WO2008028081A2 - Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein - Google Patents
Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein Download PDFInfo
- Publication number
- WO2008028081A2 WO2008028081A2 PCT/US2007/077300 US2007077300W WO2008028081A2 WO 2008028081 A2 WO2008028081 A2 WO 2008028081A2 US 2007077300 W US2007077300 W US 2007077300W WO 2008028081 A2 WO2008028081 A2 WO 2008028081A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- sperm cells
- sperm
- acid sequence
- target molecule
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0608—Germ cells
- C12N5/061—Sperm cells, spermatogonia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0608—Germ cells
- C12N5/0612—Germ cells sorting of gametes, e.g. according to sex or motility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
Definitions
- the present invention relates to methods and compositions for identifying and separating cells from a population of cells, particularly, mammalian sperm cells through the use of nucleic acids, particularly aptamers, that specifically bind with high affinity and specificity or preferentiality to either sperm cells containing the X chromosome or the Y chromosome.
- the present invention provides at least one aptamer or nucleic acid sequence that binds to a target molecule accessible from the surface of a cell, particularly, a mammalian sperm cell and a method for producing the aptamers or nucleic acid sequence.
- the method comprises contacting a collection of different nucleic acid molecules with the target molecule under conditions favorable for binding between at least one of the nucleic acid molecules and the target molecule, to form at least one complex comprising the nucleic acid molecule bound to the target molecule, wherein each of the nucleic acid molecules comprises at least one segment of randomized nucleotide sequences.
- the complexes are then separated from the unbound nucleic acid molecules and unbound target molecules, and the bound nucleic acid molecule is recovered from the separated complex.
- the present invention further provides one or more specific nucleic acid molecules or aptamers, preferably an oligonucleotide, more preferably a DNA molecule, that binds preferentially to either a sperm cell containing a X-chromosome (hereinafter referred to as a "X sperm cell”) or a sperm cell containing a Y- chromosome (hereinafter referred to as a ' ⁇ sperm cell”), and preferably preferentially binds better to one of the X sperm cells or binds with significantly different affinities to each type of X and Y sperm cells.
- X sperm cell a X-chromosome
- a ' ⁇ sperm cell a sperm cell containing a Y- chromosome
- the present invention also provides an isolated non-naturally occurring nucleic acid sequence or aptamer that binds to a target molecule on a mammalian sperm cell comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence selected from the group consisting of SEQ ID NOS: 3-35 or a target molecule binding portion thereof.
- the present invention also provides a method for using the aptamers or nucleic acid sequence to identify, select and separate X and Y sperm cells.
- the method comprises separating the mammalian sperm cells by contacting the X and Y sperm cells with at least one aptamer of the invention and separating the cells into two or more populations based upon their ability to preferentially bind to the aptamer.
- the invention further includes the X and Y sperm cell population(s) produced by the separation method.
- the invention further comprises an artificial insemination kit comprising the sperm cell population produced by the method of the invention, and a method for artificial insemination of a mammal by administering the selected sperm cell population to the mammal.
- the present invention also provides diagnostic and technological means relating to sperm cell qualities such as sperm cell viability, motility, functionality, stimulation, and preservation, as well as diagnostic and technological means that address insemination rates, fertilization rates, and birth rates of desirable offspring, by establishing a method of selectively sorting semen or sperm cells obtained from various species, individuals, and specimens.
- Figure 2A shows the binding analysis of the enriched X-cells specific aptamer pool. Fluorescence confocal images of sperm cells (Left); and optical images of sperm cells (Right), (a) X- specific aptamer pool with the X cells, (b) X-specific aptamer pool with the Y cells; (c) Na ⁇ ve DNA library with X cells.
- Figure 2B shows the binding analysis of the enriched Y-cells specific aptamer pool.
- Fluorescence confocal images of sperm cells (Left); and Optical images of sperm cells (Right), (a) Y- specific aptamer pool with the Y cells, (b) Y-specific aptamer pool with the X cells; (c) Na ⁇ ve DNA library with Y cells.
- aptamers are defined as a class of ligands or nucleic acid sequences, the terms of which are used interchangeably throughout this specification; also are referred to a oligomers or oligonucleotides, i.e., nucleic acids that bind preferentially to a particular target molecule, such as a polypeptide, a short peptide, an enzyme, a protein, a lipid, a glycolipid, a phospholipid, a glycoprotein, a carbohydrate, a small molecule or a cell surface molecule, such as a receptor, an extracellular matrix or scaffolding molecule or an ion channel.
- a particular target molecule such as a polypeptide, a short peptide, an enzyme, a protein, a lipid, a glycolipid, a phospholipid, a glycoprotein, a carbohydrate, a small molecule or a cell surface molecule, such as a receptor, an extracellular matrix or scaffolding molecule or an ion
- the aptamers of the present invention are ligands or single-stranded oligonucleotides that bind with high affinity and specificity to target molecules through complementary shape interactions.
- the aptamers or nucleic acid sequences of the present invention are capable of binding or forming a complex with a target molecule to a higher degree or affinity than the aptamer would bind to contaminating or control molecules that presumably do not contain the target on the surface of or accessible from the surface of a X or Y sperm cells.
- the aptamers or nucleic acid sequences of the present invention may bind preferentially to a target molecule on the surface of the X sperm cell as compared to the Y sperm cell or vice versa.
- the nucleic acids may be either DNA, RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those that provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, fluxionality or a label to the nucleic acid bases or to the nucleic acid molecule as a whole.
- the aptamers are DNA molecules. Most preferably, they are oligonucleotides. [0014] The length of these molecules is more than one nucleotide and may include short sequences, such as dimers or trimers, that may be intermediates in the production of specific nucleic acid molecules that bind to a target.
- Aptamers of the present invention include nucleic acid molecules of any length but preferably less than 200 nucleotides, preferably less than 150 nucleotides, preferably less than 100 nucleotides, preferably less than 80 nucleotides, more preferably less than 60 nucleotides, more preferably less than 40 nucleotides, preferably less than 35 nucleotides, preferably less than 30 nucleotides, preferably less than 25 nucleotides, preferably less than 20 nucleotides, preferably less than 15 nucleotides and preferably less than 10 nucleotides.
- such oligonucleotides are about 15-60 nucleotides long.
- aptamers are understood to include both monoclonal aptamers and polyclonal aptamers.
- monoclonal aptamers are ones with the same nucleotide sequences that bind to the same target
- polyclonal aptamers are ones with some variation in nucleotide sequences, which bind to the same target.
