WO2008010096A2 - Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases - Google Patents
Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases Download PDFInfo
- Publication number
- WO2008010096A2 WO2008010096A2 PCT/IB2007/002936 IB2007002936W WO2008010096A2 WO 2008010096 A2 WO2008010096 A2 WO 2008010096A2 IB 2007002936 W IB2007002936 W IB 2007002936W WO 2008010096 A2 WO2008010096 A2 WO 2008010096A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- seq
- polypeptide
- acid sequence
- acid residues
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
- A61P31/06—Antibacterial agents for tuberculosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/41—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
Definitions
- the present invention relates to a method for preparing a mycobacterial polypeptide qualitatively similar to the native mycobacterial protein.
- the present invention also relates to the mycobacterial polypeptide obtained by the method of the invention and its use in method and kit for the diagnosis of mycobacterial related diseases, such as tuberculosis.
- the serum recognition of even the most promising TB antigens by sera can vary widely depending upon the country of origin of the studied cohort, as well as the AFB smear status and disease manifestations of the individuals within the population (18, 27, 37).
- M. tuberculosis M. tuberculosis
- CFP32 is one out of the 30 culture filtrate (CF) proteins that have emerged as potential candidates for the serological diagnosis of tuberculosis [37].
- the CFP32 coding gene is found exclusively in the M. tuberculosis complex as assessed by PCR and southern blot analysis of the genome of several mycobacterial strains [15].
- CFP32 was identified by mass spectroscopy, N-terminal sequencing and immunodetection [42, 43].
- CFP32 is expressed by M.
- tuberculosis complex members including BCG [14].
- Native CFP32 was detected in the sputum of patients with active pulmonary tuberculosis [14]. Furthermore, the virulence-related neutral red character typical of virulent mycobacteria, was recently shown by Andreu et al [3] to be associated with the cfp32 gene upon gene transfer into M. smegmatis. Moreover CFP32 level in the lung of active TB patients was positively correlated with amounts of the immunosuppressive cytokine IL10 [14]. These observations suggest that CFP32 may play a role in tuberculosis pathogenesis, and likely interact with the immune system, as shown previously by the detection of serologic reaction to E. coli expressed rCFP32 in approximately 30% of tuberculosis patients [14].
- M. smegmatis and BCG [54, 55, 56] were also used to express mycobacterial genes by heterologous complementation.
- M. smegmatis and BCG [54, 55, 56] were also used to express mycobacterial genes by heterologous complementation.
- these are not conventional systems for the production of high levels of recombinant proteins.
- heterologous complementation of MTB genes into BCG or M. smegmatis may be associated with gene modifications and loss of protein activity.
- these hosts will need to be manipulated in level 3 standard biosafety containment, if transfected with virulence-associated genes.
- level 3 standard biosafety containment if transfected with virulence-associated genes.
- more adapted expression systems need to be explored.
- the invention relates to a method for preparation of a purified recombinant mycobacterial polypeptide containing immunogenic epitopes substantially similar to the ones of its corresponding native Mycobacterium species protein, said method comprising : a) culturing a recombinant yeast cell expressing said polypeptide in a culture medium under conditions sufficient to effect expression of the polypeptide; and b) separating the polypeptide from the yeast cell or culture medium.
- the invention further relates to a purified recombinant mycobacterial polypeptide or a functional fragment thereof obtained by the above mentioned method.
- the invention also relates to a method for diagnosing a mycobacterial related infectious disease in a subject, comprising : a) contacting a sample of a subject with a recombinant mycobacterial polypeptide of the present invention, for a time and under conditions sufficient to form a polypeptide-mycobacterial specific antibody complex; and b) detecting the presence or absence of the complex formed in a).
- the invention also relates to a yeast host cell comprising a polynucleotide encoding a recombinant mycobacterial polypeptide of the present invention.
- the invention further relates to a kit for diagnosing a mycobacterial species related infectious disease in a subject, the kit comprising: a) a recombinant mycobacterial polypeptide of the present invention or a yeast host cell of the present invention; and b) reagents to detect a polypeptide-mycobacterial specific antibody immune complex.
- the invention further relates to an immunogenic composition capable to induce antibodies recognizing specifically the polypeptide of the invention.
- (C) rCFP32 produced in yeast is relatively more antibody reactive than rCFP32 trans-expressed in E. coli.
- Western blot was performed using varying indicated input amounts of rCFP32 produced in yeast or E. coli as detected by (/) anti-E. coli rCFP32 (rabbit) antisera and (H) anti-(His)6-tag mAb.
- the figure is derived from two different blots probed with either anti-E. coli rCFP32 (rabbit) antisera or anti-(His)6-tag mAb.
- band sizes of molecular weight markers (kDa) are indicated at left in the panel.
- FIG. 2 Sera from human test subjects show greater reactivity to yeast- expressed rCFP32 than E. co//-produced rCFP32.
- TB active TB case patients
- BCG-vaccin. BCG-vaccin.
- the results of statistical analyses of the mean serological responses are shown (calculated using either the paired t test or unpaired t test, as indicated in the text). Each data point represents one patient.
- Solid horizontal lines represent the mean of each category while dashed horizontal lines represent the cut-off values above which serological responses to rCFP32 were deemed positive. Cut-off values were determined using the mean for the healthy BCG vaccinated persons plus 2 standard deviations per the E. coli rCFP32 (cut-off A) or the yeast rCFP32 (cut-off B). OD492 nm values above the cut-off are taken to indicate the presence of serum antibodies to native CFP32 resulting from an immune response to an ongoing tubercle bacillus infection. As described in the text, statistical analyses of the data (Fisher's exact test) indicated that the rCFP32 produced in P. pastoris was superior to that trans-expressed in E.
- Solid horizontal lines represent the mean of each category while dashed horizontal lines represent the cut-off values above which serological responses to rCFP32 were deemed positive and were determined using the mean for the healthy PPD-negative/BCG- na ⁇ ve infants (cut-off A), or the healthy BCG-vaccinated persons (cut-off B), plus 2 standard deviations.
- OD492 nm values above cut-off B are taken to indicate the minimal presence of serum antibodies to native CFP32 resulting from an immune response to an ongoing tubercle bacillus infection.
- the associated results of statistical analysis of the data using Fisher's exact test are shown.
- the results of statistical analysis of the mean serological responses (calculated using the unpaired t test) are proved in the text and supported that there was a statistically significant difference in the means of each control group compared to the TB cohort.
- Figure 4 Junction of the Saccharomyces cerevisiae ⁇ mating factor pre- propeptide (underlined) and the CFP32 protein sequence (bold italic) (SEQ ID NO: 13).
- the Kex2 and Ste13 sites for signal sequence cleavage in P. pastohs are indicated with arrows. Arrow in bold indicate the actual cleavage of rCFP32.
- the four amino acids added to the NH2 terminus of CFP32 are boxed.
- FIG. 6 Expression of the CFP32 gene in yeast (Pichia pastoris). Heterologous expression of the CFP32 gene by pPICZ.577-transformed yeast as shown by Western blot. Ten ng of purified yeast rCFP32 run in 15% SDS-PAGE transferred to nitro cellulose and revealed using :
- Figure 8 Amino acid sequence (SEQ ID NO:1) of rCFP32.
- Figure 9 Nucleotide sequence (SEQ ID NO:2) encoding the mycobacterial polypeptide of Fig. 8.
- Figure 10 Amino acid sequence (SEQ ID NO:3) of the mycobacterial peptide CFP10.
- Figure 11 Nucleotide sequence (SEQ ID NO:4) encoding the mycobacterial peptide of Figure 10.
- Figure 12 Amino acid sequence (SEQ ID NO:5) of the mycobacterial peptide ESAT-6.
- Figure 13 Nucleotide sequence (SEQ ID NO:6) encoding the mycobacterial peptide of Figure 12.
- Figure 14 Amino acid sequence (SEQ ID NO:7) of the mycobacterial peptide DES.
- Figure 15 Nucleotide sequence (SEQ ID NO:8) encoding the mycobacterial peptide of Figure 14.
- Figure 16 Amino acid sequence (SEQ ID NO:9) of the mycobacterial peptide APA.
- Figure 17 Nucleotide sequence (SEQ ID NO: 10) encoding the mycobacterial peptide of Figure 16.
- Figure 18 Amino acid sequence (SEQ ID NO:11) of the mycobacterial peptide EXP.
- Figure 19 Nucleotide sequence (SEQ ID NO: 12) encoding the mycobacterial peptide of Figure 18.
- Figure 20 Control gel of the purification of CFP10 and ESAT-6 recombinant proteins produced in Pichia pastohs.
- Figure 21 A Control gels before and after deglycosylation with tunicamycin of recombinant CFP32 produced in Pichia in vivo.
- Figure 21 B Control gels before and after deglycosylation with endoglycosylase F of recombinant CFP32 produced in Pichia in vitro.
- Figure 22 Reactivity of the serums of tuberculous patients and healthy controls vaccinated with BCG with the rCFP32 product in Pichia before and after deglycosylation.
- “Acceptable carrier” means a vehicle for containing, for instance, a recombinant mycobacterial polypeptide obtained by the method of the invention that can be injected into a mammalian host without adverse effects.
- Suitable carriers known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions.
- Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i. e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.
- Epitope refers to the site on an antigen or hapten to which a specific antibody molecule binds or is recognized by T cells.
- the term is also used interchangeably with “antigenic determinant” or “antigenic determinant site.”
- “Fragment” refers to an isolated portion of a polypeptide, wherein the portion of the polypeptide is cleaved from a naturally occurring polypeptide by proteolytic cleavage by at least one protease, or is a portion of the naturally occurring polypeptide synthesized by chemical methods well known to one of skill in the art.
- the fragment of a polypeptide may be obtained by cleaving the polynucleotide encoding the recombinant polypeptide into multiple pieces, using restriction endonucleases, or a portion of the encoding polynucleotide may be synthesized by PCR, DNA polymerase or any other polymerizing technique well known in the art, and then after, the resulting piece may be expressed in the yeast host expression system of this invention by recombinant nucleic acid technology well known to one of skill in the art.
- Monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each mAb is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they can be synthesized by hybridoma culture, uncontaminated by other immunoglobulins.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the method of making monoclonal antibodies is common knowledge to a person skilled in the art.
- “Purified polypeptide” or “purified protein” means a protein which has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in a “substantially purified” form.
- “Substantially purified” generally refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides.
- a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample.
- Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion- exchange chromatography, affinity chromatography and sedimentation according to density.
- Recombinant broadly describes various technologies whereby genes can be cloned, DNA can be sequenced, and protein products can be produced. As used herein, the term also describes proteins or polypeptides that have been produced following the transfer of genes into the cells of host systems, such as a yeast host system.
- Sample refers to a variety of sample types obtained from an individual and can be used in a diagnostic or detection assay. The definition encompasses blood and other liquid samples of biological origin such as saliva, sputum, and pulmonary lavage fluid.
- Sequence identity means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide.
- amino acid or nucleotide sequence "identity” are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. MoI. Biol. 48:443-453).
- Substantially similar means that a first amino acid or nucleotide sequence has an amino acid or nucleotide sequence which is at least 90% identical to amino acid residues or nucleotides of a second amino acid sequence or of a nucleic acid sequence of a polypeptide of the present invention.
- “Therapeutically effective amount” of a recombinant mycobacterial polypeptide in the present invention is that amount necessary to allow the same to perform its immunological role without causing, overly negative effects in the host to which the composition is administered. The exact amount of recombinant mycobacterial polypeptide to be used and the composition to be administered will vary according to factors such as the type of condition being treated, the mode of administration, as well as the other ingredients in the composition.
- Transformation and transfection refer to the process of inserting a nucleic acid into a host.
- Many techniques are well known to those skilled in the art to facilitate transformation or transfection of a nucleic acid into a prokaryotic or eukaryotic organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules.
- salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules.
- immunogenic it refers to the property of a molecule or compound, such as a protein/polypeptide to induce in vivo or in vitro a cellular or humoral immune response.
- the term "recognizing specifically” refers to anti- bodies that bind with a relatively high affinity to one or more epitopes of a recombinant mycobacterial polypeptide obtained by the method of the invention, but which do not substantially recognize and bind molecules other than the one(s) of the invention.
- the term "relatively high affinity” means a binding affinity between the antibody and the protein of interest, namely a recombinant mycobacterial polypeptide obtained by the method of the invention, of at least 10 6 M “1 , and preferably of at least about 10 7 M "1 and even more preferably 10 8 M “1 to 10 10 M "1 . Determination of such affinity is preferably conducted under standard competitive binding immunoassay conditions which are common knowledge to one skilled in the art.
- a yeast host cell such as Pichia pastoris
- a yeast host cell is superior to the commonly used bacteria Escherichia coli for the production of high levels of recombinant mycobacterial antigens (such as the Mycobacterium tuberculosis culture filtrate antigen CFP32, the polypeptides CFP10, ESAT-6, acyl- carrier protein desaturase DESA1 (DES), fibronectin attachment protein (APA) and cell surface protein EXP53 (EXP)) that are further qualitatively closer to the native ones, for instance in terms of immunogenic properties such as epitope configuration.
- mycobacterial antigens such as the Mycobacterium tuberculosis culture filtrate antigen CFP32, the polypeptides CFP10, ESAT-6, acyl- carrier protein desaturase DESA1 (DES), fibronectin attachment protein (APA) and cell surface protein EXP53 (EXP)
- An aspect of the present invention thus relates to a method for preparing such a recombinant mycobacterial polypeptide by using a yeast host cell having the ability of producing higher levels of a recombinant mycobacterial polypeptide.
- the invention also relates to the recombinant mycobacterial polypeptide obtained by the afore mentioned method and its use in immunogenic compositions, and in methods and kits for diagnosing a Mycobacterial related disease, such as tuber- culosis.
- the present invention provides a method for preparing a recombinant mycobacterial polypeptide containing immunogenic epitopes substantially similar to the ones of its corresponding native Mycobacterial species protein.
- the method comprises : a) culturing a recombinant yeast cell expressing a polypeptide in a culture medium under conditions sufficient to effect expression of the polypeptide; and b) separating the polypeptide from the yeast cell or culture medium.
- said yeast cell consists of a Pichia pastoris cell.
- the recombinant mycobacterial polypeptide is a polypeptide derived from Mycobacterium tuberculosis, Mycobacterium africanum or Mycobacterium bovis.
- mycobacterial polypeptide is derived from Mycobacterium tuberculosis, it is selected in the group consisting of: CFP32 peptide, CFP 10 peptide, ESAT-6 peptide, DES peptide, APA peptide and EXP peptide.
- the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO:1 or an amino acid sequence at least 90% identical to amino acid residues 5 to 264 of SEQ ID NO:1 ;
- the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 103 of SEQ ID NO:3 or an amino acid sequence at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3;
- the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 98 of SEQ ID NO:5 or an amino acid sequence at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5;
- the DES peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 338 of SEQ ID NO:7 or an amino acid sequence at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7;
- the APA peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 325 of SEQ ID NO:9 or an amino acid sequence at least 90% identical to amino acid residues 1 to 325 of SEQ ID NO:9;
- the EXP peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 284 of SEQ ID NO: 11 or an amino acid sequence at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:11.
- the culture medium is the medium appropriate for growth of a strain or yeast cell.
- the culture medium may include, but is not limited to Buffered Glycerol Complex Media (BMGY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% Yeast Nitrogen Base (YNB), 4.10 "5 % biotine, 1% glycerol) and Buffered Methanol Complex Medium (BMMY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% YNB, 4.10 '5 biotine, 1% methanol).
- BMGY Buffered Glycerol Complex Media
- YNB Yeast Nitrogen Base
- BMMY 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% YNB, 4.10 '5 biotine, 1% methanol
- the yeast cell as per the present invention preferably consists of a yeast cell of a Pichia pastoris cell.
- the Pichia pastoris cell according to the present invention was deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Dondel Roux, 75724 PARIS Cedex 15, France, on July 18, 2006, under accession number I-3655.
- the recombinant yeast cell as per the present invention is the yeast deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Dondel Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3777 or the yeast cell deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Dondel Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3778.
- the recombinant yeast cell is a yeast cell that has been transformed with any polypeptide according to the present invention.
- protein purification is a series of processes intended to isolate a single type of protein from a complex mixture. Protein purification is vital for the characterisation of the function, structure and interactions of the protein of interest.
- the starting material is usually a biological tissue or a microbial culture.
- the various steps in the purification process may free the protein from a matrix that confines it, separate the protein and non-protein parts of the mixture, and finally separate the desired protein from all other proteins. Separation of one protein from all others is typically the most laborious aspect of protein purification. Separation steps exploit differences in protein size, physico-chemical properties and binding affinity.
- the methods used in protein purification can roughly be divided into analytical and preparative methods.
- Analytical methods aim to detect and identify a protein in a mixture
- preparative methods aim to produce large quantities of the protein for other purposes, such as structural biology or industrial use.
- the preparative methods can be used in analytical applications, but not the other way around.
- Purification may be achieved by column purification, ultracentrifugation, chromatography, high performance liquid chromatography (HPLC), and electrophoresis, but a person skilled in the art will understand that other methods may be used to achieve the desired effect.
- a chelating Sepharose Fast Flow (Amersham, Biosciences, Uppsala, Sweden) column with nickel, that selectively retains proteins containing a histidine tag is used.
- separating the polypeptide from the yeast cell or culture medium may be achieved by gel electrophoresis, but a person skilled in the art will understand that other methods may be used to achieve the desired result.
- the present invention concerns a recombinant mycobacterial polypeptide or a functional fragment thereof obtained by the method of the invention.
- the polypeptide or fragment thereof of the invention has immunogenic epitopes substantially similar to the ones of its corresponding native mycobacterial protein.
- the recombinant mycobacterial polypeptide is selected from the group consisting of a polypeptide derived from Mycobacterium tuberculosis, Mycobacterium africanum and Mycobacterium bovis. More specifically, the recombinant mycobacterial polypeptide is the antigen CFP32 peptide which derives from the Mycobacterium tuberculosis culture filtrate.
- the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO:1.
- the polypeptide of the invention may be fused to an epitope tag.
- Such an epitope tag comprises a c-myc amino acid sequence.
- An epitope tag contemplated by the present invention consists of a c-myc-(HIS) 6 tag.
- the c-myc-(HIS) 6 tag has an amino acid sequence consisting of amino acid residues 267 to 287 of SEQ ID NO:1.
- polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following: - amino acid residues 5 to 264 of SEQ ID NO: 1 ;
- the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis CFP10 peptide; it preferably comprises an amino acid sequence substantially similar or at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3.
- the CFP10 peptide may be fused to an epitope tag.
- the epitope tag comprises an amino acid sequence consisting of amino acid residues 107 to 126 of SEQ ID NO:3.
- the polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following amino acid residues 7 to 107 of SEQ ID NO:3, or amino acid residues 5 to 126 of SEQ ID NO:3.
- the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis ESAT-6 peptide; it preferably comprises an amino acid sequence substantially similar or at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5.
- an epitope tag contemplated by the present invention consists of an amino acid sequence consisting of amino acid residues 102 to 121 of SEQ ID NO:5.
- the polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following: amino acid residues 5 to 102 of SEQ ID NO:5, or amino acid residues 5 to 121 of SEQ ID NO:5.
- the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide DES; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7 .
- the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide APA; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 325 of SEQ ID NO:9.
- the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide EXP; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:1 1.
- the recombinant mycobacterial polypeptide consists of a combination of at least two of the Mycobacterium tuberculosis peptides as chosen among the group consisting of: CFP32, CFP10, ESAT-6, DES, APA, and EXP as detailed herein above.
- a further aspect of the invention concerns transformed or transfected yeast cells which comprises a polynucleotide encoding a polypeptide and functional fragments thereof as described above.
- An example of such a cell is a Pichia pasto ⁇ s host cell and deposited at the CNCM on July 18, 2006, under accession number I-3655.
