TITLE OF THE INVENTION
METHOD OF REGULATING MAMMALIAN TARGET-OF-RAPAMYCIN ACTIVITY BY INTERACTION BETWEEN PHOSPHOLIPASE D AND
RAPTOR
CROSS REFERENCE TO RELATED APPLICATION
This application claims priority to and the benefit of Provisional Application No. 60/821,535 filed on August 4, 2006, which is hereby incorporated by reference for all purposes as if fully set forth herein.
BACKGROUND OF THE INVENTION
(a) Field of the Invention
The present invention relates to a method of regulating mammalian target-of- rapamycin (mTOR) by regulating a phospholipase D (PLD) activity that generates a complex with mTOR. Further, the present invention also relates to a method of screening inhibitors of mTOR, and a method and a composition for treating mTOR- related metabolic diseases by inhibiting mTOR.
(b) Description of the Related Art mTOR is a serine/threonine protein kinase and a member of a novel superfamily of signaling proteins termed PI 3-kinase related kinases (PIKKs), based on sequence similarity of their catalytic domains. The mTOR pathway is an emerging target for the treatment of cancer, diabetes and obesity. Further, recent studies have demonstrated the mTOR's role as a mediator of lifespan control in C. elegans and Drosophila. However, despite the significance of this pathway in such diverse biological processes, the mechanism of its regulation by upstream signals remains to be addressed.
In addition, mTOR requires the lipid second messenger phosphatidic acid (PA) for its activation. PA is an enzymatic product of PLD. PLD, which hydro lyzes phosphatidylcholine (PC) to generate PA, constitutes another branch of the mTOR upstream regulators through which mitogenic signals impinge on the mTOR pathway. Mammalian PLD isozymes identified to date, PLDl and PLD2, sense a variety of
L
signals, such as neurotransmitters, hormones and growth factors, to regulate multiple physiological events such as proliferation, secretion, respiratory burst and actin cytoskeletal reorganization, and the like.
Here, the present inventors have studied regarding the regulatory mechanisms of mTOR signaling and found that the physical/functional connections between mitogen-induced PA generation and its effector, mTOR, to complete the present invention (see Figure 21).
SUMMARY OF THE INVENTION An aspect of the present invention is to reveal a functional/physical relationship between PLD, raptor and mTOR, and a mechanism of forming a PLD/raptor/mTOR complex to activating the mTOR activity.
Based on the above, another aspect of the present invention is to provide a method of regulating mTOR activity by regulating interactions between PLD and raptor thereby regulating formation of a complex of PLD and mTOR through raptor. The regulating method may be comprise the step of inhibiting interactions between PLD and raptor, thereby inhibiting formation of a complex of PLD and mTOR through raptor, to inhibit mTOR activity.
Another aspect of the present invention is to provide a method of screening inhibitors of mTOR activity. The method of screening inhibitors of mTOR according to the present invention may comprising the steps of: contacting a candidate compound to a sample cell; examining the interaction between PLD and mTOR through raptor to form a complex; and determining the compound as an inhibitor of mTOR activity when the level of the interaction between PLD and mTOR decreases compared with that in other sample cells without contacting with the compound.
Another aspect of the present invention is to provide the amino acid sequence of SEQ ID NO: 4 as a target for screening of an agent of treating mTOR-related metabolic diseases may include cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc.
Still other aspect of the present invention is to provide methods and
compositions for treating mTOR-related metabolic diseases by inhibiting mTOR activity, more specifically, by inhibiting the interaction between PLD2 and raptor, thereby inhibiting the formation of a complex of PLD2 and mTOR through raptor (PLD/raptor/mTOR complex). The mTOR-related metabolic diseases may include cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows electrophoresis results of phosphorylation of S6K1 and 4EBP 1 in various PLD 1 or PLD2 knockdown cells.
Figure 2 shows electrophoresis results of phosphorylation of S6K1 in various PLD 1 or PLD2 knockdown cells when PA is exogenously added. Figure 3 shows electrophoresis results of interaction between PLD2, mTOR and raptor in COS7 cells.
Figure 4 shows electrophoresis results of interaction between recombinant mTOR and PLDl or PLD2.
Figure 5 shows schematic views of PLD2 and its N-terminal truncated fragment for site mapping analysis.
Figure 6 shows various TOS motif patterns and the electrophoresis results for various mutants thereof.
Figure 7 shows electrophoresis results of interaction between raptor and PLDl or PLD2. Figure 8 shows electrophoresis results of interaction between PLD2 and raptor under Triton X-IOO or CHAPS lysis condition.
Figure 9 shows electrophoresis results of interaction between mTOR, PLD2 and raptor.
Figure 10 shows electrophoresis results of interaction between PLD2 and raptor according to various TOR-like sequence of PLD2.
Figure 11 shows a schematic view of raptor and its truncated fragments for site mapping analysis, and electrophoresis results of interaction between PLD2 and the various raptors.
Figure 12 shows the interaction preferences of PLD2, S6K1 and 4EBP1 for raptor.
Figure 13 shows electrophoresis results of interaction between PLD2 and S6K1 or 4EBP 1 through raptor. Figure 14 shows electrophoresis results of interaction between PLD2 and
S6K1 or 4EBP 1 through raptor according to various TOR-like sequence of PLD2.
Figure 15 shows PBt formation results according to PLD2 point mutations at TOR-like sequence.
Figure 16 shows S6K1 phosphorylation results according to PLD2 point mutations at TOR-like sequence.
Figure 17 shows the mTOR kinase activity according to PLD2 point mutations at TOR-like sequence.
Figure 18 shows electrophoresis results obtained from the mTOR-raptor interaction. Figure 19 shows the mitogen-dependent phosphorylation of S 6Kl in PLD knockdown cells.
Figure 20 shows the mitogen-dependent phosphorylation of S 6Kl according to PLD2 point mutations at TOR-like sequence. '
Figure 21 shows the level of PBt formation in presence or absence of leucine. Figure 22 shows IP analysis results using anti-mTOR antibody in COS7 and
HEK293 cells in presence or absence of leucine.
Figure 23 shows the western blot analysis results in HA-raptorwt/PLD2wt transfectant after leucine treatment.