- Monoclonal aptamers are preferred.
- an aptamer preferably is an oligonucleotide that is capable of complexing or binding to a target molecule as described herein.
- the affinity or complexation of an aptamer to its target molecule is a matter of degree and is measured by the ability of the aptamer to bind to the target molecule at a higher degree than to a control or contaminating molecules.
- specificity of aptamers is similar in meaning to the specificity as it applies to antibodies.
- the aptamers can be prepared by any known method of producing nucleic acid molecules, such as synthetic, recombinant and purification methods. Additionally, the aptamers may be linked to another molecule to assist with the detection and/or isolation after contacting the aptamer to the sperm cell. It is important that this additional molecule would not significantly affect or interfere with the binding affinity of the aptamer to the target molecule.
- Useful labels would include labels known to be useful for isolation and detection of proteins, peptides, metabolites and antibodies, such as fluorescent or biotin moieties or magnetic beads or other types of beads useful for isolation.
- Aptamers or nucleic acid sequences of the present invention can be used alone or in combination with other aptamers specific for the same target molecule. Different aptamers that contain the same consensus would be known from the comparison of two or more known aptamers to a specific target molecule or possibly another target molecule on or near the surface of an X or Y sperm cell. If X and Y sperm cells are to be separated, it is important to employ one or more aptamers specific or preferential for one cell or the other to provide the best separation to obtain a sperm population of either X containing or Y containing sperm cells.
- Aptamers for sperm cell surface proteins or other sperm cell surface targets are identified and selected by the methods of the invention.
- the invention provides a method for producing an aptamer that binds to a target molecule on the surface of a mammalian sperm cell. A collection of different nucleic acid molecules is contacted with a target molecule that is accessible for binding to these molecules, likely on the cell surface or protruding from the cell surface, under conditions favorable for binding between at least one of the nucleic acid molecules and the target molecule.
- Each of the nucleic acid molecules contains at least one segment of randomized nucleotide sequences. This provides variation in the nucleic acid molecules.
- the contact results in the formation of at least one complex comprising at least one nucleic acid molecule bound to the target molecule.
- the complexes are then separated from the unbound nucleic acid molecules and the unbound target molecules. Then, the bound nucleic acid molecule is recovered from the separated complex, thus providing the desired aptamer.
- the method comprises the further step of amplifying the recovered nucleic acid molecules to create additional molecules.
- the recovered and amplified molecules i.e., aptamers
- the aptamers bind more specifically with a target molecule on a cell as compared to a control pool of DNA sequences to the same cell.
- the contacting step comprises incubating the molecules to form an equilibrium mixture and the separating step comprises capillary electrophoresis.
- the target molecule on the surface of a cell is one that is unique to either a X sperm cell or a Y sperm cell and that will not cross react with each type of cell.
- a target molecule can be a protein, a peptide, an enzyme, a lipid, a glycolipid, a phospholipid, a glycoprotein, a carbohydrate, a small molecule or a cell surface molecule, such as a receptor, an extracellular matrix or scaffolding molecule or an ion channel.
- the protein distinguishes X sperm cells from Y sperm cells containing a Y chromosome.
- the methods of the invention are performed in an iterative fashion such that there are repeated steps of (a) contacting a collection of different nucleic acids (i.e., aptamers) with a target molecule accessible from the surface of a cell to form at least one complex comprising at least one nucleic acid molecule bound to a target molecule accessible from the surface of a cell, (b) separating the complexes from unbound nucleic acid molecules and unbound target molecules; and (c) recovering the bound nucleic acid molecule from the separated complex.
- a plurality of aptamers recovered from the separated complex of step (c) are used in a subsequent round of the method in step (a).
- the steps of the sorting sperm cells are repeated 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 1 1 or more times to produce an aptamer pool specific for X sperm cells or Y sperm cells.
- Sorted aptamers can be purified by methods known in the art and sequenced by known methods or a commercial vendor.
- Representative aptamers produced by the method disclosed herein comprise an isolated non-naturally occurring nucleic acid sequence that binds to a target molecule on a mammalian sperm cell comprising a nucleotide sequence selected from the group consisting of:
- nucleotide sequence having substantially the same structure and has substantially the same ability to bind said target molecule on said sperm cell as the nucleotide sequence of (a) or (b) or a target molecule binding portion thereof.
- the isolated non-naturally occurring nucleic acid sequence as described above also encompasses at least a portion of nucleotides 1 -20 are deleted from said SEQ ID NOS: 3-35 or a target molecule binding portion thereof; at least a portion of nucleotides 61 -80 are deleted from said SEQ ID NOS: 3-10 and 12-35 or nucleotides 44-63 of SEQ ID NO: 1 1 or a target molecule binding portion thereof; at least a portion of nucleotides 1 -20 are deleted from said SEQ ID NOS: 3-35 and/or wherein at least a portion of nucleotides 61 -80 are deleted from said SEQ ID NOS: 3-10 or 12-35 or nucleotides 44- 63 of SEQ ID NO: 1 1 or a target molecule binding portion thereof; and DNA sequences comprises nucleotides 21-60 of SEQ ID NOS: 3-10 or 12-35 or nucleotides 21-43 of SEQ ID NO: 1 1 or a target molecule binding
- the present invention also encompasses a composition comprising at least one of the nucleic acid sequences selected from the group consisting of all of the nucleic acid sequences enumerated in [0020] and [0021] above.
- the present method further comprises the step of amplifying the recovered nucleic acid molecule to create additional nucleic acid molecules.
- the contacting step (a) may comprise incubating the molecules to form an equilibrium mixture and wherein the separating step comprises capillary electrophoresis.
- the present method further comprises incubating the collection of different nucleic acid molecules or aptamers after each round and sperm cells containing the target molecule with a primer that is substantially complementary to template nucleic acid sequence.
- the template nucleic acid sequence is a sequence that corresponds to a segment of the aptamer that is unvaried (or constant) within a plurality of aptamers.
- the aptamer preferably is from a DNA library and this template nucleic acid sequence is a vector sequence.
- the contacting step (a) further comprises a negative selection step followed by a positive selection step.
- the plurality of the recovered aptamers are quantified using the know technique of flow cytometry.
- the target molecule on the sperm cell to which the aptamer can bind is selected from the group consisting of a protein, a peptide, an enzyme, a lipid, a glycolipid, a phospholipid, a glycoprotein, a carbohydrate, a small molecule or a cell surface molecule.