- Another example of such a cell is a Pichia pastoris host cell deposited at the CNCM on June 27, 2007, under accession number I-3777.
- a further example of such a cell is the one deposited at the CNCM on June 27, 2007, under accession number I-3778.
- the contemplated polynucleotide of the present invention may comprise a sequence substantially similar to nucleotides 13 to 794 of SEQ ID NO:2, or a sequence substantially similar to nucleotides 13 to 828 of SEQ ID NO:2, or a sequence substantially similar to nucleotides 13 to 864 of SEQ ID NO:2.
- the polynucleotide consists of nucleotides 1 to 864 of SEQ ID NO:2.
- the polynucleotide of the present invention comprises a sequence substantially similar to: - nucleotides 13 to 311 of SEQ ID NO:4;
- the polynucleotide consists of nucleotides 1 to 381 of SEQ ID NO:4.
- polynucleotide of the present invention may also comprise a sequence substantially similar to:
- nucleotides 13 to 296 of SEQ ID NO:6 - nucleotides 13 to 330 of SEQ ID NO:6;
- the polynucleotide consists of nucleotides 1 to 366 of SEQ ID NO:6.
- the polynucleotide of the present invention may further comprise a sequence substantially similar to nucleotides 1 to 1017 of SEQ ID NO:8, nucleotides 1 to 978 of SEQ ID NO: 10 or nucleotides 1 to 855 of SEQ ID NO: 12.
- said yeast host cell it preferably comprises a polynucleotide comprising a sequence similar or at least 90% identical to:
- yeast host cells have been deposited at the CNCM
- Another aspect of the invention is to provide a method for diagnosing a mycobacterial related infectious disease in a subject, comprising : a) contacting a sample of a subject with a recombinant mycobacterial polypeptide of the present invention, for a time and under conditions sufficient to form a polypeptide-mycobacterial specific antibody complex; and b) detecting the presence or absence of the complex formed in a).
- the mycobacterial related infectious disease is tuberculosis.
- any assay system capable of detecting a complex of the polypeptide of the invention bound to mycobacterial specific antibody is suitable for this aspect of the present invention, including, but not limited to, an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an enzyme-linked immunosorbent as
- kits for diagnosing a mycobacterial related infectious disease in a subject comprising: a) a recombinant mycobacterial polypeptide of the present invention or a yeast host cell of the invention; and b) reagents to detect a polypeptide-mycobacterial specific antibody immune complex.
- the kit of the invention may optionally comprise a biological reference sample lacking polypeptides that immunologically bind with the mycobacterial specific antibody and a comparison sample comprising polypeptides which can specifically bind to the mycobacterial specific antibody.
- one of the reagents is the monoclonal antibody to anti-CFP32 as deposited at the CNCM on June 27, 2007, under accession number 1-3779.
- the inventors have produced a monoclonal antibody (mAb) recognizing the CFP32 protein and which could be, inter alia, used for a direct diagnostic test by antigenic capture in view of identifying the protein in biological liquids; ex. the sputum of tuberculous patients in which it was demonstrated that CFP32 is present and that the level of the latter is correlated with the level of IL-10 which is an immunosuppressive cytokine.
- mAb monoclonal antibody
- Yet another aspect of the invention concerns an immunogenic composition capable of inducing antibodies recognizing specifically a polypeptide obtained by the method of the invention.
- the immunogenic composition of the invention may comprise an acceptable carrier.
- the amount of a recombinant mycobacterial polypeptide present in the compositions of the present invention is preferably a therapeutically effective amount.
- Example 1 Enhanced patient serum immunoreactivity to recombinant
- Mycobacterium tuberculosis CFP32 produced in the yeast Pichia pastoris was produced in the yeast Pichia pastoris:
- CFP32 is a Mycobacterium tuberculosis complex-restricted secreted protein that was previously reported to be present in a majority of sputum samples of patients with active tuberculosis (TB) and to stimulate serum antibody production. Therefore, CFP32 was considered a good candidate target antigen for the rapid serodiagnosis of TB.
- the maximal sensitivity of CFP32 serorecognition may have been limited in earlier studies because recombinant (r)CFP32 produced in Escherichia coli was used as the test antibody-capture antigen, a potential limitation stemming from differences in bacterial protein post- translational modifications.
- yeast rCFP32 showed a higher capacity to capture polyclonal antisera in Western blot studies.
- yeast rCFP32 was significantly better recognized by the sera from TB patients and healthy Bacillus Calmette-Guerin (BCG)-vaccinated individuals, by enzyme-linked immunosorbant assay (ELISA), than E. coli rCFP32.
- the trans-production of rCFP32 in P. pasto ⁇ s significantly improved the serologic detection of CFP32 specific antibody in patient sera, thereby offering a new, possibly better, modality for producing antigens of diagnostic potential for use in the development of immunoassays for both TB and other infectious diseases.
- rCFP32 was produced in the yeast P. pastoris as recently described (4). Briefly, cfp32 (rvO577) cDNA was expressed in Pichia pastoris strain KM71 H as a fusion c-Myc-epitope, six histidine [(His)6]- tag recombinant protein using the plasmid pPICZ ⁇ under the control of the strong AOX1 promoter (Invitrogen Corporation, Carlsbad, Calif.). This construct also contained a Saccharomyces cerevisiae alpha mating factor pre-propeptide secretion signal that is cleaved during protein processing.
- rCFP32 was purified using an Ni+25 -Sepharose Fast Flow column (Amersham, Piscataway, N.J.) and dialyzed against phosphate buffered saline (PBS). As a control for the potential effects due to gene trans-expression and antibiotic pressure, a second near identical plasmid was created, but with the cfp32 cassette out of frame, resulting in a failure to produce recombinant protein (data not shown).
- Western blot analysis of native M. tuberculosis CFP32, yeast-produced rCFP32, and rCFP32 generated in E. coli. The preparation of M. tuberculosis culture filtrate, expression and purification of E.
- coli rCFP32 as well as the generation of anti-E. coli rCFP32 in rabbit were previously described.
- Murine antiserum to yeast-produced rCFP32 was also generated using a classical immunization protocol. Protein assays and Western blot analysis were performed as previously reported (14). Briefly, following electrophoresis of native CFP32 (present in M. tuberculosis culture filtrate), as well as yeast and E. coli rCFP32 proteins, and transfer to nitrocellulose, the membrane was reacted with rabbit anti-E.
- coli rCFP32 sera (1 :3000 dilution in blocking buffer), mouse anti-yeast rCFP32 sera (1:2000 dilution), or anti-(His)6-tag monoclonal antibody (mAb) (Qiagen, Valencia, Calif.) (2 ⁇ g in 5 ml blocking buffer), and then reacted with the appropriate mAb-linked horseradish peroxidase (Amersham, Piscataway, N.J.). Images were developed using ECL Western blot detection reagents (Amersham), and then exposed to Kodak BioMax film. Protein quantification of M. tuberculosis lysate, as well as yeast and E.
- BCG vaccination is nearly universal in Tunisia and given first at birth and then a second time upon entry into primary school. Only persons with suspected or with known immunodeficiency are not given BCG.
- Stored sera from 4 infants who were M. tuberculosis uninfected (PPD-negative) and BCG vaccine na ⁇ ve were used as negative controls. All of the serum specimens were from Tunisian individuals with no HIV infection.
- the ELISA results from TB patients were analyzed using a cut-off value equal to the mean OD for the serum samples from the healthy BCG- vaccinated controls plus 2 standard deviations (SD).
- SD standard deviations
- the differences between groups of TB patients and healthy BCG-vaccinated controls, or PPD negative/BCG-na ⁇ ve healthy controls were compared using the paired t test, unpaired t test, or Fisher's exact test, as indicated. Differences were considered statistically significant if the P value was ⁇ 0.05.
- pasto ⁇ s cfp32-missense cassette transformant had been grown.
- Antisera raised in rabbit against E. coli- produced rCFP32 recognized both the native CFP32 in the CF of M. tuberculosis strain H37Rv and the yeast-produced rCFP32, but not the yeast culture medium (BMMY) negative control (Fig. 1A).
- the band for native CFP32 ran at approximately 32 kDa, hence its name, while that of yeast rCFP32 appeared at 35 kDa.
- the higher band size of the yeast rCFP32 is likely attributed to the c-Myc and (His)6 tag (4), but may also have potentially received contribution from P. pasto ⁇ s-specific post-translational modifications as well (4).
- the presence of the c-Myc epitope in the purified yeast rCFP32 product was previously confirmed by Western blot using a specific anti-Myc mAb (4).
- the immunogenicity of the CFP32 proteins from various sources was then comparatively evaluated in Western blot experiments using different specific reactive antibody preparations. These included the polyclonal rabbit antiserum raised against E. coli expressed rCFP32, a polyclonal mouse antiserum raised against yeast-expressed rCFP32, and a commercially available anti-(His)6-tag mAb of murine origin (Fig. 1 B). Each antibody preparation reacted more strongly towards the yeast rCFP32 than the E. co//-expressed rCFP32 for the same calculated amount of input protein, regardless of the immunogen originally used to derive the antibodies or the respective species in which the antibodies were raised (Fig. 1 B).
- the sera from every TB patient and healthy BCG vaccinee that was tested reacted more strongly to the yeast rCFP32 than the E. coli rCFP32.
- there was a greater difference in mean OD492 nm ( ⁇ OD492 nm) response to yeast rCFP32, as compared to E. coli rCFP32, in TB patient cases than there was in BCG-vaccinated persons ( ⁇ OD492 nm 0.75 versus 0.31 , respectively).
- the mean OD492 nm of TB patients to yeast rCFP32 was also greater than that of the sera from BCG-vaccinated healthy persons (respectively, 1.19 versus 0.39) (P ⁇ 0.0001 , unpaired t test) (Fig. 2).
- P ⁇ 0.0001 unpaired t test
- this cohort included each of the samples previously evaluated (Fig. 2) in order to prove consistency of results.
- the average serological response to yeast rCFP32 in OD492 nm units was significantly higher in TB patients (P ⁇ 0.0001 , unpaired t test).
- the mean OD492 nm value for TB patients and PPD-negative/BCG-na ⁇ ve controls was 1.28 and 0.23, respectively (with a mean ⁇ OD492 nm of 1.05).
- yeast rCFP32 was able to diagnose 85.0% of TB patients and misclassified only one BCG-vaccinated healthy serum sample as being reactive (or positive) for M. tuberculosis infection, resulting in a specificity of 97.5%. This donor was also positive in the preliminary evaluation (Fig. 2). All TB patients previously determined to be serologically positive for anti- CFP32 antibodies in Figure 2 were positive in the secondary evaluation illustrated in Figure 3. The positive predictive (97.1%) and negative predictive (90.4%) values of the yeast rCFP32 ELISA were very good as well. Therefore, even though a single antigen was utilized in the assay, the sensitivity and specificity of the yeast rCFP32 TB test approached or surpassed the values of these measures from multi-antigen serodiagnostic tests for TB 1 (17, 18, 37).
- TB is a leading cause of morbidity and mortality worldwide. Indeed, the World Health Organization recently declared a new TB emergency for Africa, where the incidence rate of infections has tripled in many countries since 1990 (39). The lack of a low-cost, easy to perform, rapid, sensitive, and specific TB diagnostic test impedes patient treatment and transmission control measures, especially in resource-poor countries. Standard bacteriologic culture is slow, the sensitivity of AFB morphologic identification is suboptimal, and molecular methods for diagnosis of TB based on nucleic acid amplification remain out of reach of most high TB-burdened countries due to cost and technical restrictions. On the other hand, a diagnostic method for TB that directly detects patient antibodies to M.
- tuberculosis components has the technological potential to overcome these limitations and may as well provide additional benefits as well.
- a low cost, real time, point-of-care serologic test could theoretically be developed into a simple dipstick format for both serum and urinary antibody detection, thereby minimizing infectious material handling and laboratory infrastructure.
- Such a TB test may also be applied to situations where diagnosis can be problematic, as with extrapulmonary TB patients, children, the elderly, and immucompromised individuals or other smear-negative culture-negative cases.
- the serodiagnostic methods for TB are not adequately sensitive, poorly specific, or both (16). It is generally accepted that the most likely format of a truly robust serological assay for TB will incorporate a combination of several different M.
- tuberculosis antigens including proteins such as ESAT-6 and CFP10 that are absent in BCG, thereby allowing a necessary differentiation of M. tuberculosis- ' mfected persons from BCG vaccinees.
- the inventors investigated whether the means of antigen production may be impeding the development of an optimized serodiagnostic test for TB.
- M. tuberculosis In the case of M. tuberculosis, its slow growth, coupled with safety concerns, precludes the commercial viability of an immunoassay incorporating mass-produced native protein(s) as the antibody capture antigen(s). In so being, in order to produce a robust serological assay to detect specific, and possibly conformationally sensitive, antibodies, a source of high yield, highly pure, and correctly folded, recombinant protein(s) that would give additional discrimination advantages in the serodiagnosis of TB, needs be identified and evaluated (7). With each of these considerations in mind, the inventors synthesized a recombinant form of a M. tuberculosis CF protein in the yeast P. pastoris and then evaluated its immunogenicity and serodiagnostic potential as compared to the same protein expressed in E. coli.
- CF proteins are secreted or released by growing M. tuberculosis into the culture medium.
- One such M. tuberculosis CF protein is CFP32, a 32- kDa putative bimodular glyoxalase of unknown function.
- CFP32 has been shown to be expressed in the lungs of TB patients and is known to stimulate a humoral antibody response (14, 27).
- CFP32 is restricted to members of the MTC and has not been identified in environmental mycobacteria (14, 15). Recently, CFP32 was recognized as the enzymatic mediator of M.
- tuberculosis-spec ⁇ f ⁇ c neutral red dye cytochemical staining a classical test once used to differentiate virulent M. tuberculosis from non- tuberculous mycobacteria (3). Therefore, in being a conserved MTC-restricted antigenic CF protein, the inventors believed CFP32 to be a prime antigen for use in a specific serodiagnostic test for TB.
- coli rCFP32 as the screening antigen (14) and also performed better than the parallel E. coli rCFP32-based immunoassay to which it was compared in the present study. Moreover, not only was the serologic response of TB patients and BCG-vaccinated persons significantly greater for yeast rCFP32 than E. coli rCFP32, but the differential mean reactivity between these groups was greater in the case of rCFP32 produced in yeast, elevating the usefulness and appeal of this antigen for use as a serodiagnostic marker. Because CFP32 is expressed by all MTC subspecies, including BCG (14), it was not unexpected that residual antibodies were present in individuals BCG- vaccinated over two decades previous.
- the sensitivity of the yeast rCFP32-based assay dropped by 15%.
- the BCG-vaccinated cohort arguably represents a more relevant control than the PPD-negative/BCG-na ⁇ ve group in a TB serodiagnosic test applied in certain contexts such as Tunisia; the important point being, that even in this situation, the yeast rCFP32-based assay remained highly sensitive and specific.
- the inventors did not evaluate a cohort comprised of healthy PPD-positive, presumably M. tuberculosis-exposed, persons. Such a cohort of latently infected persons will be included in a wider evaluation currently in the planning stages. At present, the inventors do not know if the yeast rCFP32 will be able to segregate latent TB from active disease. The inventors hope that the assay will allow us to predict which persons are likely to reactivate latent TB or are manifesting early active disease. In any case, based upon the present data, the rCFP32 produced in P. pastoris seems to have good potential for the serological diagnosis of TB and underscores the need to produce recombinant protein in systems that approximate the native antigen. It is further worth mentioning that in a separate study, and unlike the E. coli version of rCFP32, the yeast-generated rCFP32 exhibited functional properties similar to those of native CFP32 (61).
- a multivalent serological assay incorporating yeast rCFP32 may overcome these restrictions and serve as a confirmation or replacement of PPD screening.
- the combined data support that BCG expresses immunogenic CFP32 in vivo but, as indicated by the data from the other excluded individual who was BCG-vaccinated for a third time and had a good serological response to yeast rCFP32, this response wanes over time.
- BCG is known to protect against certain forms of childhood TB (2).
- coli rCFP32 both by laboratory raised antibodies and by sera from TB patients or persons vaccinated with BCG. Testing with yeast rCFP32 resulted in a 85.0% sensitivity in diagnosing TB patients and a specificity of 97.5% when using healthy BCG- vaccinated persons to establish a cut-off.
- Our data provide a sound basis for larger scale comparison between rCFP32 produced by P. pastoris, E. coli, and mycobacteria as serologic test antigens to discriminate active TB from latent M. tuberculosis infection or prior BCG vaccination. Together with CFP32, a panel of M. tuberculosis antigens expressed in yeast may provide a rapid and low cost approach to diagnosis TB with a sensitivity that is at least comparable to mycobacterial culture.
- Example 2 High level expression of recombinant Mycobacterium tuberculosis culture filtrate protein CFP32 in Pichia pastoris. Unavailability of large quantities for Mycobacterium tuberculosis (MTB) proteins still remain a major obstacle to the development of subunit vaccine and diagnostic reagents for tuberculosis. E. Coli has proven not to be an optimal host for the expression of MTB genes. In this work, the inventors used the yeast Pichia pastoris to express high level of CFP32, a culture filtrate protein restricted to MTB complex and a potential target antigen, for the sero diagnostic of tuberculosis. The inventors generated a P.
- Plasmids The pPICZ ⁇ A (Invitrogen Corporation, Carlsbad, CA, USA) vector was used to transfer the CFP32 expression cassette to Pichia pastoris.
- CFP32 cDNA was amplified by PCR using plasmid pQE31/RvO577 as template.
- KM71 H strain (Invitrogen Corporation, Carlsbad, CA, and USA.) was used to express a secreted rCFP32.
- the amplified DNA was ligated to the transfer vector pPICZ ⁇ A, to be fused to the secretion signal of the alpha matting factor from Saccharomycess cerevisea under the control of the alcohol oxidase 1 promoter (AOX1).
- AOX1 alcohol oxidase 1 promoter
- the resulting expression cassette was verified by DNA sequencing. Standard techniques (Sambrook et al. 1989) [59] were used for DNA modification, ligation and plasmid transformation. Restriction endonucleases and other enzymes were used as recommended by the supplier (Invitrogen Corporation, Carlsbad, CA, USA.)
- Plasmid DNA was isolated from the selected transformants E.coli clone. It was digested with Bst X I restriction enzyme (Amersham). The digested DNA was used for the transformation of Pichia pastoris KM71 H strain by electroporation. Linear DNA can generate stable transformants of Pichia pastoris via homologous recombination between the transforming DNA and the DNA cassette flanked by regions of homology within the genome.
- Genomic DNA of a number of transformants was analyzed by PCR.
- the isolation of genomic DNA and PCR amplification were then carried out according to the Pichia manual, Invitrogen Corporation, Carlsbad, CA, USA. Primers complementary to the 5' and 3' region of the Aox 1 gene were used for PCR amplification.
- the insertion of the expression cassette into yeast genome was verified by DNA sequencing using a conventional Big Dye Terminator cycle sequencing ready reaction kit (Perkin Elmer, Applied Biosystems, Foster city, CA, USA) and an ABI373 automated DNA sequencer.
- a recombinant Pichia pastohs clone was inoculated into 5 ml of YPD media with 5 ⁇ g of Zeocin and incubated at 30 c C in a shaker at 250 rpm over night.
- the culture was transferred into 250 ml of Buffered Glycerol Complex Media (BMGY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% Yeast Nitrogen Base, 4.10 "5 % biotine, 1 % glycerol) in a 2 L baffled flask and incubated at 30 0 C in a shaking incubator at 250 rpm over night.
- BMGY Buffered Glycerol Complex Media
- BMGY 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% Yeast Nitrogen Base, 4.10 "5 % biotine, 1 % glycerol) in a 2 L baffled flask and incuba
- BMMY 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% YNB, 4.10 "5 boitine,1% methanol
- Cultures were centrifuged at 120Og for 10 min and the supernatant was collected.
