WO2007137616A1 - Highly diversified antibody libraries - Google Patents
Highly diversified antibody libraries Download PDFInfo
- Publication number
- WO2007137616A1 WO2007137616A1 PCT/EP2006/006339 EP2006006339W WO2007137616A1 WO 2007137616 A1 WO2007137616 A1 WO 2007137616A1 EP 2006006339 W EP2006006339 W EP 2006006339W WO 2007137616 A1 WO2007137616 A1 WO 2007137616A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- library
- variable region
- antibody
- fragments
- random mutagenesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
Definitions
- This invention relates to highly diversified antibody libraries and methods for generating highly diversified antibody libraries.
- Human antibody fragments can be directly selected from antibody gene repertoires expressed on the surface of filamentous bacteriophages (Winter et al 1994 Annu Rev Immunol 12:433-455), of yeast cells (Feldaus et al 2003 Nat Biotechnol 21 : 163-170), of bacterial cells or of ribosomes (Hanes J. and Pluckthun A. 1997 PNAS 94:4937- 42).
- the diversity of the library determines the probability to isolate an antibody with high affinity for a given antigen.
- Antibodies libraries may be obtained from natural sources. Diverse libraries of immunoglobulin heavy (VH) and light (VL: V kappa and V lambda) chain variable (V) genes were prepared from B-cells of unimmunized donors (Marks et al 1991 J MoI Biol 222:581-597) or of immunized donors (Barbas et al, 1991 PNAS 88:7978- 7982; Clackson et al 1991 Nature 352:624-628) by polymerase chain reaction (PCR) amplification.
- VH immunoglobulin heavy
- the CDRH3 loop of the variable heavy genes varies in size and sequence during the rearrangement of the V-D-J segments in the process of forming the unmutated VH repertoire and plays a dominant role in the antibody diversity.
- CDRH3 is located at the center of the antigen binding site and it is the most variable among the CDRs in natural antibody.
- Synthetic libraries were constructed by the randomization with degenerate primers of the CDRH3.
- medium size libraries (5x10 7 members) with variation in the CRDH3 have provided a successful selection of novel antibody specificities (Barbas et al 1992 PNAS 89:4457-4461; Hoogenboom and Winter 1992 J MoI Biol 227:381-388).
- the degree of functional variation is achieved by means of simultaneous and random combination of six biologically derived CDRs (Soderlind et al 2000 Naturel 8:852-856).
- the CDRs from a cDNA library prepared from peripheral blood B cell were combined within a selected framework of the DP-47 germline gene (VH3 family) by overlap extension PCR.
- VH3 family germline gene
- the genetic diversity produced with this process is different from naturally created in the immune system. This means that this new type of antibody could be potentially immunogen.
- the library is based on a single framework and this hinders the ability of the antibodies of the library to bind all types of antigens.
- the present invention provides an in vitro method for obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and/or the variable region of a light chain, wherein random mutagenesis is performed on a library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain; and wherein the random mutagenesis process creates randomly distributed mutations along at least 70% of the sequence encoding the variable region.
- a library of polynucleotides comprising a sequence with one or more mutations within the CDRs encoding region and/or with one or more mutations within the framework encoding regions is created.
- random mutagenesis process creates randomly distributed mutations along the whole sequence encoding the variable region.
- a method according to the invention may comprise the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and the step of performing random mutagenesis of a polynucleotide encoding the variable region of a light chain.
- the polynucleotide encoding the variable region is a polynucleotide encoding a single chain antibody.
- An embodiment of the present invention provides a method for obtaining a library of cells, each comprising a polynucleotide encoding antibodies or fragments thereof, comprising the steps of: a) obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof by the method according to the invention; and b) transforming cells with the polynucleotides obtained in step a).
- An embodiment of the present invention provides a library of cells obtainable by this method.
- An embodiment of the present invention provides a library of phages obtainable by this method.