- the target molecule is a target molecule contained on a sperm cell and the target molecule distinguishes at least one X sperm cell from at least one Y sperm cell by a comparison of the binding or no binding or differential binding.
- the sperm cells identified by this method are cattle sperm cells or human sperm cells.
- Aptamers that specifically bind to sperms cells can be identified by methods known in the art, including, but not limited to cell sorting and flow cytometry techniques.
- the present method provides a method of preparing aptamers that permits separation of mammalian X sperm cells from mammalian Y sperm cells, wherein the method produces a first group of aptamers that bind to X sperm cells in the first sample and a second group of aptamers that bind to Y sperm cells in the second sample; and the method further comprises: (d) comparing the first and second groups of aptamers to identify by process elimination at least one aptamer that binds only to either the X sperm cells or the Y sperm cells.
- the first and second samples of mammalian sperm cells are produced by flow cytometry and cell sorting.
- the method of preparing sperm specific aptamers further comprises a contacting step (a) which further comprises: (al) contacting a first collection of different nucleic acid molecules with a target molecule contained in a first sample of mammalian X sperm cells under conditions favorable for binding between the nucleic acid molecules and the X sperm cells to form at least one complex comprising at least one nucleic acid molecule bound to at least one X spe ⁇ n cell, wherein each of the nucleic acid molecules comprises at least one segment of randomized nucleotide sequences; and (a2) contacting a second collection of different nucleic acid molecules with a target molecule contained in a second sample of mammalian Y sperm cells under conditions favorable for binding between the nucleic acid molecules and the Y sperm cells to form at least one complex comprising at least one nucleic acid molecules bound to at least one Y sperm cell, wherein each of the nucleic acid molecules comprises at least one segment of randomized nucleot
- the method of producing spe ⁇ n specific aptamers further comprises that prior to step (a), at least 1 round of contact of the nucleic acid molecules with an unsorted cell population comprising both mammalian X spe ⁇ n cells and Y sperm cells occurs. Also the separating step (b) further comprises the step of separating the sperm cells bound to the aptamer from the aptamer and the recovering step (c) further comprises recovering the separated sperm cells.
- the mammalian sperm cells preferably are cattle sperm cells or human sperm cells.
- rounds of unsorted aptamer selection can be performed prior to rounds of sorted X and Y sperm cell/aptamer selection. For instance, 1 to 5 rounds of unsorted aptamer selection can be performed.
- the invention includes methods comprising 3 rounds of unsorted aptamer selection prior to rounds of sorted aptamer selection.
- the method of claim 1, further comprises incubating the collection of different nucleic acid molecules and the target molecule with a primer that is substantially complementary to template nucleic acid sequence.
- the invention provides a method for producing an aptamer that permits separation of X sperm cells from Y sperm cells.
- a first sample of X sperm cells is obtained, and a second sample of Y sperm cells is obtained.
- a first group of aptamers are produced, which bind to the X sperm cells in the first sample, and a second group of aptamers are produced that bind to the Y sperm cells in the second sample.
- the first and second groups of aptamers are compared to identify by a process of elimination at least one aptamer that binds to either of the X sperm cells or the Y sperm cells. Generally, several different aptamers are identified that bind to either type of cells.
- the first and second samples of mammalian sperm cells which contain either Y sperm cells or X sperm cells are produced by flow cytometry and cell sorting techniques that are known to those skilled in the art. Such techniques are disclosed in U.S. Patent No. 5,135,759, issued August 4, 1992.
- a flow cytometer measures the amount of fluorescent light given off when the sperm, previously treated with a fluorescent dye, passes through a laser beam. The dye binds to the DNA. Because the X chromosome contains more DNA than the Y chromosome, the female (X) sperm takes up more dye and gives off more fluorescent light than the male (Y) sperm.
- the sperm passes single file through the laser beam, which measures the DNA content of individual sperm. This permits separation of the individual X and Y sperm cells by a cell sorter. Sorted X and Y sperm cells can be purchased from commercial sources which have been sorted using similar cell sorting methods.
- the aptamers are produced by a process comprising the steps of: (a) contacting a first collection of different nucleic acid molecules with a first sample of Y sperm cells under conditions favorable for binding between the nucleic acid molecules and the Y sperm cells to form at least one complex comprising at least one nucleic acid molecules bound to at least one Y chromosome-bearing sperm cell, wherein each of the nucleic acid molecules comprises at least one segment of randomized nucleotide sequences; (b) contacting a second collection of different nucleic acid molecules with the second sample of X sperm cells under conditions favorable for binding between the nucleic acid molecules and the X sperm cells to form at least one complex comprising at least one nucleic acid molecule bound to at least one X sperm cell, wherein each of the nucleic acid molecules comprises at least one segment of randomized nucleotide sequences; (c) separating the complexes from the unbound nucleic acid molecules
- the aptamers are tested and validated by contacting them with a sample of sperm cells containing X sperm cells and Y sperm cells, separating the sperm cells by flow cytometry and cell sorting, and determining that the putative X-binding aptamer binds to the X sperm cell and the putative Y-binding aptamer binds to the Y sperm cell.
- the aptamers are labeled, for example, with a fluorescent moiety to pe ⁇ nit the appropriate identification.
- aptamers of the invention various specific techniques known to those skilled in the art may be used.
- One such technique is the MonoLex process of AptaRes, Luckenwalde, Germany. The process involves the steps of: (1) synthesis of an oligonucleotide library with regions of random sequence; (2) affinity adsorption of the oligonucleotides to a target; (3) affinity sorting of the oligonucleotides along an affinity resin; (4) separation of the oligonucleotides with different levels of affinity into numerous pools comprising multiple aptamers per pool; (5) amplification of the separated nucleotide pools (which produces polyclonal aptamers); and (6) identification of individual oligonucleotides by cloning and sequencing (which produces monoclonal aptamers).
- SELEX Systematic Evolution of Ligands by Exponential enrichment
- This process includes the steps of: (1 ) contacting a mixture of nucleic acids, preferably comprising segments of randomized sequences, with a target under conditions favorable for binding; (2) partitioning unbound nucleic acids from those nucleic acids that have bound specifically to target molecules; (3) disassociating the nucleic acid-target complexes; (4) amplifying the nucleic acids disassociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (5) repeating the previous steps through as many cycles as desired or necessary to yield highly specific, high affinity aptamers to the target molecule.
