WO2008043268A1 - Gmrd22-like genes and use thereof to protect against abiotic stress - Google Patents
Gmrd22-like genes and use thereof to protect against abiotic stress Download PDFInfo
- Publication number
- WO2008043268A1 WO2008043268A1 PCT/CN2007/002857 CN2007002857W WO2008043268A1 WO 2008043268 A1 WO2008043268 A1 WO 2008043268A1 CN 2007002857 W CN2007002857 W CN 2007002857W WO 2008043268 A1 WO2008043268 A1 WO 2008043268A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gmrd22
- plant
- nucleic acid
- sequence
- stress
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
- C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Definitions
- This invention relates to agricultural biotechnology. More specifically, this invention relates to a novel gene and its homologs that enhance tolerance to abiotic stresses and uses thereof, particularly in producing transgenic plants, seeds, and progeny thereof that are substantially tolerant of abiotic stress.
- Yield enhancement to increase crop production is one of the essential strategies to meet the demand for food by our continually growing populations.
- Abiotic stress limits crop production significantly by, e.g., reducing overall crop yield or decreasing crop quality.
- Abiotic stresses are environmental factors such as drought, salt, extreme temperatures and high winds. While many agricultural practices are designed to optimize crop growth by reducing or avoiding such abiotic stresses, improvements are still needed.
- Soybean one of the most important cash crops, is classified as a moderately NaCl-tolerant plant (Maas & Hoffman, 1977). Understanding the NaCl tolerance mechanism in this crop plant may ultimately help improve its yield on saline lands, and the NaCl tolerance conferring genes in soybean may also be applicable to crops that are more sensitive to NaCl (e.g., carrot, orange and rice).
- Salinity (such as accumulation of NaCl) is a severe abiotic environmental stress affecting plant growth. The adverse effects are multifaceted and include ionic stress, physiological drought, specific ion toxicity, and salt-induced oxidative stress.
- Salt stress and dehydration stress are long thought to be closely associated since accumulation of salt (mainly NaCl) presents in external environment will lead to a drop of external water potential, which then become lower than that of the water potential in the plant cells. As a result, the net water flow will be from interior of the plant cell to its exterior. This leads to osmotic desiccation (Ashraf, 1994), also known as physiological drought in plants (Jain, et al., 1997).
- RD22 first discovered in Arabidopsis, is induced by salt stress, but not by cold or heat stress (Yamaguchi-Shinozaki and Shinozaki, 1993). It was found that the plant hormone abscisic acid (ABA) is crucial for the induction of RD22 under dehydration and salt stress, although RD22 lacks the ABA-responsive element (ABRE) (Xiong, et al., 2001). It appears that dehydration triggers the production of ABA, in turns induces expression of various genes, cis and trans-acting factors. Based on the current model for RD22 induction proposed by Abe, H.
- ABA is synthesized and triggers the production of RD22BP1 and ATMYB2 proteins, which act as transcriptional activators to bind to the MYC and MYB sites locating on a 67bp fragment of the RD22 promoter, and hence activates the expression of RD22.
- RD22BP1 and ATMYB2 proteins act as transcriptional activators to bind to the MYC and MYB sites locating on a 67bp fragment of the RD22 promoter, and hence activates the expression of RD22.
- GmRD22 A novel clone impacting tolerance to abiotic stresses, GmRD22, and its related protein, is provided herein.
- GmRD22 a novel RD22 clone originally identified from salt-stress soybeans.
- an isolated polynucleotide sequence comprising a nucleotide sequence of SEQ ID NO: 1 and complementary sequences thereof. Also provided is an isolated polynucleotide sequence comprising a nucleotide sequence of at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to a nucleic acid sequence of SEQ ID NO: 1, and complementary sequences thereof.
- a recombinant nucleic acid construct comprising the polynucleotide sequence encoding GmRD22 protein or a GmRD22-like protein, or any one of the polynucleotide sequences provided herein, wherein the polynucleotide is operably linked to control sequences operable to effect a detectable expression in plant cells.
- the expression of the heterologous polynucleotide is high.
- the control sequences are heterologous to the polynucleotide sequence of the present invention.
- the control sequences further effect insertion of the recombinant nucleic acid construct of the present invention into host cell chromosomal DNA.
- Hosts cell comprising the recombinant nucleic acid construct are provided.
- the host cell is a plant cell.
- Transgenic plants or plant parts or plant cells comprising GmRD22 protein or a GmRD22-like protein, or the polynucleotide sequence, the recombinant nucleic acid construct provided herein are also contemplated.
- substantially pure polypeptide having the amino acid sequence of SEQ ID NO:2, a substantially pure polypeptide having of at least 80%, at least 85%, at least 90%, at least 95%,or at least 99% sequence identity to an amino acid sequence of SEQ ID NO:2, or isolated polypeptides encoded by any one of the polynucleotides provided herein.
- polypeptide comprising growing a host cell under conditions which allow and/or induce the expression of the heterologous polynucleotide and isolating the polypeptide encoded by the polynucleotide.
- a method for protecting plants or plant cells from abiotic stress by inducing or increasing tolerance to abiotic stress comprising modifying said plants or plant cells to express a GmRD22 protein, wherein the GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 2, or a polypeptide encoded by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1.
- the method provided herein comprises modifying said plants or plant cells to contain an expression vector comprising a polynucleotide sequence encoding a heterologous GmRD22 protein and operably linked to control sequences operable in plant cells.
- the GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 2, or a polypeptide encoded by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1.
- the abiotic stress can be salinity stress or drought.
- a method for selecting for successfully transformed plant cells or plants comprises applying abiotic stress to plant cells or plants subjected to a transformation with a recombinant nucleic acid construct of the present invention as a selectable marker, whereby cells that have increased resistance or tolerance to the abiotic stress are selected.
- nucleic acid sequence of GmRD22 or a protein encoded by the nucleic acid sequence in water saving agricultural practice.
- Such water saving agricultural practice can be used by itself or in combination with other prior art water saving agricultural practices for the enhancement of agriculture in saline lands and arid/semi-arid regions.
- a method for reducing water usage in agriculture is provided herein, in which the method comprises transforming and expressing the polynucleotide or the construct of the present invention in a plant or a part thereof.
- GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ED NO: 2, or encoded by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ DD NO: 1.
- Figure 1 shows the sequence of GmRD22, in which panel A shows a Nucleotide Sequence (SEQ ID NO: 1); and panel B show an Amino acid sequence (SEQ ID NO: 2) thereof .
- Figure 2 shows the effect of NaCl on the expression of GmRD22 in various cultivated (G.max) (panel A) and wild (G. soja) (panel B) soybean varieties. + and - indicate plants with and without NaCl treatment, respectively.
- Figure 3 shows the alignment of GmRD22 to other RD22 or BURP-domain containing proteins, in which amino acid residues in bold indicates the BURP-domain conserved among RD22-like proteins.
- the first two letters of each protein label represent the abbreviated species name, followed by GenBank accession number, in which At represents: Arabidopsis thaliana; Bn represents Brassica napus; Gm represents Glycine max; Le represents Lycopersicon esculentum; Os represents Oryza sativa.
- Figure 4 shows the phylogenetic analysis of RD22 proteins and other BURP domain-containing proteins. Except for GmRD22, the first two letters of each protein label represent the abbreviated species name, followed by GenBank accession number. At represents Arabidopsis thaliana.; Bn represents Br ⁇ ssic ⁇ n ⁇ pus; Gm represents Glycine max; Le represents Lycopersicon esculentum; Os represents Oryza saliva; Pp represents Prunus persica; Vr represents Vigna radiate; Vv represents Vitis vinifera.
- Figure 5 shows the expression of GmRD22 in soybean leaves under NaCl stress. Ethidium bromide staining of rRNA was used as a loading reference for RNA samples.
- Figure 6 shows a Northern blot analysis of GmRD22 under salt and PEG treatment, in which CT represents control, NaCl represents 125mM NaCl treatment for 48 hr; PEG represents 5% PEG treatment for 48 hr, which mimic the effect of dehydration.
- Figure 7 shows differential expression pattern of GmRD22 among 2 soybean cultivars with contrasting salt tolerance ability under: salt stress (panel (a)) and osmotic stress (panel (b)), in which WF represents the salt tolerant cultivar Wenfeng 7; UN represents the salt sensitive cultivar Union.
- Figure 8 shows the expression of GmRD22 in transgenic rice using Northern blot analysis. All 3 independent transgenic lines show expression of GmRD22 while the untransformed parent gives no signal.
- Figure 9 shows a field test of GmRD22 transgenic rice.
- Figure 10 shows the performance of several homozygous GmRD22 transgenic rice lines and the untransformed wild type under: drought stress (panel (a)) and (b) salinity stress (panel (b)), in which WT represents wild type; 137, 141, 153 represent GmRD22 transgenic lines.
- the seedlings without label are transgenic rice expressing another proprietary clone (also confers salt and drought tolerance) obtained in our lab.
- Figure 11 shows the survival rates of GmRD22 transgenic rice and the untransformed wild type under: drought stress (panel (a)) and salinity stress (panel Qa)), in which WT represents wild type; 137, 141, 153 represent GmRD22 transgenic lines.
- WT drought stress
- panel Qa salinity stress
- Figure 12 shows the expression of GmRD22 in transgenic Arabidopsis thaliana using Northern blot analysis, in which CoI-O represents wild type parent; V7 represents an empty vector transgenic control. 1-1-2, 2-2-7, 4-4-1 represents three independent GmRD22 transgenic lines. Strong signals can be seen in all independent transgenic lines. The very faint signals in CoI-O and V7 are probably due to the endogenous Arabidopsis RD22 transcripts.
- Figure 13 shows the effects of osmotic stress on root growth of GmRD22 transgenic Arabidopsis thaliana.
- the percentage of root growth after treated with 20% PEG is compared among the wild type Col-0, the empty vector transgenic control (V7) and two independent GmRD22 transgenic lines (4-4-1 and 1-1-2).
- polynucleotide and “nucleic acid” are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer.
- the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties. In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
- polypeptide polypeptide
- peptide protein
- amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally occurring amino acid, for example selenocysteine (Bock et al. (1991) Trends Biochem. Sci. 16:463-467; Nasim et al. (2000) J. Biol. Chem. 275:14,846-14,852) and the like.
- sequence identity means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions.
- sequence identity means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions.
- the length of the compared sequences is at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides.
- Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705).
- an "isolated” or “purified” protein, or biologically active portion thereof is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- a protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, (by dry weight) of non-GmRD22 protein.
- the culture medium typically represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.
- isolated indicates that the nucleic acid or polypeptide exists apart from its native environment and is not a product of nature.
- An isolated nucleic acid or polypeptide can exist in a purified form or can exist in a non-native environment such as a transgenic host cell.
- abiotic stress refers to nonliving environmental factors that exert a disadvantageous influence on plants or plant cells. In most cases, stress is measured in relation to plant survival, crop yield, growth (biomass accumulation), or the primary assimilation processes (CO 2 and mineral uptake), which are related to overall growth. Examples of abiotic stresses include, but are not limited to, salinity, dehydration, oxidative stress, and extreme cold or heat.
- Salinity stress means that the growth substratum (including but not limited to soil and hydroponic systems) contains salts (including but not limited to NaCl, MgSO 4 , NaSO 4 , NaHCO 3 , Na 2 CO 3 , MgCO 3 ) at levels that limit the growth of target plants.
- Osmotic stress means that the growth substratum contains substances (including but not limited salts) that will decrease water potential in the growth substratum.
- Dehydration stress means that the growth substratum contains water less than that required for optimal growth of target plants.
- higher plants refers to plants with vascular systems, i.e. vascular plants. Specifically, higher plants include those of Pteridophyta, Gymnosperms, and Angiosperms.
- heterologous means that things are of different origins, such as different species, different tissues or different genes.
- a GmRD22 protein from soybean is considered heterologous to Arabidopsis.
- Heterologous nucleic acid sequences also refers to those that are not contiguous to each other in nature.
- a promoter and a coding sequence to which it is operably linked are heterologous when they are derived from different species or genes.
- exdogenous means that a protein or a nucleic acid sequence is utilized in an organism other than the one from which it originated.
- promoter refers to a regulator region a short distance from the 5' end of a gene that acts as the binding site for RNA polymerase. Such sequences have the functions of directing or regulating the transcription of nucleic acid sequences immediately downstream of them.
- promoters include constitutive promoters, tissue-specific promoters, inducible promoters and those triggered by specific physiological conditions, such as dehydration.
- the examples of promoters could be used in the present invention include, but are not limited to, CaMV 35S, Ubi, SAG12 promoter, and the like. More suitable promoters can be found in the PlantProm database (Shahmuradov et al, Nucleic Acids Research, 2003, Vol. 31, No. 1 114-117).
- operably linked refers to that a promoter is positioned relative to a polypeptide-encoding polynucleotide in such a manner that the polynucleotide is, under the control of the regulatory nucleic acids, transcribed and optionally the polypeptide is translated.