- PBMC peripheral blood monocyte
- PBMC RNA was isolated from 100 donors. The donors were healthy or were afflicted with diverse diseases: Bacterial or viral infections, autoimmune diseases, endocrine diseases (e.g. diabetes) and cancer.
- PBMC mRNA was isolated and antibody heavy and light chains (Vlambda and Vkappa) cDNA produced from the reverse transcription were PCR amplified with several mixtures of primer pair characteristics of the N-terminal and C-terminal extremities of all different families of the variable genes.
- VH were PCR amplified using 14 different VH forward primers and a mixture of 4 JH reverse primers.
- a second PCR with tagged primers were used to introduce restriction sites Sail in 5' and EcoRI in 3' of the VH fragments.
- the VH PCR products were cloned into Sail and EcoRI restriction sites of pUC18 vector.
- VH5 SEQ ID N°l
- VHlO SEQ ID N°2
- the DNA coding for the VH5 and VHlO clones corresponded to the germline gene IGHV 1-3 and IGHV 1-24, respectively.
- the blast program was used on the IMGT web site: http://imgt.cines.fr/.
- the sequences are described in figure 1.
- the mutagenesis process was designed to modify the complete variable gene without the JH region. This region was not mutated in prevision of possible future use as template in an overlap PCR to associate the VH and the VL libraries. Two randomly mutated libraries were constructed MB-VH5 and MB-VHlO.
- the mixture was denatured for 5 min at 95°C and cooled down to 4°C.
- An equal volume of a solution containing 4 units of human polymerase beta in replication buffer A, B or E was added to each replication reaction A, B and E.
- the reactions of replication were carried out at 37°C for one hour.
- the replication products were then purified through phenol-chloroform and ethanol precipitation.
- the replication products obtained in replication conditions A, B and E were selectively amplified through a selective PCR amplification with tail primers.
- the primers were designed with a tail that is non-specific to the template and allowed to specifically amplify the DNA fragments synthesized by the mutases.
- a fraction of each replication product obtained in the replication conditions A, B and E was added to a mixture containing the PCR buffer (20 mM Tris HCl pH 8.4, 50 mM KCl) (Life Technologies), 1.5 mM MgCl 2 , 10 pmol of the 5' and 3 1 primers, 200 microM of the 4 dNTPs and 1.25 U Platinum Taq DNA polymerase (Life Technologies). This mixture was incubated 5 min at 95°C, 5 sec at 55 C, 30 sec at 72°C following by 30 selective cycles of 20 sec at 94 0 C and 30 sec at 72°C.
- active part of the library it is meant the quantity of clones with open reading frames and thus potentially coding for functional variable antibody domains.
- FR framework of the variable domain
- CDR Complementary determining region of the variable domain
- TCAGTCTATCGTCACGTCAACGGCGGCGGATCTTCTAGA-S' SEQ ID N 0 I l
- plasmid pUC18-VL pUC18-VL6, pUC18-VL9 or pUC18-VL18
- Each mixture was denatured for 5 min at 95°C and cool down to 4°C.
- An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added.
- the reactions of replication were carried out at 37 0 C for one hour. The replication products were then purified.
- the amplified replication products were cloned into Xbal and Sail restriction sites of pUC18 to obtain: MB-VL6, MB-VL9 and MB-VLl 8 libraries.
- Table 7 Frequency of amino acid mutations in the different frameworks (FR) and CDR of the MB- VL6, MB- VL9 and MB-VL 18
- VK5 SEQ ID N°12
- VKI l SEQ ID N°13
- the sequences of the clones are described in figure 5.
- the VK5 and VKI l clones corresponded with the germline gene IGKV4-1 and IGKV6-57, respectively.
- Two randomly mutated libraries were constructed MB-VK5 and MB-VKl 1.
- VK genes were double replicated with human polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N 0 I l) and 1 ⁇ g of plasmid pUC18-VK (pUC18-VK5 or pUC18-VKl 1) as template in three different replication buffers A, B or E (cf. table 2). Each mixture was denatured for 5 min. at 95°C and cooled down to 4 0 C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reactions of replication were carried out at 37°C for one hour. The replication products were then purified.