Figure 24 is a schematic view of PLD2/raptor/mTOR complex.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
A more complete appreciation of the invention, and many of the attendant advantages thereof, will be readily apparent as the same becomes better understood by reference to the following detailed description.
The present inventor found that PLD2 is identified as a novel raptor binding partner, suggesting that PLD2 is an important molecular link in mitogen-regulated
mTOR signaling, and that it presents a novel regulatory point that can be targeted for the treatment of metabolic diseases, to complete the present invention.
The present inventors have been studied the regulatory mechanisms of mTOR signaling, and found the participation of the mTOR complex (mTOR/raptor) containing raptor and GβL in response to upstream signals for the appropriate control of cell growth and the other mTOR complex (mTOR/rictor) containing rictor and GβL for the control of actin cytoskeletone (Kim, D.H., Sarbassov, D.D., AIi, S.M., Latek, R.R., Guntur, K. V., Erdjument-Bromage, H., Tempst, P., Sabatini, D.M. MoI. Cell 11 (2003) 895, which is hereby incorporated by reference). The upstream signals may be derived from insulin, nutrients, and/or mitogens. The present invention has been completed by finding the physical connection as well as the functional connection between mTOR complex and the upstream regulators.
Further, in the present invention, it was studied that which isozyme is mainly involved in mitogen-induced mTOR activation, revealing that PLD2 is a major isozyme to transduce mitogenic signaling to mTOR/raptor and the activity of mTOR is achieved by complex formation between PLD2 and mTOR/raptor. As a result, the present invention suggests the physical/functional connections between mitogen- induced PA generation and its effector mTOR and would provide further insight into mTOR-related metabolic diseases such as cancer, diabetes and obesity. The present invention suggests that PLD2 might function as a mediator of mitogen-induced mTOR activation. Further, in the present invention, it is found that PLD2 binds to raptor through its TOS motif-like sequence (Fig.21), and that the mitogen-induced PLD2-raptor interaction allows PA accumulation near mTOR, enabling PA-dependent mTOR activation, resulting phosphorylation of mTOR effectors, such as S6K1 , 4EBP 1 , and the like.
Definition
The term 'mTOR' refers to a mammalian target-of-rapamycin. In the present invention, mTOR may be originated from any mammalians including human and its amino acid sequences according to the source species are well known in the relevant art. In the present invention, the mTOR may originated from any mammalians, for example, Homo sapiens (NP 004949), Drosophila melanogaster (NP524891), Caenorhabditis elegans (Q95Q95), etc. In an embodiment of the
present invention, human mTOR having the amino acid sequence of SEQ ID NO: 1 may be used.
The term 'PLD' refers to a phospholipase D, and mammalian PLD isozymes include to classes, PLDl and PLD2. In the present invention, PLD may be originated from any mammalians including human, and its amino acid sequences according to the source species are well known in the relevant art. In an embodiment of the present invention, PLDl (e.g., NM 030992 originated from Rattus norvegicus) having the amino acid sequence of SEQ ID NO: 2 and PLD2 (e.g., NM 002663 originated from Homo sapiens) having the amino acid sequence of SEQ ID NO: 3 may be used.
The term 'PA' refers to a phosphatidic acid, which is an enzymatic product of PLD. mTOR requires the lipid second messenger phosphatidic acid (PA) for its activation.
The term 'TOR signal (TOS) motif-like sequence' refers to an amino acid sequence of upstream or downstream regulators of mTOR, which actually functions to bind to raptor. In an embodiment of the present invention, the TOS motif-like sequence of PLD2 may have the amino acid sequence of SEQ ID NO: 4.
The term 'raptor' refers to a regulatory-associated protein of mTOR. In the present invention, the raptor may be originated from any mammalians including human and its amino acid sequences according to the source species are well known in the relevant art. In an embodiment of the present invention, the raptor may be originated from human, and have the amino acid sequence of SEQ ID NO: 5 (Accession No. Q8N122).
An aspect of the present invention is to reveal a functional/physical relationship between PLD, raptor and mTOR, and a mechanism of forming a PLD/raptor/mTOR complex to activating the mTOR activity.
Based on the above, another aspect of the present invention is to provide a method of regulating mTOR activity by regulating interactions between PLD and raptor thereby regulating formation of a complex of PLD and mTOR through raptor. The regulating method may be comprise the step of inhibiting interactions between PLD and raptor, thereby inhibiting formation of a complex of PLD and mTOR through raptor, to inhibit mTOR activity.
More specifically, the present invention provides a method of inhibiting mTOR by inhibiting the interaction between PLD and raptor, thereby inhibiting formation of a complex of PLD and mTOR through raptor (PLD/raptor/mTOR complex, Fig 24). The inhibition of the formation of the PLD/raptor/mTOR complex may be conducted by inactivating a binding domain of PLD, especially PLD2, capable of binding to raptor (raptor binding domain of PLD or PLD2), or a binding domain of raptor capable of binding to PLD, especially PLD2 (PLD- or PLD2 binding domain of raptor). The raptor binding domain of PLD may comprise a TOR signal (TOS) motif-like sequence. In a preferable embodiment, the PLD may be a PLD2, and the raptor binding domain of PLD2 may be a polypeptide consisting of 50 to 200 amino acids, more preferably 100 to 180 amino acids, and essentially comprising PH domain of PDL2, more preferably the amino acid sequence of FEVQV (SEQ ID NO: 4) that is one of TOS motif-like sequence. In an embodiment, the raptor binding domain of PLD2 comprises the amino acid residues from the 186 position to the 308 position in the full-length amino acid sequence of PLD2 (SEQ ID NO: 2).
The inactivation of the raptor binding domain of PLD may be conducted by modifying the amino acid sequence of the raptor binding domain. For example, the modification of the raptor binding domain of PLD may be deletion of one or more amino acids located in the TOS motif-like sequence, preferably one or more amino acids located in the amino acid sequence of SEQ ID NO: 4. Alternatively, the modification of the raptor binding domain of PLD may be substitution of one or more amino acids located in the TOS motif-like sequence, preferably one or more amino acids located in the amino acid sequence of SEQ ID NO: 4, with other amino acid(s), preferably selected from the group consisting of alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, asparagine, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, glutamic acid, arginine, histidine, and lysine. Alternatively, the modification of the raptor binding domain of PLD may be addition of one or more amino acids, preferably selected from the group consisting of alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, asparagine, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, glutamic acid, arginine, histidine, and lysine, to the TOS motif-like sequence, preferably the amino acid sequence of SEQ ID NO: 4.