- CE-SELEX capillary electrophoresis-SELEX
- This technique uses electrophoresis to separate binding sequences from inactive ones. Selection occurs in free solution. Active sequences that bind the target undergo a mobility shift, similar to that seen in affinity capillary electrophoresis. Active sequences are separated from inactive sequences and collected as separate fractions.
- a preferred method for identifying and isolating aptamers is the NECEEM (NonEquilibrium Capillary Electrophoresis of Equilibrium Mixtures) process as described in J. Am. Chem. Soc. 2002, 124, 13674-13675, Anal. Chem. 2003, 75, 1382- 1386, Krylov, "NECEEM for Development, Characterization and Analytical Utilization of Aptamers," Lab Plus International, November 2005, and Krylov, "Nonequilibrium Capillary Electrophoresis of Equilibrium Mixtures (NECEEM): A Novel Method for Biological Screening," J. Biomol. Screen Online First, January 17, 2006.
- this method starts with a naive DNA library (every sequence is statistically unique) that is mixed with the target protein and incubated to form an equilibrium mixture. DNA molecules with high affinity bind to the target protein, while those with low affinity do not bind. A plug of the equilibrium mixture is then introduced into a capillary, and a high voltage is applied. The equilibrium fraction of DNA-target is separated from the equilibrium fraction of DNA by gel-free capillary electrophoresis under non-equilibrium conditions. Under these conditions, the mobility of the target is higher than that of DNA, and the mobility of the target-DNA complex is typically intermediate between that of the DNA and the target. In the electric field, the zones are thus separated, and equilibrium between the three components is no longer maintained. The DNA-target complex starts disassociating, which results in "smears" of DNA and target between three peaks. Due to the high efficiency of separation, reattachment of disassociated DNA and target is negligible.
- the components reach the end of the capillary in the following order: (1 ) the equilibrium part of free target; (2) free target formed by disassociation of DNA-target during NECEEM; (3) the remains of intact DNA-target; (4) free DNA formed from the disassociation of DNA-target during NECEEM; and (5) the equilibrium part of free DNA.
- a fraction is collected from the output of the capillary in a time window.
- the widest aptamer collection window includes DNA-target complexes and DNA disassociated from DNA-target complexes during NECEEM.
- the preferred targets are polypeptides (peptides and proteins) on the sperm cells that are sex-specific or otherwise allow identification or separation of the sperm based on sex selection or other desired characteristics.
- polypeptides are disclosed in U.S. Pat. Nos. 4,191 ,749; 4,448,767; 5,021 ,244; 6,153,373; and 6,489,092 and in U.S. Patent Application Publication 2003/0162238 Al .
- the published patent application discloses an isolated sex-chromosome-specific protein characterized as follows: (a) X chromosome specific, (b) associated with the cell membrane of bovine sperm cells, and (c) having a molecular weight on SDS-PAGE of about 32 kDa.
- suitable aptamers may be produced and reproduced by many techniques well known to those of ordinary skill in the art, including enzymatic techniques or through chemical synthesis. Additional chemical groups may be added through known chemical techniques. Such groups include fluorescein or biotin and other groups that create a detectable signal.
- modified nucleotides may be used to protect the aptamers from degradation by nucleases. Such modified nucleotides include 2'-0-methyl and 2'-fluro derivatives.
- the aptamers selected and/or produced as described above will be used in an assay for separating populations of sperm cells based on whether they carry the X or Y chromosome, an abnormal number of sex chromosomes, or other desired sperm cell characteristics.
- the method of separating mammalian sperm cells comprises the steps of: 1) contacting the mammalian sperm cells with the aptamer of the invention and 2) separating the sperm cells into two or more populations based on the ability of the sperm cells to bind to the aptamer.
- the method comprises the further step of separating the sperm cells bound to the aptamer from the aptamer and recovering the separated sperm cells.
- the sperm cells that are not bound to the aptamer are recovered.
- more than one type of aptamer maybe used.
- two or more aptamers of the invention may be used in the separation method and these aptamers may contain consensus sequences that bind to the same target molecule.
- Aptamers produced by the present method are useful for binding to target molecules and more specifically those target molecules on sperm cells, both X sperm cells and Y sperm cells.
- This method produces sperm cell populations selected and separated based upon certain desired characteristics of the cells. Separated populations may be bound or unbound to the aptamer. If the desired population is bound to the aptamer, preferably the sperm cells are separated from the aptamer molecules. Preferably, the sperm cells are cattle sperm cells. In one preferred embodiment, the sperm cells contain a Y chromosome. In an alternative preferred embodiment, the sperm cells contain only the X chromosome. [0046] In a further embodiment, the invention provides a method for producing an aptamer or nucleic acid sequence that permits separation of X sperm cells from Y sperm cells.
- This prepared aptamer is contacted with a mixed population of X and Y sperm cells, and the aptamer binds preferentially to the X sperm cells and these bound aptamer-X sperm cell complexes are separated from the original mixed sperm cell population leaving a Y containing rich sperm cell population.
- the bound aptamer-X containing sperm cell complex can be treated to release the X containing sperm cells so that they can be isolated as a population of cells.
- An assay for separating sperm cells by use of aptamers could be used, for example, as follows.
- Commercially available, microscopically small magnetic beads are coated with an appropriate aptamer of the invention, such as X sperm specific aptamers. These beads will be placed in a suspension of the sperm-cells in an appropriate receptacle, such as a glass dish. Because the sex-chromosome-specific proteins are present on the cell surface, the X sperm cells will then bind to the X sperm specific/preferential aptamer on the beads, while the Y sperm cells will not or will bind less preferentially. The beads are then pulled to the side of the dish using a magnet.
- Sperm cells having the Y chromosome are then recovered.
- Other types of beads that can be used to capture and recover the aptamers may also be used. Additional techniques using magnetic beads coated with substances that bind to sperm cells are disclosed in U.S. Patent Application Publication Nos. 2003/0068654 Al , 2004/0142384 Al , and 2005/01 14915 Al .
- agglutination of sperm cells may be used.
- live, unsorted sperm may be suspended in a serum free, in vitro culture medium and exposed to either Y or X spe ⁇ n cell specific/preferential aptamers.
- the medium is filtered in a glass wool filter, and spe ⁇ n in the filtrate is used to perform in vitro fertilization.
- the aptamers against X or Y sperm cell specific surface proteins may bind to and inactivate X or Y sperm cells respectively, and may prevent them from fertilizing an ovum.
- the sperm cells not bound by the aptamers may remain viable and active for fertilizing ova.