- phase "operable in plant cells” as used herein means that a promoter or control sequence is capable of performing its normal function of directing and/or regulating expression of coding sequences immediately downstream to it in a plant cell, wherein the plant cell can be a part of a living plant or in cell culture.
- selectable marker and “selection marker” interchangeably refer to a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker.
- a selectable marker gene confers a trait for which one can 'select' based on resistance or tolerance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells, including abiotic stresses).
- a screenable marker gene confers a trait or a phenotype that one can identify through observation or testing, i.e., by 'screening' (e.g. .beta.-glucuronidase, luciferase, or other enzyme activity not present in untransformed cells).
- expression cassette refers to a nucleic acid sequence, particularly a DNA sequence harboring a gene and a control sequence to which said gene are operably linked. By using various control sequences the expression pattern and level of the gene can be regulated.
- One or more expression cassettes can be inserted into a construct or a transformation vector of the invention which in turn is introduced into a desired host so that the gene is expressed therein.
- GmRD22 or a GmRD22-like protein expression successfully confers abiotic stress tolerance or resistance to plant cells and plants when heterologously expressed, particularly tolerance or resistance to salinity and dehydration.
- This is illustrated below in rice and Arabidopsis thaliana, but is by no means limited to this example.
- GmRD22 nucleic acid sequence of SEQ ID NO: 1 or with at least 80% sequence identity to SEQ ID NO: 1, and complementary sequences thereof.
- amino acid sequence of GmRD22 of SEQ ID NO:2 as well as amino acid sequences with at least 80% sequence identity to SEQ ID NO:2.
- the polynucleotide of GmRDH may be provided in an integration vector or an expression vector in combination with various promoter to achieve expression of the coding region in a suitable host plant or plant cell.
- the invention provides an isolated or substantially purified polynucleotide having a nucleic acid sequence of SEQ ID NO: 1 or a sequence substantially similar thereto.
- the invention also provides an isolated polynucleotide encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2 or a sequence substantially similar thereto.
- a preferred polynucleotide of the invention is the native GmRDH polynucleotide shown in Figure Ia (SEQ ID NO: 1) which encodes the native GmRD22 protein shown in Figure Ib (SEQ ID NO: T).
- the polynucleotide of the present invention can be obtained from soybean plants (e.g., Glycine max var. Wenfeng
- the polynucleotide of the present invention may be in the form of RNA or in the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA).
- the DNA may be circular or linear, double-stranded or single-stranded, and if single-stranded may be the coding (sense) strand or non-coding (anti-sense) strand.
- the polynucleotide which encodes native GmRD22 protein may be identical to the nucleotide sequence shown in Figure Ia (SEQ ID NO: 1). It may also be a different polynucleotide which, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptide as the polynucleotide of SEQ ID NO. 1 does.
- Other polynucleotide molecules within the invention are variants of GmRD22 polynucleotide such as those that encode fragments, analogs and derivatives of native GmRD22 protein.
- Such variants may be, e.g., a naturally occurring allelic variant of native GmRD22, a homolog of native GmRD22, or a non-naturally occurring variant of native GmRD22.
- These variants have a nucleotide sequence that differs from native GmRD22 polynucleotide in one or more bases.
- the nucleotide sequence of such variants can feature a deletion, addition, or substitution of one or more nucleotides of a native GmRD22.
- these changes are silent or conservative nucleotide changes.
- Fragments and variants of the disclosed polynucleotides or nucleotide sequences are contemplated. Fragments and variants of proteins encoded by the disclosed nucleotide sequences are also provided herein.
- a fragment is a portion of the nucleotide sequence or a portion of the amino acid sequence.
- Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein and hence induce or increase tolerance to abiotic stress by retaining at least one GmRD22 activity.
- fragments of a nucleotide sequence that are useful as hybridization probes generally do not encode fragment proteins retaining biological activity.
- fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence encoding the proteins provided herein.
- a fragment of a GmRD22 nucleotide sequence that encodes a biologically active portion of a GmRD22 protein of the invention will encode at least 12, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 125, 135, 150, 165, 175, 185, 200, 215, 225, 235, 250, 260, 275, 285, 300, 315, 325, 335, or 340 contiguous amino acids, or up to the total number of amino acids present in a full-length GmRD22 protein of the invention (for example, 343 amino acids for SEQ ID NO:2).
- the polynucleotide sequences provided herein include both the naturally occurring sequences as well as variant forms.
- the GmRD22 proteins provided herein encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess at least one of the desired GmRD22-like activities.
- the deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by either an enhanced tolerance to stress when expression of the GmRD22 protein sequence is induced or increased. For example, the activity may be evaluated as an increase in tolerance to hypersalinity in the plant expressing the heterologous GmRD22 protein using the assay described herein.
- the GmRDH polynucleotide sequences provided herein can be used to isolate corresponding sequences from other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. By "orthologs" is intended genes derived from a common ancestral gene and which are found in different species as a result of speciation. Functions of orthologs are often highly conserved among species.
- isolated sequences that encode a GmRD22 protein and which that hybridize under stringent conditions to the GmRD22 sequences disclosed herein,nucleic acid of SEQ ID NO: 1 or to fragments thereof,the complement of SEQ ID NO: 1 are also provided.
- all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism.
- the hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32 P, or any other detectable marker.
- nucleic acids that hybridize under stringent conditions to the nucleic acid of SEQ ID NO: 1 or the complement of SEQ ID NO: 1 are also within the invention.
- nucleic acids can be those that hybridize to SEQ ID NO: 1 or the complement of SEQ ID NO: 1 under stringent conditions low stringency conditions, moderate stringency conditions, or high stringency conditions are within the invention.
- Preferred such nucleotide acids are those having a nucleotide sequence that is the complement of all or a portion of SEQ ID NO: 1.
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O 0 C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 37 0 C, and a wash in IX.
- wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
- T m 81.5°C+16.6 (log M)+0.41 (% GQ-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- the ,T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 1O 0 C. Generally, stringent conditions are selected to be about 5 0 C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- polynucleotide sequences that encode a GmRD22 protein or a biologically active portion thereof and which hybridize to the GmRD22 sequences disclosed herein will have a sequence identity from about 40% to 50% identical, about 60% to 70% or 75%, and even about 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or higher to SEQ ID NO:1, so that the sequences may differ by only one nucleic acid or one amino acid when translated.
- Fragments of a GmRD22 nucleotide sequence that are useful as hybridization probes or PCR primers generally need not encode a biologically active portion of a GmRD22 protein.
- Nucleic acid molecules that are fragments of a GmRD22 nucleotide sequence comprise at least 16, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, or 1025 nucleotides, or up to the number of nucleotides present in a full-length GmRD22 nucleotide sequence disclosed herein.
- GmRD22 within the invention are polynucleotides that share at least 70% (e.g., 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99%) sequence identity to SEQ ID NO: 1 or the complement of SEQ ID NO: 1.
- 70% e.g., 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99% sequence identity to SEQ ID NO: 1 or the complement of SEQ ID NO: 1.
- Nucleic acids that hybridize under stringent conditions to or share at least 70% sequence identity with SEQ ID NO: 1 or the complement of SEQ ID NO: 1 can be obtained by techniques known in the art such as by making mutations in native GmRD22, by isolation from an organism expressing such a nucleic acid (e.g., a soybean plant expressing a variant of native GmRD22), or a non-soybean plant (e.g., a rice plant) expressing a homolog of native GmRD22.
- a nucleic acid e.g., a soybean plant expressing a variant of native GmRD22
- a non-soybean plant e.g., a rice plant
- an isolated polypeptide having an amino acid sequence of SEQ ID NO: 2 or a sequence substantially similar thereto is meant that the polypeptide has at least 70%, 80%, 85%, 90%, 95% or higher sequence identity to SEQ ID NO: 2.
- these GmRD22 protein variants feature amino acid changes that enable them to retain the GmRD22 function.
- the GmRD22 protein variants can be naturally occurring such as those encoded by GmRD22 homologs. They can also be synthetic proteins such as a fusion protein or those modified for a higher expression level in a host cell.
- a variant GmRD22 protein is a protein derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein as shown in, e.g., SEQ ID NO:2.
- Variant proteins typically are biologically active, that is, they continue to possess at least one desired biological activity of the full length GmRD22 protein. Such variants may result from, for example, genetic polymorphism or from human manipulation using recombinant molecular biology methods.
- Biologically active variants of a GmRD22 native protein of the invention will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs using default parameters.
- a biologically active variant of a protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
- the GmRD22 proteins provided herein may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art.
- amino acid sequence variants of the GmRD22 proteins can be prepared by mutations in the DNA.
- Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1979) ATLAS OF PROTEIN SEQUENCE AND STRUCTURE (Natl. Biomed. Res. Found., Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be made.
- the present invention also provide a method of producing GmRD22 protein and variants thereof, a method of protecting plants or plant cells from abiotic stress and a method for selecting for successfully transformed plant cells or plants, all of which involving transformation of a plant or a plant cell.
- Any higher plant or cell of a higher plant that is important or of interest for agriculture, horticulture, energy industry, biomass for bioconversion and/or forestry is a suitable subject for the present methods including but not limited to tobacco, corn, lettuce, oilseed rape, sugar beet, potatoes, tomatoes, cucumbers, peppers, beans, peas, citrus fruits, avocados, peaches, apples, pears, berries, plumbs, melons, eggplants, cotton, soybean, sunflowers, roses, poinsettia, petunia, guayule, cabbages, spinach, alfalfa, artichokes, corn, wheat, rice, rye, barley, grasses such as switch grass or turf grass, millet, hemp, bananas, poplars, eucalyptus trees, conifer, ornamental (e.g., larger flowers, larger leaves) and legume plants. Accordingly, provided herein also is a plant or cells of a higher plant produced by the methods of the present invention.
- Such plants can have no endogenous GmRD22 expression or endogenously express GmRD22 protein.
- the cells of the transformed plant may comprise a native GmRD22 polynuleotide and a recombinant nucleic acid construct encoding an exogenous or heterologous GmRD22 protein or only a recombinant nucleic acid construct encoding a heterologous GmRD22 protein.
- Heterologous nucleic acids are those nucleic acids from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced.
- the heterologous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA).
- the heterologous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand.
- Any suitable expression vector system or construct may be employed to modify a susceptible plant cell to contain and express a GmRD22 encoding-polynucleotide.
- plant cells can be modified to contain nucleotide sequences encoding the relevant protein, optionally operably linked to control sequences operable in plants, or integrated into the genome so as to be expressed under the control of endogenous control sequences.
- operably linked sequences are those with a functional linkage between a promoter or promoter-like sequence and a second sequence, wherein the promoter or promoter-like sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
- operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.
- the expression vector system may include in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a GmRD22 DNA sequence as provided herein, and a transcriptional and translational termination region functional in plants.
- the transcriptional initiation region, the promoter may be native or heterologous to the plant host. Additionally, the promoter may be an isolated sequence or alternatively a synthetic or recombinant sequence.
- Recombinant nucleic acid constructs may contain control sequences operable in plants operably linked to the GmRD22 protein-encoding sequence, which control sequences that result in transient, constitutive or inducible expression. Expression can be tissue-specific or tissue non-specific. In the present invention, the terms "construct" and "vector” may be alternately used.
- a promoter or a fragment of a promoter either alone or in combination with other sequences to create synthetic promoter constructs.
- the fragments confer desired properties on the synthetic promoter construct, such as conferring increased transcription of operably linked sequences in response to drought stress or hypersalinity.
- the GmRD22 polynucleotide(s) may be optimized for increased expression in the transformed plant. That is, the genes can be synthesized using plant-preferred codons for improved expression. Methods are available in the art for synthesizing plant-preferred genes. See, e.g., U.S. Pat. Nos. 5,380,831, and 5,436,391.
- the recombinant nucleic acid construct can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and/or stability (e.g., of mRNA).
- Such elements can be included in the recombinant nucleic acid construct to obtain optimal integration and/or expression of the nucleic acid.
- a polynucleotide encoding the GmRD22 protein is placed in operable linkage with a stress-inducible promoter and stably integrated into the genome of a suitable host such as rice.
- Other embodiments include the operable linkage of GmRD22 with developmentally controlled promoters or tissue-specific promoters. Such promoters include leaf-specific, root-specific or seed-specific promoters.
- a polynucleotide encoding the GmRD22 protein is placed in operable linkage with a chemically-inducible promoter and stably integrated into the genome of or stably expressed in a suitable host plant.
- plants which have been subjected to or are at risk for abiotic stress may be treated with the appropriate chemical in order to induce expression of the GmRD22 protein, thereby ameliorating the effect of the stress on the plant and improving crop yield.
- Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid.
- Other chemical-regulated promoters of interest include steroid-responsive promoters such as the glucocorticoid-inducible promoter and tetracycline-inducible and tetracycline-repressible promoters.
- the binary systems derived from the Ti plasmid of Agrobacteria are particular suitable for the present invention.
- a binary system typically includes two vectors of different sizes.
- the larger vector is a helper vector containing the necessary genes for integration of the T-DNA carried on the smaller vector into the genome of a plant cell.