The PLD binding domain of raptor may comprise the amino acid residues
from the 1020 position to the 1335 position in the full-length amino acid sequence of raptor (SEQ ID NO: 5). The inactivation of the PLD binding domain of raptor may be conducted by deleting the polypeptide fragment consisting essentially of the amino acid sequence of the raptor binding domain. Alternatively, the inactivation of the raptor binding domain of PLD may be conducted by change of pH or temperature of the raptor binding domain of PLD2 or the PLD2 binding domain of raptor, and the like.
The interaction between PLD2 and raptor may be regulated by nutrient levels, preferably amino acid level, more preferably leucine level, such that this interaction is stabilized under high nutrient conditions and weakened under low nutrient conditions.
Therefore, the interaction between PLD2 and raptor may be inhibited by decreasing the level of nutrients, preferably amino acids, more preferably leucine.
The method of inhibiting mTOR according to the present invention results in inhibiting the mTOR' phosphorylation activity on one or more mTOR effectors selected from the group consisting of ribosomal protein S6 kinase 1 (S6K1 ; e.g., NP 003152, NP 082535, etc.), and 4E-binding protein-1 (4EBP1; e.g., NP 004086).
Another aspect of the present invention is to provide a method of screening inhibitors of mTOR activity. The method of screening inhibitors of mTOR according to the present invention may comprise the steps of: contacting a candidate compound to a sample cell; examining the interaction between PLD and mTOR through raptor to form a complex; and determining the compound as an inhibitor of mTOR activity when the level of the interaction between PLD and mTOR decreases compared with that in other sample cells without contacting with the compound.
The sample cell may be any cell capable of expressing PLD, more preferably PLD2. For example, the sample cell may be selected from the group consisting of a human embryonic kidney (HEK293), a human epithelial ovarian cancer cell (OVCAR-3), COS7 cell, a human cervical cancer (HeLa) cell, a human colon cancer cell (PC-3), a human breast cancer cell (MB231), a human hepatoma (HepG2), a human breast cancer cell (MCF-7), a human T cell leukemia (Jurkat), and the like. The inhibitor of mTOR may be useful in treating mTOR-related metabolic diseases, such as cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis
complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc. Therefore, the method of the present invention may also used in screening agents of mTOR-related metabolic disease selected from the group consisting of cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc.
The interaction between PLD and mTOR through raptor may be examined by any conventional method, for example immunoprecipitation, but not limited thereto.
Another aspect of the present invention is to provide the amino acid sequence of SEQ ID NO: 4 as a target for screening of an agent of treating mTOR-related metabolic diseases may include cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc.
Still other aspect of the present invention is to provide methods and compositions for treating mTOR-related metabolic diseases by inhibiting mTOR activity, more specifically, by inhibiting the interaction between PLD2 and raptor, thereby inhibiting the formation of a complex of PLD2 and mTOR through raptor (PLD/raptor/mTOR complex). The treating method may comprise the step of inactivating the raptor binding domain of PLD, thereby inhibiting formation of a complex of PLD and mTOR through raptor. The inactivation of the raptor binding domain of PLD is as aforementioned. Alternatively, the treating method comprises the step of administering an effective amount of an inhibitor of mTOR as an active ingredient, wherein the inhibitor of mTOR may be screened by the screening method according to the present invention. The composition may contain an effective amount of an inhibitor of mTOR as an active ingredient. The inhibitor of mTOR may be any material having the activity to prevent PLD from binding to raptor, thereby inhibiting the formation of a complex of PLD and mTOR through raptor. The inhibitor of mTOR may be any material capable of inactivating the raptor binding domain of PLD by various means as aforementioned. Alternatively, the inhibitor of mTOR may be a compound screened by the screening method according to the present invention.
The mTOR-related metabolic diseases may include cancer, diabetes, obesity, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome,
Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc.
In terms of sensing mitogenic signal as a form of PA through complex formation, this appears an efficient means of responding quickly and specifically. Moreover, the coordinated organization of multiple proteins by scaffold proteins is important for signaling efficiency and specificity, as exemplified in KSR-mediated MAPK regulation (Raabe, T., Rapp, U.R. Science's STKE (2002) http://www.stke.Org/cgi/content/full/sigtrans:2002/136/pe28. which is incorporated herein as an reference). KSR, a kinase suppressor of Ras, functions as a scaffold and thus helps assemble MAPK pathway components into a localized signaling complex. It is likely that the interaction of the upstream regulator (i.e., PLD2) with scaffold (i.e., raptor) is also important for localized mTOR signaling complex, since downstream effectors (i.e., S6K1 and 4EBP1) use same scaffold (i.e., raptor) to localize at the mTOR complex. Furthermore, it has been reported that various proteins as well as mTOR can interact with PA. Interestingly, in the present invention, the novel role of PLD2 in the regulation of the other PA binding proteins, such as mTOR, is examined.
S6K1 and 4EBP 1 use their TOS motifs to interact with raptor in similar ways, and therefore compete with each other for binding to raptor (Fig. 6). However, in the present invention, PLD2 is found to share raptor with S 6Kl or 4EBP 1 despite their possessing a TOS motif-like sequence. The present invention find that the PLD2 binding site in raptor is the amino acids 1020-1335 of the full-length raptor (SSEQ ID NO: 5) encompassing WD40 repeat at C-terminus (Fig. 11). It is not clear why PLD2 favor the C-terminal WD40 domain to bind to raptor, and it is possible that PLD2 has additional binding motifs that interact with this domain. Although over-expression of PLDl as well as PLD2 activates the mTOR pathway in HEK293 cells, mTOR is likely to interact with PLD2 only, which implies an alternative pathway for the PLDl -dependent activation of the mTOR pathway, possibly through Cdc42/S6K1 signaling. This results also show that the silencing effect of PLDl on mTOR signaling is modest and completely rescued by PA treatment, whereas PLD2 effect on mTOR signaling is not rescued by exogenous PA treatment, demonstrating an obvious difference between PLDl and PLD2. Moreover, it is possible that PLD2 is under the control of PLDl since PLDl signals PLD2 through phosphoinositide 4-phosphate 5 kinase.
