgenic event 47B exhibits an increase of 19% in fiber length when compared to the control plants (FIGURE 2; P ⁇ 0.05, t-test). Additionally, transgenic event 43B exhibit an increase of 15% in fiber length as compared to the control plants (FIG. 2 P ⁇ 0.05, t- test).
- the results presented are an example of the increase in plant height observed in the homozygote dominant plants of different lines. Plant height of the three genotypes from the event 5 IB was compared. Plants that are homozygote dominant are 12% higher than the homozygote recessive plants. Plants that are hemizygote are 9% higher than the homozygote recessive plants (P ⁇ 0.05, t-test) (FIGURE 5).
- Example 1 The gene obtained in Example 1 above was introduced into a plant host to produce transgenic Populus plants.
- Expression constructs can be prepared by cleaving the wall-associated kinase gene obtained in Example 1 above with suitable restriction enzymes so as to include the entire open reading frame and inserting the gene into the plant transformation vector pALELLYX-WAK (FIG. 1) together with an appropriate promoter.
- the wall-associated kinase gene obtained in Example 1 was cloned into the aforementioned expression vector downstream to a xylem-preferred tubulin gene (TUB) promoter from Populus deltoides, as set forth in international application WO 2005/096805.
- TAB tubulin gene
- Wild-type aspen was transformed with Agrobacterium tumefaciens carrying a construct comprising an Arabidopsis thaliana wall-associated kinase gene obtained in Example 1 operably linked to the promoter of a xylem-preferred gene (TUB).
- TTB xylem-preferred gene
- Petioles and internodal stem segments from in vitro micropropagated plants were used as explants.
- Transformed shoots are selected on regeneration medium containing lOOmg/L of kanamycin and allowed to root on the Murashige and Skoog medium. Selected plants are subsequently transferred to soil and grown in the greenhouse.
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2007335207A AU2007335207B2 (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs and methods for altering plant fiber length and/or plant height |
CA2672771A CA2672771C (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs and methods for altering plant fiber length and/or plant height |
EP07845482.4A EP2094852B1 (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs and methods for altering plant fiber length and/or plant height |
CN200780046680.9A CN101583719B (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs and methods for altering plant fiber length and/or plant height |
BRPI0720468-0A BRPI0720468A2 (en) | 2006-12-20 | 2007-12-20 | NUCLEIC ACID CONSTRUCTS AND METHODS FOR CHANGING PLANT FIBER LENGTH AND / OR PLANT HEIGHT |
US12/520,282 US9080181B2 (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs methods for altering plant fiber length and/or plant height |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US87104806P | 2006-12-20 | 2006-12-20 | |
US60/871,048 | 2006-12-20 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2008074115A1 true WO2008074115A1 (en) | 2008-06-26 |
WO2008074115A8 WO2008074115A8 (en) | 2009-08-13 |
Family
ID=39535914
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/BR2007/000357 WO2008074115A1 (en) | 2006-12-20 | 2007-12-20 | Nucleic acid constructs and methods for altering plant fiber length and/or plant height |
Country Status (7)
Country | Link |
---|---|
US (1) | US9080181B2 (en) |
EP (1) | EP2094852B1 (en) |
CN (1) | CN101583719B (en) |
AU (1) | AU2007335207B2 (en) |
BR (1) | BRPI0720468A2 (en) |
CA (1) | CA2672771C (en) |