- the invention provides a method to produce a semen sample enriched in active X or Y sperm cells and thus capable of increasing the probability that offspring will be of a desired sex or have a gene for a sex- chromosome linked trait,
- a native sperm preparation may be exposed to a first aptamer that binds, for example, Y specific molecules.
- the exposed sperm may be suspended together with a conjugate of a second aptamer that binds exclusively to the first aptamer and an immuno absorbent substrate in a protein-free diluent to form a conjugate/sperm preparation whereby the Y spe ⁇ n are bound to the substrate.
- the Y sperm may then be recovered from the substrate by specific binding of the substrate.
- the methods described herein provide the means to separate sperm on factors of quality and desirability, including spe ⁇ n cell motility, functionality, stimulation, and preservation, which can affect fertility rates, insemination rates, fertilization rates, offspring health, and offspring desirability for various species of mammals, including, but not limited to, humans, horse, cattle, swine, cats, dogs, buffalo, oxen, and elk.
- the methods for separating sperm on the basis of desired characteristics described herein minimize damage to the sperm by mechanical handling so that the sperm have improved viability.
- the methods are non-invasive, do not require chemical binding to cellular internal structures, involve minimal manipulation, and are inexpensive. There are minimal requirements for equipment or instrumentation and they are readily carried out by a person skilled in the art.
- the aptamers prepared by the present method and methods of the present invention may also be used to evaluate other characteristics of the sperm. For example, they may be used to determine sperm quality, determine male fertility, identify healthy sperm, or identify abnormal or damaged sperm.
- the separated sperm cells of the invention are preferably used for artificial insemination of a mammal.
- the mammal is a bovine mammal.
- the method for artificial insemination comprises administering the sperm to the mammal using techniques known to those skilled in the art.
- the invention further comprises a kit for artificial insemination of a mammal.
- the kit contains at least the separated sperm cell population of the invention and optionally other components or devices to administer the sperm cell population to the mammal.
- the kit contains the individual sperm cell sample in a tube for insertion into the vagina of the female animal. Such sample tube is known in the art as a "straw".
- the separated sperm of the invention maybe used for in vitro fertilization of a mammal.
- the mammal is a human being.
- a preferred method of selecting specific aptamers according to the present invention employs a method that utilizes several rounds of incubation of unsorted, sorted X and/or sorted Y sperm cells with a DNA library with a final step of collecting the solution with DNA binders and use it as a template for PCR and for strand separation on streptavadin beads.
- Applicants have determined that more than 6 rounds of sperm aptamer selection according to the present invention is optimal. Preferably 7 rounds, more preferably 8 rounds and even more preferably 9 rounds of selection are performed as outlined below. However, more than 9 rounds of selection can be performed if necessary to obtain aptamers that bind to the specific target molecule.
- F-primer forward primer custom ordered from IDT with the following sequence 5'-CTC CTC TGA CTG TAA CCA CG -3') (SEQ ID NO: 1 ) into the 40 ⁇ L aliquots of cells, to a final concentration of 50 ⁇ M.
- Fprimer is a first 20 nucleotides of the library. It is used in the selection as a background DNA. This sequence was chosen to decrease the likelihood that at least one of the constant regions of the library will not participate in the binding, and if removed will produce a shorter aptamer sequence but will not change the binding properties.
- steps 1 - 18 above constitutes the completion of a single round.
- the supernatant from 18 is considered to be the Round 1 (Rl) aptamer pool and is used directly or is amplified using known PCR techniques.
- Round 2 (R2) the Rl aptamer pool is used in place of the naive DNA library in step 7 on a new sample of unsorted cells that are prepared according to steps 1 -6.
- the supernatant or Round 2 (R2) aptamer pool from step 18 of the completion of Round 2 is then utilized directly or amplified using known PCR techniques and added in place of the DNA library in step 7 on a new sample of unsorted cells in Round 3 (R3).
- the supernatant from step 18 of Round 3 or the Round 3 (R3) aptamer pool is then used in step 7 of Round 4 described below.
- Rounds 4-11 Positive and negative selections with sorted cells
- B X cells with 50 ⁇ M of F4 and 5 nM of Y Apt pool from previous selection round (or R3 aptamer pool only if it is forth selection round). Incubate the mixtures at room temperature for 1 hour and spin the cells down (300 ⁇ g, 17°C 12 min). Take the supernatant and use it in the positive selection. To each one of X and Y cells aliquots, add F-primer for a final concentration of 50 ⁇ M and equal amount of the supernatant from previous step. C. To X cells, add supernatant from fraction 1 to get 2.5 nM X aptamer pool and 50 ⁇ M F4.
- a round of the aptamer selection of Rounds 4-9 and higher rounds include steps 1 -16 directly above.
- the Round 4 aptamer pool is then added to step 7 of the next round, Round 5, then the Round 5 aptamer pool is then added to step 7 of the next round, Round 6, then the Round 6 aptamer pool is then added to step 7 of the next round, Round 7, then the Round 7 aptamer pool is then added to step 7 of the next round, Round 8, then the Round 8 aptamer pool is then added to step 7 of the next round, Round 9, then the Round 9 aptamer pool is then added to step 7 of the next round, and any additional rounds can continue to be repeated accordingly.
- the goal of these rounds of aptamer selection is to obtain a pool of aptamers that bind specifically to Y or X sperm cells. Therefore, at least Round 7 of the selection method should be run to obtain aptamers that specifically bind to the target molecule, more preferably at least Round 8 should be run and most preferably at least Round 9 or higher should be run to obtain a pool of aptamers that are specific for Y containing and X containing sperm.
- Applicants submit that the above method can be utilized to prepare target specific aptamers of any type as long as the pool of cells that contain the target molecule that identifies the cell (unsorted or sorted) is substituted in the rounds of aptamer selection for the Y and X sperm cells both unsorted and sorted.
- the following method was performed to provide labeled pools of DNA and to provide a sufficient amount of DNA for analysis that could additionally save time and costs in the preparation.
- the known technique, asymmetric PCR resulted in the production of one of the DNA strands.
- labeled aptamers resulting from the asymmetric PCR technique were mixed with sperm cells and subjected to flow cell cytometry analysis. Na ⁇ ve DNA library was used as a control.
- PCR cycles There were 20 PCR cycles performed which includes a PCR cycle consisting of melting at 94 0 C for 10 seconds, annealing at 56 0 C for 10 seconds, and extension at 72 0 C for 10 seconds.