- proteins were transferred into a nitrocellulose membrane (Amersham, Biosciences, Uppsala, Sweden) using a Multiphor Il Electrophoresis System (Bio-Rad Laboratories, California, USA).
- the transblotted membrane was blocked with PBS-5% fat milk- 0.1% Tween 20 (PBS-T-Fat milk) overnight at 4°C.
- Two types of western blot were performed. In the first one a monoclonal anti-myc HRP antibody (Invitrogen, R951-25) was used. For the second one, membrane was probed with a rabbit polyclonal antibody directed against CFP32.
- the membrane was incubated for one hour with the anti-myc-HRP antibody and then incubated for one minute with ECL solution (Amersham Biosciences, Uppsala, Sweden).
- ECL solution Amersham Biosciences, Uppsala, Sweden
- DAKO anti- rabbit HRP conjugate
- the amount of the purified fusion protein CFP32-myc-(His) 6 was quantified after dialysis for 48 hours against PBS buffer, using a protein kit from Sigma (Ref.BCA-1) according to the manufacturer's instruction.
- the recombinant CFP32 was immobilized in a 96 wells ELISA plate overnight at 4°C (2ug per well) and incubated with serum from patients with tuberculosis diluted 1 :200 in PBS.
- the bound immunoglobulins were detected by adding 100 ⁇ l of horseradish peroxidase (HRP)-conjugate sheep anti-human IgG. Binding was revealed by the addition of 150 ⁇ l of 1mg/ml OPD substrate.
- the plates were incubated for colour development then blocked with 3 N acid sulphuric and the absorbance's were determined at 492 nm with a microtiter plate reader.
- the inventors have inserted at the 3' end of the cfp32 cDNA an additional codon specific of alanine [A].
- A alanine
- two additional residues, Glutamic acid (E) and Phenylalanine (F) were also inserted at the junction of the ⁇ mating factor and the CFP32 amino acid sequence (FIG.4).
- This expression cassette was inserted into Pichia pastoris strain KM71 H genome by homologous recombination. The inventors have selected 3 clones that resisted 2000 ⁇ g/ml of zeocin and retained the highest expressing one for the production of rCFP32 in shake-flask.
- the protein was eluted as a single peak at 500 mM Imidazole concentration, and was seen as a single band with diffused staining pattern when analyzed by SDS-PAGE (FIG.5).
- This band likely corresponds to the recombinant CFP32 that has lost the myc-(His) 6 tag due to spontaneous cleavage or proteolysis, a feature that the inventors have already observed with fusion proteins produced in P. pastohs KM71 H. [60] Furthermore, a preliminary ELISA study using the rCFP32 produced in P. pastoris and seven sera from tuberculosis patients showed a strong reactivity with all the sera as compared to four healthy BCG vaccinated individuals [Figure 7].
- N-terminal sequencing of HPLC purified rCFP32 was performed to determine if cleavage of the Saccharomyces cerevisiae ⁇ mating factor, signal peptide was properly processed. A single N terminus end was found and corresponded to the Glu-Ala-Glu-Phe-Pro-Lys-Arg-Ser-Tyr-Arg-Gln sequence (SEQ ID NO:27). The four amino acids Glu-Ala-Glu-Phe (SEQ ID NO:26) at the N-terminus correspond to the two last residues of the ⁇ factor [GIu-AIa] followed by the two residues [Glu-Phe] introduced at the cloning site.
- Proline is the first residue of CFP32 originally expressed by Mycobacterium (FIG.4).
- CFP32 including the extra NH 2 Glu-Ala-Glu-Phe (SEQ ID NO:27) residues and the extra Ala at the COOH terminus was analyzed using several protein analysis softwares for the presence of postranslational modification motif. As shown in
- the inventors have generated a P. Pastoris clone that produces a high level of rCFP32 as a myc-(His) 6 tagged protein. Because of cloning constraints, the inventors designed an expression cassette that introduced two extra residues, glutamic acid and phenylalanine at the NH2 terminus of the molecule as well as an alanine at the COOH end.
- Alanine was chosen because it's a neutral amino acid that is unlikely to affect the proper folding of the protein. Purification was carried out in one single step and the average yield obtained was 0.5gr per litre of culture supernatant. This is a high production yield considering that the culture was performed in shake flask and that no specific optimization procedure was carried out in any of the production steps.
- the higher apparent molecular weight observed for the rCFP32 produced in P. pastoris is probably due to the production of this molecule as a fusion protein containing a myc-(His) 6 tag at the COOH end.
- Yeast specific post translational modifications probably contribute to the size difference as suggested by the diffused banding pattern observed in SDS-PAGE.
- the identification of putative acylation and glycosylation sites in the CFP32 amino acid sequence argue in favor of post translational modification of the recombinant form produced in Pichia pastoris.
- N-terminal sequencing suggested that cleavage of the ⁇ mating factor signal peptide, was essentially carried out by the Ste13 protease.
- the Saccharomyces cerevisiae gmating factor pre-propeptide can be cleaved at different sites by two proteases, namely Kex2 and Ste13 and variation of cleavage was observed for a number of recombinant protein expressed in P. pastoris [19, 60].
- Proper cleavage of the heterologous signal peptide is important to yield a recombinant protein that is as close as possible to the native protein.
- Recombinant CFP32 produced in P. pastoris is recognized by sera from patients with tuberculosis suggesting that yeast rCFP32 is similar to the native CFP32 and thereby have immunogenic epitopes for antibodies developed in the patient to native CFP32. These immunogenic epitopes could be due either to a protein folding nearly identical to that of the native CFP32 and/or to post translational modifications that are common in Mycobacterial antigens.
- the identification in the CFP32 amino acid sequence of a number of putative motifs for post translational modifications, that can be performed by P. pastohs, [57, 58] also argue in favor of this possibility.
- the high solvent accessibility index observed in rCFP32 is an indicator of high antigenicity and could explain the good reactivity of rCFP32 with tuberculosis patients' sera (100% in our preliminary study as compared to the 30% previously reported with rCFP32 produced in E. CoIi [14]).
- the rCFP32 produced in P. pastohs could be very useful in conducting further analysis of the structure-function of the protein mainly, its potential role in the pathogenesis of tuberculosis as suggested earlier [3, 14]. Furthermore, reactivity of this rCFP32 with tuberculosis patients' sera is being investigated with a larger panel of patients (4).
- Table 1 Putative postranslational modification sites present in the amino aid sequence of Mycobacterium tuberculosis culture filtrate protein CFP32. [PKC Protein Kinase C 1 CK2 Casein kinase II, Single letter amino acid nomenclature is used]. One glycosylation and two phosphorylation sites were identified. Six acylation [myristoylation] motifs are scattered throughout the sequence.
- ⁇ means any amino acid
- Example 3 High level expression of recombinant Mycobacterium tuberculosis proteins CFP10 and ESAT-6 in Pichia pastoris.
- Mycobacterium smegmatis displays the Mycobacterium tuberculosis virulence-related neural red character when expressing the RvO577 gene.
- FEMS Microbiol. Lett. 231 :283-289. Benabdesselem, C 1 Barbouche, M. R., Jarboui, M.A., Dellagi, K., Ho, J. L., Fathallah, D. M. 2007. High Level Expression of Recombinant Mycobacterium tuberculosis Culture Filtrate Protein CFP32 in Pichia pastoris. MoI. Biotechnol. 35(1): 41-50.
- the Mycobacterium tuberculosis complex- restricted gene cfp32 encodes an expressed protein that is detectable in tuberculosis patients and is positively correlated with pulmonary interleukin- 10. Infect. Immun. 71 :6871-83.
- Electrophoresis 21 , 3740-3756. 44. Korepanova, A., Gao, F.P., Hua, Y., Qin, H., Nakamoto, R.K., Cross, T.A. (2005) Cloning and expression of multiple integral membrane proteins from Mycobacterium tuberculosis in Escherichia coli. Prot Sci. 14, 1 , 148-58.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a method for preparing a mycobacterial polypeptide qualitatively similar to the native mycobacterial protein. The present invention also relates to the mycobacterial polypeptide obtained by the method of invention and its use in method and kit for the diagnosis of mycobacterial related diseases, such as tuberculosis.
Description
METHOD FOR PREPARING RECOMBINANT MYCOBACTERIAL
POLYPEPTIDES IN YEAST AND THEIR USE IN DIAGNOSIS OF
MYCOBACTERIAL RELATED DISEASES
FIELD OF THE INVENTION
The present invention relates to a method for preparing a mycobacterial polypeptide qualitatively similar to the native mycobacterial protein. The present invention also relates to the mycobacterial polypeptide obtained by the method of the invention and its use in method and kit for the diagnosis of mycobacterial related diseases, such as tuberculosis.
BACKGROUND OF THE INVENTION
Over one-third of the world's population is infected with Mycobacterium tuberculosis, the etiologic agent of tuberculosis (TB) (11). Annually, this infection causes an estimated 8 million new TB cases and 3 million deaths. Rapid diagnosis and case identification, to minimize transmission to susceptible individuals, is critical in the control of TB. Current methods have either a low sensitivity, are slow to definitive results, or require methods and infrastructure not available in most resource poor countries burdened by the majority of TB and human immunodeficiency virus (HIV) cases. In most developing countries less than 50 to 60% of patients are diagnosed by the microscopic identification of acid-fast bacilli (AFB) in sputum smears (30). The remaining is eventually diagnosed by clinical criteria alone. Therefore, the availability of a sensitive, affordable, and practical point-of-care diagnostic test for rapid TB case identifica- tion and treatment would be of substantial benefit. As with current standard-of- care TB diagnostic tests, the sensitivities and specificities of most currently available serodiagnostic tests for TB need significant improvement (22). One major difficulty is that the spectrum of M. tuberculosis antigens recognized by sera varies dramatically between patients. Depending upon the antigen, its method of production (as purified native M. tuberculosis protein versus a recombinant), and its use in combination with other antigens, the sera of 12 to 96% of TB patients have been found to contain specific antibodies to the test antigens
(17, 18, 31, 37). However, even with the same method of manufacture, the serum recognition of even the most promising TB antigens by sera can vary widely depending upon the country of origin of the studied cohort, as well as the AFB smear status and disease manifestations of the individuals within the population (18, 27, 37).
The release of Mycobacterium (M. tuberculosis) complete genome sequence [8] and data from its proteome analysis have urged the evaluation of M. tuberculosis culture filtrate proteins as candidate targets for vaccine and/or diagnostic development [41]. Originally called RvO577, CFP32 is one out of the 30 culture filtrate (CF) proteins that have emerged as potential candidates for the serological diagnosis of tuberculosis [37]. The CFP32 coding gene is found exclusively in the M. tuberculosis complex as assessed by PCR and southern blot analysis of the genome of several mycobacterial strains [15]. CFP32 was identified by mass spectroscopy, N-terminal sequencing and immunodetection [42, 43]. CFP32 is expressed by M. tuberculosis complex (MTC) members including BCG [14]. Native CFP32 was detected in the sputum of patients with active pulmonary tuberculosis [14]. Furthermore, the virulence-related neutral red character typical of virulent mycobacteria, was recently shown by Andreu et al [3] to be associated with the cfp32 gene upon gene transfer into M. smegmatis. Moreover CFP32 level in the lung of active TB patients was positively correlated with amounts of the immunosuppressive cytokine IL10 [14]. These observations suggest that CFP32 may play a role in tuberculosis pathogenesis, and likely interact with the immune system, as shown previously by the detection of serologic reaction to E. coli expressed rCFP32 in approximately 30% of tuberculosis patients [14].
As mentioned, considerable efforts have been made for the identification of antigens that allow the development of a rapid test for the serodiagnosis of tuberculosis. These efforts have been hindered by difficulties in producing and purifying recombinant M. tuberculosis antigens in E. coli mainly poor yield, insolubility and gene instability, [40, 44, 45, 46]. E. coli genes have low GC content and probably lack the transcriptional and translational machinery needed to efficiently express mycobacterial genes that have high GC content [47].
Expression of Mycobacterium tuberculosis antigen in E. coli was enhanced following replacement of low-usage codons, however the highest yield achieved was 80 mg per litre of culture for mycobacterium Ag85A [48]. Furthermore procedures for engineering Mycobacterium genes are cumbersome and lengthy. The difficulties to over express mycobacterial antigens in E. coli led investigators to use other expression systems such as baculovirus [49, 50], Streptomyces lividans and Corynebactehum spp. [51 , 52, 53].
Closely related non-pathogenic mycobacterium such as M. smegmatis, and BCG [54, 55, 56], were also used to express mycobacterial genes by heterologous complementation. However, these are not conventional systems for the production of high levels of recombinant proteins. It is also known that heterologous complementation of MTB genes into BCG or M. smegmatis may be associated with gene modifications and loss of protein activity. Furthermore these hosts will need to be manipulated in level 3 standard biosafety containment, if transfected with virulence-associated genes. Hence to provide the large amounts of mycobacterial proteins needed for diagnostic evaluation and/or large scale immunization other, more adapted expression systems need to be explored.
Therefore, there is a need for new methods for preparing potential candidate antigens for mycobacterial serodiagnosis, such as for the diagnosis of tuberculosis.
SUMMARY OF THE INVENTION
The invention relates to a method for preparation of a purified recombinant mycobacterial polypeptide containing immunogenic epitopes substantially similar to the ones of its corresponding native Mycobacterium species protein, said method comprising : a) culturing a recombinant yeast cell expressing said polypeptide in a culture medium under conditions sufficient to effect expression of the polypeptide; and b) separating the polypeptide from the yeast cell or culture medium.
The invention further relates to a purified recombinant mycobacterial polypeptide or a functional fragment thereof obtained by the above mentioned method.
The invention also relates to a method for diagnosing a mycobacterial related infectious disease in a subject, comprising : a) contacting a sample of a subject with a recombinant mycobacterial polypeptide of the present invention, for a time and under conditions sufficient to form a polypeptide-mycobacterial specific antibody complex; and b) detecting the presence or absence of the complex formed in a).
The invention also relates to a yeast host cell comprising a polynucleotide encoding a recombinant mycobacterial polypeptide of the present invention.
The invention further relates to a kit for diagnosing a mycobacterial species related infectious disease in a subject, the kit comprising: a) a recombinant mycobacterial polypeptide of the present invention or a yeast host cell of the present invention; and b) reagents to detect a polypeptide-mycobacterial specific antibody immune complex.
The invention further relates to an immunogenic composition capable to induce antibodies recognizing specifically the polypeptide of the invention.
DESCRIPTION OF THE FIGURES
Figure 1 : Comparative study of antibody recognition of native M. tuberculosis
CFP32 and rCFP32 expressed in P. pastoris and E. coli. (A) Trans-expression of the CFP32 gene in yeast as detected by Western Blot. The detection of rCFP32 produced by pPICZα-c/rp32-transformed yeast was done using rabbit anti-E. coli rCFP32 as the primary anti-serum, 1 μg of M. tuberculosis H37Rv culture filtrate (MtbRv CF), 10 ng of (His)6-tag purified yeast rCFP32, and a volume (equal to 50 ng total protein) of concentrated filtered yeast culture medium in which yeast transformed with the missense CFP32 gene-expression vector were grown (BMMY). (B) Western blot analysis point to a relative preferential antibody avidity for yeast-expressed rCFP32 as compared to E. co//-expressed rCFP32. Native
CFP32 in M. tuberculosis H37Rv CF, and yeast- or E. co//-produced rCFP32, at indicated input protein quantity, were detected by Western blot using (/) anti-£. coli rCFP32 (rabbit), (H) anti-yeast rCFP32 (mouse) antisera, or (///) anti-(His)6-tag mAb. The figure is representative of 3 separate experiments; in one experiment (not shown) a membrane was successively stripped and reprobed with an alternative antiserum. (C) rCFP32 produced in yeast is relatively more antibody reactive than rCFP32 trans-expressed in E. coli. Western blot was performed using varying indicated input amounts of rCFP32 produced in yeast or E. coli as detected by (/) anti-E. coli rCFP32 (rabbit) antisera and (H) anti-(His)6-tag mAb. The figure is derived from two different blots probed with either anti-E. coli rCFP32 (rabbit) antisera or anti-(His)6-tag mAb. For each of the above blots, band sizes of molecular weight markers (kDa) are indicated at left in the panel.
Figure 2 : Sera from human test subjects show greater reactivity to yeast- expressed rCFP32 than E. co//-produced rCFP32. Using a home-brew ELISA, the sera from 25 active TB case patients (TB), along with the sera of 17 BCG- vaccinated healthy persons (BCG-vaccin.), were cross-compared for immuno- reactivity (measured in OD492 nm units) to two preparations of rCFP32 that were generated using either E. coli or P. pastoris as the surrogate host. The results of statistical analyses of the mean serological responses are shown (calculated using either the paired t test or unpaired t test, as indicated in the text). Each data point represents one patient. Solid horizontal lines represent the mean of each category while dashed horizontal lines represent the cut-off values above which serological responses to rCFP32 were deemed positive. Cut-off values were determined using the mean for the healthy BCG vaccinated persons plus 2 standard deviations per the E. coli rCFP32 (cut-off A) or the yeast rCFP32 (cut-off B). OD492 nm values above the cut-off are taken to indicate the presence of serum antibodies to native CFP32 resulting from an immune response to an ongoing tubercle bacillus infection. As described in the text, statistical analyses of the data (Fisher's exact test) indicated that the rCFP32 produced in P. pastoris was superior to that trans-expressed in E. coli for the serodiagnosis of TB.
Figure 3 : Evaluation of a serological test for TB that incorporates rCFP32 trans- expressed in yeast. Using a home-brew ELISA, the sera from 40 active TB case patients (TB)1 39 BCG-vaccinated healthy persons (BCG-vaccin.), and 4 healthy PPD-negative/BCG-naϊve infants (BCG-naive), were compared for immuno- reactivity (measured in OD492 nm units) to rCFP32 generated using P. pastohs as the surrogate host. Each data point represents one patient. Solid horizontal lines represent the mean of each category while dashed horizontal lines represent the cut-off values above which serological responses to rCFP32 were deemed positive and were determined using the mean for the healthy PPD-negative/BCG- naϊve infants (cut-off A), or the healthy BCG-vaccinated persons (cut-off B), plus 2 standard deviations. OD492 nm values above cut-off B are taken to indicate the minimal presence of serum antibodies to native CFP32 resulting from an immune response to an ongoing tubercle bacillus infection. The associated results of statistical analysis of the data using Fisher's exact test are shown. The results of statistical analysis of the mean serological responses (calculated using the unpaired t test) are proved in the text and supported that there was a statistically significant difference in the means of each control group compared to the TB cohort.
Figure 4 : Junction of the Saccharomyces cerevisiae α mating factor pre- propeptide (underlined) and the CFP32 protein sequence (bold italic) (SEQ ID NO: 13). The Kex2 and Ste13 sites for signal sequence cleavage in P. pastohs are indicated with arrows. Arrow in bold indicate the actual cleavage of rCFP32. The four amino acids added to the NH2 terminus of CFP32 are boxed.
Figure 5 : Control of the purified rCFP32 myc-(His)6 fusion protein : Recombinant protein secreted in the culture media was purified using a Chelating Sepharose Fast Flow Nickel column. The rCFP32 was eluted from the column using an imidazole concentration of 50OmM and 10 μl of each fraction run on an SDS- PAGE. Lane 1 : culture supernatant before purification, the dashed arrow shows the rCFP32 that has lost the myc-(His)6-tag. Lane 2: flow trough, the band correspond to the rCFP32 missing the tag. Lane 3: fraction obtained after
washing with 2OmM imidazole. Lanes 4 to 7: elution fractions. M=molecular size marker RNP800 (Amersham).
Figure 6 : Expression of the CFP32 gene in yeast (Pichia pastoris). Heterologous expression of the CFP32 gene by pPICZ.577-transformed yeast as shown by Western blot. Ten ng of purified yeast rCFP32 run in 15% SDS-PAGE transferred to nitro cellulose and revealed using :
(6a) Rabbit anti-rCFP32 produced in E. coli as primary anti-serum (dilution 1/2000). The minor band shown by the arrow corresponds to the rCFP32 missing the myc-(His)6.