WO (1) | WO2008074115A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8648231B2 (en) * | 2008-11-24 | 2014-02-11 | The Regents Of The University Of California | Wall-associated kinase-like polypeptide mediates nutritional status perception and response |
Citations (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5378619A (en) | 1989-10-31 | 1995-01-03 | Monsanto Company | Promoter for transgenic plants |
US5424412A (en) | 1992-03-19 | 1995-06-13 | Monsanto Company | Enhanced expression in plants |
US5510474A (en) | 1988-05-17 | 1996-04-23 | Mycogen Plant Science, Inc. | Plant ubiquitin promoter system |
US6096950A (en) | 1992-05-18 | 2000-08-01 | Monsanto Company | Cotton fiber-specific promoters |
WO2000052168A1 (en) | 1999-02-26 | 2000-09-08 | Cropdesign N.V. | Method of selecting transformed cells and tissues |
US6117679A (en) | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6132970A (en) | 1994-02-17 | 2000-10-17 | Maxygen, Inc. | Methods of shuffling polynucleotides |
US6165793A (en) | 1996-03-25 | 2000-12-26 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
WO2001059086A2 (en) | 2000-02-08 | 2001-08-16 | Sakata Seed Corporation | Methods and constructs for agrobacterium-mediated plant transformation |
US20030172402A1 (en) * | 2000-03-07 | 2003-09-11 | Maria Eriksson | Transgenic trees exhibiting increased growth, biomass production and xylem fibre length, and methods for their production |
WO2005096805A2 (en) | 2004-04-06 | 2005-10-20 | Alellyx S.A. | Cambium/xylem-preferred promoters and uses thereof |
US6995256B1 (en) | 2000-08-01 | 2006-02-07 | Temasek Life Sciences Laboratory Limited | Isolation and characterization of a fiber-specific actin promoter from cotton |
WO2006068603A1 (en) | 2004-12-21 | 2006-06-29 | Swetree Technologies Ab | New transgenic plants and method for their production |
WO2007000611A1 (en) | 2005-06-29 | 2007-01-04 | The Boc Group Plc | Gas dispenser |
US20080058510A1 (en) * | 2004-08-18 | 2008-03-06 | Alellyx S.A. | Altering lignin and wood density |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1229781B1 (en) | 1999-11-17 | 2013-01-02 | Mendel Biotechnology, Inc. | Seed trait genes |
EP2410060A1 (en) | 2000-08-22 | 2012-01-25 | Mendel Biotechnology, Inc. | Genes for modifying plant traits IV |
EP1402037A1 (en) | 2001-06-22 | 2004-03-31 | Syngenta Participations AG | Plant genes involved in defense against pathogens |
SE0301233D0 (en) * | 2003-04-28 | 2003-04-28 | Swetree Technologies Ab | Tissue specific promoters |
-
2007
- 2007-12-20 BR BRPI0720468-0A patent/BRPI0720468A2/en not_active IP Right Cessation
- 2007-12-20 US US12/520,282 patent/US9080181B2/en not_active Expired - Fee Related
- 2007-12-20 EP EP07845482.4A patent/EP2094852B1/en not_active Not-in-force
- 2007-12-20 WO PCT/BR2007/000357 patent/WO2008074115A1/en active Application Filing
- 2007-12-20 CN CN200780046680.9A patent/CN101583719B/en not_active Expired - Fee Related
- 2007-12-20 AU AU2007335207A patent/AU2007335207B2/en not_active Ceased
- 2007-12-20 CA CA2672771A patent/CA2672771C/en active Active
Patent Citations (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5510474A (en) | 1988-05-17 | 1996-04-23 | Mycogen Plant Science, Inc. | Plant ubiquitin promoter system |
US5378619A (en) | 1989-10-31 | 1995-01-03 | Monsanto Company | Promoter for transgenic plants |
US5424412A (en) | 1992-03-19 | 1995-06-13 | Monsanto Company | Enhanced expression in plants |
US5859347A (en) | 1992-03-19 | 1999-01-12 | Monsanto Company | Enhanced expression in plants |
US6096950A (en) | 1992-05-18 | 2000-08-01 | Monsanto Company | Cotton fiber-specific promoters |
US6506603B1 (en) | 1994-02-17 | 2003-01-14 | Maxygen, Inc. | Shuffling polynucleotides by incomplete extension |
US6117679A (en) | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US6132970A (en) | 1994-02-17 | 2000-10-17 | Maxygen, Inc. | Methods of shuffling polynucleotides |