- the smaller vector usually called as a binary vector, carries the gene to be inserted or cloned.
- the helper vector has been transformed to a suitable Agrobacterium strain in advance.
- Agrobacterium strains are well known in the art, such as LBA4404, GV3101, EHAlOl, EHA105, ABI, and the like (Plant Molecular Biology Manual. Ed. S. B.
- the promoter can be a 35s CaMV, rice actin promoter, ubiquitin promoter, or nopaline synthase (NOS) promoter.
- the expression system or recombinant nucleic acid construct may comprise a selectable marker gene for the selection of transformed cells.
- Selectable marker genes are utilized for the selection of transformed cells or tissues, and any suitable marker gene can be employed.
- Marker genes include, include but are not limited to genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
- GmRD22 can act as a selectable marker.
- transgenic plants can then be regenerated therefrom, and evaluated for stability of the inheritance of the resistance or tolerance trait, that is, whether the resistance or tolerance trait is transmitted to progeny.
- a transformed plant that is substantially tolerant or resistant to abiotic stress, particularly salt and drought stress or dehydration stress.
- the cells of the transformed plant may comprise a native GmRD22 polynucleotide and a recombinant nucleic acid construct encoding a heterologous GmRD22 protein or only a recombinant nucleic acid construct encoding a heterologous GmRD22 protein.
- abiotic stress tolerant trait can be evaluated at a molecular level, e.g., Southern or Northern blot analysis, PCR-based methodologies, or the biochemical or immunological detection of GmRD22, or by phenotypic analyses, i.e., whether transformed progeny can grow in the presence of salt or drought (or dehydration) that inhibits the growth of an untransformed plant. Also provided is a transformed plant seed and other progeny arising from the transformed plant.
- an expression cassette comprising a nucleotide sequence encoding the GmRD22 containing protein operably linked to control sequences operable in plants can be used as a selectable marker for successful transformation of cells.
- Successful transformants are more highly resistant and survive an applied stress for which the marker confers tolerance.
- successful transformants can be identified by virtue of their ability to survive and/or thrive under such stress conditions.
- These stress tolerant "cell lines" can be sub-cultured several times to remove non-tolerant cells.
- Generating transgenic crops harboring GmRD22 or a homolog thereof as a water saving agricultural plant or a part thereof can be used in a water saving agricultural practice.
- the plant or a part thereof of the present invention can also be used in a yield enhancement to increase crop production.
- the GmRD22 transgenic plants, progeny and seeds provided herein also may be employed alone or in combination with other water conserving agricultural practices to reduce or limit the usage of water while maintaining crop yield and quality.
- the crop plant can be co-transferred with GmRD22 and another stress-related gene such as GmPAPi to be conferred more tolerance to drought.
- these plants, progeny and seeds are particularly useful in saline lands and arid/semi-arid regions as the induced or increased tolerance to abiotic stressors will permit these transgenic plants to thrive in lands otherwise unusable or undesirable for agricultural development.
- Plant materials Ten cultivated (Glycine max L. Merr.) and ten wild (Glycine soja) soybean varieties consisting of different genetic backgrounds were employed in this study.
- the cultivated varieties Union (UN), Hark (HK) and Nebsoy (NS) are from the U.S.A.
- the other cultivated varieties Wenfeng 7 (WF), Tiefeng 8 (TF), Jindou 5 (JD5), Jindou 6 (JD6), Dandou 5 (DD), 85-140 and Zaoshu 6 (ZS) are from P.R.C.
- RNA was extracted from the leaves of NaCl-treated and control seedlings using a modified phenol/chloroform/isoamylalcohol (P:C:I 25:24:1, v/v) mediated extraction protocol (Jackson and Larkins, 1976).
- the CLONTECH PCR-SelectTM cDNA Subtraction Kit (Clontech K1804-1) was employed to construct the WF subtractive library. All procedures were performed according to the manufacturer's recommendations. The tester and driver cDNAs were originated from the leaves of NaCl-treated and control WF plants, respectively.
- GmRD22 One of the subtractive fragments (GmRD22) was identified as a RD22- ⁇ ike gene based on its high homology to other known RD22 and RD22- ⁇ ike genes (see Results).
- the cDNA sequence covering the intact coding region of GmRD22 was first obtained by 5' and 3 1 rapid amplification of cDNA ends (RACE) techniques using the SMARTTM RACE cDNA amplification Kit (Clontech K1811-1).
- RACE rapid amplification of cDNA ends
- the gene specific primers were as follows: GSPl (5'-GCTAGCGCGGTATATCGTCATTGTC); nested-GSP 1 (5'-
- CGTAACTTTTGCCCCTTCCGCTAATC CGTAACTTTTGCCCCTTCCGCTAATC.
- the gene specific primers were as follows: GSPl (5'-CCTGGGCGTTTAACCTTTCGAATAC) and nested-GSP 1 (5'- GGCTGTTCCTATCTACCGCTTCC).
- PCR Polymerase chain reaction
- GmRD22 The DNA sequence of GmRD22 was subsequently verified by direct sequencing of the PCR products generated from a WF cDNA preparation using primers flanking the full-length coding region of GmRD22 (5'-AGCTTTGCTTACAGTTCC and 5'-AAGTTATTCAAGMCAGG).
- RNA samples for the NaCl inducibility test were germinated and grown as described above. Gene expression was analyzed by Northern blot analysis using a standard procedure in a hybridization solution containing 50% formamide at 42°C (Sambrook and Russell, 2001). Unless otherwise indicated, 10 pg of total RNA was loaded onto each lane in Northern blot analysis. Single-stranded DIG (Digoxigenin)-labeled PCR products were used as probes (Finch et al., 1991). T3 and T7 primers (5 1 - AATTAACCCTCACTMAGGG and 5'-GTAATACGACTCACTATAGGGC) flanking the original subtractive GmRD22 clone were employed to generate probes for GmRD22.
- T3 and T7 primers (5'- AATTAACCCTCACTAAAGGG and 5'-GTAATACGACTCACTATAGGGC) flanking the original subtractive GmRD22 clone were employed to generate probes for GmRD22.
- transgenic rice lines The construction of transgenic rice is a joint effort with the China National Rice Institute.
- the transgene was cloned into the multiple cloning sites (MCS) of the double T-DNA binary vector pSB 130 driven by the ubiquitin promoter.
- MCS multiple cloning sites
- the Oryza sativa ssp japonica cultivar Nipponbare was used to induce callus for transformation.
- the constructs containing the target gene were transformed into calli by co-cultivation.
- the transformed calli after subsequent sub-culturing, were regenerate on regeneration medium with hygromycin as selective agent.
- the transformants were screened for presence of transgene by PCR using Genespecific primer.
- the transgenic lines were screened and raised until homozygous lines obtained. Northern blot analysis was performed to confirm expression of transgene.
- transgenic Arabidopsis lines The transgene was subcloned into the multiple cloning site (MCS) of the binary vector V7 (Brears, et ah, 1993) driven by the CaMV 35S constitutive promoter. The transformation was carried by Agrobacterium-mediated method aided with vacuum infiltration (Bechtold and Pelletier, 1993). The positive transformants were selected by kanamycin and the presence of transgene was confirmed by PCR using Gmi?D22-specific primers. The transgenic lines with single insertion locus were screened and propagated until homozygous lines were obtained. Northern blot analysis was performed to confirm the expression of transgene.
- SSH Suppression subtractive hybridization
- GmRD22 was a RD22-like gene due to the high homology of its gene product to other identified plant RD22 gene products, as well as some BURP domain-containing protein.
- BURP domain is a conserved domain found at the C-terminus of several plant proteins including RD22 proteins.
- the putative peptide of GmRD22 shares 66% identity (homology) to RD22-like protein from Vitis vinifera, 65% identity to dehydration-induced protein RD22-like protein from Gossypium hirsutum, and 63% to a BURP protein from Medicago truncatula.
- the full-length amino acid sequence of GmRD22 was aligned to identified RD22 proteins, including those from Arabidopsis, soybean, rice, tomato and Brassica napus.
- the BURP domain that found in other identified RD22 proteins is conserved in GmRD22 ( Figure 3).
- GmRD22 display differential expression between two soybean cultivars of contrasting salt-tolerance ability under salt, dehydration and ABA treatment
- WF salt-tolerant variety
- UN salt-sensitive variety
- Transgenic rice expressing GmRD22 were constructed. Northern blot analysis was performed to confirm the expression of GmRD22 and all transgenic lines tested showed expression of the transgene (Figure 8). After treated for a month, transgenic rice harboring GmRD22 or one other proprietary clone obtained in our lab still survived while most of the others (including the parental line Nipponbare) failed to sustain in such a harsh environment. The transgene conferred salt tolerance to rice in testing saline field and was found to be able to survive under 2% salt treatment (Figure 9). For drought stress experiment (Figure 10), the GmRD22 transgenic rice could recover by replenishing liquid medium after the removal for 16 hours. Under such conditions, the wild type could not survive.
- GmRD22 functioned in the adaptation to NaCl and dehydration stress.
- physiological drought is the immediate stress.
- the leaves drooped within 1 h and the stomatal conductance dropped to less than 50% of the baseline within 10 min after NaCl treatment (data not shown).
- a prominent induction of GmRD22 mRNA levels in leaves started to appear within 8 h after NaCl treatment ( Figure 5) when no significant accumulation OfNa + in leaves was established at this time.
- expression of GmRD22 remained at a high expression level ( Figure 5).
- GmRD22 showed a differential induction in the salt tolerance cultivar (WF) when compared to the salt sensitive (UN) one under both salinity stress and osmotic stress ( Figures 7a and 7b).
- Transgenic rice were used in to perform gain-of-function tests to investigate the possible application value of GmRD22 in stress-tolerance crops engineering.
- Transgenic rice expressing GmRD22 survived under 2% salt treatment (in form of sea water) ( Figures 8 and 9), whereas those not expressing GmRD22. This finding demonstrated that GmRD22 was able to protect the plant from salt and salt-induced dehydration stress.
- Transgenic rice and Arabidopsis thaliana were used to perform gain-of-function tests to investigate the possible application value of GmRD22 in stress-tolerance crops engineering.
- Transgenic rice expressing GmRD22 ( Figure 8) survived under 2% salt treatment (in form of sea water) in a field test ( Figure 9), but not for the untransformed parent.
- GmRD22 transgenic rice showed a higher recovery and survival rates under drought stress and salt stress ( Figures 10 and 11). Similar protection was also observed in transgenic Arabidopsis thaliana expressing GmRD22 ( Figure 12).
- Transgenic GmRD22 Arabidopsis thaliana exhibited a higher growth rate in root under drought stress when comparing to the untransformed wild type (Col-0) and the empty vector transgenic control (V7) ( Figure 13). These findings demonstrated that GmRD22 was able to protect the plant from salinity, salinity-induced dehydration, and drought stresses.
- GmRD22 showed that its physiological role was related to the adaptation to salinity, salinity-induced dehydration, and drought stresses.
- GmRD22 in rice and Arabidopsis thaliana provided definitive evidence that heterologous expression protects plants from salinity and drought stresses, suggesting that this clone can be used for salt tolerant and drought tolerant crop engineering.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Provided herein are protein and nucleic acid sequences of GmRD22. Further provided herein are methods for conferring abiotic stress tolerance to a plant cell or plant by introducing and expressing an isolated polynucleotide encoding a GmRD22 protein into the cells of the plant. Transgenic plants transformed with an isolated polynucleotide encoding a GmRD22 protein, as well as seeds and progeny derived from these plants, are also provided.
Description
GMRD22-LIKE GENES AND USE THEREOF TO PROTECT AGAINST
ABIOTIC STRESS
TECHNICAL FIELD
[0001] This invention relates to agricultural biotechnology. More specifically, this invention relates to a novel gene and its homologs that enhance tolerance to abiotic stresses and uses thereof, particularly in producing transgenic plants, seeds, and progeny thereof that are substantially tolerant of abiotic stress.
BACKGROUND ART
[0002] Yield enhancement to increase crop production is one of the essential strategies to meet the demand for food by our continually growing populations. Abiotic stress limits crop production significantly by, e.g., reducing overall crop yield or decreasing crop quality. Abiotic stresses are environmental factors such as drought, salt, extreme temperatures and high winds. While many agricultural practices are designed to optimize crop growth by reducing or avoiding such abiotic stresses, improvements are still needed.
[0003] Soybean, one of the most important cash crops, is classified as a moderately NaCl-tolerant plant (Maas & Hoffman, 1977). Understanding the NaCl tolerance mechanism in this crop plant may ultimately help improve its yield on saline lands, and the NaCl tolerance conferring genes in soybean may also be applicable to crops that are more sensitive to NaCl (e.g., carrot, orange and rice). Salinity (such as accumulation of NaCl) is a severe abiotic environmental stress affecting plant growth. The adverse effects are multifaceted and include ionic stress, physiological drought, specific ion toxicity, and salt-induced oxidative stress. Salt stress and dehydration stress
are long thought to be closely associated since accumulation of salt (mainly NaCl) presents in external environment will lead to a drop of external water potential, which then become lower than that of the water potential in the plant cells. As a result, the net water flow will be from interior of the plant cell to its exterior. This leads to osmotic desiccation (Ashraf, 1994), also known as physiological drought in plants (Jain, et al., 1997).