(6b) Anti myc HRP mAb (Invitrogen, R951-25) (dilution 1/5000). Band sizes of markers (KDa) are indicated at left in the panel.
Figure 7 : Box-and-whiskers (mean value +/- 2SD) illustration of the serological recognition pattern of rCFP32 (red boxes) by the sera of 7 TB patients and 4 BCG vaccinated healthy controls (p=0.06).
Figure 8 : Amino acid sequence (SEQ ID NO:1) of rCFP32.
Figure 9 : Nucleotide sequence (SEQ ID NO:2) encoding the mycobacterial polypeptide of Fig. 8.
Figure 10 : Amino acid sequence (SEQ ID NO:3) of the mycobacterial peptide CFP10.
Figure 11 : Nucleotide sequence (SEQ ID NO:4) encoding the mycobacterial peptide of Figure 10.
Figure 12 : Amino acid sequence (SEQ ID NO:5) of the mycobacterial peptide ESAT-6.
Figure 13 : Nucleotide sequence (SEQ ID NO:6) encoding the mycobacterial peptide of Figure 12.
Figure 14 : Amino acid sequence (SEQ ID NO:7) of the mycobacterial peptide DES.
Figure 15 : Nucleotide sequence (SEQ ID NO:8) encoding the mycobacterial peptide of Figure 14. Figure 16 : Amino acid sequence (SEQ ID NO:9) of the mycobacterial peptide APA.
Figure 17 : Nucleotide sequence (SEQ ID NO: 10) encoding the mycobacterial peptide of Figure 16.
Figure 18 : Amino acid sequence (SEQ ID NO:11) of the mycobacterial peptide EXP.
Figure 19 : Nucleotide sequence (SEQ ID NO: 12) encoding the mycobacterial peptide of Figure 18.
Figure 20 : Control gel of the purification of CFP10 and ESAT-6 recombinant proteins produced in Pichia pastohs. Figure 21 A : Control gels before and after deglycosylation with tunicamycin of recombinant CFP32 produced in Pichia in vivo.
Figure 21 B : Control gels before and after deglycosylation with endoglycosylase F of recombinant CFP32 produced in Pichia in vitro.
Figure 22 : Reactivity of the serums of tuberculous patients and healthy controls vaccinated with BCG with the rCFP32 product in Pichia before and after deglycosylation.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the terms or expressions listed below will have the following meaning:
"Acceptable carrier" means a vehicle for containing, for instance, a recombinant mycobacterial polypeptide obtained by the method of the invention that can be injected into a mammalian host without adverse effects. Suitable carriers known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions. Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i. e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.
"Epitope" refers to the site on an antigen or hapten to which a specific antibody molecule binds or is recognized by T cells. The term is also used interchangeably with "antigenic determinant" or "antigenic determinant site."
"Fragment" refers to an isolated portion of a polypeptide, wherein the portion of the polypeptide is cleaved from a naturally occurring polypeptide by proteolytic cleavage by at least one protease, or is a portion of the naturally occurring polypeptide synthesized by chemical methods well known to one of skill in the art. Alternatively, the fragment of a polypeptide may be obtained by cleaving the polynucleotide encoding the recombinant polypeptide into multiple pieces, using restriction endonucleases, or a portion of the encoding polynucleotide may be synthesized by PCR, DNA polymerase or any other polymerizing technique well known in the art, and then after, the resulting piece may be expressed in the yeast host expression system of this invention by recombinant nucleic acid technology well known to one of skill in the art. "Monoclonal antibody" (mAb) as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the
individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each mAb is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they can be synthesized by hybridoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. The method of making monoclonal antibodies is common knowledge to a person skilled in the art.
"Purified polypeptide" or "purified protein", means a protein which has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in a "substantially purified" form. "Substantially purified" generally refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically in a sample a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion- exchange chromatography, affinity chromatography and sedimentation according to density. "Recombinant" broadly describes various technologies whereby genes can be cloned, DNA can be sequenced, and protein products can be produced. As used herein, the term also describes proteins or polypeptides that have been produced following the transfer of genes into the cells of host systems, such as a yeast host system. "Sample" refers to a variety of sample types obtained from an individual and can be used in a diagnostic or detection assay. The definition encompasses
blood and other liquid samples of biological origin such as saliva, sputum, and pulmonary lavage fluid.
"Sequence identity" or "Identity" means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide. As such, amino acid or nucleotide sequence "identity" are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. MoI. Biol. 48:443-453).
"Substantially similar" means that a first amino acid or nucleotide sequence has an amino acid or nucleotide sequence which is at least 90% identical to amino acid residues or nucleotides of a second amino acid sequence or of a nucleic acid sequence of a polypeptide of the present invention. "Therapeutically effective amount" of a recombinant mycobacterial polypeptide in the present invention is that amount necessary to allow the same to perform its immunological role without causing, overly negative effects in the host to which the composition is administered. The exact amount of recombinant mycobacterial polypeptide to be used and the composition to be administered will vary according to factors such as the type of condition being treated, the mode of administration, as well as the other ingredients in the composition.
"Transformation" and "transfection" as used interchangeably herein refer to the process of inserting a nucleic acid into a host. Many techniques are well known to those skilled in the art to facilitate transformation or transfection of a nucleic acid into a prokaryotic or eukaryotic organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules. By the term "immunogenic", it refers to the property of a molecule or compound, such as a protein/polypeptide to induce in vivo or in vitro a cellular or humoral immune response. The term "recognizing specifically" refers to anti-
bodies that bind with a relatively high affinity to one or more epitopes of a recombinant mycobacterial polypeptide obtained by the method of the invention, but which do not substantially recognize and bind molecules other than the one(s) of the invention. As used herein, the term "relatively high affinity" means a binding affinity between the antibody and the protein of interest, namely a recombinant mycobacterial polypeptide obtained by the method of the invention, of at least 106 M"1, and preferably of at least about 107 M"1 and even more preferably 108 M"1 to 1010 M"1. Determination of such affinity is preferably conducted under standard competitive binding immunoassay conditions which are common knowledge to one skilled in the art.
The applicant has surprisingly found that a yeast host cell, such as Pichia pastoris, is superior to the commonly used bacteria Escherichia coli for the production of high levels of recombinant mycobacterial antigens (such as the Mycobacterium tuberculosis culture filtrate antigen CFP32, the polypeptides CFP10, ESAT-6, acyl- carrier protein desaturase DESA1 (DES), fibronectin attachment protein (APA) and cell surface protein EXP53 (EXP)) that are further qualitatively closer to the native ones, for instance in terms of immunogenic properties such as epitope configuration.
An aspect of the present invention thus relates to a method for preparing such a recombinant mycobacterial polypeptide by using a yeast host cell having the ability of producing higher levels of a recombinant mycobacterial polypeptide. The invention also relates to the recombinant mycobacterial polypeptide obtained by the afore mentioned method and its use in immunogenic compositions, and in methods and kits for diagnosing a Mycobacterial related disease, such as tuber- culosis.
According to an embodiment, the present invention provides a method for preparing a recombinant mycobacterial polypeptide containing immunogenic epitopes substantially similar to the ones of its corresponding native Mycobacterial species protein. The method comprises : a) culturing a recombinant yeast cell expressing a polypeptide in a culture medium under conditions sufficient to effect expression of the polypeptide; and
b) separating the polypeptide from the yeast cell or culture medium. According to a mode of carrying out said method, said yeast cell consists of a Pichia pastoris cell.
According to another mode of carrying out said method, the recombinant mycobacterial polypeptide is a polypeptide derived from Mycobacterium tuberculosis, Mycobacterium africanum or Mycobacterium bovis.
When said recombinant mycobacterial polypeptide is derived from Mycobacterium tuberculosis, it is selected in the group consisting of: CFP32 peptide, CFP 10 peptide, ESAT-6 peptide, DES peptide, APA peptide and EXP peptide.
Preferably:
- the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO:1 or an amino acid sequence at least 90% identical to amino acid residues 5 to 264 of SEQ ID NO:1 ; - the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 103 of SEQ ID NO:3 or an amino acid sequence at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3;
- the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 98 of SEQ ID NO:5 or an amino acid sequence at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5;
- the DES peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 338 of SEQ ID NO:7 or an amino acid sequence at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7;
- the APA peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 325 of SEQ ID NO:9 or an amino acid sequence at least 90% identical to amino acid residues 1 to 325 of SEQ ID NO:9;
- the EXP peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 284 of SEQ ID NO: 11 or an amino acid sequence at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:11. As will be understood by a person skilled in the art, the culture medium is the medium appropriate for growth of a strain or yeast cell. As is detailed in the Examples herein, the culture medium may include, but is not limited to Buffered
Glycerol Complex Media (BMGY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% Yeast Nitrogen Base (YNB), 4.10"5 % biotine, 1% glycerol) and Buffered Methanol Complex Medium (BMMY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% YNB, 4.10'5 biotine, 1% methanol).
A person skilled in the art will also understand that conditions sufficient to effect expression of the polypeptide are "sufficient" in that the recombinant protein is produced in the yeast cell by a method as described in (4). More specifically, and as may be understood from Example 1 , cfp32 (rvO577) cDNA was expressed in Pichia pastoris strain KM71H as a fusion c-Myc-epitope, six histidine [(His)6]- tag recombinant protein using the plasmid pPICZα under the control of the strong AOX1 promoter (Invitrogen Corporation, Carlsbad, Calif.).
Furthermore, a person skilled in the art will understand that the yeast cell as per the present invention preferably consists of a yeast cell of a Pichia pastoris cell. As mentioned herein, the Pichia pastoris cell according to the present invention was deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on July 18, 2006, under accession number I-3655. The recombinant yeast cell as per the present invention is the yeast deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3777 or the yeast cell deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3778. A person skilled in the art will understand that the recombinant yeast cell is a yeast cell that has been transformed with any polypeptide according to the present invention.
A person skilled in the art will understand that protein purification is a series of processes intended to isolate a single type of protein from a complex mixture. Protein purification is vital for the characterisation of the function, structure and interactions of the protein of interest. The starting material is usually a biological tissue or a microbial culture. The various steps in the purification process may free the protein from a matrix that confines it, separate the protein
and non-protein parts of the mixture, and finally separate the desired protein from all other proteins. Separation of one protein from all others is typically the most laborious aspect of protein purification. Separation steps exploit differences in protein size, physico-chemical properties and binding affinity. The methods used in protein purification, can roughly be divided into analytical and preparative methods. The distinction is not exact, but the deciding factor is the amount of protein, that can practically be purified with that method. Analytical methods aim to detect and identify a protein in a mixture, whereas preparative methods aim to produce large quantities of the protein for other purposes, such as structural biology or industrial use. In general, the preparative methods can be used in analytical applications, but not the other way around. Purification may be achieved by column purification, ultracentrifugation, chromatography, high performance liquid chromatography (HPLC), and electrophoresis, but a person skilled in the art will understand that other methods may be used to achieve the desired effect. Preferably in the present invention, a chelating Sepharose Fast Flow (Amersham, Biosciences, Uppsala, Sweden) column with nickel, that selectively retains proteins containing a histidine tag, is used. Similarly, separating the polypeptide from the yeast cell or culture medium may be achieved by gel electrophoresis, but a person skilled in the art will understand that other methods may be used to achieve the desired result.
According to a related aspect, the present invention concerns a recombinant mycobacterial polypeptide or a functional fragment thereof obtained by the method of the invention. The polypeptide or fragment thereof of the invention has immunogenic epitopes substantially similar to the ones of its corresponding native mycobacterial protein.
According to an embodiment of the invention, the recombinant mycobacterial polypeptide is selected from the group consisting of a polypeptide derived from Mycobacterium tuberculosis, Mycobacterium africanum and Mycobacterium bovis. More specifically, the recombinant mycobacterial polypeptide is the antigen CFP32 peptide which derives from the Mycobacterium tuberculosis culture filtrate. The CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO:1.
As one skilled in the art may appreciate, the polypeptide of the invention may be fused to an epitope tag. Such an epitope tag comprises a c-myc amino acid sequence. An epitope tag contemplated by the present invention consists of a c-myc-(HIS)6 tag. According to an embodiment, the c-myc-(HIS)6 tag has an amino acid sequence consisting of amino acid residues 267 to 287 of SEQ ID NO:1.
Accordingly, the polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following: - amino acid residues 5 to 264 of SEQ ID NO: 1 ;
- amino acid residues 5 to 267 or 5 to 268 of SEQ ID NO:1 ; or
- amino acid residues 5 to 287 of SEQ ID NO: 1.
According to another embodiment of the invention, the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis CFP10 peptide; it preferably comprises an amino acid sequence substantially similar or at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3.
As also contemplated by the invention, the CFP10 peptide may be fused to an epitope tag. The epitope tag comprises an amino acid sequence consisting of amino acid residues 107 to 126 of SEQ ID NO:3. Accordingly, the polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following amino acid residues 7 to 107 of SEQ ID NO:3, or amino acid residues 5 to 126 of SEQ ID NO:3.
According to yet another embodiment of the invention, the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis ESAT-6 peptide; it preferably comprises an amino acid sequence substantially similar or at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5.
An epitope tag contemplated by the present invention consists of an amino acid sequence consisting of amino acid residues 102 to 121 of SEQ ID NO:5. As such, the polypeptide of the invention may comprise an amino acid sequence substantially similar or at least 90% identical to any one of the following: amino acid residues 5 to 102 of SEQ ID NO:5, or amino acid residues 5 to 121 of SEQ ID NO:5.
According to yet another embodiment of the invention, the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide DES; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7 . According to yet another embodiment of the invention, the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide APA; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 325 of SEQ ID NO:9.
According to yet another embodiment of the invention, the recombinant mycobacterial polypeptide consists of the Mycobacterium tuberculosis peptide EXP; it preferably consists of an amino acid sequence substantially similar or at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:1 1.
According to yet another embodiment of the invention, the recombinant mycobacterial polypeptide consists of a combination of at least two of the Mycobacterium tuberculosis peptides as chosen among the group consisting of: CFP32, CFP10, ESAT-6, DES, APA, and EXP as detailed herein above.
A further aspect of the invention concerns transformed or transfected yeast cells which comprises a polynucleotide encoding a polypeptide and functional fragments thereof as described above. An example of such a cell is a Pichia pastoήs host cell and deposited at the CNCM on July 18, 2006, under accession number I-3655. Another example of such a cell is a Pichia pastoris host cell deposited at the CNCM on June 27, 2007, under accession number I-3777. A further example of such a cell is the one deposited at the CNCM on June 27, 2007, under accession number I-3778. The contemplated polynucleotide of the present invention may comprise a sequence substantially similar to nucleotides 13 to 794 of SEQ ID NO:2, or a sequence substantially similar to nucleotides 13 to 828 of SEQ ID NO:2, or a sequence substantially similar to nucleotides 13 to 864 of SEQ ID NO:2.
According to an embodiment of the invention, the polynucleotide consists of nucleotides 1 to 864 of SEQ ID NO:2.
According to a further embodiment, the polynucleotide of the present invention comprises a sequence substantially similar to:
- nucleotides 13 to 311 of SEQ ID NO:4;
- nucleotides 13 to 345 of SEQ ID NO:4;
- nucleotides 13 to 378 of SEQ ID NO:4; or
- nucleotides 13 to 381 of SEQ ID NO:4. According to another embodiment of the invention, the polynucleotide consists of nucleotides 1 to 381 of SEQ ID NO:4.
The polynucleotide of the present invention may also comprise a sequence substantially similar to:
- nucleotides 13 to 296 of SEQ ID NO:6; - nucleotides 13 to 330 of SEQ ID NO:6;
- nucleotides 13 to 363 of SEQ ID NO:6; or
- nucleotides 13 to 366 of SEQ ID NO:6.
According to another embodiment of the invention, the polynucleotide consists of nucleotides 1 to 366 of SEQ ID NO:6. The polynucleotide of the present invention may further comprise a sequence substantially similar to nucleotides 1 to 1017 of SEQ ID NO:8, nucleotides 1 to 978 of SEQ ID NO: 10 or nucleotides 1 to 855 of SEQ ID NO: 12. According to an advantageous embodiment of said yeast host cell, it preferably comprises a polynucleotide comprising a sequence similar or at least 90% identical to:
- nucleotides 13 to 794 of SEQ ID NO:2;
- nucleotides 13 to 828 of SEQ ID NO:2;
- nucleotides 1 to 864 of SEQ ID NO:2;
- nucleotides 13 to 311 of SEQ ID NO:4; - nucleotides 13 to 345 of SEQ ID NO:4;
- nucleotides 13 to 378 of SEQ ID NO:4;
- nucleotides 1 to 381 of SEQ ID NO:4.
- nucleotides 13 to 296 of SEQ ID NO:6;
- nucleotides 13 to 330 of SEQ ID NO:6; - nucleotides 13 to 363 of SEQ ID NO:6;
- nucleotides 1 to 366 of SEQ ID NO:6;
- nucleotides 1 to 1017 of SEQ ID NO:8;
- nucleotides 1 to 978 of SEQ ID NO: 10; or
- nucleotides 1 to 855 of SEQ ID NO: 12.
Advantageously, yeast host cells have been deposited at the CNCM
(Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on July 18, 2006, under accession number I-
3655, on June 27, 2007, under accession number I-3777 and on June 27, 2007, under accession number I-3778.
Another aspect of the invention is to provide a method for diagnosing a mycobacterial related infectious disease in a subject, comprising : a) contacting a sample of a subject with a recombinant mycobacterial polypeptide of the present invention, for a time and under conditions sufficient to form a polypeptide-mycobacterial specific antibody complex; and b) detecting the presence or absence of the complex formed in a). According to an embodiment, the mycobacterial related infectious disease is tuberculosis.
Any assay system capable of detecting a complex of the polypeptide of the invention bound to mycobacterial specific antibody is suitable for this aspect of the present invention, including, but not limited to, an enzyme-linked immunosorbent assay, a radioimmunoassay, a fluorescent immunoassay and an
Immunoelectrophoresis assay.
Another aspect of the invention concerns a kit for diagnosing a mycobacterial related infectious disease in a subject, comprising: a) a recombinant mycobacterial polypeptide of the present invention or a yeast host cell of the invention; and b) reagents to detect a polypeptide-mycobacterial specific antibody immune complex.
The kit of the invention may optionally comprise a biological reference sample lacking polypeptides that immunologically bind with the mycobacterial specific antibody and a comparison sample comprising polypeptides which can specifically bind to the mycobacterial specific antibody.
According to one embodiment of said kit, one of the reagents is the monoclonal antibody to anti-CFP32 as deposited at the CNCM on June 27, 2007, under accession number 1-3779.
The inventors have produced a monoclonal antibody (mAb) recognizing the CFP32 protein and which could be, inter alia, used for a direct diagnostic test by antigenic capture in view of identifying the protein in biological liquids; ex. the sputum of tuberculous patients in which it was demonstrated that CFP32 is present and that the level of the latter is correlated with the level of IL-10 which is an immunosuppressive cytokine. The hybridoma producing this mAb has been deposited at the CNCM (Collection Nationale de Cultures de Microorganismes),
28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under number I-3779.
Yet another aspect of the invention concerns an immunogenic composition capable of inducing antibodies recognizing specifically a polypeptide obtained by the method of the invention.
The immunogenic composition of the invention may comprise an acceptable carrier.
The amount of a recombinant mycobacterial polypeptide present in the compositions of the present invention is preferably a therapeutically effective amount.