US6165793A (en) | 1996-03-25 | 2000-12-26 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
WO2000052168A1 (en) | 1999-02-26 | 2000-09-08 | Cropdesign N.V. | Method of selecting transformed cells and tissues |
WO2001059086A2 (en) | 2000-02-08 | 2001-08-16 | Sakata Seed Corporation | Methods and constructs for agrobacterium-mediated plant transformation |
US20030172402A1 (en) * | 2000-03-07 | 2003-09-11 | Maria Eriksson | Transgenic trees exhibiting increased growth, biomass production and xylem fibre length, and methods for their production |
US6995256B1 (en) | 2000-08-01 | 2006-02-07 | Temasek Life Sciences Laboratory Limited | Isolation and characterization of a fiber-specific actin promoter from cotton |
WO2005096805A2 (en) | 2004-04-06 | 2005-10-20 | Alellyx S.A. | Cambium/xylem-preferred promoters and uses thereof |
US20080058510A1 (en) * | 2004-08-18 | 2008-03-06 | Alellyx S.A. | Altering lignin and wood density |
WO2006068603A1 (en) | 2004-12-21 | 2006-06-29 | Swetree Technologies Ab | New transgenic plants and method for their production |
WO2007000611A1 (en) | 2005-06-29 | 2007-01-04 | The Boc Group Plc | Gas dispenser |
Non-Patent Citations (60)
Title |
---|
"CURRENT PROTOCOLS IN MOLECULAR BIOLOGY", 1988, GREENE PUBLISHING ASSOCIATES AND WILEY-INTERSCIENCE |
"GENOME ANALYSIS: A LABORATORY MANUAL", vol. 1-2, 1997, COLD SPRING HARBOR LABORATORY PRESS |
"METHODS IN PLANT MOLECULAR BIOLOGY: A LABORATORY COURSE MANUAL", 1995, COLD SPRING HARBOR LABORATORY PRESS |
"MOLECULAR CLONING: A LABORATORY MANUAL", vol. 1-3, 2001, COLD SPRING HARBOR LABORATORY PRESS |
"PCR PRIMER: A LABORATORY MANUAL", 2003, COLD SPRING HARBOR LABORATORY PRESS |
"SHORT PROTOCOLS IN MOLECULAR BIOLOGY: A COMPENDIUM OF METHODS FROM CURRENT PROTOCOLS IN MOLECULAR BIOLOGY", vol. 1-2, 2002, JOHN WILEY & SONS, INC. |
ALDRICH; CULLIS, PLANT MOL. BIOL. REPORT, vol. 11, 1993, pages 128 - 141 |
AN, PLANT PHYSIOL., vol. 88, 1988, pages 547 - 552 |
AZIZ ET AL.: "Wood and pulp properties of aspen and its hybrids", TAPPI PROC. PULPING CONFERENCE, 1996, pages 437 - 443 |
BAMBER, APPITA, vol. 38, 1985, pages 210 - 216 |
BEAUCAGE; CARUTHERS, TETRA. LETTS., vol. 22, 1981, pages 1859 - 1862 |
BECHTOLD ET AL., C. R. ACAD SCI. PARIS, vol. 316, 1993, pages 1194 - 1199 |
BECHTOLD; PELLETIER, METHODS MOL. BIOL., vol. 82, 1998, pages 259 - 266 |
BROOTHAERTS ET AL., NATURE, vol. 433, 2005, pages 629 - 633 |
CALLIS ET AL., GENES DEV., vol. 1, 1987, pages 1183 - 1200 |
DATABASE PUBMED [online] ERIKSSON ET AL.: "Increased gibberellin biosynthesis in transgenic trees promotes growth, biomass production and xylem fiber length", XP002956005, Database accession no. (10888850) * |
DEAN, PLANT CELL, vol. 1, 1989, pages 201 - 208 |
FROMM ET AL., PLANT CELL, vol. 1, 1989, pages 977 - 984 |
GRAY-MITSUMUNE ET AL., PLANT PHYSIOL., vol. 135, 2004, pages 1552 - 1564 |
HAN ET AL.: "Kenaf Properties, Processing and Products", 1999, AG & BIO ENGINEERING, pages: 149 - 167 |
HE ET AL., PLANT MOL. BIOL., vol. 39, 1999, pages 1189 - 1196 |
HUANG ET AL., FUNCTIONAL PLANT BIOLOGY, vol. 34, 2007, pages 499 - 507 |
HUSSEY ET AL., ANNU. REV. PLANT BIOL., vol. 57, 2006, pages 109 - 125 |
INNIS ET AL.: "PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS", 1990, ACADEMIC PRESS |
JEON ET AL., PLANT PHYSIOL., vol. 123, 2000, pages 1005 - 1014 |
JOHN ET AL., PLANT MOL. BIOL., vol. 30, 1996, pages 297 - 306 |
JOHN ET AL., PLANT PHYSIOL., vol. 108, 1995, pages 669 - 676 |
JOHN ET AL., PROC. NATL. ACAD SCI. USA, vol. 93, 1996, pages 12768 - 12773 |
JOHN ET AL., PROC. NATL. ACAD SCI., vol. 93, 1996, pages 12768 - 12773 |
KLEIN ET AL., BIOTECHNOLOGY, vol. 4, 1993, pages 583 - 590 |