- the first cycle has an extended melting step of 30 seconds.
- the purified single stranded aptamers pools after each selection round are used.
- the products are purified using the 3OkDA cut off DNA purification column (Microcon ultracel YM-30, from Millipore Bedford MA, USA.) using standard procedure described in the manual and known to persons skilled in the art.
- Figure 1 provides the analysis of the aptamers obtained by the present method in which 9 rounds of aptamer selection and analysis using flow cytometry was performed. Each population of live spermatozoa was represented by 8,000 to 9,000 cells. Live cells population were differentiated from dead cells by Propidium Iodide, a dead cell stain.
- the present method provides aptamers that bind to target molecules that may or may not be on the surface of a cell but should be accessible from the surface of a cell, such as preferably a X or Y sperm cells.
- the cell cytometry analysis described herein provides a method to determine whether an aptamer pool obtained in the last step of a single round aptamer selection round as described herein contains one or more aptamers that bind to a target molecule.
- This binding data should be compared with any binding of the same aptamer pool to the na ⁇ ve DNA library, preferably the library from which the aptamer pools were first obtained as a negative control. Additionally, the aptamer pool binding also should be compared to a second or third sample that does not contain the target molecule. Results that show higher binding of the aptamer pool to the target molecule as compared to the binding to the na ⁇ ve DNA library is considered as a positive preferential binding. Additionally, further rounds of selection as disclosed herein may increase the binding affinity of the aptamer pool.
- the aptamer pool binding also should be analyzed for its binding to the preferred target molecule as well as a sample containing the "non-target" molecule from which one wishes to separate the target molecule. In this latter instance, all of these comparisons should be analyzed to select aptamer pools that bind to a specific target molecules and do not bind or binds to a lesser degree or less preferentially to the cell or molecule from which one wants to separate the target molecule.
- using aptamers to separate different sperm cell populations requires analysis and comparison to different controls and negative controls,
- Table 1 provides aptamers obtained from the aptamer pool after Round 9 according to the procedure provided above that bound preferentially to the X sperm cells and which did not bind or which bound less preferentially to the Y sperm cells than to the X sperm cells.
- the aptamers in Table 1 (SEQ ID NOS: 3-35) show portions of the nucleotides on the 5 ' end and the 3 ' end of each sequence that is underlined.
- aptamers that correspond to the forward primer CTC CTC TGA CTG TAA CCA CG (SEQ ID NO: 1 ) at the 5 ' end and the reverse primer, GGC TTC TGG ACT ACC TAT GC (SEQ ID NO: 2) at the 3 ' end used to generate the aptamers from the na ⁇ ve library, NP40.
- Each of these constant regions are 20 nucleotides in length.
- the aptamers of the present invention are intended to encompass the nucleotide length sequence of each of SEQ ID NOS: 3-35 or a portion thereof.
- an aptamer of the present invention comprises nucleotides 21-60 of SEQ ID NOS: 3-10 and 12-35 or portions thereof or nucleotides 21 -43 of SEQ ID NO: 1 1 or portions thereof.
- an aptamer SEQ ID NOS: 3-35 or a portion of the recited sequence to be considered to be an aptamer within the meaning of the present invention, it must bind preferentially to a target molecule on an X or Y sperm cell at a higher affinity than any contaminating or control cells,
- the DNA sequences in Table 1 represent selected sequences that were located in the Round 9 aptamer pool. Several of the sequences were present in the aptamer pool in multiple copies.
- TCCAGAAGCC SEQ I D NO : I i CTCCTCTGACTGTAACCACGAATAACATTACATATAGTTACTTGCATAGGTAGTCCAGAAGCC
- TCCAGAAGCC SEQ I O NO : 24 CTCCTCTGACTGTAACCACGTATCACTTACATTTAAATCAATGTATATCAATATTTTAGTGCATAGGTAG
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Plant Pathology (AREA)
- Reproductive Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2007289164A AU2007289164A1 (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
NZ575829A NZ575829A (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
CA2697960A CA2697960A1 (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
BRPI0714897-6A2A BRPI0714897A2 (en) | 2006-08-30 | 2007-08-30 | ISOLATED NUCLEIC ACID SEQUENCE AND OBTAINED COMPOSITION, METHOD OF SEPARATION OF A SPERM CELL MIXTURE, METHOD OF PRODUCTION OF A NUCLEIC ACID SEQUENCE OF SPERM CELL PRODUCED INSULATED PULMEDIAL CULINES AND THEIR ARTIFICIAL INSEMINATION METHOD |
MX2009002214A MX2009002214A (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein. |
RU2009111277/10A RU2475539C2 (en) | 2006-08-30 | 2007-08-30 | Method to separate spermatozoa and applied compositions, containing aptamers or sequences of nucleic acids |
CN200780040177.2A CN101553237B (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
EP07841662A EP2061478A4 (en) | 2006-08-30 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
US12/394,993 US8138319B2 (en) | 2005-02-24 | 2009-02-27 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
US14/472,155 US9546397B2 (en) | 2005-02-24 | 2014-08-28 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US82406906P | 2006-08-30 | 2006-08-30 | |
US60/824,069 | 2006-08-30 |
Related Parent Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2006/006376 Continuation-In-Part WO2006091717A1 (en) | 2005-02-24 | 2006-02-24 | Sperm cell separation methods and compositions |
US11/817,093 Continuation-In-Part US20100121135A1 (en) | 2005-02-24 | 2007-08-24 | Sperm cell separation methods and compositions |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/394,993 Continuation-In-Part US8138319B2 (en) | 2005-02-24 | 2009-02-27 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2008028081A2 true WO2008028081A2 (en) | 2008-03-06 |
WO2008028081A3 WO2008028081A3 (en) | 2008-06-12 |
Family
ID=39136915