Knowledge about the molecular mechanism by which the mTOR pathway is regulated by cellular nutritional states and how impairment of the pathway leads to metabolic diseases, such as cancer, obesity, diabetes, hamartoma syndrome including tuberous sclerosis complex, Peutz-Jeghers syndrome, Cowden disease, tissue/organ hypertrophy including cardiac hypertrophy, etc., is critically required. The findings of the present invention may be the first step toward attainment of such knowledge. This may be supported by the determination of Rheb-mediated regulation of the mTOR pathway. Interaction of PLD2 with Rheb is stabilized in nutrient-rich condition. Also, interaction of PLD2 with raptor is stabilized in nutrient-rich condition. It may be speculated that these two interactions are a regulatory point for nutrient-induced mTOR activation. Identification of molecular mechanism may provide an important understanding how nutrient impinges on the mTOR complex.
Enhancement of PA production has been reported in various cancer tissues and tumors including prostate cancer and breast cancer. In most cases, this is correlated with overexpression of PLD. However, the mechanism how this is related with tumorigenesis has not been suggested. Our identification of the role of PLD2 in the mTOR signaling suggests the potential molecular mechanism for PLD2-mediated tumorigenesis.
The present invention is further explained in more detail with reference to the following examples. These examples, however, should not be interpreted as limiting the scope of the present invention in any manner.
EXAMPLE
Example 1: Preparation of Materials
The materials used in the following examples were as follows:
The enhanced chemiluminescence kit and dipalmitoylphosphatidyl [methyl-
3H]choline were purchased from Amersham Biosciences. Horseradish peroxidase- conjugated goat anti-rabbit IgG and goat anti-mouse IgA, IgM, and IgG were from
Kirkegaard & Perry Laboratories, Inc. (Gaithersburg, MD). Polyclonal antibody was raised against PLD as previously described in "Lee, T. G, Park, J. B., Lee, S. D.,
Hong, S., Kim, J. H., Kim, Y., Yi, K. S., Bae, S., Hannun, Y. A., Obeid, L. M. et al.
Biochim. Biophys. Acta 1347 (1997) 199", which is hereby incorporated by reference. Antibodies against mTOR, pS6Kl (pThr 389), S6K1, p4EBPl(pThr 37/46), and 4EBP 1 and rapamycin were from Cell Signaling Technology (Beverly, MA. Polyclonal raptor antibody was a generously gift from Dr. David M. Sabatini (MIT, USA). Protein A-Sepharose was from RepliGen (Needham, MA). CHAPS was from Sigma. Dulbecco's modified Eagle's medium (DMEM) and LipofectAMINE were from Invitrogen. C-6 phosphatidic acid was from Avanti, and recombinant 4EBP 1 was purchased from Stratagen. Cells and vectors used the following examples were obtained from Invitrogen, unless differently mentioned.
Example 2: Preparation of PIasmids
Mammalian expression vectors for PLDl^, PLD2™1, PLD2ΔN184, PLD2ΔN308, and PLD2K758R were used as described in "Park, J.B., Kim, J.H., Kim, Y., Ha, S.H., Yoo, J.S., Du, G, Frohman, M.A., Suh, P.G., Ryu, S.H. J. Biol. Chem. 275 (2000) 21295," "Kim, J.H., Kim, J.H., Ohba, M., Suh, P.G., Ryu, S.H. MoI. Cell. Biol. 25 (2005) 3194" and "Lee, J.S., Kim, J.H., Jang, I.H., Kim, H.S., Han, J.M., Kazlauskas, A., Yagaisawa, H., Suh, P.G., Ryu,S.H. J. Cell Sci. 118 (2005) 4405," which are incoperated herein as refernceds. Expression vectors for HA-mTOR™*, myc-mTOR^, myc-raptoΛ HA-raptor^ and HA-raptor194YDC/AAAmt were gifts from Dr. David M. Sabatini (MIT) (Kim, D.H., et al. mTOR interacts with raptor to form a nutrient- sensitive complex that signals to the cell growth machinery. Cell 110, 163-175 (2002), which is hereby incorporated by reference). To introduce the TOS-motif mutation in PLD2, pCDNA3.1(+)/PLD2 containing wild type PLD2 was PCR amplified using the following oligomers; sense (5'GGC CGA GAC CAA GTT TGT TAT CGC3'; SEQ ID NO: 6), antisense (F265A:5'CCA TCG ATC CGC ACG CCG TGC CGT GCC TCC GTG CTC CTT TTC CCC ACT TGC ACC TCA GCG CCA GG3'; SEQ ID NO: 7), antisense (E266R:5'CCA TCG ATC CGC ACG CCG TGC CGT GCC TCC GTG CTC CTT TTC CCC ACT TGC ACC CTA AAG CCA GG3'; SEQ ID NO: 8). DNA fragments generated by PCR and pCDNA3.1(+)/PLD2(WT) were treated with Xhol and CIa I.
Example 3: RNA interference
Pairs of 21 -nucleotide sense and antisense RNA oligomers were synthesized and annealed by Dharmacon Research, Inc. (Lafayette, CO). The oligonucleotides used for PLD2 were: sense, 5'-AAG AGG UGG CUG GUG GUG AAG-3' (SEQ ID NO: 9) and antisense, 5'-CUU CAC CAC CAG CCA CCU CUU-3' (SEQ ID NO: 10), which correspond to human PLD2 coding nucleotides 703-723. The oligonucleotides used for PLDl were: sense, 5'-AAG GUG GGA CGA CAA UGA GCA-3' (SEQ ID NO: 11), and antisense, 5'-UGC UCA UUG UCG UCC CAC CUU-3' (SEQ ID NO: 12), which correspond to human PLDIa coding nucleotides 1455-1475. All siRNA sequences were subjected to BLAST in the NCBI database and complete matches were only found for PLD2 sequences. Luciferase GL2 duplex was purchased from Dharmacon Research, Inc. and was used as a negative control. For add-back experiment for PLD2 silencing, three residues of human PLD2 cDNA (nucleotides 703-723 of PLD2; AAGAGGTGGCTGGTGGTGAAG; SEQ ID NO: 13) are substituted to AAGAGATGGCTAGTAGTGAAG for addback mutants of PLD2wt (Kim, J.H., Kim, J.H., Ohba, M., Suh, RG, Ryu, S.H. MoI. Cell. Biol. 25 (2005) 3194, which is hereby incorporated by reference). This mutation is silencing mutations. This gene is subcloned into mammalian expression vector pcDNA3.1 (Invitrogen) and digested with restriction enzymes Kpnl and Xbal. These mutations are confirmed through nucleotide sequence analysis.