EXAMPLES
Example 1 : Enhanced patient serum immunoreactivity to recombinant
Mycobacterium tuberculosis CFP32 produced in the yeast Pichia pastoris:
Potential for the serodiagnosis of tuberculosis CFP32 is a Mycobacterium tuberculosis complex-restricted secreted protein that was previously reported to be present in a majority of sputum samples of patients with active tuberculosis (TB) and to stimulate serum antibody production. Therefore, CFP32 was considered a good candidate target antigen for the rapid serodiagnosis of TB. However, the maximal sensitivity of CFP32 serorecognition may have been limited in earlier studies because recombinant
(r)CFP32 produced in Escherichia coli was used as the test antibody-capture antigen, a potential limitation stemming from differences in bacterial protein post- translational modifications. To further investigate the serodiagnostic potential of rCFP32 synthesized in different heterologous hosts, the inventors expressed rCFP32 in the yeast Pichia pastoris. As compared to E. coli rCFP32, yeast rCFP32 showed a higher capacity to capture polyclonal antisera in Western blot studies. Likewise, yeast rCFP32 was significantly better recognized by the sera from TB patients and healthy Bacillus Calmette-Guerin (BCG)-vaccinated individuals, by enzyme-linked immunosorbant assay (ELISA), than E. coli rCFP32. In subsequent testing, the yeast rCFP32-based antibody-capture ELISA had a sensitivity of 85.0% and specificity of 97.5 % for the discrimination of active TB cases (n = 40) from BCG vaccinees (n = 39) - surprisingly high for a single antigen TB serodiagnostic test. Overall, the trans-production of rCFP32 in P. pastoήs significantly improved the serologic detection of CFP32 specific antibody in patient sera, thereby offering a new, possibly better, modality for producing antigens of diagnostic potential for use in the development of immunoassays for both TB and other infectious diseases.
MATERIAL AND METHODS Expression of CFP32 in P. pastoris. rCFP32 was produced in the yeast P. pastoris as recently described (4). Briefly, cfp32 (rvO577) cDNA was expressed in Pichia pastoris strain KM71 H as a fusion c-Myc-epitope, six histidine [(His)6]- tag recombinant protein using the plasmid pPICZα under the control of the strong AOX1 promoter (Invitrogen Corporation, Carlsbad, Calif.). This construct also contained a Saccharomyces cerevisiae alpha mating factor pre-propeptide secretion signal that is cleaved during protein processing. rCFP32 was purified using an Ni+25 -Sepharose Fast Flow column (Amersham, Piscataway, N.J.) and dialyzed against phosphate buffered saline (PBS). As a control for the potential effects due to gene trans-expression and antibiotic pressure, a second near identical plasmid was created, but with the cfp32 cassette out of frame, resulting in a failure to produce recombinant protein (data not shown).
Western blot analysis of native M. tuberculosis CFP32, yeast-produced rCFP32, and rCFP32 generated in E. coli. The preparation of M. tuberculosis culture filtrate, expression and purification of E. coli rCFP32, as well as the generation of anti-E. coli rCFP32 in rabbit were previously described. Murine antiserum to yeast-produced rCFP32 was also generated using a classical immunization protocol. Protein assays and Western blot analysis were performed as previously reported (14). Briefly, following electrophoresis of native CFP32 (present in M. tuberculosis culture filtrate), as well as yeast and E. coli rCFP32 proteins, and transfer to nitrocellulose, the membrane was reacted with rabbit anti-E. coli rCFP32 sera (1 :3000 dilution in blocking buffer), mouse anti-yeast rCFP32 sera (1:2000 dilution), or anti-(His)6-tag monoclonal antibody (mAb) (Qiagen, Valencia, Calif.) (2 μg in 5 ml blocking buffer), and then reacted with the appropriate mAb-linked horseradish peroxidase (Amersham, Piscataway, N.J.). Images were developed using ECL Western blot detection reagents (Amersham), and then exposed to Kodak BioMax film. Protein quantification of M. tuberculosis lysate, as well as yeast and E. coli rCFP32, was performed using the Bio-Rad protein assay (Bio-Rad, Hercules, Calif.). This protein quantification was repeated several times over, by more than one individual, and in side-by-side comparisons on some occasions. The variance in protein content between evaluations was never more than ~15%. Western blot data are illustrated in Figure 1.
Study population. Tunisia is a country in Northern Africa with a TB case rate of 19.6/100,000 persons. In the preliminary immunoassay evaluation (Fig. 2), the sera from TB patients (n = 25) were randomly selected from a repository of patient sera collected during the initial clinical and biological testing for TB. Active pulmonary TB was confirmed by clinical, radiological, and bacteriological investigation. Sera from healthy subjects (n = 17) were randomly selected from a repository of sera remaining from clinical testing of student and/or staff members at the Pasteur Institute, Tunis. In the follow-up immunoassay evaluation (Fig. 3) additional serum samples were randomly selected from the same repository as used previously. Total subjects: TB patients (n = 40; 33 males and 7 females; mean age of 31 years, range of 17 to 44 years) and healthy subjects (n = 39; 23
males and 16 females; mean age of 28 years, range of 22 to 54 years). Two additional healthy subjects, initially investigated, were excluded from the analysis because one person was revaccinated a third time upon entry into the university at the age of 20 and the second person had a 15 mm induration in response to the tuberculin skin test indicating recent exposure to M. tuberculosis (36). Chest X-ray and sputum culture were negative in this case but extrapulmonary disease was not definitively excluded. Otherwise, the PPD status of the healthy BCG- vaccinated controls was not known. BCG vaccination is nearly universal in Tunisia and given first at birth and then a second time upon entry into primary school. Only persons with suspected or with known immunodeficiency are not given BCG. Stored sera from 4 infants who were M. tuberculosis uninfected (PPD-negative) and BCG vaccine naϊve (each infant was born to a family known to have had a child with a primary immunodeficiency and was later proven to be immunocompetent) were used as negative controls. All of the serum specimens were from Tunisian individuals with no HIV infection.
Detection of human anti-CFP32 antibodies by ELISA. Polystyrene 96-well plates were coated with 100 μl 7 of 1 μg/ml E. coli or P. pastoris rCFP32 in 0.05 M carbonate buffer (pH 9.6), incubated overnight at 4°C, washed once with PBS (pH 7.2) plus 0.05% Tween 20 (Sigma, St. Louis, Mo) (PBS-T), blocked with 1.5% milk in PBS-T at room temperature (RT) for 1 hour and then washed three times with PBS-T. Serum samples diluted 1:200 in PBS were then added, incubated for 2 h at RT, and washed with 11 PBS-T. To determine the amount of antibodies bound, wells were incubated for 1 h with alkaline phosphatase-linked sheep anti-human Ig (Amersham) diluted 1 :3000 in PBS-T, washed with PBS-T, developed with the alkaline phosphatase substrate O-phenylenediamine/H2θ2 (Sigma) for 20 minutes incubation at RT, and then the reaction was stopped with 100 μl of 4N sulfuric acid. The enzymatic conversion of the substrate was quantified in a Multiskan.EX ELISA reader (Labsystems, Helsinki. Finland) at 492 nm as optical density (OD) units.
Data analysis. The ELISA results from TB patients were analyzed using a cut-off value equal to the mean OD for the serum samples from the healthy BCG- vaccinated controls plus 2 standard deviations (SD). For statistical analysis of the data, the differences between groups of TB patients and healthy BCG-vaccinated controls, or PPD negative/BCG-naϊve healthy controls, were compared using the paired t test, unpaired t test, or Fisher's exact test, as indicated. Differences were considered statistically significant if the P value was < 0.05.
RESULTS Differential antibody recognition of native and recombinant forms of CFP32 antigen. The inventors recently reported on the cloning and expression of M. tuberculosis CFP32 in P. pastoris (4)). To our knowledge, this was the first report on the production of a M. tuberculosis antigen in yeast. To reconfirm the correct cloning of CFP32 in P. pastoris, Western blot analysis was performed upon the culture filtrate (CF) of M. tuberculosis strain H37Rv (previously determined to contain CFP32; ref. 14), (His)β-tag purified yeast rCFP32, and a sample of cell- free BMMY yeast culture medium in which the P. pastoήs cfp32-missense cassette transformant had been grown. Antisera raised in rabbit against E. coli- produced rCFP32 recognized both the native CFP32 in the CF of M. tuberculosis strain H37Rv and the yeast-produced rCFP32, but not the yeast culture medium (BMMY) negative control (Fig. 1A). The band for native CFP32 ran at approximately 32 kDa, hence its name, while that of yeast rCFP32 appeared at 35 kDa. The higher band size of the yeast rCFP32 is likely attributed to the c-Myc and (His)6 tag (4), but may also have potentially received contribution from P. pastoπs-specific post-translational modifications as well (4). The presence of the c-Myc epitope in the purified yeast rCFP32 product was previously confirmed by Western blot using a specific anti-Myc mAb (4).
The immunogenicity of the CFP32 proteins from various sources was then comparatively evaluated in Western blot experiments using different specific reactive antibody preparations. These included the polyclonal rabbit antiserum raised against E. coli expressed rCFP32, a polyclonal mouse antiserum raised against yeast-expressed rCFP32, and a commercially available anti-(His)6-tag
mAb of murine origin (Fig. 1 B). Each antibody preparation reacted more strongly towards the yeast rCFP32 than the E. co//-expressed rCFP32 for the same calculated amount of input protein, regardless of the immunogen originally used to derive the antibodies or the respective species in which the antibodies were raised (Fig. 1 B). A dilutional effect was also seen for each preparation and, consistent with previous observations, the E. coli rCFP32 ran at approximately 33 kDa. Furthermore, the native CFP32 was recognized by antisera raised to both recombinant proteins but not the anti-(His)6-tag mAb, as was anticipated. These data also further demonstrate the presence of the (His)θ-tag in the purified yeast rCFP32 protein. In this regard, it should be noted that the (His)6-tag was placed N-terminal in the E. coli rCFP32 but C-terminal in the yeast rCFP32. However, both preparations of purified rCFP32 were confirmed to possess predominantly full-length protein by silver and/or Coomasie blue staining (14,4). Therefore, it was contrary to expectations that the band intensities for each respective amount of input protein of yeast and E. coli rCFP32 were not equal in the blot probed with the anti-(His)6-tag mAbs. Again, as described in the Materials and Methods, much effort was dedicated to ensuring the accuracy of recombinant protein quantification and the calculated amounts of input protein are believed to have been correct. These data therefore suggested either a variance in the relative immunogenicity of the yeast and E. coli rCFP32 proteins or that perhaps the C terminus position of the (His)6-tag in yeast rCFP32 is better exposed and consequently might be better recognized than the E. coli form.
To qualitatively estimate the inequality in antibody avidity between the two rCFP32 preparations, the western blot was repeated using a broader range of protein input amounts (Fig. 1C). As a result, using the anti- E. coli rCFP32 antiserum, the relative band intensity of 2 μg of yeast rCFP32 appeared similar to 30 μg of E. coli-expressed rCFP32, suggesting a 15-fold difference in immunoreactivity. The basis of this disparate capacity to capture antibodies remains to be determined but may stem from differences in the nature of post- translational protein processing in P. pastoήs and E. coli which could better avail the yeast rCFP32 to antibody recognition.
Differences in serological reactivity to E. coli and yeast rCFP32 antigens. In a previous study, 30 to 34% of TB patients living in Brazil or India exhibited a serologic response to E. co//-generated rCFP32 (14). Given the above mentioned factors that may limit the immunological activity of antigens synthesized in E. coli (24, 28), the inventors were interested in comparing the serologic response towards rCFP32 produced respectively in yeast and in E. coli. Using a random sample collection of sera from TB patients (n = 25) and healthy BCG-vaccinated persons (n = 17), the inventors performed side-by-side challenges in a homebrew ELISA incorporating one or the other rCFP32 as the test antibody-capture antigen. As shown in Figure 2, the average serological response (as OD492 nm units) to yeast rCFP32 was much greater than the response to E. coli rCFP32 from patients with TB (P < 0.0001 , paired f test), as well as the healthy BCG- vaccinated persons (P = 0.0004, paired f test). In fact, the sera from every TB patient and healthy BCG vaccinee that was tested reacted more strongly to the yeast rCFP32 than the E. coli rCFP32. Interestingly, there was a greater difference in mean OD492 nm (ΔOD492 nm) response to yeast rCFP32, as compared to E. coli rCFP32, in TB patient cases than there was in BCG-vaccinated persons (ΔOD492 nm = 0.75 versus 0.31 , respectively).
Moreover, the mean response of TB patients to E. coli rCFP32 (OD492 nm = 0.58) was significantly greater than that of the sera from BCG-vaccinated healthy persons (OD492 nm = 0.27) (P = 0.0007, unpaired t test). Indeed, similar to our previous study (13), more TB patient sera recognized the E. coli rCFP32 than did the non-TB controls. In fact, using a cut-off value given by the mean OD492 nm reading of the BCG-vaccinated persons to E. coli rCFP32 + 2SD, 56% of TB patients (14 of 25) and 6% of BCG-vaccinated persons (1 of 17) were positive for a serological response to E. coli rCFP32 (P = 0.001 , Fisher's exact test). These data from a Tunisian population therefore support the earlier reported findings with respect to the immunogenicity of CFP32 in humans from different parts of the world, although the overall percentage of serological responders to E. coli rCFP32 was higher in the Tunisian TB cohort (56%) than the previously evaluated TB cohorts from Brazil and India (30 to 34%) (14). It should be noted here the TB patient with a serological response to E. coli rCFP32 that was greater
than that of any other subject to this antigen (OD492 nm = 1.9) and was exceeded in magnitude only by this same person's response to yeast rCFP32 (OD492 nm = 2.65) and one other's (Fig. 2). These data argue against the possibility that errors in recombinant protein quantification were acting as a limiting factor determining differences in antibody affinity in this experiment and support the Western blot observations illustrated in Figure 1.
As with the rCFP32 produced in E. coli, the mean OD492 nm of TB patients to yeast rCFP32 was also greater than that of the sera from BCG-vaccinated healthy persons (respectively, 1.19 versus 0.39) (P < 0.0001 , unpaired t test) (Fig. 2). Using a cut-off value given by the mean OD492 nm reading of the BCG- vaccinated persons to yeast rCFP32 + 2SD, 76% of TB patients (19 of 25) and 6% of BCG-vaccinated persons (1 of 17) were positive for a serological response to yeast rCFP32 - a statistically relevant difference (P < 0.0001 , Fisher's exact test). Indeed, by this measure, more TB patients exhibited a serological response to yeast rCFP32 than did to E. coli rCFP32 (19 vs.14, respectively). Therefore, in this preliminary examination, in terms of both the magnitude of responses and the degree of TB case differentiation, the immunoassay utilizing yeast rCFP32 as the antibody-capture antigen outperformed the similar ELISA utilizing rCFP32 produced in E. coli as a surrogate measure for the presence of antibodies to M. tuberculosis CFP32 and as a serodiagnostic test for TB.
Evaluation of the yeast rCFP32-based ELISA for serodiagnosis of TB. To validate the diagnostic potential of the ELISA utilizing rCFP32 expressed in yeast as a serological test for TB, additional sera were tested. The total collection included samples from 40 patients with confirmed pulmonary TB, 39 healthy
BCG-vaccinated individuals, and 4 healthy infants who were PPD-negative/BCG vaccine-naϊve (Fig. 3). In addition to serum samples tested for the first time, this cohort included each of the samples previously evaluated (Fig. 2) in order to prove consistency of results. In comparison to the PPD-negative/BCG-naϊve controls, the average serological response to yeast rCFP32 (in OD492 nm units) was significantly higher in TB patients (P < 0.0001 , unpaired t test). The mean
OD492 nm value for TB patients and PPD-negative/BCG-naϊve controls was 1.28 and 0.23, respectively (with a mean ΔOD492 nm of 1.05). Using a cut-off value given by the mean OD492 nm reading of the PPD-negative/BCG-naϊve controls + 2SD, 100% of TB patients (40 of 40) and 0% of the controls (0 of 4) were positive for a serological response to yeast rCFP32 (P = 0.0024, Fisher's exact test). As compared to the BCG-naϊve controls, the serological response of the BCG- vaccinated subjects to the yeast rCFP32 was also higher. This was not an unexpected finding given that, as an MTC subspecies, BCG is known to possess the cfp32 gene and to express CFP32 in vitro (14, 15). Interestingly, one healthy subject excluded from this analysis was revaccinated for a third time with BCG in early adulthood prior to blood donation and also exhibited a strong serologic response to CFP32 (OD492 nm = 1.4). In addition, there was another BCG- vaccinated person who was noted for having an extremely high serological response to the yeast rCFP32 (OD492 nm = 1.8). The subsequent tuberculin skin testing of this subject showed a 15 mm induration that is highly suspicious for recent exposure to M. tuberculosis. As a result this person was also excluded from the data set.
Most noteworthy overall however was that the average serological response to yeast rCFP32 was significantly higher in the TB patients in comparison to the remaining BCG-vaccinated healthy persons (P < 0.0001 , unpaired t test). The mean OD492 nm value for the BCG-vaccinated subjects was 0.36 (with a mean ΔOD492 nm = 0.91 , when compared to TB patients). Using a cutoff value given by the mean OD492 nm reading of the BCG vaccinees + 2SD, 85.0% of TB patients (34 of 40) and 2.5% of the BCG-vaccinated persons (1 of 40) were positive for a serological response to yeast rCFP32 (P < 0.0001 , Fisher's exact test). Therefore, even using the more stringent BCG-vaccinated persons' sera for a reference cut-off, yeast rCFP32 was able to diagnose 85.0% of TB patients and misclassified only one BCG-vaccinated healthy serum sample as being reactive (or positive) for M. tuberculosis infection, resulting in a specificity of 97.5%. This donor was also positive in the preliminary evaluation (Fig. 2). All TB patients previously determined to be serologically positive for anti- CFP32 antibodies in Figure 2 were positive in the secondary evaluation illustrated
in Figure 3. The positive predictive (97.1%) and negative predictive (90.4%) values of the yeast rCFP32 ELISA were very good as well. Therefore, even though a single antigen was utilized in the assay, the sensitivity and specificity of the yeast rCFP32 TB test approached or surpassed the values of these measures from multi-antigen serodiagnostic tests for TB 1 (17, 18, 37).
DISCUSSION
TB is a leading cause of morbidity and mortality worldwide. Indeed, the World Health Organization recently declared a new TB emergency for Africa, where the incidence rate of infections has tripled in many countries since 1990 (39). The lack of a low-cost, easy to perform, rapid, sensitive, and specific TB diagnostic test impedes patient treatment and transmission control measures, especially in resource-poor countries. Standard bacteriologic culture is slow, the sensitivity of AFB morphologic identification is suboptimal, and molecular methods for diagnosis of TB based on nucleic acid amplification remain out of reach of most high TB-burdened countries due to cost and technical restrictions. On the other hand, a diagnostic method for TB that directly detects patient antibodies to M. tuberculosis components has the technological potential to overcome these limitations and may as well provide additional benefits as well. For instance, a low cost, real time, point-of-care serologic test could theoretically be developed into a simple dipstick format for both serum and urinary antibody detection, thereby minimizing infectious material handling and laboratory infrastructure. Such a TB test may also be applied to situations where diagnosis can be problematic, as with extrapulmonary TB patients, children, the elderly, and immucompromised individuals or other smear-negative culture-negative cases. However, as currently devised, the serodiagnostic methods for TB are not adequately sensitive, poorly specific, or both (16). It is generally accepted that the most likely format of a truly robust serological assay for TB will incorporate a combination of several different M. tuberculosis antigens, including proteins such as ESAT-6 and CFP10 that are absent in BCG, thereby allowing a necessary differentiation of M. tuberculosis-'mfected persons from BCG vaccinees. In the present study, the inventors investigated whether the means of antigen
production may be impeding the development of an optimized serodiagnostic test for TB.
In the case of M. tuberculosis, its slow growth, coupled with safety concerns, precludes the commercial viability of an immunoassay incorporating mass-produced native protein(s) as the antibody capture antigen(s). In so being, in order to produce a robust serological assay to detect specific, and possibly conformationally sensitive, antibodies, a source of high yield, highly pure, and correctly folded, recombinant protein(s) that would give additional discrimination advantages in the serodiagnosis of TB, needs be identified and evaluated (7). With each of these considerations in mind, the inventors synthesized a recombinant form of a M. tuberculosis CF protein in the yeast P. pastoris and then evaluated its immunogenicity and serodiagnostic potential as compared to the same protein expressed in E. coli.