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2007/077300 WO2008028081A2 (en) | 2005-02-24 | 2007-08-30 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
Country Status (11)
Country | Link |
---|---|
US (2) | US8138319B2 (en) |
EP (1) | EP2061478A4 (en) |
CN (1) | CN101553237B (en) |
AU (1) | AU2007289164A1 (en) |
BR (1) | BRPI0714897A2 (en) |
CA (1) | CA2697960A1 (en) |
CO (1) | CO6190565A2 (en) |
MX (1) | MX2009002214A (en) |
NZ (1) | NZ575829A (en) |
RU (1) | RU2475539C2 (en) |
WO (1) | WO2008028081A2 (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010008001A1 (en) * | 2008-07-14 | 2010-01-21 | 国立大学法人 東京大学 | Aptamer against il-17 and use thereof |
WO2010120518A2 (en) * | 2009-04-01 | 2010-10-21 | Biocern, Inc. | Sperm cell separation methods and compositions containing sperm cell targeting ligands for use therein |
WO2010150013A2 (en) | 2009-06-23 | 2010-12-29 | Ovasort Limited | Identification of sex-linked proteins |
CN102796730A (en) * | 2012-07-18 | 2012-11-28 | 海南广陵高科实业有限公司 | Method for recycling nucleic acid molecules from polyacrylamide gel |
US9546397B2 (en) | 2005-02-24 | 2017-01-17 | Biocern Inc. | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
US9850492B2 (en) | 2013-03-22 | 2017-12-26 | The University Of Tokyo | Aptamer to IL-17 and use thereof |
US9879222B2 (en) | 2007-12-14 | 2018-01-30 | Mofa Group Llc | Gender-specific separation of sperm cells and embryos |
US11701655B2 (en) | 2013-05-03 | 2023-07-18 | Motilitycount Aps | Device for analysis of cellular motility |
Families Citing this family (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006091717A1 (en) * | 2005-02-24 | 2006-08-31 | Biocern, Inc. | Sperm cell separation methods and compositions |
US20110136099A1 (en) | 2007-01-16 | 2011-06-09 | Somalogic, Inc. | Multiplexed Analyses of Test Samples |
US7947447B2 (en) | 2007-01-16 | 2011-05-24 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
US8975026B2 (en) | 2007-01-16 | 2015-03-10 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
US8703416B2 (en) | 2008-07-17 | 2014-04-22 | Somalogic, Inc. | Method for purification and identification of sperm cells |
WO2012174496A2 (en) * | 2011-06-17 | 2012-12-20 | Somalogic, Inc. | Method for purification and identification of sperm cells |
US10379026B2 (en) | 2012-08-29 | 2019-08-13 | Inguran, Llc | Cell processing using magnetic particles |
EP2890498B1 (en) | 2012-08-29 | 2018-02-21 | Inguran, LLC | Magnetic removal or identification of damaged or compromised cells or cellular structures |
RU2528870C2 (en) * | 2012-11-06 | 2014-09-20 | Государственное бюджетное образовательное учреждение высшего профессионального образования "Красноярский государственный медицинский университет имени профессора В.Ф. Войно-Ясенецкого" Министерства здравоохранения и социального развития Российской Федерации (ГБОУ ВПО КрасГМУ им. проф. В.Ф. Войно-Ясе | Aptamer specific to human tumour lung tissues |
DE102013218528B3 (en) | 2013-09-16 | 2014-12-24 | ViaMed GmbH | Device for the enrichment of spermatozoa |
US11008575B2 (en) * | 2015-07-28 | 2021-05-18 | The University Of North Carolina At Charlotte | DNA aptamers against cancer and uses thereof in delivery of therapy and diagnosis of cancer |
CN110607303A (en) * | 2019-10-30 | 2019-12-24 | 多能干细胞再生医学科技(广州)有限公司 | Nucleic acid aptamers and methods for isolating populations of sperm cells |
CN111876367A (en) * | 2020-07-10 | 2020-11-03 | 华侨大学 | Method for removing low-quality sperm |
Family Cites Families (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2001988A (en) * | 1930-05-14 | 1935-05-21 | Cash A W Co | Control mechanism |
US4999283A (en) * | 1986-01-10 | 1991-03-12 | University Of Kentucky Research Foundation | Method for x and y spermatozoa separation |
US6001988A (en) * | 1990-06-11 | 1999-12-14 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands to lectins |
US5840482A (en) * | 1990-10-10 | 1998-11-24 | The Regents Of The University Of California | Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ |
JP3061863B2 (en) * | 1994-11-10 | 2000-07-10 | ファイザー製薬株式会社 | Macrocyclic lactone compound and method for producing the same |
BR9610235A (en) * | 1995-08-11 | 1999-07-27 | Univ Guelph | Processes for identifying sex-specific and non-specific molecules to take a sex-specific molecule to differentiate between males and females to separate certain male or female sperm from native semen and to prepare an enriched preparation for non-female and male specific molecules antibody against an epitope of a sex-specific molecule sex-specific molecule isolated and purified contraceptive kit and use of a non-sex specific molecule. |
DE69834527T2 (en) * | 1997-07-01 | 2007-05-10 | VLP Watertown Limited Partnership, Watertown | Method of sexing mammalian offspring |
US6126835A (en) * | 1998-05-15 | 2000-10-03 | Biocrystal Ltd. | Device and method for magnetic separation of biological molecules |
US20040142384A1 (en) * | 2003-01-16 | 2004-07-22 | Cohen Barb Ariel | Magnetic separator |
EP1494028A1 (en) * | 2003-07-03 | 2005-01-05 | Labsoft Diagnostics AG | Immunomagnetic separation of specific target cells |
US20050114915A1 (en) * | 2003-11-26 | 2005-05-26 | Vicam L.P. | Method for sex biasing spermatozoa |
CA2578046A1 (en) * | 2004-09-07 | 2006-03-16 | Archemix Corp. | Aptamer medicinal chemistry |
US20090054250A1 (en) * | 2004-11-04 | 2009-02-26 | Evaldas Katilius | Methods to create fluorescent biosensors using aptamers with fluorescent base analogs |
WO2006091717A1 (en) * | 2005-02-24 | 2006-08-31 | Biocern, Inc. | Sperm cell separation methods and compositions |
CN101553237B (en) | 2006-08-30 | 2015-05-27 | 比奥塞尔恩公司 | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
-
2007
- 2007-08-30 CN CN200780040177.2A patent/CN101553237B/en not_active Expired - Fee Related
- 2007-08-30 WO PCT/US2007/077300 patent/WO2008028081A2/en active Application Filing
- 2007-08-30 EP EP07841662A patent/EP2061478A4/en not_active Withdrawn
- 2007-08-30 RU RU2009111277/10A patent/RU2475539C2/en not_active IP Right Cessation
- 2007-08-30 AU AU2007289164A patent/AU2007289164A1/en not_active Abandoned
- 2007-08-30 BR BRPI0714897-6A2A patent/BRPI0714897A2/en not_active IP Right Cessation