[0004] RD22, first discovered in Arabidopsis, is induced by salt stress, but not by cold or heat stress (Yamaguchi-Shinozaki and Shinozaki, 1993). It was found that the plant hormone abscisic acid (ABA) is crucial for the induction of RD22 under dehydration and salt stress, although RD22 lacks the ABA-responsive element (ABRE) (Xiong, et al., 2001). It appears that dehydration triggers the production of ABA, in turns induces expression of various genes, cis and trans-acting factors. Based on the current model for RD22 induction proposed by Abe, H. and associates (1997), under osmotic stresses (including salt and dehydration stress), ABA is synthesized and triggers the production of RD22BP1 and ATMYB2 proteins, which act as transcriptional activators to bind to the MYC and MYB sites locating on a 67bp fragment of the RD22 promoter, and hence activates the expression of RD22. However, while the regulation of gene expression of RD22 related to dehydration and salt stress are well studied, its precise role in plant adaptation to salt and dehydration stress remains unknown.
[0005] In summary, while gene expression has been correlated to abiotic stresses, a demonstrated ability of such genes to confer tolerance or resistance to such stresses is still lacking. Identification of genes having the ability to significantly alter tolerance to abiotic stress would represent a significant advance for genetic engineering of crops and other plants.
SUMMARY OF THE INVENTION
[0006] A novel clone impacting tolerance to abiotic stresses, GmRD22, and its related protein, is provided herein. Using suppression subtractive techniques (Diatchenko et al., 1998), provided herein is a novel RD22 clone (GmRD22) originally identified from salt-stress soybeans. The salt and osmotic stress inducibility combined with its protective effect in transgenic rice and Arabidopsis thaliana expressing GmRD22 under salt stress suggest that GmRD22 plays a key role in plant adaptive mechanism towards salt and osmotic (and dehydration) stresses. Therefore, GmRD22 and related proteins are useful for genetically engineering crops to improve or confer salt and dehydration (or drought) stress tolerance.
[0007] More specifically, provided herein is an isolated polynucleotide sequence comprising a nucleotide sequence of SEQ ID NO: 1 and complementary sequences thereof. Also provided is an isolated polynucleotide sequence comprising a nucleotide sequence of at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to a nucleic acid sequence of SEQ ID NO: 1, and complementary sequences thereof.
[0008] Further provided is a recombinant nucleic acid construct comprising the polynucleotide sequence encoding GmRD22 protein or a GmRD22-like protein, or any one of the polynucleotide sequences provided herein, wherein the polynucleotide is operably linked to control sequences operable to effect a detectable expression in plant cells. In some embodiments, the expression of the heterologous polynucleotide is high. Typically, the control sequences are heterologous to the polynucleotide sequence of the present invention. In some embodiments, the control sequences further effect insertion of the recombinant nucleic acid construct of the present invention into host cell chromosomal DNA.
[0009] Hosts cell comprising the recombinant nucleic acid construct are provided. In one embodiment, the host cell is a plant cell. Transgenic plants or plant parts or plant cells comprising GmRD22 protein or a GmRD22-like protein, or the polynucleotide sequence, the recombinant nucleic acid construct provided herein are also contemplated.
[0010] Provided herein is a substantially pure polypeptide having the amino acid sequence of SEQ ID NO:2, a substantially pure polypeptide having of at least 80%, at least 85%, at least 90%, at least 95%,or at least 99% sequence identity to an amino acid sequence of SEQ ID NO:2, or isolated polypeptides encoded by any one of the polynucleotides provided herein.
[0011] Provided herein is a method for producing the polypeptide comprising growing a host cell under conditions which allow and/or induce the expression of the heterologous polynucleotide and isolating the polypeptide encoded by the polynucleotide.
[0012] Provided herein is a method for protecting plants or plant cells from abiotic stress by inducing or increasing tolerance to abiotic stress comprising modifying said plants or plant cells to express a GmRD22 protein, wherein the GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 2, or a polypeptide encoded by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the method provided herein comprises modifying said plants or plant cells to contain an expression vector comprising a polynucleotide sequence encoding a heterologous GmRD22 protein and operably linked to control sequences operable in plant cells. In other embodiments, the GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 2, or a polypeptide encoded
by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1. The abiotic stress can be salinity stress or drought.
[0013] Provided herein is a method for selecting for successfully transformed plant cells or plants, in which the method comprises applying abiotic stress to plant cells or plants subjected to a transformation with a recombinant nucleic acid construct of the present invention as a selectable marker, whereby cells that have increased resistance or tolerance to the abiotic stress are selected.
[0014] Provided herein is use of a nucleic acid sequence of GmRD22 or a protein encoded by the nucleic acid sequence in water saving agricultural practice. Such water saving agricultural practice can be used by itself or in combination with other prior art water saving agricultural practices for the enhancement of agriculture in saline lands and arid/semi-arid regions. Accordingly, a method for reducing water usage in agriculture is provided herein, in which the method comprises transforming and expressing the polynucleotide or the construct of the present invention in a plant or a part thereof.
[0015] Provided herein is a plant or plant part expressing a GmRD22 protein, or produced by the methods of the present invention, wherein the GmRD22 protein is a polypeptide having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ED NO: 2, or encoded by a polynucleotide sequence having of at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ DD NO: 1.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 shows the sequence of GmRD22, in which panel A shows a Nucleotide Sequence (SEQ ID NO: 1); and panel B show an Amino acid sequence (SEQ
ID NO: 2) thereof .
[0017] Figure 2 shows the effect of NaCl on the expression of GmRD22 in various cultivated (G.max) (panel A) and wild (G. soja) (panel B) soybean varieties. + and - indicate plants with and without NaCl treatment, respectively.
[0018] Figure 3 shows the alignment of GmRD22 to other RD22 or BURP-domain containing proteins, in which amino acid residues in bold indicates the BURP-domain conserved among RD22-like proteins. Except for GmRD22, the first two letters of each protein label represent the abbreviated species name, followed by GenBank accession number, in which At represents: Arabidopsis thaliana; Bn represents Brassica napus; Gm represents Glycine max; Le represents Lycopersicon esculentum; Os represents Oryza sativa.
[0019] Figure 4 shows the phylogenetic analysis of RD22 proteins and other BURP domain-containing proteins. Except for GmRD22, the first two letters of each protein label represent the abbreviated species name, followed by GenBank accession number. At represents Arabidopsis thaliana.; Bn represents Brαssicα nαpus; Gm represents Glycine max; Le represents Lycopersicon esculentum; Os represents Oryza saliva; Pp represents Prunus persica; Vr represents Vigna radiate; Vv represents Vitis vinifera.
[0020] Figure 5 shows the expression of GmRD22 in soybean leaves under NaCl stress. Ethidium bromide staining of rRNA was used as a loading reference for RNA samples.
[0021] Figure 6 shows a Northern blot analysis of GmRD22 under salt and PEG treatment, in which CT represents control, NaCl represents 125mM NaCl treatment for 48 hr; PEG represents 5% PEG treatment for 48 hr, which mimic the effect of dehydration.
[0022] Figure 7 shows differential expression pattern of GmRD22 among 2 soybean cultivars with contrasting salt tolerance ability under: salt stress (panel (a)) and osmotic stress (panel (b)), in which WF represents the salt tolerant cultivar Wenfeng 7; UN represents the salt sensitive cultivar Union.
[0023] Figure 8 shows the expression of GmRD22 in transgenic rice using Northern blot analysis. All 3 independent transgenic lines show expression of GmRD22 while the untransformed parent gives no signal.
[0024] Figure 9 shows a field test of GmRD22 transgenic rice.
[0025] Figure 10 shows the performance of several homozygous GmRD22 transgenic rice lines and the untransformed wild type under: drought stress (panel (a)) and (b) salinity stress (panel (b)), in which WT represents wild type; 137, 141, 153 represent GmRD22 transgenic lines. The seedlings without label are transgenic rice expressing another proprietary clone (also confers salt and drought tolerance) obtained in our lab.
[0026] Figure 11 shows the survival rates of GmRD22 transgenic rice and the untransformed wild type under: drought stress (panel (a)) and salinity stress (panel Qa)), in which WT represents wild type; 137, 141, 153 represent GmRD22 transgenic lines. The GmRD22 transgenic rice exhibits higher survival rate than the untransformed wild type.
[0027] Figure 12 shows the expression of GmRD22 in transgenic Arabidopsis thaliana using Northern blot analysis, in which CoI-O represents wild type parent; V7 represents an empty vector transgenic control. 1-1-2, 2-2-7, 4-4-1 represents three independent GmRD22 transgenic lines. Strong signals can be seen in all independent transgenic lines. The very faint signals in CoI-O and V7 are probably due to the endogenous Arabidopsis RD22 transcripts.
[0028] Figure 13 shows the effects of osmotic stress on root growth of GmRD22 transgenic Arabidopsis thaliana. The percentage of root growth after treated with 20% PEG is compared among the wild type Col-0, the empty vector transgenic control (V7) and two independent GmRD22 transgenic lines (4-4-1 and 1-1-2). Y-axis on the left and right of the graph indicates the % root growth of untreated (bar) and stressed (line) plants, respectively. Error bar is standard error and N= 16. Data obtained are analyzed by one-way analysis of variance (one-way ANOVA) followed by the Tukey's test. ** indicates that the mean difference (compared to wild type) is significant at p<0.01 level.
Detailed Descriptions of the Invention Definitions
[0029] The following definitions are set forth to facilitate explanation of the invention. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as they would to one of ordinary skill in the art of the present invention.
[0030] The terms "polynucleotide" and "nucleic acid" are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties. In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
[0031] The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally occurring amino acid, for example selenocysteine (Bock et al. (1991) Trends Biochem. Sci. 16:463-467; Nasim et al. (2000) J. Biol. Chem. 275:14,846-14,852) and the like.
[0032] As used herein, "sequence identity" means the percentage of identical subunits at corresponding positions in two sequences when the two sequences are aligned to maximize subunit matching, i.e., taking into account gaps and insertions. When a subunit position in both of the two sequences is occupied by the same monomelic subunit, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then the molecules are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity. Preferably, the length of the compared sequences is at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 100 nucleotides. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705).
[0033] As used herein, an "isolated" or "purified" protein, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, (by dry weight) of non-GmRD22 protein. When the GmRD22 protein or a
biologically active portion thereof is recombinantly produced, the culture medium typically represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of-interest chemicals. The term "isolated", as used in the context of a nucleic acid or polypeptide, indicates that the nucleic acid or polypeptide exists apart from its native environment and is not a product of nature. An isolated nucleic acid or polypeptide can exist in a purified form or can exist in a non-native environment such as a transgenic host cell.
[0034] The term "abiotic stress" as used herein refers to nonliving environmental factors that exert a disadvantageous influence on plants or plant cells. In most cases, stress is measured in relation to plant survival, crop yield, growth (biomass accumulation), or the primary assimilation processes (CO2 and mineral uptake), which are related to overall growth. Examples of abiotic stresses include, but are not limited to, salinity, dehydration, oxidative stress, and extreme cold or heat. Salinity stress means that the growth substratum (including but not limited to soil and hydroponic systems) contains salts (including but not limited to NaCl, MgSO4, NaSO4, NaHCO3, Na2CO3, MgCO3) at levels that limit the growth of target plants. Osmotic stress means that the growth substratum contains substances (including but not limited salts) that will decrease water potential in the growth substratum. Dehydration stress means that the growth substratum contains water less than that required for optimal growth of target plants.
[0035] The term "higher plants" refers to plants with vascular systems, i.e. vascular plants. Specifically, higher plants include those of Pteridophyta, Gymnosperms, and Angiosperms.
[0036] The term "heterologous" means that things are of different origins, such as different species, different tissues or different genes. For example, a GmRD22 protein from soybean is considered heterologous to Arabidopsis. "Heterologous nucleic
acid sequences" also refers to those that are not contiguous to each other in nature. For example, a promoter and a coding sequence to which it is operably linked are heterologous when they are derived from different species or genes.
[0037] The term "exdogenous" as used herein means that a protein or a nucleic acid sequence is utilized in an organism other than the one from which it originated.
[0038] The terms "promoter" and "control sequences" as used herein refer to a regulator region a short distance from the 5' end of a gene that acts as the binding site for RNA polymerase. Such sequences have the functions of directing or regulating the transcription of nucleic acid sequences immediately downstream of them. There are various types of promoters, including constitutive promoters, tissue-specific promoters, inducible promoters and those triggered by specific physiological conditions, such as dehydration. The examples of promoters could be used in the present invention include, but are not limited to, CaMV 35S, Ubi, SAG12 promoter, and the like. More suitable promoters can be found in the PlantProm database (Shahmuradov et al, Nucleic Acids Research, 2003, Vol. 31, No. 1 114-117).