Example 4: Cell culture and plasmid/siRNA transfection
COS7 cells (ATCC, CRL-1651) were maintained in a 5% CO2 humidified atmosphere at 37 "C and fed DMEM supplemented with 10% bovine calf serum (HyClone). HEK293 cells (ATCC, CRL-1573) and OVCAR-3 cells (ATCC, HTB- 161) were fed DMEM supplemented with 10% fetal bovine serum (HyClone). Cells grown on tissue culture dishes was transiently transfected using LipofectAMINE, as described in "Kim, J.H., Kim, J.H., Ohba, M., Suh, P.G., Ryu, S.H. MoI. Cell. Biol. 25 (2005) 3194" and "Lee, J.S., Kim, J.H., Jang, I.H., Kim, H.S., Han, J.M., Kazlauskas, A., Yagaisawa, H., Suh, RQ, Ryu,S.H. J. Cell Sci. 118 (2005) 4405," which are hereby incorporated by reference. Cells were allowed to express the recombinant proteins for 24hr after transfection and then deprived of serum for additional 24hr. The cells were then subjected to co-immunoprecipitation analysis. For knockdown
with siRNA, cells were grown for 36-48hrs before serum deprivation.
Example 5: Co-immunoprecipitation
After harvesting C0S7 cells, total extracts were prepared by brief sonication in ice-cold lysis buffer (4OmM HEPES pH7.5, 12OmM NaCl, ImM EDTA, 1OmM pyrophosphate, 1OmM glycerophosphate, 5OmM NaF, 1.5mM Na3VO4, 0.5% CHAPS, 1 raM PMSF, protease inhibitor cocktails). Clarified extracts were mixed with 2 μg of the respective antibodies. Then protein A-Sepharose beads were added to isolate the antibody complex. After four washings with lysis buffer, the final immunoprecipitates were washed once with wash buffer (5OmM HEPES pH7.5, 15OmM NaCl), and then subjected to SDS-PAGE using Hyperfilm (Amersham Pharmacia Biotech), nitrocellulose membranes (Watmann), Power supply (Amersham Pharmacia Biotech), Electrophoretic Transfer unit (Hoefer Scientific Instruments), and ECL™ (Amersham Pharmacia Biotech).
Example 6: Western blot analysis
Proteins were separated by SDS-PAGE on 8-16% gradient gels, and the separated proteins were transferred onto nitrocellulose membranes and blocked with TTBS buffer (1OmM Tris-HCl, pH 7.6, 15OmM NaCl, and 0.05% Tween-20) containing 5% skimmed milk powder. The SDS-PAGE was performed using Hyperfilm (Amersham Pharmacia Biotech), nitrocellulose membranes (Watmann), Power supply (Amersham Pharmacia Biotech), Electrophoretic Transfer unit (Hoefer Scientific Instruments), and ECL™ (Amersham Pharmacia Biotech). Membranes were then incubated with primary antibody at the concentration recommended by the manufacturer for 4hr at room temperature. Unbound antibody was washed away with TTBS buffer. Membranes were subsequently incubated with horseradish peroxidase-conjugated secondary antibody for lhr at room temperature, washed five times with TTBS buffer, and developed using an ECL system.
Example7: In vivo PLD assay
In vivo PLD activity was assayed by measuring the formation of phosphatidyl-butanol as described in "Lee, J.S., Kim, J.H., Jang, I.H., Kim, H.S., Han,
J.M., Kazlauskas, A., Yagaisawa, H., Suh, RG, Ryu,S.H. J. Cell Sci. 118 (2005) 4405," which is hereby incorporated by reference. In brief, cells were loaded with [3H]myristic acid (2μCi/ml) for 8 hrs and then washed twice with DMEM. Labeled cells were incubated with 0.4% butanol for lOmin to measure basal PLD activity. Total lipids were extracted with 1.2 ml of methanol: IM NaCl: chloroform (1:1 :1 by volume) and then separated by thin-layer chromatography on silica gel plates. The amount of [3H]phosphatidyl-butanol formed was expressed as a percentage of total [3H]lipid to account for cell labeling efficiency differences.
Example 8: In vitro kinase assay for mTOR activity.
Recombinant myc-mTOR was expressed with the indicated proteins and then immunoprecipitated using anti-myc antibody, as previously described in Kim, D.H., Sarbassov, D.D., AH, S.M., King, J.E., Latek, R.R., Erdjument-Bromage, H., Tempst, P., Sabatini, D.M. Cell 110 (2002) 163, which is hereby incorporated by reference. Recombinant 4EBP 1 (Stratagen) was used as a substrate for in vitro kinase assays. Activities were measured using anti-phospho-4EBPl antibody (phosphor-37/46). The kinase assay was performed by mixing buffer containing 25mM Hepes pH7.4, 5OmM KCl, 1OmM MgCl2, 4mM MnCl2, 20% glycerol, 2mM DTT, 0.ImM ATP, lμg 4EBP 1 with the indicated immunoprecipitates and then incubated at 30°C for 15min.
Example 9: Examination of mTOR activation by PLD2
PLD hydrolyzes phosphatidylcholine to generate PA and this process constitutes a link whereby mitogenic signals impinge on the mTOR pathway. However, the mechanism by which PA activates mTOR in cells remains unknown. To gain further insight into this process, the present example compared the effects of two mammalian PLD isozymes, PLDl and PLD2, on mTOR activation using isozyme- specific siRNAs in human embryonic kidney (HEK) 293 cells, human ovarian cancer- derived OVCAR-3 cells, and monkey epithelial COS7 cells. siRNAs for PLDl or PLDl were transfected into HEK293, OVCAR-3, and COS7 cells, respectively, using lipofectamine, as described in Examples 3 and 4. After 36hrs, cells were deprived of serum for 24hrs, and then were lysed in CHPAS- containing lysis buffer (Sigma), as described above. siRNA for luciferase was used as a negative control. Equal protein loadings were verified versus actin. Then, the
phosphorylations of S6K1 and 4EBP1 in the cells were examined and the obtained results are shown in Fig. 1. As shown in Fig.l, the knockdown of PLD2 dramatically reduced the phosphorylations of S6K1 and 4EBP1, well-known mTOR effectors, as compared with those of PLDl knockdown. The results suggest that PLD has an essential role in mTOR activation.