KOHORN ET AL., PLANT J, vol. 46, 2006, pages 307 - 316 |
KONCZ; SCHELL, MOL. GEN. GENET., vol. 204, 1986, pages 383 - 396 |
LALLY ET AL., PLANT CELL, vol. 13, 2001, pages 1317 - 1331 |
LEON ET AL., PLANT PHYSIOL., vol. 95, 1991, pages 968 - 972 |
LEYVA ET AL., PLANT CELL, vol. 4, 1992, pages 263 - 271 |
LI, PLANT PHYSIOL., vol. 130, 2002, pages 666 - 674 |
LORZ ET AL., MOL. GENET., vol. 199, 1985, pages 179 - 182 |
MATTEUCCI; CARUTHERS, J. AM. CHEM. SOC., vol. 103, 1981, pages 3185 |
MELLEROWICZ ET AL., PLANT MOL. BIOL., vol. 47, 2001, pages 239 - 274 |
NAGEL ET AL., MICROBIOL LETT, vol. 67, 1990, pages 325 |
NAT. BIOTECHNOL., vol. 18, no. 7, July 2000 (2000-07-01), pages 784 - 788 * |
NORRIS ET AL., PLANT MOL. BIOL., vol. 21, 1993, pages 895 - 906 |
ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 812 |
PASZKOWSKI ET AL., EMBO J, vol. 3, 1984, pages 2717 - 2722 |
PENA ET AL., NATURE, vol. 325, 1987, pages 274 - 276 |
RHODES ET AL., SCIENCE, vol. 240, 1988, pages 204 - 207 |
RINEHART ET AL., PLANT PHYSIOL., vol. 112, 1996, pages 1331 - 1341 |
ROSE; LAST, PLANT J., vol. 11, 1997, pages 455 - 464 |
RUAN ET AL., PLANT PHYSIOL., vol. 136, 2004, pages 4104 - 4113 |
SAGI ET AL., PLANT CELL REP., vol. 13, 1994, pages 262 - 266 |
SAMBROOK ET AL.: "MOLECULAR CLONING: A LABORATORY MANUAL", 1989, COLD SPRING HARBOR LABORATORY PRESS |
See also references of EP2094852A4 |
SEGUIN ET AL., PLANT MOL. BIOL., vol. 35, 1997, pages 281 - 291 |
SHIMAMOTO ET AL., NATURE, vol. 328, 1989, pages 274 - 276 |
THOMPSON, EMBO J, vol. 6, 1987, pages 2519 - 23 |
TORRES-SCHUMANN, PLANT J, vol. 9, 1996, pages 283 - 296 |
VASIL ET AL., PLANT PHYSIOL., vol. 91, 1989, pages 1575 - 1579 |
VERHAEGEN; PLOMION, GENOME, vol. 39, 1996, pages 1051 - 1061 |
WAGNER; KOHORN, PLANT CELL, vol. 13, 2001, pages 303 - 318 |
ZOLLER; SMITH, NUCLEIC ACID RES., vol. 10, 1982, pages 6487 - 6500 |
Also Published As
Publication number | Publication date |
---|---|
EP2094852A4 (en) | 2010-06-30 |
EP2094852A1 (en) | 2009-09-02 |
WO2008074115A8 (en) | 2009-08-13 |
AU2007335207A1 (en) | 2008-06-26 |
CN101583719B (en) | 2015-03-25 |
AU2007335207B2 (en) | 2012-08-02 |
CA2672771C (en) | 2016-11-29 |
US9080181B2 (en) | 2015-07-14 |
EP2094852B1 (en) | 2014-01-22 |
BRPI0720468A2 (en) | 2014-01-14 |
US20100095405A1 (en) | 2010-04-15 |
CA2672771A1 (en) | 2008-06-26 |
CN101583719A (en) | 2009-11-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2010201471B2 (en) | Cambium/xylem-preferred promoters and uses thereof | |
US20130160162A1 (en) | Nucleic Acid Molecules Encoding Plant Proteins in the C3HC4 Family and Methods for the Alteration of Plant Cellulose And Lignin Content | |
AU2007335207B2 (en) | Nucleic acid constructs and methods for altering plant fiber length and/or plant height | |
AU2012203911B2 (en) | Cambium/xylem-preferred promoters and uses thereof | |
BRPI0720468B1 (en) | NUCLEIC ACID CONSTRUCTS AND METHODS FOR ALTERING THE LENGTH OF THE FIBER OF THE PLANT AND / OR THE HEIGHT OF THE PLANT |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780046680.9 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07845482 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007335207 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2672771 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007845482 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 4022/CHENP/2009 Country of ref document: IN |
|
ENP | Entry into the national phase |
Ref document number: 2007335207 Country of ref document: AU Date of ref document: 20071220 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12520282 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0720468 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090617 |