[0039] The term "operably linked" as used herein refers to that a promoter is positioned relative to a polypeptide-encoding polynucleotide in such a manner that the polynucleotide is, under the control of the regulatory nucleic acids, transcribed and optionally the polypeptide is translated.
[0040] The phase "operable in plant cells" as used herein means that a promoter or control sequence is capable of performing its normal function of directing and/or regulating expression of coding sequences immediately downstream to it in a plant cell, wherein the plant cell can be a part of a living plant or in cell culture.
[0041] The terms "selectable marker" and "selection marker" interchangeably
refer to a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can 'select' based on resistance or tolerance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells, including abiotic stresses). A screenable marker gene (or reporter gene) confers a trait or a phenotype that one can identify through observation or testing, i.e., by 'screening' (e.g. .beta.-glucuronidase, luciferase, or other enzyme activity not present in untransformed cells).
[0042] The term "expression cassette" as used herein refers to a nucleic acid sequence, particularly a DNA sequence harboring a gene and a control sequence to which said gene are operably linked. By using various control sequences the expression pattern and level of the gene can be regulated. One or more expression cassettes can be inserted into a construct or a transformation vector of the invention which in turn is introduced into a desired host so that the gene is expressed therein.
Embodiments of Carrying Out the Invention
[0043] It will be understood that this invention is not limited to the particular methodology, protocol, and reagents described, as these may vary.
[0044] All publications cited herein are expressly incorporated herein by reference for the purpose of describing and disclosing compositions and methodologies which might be used in connection with the invention.
[0045] In the present invention, it has been demonstrated that GmRD22 or a GmRD22-like protein expression successfully confers abiotic stress tolerance or resistance to plant cells and plants when heterologously expressed, particularly tolerance or resistance to salinity and dehydration. This is illustrated below in rice and Arabidopsis
thaliana, but is by no means limited to this example. Thus, provided herein is the novel gene GmRD22, nucleic acid sequence of SEQ ID NO: 1 or with at least 80% sequence identity to SEQ ID NO: 1, and complementary sequences thereof. Also provided is the amino acid sequence of GmRD22 of SEQ ID NO:2 as well as amino acid sequences with at least 80% sequence identity to SEQ ID NO:2. The polynucleotide of GmRDH may be provided in an integration vector or an expression vector in combination with various promoter to achieve expression of the coding region in a suitable host plant or plant cell.
[0046] In one aspect, the invention provides an isolated or substantially purified polynucleotide having a nucleic acid sequence of SEQ ID NO: 1 or a sequence substantially similar thereto. In another aspect, the invention also provides an isolated polynucleotide encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2 or a sequence substantially similar thereto. A preferred polynucleotide of the invention is the native GmRDH polynucleotide shown in Figure Ia (SEQ ID NO: 1) which encodes the native GmRD22 protein shown in Figure Ib (SEQ ID NO: T). As native GmRDH polynucleotide is discovered in a soybean cDNA library, the polynucleotide of the present invention can be obtained from soybean plants (e.g., Glycine max var. Wenfeng
7).
[0047] The polynucleotide of the present invention may be in the form of RNA or in the form of DNA (e.g., cDNA, genomic DNA, and synthetic DNA). The DNA may be circular or linear, double-stranded or single-stranded, and if single-stranded may be the coding (sense) strand or non-coding (anti-sense) strand.
[0048] The polynucleotide which encodes native GmRD22 protein may be identical to the nucleotide sequence shown in Figure Ia (SEQ ID NO: 1). It may also be a different polynucleotide which, as a result of the redundancy or degeneracy of the genetic code, encodes the same polypeptide as the polynucleotide of SEQ ID NO. 1 does. Other
polynucleotide molecules within the invention are variants of GmRD22 polynucleotide such as those that encode fragments, analogs and derivatives of native GmRD22 protein. Such variants may be, e.g., a naturally occurring allelic variant of native GmRD22, a homolog of native GmRD22, or a non-naturally occurring variant of native GmRD22. These variants have a nucleotide sequence that differs from native GmRD22 polynucleotide in one or more bases. For example, the nucleotide sequence of such variants can feature a deletion, addition, or substitution of one or more nucleotides of a native GmRD22. Preferably, these changes are silent or conservative nucleotide changes.
[0049] Fragments and variants of the disclosed polynucleotides or nucleotide sequences are contemplated. Fragments and variants of proteins encoded by the disclosed nucleotide sequences are also provided herein. A fragment is a portion of the nucleotide sequence or a portion of the amino acid sequence. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein and hence induce or increase tolerance to abiotic stress by retaining at least one GmRD22 activity. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes generally do not encode fragment proteins retaining biological activity. Thus, fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence encoding the proteins provided herein.
[0050] A fragment of a GmRD22 nucleotide sequence that encodes a biologically active portion of a GmRD22 protein of the invention will encode at least 12, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 125, 135, 150, 165, 175, 185, 200, 215, 225, 235, 250, 260, 275, 285, 300, 315, 325, 335, or 340 contiguous amino acids, or up to the total number of amino acids present in a full-length GmRD22 protein of the invention (for example, 343 amino acids for SEQ ID NO:2).
[0051] Thus, the polynucleotide sequences provided herein include both the naturally occurring sequences as well as variant forms. Likewise, the GmRD22 proteins provided herein encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess at least one of the desired GmRD22-like activities. The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by either an enhanced tolerance to stress when expression of the GmRD22 protein sequence is induced or increased. For example, the activity may be evaluated as an increase in tolerance to hypersalinity in the plant expressing the heterologous GmRD22 protein using the assay described herein.
[0052] The GmRDH polynucleotide sequences provided herein can be used to isolate corresponding sequences from other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. By "orthologs" is intended genes derived from a common ancestral gene and which are found in different species as a result of speciation. Functions of orthologs are often highly conserved among species. Thus, isolated sequences that encode a GmRD22 protein and which that hybridize under stringent conditions to the GmRD22 sequences disclosed herein,nucleic acid of SEQ ID NO: 1 or to fragments thereof,the complement of SEQ ID NO: 1 are also provided.
[0053] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P, or any other detectable marker.
[0054] Nucleic acids that hybridize under stringent conditions to the nucleic acid of SEQ ID NO: 1 or the complement of SEQ ID NO: 1 are also within the invention. For example, such nucleic acids can be those that hybridize to SEQ ID NO: 1 or the complement of SEQ ID NO: 1 under stringent conditions low stringency conditions, moderate stringency conditions, or high stringency conditions are within the invention. Preferred such nucleotide acids are those having a nucleotide sequence that is the complement of all or a portion of SEQ ID NO: 1. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O0C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O0C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at 370C, and a wash in IX. to 2XSSC (20XSSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 370C, and a wash in 0.5X to IXSSC at 55 to 6O0C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 370C, and a wash in 0.1 XSSC at 60 to 650C. Optionally, wash buffers may comprise
about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
[0055] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA--DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267 284: Tm=81.5°C+16.6 (log M)+0.41 (% GQ-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The ,Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 1O0C. Generally, stringent conditions are selected to be about 50C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 40C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 1O0C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 200C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than
450C (aqueous solution) or 32°C (formamide solution), the SSC concentration may be increased so that a higher temperature can be used.
[0056] hi general, polynucleotide sequences that encode a GmRD22 protein or a biologically active portion thereof and which hybridize to the GmRD22 sequences disclosed herein will have a sequence identity from about 40% to 50% identical, about 60% to 70% or 75%, and even about 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or higher to SEQ ID NO:1, so that the sequences may differ by only one nucleic acid or one amino acid when translated.
[0057] Fragments of a GmRD22 nucleotide sequence that are useful as hybridization probes or PCR primers generally need not encode a biologically active portion of a GmRD22 protein. Nucleic acid molecules that are fragments of a GmRD22 nucleotide sequence comprise at least 16, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, or 1025 nucleotides, or up to the number of nucleotides present in a full-length GmRD22 nucleotide sequence disclosed herein.
[0058] Other variants of GmRD22 within the invention are polynucleotides that share at least 70% (e.g., 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99%) sequence identity to SEQ ID NO: 1 or the complement of SEQ ID NO: 1. Nucleic acids that hybridize under stringent conditions to or share at least 70% sequence identity with SEQ ID NO: 1 or the complement of SEQ ID NO: 1 can be obtained by techniques known in the art such as by making mutations in native GmRD22, by isolation from an organism expressing such a nucleic acid (e.g., a soybean plant expressing a variant of native GmRD22), or a non-soybean plant (e.g., a rice plant) expressing a homolog of native GmRD22.
[0059] Also provided herein is an isolated polypeptide having an amino acid
sequence of SEQ ID NO: 2 or a sequence substantially similar thereto. By "substantially similar" is meant that the polypeptide has at least 70%, 80%, 85%, 90%, 95% or higher sequence identity to SEQ ID NO: 2. Preferably, these GmRD22 protein variants feature amino acid changes that enable them to retain the GmRD22 function. The GmRD22 protein variants can be naturally occurring such as those encoded by GmRD22 homologs. They can also be synthetic proteins such as a fusion protein or those modified for a higher expression level in a host cell.
[0060] A variant GmRD22 protein is a protein derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein as shown in, e.g., SEQ ID NO:2. Variant proteins typically are biologically active, that is, they continue to possess at least one desired biological activity of the full length GmRD22 protein. Such variants may result from, for example, genetic polymorphism or from human manipulation using recombinant molecular biology methods. Biologically active variants of a GmRD22 native protein of the invention will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs using default parameters. A biologically active variant of a protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
[0061] The GmRD22 proteins provided herein may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for
such manipulations are generally known in the art. For example, amino acid sequence variants of the GmRD22 proteins can be prepared by mutations in the DNA. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1979) ATLAS OF PROTEIN SEQUENCE AND STRUCTURE (Natl. Biomed. Res. Found., Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be made.
[0062] The present invention also provide a method of producing GmRD22 protein and variants thereof, a method of protecting plants or plant cells from abiotic stress and a method for selecting for successfully transformed plant cells or plants, all of which involving transformation of a plant or a plant cell.
[0063] Any higher plant or cell of a higher plant that is important or of interest for agriculture, horticulture, energy industry, biomass for bioconversion and/or forestry is a suitable subject for the present methods including but not limited to tobacco, corn, lettuce, oilseed rape, sugar beet, potatoes, tomatoes, cucumbers, peppers, beans, peas, citrus fruits, avocados, peaches, apples, pears, berries, plumbs, melons, eggplants, cotton, soybean, sunflowers, roses, poinsettia, petunia, guayule, cabbages, spinach, alfalfa, artichokes, corn, wheat, rice, rye, barley, grasses such as switch grass or turf grass, millet, hemp, bananas, poplars, eucalyptus trees, conifer, ornamental (e.g., larger flowers, larger leaves) and legume plants. Accordingly, provided herein also is a plant or cells of a higher plant produced by the methods of the present invention.
[0064] Such plants can have no endogenous GmRD22 expression or endogenously express GmRD22 protein. Thus, the cells of the transformed plant may comprise a native GmRD22 polynuleotide and a recombinant nucleic acid construct encoding an exogenous or heterologous GmRD22 protein or only a recombinant nucleic
acid construct encoding a heterologous GmRD22 protein. Heterologous nucleic acids are those nucleic acids from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced. The heterologous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA). In addition, the heterologous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand.
[0065] Any suitable expression vector system or construct may be employed to modify a susceptible plant cell to contain and express a GmRD22 encoding-polynucleotide. For example, plant cells can be modified to contain nucleotide sequences encoding the relevant protein, optionally operably linked to control sequences operable in plants, or integrated into the genome so as to be expressed under the control of endogenous control sequences.
[0066] The operably linked sequences are those with a functional linkage between a promoter or promoter-like sequence and a second sequence, wherein the promoter or promoter-like sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.
[0067] The expression vector system may include in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a GmRD22 DNA sequence as provided herein, and a transcriptional and translational termination region functional in plants. The transcriptional initiation region, the promoter, may be native or heterologous to the plant host. Additionally, the promoter may be an isolated sequence or alternatively a synthetic or recombinant sequence.
[0068] Recombinant nucleic acid constructs may contain control sequences operable in plants operably linked to the GmRD22 protein-encoding sequence, which control sequences that result in transient, constitutive or inducible expression. Expression can be tissue-specific or tissue non-specific. In the present invention, the terms "construct" and "vector" may be alternately used.
[0069] hi some embodiments, a promoter or a fragment of a promoter either alone or in combination with other sequences to create synthetic promoter constructs. In such embodiments, the fragments confer desired properties on the synthetic promoter construct, such as conferring increased transcription of operably linked sequences in response to drought stress or hypersalinity..
[0070] Where appropriate, the GmRD22 polynucleotide(s) may be optimized for increased expression in the transformed plant. That is, the genes can be synthesized using plant-preferred codons for improved expression. Methods are available in the art for synthesizing plant-preferred genes. See, e.g., U.S. Pat. Nos. 5,380,831, and 5,436,391.