Next, another experiment was conducted to test whether exogenous PA can rescue mTOR signal abrogation in PLD2-knocked-down cells. HEK293 and COS7 cells were transfected with the indicated siRNAs using lipofectamine. After 36 hrs, cells were deprived of serum for 24hrs. lOOμM of C-6 PA solubilized in DW was then treated for 30min. Resulting lysates were subject to SDS-PAGE. The SDS-PAGE results were shown in Fig. 2.
The inventor reasoned that if the role of PLD2 in mTOR activation is solely that of PA ge neration, then the exogenous addition of PA should completely rescue mTOR signaling despite PLD2 expression. However, according to Fig.2, to is found that PA could not trigger S6K1 phosphorylation in PLD2-knocked-down HEK293 and COS7 cells. Summarizing, the isozyme-specific knockdown of PLD by using siRNA suggests that PLD2 has a profound role in mTOR signaling, and that PLD2 might have another mechanism to activate mTOR signaling in accord with PA generation.
Example 10: Formation of a complex of PLD2 with mTOR through PLD2's TOS motif-like sequence
This example investigated the reason why PA could no longer activate mTOR in the absence of PLD2 expression. One possibility concerns the proximity of PLD2 around the mTOR complex. PA contains a long acyl chain that might restrict its membrane mobility; moreover, PA is a transient species. These properties of PA encouraged the inventors to speculate that mTOR might be localized near PLD to monitor the PA produced in response to upstream signals; moreover, such a possibility suggests the existence of a physical connection between mTOR complex and PLD.
To test this possibility, endogenous mTOR was immunoprecipitated with anti- mTOR antibody. C0S7 cell lysates (lOmg) were prepared under different lysis conditions using Triton X-IOO or CHPAS and then subjected to co-IP
(immunoprecipitation) analysis against anti-mTOR antibody, as described above
Examples 1 to 5. Resulting immunoprecipitates were subjected to SDS-PAGE.
The obtained results were shown in Fig. 3 (arrows indicate the positions of blotted protein). As shown in Fig. 3, it was found that these immunoprecipitates from C0S7 and HEK293 contained endogenous PLD2. The interaction between mTOR and PLD2 was sensitive to Triton X-IOO, but stable in CHAP S -containing lysis conditions, similarly to the mTOR-raptor interaction.
Further, lysates from COS7 cells overexpressing myc-mTOR above and PLDl or PLD2 were co-immunoprecipitated with anti-myc antibody and immunoblotted with anti-PLD antibody, as described above Examples 1 to 5. The obtained SDS-PAGE results were shown in Fig. 4. As shown in Fig. 4, recombinant PLD2 also formed a complex with recombinant mTOR, and this interaction was specific for PLD2 as recombinant PLDl did not interact with mTOR. The recombinant PLD2 was prepared by expressing hPLD2 in a baculovirus expression system and purifying the expressed product from detergent extracts of baculovirus- infected Sf9 cells (Invitrogen) using chelating Sepharose affinity column chromatography. The recombinant myc-mTOR was expressed and immunoprecipitated using anti-myc antibody.
To identify the region of PLD2 responsible for the interaction with mTOR, N- terminal truncated PLD2 fragments were prepared as described in "Park, J.B., Kim, J.H., Kim, Y., Ha, S.H., Yoo5 J.S., Du, G, Frohman, M.A., Suh, P.G, Ryu, S.H. J. Biol. Chem. 275 (2000) 21295," which is hereby incorporated by reference, and used for site-mapping analysis. The process resulted in the identification of a PH domain- containing region in PLD2 (i.e., a,a. 185-308). The obtained schematic view of PLD2 was shown in upper panel of Fig 5, showing a schematic view of PLD2 N- terminal deleted fragments versus whole PLD2. Then, myc-mTOR"1 was transfected with the indicated PLD2 fragments and co-IP analysis was performed as above. The obtained results were shown in lower panel of Fig. 5 (IP; immunoprecipitation, T.Lys.; Total lysates), showing that the immunoprecipitation of mTOR is generated when using wild-type PLD2 or ΔN184 PLD2 (184 amino acid residues at N-terminus are deleted), but not when using ΔN308 PLD2, indicating that the raptor bonding site of PLD2 resides between 185 and 308 amino acid residues.
Interestingly, in PLD2, but not in PLDl, this region was found to contain FEVQV (a.a. 265-269 of PLD2; SEQ ID NO: 4), which is a TOS motif pattern present
in both S6K1 and 4EBP 1 that allows binding with mTOR through raptor (Fig.6 upper panel; TOS motifs of human 4EBP1 and human S6K1 were compared with the putative TOS motif in human/rat/mouse PLD2. Corresponding regions in human/rat/mouse PLDl are shown and asterisks are used to highlight differences). Therefore, point mutants, PLD2F265A and PLD2E266R were prepared and examined their binding with mTOR. myc-mTOR was expressed with the indicated PLD2 mutants and the resulting lysates were subjected to co-IP analysis. Endogenous raptor was immunoblotted with anti-raptor polyclonal antibody described above. The obtained results were shown in lower panel of Fig. 6. It was found that both of these PLD2 point mutants abrogated its interaction with mTOR, thus supporting the notion that these residues are important for PLD2-mT0R binding, and that they constitute a TOS motif, as found in S6K1 and 4EBP 1.
Example 11: Formation of a complex of PLD2 with mTOR through raptor mTOR exists as two protein complexes in mammalian cells, i.e., cell growth- related mTOR functions in cooperation with raptor, whereas cytoskeletal organization- related mTOR function cooperates with rictor/mAVO3. The finding of Example 10 regarding a TOS motif-like sequence in PLD2 suggests that PLD2 may form a complex with mTOR by interacting with raptor. This example tested whether PLD2 forms a complex with mTOR by binding to raptor.