CF proteins are secreted or released by growing M. tuberculosis into the culture medium. One characteristic of CF proteins as a whole, and many individual CF proteins, is their strong immunostimulatory capacity (5, 10, 32). Indeed, the production of CF proteins is believed to account for the heightened efficacy of live, as opposed to killed, M. tuberculosis vaccines in animal models (1 , 13). Containing more than 200 different proteins, the CF presents an abundance of candidate antigens for use in developing a viable serodiagnostic immunoassay for TB (32). One such M. tuberculosis CF protein is CFP32, a 32- kDa putative bimodular glyoxalase of unknown function. CFP32 has been shown to be expressed in the lungs of TB patients and is known to stimulate a humoral antibody response (14, 27). The fact that all M. tuberculosis strains evaluated to date (>600) by PCR or Southern blot for cfp32 have been found to be in possession of the gene indicates that CFP32 serves a necessary biological role (14. 15). Importantly, unlike other CF proteins that have been evaluated as serodiagnostic antigens, such as the antigen 85 complex proteins (16), CFP32 is restricted to members of the MTC and has not been identified in environmental mycobacteria (14, 15). Recently, CFP32 was recognized as the enzymatic mediator of M. tuberculosis-spec\f\c neutral red dye cytochemical staining, a classical test once used to differentiate virulent M. tuberculosis from non-
tuberculous mycobacteria (3). Therefore, in being a conserved MTC-restricted antigenic CF protein, the inventors believed CFP32 to be a prime antigen for use in a specific serodiagnostic test for TB.
The results of our investigation indicate that antigenic epitopes were more readily available for antibody recognition in the yeast-produced rCFP32 as opposed to the rCFP32 generated in E. coli by both Western blot studies as well as in a comparative ELISA immunoassay. In further testing, the ELISA incorporating yeast rCFP32 as the antibody capture antigen was able to discriminate TB case patients from M. tuberculosis-unexposed/BCG-naϊve healthy controls and healthy BCG vaccinees with a high sensitivity (100% and 85.0 %) and high specificity (100% and 97.5 %), respectively. Notably, this de novo assay showed a significant improvement over a previously evaluated ELISA that incorporated E. coli rCFP32 as the screening antigen (14) and also performed better than the parallel E. coli rCFP32-based immunoassay to which it was compared in the present study. Moreover, not only was the serologic response of TB patients and BCG-vaccinated persons significantly greater for yeast rCFP32 than E. coli rCFP32, but the differential mean reactivity between these groups was greater in the case of rCFP32 produced in yeast, elevating the usefulness and appeal of this antigen for use as a serodiagnostic marker. Because CFP32 is expressed by all MTC subspecies, including BCG (14), it was not unexpected that residual antibodies were present in individuals BCG- vaccinated over two decades previous. In using the serological responses of BCG-vaccinated persons to set a cut-off for immune reactivity to CFP32, as compared to the PPD-negative/BCG-naϊve cohort, the sensitivity of the yeast rCFP32-based assay dropped by 15%. However, given that BCG remains one of the most widely used vaccines, the BCG-vaccinated cohort arguably represents a more relevant control than the PPD-negative/BCG-naϊve group in a TB serodiagnosic test applied in certain contexts such as Tunisia; the important point being, that even in this situation, the yeast rCFP32-based assay remained highly sensitive and specific. It should also be acknowledged that the inventors did not evaluate a cohort comprised of healthy PPD-positive, presumably M. tuberculosis-exposed, persons. Such a cohort of latently infected persons will be
included in a wider evaluation currently in the planning stages. At present, the inventors do not know if the yeast rCFP32 will be able to segregate latent TB from active disease. The inventors hope that the assay will allow us to predict which persons are likely to reactivate latent TB or are manifesting early active disease. In any case, based upon the present data, the rCFP32 produced in P. pastoris seems to have good potential for the serological diagnosis of TB and underscores the need to produce recombinant protein in systems that approximate the native antigen. It is further worth mentioning that in a separate study, and unlike the E. coli version of rCFP32, the yeast-generated rCFP32 exhibited functional properties similar to those of native CFP32 (61).
In most reports, assays based upon E. coli expressed recombinant M. tuberculosis proteins appear to have significantly lower sensitivities when compared to the native counterpart antigen and this has been linked to differences in glycosylation patterns (12, 24). Since B cell epitopes are known to recognize specific conformational structures, species restricted differences in post-translation modifications may translate to a reduced number of antigenic epitopes for antibody binding (12, 24). The inventors hypothesize that the extraordinary level of TB patient serorecognition of yeast rCFP32 demonstrated in the current Tunisian cohort is due to shared forms of protein post-translational modification between P. pastoris and M. tuberculosis; similarities that remain to be fully characterized. Indeed, recent data (35) support that certain pathways and forms of protein post-translational modification in eukaryotes are evolutionarily conserved in M. tuberculosis, and specifically that these similarities are shared by yeasts, thereby justifying our choice of P. pastoris as a surrogate host for the production of rCFP32. As it so happens, in a separate study, the yeast-generated rCFP32 exhibited functional properties similar to those of native CFP32, and unlike the E. coli version of rCFP32 (61 ). Subsequent to our publication of the first E. coli rCFP32-based serodiagnostic immunoassay evaluating for anti-CFP32 antibodies in TB patients (14), Weldingh et al. (35) screened a collection of recombinant M. tuberculosis proteins, including CFP32 (given as TB27.3). Although their rCFP32 exhibited a degree of seroreactivity in their selected cohort, as compared to controls, it was not further analyzed because their
minimum serological response threeshold ratio was not met for this protein. Our data suggest that their failure to mark CFP32 (and other known immunologically active M. tuberculosis antigens such as ESAT-6) may have been because they produced their recombinant antigens in E. coli. Our data highlight that the mode of antigen production can be a factor limiting the identification of seroreactive antigens. Indeed, for this reason, many potential serodiagnostic antigens for TB or other diseases may have been overlooked in prior studies because their immunogenicity was underestimated and these should be reproduced using alternate surrogate hosts and reevaluated. In the current study the results of serological testing from two persons were excluded from analysis but raised some intriguing possibilities. One individual in the healthy BCG23 vaccinated cohort had a strong TST result (suggestive of exposure to M. tuberculosis) and high serological response to yeast rCFP32. This data indicates that the assay developed to detect anti-CFP32 antibodies may be useful in identifying cases of recent M. tuberculosis infection. The limitations of the TST were recently summarized by Pai et al. (20). Therefore, a multivalent serological assay incorporating yeast rCFP32 may overcome these restrictions and serve as a confirmation or replacement of PPD screening. As related to the other regularly BCG-vaccinated persons and the BCG-naϊve infants, the combined data support that BCG expresses immunogenic CFP32 in vivo but, as indicated by the data from the other excluded individual who was BCG-vaccinated for a third time and had a good serological response to yeast rCFP32, this response wanes over time. BCG is known to protect against certain forms of childhood TB (2). Could this potential decline in anti-CFP32 humoral responses also exist for other BCG antigens and underlie, in part, the inconsistent protection of BCG vaccination from adult forms of TB? There is a growing interest in BCG-boosting of adults and so, with respect to the thrice BCG-vaccinated individual, the data suggest that perhaps a serological assay such as ours could prove useful when monitoring the immunological response to BCG revaccination and provide a correlate of protective immunity. Of course the above speculations are based on single subjects and the questions raised can only be answered by further research. Nonetheless, our data provide strong
evidence that the expression of M. tuberculosis proteins in P. pastoris may be a better modality for producing antigens of diagnostic potential for both TB and other infectious diseases, representing an advance with potentially far-reaching applications that merits further investigation. In conclusion, our study demonstrates that yeast P. pastoris produced rCFP32 displayed enhanced antibody binding when compared to E. coli rCFP32 both by laboratory raised antibodies and by sera from TB patients or persons vaccinated with BCG. Testing with yeast rCFP32 resulted in a 85.0% sensitivity in diagnosing TB patients and a specificity of 97.5% when using healthy BCG- vaccinated persons to establish a cut-off. Our data provide a sound basis for larger scale comparison between rCFP32 produced by P. pastoris, E. coli, and mycobacteria as serologic test antigens to discriminate active TB from latent M. tuberculosis infection or prior BCG vaccination. Together with CFP32, a panel of M. tuberculosis antigens expressed in yeast may provide a rapid and low cost approach to diagnosis TB with a sensitivity that is at least comparable to mycobacterial culture.
Example 2 : High level expression of recombinant Mycobacterium tuberculosis culture filtrate protein CFP32 in Pichia pastoris. Unavailability of large quantities for Mycobacterium tuberculosis (MTB) proteins still remain a major obstacle to the development of subunit vaccine and diagnostic reagents for tuberculosis. E. Coli has proven not to be an optimal host for the expression of MTB genes. In this work, the inventors used the yeast Pichia pastoris to express high level of CFP32, a culture filtrate protein restricted to MTB complex and a potential target antigen, for the sero diagnostic of tuberculosis. The inventors generated a P. pastoris clone expressing CFP32 as a secreted protein fused to the myc-(His)6 tag, at a yield of 0.5 gr of purified protein per liter of culture in shake flask. Recombinant CFP32 (rCFP32) produced in P. pastoris has an apparent molecular weight of 35 KDa which is slightly higher than that of the native protein. The inventors identified putative acylation and glycosylation sites in the CFP32 amino acid sequence which suggested that post translational modifications might contribute to the size difference. NH2 terminal peptide
sequencing of the rCFP32 showed that the signal peptide, alpha factor, is correctly excised. This recombinant CFP32 reacted with the sera of patients with tuberculosis. These data are the first to show that P. pastoris is a suitable host for high yield production of good quality mycobacterium antigens, especially culture filtrate proteins that have vaccine and diagnostic potential.
MATERIALS AND METHODS
Plasmids The pPICZαA (Invitrogen Corporation, Carlsbad, CA, USA) vector was used to transfer the CFP32 expression cassette to Pichia pastoris. CFP32 cDNA was amplified by PCR using plasmid pQE31/RvO577 as template.
Strains Escherichia coli Top 10f was used in sub cloning steps. Pichia pastoris
KM71 H strain (Invitrogen Corporation, Carlsbad, CA, and USA.) was used to express a secreted rCFP32.
Construction of CFP32 expression cassette The cDNA encoding the mature CFP32 was amplified by PCR using plasmid pQE31/RvO577 as DNA template (Huard 2003) [15] and the following specific primers:
Forward δ'CCGGAATTCCCCAAGAGAAGCGAATACAGS' (SEQ ID NO: 14) Reverse 5'GCTCTAGAGCTTGCTGCGGTGCGGGCTT 3' (SEQ ID NO: 15). The primers were designed such as to include at their 51 end an EcoR1 site for the forward one and an Xba I site for the reverse. The latter also included an additional alanine codon, 3' end of the Xba I site. PCR products were purified on a PCR prep column (Qiagen purification kit) and digested by EcoR1/Xbal.
After purification, the amplified DNA was ligated to the transfer vector pPICZαA, to be fused to the secretion signal of the alpha matting factor from Saccharomycess cerevisea under the control of the alcohol oxidase 1 promoter (AOX1). The resulting expression cassette was verified by DNA sequencing.
Standard techniques (Sambrook et al. 1989) [59] were used for DNA modification, ligation and plasmid transformation. Restriction endonucleases and other enzymes were used as recommended by the supplier (Invitrogen Corporation, Carlsbad, CA, USA.)
Transformation of Pichia pastoris
The recombinant plasmid pPICZα-RvO577 was propagated using the E.coli Top 10 F'. Plasmid DNA was isolated from the selected transformants E.coli clone. It was digested with Bst X I restriction enzyme (Amersham). The digested DNA was used for the transformation of Pichia pastoris KM71 H strain by electroporation. Linear DNA can generate stable transformants of Pichia pastoris via homologous recombination between the transforming DNA and the DNA cassette flanked by regions of homology within the genome.
Analysis of genomic DNA
To check for the integration of the expression cassette in the P. pastoris genome, Genomic DNA of a number of transformants was analyzed by PCR. The isolation of genomic DNA and PCR amplification were then carried out according to the Pichia manual, Invitrogen Corporation, Carlsbad, CA, USA. Primers complementary to the 5' and 3' region of the Aox 1 gene were used for PCR amplification. The insertion of the expression cassette into yeast genome was verified by DNA sequencing using a conventional Big Dye Terminator cycle sequencing ready reaction kit (Perkin Elmer, Applied Biosystems, Foster city, CA, USA) and an ABI373 automated DNA sequencer.
In silico Amino Acid sequence analysis
The following softwares and databases were used to analyze CFP32 amino acid sequence: ScanProsite version 99.07 on Prosite at http://www.expasy.ch/prosite/. Blast Version 2000.1 on ProDom at http://www.protein.toulouse.inra.fr/prodom.html, PROFsec and PROFacc version 2000_04 at http://cubic.bioc.columbia.edu. and GLOBE version 1. 98.05 at http://www.cubic.bioc.columbia.edu/predictprotein
Expression of rCFP32
For extra cellular expression of rCFP32, a recombinant Pichia pastohs clone was inoculated into 5 ml of YPD media with 5μg of Zeocin and incubated at 30cC in a shaker at 250 rpm over night. The culture was transferred into 250 ml of Buffered Glycerol Complex Media (BMGY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% Yeast Nitrogen Base, 4.10"5 % biotine, 1 % glycerol) in a 2 L baffled flask and incubated at 300C in a shaking incubator at 250 rpm over night. Cells were harvested through centrifugation at 120Og for 10 min. then resuspended in a 25 ml of Buffered Methanol Complex Medium (BMMY: 1% yeast extract, 2% peptone, 10OmM potassium phosphate pH 6, 1.34% YNB, 4.10"5 boitine,1% methanol), and incubated for another 72 hrs with the addition of 1% methanol after every 24hrs to maintain induction conditions. Cultures were centrifuged at 120Og for 10 min and the supernatant was collected.
Protein Electrophoresis
Ten μl_ of culture supernatant or purified protein was heated for 5 min. at 1000C after the addition of 5 μl_ of 3X loading buffer, (125 mM tris-Hcl, pH 6.8, 6% SDS, 0.2% bromophenol blue, and 15%glycerol) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% Polyacrylamide) using a Mini-protean Il system (Bio-Rad Laboratories, California, USA). RNP 800 molecular size marker (Amersham Biosciences, Uppsala, Sweden) was used to calibrate protein mobility. The gels were run at 120 V. The proteins were visualized by Coomassie brilliant blue G-250staining.
Western blotting
Following electrophoresis, proteins were transferred into a nitrocellulose membrane (Amersham, Biosciences, Uppsala, Sweden) using a Multiphor Il Electrophoresis System (Bio-Rad Laboratories, California, USA). The transblotted membrane was blocked with PBS-5% fat milk- 0.1% Tween 20 (PBS-T-Fat milk) overnight at 4°C. Two types of western blot were performed. In the first one a monoclonal anti-myc HRP antibody (Invitrogen, R951-25) was used. For the
second one, membrane was probed with a rabbit polyclonal antibody directed against CFP32. To detect the fusion protein, the membrane was incubated for one hour with the anti-myc-HRP antibody and then incubated for one minute with ECL solution (Amersham Biosciences, Uppsala, Sweden). For visualization of the immunoreactive band with the rabbit anti sera, an anti- rabbit HRP conjugate (DAKO) was used.
Purification of rCFP32
A chelating Sepharose Fast Flow (Amersham, Biosciences, Uppsala, Sweden) column with nickel, that selectively retains proteins containing a histidine tag, was used. Histidine tagged rCFP32 was eluted using buffers containing imidazole. Briefly, two ml of chelating Sepharose Fast Flow
(Amersham) were loaded in a column and washed with 10 ml of distilled water and shook end-over-end for 5 min. One ml of 0.1 M NiSO4 was added and incubated for ten minutes then the column was equilibrated with 10 ml of start buffer (20 mM Na2HPO4, 0.5 M NaCI, 10 mM Imidazole, pH 7.4). Ten ml volume of culture supernatant was incubated for 1 hr with shaking end-over-end rotation at room temperature. One ml volume of elution buffer (20 mM Na2HPO4, 0.5 M
NaCI, 500 mM Imidazole, pH 7.4) was added and mixed end-over-end rotation for 15 min. Elution step was repeated five times.
Protein Quantification
The amount of the purified fusion protein CFP32-myc-(His)6 was quantified after dialysis for 48 hours against PBS buffer, using a protein kit from Sigma (Ref.BCA-1) according to the manufacturer's instruction.
NH2 terminal sequencing
HPLC purification of rCFP32 was performed using a Beckman Series 125 pump and a Beckman diode array detector set at 214 nm and 280 nm, controlled by the GOLD software. Fractions were loaded onto a C8 reverse-phase HPLC column (5μm, 4.6 250 mm, Beckman). The protein was eluted from the column at
1 ml/min in a gradient of 0.1 % TFA/acetonitrile from 10 to 80% in 60 min.
fractions 17 and 18 were collected at 39.1 min and 39.6min respectively. NH2 amino acid sequencing was carried out by performing 12 cycles of automated Edman degradation in an Applied Biosystems 476 A protein sequencer. Sample was deposited onto Biobrene-precycled glass-fibre disc.
ELISA
The recombinant CFP32 was immobilized in a 96 wells ELISA plate overnight at 4°C (2ug per well) and incubated with serum from patients with tuberculosis diluted 1 :200 in PBS. The bound immunoglobulins were detected by adding 100μl of horseradish peroxidase (HRP)-conjugate sheep anti-human IgG. Binding was revealed by the addition of 150 μl of 1mg/ml OPD substrate. The plates were incubated for colour development then blocked with 3 N acid sulphuric and the absorbance's were determined at 492 nm with a microtiter plate reader.
RESULTS
Clone design and expression of recombinant CFP32 in P. pastoris.
To use the methyltrophic yeast Pichia pastoris for the production of a secreted recombinant form of the Mycobacterium tuberculosis culture filtrate protein CFP32, specific cfp32(RvO577) cDNA and plasmid pICZα were used to design an expression cassette that consisted on the cloning of the cDNA downstream of the Saccharomyces cerevisiae αmating factor pre-propeptide as a secretion signal and under the control of the Pichia pastoris AOX1 strong promotor and upstream of the sequence coding for the myc epitope-(His)6 tag . To conserve an open reading frame with the tag, the inventors have inserted at the 3' end of the cfp32 cDNA an additional codon specific of alanine [A]. For cloning purpose, two additional residues, Glutamic acid (E) and Phenylalanine (F) were also inserted at the junction of the α mating factor and the CFP32 amino acid sequence (FIG.4). This expression cassette was inserted into Pichia pastoris strain KM71 H genome by homologous recombination. The inventors have selected 3 clones that resisted 2000 μg/ml of zeocin and retained the highest
expressing one for the production of rCFP32 in shake-flask. SDS-PAGE analysis of the yeast rCFP32 showed an apparent molecular weight of approximately 35 kilo Dalton, which is higher than that of native CFP32 as determined by the 2-D map of short-term culture filtrate of M. tuberculosis H37Rv [42].
Production of rCFP32 in Shake flask and purification
The recombinant Pichia pastohs clone that grew in the presence of a high concentration of zeocin (2000 μg/ml) and had the highest level of expression suggesting the presence of a high copy number of the CFP32 expression cassette, was used for the production in shake flask using complex medium. The optimal induction time was determined at 48 hours. The concentration of the rCFP32 in the culture supernatant was high enough to allow direct purification in a single-step using a nickel column. The protein was eluted as a single peak at 500 mM Imidazole concentration, and was seen as a single band with diffused staining pattern when analyzed by SDS-PAGE (FIG.5). Interestingly, the inventors obtained approximately, 0.5 gram of purified rCFP32 from one litre of shake flask culture supernatant without carrying out any optimization neither in the culture nor in the purification steps.