[0071] A wide variety of such control sequences is available in the art, and appropriate vectors for genetic modification are also well known and, indeed, commercially available. The recombinant nucleic acid construct can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and/or stability (e.g., of mRNA). Such elements can be included in the recombinant nucleic acid construct to obtain optimal integration and/or expression of the nucleic acid.
[0072] In some embodiments of the invention, a polynucleotide encoding the GmRD22 protein is placed in operable linkage with a stress-inducible promoter and
stably integrated into the genome of a suitable host such as rice. Other embodiments include the operable linkage of GmRD22 with developmentally controlled promoters or tissue-specific promoters. Such promoters include leaf-specific, root-specific or seed-specific promoters.
[0073] In other embodiments of the invention, a polynucleotide encoding the GmRD22 protein is placed in operable linkage with a chemically-inducible promoter and stably integrated into the genome of or stably expressed in a suitable host plant. In these embodiments, plants which have been subjected to or are at risk for abiotic stress may be treated with the appropriate chemical in order to induce expression of the GmRD22 protein, thereby ameliorating the effect of the stress on the plant and improving crop yield. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters such as the glucocorticoid-inducible promoter and tetracycline-inducible and tetracycline-repressible promoters.
[0074] In one embodiment of the invention, the binary systems derived from the Ti plasmid of Agrobacteria are particular suitable for the present invention. A binary system typically includes two vectors of different sizes. The larger vector is a helper vector containing the necessary genes for integration of the T-DNA carried on the smaller vector into the genome of a plant cell. The smaller vector, usually called as a binary vector, carries the gene to be inserted or cloned. Typically, the helper vector has been transformed to a suitable Agrobacterium strain in advance. Many of such Agrobacterium strains are well known in the art, such as LBA4404, GV3101, EHAlOl, EHA105, ABI,
and the like (Plant Molecular Biology Manual. Ed. S. B. Gelvin and R. A. Schilperoort, 2nd Edition. Springer, 1994). Similarly, there are many binary vectors available for practicing the invention, such as pBR322, pUC series, pBI series, pMON series, pCambia series, pGreen series, and the like. The choice of the binary vectors will depend on the plant species to be transformed. For example, LBA4404 is suitable for transforming a dicot, while EHA 105 should be chosen for a monocot. Knowledge about choosing suitable vectors is within the ability of one of ordinary skill in the art and can be found, for example, in Plant Molecular Biology Manual. Ed. S. B. Gelvin and R. A. Schilperoort, 2nd Edition. Springer, 1994.
[0075] Techniques for effecting genetic modification of plant cells and reconstituting intact plants are well known in the art. See, e.g., Sambrook et al., MOLECULACRL ONINGA: LABORATORMYA NUAL Cold Spring Harbor, N. Y. (1989); Gelvin et al., PLANT MOLECULAR BIOLOGY ANNUAL(1990)); Dashek, METHODS IN PLANT BIOCHEMISTRY AND MOLECULAR BIOLOGY(CRC Press 1997). In one embodiment, the promoter can be a 35s CaMV, rice actin promoter, ubiquitin promoter, or nopaline synthase (NOS) promoter. A useful summary of the state of the art in this regard, including a reasonably comprehensive list of the types of plants and plant cells that can be used as the subjects of the present invention is found in U.S. Patent Publication 2004/0009476, published 14 January 2004, incorporated herein by reference with respect to its disclosure of appropriate techniques for genetic manipulation of plants and the range of plants and plant cells to which these techniques may be applied.
[0076] In some embodiments, the expression system or recombinant nucleic acid construct may comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or
tissues, and any suitable marker gene can be employed. Marker genes include, include but are not limited to genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). In other embodiments, GmRD22 can act as a selectable marker.
[0077] Once transformed plant cells exhibiting tolerance are obtained, transgenic plants can then be regenerated therefrom, and evaluated for stability of the inheritance of the resistance or tolerance trait, that is, whether the resistance or tolerance trait is transmitted to progeny. Thus, provided is a transformed plant that is substantially tolerant or resistant to abiotic stress, particularly salt and drought stress or dehydration stress. For example, the plant can survive and/or thrive in the presence of one or more abiotic stresses. The cells of the transformed plant may comprise a native GmRD22 polynucleotide and a recombinant nucleic acid construct encoding a heterologous GmRD22 protein or only a recombinant nucleic acid construct encoding a heterologous GmRD22 protein.
[0078] The transmission of abiotic stress tolerant trait can be evaluated at a molecular level, e.g., Southern or Northern blot analysis, PCR-based methodologies, or the biochemical or immunological detection of GmRD22, or by phenotypic analyses, i.e., whether transformed progeny can grow in the presence of salt or drought (or dehydration) that inhibits the growth of an untransformed plant. Also provided is a transformed plant seed and other progeny arising from the transformed plant.
[0079] Further, because the modified cells and plants of the invention are tolerant to stress caused by dehydration and/or salinity stress, an expression cassette comprising a nucleotide sequence encoding the GmRD22 containing protein operably
linked to control sequences operable in plants can be used as a selectable marker for successful transformation of cells. Successful transformants are more highly resistant and survive an applied stress for which the marker confers tolerance. Hence, successful transformants can be identified by virtue of their ability to survive and/or thrive under such stress conditions. These stress tolerant "cell lines" can be sub-cultured several times to remove non-tolerant cells.
[0080] Generating transgenic crops harboring GmRD22 or a homolog thereof as a water saving agricultural plant or a part thereof can be used in a water saving agricultural practice. The plant or a part thereof of the present invention can also be used in a yield enhancement to increase crop production.
[0081] The GmRD22 transgenic plants, progeny and seeds provided herein also may be employed alone or in combination with other water conserving agricultural practices to reduce or limit the usage of water while maintaining crop yield and quality. For example, the crop plant can be co-transferred with GmRD22 and another stress-related gene such as GmPAPi to be conferred more tolerance to drought.
[0082] In particular, these plants, progeny and seeds are particularly useful in saline lands and arid/semi-arid regions as the induced or increased tolerance to abiotic stressors will permit these transgenic plants to thrive in lands otherwise unusable or undesirable for agricultural development.
[0083] The following examples are offered to illustrate but not to limit the invention.
EXAMPLES
Materials and Methods
[0084] Plant materials. Ten cultivated (Glycine max L. Merr.) and ten wild
(Glycine soja) soybean varieties consisting of different genetic backgrounds were employed in this study. The cultivated varieties Union (UN), Hark (HK) and Nebsoy (NS) are from the U.S.A. The other cultivated varieties Wenfeng 7 (WF), Tiefeng 8 (TF), Jindou 5 (JD5), Jindou 6 (JD6), Dandou 5 (DD), 85-140 and Zaoshu 6 (ZS) are from P.R.C. All wild soybean varieties including: Beijing 4 (BJ), Donggou 16 (DG), Wuhai 4 (WH), Yinjin3 (YJ), Mengjin 1 (MJ), Jidong 5 (JO), Fengcheng 20 (FC), Jixian 11 (JX), Kaiyuan 21 (KY) and Shuangcheng 4 (SC) are originated from P.R.C. The rice transformation parent was Oryza sativa, sub-species japonica, variety Nipponbare. The Arabidopsis thaliana transformation parent was the ecotype Col-0.
[0085] Molecular cloning, phylogenetic analysis, and gene expression study of a RD22-like gene from soybean. To prepare samples for the construction of the subtractive library, seeds of the variety Wenfeng 7 (WF) were germinated and grown in perforated plastic pots filled with thoroughly washed silicon sand and irrigated with modified Hoagland's nutrient solution (Hoagland and Arnon, 1938) for 14 days before treated with 0.3% (w/v) NaCl in 3-day intervals. The salt treatment was then gradually increased to 0.6%, 0.9%, 1.2%, and finally to 1.5% (w/v) NaCl for 3 days, total RNA was extracted from the leaves of NaCl-treated and control seedlings using a modified phenol/chloroform/isoamylalcohol (P:C:I=25:24:1, v/v) mediated extraction protocol (Jackson and Larkins, 1976). The CLONTECH PCR-Select™ cDNA Subtraction Kit (Clontech K1804-1) was employed to construct the WF subtractive library. All procedures were performed according to the manufacturer's recommendations. The tester and driver cDNAs were originated from the leaves of NaCl-treated and control WF plants, respectively. Selected subtractive fragments were cloned into the pBluescript II KS (+) by the T-A cloning method (Sarnbrook and Russell, 2001). The ligation products were then transformed into the Escherichia coli strain DH5α by the CaCl2 method (Sambrook y
and Russell, 2001). The cDNA clone in each successful transformant was sequenced using the ABI PRISM™ dRhodamine Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer 402078). Prepared sequencing samples were applied to the Genetic Analyzer ABI prism 310 to resolve the cycle sequencing product. All sequencing data were analyzed by Blastn, Blastx and PSI-Blast programs provided on the National Center for Biotechnology Information website. One of the subtractive fragments (GmRD22) was identified as a RD22-\ike gene based on its high homology to other known RD22 and RD22-\ike genes (see Results). The cDNA sequence covering the intact coding region of GmRD22 was first obtained by 5' and 31 rapid amplification of cDNA ends (RACE) techniques using the SMART™ RACE cDNA amplification Kit (Clontech K1811-1). For 5'RACE, the gene specific primers were as follows: GSPl (5'-GCTAGCGCGGTATATCGTCATTGTC); nested-GSP 1 (5'-
CCGCTTTTCGACAATCCTTCCTATC); and nested-GSP2 (5'-
CGTAACTTTTGCCCCTTCCGCTAATC). For 3'RACE, the gene specific primers were as follows: GSPl (5'-CCTGGGCGTTTAACCTTTCGAATAC) and nested-GSP 1 (5'- GGCTGTTCCTATCTACCGCTTCC). Touch-down polymerase chain reaction (PCR) reactions for RACE were performed according to the manufacturer's instruction with modification in the annealing temperatures as follows: amplification with 5' and 3' GSPl (700C, 68°C and 66°C for 1st, 2nd, and 3rd round PCR, respectively); reamplification with 5' nested-GSP 1, 5' nested-GSP2 and 3'nested-GSPl (700C and 67°C for 1st and 2nd round PCR, respectively). The DNA sequence of GmRD22 was subsequently verified by direct sequencing of the PCR products generated from a WF cDNA preparation using primers flanking the full-length coding region of GmRD22 (5'-AGCTTTGCTTACAGTTCC and 5'-AAGTTATTCAAGMCAGG).
[0086] Phylogenetic relationships of GmRD22 with other RD22-like
proteins/BURP domain containing proteins were analyzed. Multiple sequence alignment was performed using the ClustalW program (Thompson et al., 1994). The bootstrap value was calculated and the phylogenetic tree was built using the MEGA program (version 2.1) (Kumar et. al., 2001). One thousand replicates were used for all possible tree topology calculations.
[0087] To prepare RNA samples for the NaCl inducibility test, seeds of different soybean varieties were germinated and grown as described above. Gene expression was analyzed by Northern blot analysis using a standard procedure in a hybridization solution containing 50% formamide at 42°C (Sambrook and Russell, 2001). Unless otherwise indicated, 10 pg of total RNA was loaded onto each lane in Northern blot analysis. Single-stranded DIG (Digoxigenin)-labeled PCR products were used as probes (Finch et al., 1991). T3 and T7 primers (51- AATTAACCCTCACTMAGGG and 5'-GTAATACGACTCACTATAGGGC) flanking the original subtractive GmRD22 clone were employed to generate probes for GmRD22.
[0088] Growth conditions for NaCl stress and dehydration stress. For NaCl treatments, the surface-sterilized seeds were germinated in filter papers containing modified Hoagland's solution. After germination, 1 -week-old seedlings of uniform growth stage were transferred to a hydroponics system containing the same culture medium. After the opening of the first trifoliate, the seedlings were treated with Hoagland's solution supplemented with 125 mM NaCl. The youngest fully expanded trifoliate of treated plants were collected for total RNA extraction after 0-, 8-, 72- and 144-h treatment (Figure 5). For polyethylene glycol (PEG) treatment, the soybean plants were germinated and grown similarly, except that the resulting seedlings were treated with Hoagland's solution (control) or Hoagland's solution supplemented with 5% PEG 6000 or 125 mM NaCl (Figure 6). The youngest fully expanded trifoliate was collected
for total RNA extraction after 48-h treatment. The youngest fully expanded trifoliate was collected for total RNA extraction after 8-, 12- and 24-h after treatment (Figure 7). Gene expression was analyzed by Northern blot analysis using a standard procedure in a hybridization solution containing 50% formamide at 42°C (Sambrook and Russell, 2001). Single-stranded DIG (Digoxigenin)-labeled PCR products were used as probes (Finckh et al., 1991). T3 and T7 primers (5'- AATTAACCCTCACTAAAGGG and 5'-GTAATACGACTCACTATAGGGC) flanking the original subtractive GmRD22 clone were employed to generate probes for GmRD22.