Myc-raptor was expressed with PLDl or PLD2 into C0S7 cells as described above. Resulting lysates were prepared using Triton X-100-containing lysis conditions and then subjected to co-IP analysis. The obtained results were shown in Fig. 7. HA-raptor and PLD2 were expressed and lysed in lysis buffer containing different detergents, Triton X-IOO and CHAPS, and then subjected to co-IP analysis. Endogenous mTOR was blotted by anti-mTOR antibody. The results were shown in Fig. 8. PLD2 was expressed with either HA-raptor^ or HA-raptor I94YDC/AAAmt and the resulting lysates were immunoprecipitated with anti-HA antibody. Bound mTOR and PLD2 were detected by immunoblotting. The results were shown in Fig. 9. HA-raptor was expressed with the indicated PLD2 constructs into C0S7 cells. Cells were lysed in lysis buffer containing Triton X-IOO and then subjected to co-IP analysis using anti-HA antibody. The results were shown in Fig. 10.
In the present example, it was found; 1) that recombinant PLD2 specifically interacts with recombinant raptor even under Triton X-IOO lysis conditions (Fig. 7); 2) that the interaction between PLD2 and raptor is insensitive to Triton X-IOO (Fig. 8) and that it does not require an interaction between raptor and mTOR (Fig. 9); 3) that the interaction between PLD2 and raptor under Triton X-100 lysis conditions is also dependent on TOS motif-like sequence of PLD2 (Fig. 10).
These findings raise the possibility the PLD2 -raptor interaction is independent of mTOR. However, endogenous mTOR complex was found to contain raptor and PLD2 (Fig. 3), and the interaction between mTOR and PLD2 was also found to be dependent on its TOS motif-like sequence (Fig. 6). These findings strongly suggest that PLD2 forms a complex with mTOR-raptor, and that in this context raptor provides docking site for PLD2 by interacting with a TOS motif-like sequence in PLD2.
Example 12: PLD2 binding site in raptor
Raptor contains a conserved N-terminal (RNC) domain, which is followed by three HEAT repeats in its central region and 7 WD40 repeats in the C-terminal portion. Moreover, these HEAT and WD40 repeats are protein-protein interaction motifs and are present in many eukaryotic proteins. To identify the PLD2 binding sites in raptor, truncated raptor mutants were used for site mapping analysis. Fig. 11 is a schematic view of raptor fragments and whole raptor (left panel). PLD2wt was transfected with the indicated HA-raptor constructs and co-IP analysis was performed using anti-HA antibody, as described above. The results were shown in right panel of Fig. 11 (asterisks indicate expressed raptor fragments). It is believed that the WD40 repeat of raptor is responsible for PLD2 binding, because it was found that amino acids 1020-1335 of raptor, which encompasses the WD40 repeat, can interact with PLD2.
Then, the interaction preferences of PLD2, S6K1 and 4EBP 1 for raptor were directly compared, because S6K1 and 4EBP 1 primarily use their TOS motifs to interact with raptor. HA-raptor1"646 and HA-raptor1020"1335 were expressed with PLD2, myc-S6Kl, or myc-4EBPl . After co-IP analysis with anti-HA antibody, resulting immunoprecipitates were subjected to SDS-PAGE analysis. Anti-myc antibody was
used to determine rayc-S6Kl and myc-4EBPl levels. The obtained results were shown in Fig. 12 (asterisks indicate expressed raptor fragments).
As shown in Fig. 12, 4EBP 1 were found to favor the N-terminal region (a. a.
1-646) of raptor, though they showed different preference on raptor binding with 5 PLD2. These results raised the possibility that PLD2 forms a complex with either
S6K1 or 4EBPl through raptor.
This was found to be the case, as PLD2 was found in raptor immunoprecipitates with S6K1 or 4EBP 1 as shown in Fig. 13. The indicated recombinant proteins were expressed into COS7 cells. Resulting lysates were 10 obtained under CHAPS-containing conditions, divided in two, and subjected to co-IP analysis with anti-HA or anti-myc antibodies. The obtained results were shown in
Fig. 13. Likewise, immunoprecipitation with recombinant S6K1 or 4EBP 1 also showed PLD2 bound raptor with S6K1 or 4EBP 1.
As expected, PLD2-raptor-S6Kl complex formation was found to require the lδ integrity of the PLD2 TOS motif-like sequence as shown in Fig. 14. The indicated proteins were expressed in COS7 cells and the resulting lysates were subjected to co-
IP analysis with anti-myc antibody. The obtained results were shown in Fig. 14. In case of S 6Kl and 4EBP 1, it was reported that they compete for interaction with raptor.
However, PLD2 uses WD40 region of raptor to interact. Therefore, it is reasonable 20 that PLD2 can form a complex with either S6K1 or 4EBP1 through raptor.
Altogether, more detailed molecular analysis revealed that PLD2 binds the mTOR/raptor complex through raptor.
Example 13: PLD2-raptor interaction and enzymatic activity of PLD2
2δ To determine whether the PLD2-raptor binding is an aspect of mTOR pathway activation, the ability of PLD2 point mutants to stimulate S6K1 phosphorylation was examined.
In vivo PLD assays were performed in C0S7 cells expressing the various PLD2 constructs shown in Fig 15. The obtained PBt (phosphatidyl-butanol)
30 formation results were shown in Fig. 15. Fig 15 shows that PLD2F265A and PLD2E265R have similar level of enzymatic activity compared to PLD2wt, suggesting that the localization of PLD2 at the mTOR complex is not important for its enzymatic
property.