Immunological Characterization:
To confirm the identity of the recombinant protein, Western blot analysis was carried out and it showed (FIG. 6) that the purified rCFP32 reacted strongly with an anti-myc monoclonal antibody and with a rabbit polyclonal antibody raised against rCFP32 produced in E. coli and expressed as a (His)6 fusion protein. As shown in figure 6 and figure 5 lane 1 , a lower band appears consistently and its intensity increases with extended storage time. This band reacts with the anti- rCFP32 sera but not with the anti-myc monoclonal antibody. This band likely corresponds to the recombinant CFP32 that has lost the myc-(His)6 tag due to spontaneous cleavage or proteolysis, a feature that the inventors have already observed with fusion proteins produced in P. pastohs KM71 H. [60]
Furthermore, a preliminary ELISA study using the rCFP32 produced in P. pastoris and seven sera from tuberculosis patients showed a strong reactivity with all the sera as compared to four healthy BCG vaccinated individuals [Figure 7].
N-terminal sequencing:
N-terminal sequencing of HPLC purified rCFP32 was performed to determine if cleavage of the Saccharomyces cerevisiae αmating factor, signal peptide was properly processed. A single N terminus end was found and corresponded to the Glu-Ala-Glu-Phe-Pro-Lys-Arg-Ser-Tyr-Arg-Gln sequence (SEQ ID NO:27). The four amino acids Glu-Ala-Glu-Phe (SEQ ID NO:26) at the N-terminus correspond to the two last residues of the αfactor [GIu-AIa] followed by the two residues [Glu-Phe] introduced at the cloning site. Proline is the first residue of CFP32 originally expressed by Mycobacterium (FIG.4). These data show that the signal peptide is properly cleaved and that the Ste13 protease of the P.pastoris secretory pathway is responsible for the removal of this signal peptide.
In silico analysis of the rCFP32 amino acid sequence.
To relate the higher size observed for the rCFP32 to potential post translational modification, the sequence corresponding to the recombinant form of
CFP32 including the extra NH2 Glu-Ala-Glu-Phe (SEQ ID NO:27) residues and the extra Ala at the COOH terminus, was analyzed using several protein analysis softwares for the presence of postranslational modification motif. As shown in
Table I several putative sequence of post translational modifications were identified. Glycosylation and acylation are usually carried out by Pichia pastoris.
Prediction of solvent accessibility [core/surface ratio] indicates that 57.47% of rCFP32 have more than 16% of their surface exposed. This data is confirmed by the prediction of the protein secondary structure that shows 17% of the protein folds as alpha helixes, 31% as extended sheet and 52% as loops. Furthermore prediction of protein globularity showed that rCFP32 appears as compact as a globular domain.
DICUSSION
To investigate the capacity of yeast to produce high amounts of recombinant Mycobacterium tuberculosis complex-specific culture filtrate proteins for the assessment of their potential for the serodiagnostic of tuberculosis and their relevance to the pathogenesis of tuberculosis, the inventors have generated a P. Pastoris clone that produces a high level of rCFP32 as a myc-(His)6 tagged protein. Because of cloning constraints, the inventors designed an expression cassette that introduced two extra residues, glutamic acid and phenylalanine at the NH2 terminus of the molecule as well as an alanine at the COOH end. Alanine was chosen because it's a neutral amino acid that is unlikely to affect the proper folding of the protein. Purification was carried out in one single step and the average yield obtained was 0.5gr per litre of culture supernatant. This is a high production yield considering that the culture was performed in shake flask and that no specific optimization procedure was carried out in any of the production steps.
The higher apparent molecular weight observed for the rCFP32 produced in P. pastoris is probably due to the production of this molecule as a fusion protein containing a myc-(His)6 tag at the COOH end. Yeast specific post translational modifications probably contribute to the size difference as suggested by the diffused banding pattern observed in SDS-PAGE. The identification of putative acylation and glycosylation sites in the CFP32 amino acid sequence argue in favor of post translational modification of the recombinant form produced in Pichia pastoris.
N-terminal sequencing suggested that cleavage of the αmating factor signal peptide, was essentially carried out by the Ste13 protease. The Saccharomyces cerevisiae gmating factor pre-propeptide can be cleaved at different sites by two proteases, namely Kex2 and Ste13 and variation of cleavage was observed for a number of recombinant protein expressed in P. pastoris [19, 60]. Proper cleavage of the heterologous signal peptide is important to yield a recombinant protein that is as close as possible to the native protein.
Recombinant CFP32 produced in P. pastoris is recognized by sera from patients with tuberculosis suggesting that yeast rCFP32 is similar to the native
CFP32 and thereby have immunogenic epitopes for antibodies developed in the patient to native CFP32. These immunogenic epitopes could be due either to a protein folding nearly identical to that of the native CFP32 and/or to post translational modifications that are common in Mycobacterial antigens. The identification in the CFP32 amino acid sequence of a number of putative motifs for post translational modifications, that can be performed by P. pastohs, [57, 58] also argue in favor of this possibility. The high solvent accessibility index observed in rCFP32 is an indicator of high antigenicity and could explain the good reactivity of rCFP32 with tuberculosis patients' sera (100% in our preliminary study as compared to the 30% previously reported with rCFP32 produced in E. CoIi [14]).
The rCFP32 produced in P. pastohs could be very useful in conducting further analysis of the structure-function of the protein mainly, its potential role in the pathogenesis of tuberculosis as suggested earlier [3, 14]. Furthermore, reactivity of this rCFP32 with tuberculosis patients' sera is being investigated with a larger panel of patients (4).
Our findings underscore the potential of using the yeast Pichia pastoris to produce high amounts of recombinant mycobacterial antigens that structurally approximate the native protein. By overcoming the obstacle of making large quantities of mycobacterium antigens, mainly those found in culture filtrate, in depth investigation of their vaccinal and/or diagnostic potential as well as their role in the pathogenesis of the disease will be facilitated.
Table 1 : Putative postranslational modification sites present in the amino aid sequence of Mycobacterium tuberculosis culture filtrate protein CFP32. [PKC Protein Kinase C1 CK2 Casein kinase II, Single letter amino acid nomenclature is used]. One glycosylation and two phosphorylation sites were identified. Six acylation [myristoylation] motifs are scattered throughout the sequence.
Λ means any amino acid
Example 3 : High level expression of recombinant Mycobacterium tuberculosis proteins CFP10 and ESAT-6 in Pichia pastoris.
Pursuant to the objective of evaluating the potential of using Mycobacterium tuberculosis recombinant proteins produced from the yeast Pichia Pastoris in the serodiagnostic of tuberculosis -and after having demonstrated it for the culture filtrate antigen CFP32- we were interested in two other antigens, ESAT-6 and CFP10, precociously secreted by M. tuberculosis and which are of interest since they are not present in M.bovis, thereby allowing a better discrimination of the tuberculous patient compared to the individual vaccinated with BCG (M.bovis attenuated strain/
The inventors have now been able to produce these proteins in the recombinant form after having expressed them in Pichia (Figure 20). The two strains of Pichia respectively expressing ESAT-6 and CFP10 have been deposited at the CNCM on June 27, 2007, under accession numbers I-3778 and I-3777, respectively. Their purpose in serology is under study in the Tunisian cohort of tuberculous patients and of healthy control vaccinated with BCG.
Interestingly, the in silico study of ESAT-6 shows the presence of a glycosylation site, which will allow us to verify the hypothesis for the potential role
of post-translational phenomena effected by Pichia and not by E.coli, in the best serious recognition of recombinant antigens produced by Pichia which are closer to the native form.
As such, for the CFP32 protein produced in Pichia, the inventors have obtained preliminary results which have not been published - and which must first be confirmed in a larger cohort - showing that, following deglycosylation obtained either in vivo with the use of tunicamycin in the Pichia culture or in vitro by deglycosylating the CFP32 recombinant protein already produced by endoglycosidase F (Figures 21 A and 21 B), the deglycosylated recombinant proteins are not as well recognized by the serums when compared to the recognition obtained before deglycosylation (Figure 22).
Although preferred embodiments of the present invention have been described in detail herein and illustrated in the accompanying drawings, it is to be understood that the invention is not limited to this embodiment and that various changes and modifications could be made without departing from the scope and spirit of the present invention.
REFERENCES
1. Andersen, P. 1997. Host responses and antigens involved in protective immunity to Mycobacterium tuberculosis. Scand. J. Immunol. 45:115-131.
2. Andersen, P., and MT Doherty. 2005. Nat. Rev. Microbiol. 3: 656-662.
3. Andreu, N., C. Ysoto, I. Roca, C. Martin, and I. Gibert. 2004. Mycobacterium smegmatis displays the Mycobacterium tuberculosis virulence-related neural red character when expressing the RvO577 gene. FEMS Microbiol. Lett. 231 :283-289.
4. Benabdesselem, C1 Barbouche, M. R., Jarboui, M.A., Dellagi, K., Ho, J. L., Fathallah, D. M. 2007. High Level Expression of Recombinant Mycobacterium tuberculosis Culture Filtrate Protein CFP32 in Pichia pastoris. MoI. Biotechnol. 35(1): 41-50.
5. Boesen, H., B. N. Jensen, T. Wilcke, and P. Andersen. 1995. Human T-cell responses to secreted antigen fractions of Mycobacterium tuberculosis. Infect. Immun. 63:1491-1497.
6. Camus, J. C, M.J. Pryor, C. Medigue, and ST. Cole. 2002. Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv. Microbiology. 148:2967-2973.
7. Chaudhary, V. K., A. Kulshreshta, G. Gupta, N. Verma, S. Kumari, S. K. Sharma, A. Gupta, and A. K. Tyagi. 2005. Expression and purification of recombinant 38-kDa and Mtb81 antigens of Mycobacterium tuberculosis for application in serodiagnosis. Protein Expr Purif. 40:169-176.
8. Cole, S. T., R. Brosch, J. Parkhill, T. Gamier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D.
Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M. -A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrel. 1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 393:537-544.
9. Cregg, J. M., T. S. Vedvick, W. C.Raschke. 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Biotechnology. 11 :905-910.
10. Demissie, A., P. Ravn, J. Olobo, T. M. Doherty, T. Eguale, M. Geletu, W. Hailu, P. Andersen, and S. Britton. 1999. T-cell recognition of Mycobacterium tuberculosis culture filtrate fractions in tuberculosis patients and their household contacts. Infect. Immun. 67:5967-5971.
11. Dye, C, S. Scheele, P. Dolin, V. Pathania, and M. C. Raviglione. 1999. Consensus statement. Global burden of tuberculosis: estimated incidence, prevalence, and mortality by country. WHO Global Surveillance and Monitoring Project. JAMA 282:677-686.
12. Horn C, A. Namane, P. Pescher, M. Riviere, F. Romain, G. Puzo, O. Barzu, and G. Marchal. 1999. Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern. J. Biol. Chem. 274:32023-30.
13. Horwitz, M. A., B. W. Lee, B. J. Dillon, and G. Harth. 1995. Protective immunity against tuberculosis induced by vaccination with major extracellular proteins of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA. 92:1530-1534.
14. Huard R.C., S. Chitale, M. Leung, L.C. Lazzarini, H. Zhu, E. Shashkina, S. Laal, M. B. Conde, A. L. Kritiski, J. T. Belisle, B. N. Krieswirth, J. R. Lapa e Silva, and J. L. Ho. 2003. The Mycobacterium tuberculosis complex- restricted gene cfp32 encodes an expressed protein that is detectable in tuberculosis patients and is positively correlated with pulmonary interleukin- 10. Infect. Immun. 71 :6871-83.
15. Huard, R.C., L.C. Lazzarini, W. R. Butler, D. Van Soolingen, and J. L. Ho. 2003. PCR-based method to differentiate the subspecies of Mycobacterium tuberculosis complex on the basis genomic deletions. J. Clin. Microbiol. 41 :1637-1650.
16. Landowski, C.P., H. P. Gogfrey, S. I. Bentley-Hibbert, X. Liu, Z. Huang, R. Sepulveda, K. Huygen, M. L Gennaro, F. H. Moy, S. A. Lesley, and M. Haak-Frendscho. 2001. Combinatorial use of antibodies to secreted mycobacterial proteins in a host immune system-independent test for tuberculosis. J. Clin. Microbiol. 39:2418-2424.
17. Lim, R. L., L. K. Tan, W. F. Lau, M. C. Ming, R. Dunn, H. P. Too, and L. Chan. 2000. Cloning and expression of immunoreactive antigens from Mycobacterium tuberculosis. Clin. Diagn. Lab. Immunol. 7:600-606.
18. Lyashchenko, K., R. Colangeli, M. Houde, H. Al Jahdali, D. Menzies, and M. L. Gennaro. 1998. Heterogeneous antibody responses in tuberculosis. Infect. Immun. 66:3936-3940.
19. Macau ley-Patrick, S., M. L. Fazenda, B. McNeil, and L. M. Harvey. 2005. Heterologous protein production using the Pichia pastoris expression system. Yeast. 22:249-270.
20. Pai, M., L. R. Riley, and J. M. Colford Jr. 2004. Interferon^ assays in immunodiagnosis of tuberculosis: a systematic review. Lancet Infect.Dis. 4:761-776.
21. Paramasivam, M., K. Saravanan, K. Uma, S. Sharma, T. P. Singh, and A. Srinivasam, 2002. Expression, purification and characterization of equine lactoferrin in Pichia pastoris. Protein. Expr. Purif. 26:28-34.
22. Pottumarthy, S., V. C. Wells, and A. J. Morris. 2000. A comparison of seven tests for 40 serological diagnosis of tuberculosis. J. Clin. Microbiol. 38:2227- 31.
23. Roche, P. W., N. Winter, J. A. Triccas, C. G. Feng, and W. J. Britton. 1996. Expression of Mycobacterium tuberculosis MPT64 in recombinant Mycobacterium smegmatis: purification, immunogenicity and application to skin tests for tuberculosis. Clin. Exp. Immunol. 103:226-32.
24. Romain, F., C. Horn, P. Pescher, A. Namane, M. Riviere, G. Puzo, O. Barzu, and G. Marchal. 1999. Deglycosylation of the 45/47-kilodalton antigen complex of Mycobacterium tuberculosis decreases its capacity to elicit in vivo or in vitro cellular immune responses. Infect. Immun. 67:5567- 72.
25. Romanos, M.A., C. A. Scorer, and J. J. Clare. 1992. Foreign gene expression in yeast. Yeast. 8:423-488.
26. Samanich, K., J. T. Belisle, and S. Laal. 2001. Homogeneity of antibody responses in tuberculosis patients. Infect. Immun. 69: 4600-4609.
27. Samanich, K. M., J. T. Belisle, M. G. Sonnenberg, M. A. Keen, S. ZoIIa- Pazner, and S. Laal. 1998. Delineation of human antibody responses to culture filtrate antigens of Mycobacterium tuberculosis. J. Infect. Dis.
178:1534-1538.
28. Samanich, K.M., M. A. Keen, V. D. Vissa, J. D. Harder, J. S. Spencer, J. T. Belisle, S. Zolla-Pazner, and S. Laal. 2000. Serodiagnostic potential of culture filtrate antigens of Mycobacterium tuberculosis. Clin. Diagn. Lab.
Immunol. 7:662-668.
29. Scorer, C. A., R. G. Buckholz, J. J. Clare, and M. A. Romanos. 1993. The intracellular production and secretion of HIV-1 envelope protein in the methylotrophic yeast Pichia pastoήs. Gene. 136:111-1 19.
30. Siddiqi, K., M. L. Lambert, and J. Walley. 2003. Clinical diagnosis of smear- negative pulmonary tuberculosis in low-income countries: the current evidence. Lancet Infect. Dis. 3:288-296.
31. Singh, K. K., Y. Dong, L. Hinds, M. A. Keen, J. T. Belisle, S. Zolla-Pazner, J. M. Achkar, A. J. Nadas, V. K. Arora, and S. Laal. 2003. Combined use of serum and urinary antibody for diagnosis of tuberculosis. J. Infect. Dis. 188:371-377.
32. Smith, S. M., M. R. Klein, A. S. MaNn, J. Sillah, K. Huygen, P. Andersen, K. P. McAdam, and H. M. Dockrell. 2000. Human CD8+ 29 T cells specific for Mycobacterium tuberculosis secreted antigens in tuberculosis patients and healthy BCG-vaccinated controls in the Gambia. Infect. Immun. 68:7144- 7148.
33. Sonnenberg, M. G., and J. T. Belisle. 1997. Definition of Mycobacterium tuberculosis culture filtrate proteins by two-dimensional polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and electrospray mass spectrometry. Infect. Immun. 65:4515-4524.
34. Sreekrishna, K., R. G. Brankaamp, K. E. Kropp, D. T. Blankenship, J. T. Tsay, P. L. Smith, J. D. Wierschke, A. Subramaniam, and L. A. Birkenberger. 1997. Strategies for optimal synthesis and secretion of heterologous proteins in the methylotrophic yeast Pichia pastohs. Gene. 190:55-62.
35. VanderVen, C. B., J. D. Harder, D. C. Crick, and J. T.Belisle, 2005. Export- mediated assembly of mycobacterial glycoproteins parallels eukaryotic pathways. Science. 309:941-44 943.
36. Wang, L., M. O. Turner, R. K. Elwood, M. Schulzer, and J. M. FitzGerald. 2002. A meta-analysis of the effect of Bacille Calmette Guerin vaccination on tuberculin skin test measurements. Thorax. 57:804-9.
37. Weldingh, K., I. Rosenkrands, L. M. Okkels, T. M. Doherty, and P. Andersen. 2005. Assessing the serodiagnostic potential of 35 Mycobacterium tuberculosis proteins and identification of four novel serological antigens. J. Clin. Microbiol. 43:57-65.
38. Wendeler, M., J. Hoerschemeyer, M. John, N. Werth, M. Schoeniger, T. Lemm, R. Hartman, H. Kessler, and K. Sandhoff. 2004. Expression of the GM2-activator protein in the methylotrophic yeast Pichia pastoris, purification, isotopic labelling, and biophysical characterization. Protein.
Expr. Purif. 34:147-157.
39. WHO Report 2005. Global tuberculosis control.
40. Zhang, Y., R. Lathigra, T. Garbe, D. Catty, and D. Young. 1991. Genetic analysis of superoxide dismutase, the 23 kilodalton antigen of Mycobacterium tuberculosis. MoI Microbiol. 5:381-91.
41 Bassey, E. O. E., Catty, D., Kumararatne, D. S., Raykundalia, C. (1996) Candidate antigens for improved serodiagnosis of tuberculosis. Tubercle and Lung Disease. 77, 136-145.
42. RosenKrands, I., Weldingh, K., Jacobsen, S., Veggerby Hansen, G., Florio, W., Gianetri, I. and Andersen, P.( 2000) Mapping and identification of Mycobacterium tuberculosis proteins by two dimensional gel electrophoresis, microsequencing and immunodetection. Electrophoresis, 2, 935-949.
43. RosenKrands, I., King, A., Weldingh, K., Moniatte, M., Moertz, E., Andersen, P. (2000) Towards the proteome of Mycobacterium tuberculosis.
Electrophoresis, 21 , 3740-3756.
44. Korepanova, A., Gao, F.P., Hua, Y., Qin, H., Nakamoto, R.K., Cross, T.A. (2005) Cloning and expression of multiple integral membrane proteins from Mycobacterium tuberculosis in Escherichia coli. Prot Sci. 14, 1 , 148-58.
45. Choudhary, R.K., Pullakhandam, R., Ehtesham, N.Z., Hasnain, S.E. (2004) Expression and characterization of Rv2430c, a novel immunodominant antigen of Mycobacterium tuberculosis. Prot Expr. Purif. 36, 2, 249-53.