[0089] Establishment of transgenic rice lines. The construction of transgenic rice is a joint effort with the China National Rice Institute. The transgene was cloned into the multiple cloning sites (MCS) of the double T-DNA binary vector pSB 130 driven by the ubiquitin promoter. The Oryza sativa ssp japonica cultivar Nipponbare was used to induce callus for transformation. The constructs containing the target gene were transformed into calli by co-cultivation. The transformed calli, after subsequent sub-culturing, were regenerate on regeneration medium with hygromycin as selective agent. The transformants were screened for presence of transgene by PCR using Genespecific primer. The transgenic lines were screened and raised until homozygous lines obtained. Northern blot analysis was performed to confirm expression of transgene.
[0090] Growth conditions for effects of salt stress in transgenic rice in open field. After germination, rice seedlings (The transgenic rice together with the wild type) were sowed into the open field and treated with 2% salt water (in the form of sea water) for 1 month.
[0091] Growth conditions for effects of drought stress and salt stress in transgenic rice in environmental-controlled growth chamber. After germination in the dark for 10 days, triplicate sets each containing the wild type parent and three
independent GmRD22 transgenic rice lines were grown in 1/2 MS liquid medium for another 9 days, in a growth chamber kept at about 280C with a 16 h light (intensity about 120 E)-8 h dark cycle. The first group was treated with 1/2 MS liquid medium supplemented with 20OmM NaCl for 2 days followed by irrigation of 1/2 MS liquid medium for 2 days. Drought stress was introduced to another group by the removal of the liquid growth medium for 16 hours followed by replenishment of 1/2 MS liquid medium for 3 days. The control group was irrigated with 1/2 MS liquid medium throughout the whole testing period. The performance of the representative seedlings was recorded and survival rates were calculated.
[0092] Establishment of transgenic Arabidopsis lines. The transgene was subcloned into the multiple cloning site (MCS) of the binary vector V7 (Brears, et ah, 1993) driven by the CaMV 35S constitutive promoter. The transformation was carried by Agrobacterium-mediated method aided with vacuum infiltration (Bechtold and Pelletier, 1993). The positive transformants were selected by kanamycin and the presence of transgene was confirmed by PCR using Gmi?D22-specific primers. The transgenic lines with single insertion locus were screened and propagated until homozygous lines were obtained. Northern blot analysis was performed to confirm the expression of transgene.
[0093] Testing the effects of drought stress on the root length of transgenic Arabidopsis. Seeds from the wild type parent (Col-0), the empty vector transgenic control (V7) and two independent GmRD22 transgenic lines (4-4-1 and 1-1-2) were sown on MS plates containing 3 % sucrose and 0.9 % (w/v) agar. Seedlings (7 d after germination) were transferred onto either the control MS agar plates or MS agar plates supplemented with 20% polyethylene-glycol 6000 (PEG). The root length of each individual seedlings before and 7 d after treatment was recorded and percentage root growth was calculated.
Example 1
Identification of salt stress responsive genes in salt tolerant soybean germplasms
[0094] Suppression subtractive hybridization (SSH) techniques (see Materials and Methods) were used to identify salt-inducible genes from the soybean variety Wenfeng 7. The full-length coding region of GmRD22 of the following soybean cultivars: Wenfeng 7, Tiefeng 8, Union, Zaoshu 6, Mengjin 1 and Jixian 11 is obtained by 5' and 31 RACE as described in Materials and Methods section. The amino acid sequence is predicted using Translate tool provided by the Expert Protein Analysis System proteomics server of the Swiss Institute of Bioinformatics (SIB) (Figure 1).
[0095] Seeds of different soybean varieties were germinated and grown as described in Materials and Methods. Twenty-day-old seedlings were subjected to a stepwise NaCl treatment of 0.3%, 0.6% and 0.9% (w/v) in 3-day intervals. Expression of the GmRD22 gene was analyzed by Northern blot analysis after NaCl treatment (see Materials and Methods for details). One of the candidate genes (GmRD22) was found to be strongly induced by NaCl stress in all the ten cultivated and ten wild soybean varieties tested (Figure 2). DNA sequence analysis indicated that GmRD22 was a RD22-like gene due to the high homology of its gene product to other identified plant RD22 gene products, as well as some BURP domain-containing protein. BURP domain is a conserved domain found at the C-terminus of several plant proteins including RD22 proteins. The putative peptide of GmRD22 shares 66% identity (homology) to RD22-like protein from Vitis vinifera, 65% identity to dehydration-induced protein RD22-like protein from Gossypium hirsutum, and 63% to a BURP protein from Medicago truncatula. Moreover, the full-length amino acid sequence of GmRD22 was aligned to identified RD22 proteins, including those from Arabidopsis, soybean, rice, tomato and Brassica napus. The BURP domain that found in other identified RD22 proteins is
conserved in GmRD22 (Figure 3).
[0096] The phylogenetic relationship of the GmRD22 polypeptide to other RD22-like protein/BURP domain-containing protein was analyzed using the ClustalW (Thompson et al., 1994) and MEGA (version 2.1) program (Kumar et al., 2001). RD29A from Arabidopsis RD29A (accession no. BAA02376) was used as an outgroup. The analyzed polypeptides were divided into three major groups, including: plant RD22 proteins (Group I), tolerance related protein with BURP domain and plant polygalacturonase (with BURP domain). Bootstrap values were indicated for major branches as percentages. One thousand replicates were used for all possible tree topology calculation. In the Neighbor-joining tree of RD22 proteins, GmRD22 together with other published plant RD22 proteins form a tight group (Figure 4).
Example 2
Expression of GmRD22 was induced by NaCl and dehydration stress [0097] The short-term and long-term effects of NaCl treatments on the expression of GmRD22 in soybean leaves were studied by Northern blot analysis (see Materials and Methods). When soybean plants were subjected to a short-term NaCl treatment (up to 8 h), an initial rise of GmRD22 mRNA levels were observed 8h after treatment (Figure 5). In parallel, the accumulation of Na+ in leaves was minimal during the first 8 h after treatment. Therefore, the initial rise of GmRD22 mRNA levels may be a result of dehydration responses. When soybean plants were subjected to long-term NaCl treatment (over 72 h), the steady-state mRNA levels of GmRD22 remained high (Figure 5). To further explore the possible regulation of GmRD22 gene expression by dehydration, soybean plants were subjected to PEG treatment to mimic the dehydration stress (Jia et al., 2001). When soybean plants were subjected to long-term salt or
dehydration treatment, the steady-state mRNA level of GmRDH was elevated (Figure 6).
Example 3
GmRD22 display differential expression between two soybean cultivars of contrasting salt-tolerance ability under salt, dehydration and ABA treatment [0098] To further characterize the function of GmRD22 in response to salt and dehydration stress, the stress conditions that may affect the expression of GmRD22 were determined using 2 genetically distinct soybean varieties: WF (a salt-tolerant variety) and UN (a salt-sensitive variety). Gene expression profile of GmRD22 in response to salt, dehydration and ABA treatment at different time point was studied using Northern blot analysis. Interestingly, after 8 hr of salt treatment, GmRD22 showed differential induction in the salt-tolerant cultivar (WF) when compared to the salt sensitive (UN) one under both salt, dehydration and ABA treatment. Such phenomenon also was observed in longer term treatments (12 and 24hr) (Figure 7).
Example 4
Ectopic expression of GmRD22 confer salt tolerance
[0099] Transgenic rice expressing GmRD22 were constructed. Northern blot analysis was performed to confirm the expression of GmRD22 and all transgenic lines tested showed expression of the transgene (Figure 8). After treated for a month, transgenic rice harboring GmRD22 or one other proprietary clone obtained in our lab still survived while most of the others (including the parental line Nipponbare) failed to sustain in such a harsh environment. The transgene conferred salt tolerance to rice in testing saline field and was found to be able to survive under 2% salt treatment (Figure 9). For drought stress experiment (Figure 10), the GmRD22 transgenic rice could recover by
replenishing liquid medium after the removal for 16 hours. Under such conditions, the wild type could not survive. For salinity stress experiment, the GmRD22 transgenic rice but not the wild type could survive in 20OmM NaCl (Figure 10). Thus, homozygous GmRD22 transgenic rice lines, in a growth chamber setting, could confer tolerance to drought stress and salinity stress (Figure 10). The drought stress was achieved by removal of liquid growth medium for 16 hours followed by replenishment. The salinity stress was achieved by an addition of 20OmM NaCl into the liquid growth medium. Under either drought stress or salinity stress, transgenic rice expressing GmRD22 exhibited a much better survival rate (Figure 11).
[0100] Transgenic Arabidopsis expressing GmRD22 were constructed. Northern blot analysis was performed to confirm the expression of GmRD22 and all transgenic lines tested showed expression of the transgene (Figure 12). When subjected to osmotic stress (20% PEG), the GmRD22 transgenic Arabidopsis lines exhibited a better root growth than the untransformed wild type (Col-0) and the empty vector transgenic control (V7) (Figure 13).
DISCUSSION
[0101] In a search for salt-inducible genes in soybean using subtraction subtractive hybridization techniques, a novel RD22-\ike gene, namely GmRD22, was cloned. Several lines of evidences suggest that it was indeed a member of the RD22 family: (1) It exhibits high homology to other identified RD22 proteins; (2) by phylogenetic analysis it forms a tight group together with the other identified plant-RD22 like proteins.
[0102] GmRD22 functioned in the adaptation to NaCl and dehydration stress. When soybean plants were treated with NaCl, physiological drought is the immediate
stress. As a result of physiological drought, the leaves drooped within 1 h and the stomatal conductance dropped to less than 50% of the baseline within 10 min after NaCl treatment (data not shown). A prominent induction of GmRD22 mRNA levels in leaves started to appear within 8 h after NaCl treatment (Figure 5) when no significant accumulation OfNa+ in leaves was established at this time. When subjected to long-term NaCl treatments, expression of GmRD22 remained at a high expression level (Figure 5). Because dehydration symptoms were also observed in leaves when soybean plants were placed under such long-term treatments, we could not distinguish whether the apparent NaCl induction effects were results of NaCl per se or whether the consequential drought was caused by stress. The induction of GmRD22 by PEG (Figure 6) was further supported the notion that the gene expression of GmRD22 was at least in part regulated by dehydration.
[0103] In the comparative studies using 2 soybean germplasms with contrasting salt-tolerance ability, GmRD22 showed a differential induction in the salt tolerance cultivar (WF) when compared to the salt sensitive (UN) one under both salinity stress and osmotic stress (Figures 7a and 7b).
[0104] Transgenic rice were used in to perform gain-of-function tests to investigate the possible application value of GmRD22 in stress-tolerance crops engineering. Transgenic rice expressing GmRD22 survived under 2% salt treatment (in form of sea water) (Figures 8 and 9), whereas those not expressing GmRD22. This finding demonstrated that GmRD22 was able to protect the plant from salt and salt-induced dehydration stress.
[0105] Transgenic rice and Arabidopsis thaliana were used to perform gain-of-function tests to investigate the possible application value of GmRD22 in stress-tolerance crops engineering. Transgenic rice expressing GmRD22 (Figure 8)
survived under 2% salt treatment (in form of sea water) in a field test (Figure 9), but not for the untransformed parent. When grown in environmental controlled growth chambers, GmRD22 transgenic rice showed a higher recovery and survival rates under drought stress and salt stress (Figures 10 and 11). Similar protection was also observed in transgenic Arabidopsis thaliana expressing GmRD22 (Figure 12). Transgenic GmRD22 Arabidopsis thaliana exhibited a higher growth rate in root under drought stress when comparing to the untransformed wild type (Col-0) and the empty vector transgenic control (V7) (Figure 13). These findings demonstrated that GmRD22 was able to protect the plant from salinity, salinity-induced dehydration, and drought stresses.
[0106] hi summary, the NaCl and PEG inducibility of GmRD22 showed that its physiological role was related to the adaptation to salinity, salinity-induced dehydration, and drought stresses. Expressing GmRD22 in rice and Arabidopsis thaliana provided definitive evidence that heterologous expression protects plants from salinity and drought stresses, suggesting that this clone can be used for salt tolerant and drought tolerant crop engineering.
[0107] Modifications may be made to the foregoing without departing from the basic aspects of the invention. Although the invention has been described in substantial detail with reference to one or more specific embodiments, those of skill in the art will recognize that changes may be made to the embodiments specifically disclosed in this application, yet these modifications and improvements are within the scope and spirit of the invention, as set forth in the claims which follow.
[0108] Citation of the above publications or documents is not intended as an admission that any of the foregoing is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents. U.S. patents and other publications referenced herein are hereby incorporated by reference.
References
[0109] Abe, H., Yamaguchi-Shinozaki, K., Urao, T., Iwasaki, T., Hosokawa, D., and Shinozaki, K. (1997). Role of Arabidopsis MYC and MYB homologs in drought and abscisic acid-regulated gene expression. Plant Cell 9, 1859-68
[0110] Ashraf, M. (1994). Breeding for salinity tolerance in plants. Crit. Rev. Plant Sci. 13, 17-42
[0111] Bechtold, N. and Pelletier, G. (1993). Inplanta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. In: Martinez-Zapater, J., Salinas, J. (Eds.), ARABIDOPSIS PROTOCOLS. Humana Press Inc., Totowa, pp. 259-266.