- 2007-08-30 NZ NZ575829A patent/NZ575829A/en not_active IP Right Cessation
- 2007-08-30 MX MX2009002214A patent/MX2009002214A/en unknown
- 2007-08-30 CA CA2697960A patent/CA2697960A1/en not_active Abandoned
-
2009
- 2009-02-27 US US12/394,993 patent/US8138319B2/en not_active Expired - Fee Related
- 2009-03-30 CO CO09032342A patent/CO6190565A2/en active IP Right Grant
-
2014
- 2014-08-28 US US14/472,155 patent/US9546397B2/en not_active Expired - Fee Related
Non-Patent Citations (1)
Title |
---|
See references of EP2061478A4 * |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9546397B2 (en) | 2005-02-24 | 2017-01-17 | Biocern Inc. | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein |
US9879222B2 (en) | 2007-12-14 | 2018-01-30 | Mofa Group Llc | Gender-specific separation of sperm cells and embryos |
WO2010008001A1 (en) * | 2008-07-14 | 2010-01-21 | 国立大学法人 東京大学 | Aptamer against il-17 and use thereof |
US8440801B2 (en) | 2008-07-14 | 2013-05-14 | The University Of Tokyo | Aptamer against IL-17 and use thereof |
KR101276519B1 (en) * | 2008-07-14 | 2013-06-18 | 고쿠리츠다이가쿠호우진 도쿄다이가쿠 | Aptamer against il-17 and use thereof |
JP5704638B2 (en) * | 2008-07-14 | 2015-04-22 | 国立大学法人 東京大学 | Aptamers against IL-17 and use thereof |
WO2010120518A2 (en) * | 2009-04-01 | 2010-10-21 | Biocern, Inc. | Sperm cell separation methods and compositions containing sperm cell targeting ligands for use therein |
WO2010120518A3 (en) * | 2009-04-01 | 2011-03-10 | Biocern, Inc. | Sperm cell separation methods and compositions containing sperm cell targeting ligands for use therein |
WO2010150013A2 (en) | 2009-06-23 | 2010-12-29 | Ovasort Limited | Identification of sex-linked proteins |
CN102796730A (en) * | 2012-07-18 | 2012-11-28 | 海南广陵高科实业有限公司 | Method for recycling nucleic acid molecules from polyacrylamide gel |
US9850492B2 (en) | 2013-03-22 | 2017-12-26 | The University Of Tokyo | Aptamer to IL-17 and use thereof |
US11701655B2 (en) | 2013-05-03 | 2023-07-18 | Motilitycount Aps | Device for analysis of cellular motility |
Also Published As
Publication number | Publication date |
---|---|
WO2008028081A3 (en) | 2008-06-12 |
US8138319B2 (en) | 2012-03-20 |
NZ575829A (en) | 2012-04-27 |
CO6190565A2 (en) | 2010-08-19 |
CN101553237A (en) | 2009-10-07 |
MX2009002214A (en) | 2009-07-02 |
RU2475539C2 (en) | 2013-02-20 |
AU2007289164A1 (en) | 2008-03-06 |
US9546397B2 (en) | 2017-01-17 |
EP2061478A2 (en) | 2009-05-27 |
US20090306461A1 (en) | 2009-12-10 |
CN101553237B (en) | 2015-05-27 |
RU2009111277A (en) | 2010-10-10 |
BRPI0714897A2 (en) | 2013-10-29 |
CA2697960A1 (en) | 2008-03-06 |
EP2061478A4 (en) | 2010-07-07 |
US20150203811A1 (en) | 2015-07-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9546397B2 (en) | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein | |
US9879222B2 (en) | Gender-specific separation of sperm cells and embryos | |
Bilska et al. | Immunoglobulin expression and the humoral immune response is regulated by the non-canonical poly (A) polymerase TENT5C | |
US20140182005A1 (en) | Sperm cell separation methods and compositions containing sperm cell targeting ligands for use therein | |
US8703416B2 (en) | Method for purification and identification of sperm cells | |
US20190010499A1 (en) | Methods for improved aptamer selection | |
Bruhn et al. | Mitochondrial DNA polymerase POLIB is essential for minicircle DNA replication in African trypanosomes | |
US20100121135A1 (en) | Sperm cell separation methods and compositions | |
EP3634992B1 (en) | Methods and compositions for identifying epitopes | |
Emanuelli et al. | Cumulus-oocyte interactions and programmed cell death in bovine embryos produced in vitro | |
McElhinny et al. | The expression pattern of the Qa-2 antigen in mouse preimplantation embryos and its correlation with the Ped gene phenotype. | |
Yang et al. | Tentative identification of sex-specific antibodies and their application for screening bovine sperm proteins for sex-specificity | |
AU2013267057A1 (en) | Sperm cell separation methods and compositions containing aptamers or nucleic acid sequences for use therein | |
US20240018512A1 (en) | Method for multi-dimensional analysis of cell epigenomics | |
WO2012174496A2 (en) | Method for purification and identification of sperm cells | |
CN109536504B (en) | Aptamer specifically combined with ischemic brain tissue, application thereof and kit | |
CN108929875B (en) | Method for separating embryonic stem cells and fixing embryonic stem cells on surface based on DNA aptamer | |
Becks | Immunomagnetic Beads Coupled with Anti-PH-20 Antibodies to Isolate Sperm from DNA Mixtures for Sexual Assault Kit Application | |
Chen et al. | Studying AnnelidaRegeneration in a Novel Model Organism: The Freshwater Aeolosoma viride | |
Magauiya et al. | BIOLOGICAL SCIENCES | |
Masibag | Aptamer selection for targeting AXL protein receptor expressed on cells and human IgG FC fragment | |
JP2008237041A (en) | Method for selecting target cell specifically binding nucleic acid by annealing | |
Blahut | Feasibility studies on non-invasive embryo-and sperm-sexing techniques. |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780040177.2 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07841662 Country of ref document: EP Kind code of ref document: A2 |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/002214 Country of ref document: MX |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007289164 Country of ref document: AU Ref document number: 575829 Country of ref document: NZ |
|
ENP | Entry into the national phase in: |
Ref document number: 2009111277 Country of ref document: RU Kind code of ref document: A |
|
REEP | Request for entry into the european phase |
Ref document number: 2007841662 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09032342 Country of ref document: CO Ref document number: 2007841662 Country of ref document: EP |
|
ENP | Entry into the national phase in: |
Ref document number: 2007289164 Country of ref document: AU Date of ref document: 20070830 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2697960 Country of ref document: CA |
|
ENP | Entry into the national phase in: |
Ref document number: PI0714897 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090227 |