However, PLD2F265A and PLD2 E266R did not trigger S6K1 phosphorylation versus PLD2™*, as shown in Fig. 16 demonstrating the results of western blot analysis of the obtained Lysates (Fig. 15). As shown in Fig. 17, myc-tagged recombinant mTOR with the indicated
PLD2 constructs was expressed. The myc-immunoprecipitate obtained was used for co-IP analysis. After co-IP analysis, myc-immunoprecipitates were subjected to in vitro kinase assays (IVK) for mTOR, as described above. The results were shown in Fig 17. The results obtained correlated with those of S6K1 phosphorylation in as much as PLD2F265A and PLD2E266R could not trigger mTOR kinase activity. It is possible that PLD2 itself has some effect on mTOR kinase activity as was raptor or GβL. However, lipase-inactive PLD2K758R, which is capable of binding mTOR- raptor, did not activate mTOR kinase activity, thus excluding any direct effect of PLD2 on mTOR kinase activity. In addition, this activation is not due to PA production during kinase assays, because our in vitro kinase assay did not contain phosphatidylcholine, an essential substrate for PLD. Thus this finding excludes mTOR activation by PA during these conditions. It was speculated that PLD2 activates mTOR before cell lysis via an unidentified mechanism, such as, a conformational change or a posttranslational modification. Myc-mTOR and HA-PLD2 were expressed in COS7 cells. After 24hrs, cells were deprived of serum for 24hrs and then were treated with 20% of BCS for the indicated times to stimulate mTOR signaling. After co-IP analysis with anti-myc antibody, bound HA-PLD2 was proven using anti-HA antibody. The obtained results were shown in Fig. 18. As shown in Fig. 18, the regulation of the mTOR-raptor interaction by PLD2 can be excluded because PLD2 did not have any effect on the mTOR-raptor interaction. Also, neither reducing PA generation with 1-butanol nor adding PA modulates the mTOR-raptor interaction. These results suggest that both the physical interaction between PLD2 and raptor and the enzymatic activity of PLD2 are concurrently required for mTOR pathway stimulation. It has been reported that the mTOR-raptor interaction is not changed by mitogen stimulation (Kim, D.H., Sarbassov, D.D., AIi, S.M., King, J.E., Latek, R.R., Erdjument-Bromage, H., Tempst, P., Sabatini, D.M. Cell 110 (2002) 163, incorporated
herein as a reference), which suggests the existence of unidentified mechanism to sense mitogenic signal. Various mitogens are known to activate PLD, and lead to PA production (Exton, J.H. Rev Physiol Biochem Pharmacol. 144 (2002) 1; and Cockcroft, S. Cell MoI. Life Sci. 58 (2001) 1674, which are incorporated herein as a reference).
The finding of the participation of PLD2 in mTOR activation encouraged the present inventors to determine whether PLD2 mediates the mitogenic activation of mTOR signaling.
First, the dynamicity of the PLD2-mT0R interaction was tested. As shown in Fig. 18, 20% bovine calf serum (BCS) potently increased the interaction between PLD2 and mTOR within lmin of treatment and maintained this for 30min. The phosphorylations of S6K1 and 4EBP 1 followed at 5 min.
The indicated siRNAs were transfected into COS7 cells, and 36hrs later, cells were deprived of serum for 24hrs. 20% of BCS was then treated and the resulting lysates were subjected to SDS-PAGE. The results were shown in Fig. 19. As expected, knockdown of PLD2 profoundly reduced the mitogen-dependent phosphorylation of S6K1, whereas PLDl knockdown had only a modest effect on S 6Kl phosphorylation, thus supporting the notion that PLD2 is a mainly involved in mitogen-induced mTOR signaling. To further check the importance of PLD2 in mitogen-dependent mTOR signaling, PLD2 expression was rescued using siRNA-resistant expression constructs. PLD2 siRNAs were transfected with the indicated PLD2 add-back constructs as described in Experimental Procedures. 20% of BCS or lOOμM of C-6 PA was used to stimulate mTOR signaling. The obtained results were shown in Fig. 20. As shown in Fig. 20, it was found that mitogen-induced S6K1 phosphorylation was rescued only by PLD2wt. Adding-back of PLD2F265A, PLD2 E266R, and PLD2K758R did not rescue S6K1 phosphorylation attenuation in PLD2-knocked-down cells. Interestingly, the exogenous PA-dependent phosphorylation of S6K1 was rescued by PLD2wt and PLD2K758R, but not by PLD2F265A and PLD2 E266R, which again highlighted the requirement for PLD2 interaction with raptor, and PA production at the mTOR complex for PLD2-dependent mTOR activation.
Example 14: Investigation of nutrient dependent PLD2 activation
The above examples suggest that both the PLD2/raptor interaction and the enzymatic activity of PLD2 are required for mTOR pathway stimulation. Again, these relations suggest that PLD2 is a new binding protein that has physical and functional connections with the mTOR complex.
Until now, the function of PLD2 in nutrient signaling has not been proposed. To this end, the importance of PLD2 in nutrient signaling was tested. The stimulatory effect of leucine on S6K1 was significantly reduced by 1-butanol. Based on the result, PLD2 activity in response to nutrient levels was checked. PLD2wt was transfected and allowed to express for 24hr. After serum-deprivation for 16hr and labeling with [3H]myristic acid (2(Ci/ml) for 8hr, cells were treated with rapamycin (2OnM), D-PBS, and leucine-free media. After 45min, same treatments including leucine-added media were added with 0.4% 1-butanol to measure PBt formation. The obtained results were shown in Fig. 21, indicating that PLD2 activity was reversibly regulated by amino acid levels, especially by leucine levels.
To reveal the relationship between PLD2 activity and complex formation, the interaction between PLD2 and mTOR was tested. mTOR inhibition by rapamycin, which is a mTOR specific inhibitor, had no effect on the interaction between PLD2 and mTOR. However, the interaction between endogenous PLD2 and endogenous mTOR complex was increased by leucine treatment in leucine-deprived COS7 and HEK293 cells as shown Fig. 22. The results in Fig. 22 were obtained by lysing confluent COS7 and HEK293 cells and immunoprecipitating with anti-mTOR antibody after treating leucine-deprived cells with leucine.
Either HA-raptorwt/PLD2wt was transfected into HEK293 cells, and the cells were subjected to leucine deprivation. Co-IP after leucine treatment was followed by Western blot analysis. The results were shown in Figs. 23. The increase by leucine was attributed to enhanced binding between PLD2 and raptor, as shown in Fig. 23. Importantly, the interaction between Rheb and PLD2 was also regulated by nutrient levels such that this interaction was stabilized under high nutrient conditions and weakened under low nutrient conditions, which allowed a nutrient-dependent mTOR complex composed of mTOR, raptor, PLD2, and Rheb to be identified. These results are well correlated with reversible regulation of PLD2 activity against the level of leucine.