[0112] Brears, T., Liu, C, Knight, TJ. and Coruzzi, G.M. (1993). Ectopic overexpression of asparagines synthetase in transgenic tobacco. Plant Physiol. 103: 1285-90.
[0113] Diatchenko, L., Chenchik, A. and Siebert, P. (1998). Suppression subtractive hybridization: A method for generating subtracted cDNA libraries starting from poly (A+) or total RNA. In: Siebert, P., Larrick, J. (Eds.), RTPCR METHOD FOR GENE CLONING AND ANALYSIS. Eaton Publishing, Natick, MA, pp. 213- 39
[0114] Finckh, U., Lingenfelter, P.A., Myerson, D. (1991). Producing single-stranded DNA probes with the Taq DNA polymerase: a high yield protocol. Biotechniques 10: 35-38
[0115] Hoagland, D.R. and Arnon, D.I. (1938). The water-culture method for growing plants without soil. Calif Agric. Expt. Circ. 2>A1, 1-39
[0116] Jackson, A.O. and Larkins, B.A. (1976). Influence of ionic strength, pH, and chelation of divalent metals on isolation of polyribosomes from tobacco leaves.
Plant Physiol. 57, 5-10.
[0117] Jain, R. L., and Selvaraj, G. (1997). Molecular genetic improvement of salt tolerance in plants. In Biotechnology Annual Review (El-Gewely, M. R., ed) Vol. 3 pp. 245-67, Elsevier Science B. V.
[0118] Kumar, S., Tamura, K., Jakobsen, LB. and Nei, M. (2001). MEGA2: molecular evolutionary genetics analysis software. Bioinjormatics 17, 1244-45.
[0119] Maas, E.V., and Hoffman, J.G.. (1977). Crop salt tolerance-current assessment. J Irrig. Drain. Eng. 103:115-34.
[0120] Sambrook, J. and Russell, D.W. (2001). MOLECULACRL ONINGA: LABORATORY MANUAL, Ed 3rd. Cold Spring Harbor Laboratory Press, New York
[0121] Thompson, J.D., Higgins, D.G., and Gibson, TJ. (1994). CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-680
[0122] Xiong, L. M., Ishitani, M., Lee, H. J., and Zhu, J. K. (2001). The Arabidopsis L0351ABA3 locus encodes a molbdenum cofactor sulfurase and modulated cold stress- and osmotic stress-responsive gene expression. Plant Cell 13,2063-83
[0123] Yamaguchi-Shinozaki, K., and Shinozaki, K. (1993). The plant hormone abscisic acid mediated the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. MoI. Gen. Genet. 23 8, 17-25
Claims
1. A substantially pure polypeptide having the amino acid sequence of SEQ ID NO:2 or an amino acid sequence of at least 80%, 85%, 90%, 95% or higher sequence identity thereto.
2. An isolated polynucleotide sequence comprising a nucleotide sequence of SEQ ID NO: 1 and complementary sequences thereof, or a nucleotide sequence of at least 80%, 85%, 90%, 95% or higher sequence identity thereto.
3. An isolated polynucleotide sequence encoding the polypeptide of claim 1.
4. A recombinant nucleic acid construct comprising the polynucleotide sequence of claim 2 or 3.
5. The recombinant nucleic acid construct of claim 4, wherein said polynucleotide sequence is operably linked to control sequences operable in plant cells.
6. The recombinant nucleic acid construct of claim 5, wherein said control sequences are heterologous to said polynucleotide sequence.
7. The recombinant nucleic acid construct of claim 5, wherein said control sequences further effect insertion of said recombinant nucleic acid construct into cell chromosomal DNA.
8. A plant host cell comprising the isolated polynucleotide sequence of claim 2 or 3, or the recombinant nucleic acid construct of any one of claims 4-7.
9. A plant or a plant part comprising the cell of claim 8.
10. A progeny or seeds of the plant or plant part of claim 9.
11. A method of producing the polypeptide of claim 1, comprising growing a cell of claim 8 under conditions which allow the expression of a polynucleotide encoding said polypeptide, and isolating the polypeptide.
12. A method of protecting a plant from abiotic stress comprising a) transforming a plant cell with the isolated polynucleotide sequence of claim 2 or 3, or the recombinant nucleic acid construct of any one of claims 4-7; and b) generating from the plant cell a transgenic plant that express a polypeptide encoded by said polynucleotide sequence.
13. The method of claim 12, wherein said polynucleotide sequence is heterologous to said plant or plant cell.
14. The method of claim 12 or 13, wherein said polynucleotide sequence is operably linked to control sequences operable in said plant cell.
15. The method of any one of claims 12-14, wherein the abiotic stress is selected from a group consisting of salinity stress, drought or dehydration and a combination thereof.
16. A method to select for successfully transformed plant cells or plants, comprising applying one or more abiotic stresses to plant cells or plants subjected to a transformation with a recombinant nucleic acid construct of any one of claims 4-7 as a selectable marker, whereby cells that have increased tolerance to said abiotic stress are selected.
17. The method of claim 16, wherein said abiotic stresses are selected from a group consisting of salinity stress, drought and a combination thereof.
18. Use of the polypeptide of claim 1 , or the polynucleotide sequence of claim 2 or 3, or recombinant nucleic acid construct of any one of claims 4-7 in water saving agricultural practice.
19. The use of claim 18 further comprises applying water-saving cultivation method(s) to a plant.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK10102402.6A HK1137776B (en) | 2006-09-29 | 2007-09-29 | Gmrd22-like genes and use thereof to protect against abiotic stress |
| CN2007800358819A CN101548013B (en) | 2006-09-29 | 2007-09-29 | GMRD22-like genes and their application in protection against abiotic stress |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US84811306P | 2006-09-29 | 2006-09-29 | |
| US60/848,113 | 2006-09-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2008043268A1 true WO2008043268A1 (en) | 2008-04-17 |
Family
ID=39282413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CN2007/002857 Ceased WO2008043268A1 (en) | 2006-09-29 | 2007-09-29 | Gmrd22-like genes and use thereof to protect against abiotic stress |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US7994390B2 (en) |
| CN (1) | CN101548013B (en) |
| WO (1) | WO2008043268A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009156371A1 (en) * | 2008-06-23 | 2009-12-30 | Nestec S.A. | Genes for modulating coffee maturation and methods for their use |
| WO2012085806A1 (en) * | 2010-12-21 | 2012-06-28 | Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional | Methods to obtain drought resistant plants |
| WO2014187571A1 (en) * | 2013-05-23 | 2014-11-27 | Nomad Bioscience Gmbh | Process of providing plants with abiotic stress resistance |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110909933B (en) * | 2019-11-20 | 2020-07-17 | 北京师范大学 | Agricultural drought rapid diagnosis and evaluation method coupling crop model and machine learning language |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624131A (en) * | 2004-11-10 | 2005-06-08 | 东北林业大学 | Gene of dehydration-inducible protein RD22 in Tamarix multibranches |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5380831A (en) | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
| TW261517B (en) | 1991-11-29 | 1995-11-01 | Mitsubishi Shozi Kk | |
| US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| EP1313867A2 (en) | 2000-08-24 | 2003-05-28 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
| AR031928A1 (en) * | 2000-12-18 | 2003-10-08 | Renessen Llc | PROMOTER OF ARCELINA-5 AND USES OF THE SAME |
| US20080148432A1 (en) * | 2005-12-21 | 2008-06-19 | Mark Scott Abad | Transgenic plants with enhanced agronomic traits |
-
2007
- 2007-09-28 US US11/904,906 patent/US7994390B2/en not_active Expired - Fee Related
- 2007-09-29 CN CN2007800358819A patent/CN101548013B/en not_active Expired - Fee Related
- 2007-09-29 WO PCT/CN2007/002857 patent/WO2008043268A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624131A (en) * | 2004-11-10 | 2005-06-08 | 东北林业大学 | Gene of dehydration-inducible protein RD22 in Tamarix multibranches |
Non-Patent Citations (3)
| Title |
|---|
| BATCHELOR A.K. ET AL.: "SCBI, a BURP-domain protein gene, from developing soybean seed coats", PLANTA, vol. 215, 2 July 2002 (2002-07-02), pages 523 - 532, XP002259319, DOI: doi:10.1007/s00425-002-0798-1 * |
| GRANGER C. ET AL.: "Identification, structure, and differential expression of members of a BURP domain containing protein family in soybean", GENOME, vol. 45, 2002, pages 693 - 701 * |
| YU Y.-W. ET AL.: "Isolation and characterization of genes related to salt-tolerance in soybean", JOURNAL OF SHENZHEN UNIVERSITY (SCIENCE & ENGINEERING), vol. 121, no. 14, 31 October 2004 (2004-10-31) * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009156371A1 (en) * | 2008-06-23 | 2009-12-30 | Nestec S.A. | Genes for modulating coffee maturation and methods for their use |
| JP2011525353A (en) * | 2008-06-23 | 2011-09-22 | ネステク ソシエテ アノニム | Genes regulating coffee maturation and methods of use thereof |
| EP2363408A3 (en) * | 2008-06-23 | 2012-07-11 | Nestec S.A. | Genes for modulating coffee maturation and methods for their use |
| US8685735B2 (en) | 2008-06-23 | 2014-04-01 | Nestec S.A. | Genes for modulating coffee maturation and methods for their use |
| WO2012085806A1 (en) * | 2010-12-21 | 2012-06-28 | Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional | Methods to obtain drought resistant plants |
| ES2461896R1 (en) * | 2010-12-21 | 2014-06-02 | Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional | Methods to obtain drought resistant plants |
| WO2014187571A1 (en) * | 2013-05-23 | 2014-11-27 | Nomad Bioscience Gmbh | Process of providing plants with abiotic stress resistance |
| JP2016522686A (en) * | 2013-05-23 | 2016-08-04 | ノマド・バイオサイエンス・ゲーエムベーハー | Methods to bring abiotic stress resistance to plants |
| AU2014270707B2 (en) * | 2013-05-23 | 2019-12-12 | Nomad Bioscience Gmbh | Process of providing plants with abiotic stress resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| HK1137776A1 (en) | 2010-08-06 |
| CN101548013B (en) | 2012-03-21 |
| US7994390B2 (en) | 2011-08-09 |
| CN101548013A (en) | 2009-09-30 |
| US20080184385A1 (en) | 2008-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1230345B1 (en) | Environmental stress tolerance genes | |
| WO2006066498A1 (en) | The transcription factor gene osnacx from rice and use for improving tolerance of plants to drought and salt thereof | |
| JP2006512071A (en) | Novel rice gene OSISAP1 imparting stress tolerance and method for imparting stress tolerance | |
| KR101803500B1 (en) | Novel Gene Implicated in Plant Cold Stress Tolerance and Use Thereof | |
| KR20120111715A (en) | Osbhlh148 gene enhancing drought stress tolerance of plant and uses thereof | |
| US20160122778A1 (en) | Stress tolerant plants and methods thereof | |
| WO2001032002A1 (en) | Myb transcription factors and uses thereof | |
| US7994390B2 (en) | Use of GmRD22-like genes to protect against abiotic stress | |
| CN101883572B (en) | Sorghum aluminum tolerance gene SBMATE | |
| MX2014007711A (en) | Methods for improving crop yield. | |
| US20250109405A1 (en) | Novel transcriptional regulator receptor-like protein 33 regulates physiological responses in plant cells | |
| KR20190083578A (en) | Novel Gene Implicated in Plant Environmental Stresses Tolerance and Use Thereof | |
| WO2025072654A1 (en) | A novel transcriptional regulator 30s ribosomal protein regulates physiological responses in plant cells | |
| WO2003088738A1 (en) | Regulated ethylene sensitivity to control flower longevity in a plant | |
| KR101592357B1 (en) | Novel Gene Implicated in Plant Cold Stress Tolerance and Use Thereof | |
| US20030079252A1 (en) | Floral induction gene | |
| HK1137776B (en) | Gmrd22-like genes and use thereof to protect against abiotic stress | |
| KR101550797B1 (en) | Novel Gene Implicated in Tolerance for Abiotic Stress of Plant and Use Thereof | |
| CN106674341A (en) | A protein GsJ11 related to plant carbonate stress tolerance and its coding gene and application | |
| CN113801890A (en) | Application of protein ZmbZIPc3 in regulation and control of salt and drought resistance of plants | |
| CA2482460A1 (en) | Regulated ethylene sensitivity to control flower longevity in a plant | |
| WO2015193653A1 (en) | Oxidative resistance chimeric genes and proteins, and transgenic plants including the same | |
| WO2003091441A1 (en) | Sfr2 protein encoding gene | |
| AU2014265120A1 (en) | The sorghum aluminum tolerance gene, SbMATE | |
| HK1140952B (en) | The sorghum aluminum tolerance gene, sbmate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780035881.9 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07816471 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 07816471 Country of ref document: EP Kind code of ref document: A1 |