46. Poletto, S.S., Da Fonseca, I.O., De Carvalho, LP., Basso, L.A., Santos, D. S. (2004) Selection of an Escherichia coli host that expresses mutant forms of Mycobacterium tuberculosis 2-trans enoyl-ACP(CoA) reductase and 3-ketoacyl-ACP(CoA) reductase enzymes. Prot Expr. Purif., 34, 1 , 118-
25.
47. Andersson, G. E., Sharp, P.M. (1996) Codon usage in the Mycobacterium tuberculosis complex. Microbiology. 142, 4, 915-25.
48. Lakey, D. L., Rama K. R. Voladri, Katheryn M., Edwards, Cynthia Hager, Buka Samten, Roberts s. Wallis, Peter F. Barnes, and Douglas S.Kernodle. (2000) Enhanced Production of recombinant Mycobacterium tuberculosis antigens in Escherichia coli by replacement of low usage codons. Infection and immunity. 68, 1 , 233-238.
49. Atkins, D., Al -Ghussein, H., Prehaund.C. And Contes, A.R. ( 1994) Overproduction and purification of Mycobacterium tuberculosis chaperonin
10. Gene. 150,145-148.
50. Bigi, F., Taboga, O., Romano, M. I., Alito, A., Fisanotti, J.C., Cataldi, A.A. (1999) Expression of the Mycobacterium bovis P36 gene in Mycobacterium smegmatis and the baculovirus/insect cell system. Braz J Med Biol Res. 32,
1 , 29-37.
51. Lara, M., Servin-Gonzalez, L., Singh, M., Moreno, C, Cohen, I., Nimtz, M., Espitia, C (2004). Expression, secretion, and glycosylation of the 45- and 47-kDa glycoprotein of Mycobacterium tuberculosis in Streptomyces lividans. Appl Environ Microbiol. 70, 2, 679-85.
52. Salim, K., Haedens, V., Content, J., Leblon, G., Huygen, K. (1997) Heterologous expression of the Mycobacterium tuberculosis gene encoding antigen 85A in Corynebacterium glutamicum. Appl Environ Microbiol. 63, 11 , 4392-400.
53. Dale, J.W. and Patki A. (1990) Mycobacterial gene expression and regulation, In Molecular biology of Mycobacteria (McFadden, J. ed.), Surrey UniversityPress, London, UK, pp173-198
54. Harth, G., Lee, B.Y., Wang, J., Clemens, D.L., Horwitz, M.A. (1996) Novel insights into the genetics, biochemistry, and immunocytochemistry of the 30-kilodalton major extracellular protein of Mycobacterium tuberculosis. Infect.lmmun. 64, 3038-3047.
55. Matsuo, K., Yamaguchi, R., Yamazaki. A., Tasaka, H. and Yamada, T. (1988) Cloning and expression of the Mycobacterium bovis BCG gene for extracellular alpha antigen. J. Bacteriol. 170, 3847-3854.
56. Al-Zarouni, M., Dale, JW. (2002) Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis 82, 6, 283-91.
57. Cregg, J. M., Cereghino, J. L., Shi J., Higgins D.R. (2000) Recombinant protein expression in Pichia pastoris. MoI. Biotechnol. 16, 23-52.
58. Cereghino, J. L., Cregg J. M.. (2000) αmating factor Recombinant protein expression in Pichia pastoris. FEMS Micobiol.Rev. 24, 45-66.
59. Sambrook, J., Fritsch, E. F. and T. Maniatis (1989). Molecular cloning: A laboratory Manual 2nd ed. Cold Spring Harbor Laboratory Press. Cold
Spring Harbor, NY, USA.
60. Guedel-Ben Tanfous, N., KaIIeI, H., Jarboui, M. A,, Fathallah, D. M. (2005) Expression in Pichia pastoris of a recombinant scFv form of MAb 107, an anti human CD11b integrin antibody. Enzy Microb technol 38, 5, 636-642.
61. Benabdesselem, C, Fathallah, D. M., Huard, R.C., Zhu, H., Jarboui, M.A.,
Dellagi, K., Ho, J. L. et Barbouche, R.M. (2006) Enhanced patient serum immunoreactivity to recombinant Mycobacterium tuberculosis CFP32 produced in the yeast Pichia pastoris compared to Escherichia coli and its potential for serodiagnosis of tuberculosis. J. Clin. Microbiol., 3086-3093.
Claims
1. A method for preparing a purified recombinant mycobacterial polypeptide containing immunogenic epitopes substantially similar to the ones of its corresponding native Mycobacterium species protein, said method comprising: a) culturing a recombinant yeast cell expressing said polypeptide in a culture medium under conditions sufficient to effect expression of the polypeptide; and b) separating the polypeptide from the yeast cell or culture medium.
2. The method according to claim 1 , wherein said yeast cell consists of a Pichia pastoris cell.
3. The method of claim 1 or 2, wherein the recombinant mycobacterial polypeptide is a polypeptide derived from Mycobacterium tuberculosis, Mycobacterium africanum or Mycobacterium bovis.
4. The method any one of claim 3, wherein the recombinant mycobacterial polypeptide is derived from Mycobacterium tuberculosis.
5. The method of claim 4, wherein the recombinant mycobacterial polypeptide is a CFP32 peptide.
6. The method of claim 4, wherein the recombinant mycobacterial polypeptide is a CFP 10 peptide.
7. The method of claim 4, wherein the recombinant mycobacterial polypeptide is an ESAT-6 peptide.
8. The method of claim 4, wherein the recombinant mycobacterial polypeptide is a DES peptide.
9. The method of claim 4, wherein the recombinant mycobacterial polypeptide is an APA peptide.
10. The method of claim 4, wherein the recombinant mycobacterial polypeptide is an EXP peptide.
11. The method of claim 5, wherein the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO:1.
12. The method of claim 11 , wherein the CFP32 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 264 of
SEQ ID NO:!
13. The method of claim 6, wherein the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 103 of SEQ ID NO:3.
14. The method of claim 13, wherein the CFP10 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3.
15. The method of claim 7, wherein the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 98 of SEQ ID NO:5.
16. The method of claim 15, wherein the ESAT-6 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5.
17. The method of claim 8, wherein the DES peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 338 of SEQ ID NO:7.
18. The method of claim 17, wherein the DES peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7.
19. The method of claim 9, wherein the APA peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 325 of SEQ ID NO:9.
20. The method of claim 19, wherein the APA peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 325 of
SEQ ID NO:9.
21. The method of claim 10, wherein the EXP peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 284 of SEQ ID NO:11.
22. The method of claim 21 , wherein the EXP peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:11.
23. A purified recombinant mycobacterial polypeptide or a functional fragment thereof obtained by the method of claim 1.
24. The polypeptide of claim 23, wherein said polypeptide is fused to an epitope tag.
25. The polypeptide of claim 24, wherein said epitope tag comprises a c-myc amino acid sequence.
26 . The polypeptide of claim 25, wherein said epitope tag consists of a c-myc- (HIS)6 tag.
27. The polypeptide of claim 26, wherein said c-myc-(HIS)6 tag has an amino acid sequence consisting of amino acid residues 267 to 287 of SEQ ID NO:1.
28. The polypeptide of claim 26, wherein said c-myc-(HIS)6 tag has an amino acid sequence consisting of amino acid residues 107 to 126 of SEQ ID NO:3.
29. The polypeptide of claim 26, wherein said c-myc-(HIS)6 tag has an amino acid sequence consisting of amino acid residues 102 to 121 of SEQ ID NO:5.
30. The polypeptide any one of claims 23 to 27, wherein the recombinant mycobacterial polypeptide derives from the Mycobacterium tuberculosis
CFP32 peptide.
31. The polypeptide of claim 30, wherein the recombinant mycobacterial polypeptide is a CFP32 peptide.
32. The polypeptide of claim 31 , wherein the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 264 of SEQ ID NO: 1.
33. The polypeptide of claim 32, wherein the CFP32 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 264 of SEQ ID NO:!
34. The polypeptide of claim 31 , wherein the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 267 of SEQ ID NO: 1.
35. The polypeptide of claim 34, wherein the CFP32 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 267 of SEQ ID NO: 1.
36. The polypeptide of claim 31 , wherein the CFP32 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 287 of SEQ ID NO:1.
37. The polypeptide of claim 36, wherein the Mycobacterium tuberculosis CFP32 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 287 of SEQ ID NO:1.
38. The polypeptide any one of claims 23 to 26 and 28, wherein the recombinant mycobacterial polypeptide derives from the Mycobacterium tuberculosis and is a CFP10 peptide.
39. The polypeptide of claim 38, wherein the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 103 of SEQ ID NO:3.
40. The polypeptide of claim 39, wherein the CFP10 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 103 of SEQ ID NO:3.
41. The polypeptide of claim 38, wherein the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 107 of SEQ ID NO:3.
42. The polypeptide of claim 41 , wherein the CFP10 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 107 of SEQ ID NO:3.
43. The polypeptide of claim 38, wherein the CFP10 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 126 of SEQ ID NO:3.
44. The polypeptide of claim 43, wherein the CFP10 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 126 of SEQ ID NO:3.
45. The polypeptide any one of claims 23 to 26 and 29, wherein the recombinant mycobacterial polypeptide consists of the ESAT-6 peptide.
46. The polypeptide of claim 45, wherein the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 98 of SEQ ID NO:5.
47. The polypeptide of claim 46, wherein the ESAT-6 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 98 of SEQ ID NO:5.
48. The polypeptide of claim 45, wherein the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 102 of SEQ ID NO:5.
49. The polypeptide of claim 48, wherein the ESAT-6 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to
102 of SEQ ID NO:5.
50. The polypeptide of claim 45, wherein the ESAT-6 peptide comprises an amino acid sequence substantially similar to amino acid residues 5 to 121 of SEQ ID NO:5.
51. The polypeptide of claim 50, wherein the ESAT-6 peptide comprises an amino acid sequence at least 90% identical to amino acid residues 5 to 121 of SEQ ID NO:5.
52. The polypeptide any one of claims 23 to 26, wherein the recombinant mycobacterial polypeptide is a DES peptide, APA peptide or a EXP peptide.
53. The polypeptide of claim 52, wherein the DES peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 338 of SEQ ID NO:7.
54. The polypeptide of claim 53, wherein the DES peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 338 of SEQ ID NO:7.
55. The polypeptide of claim 52, wherein the APA peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 325 of SEQ ID NO:9.
56. The polypeptide of claim 55, wherein the Mycobacterium tuberculosis APA peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 325 of SEQ ID NO:9.
57. The polypeptide of claim 52, wherein the EXP peptide comprises an amino acid sequence substantially similar to amino acid residues 1 to 284 of SEQ
ID NO:11.
58. The polypeptide of claim 57, wherein the EXP peptide comprises an amino acid sequence at least 90% identical to amino acid residues 1 to 284 of SEQ ID NO:11.
59. A method for diagnosing a mycobacterial related infectious disease in a subject, comprising : a) contacting a sample of a subject with a polypeptide as defined in any one of claims 23 to 58 for a time and under conditions sufficient to form a polypeptide-mycobacterial specific antibody complex; and b) detecting the presence or absence of the complex formed in a).
60. The method of claim 59, wherein the mycobacterial related infectious disease is tuberculosis.
61. A yeast host cell comprising a polynucleotide encoding a recombinant mycobacterial polypeptide as defined any one of claims 23 to 58.
62. The yeast host cell of claim 61 , consisting of a Pichia pastoris host cell.
63. The yeast host cell of claim 62, wherein said polynucleotide comprises a sequence substantially similar to:
- nucleotides 13 to 794 of SEQ ID NO:2;
- nucleotides 13 to 828 of SEQ ID NO:2; - nucleotides 1 to 864 of SEQ ID NO:2;
- nucleotides 13 to 311 of SEQ ID NO:4;
- nucleotides 13 to 345 of SEQ ID NO:4;
- nucleotides 13 to 378 of SEQ ID NO:4;
- nucleotides 1 to 381 of SEQ ID NO:4; - nucleotides 13 to 296 of SEQ ID NO:6;
- nucleotides 13 to 330 of SEQ ID NO:6;
- nucleotides 13 to 363 of SEQ ID NO:6; - nucleotides 1 to 366 of SEQ ID NO:6;
- nucleotides 1 to 1017 of SEQ ID NO:8;
- nucleotides 1 to 978 of SEQ ID NO:10; or
- nucleotides 1 to 855 of SEQ ID NO: 12.
64. The yeast host cell of claim 63, wherein said polynucleotide comprises a sequence at least 90% identical to:
- nucleotides 13 to 794 of SEQ ID NO:2;
- nucleotides 13 to 828 of SEQ ID NO:2; - nucleotides 1 to 864 of SEQ ID NO:2;
- nucleotides 13 to 311 of SEQ ID NO:4;
- nucleotides 13 to 345 of SEQ ID NO:4;
- nucleotides 13 to 378 of SEQ ID NO:4;
- nucleotides 1 to 381 of SEQ ID NO:4; - nucleotides 13 to 296 of SEQ ID NO:6;
- nucleotides 13 to 330 of SEQ ID NO:6;
- nucleotides 13 to 363 of SEQ ID NO:6;
- nucleotides 1 to 366 of SEQ ID NO:6;
- nucleotides 1 to 1017 of SEQ ID NO:8; - nucleotides 1 to 978 of SEQ ID NO: 10; or
- nucleotides 1 to 855 of SEQ ID NO: 12.
65. The yeast host cell deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on July 18, 2006, under accession number I-3655.
66. The recombinant yeast cell deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3777.
67. The recombinant yeast cell deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3778.
68. The hybridoma cell producing monoclonal antibodies to anti-CFP32 deposited at the CNCM (Collection Nationale de Cultures de Microorganismes), 28 rue du Docteur Roux, 75724 PARIS Cedex 15, France, on June 27, 2007, under accession number I-3779.
69. A kit for diagnosing a mycobacterial species related infectious disease in a subject, comprising: a) a recombinant mycobacterial polypeptide of any one of claims 23 to 58 or a yeast host cell of any one of claims 63 and 64; and b) reagents to detect a polypeptide-mycobacterial specific antibody immune complex.
70. The kit as defined in claim 69, wherein one of the reagents is the monoclonal antibody to anti-CFP32 as deposited at the CNCM on June 27, 2007, under accession number 1-3779.
71. An immunogenic composition capable to induce antibodies recognizing specifically the polypeptide according to claims 23 to 58.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2551537 | 2006-07-04 | ||
| CA002551537A CA2551537A1 (en) | 2006-07-04 | 2006-07-04 | Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008010096A2 true WO2008010096A2 (en) | 2008-01-24 |
| WO2008010096A3 WO2008010096A3 (en) | 2008-07-10 |
Family
ID=38878488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2007/002936 Ceased WO2008010096A2 (en) | 2006-07-04 | 2007-07-04 | Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases |
Country Status (2)
| Country | Link |
|---|---|
| CA (1) | CA2551537A1 (en) |
| WO (1) | WO2008010096A2 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015168112A1 (en) * | 2014-04-29 | 2015-11-05 | Conagen, Inc. | Microbial ergothioneine biosynthesis |
| CN110862969A (en) * | 2019-11-28 | 2020-03-06 | 扬州大学 | Hybridoma cell strain secreting anti-CFP-10 antibody, antibody and application thereof |
| WO2024138121A3 (en) * | 2022-12-22 | 2024-08-02 | Akagera Medicines, Inc. | Lipid nanoparticles for the prevention of tuberculosis or other mycobacterial infections |
| CN118852457A (en) * | 2024-06-25 | 2024-10-29 | 中山大学附属第五医院 | A Mycobacterium tuberculosis multi-epitope protein and its construction method and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6641814B1 (en) * | 1997-04-02 | 2003-11-04 | Statens Serum Institut | Nucleic acids fragments and polypeptide fragments derived from M. tuberculosis |
-
2006
- 2006-07-04 CA CA002551537A patent/CA2551537A1/en not_active Abandoned
-
2007
- 2007-07-04 WO PCT/IB2007/002936 patent/WO2008010096A2/en not_active Ceased
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015168112A1 (en) * | 2014-04-29 | 2015-11-05 | Conagen, Inc. | Microbial ergothioneine biosynthesis |
| CN106661585A (en) * | 2014-04-29 | 2017-05-10 | 科纳根公司 | Microbial ergothioneine biosynthesis |
| US10544437B2 (en) | 2014-04-29 | 2020-01-28 | Conagen Inc. | Microbial ergothioneine biosynthesis |
| CN110862969A (en) * | 2019-11-28 | 2020-03-06 | 扬州大学 | Hybridoma cell strain secreting anti-CFP-10 antibody, antibody and application thereof |
| CN110862969B (en) * | 2019-11-28 | 2021-08-24 | 扬州大学 | Hybridoma cell line secreting anti-CFP-10 antibody, its antibody and its application |
| WO2024138121A3 (en) * | 2022-12-22 | 2024-08-02 | Akagera Medicines, Inc. | Lipid nanoparticles for the prevention of tuberculosis or other mycobacterial infections |
| CN118852457A (en) * | 2024-06-25 | 2024-10-29 | 中山大学附属第五医院 | A Mycobacterium tuberculosis multi-epitope protein and its construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2008010096A3 (en) | 2008-07-10 |
| CA2551537A1 (en) | 2008-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7122196B2 (en) | Compounds and methods for diagnosis of tuberculosis | |
| EP2154248B1 (en) | Compounds and methods for diagnosis of tuberculosis | |
| CN104640564B (en) | Mycobacterial antigen vaccines | |
| Roche et al. | T-cell determinants and antibody binding sites on the major mycobacterial secretory protein MPB59 of Mycobacterium bovis | |
| KR101528169B1 (en) | Method and kit for detection of anti-avibacterium paragallinarum antibody | |
| WO1997009428A9 (en) | Compounds and methods for immunotherapy and diagnosis of tuberculosis | |
| KR20010012813A (en) | Compounds for diagnosis of tuberculosis and methods for their use | |
| WO1997009428A2 (en) | Compounds and methods for immunotherapy and diagnosis of tuberculosis | |
| CA2268036A1 (en) | Compounds and methods for diagnosis of tuberculosis | |
| Arif et al. | Serodiagnostic evaluation of fusion proteins from multiple antigens of Mycobacterium tuberculosis for active TB | |
| CN105829891B (en) | Diagnostic reagents for improved in vivo or in vitro cell-mediated immunodiagnosis of tuberculosis | |
| AU2002324578B2 (en) | Early detection of mycobacterial disease using peptides | |
| WO2008010096A2 (en) | Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases | |
| Benabdesselem et al. | Enhanced patient serum immunoreactivity to recombinant Mycobacterium tuberculosis CFP32 produced in the yeast Pichia pastoris compared to Escherichia coli and its potential for serodiagnosis of tuberculosis | |
| Verbon et al. | Characterization of B cell epitopes on the 16K antigen of Mycobacterium tuberculosis | |
| AU2002324578A1 (en) | Early detection of mycobacterial disease using peptides | |
| US7807182B2 (en) | Early detection of mycobacterial disease using peptides | |
| Falla et al. | Identification of B-and T-cell epitopes within the MTP40 protein of Mycobacterium tuberculosis and their correlation with the disease course | |
| Ramalingam et al. | Cloning, expression, and purification of the 27 kDa (MPT51, Rv3803c) protein of Mycobacterium tuberculosis | |
| Benabdesselem et al. | High level expression of recombinant Mycobacterium tuberculosis culture filtrate protein CFP32 in Pichia pastoris | |
| CA2591804A1 (en) | Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases | |
| CA2557772A1 (en) | Method for preparing recombinant mycobacterial polypeptides in yeast and their use in diagnosis of mycobacterial related diseases | |
| EP1712629A2 (en) | Compounds and methods for diagnosis of tuberculosis | |
| EP0962532A1 (en) | Polypeptides and nucleic acids encoding the same for the diagnosis and prevention of tuberculosis disease. | |
| ES2368572T3 (en) | COMPOUNDS AND METHODS FOR IMMUNOTHERAPY AND DIAGNOSIS OF TUBERCULOSIS. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07825261 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 07825261 Country of ref document: EP Kind code of ref document: A2 |