- the replication products were selectively amplified through a selective PCR amplification with tail primers.
- the primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the mutases.
- a fraction of each replication product obtained in conditions A, B and E was added to a mixture containing the PCR buffer (20 mM Tris HCl pH 8.4, 50 mM KCl) (Life Technologies), 1.5 mM MgCl 2 , 10 pmol of the 5' and 3' primers, 200 ⁇ M of the 4 dNTPs and 1.25 U Platinum Taq DNA polymerase (Life Technologies). This mixture was incubated 5 min at 95 0 C, 5 sec at 55°C, 30 sec at 72°C followed by 30 selective cycles of 20 sec at 94°C and 30 sec at 72°C.
- the amplified replication products were cloned into Xbal and Sail restriction sites of pUC18 to obtain MB-VK5 and MB-VKl 1 libraries.
- the frequencies of mutations (cf. table 3) of the MB-VK5 and MB-VKl 1 libraries were 8.97 and 5.15 mutations per kilo bases, respectively.
- the average frequency of mutations of 7.06 per kilobases of the MB-VK libraries means 2.31 base mutations per gene.
- FR framework of the variable domain
- CDR Complementary determining region of the variable domain
- Example 2 Random mutagenesis applied to variable domain libraries. A. Random mutagenesis of the HS-VH library
- the HS-VH library (c.f. table 1) obtained as described before was double replicated with human polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer as an equimolar mixture of 4 primers [JH-l/2-for-mut (SEQ ID N°4), JH-3- for-mut (SEQ ID N°5), JH-4/5-for-mut (SEQ ID N°6), JH-6-for-mut (SEQ ID N°7)] and 1 ⁇ g of plasmid pUC18-VH (HS-VH DNA library) as template in the replication buffer A, B or E (cf. table 2). Each mixture was denatured for 5 min at 95°C and cooled down to 4°C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reaction of replication was carried out at 37°C for one hour.
- the replication products obtained in condition A, B and E were selectively amplified through a selective PCR amplification with tail primers.
- the primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the polymerase beta.
- the replication products selectively PCR amplified were cloned into Sail and EcoRI restriction sites of pUC18 to obtain the library MB_HS_VH_AEB01 (cf. table 9).
- the HS-VL library (cf. table 1) was double replicated with polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N 0 I l) and 1 ⁇ g of plasmid pUC18-VL (MB-VL DNA library) as template in the replication buffer A, B or E (cf. table 2).
- Each mixture was denatured for 5 min at 95°C and cooled down to 4°C.
- An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reaction of replication was carried out at 37°C for one hour.
- the replication products obtained in condition A, B and E were selectively amplified through a selective PCR amplification with tail primers.
- the primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the polymerase beta.
- the replication products selectively PCR amplified were cloned into Sail and EcoRI restriction site of pUC18 to obtain the library MB_HS_VL_AEB01 (cf. table 9).
- the HS-Vkappa library (cf. table 1) was double replicated with polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N 0 I l), 1 ⁇ g of plasmid pUC18-VK (HS_VK DNA library) as template in the replication buffer A, B or E (cf. table 2).
- the mixture was denatured for 5 min at 95° C and cooled down to 4°C.
- An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. Each reaction of replication was carried out at 37 0 C for one hour.
- the replication products were selectively amplified through a selective PCR amplification with tail primers.
- the primers were designed with a tail that is non-specific to the template and allowed to specifically amplify the DNA fragments synthesized by the polymerase beta.
- the replication products selectively PCR amplify were cloned into Sail and EcoRI restriction site of pUC18 to obtain the library MB_HS_VK_AEB01 (cf. table 9).
- the random mutagenesis of the human repertoires of HS_VH, HS_VL and HS VK domains has provided three libraries: MB_HS_VH_AEB01, MB_HS_VK_AEB01 and MB_HS_VL_AEB01, with library sizes of 1.17xlO 7 , 9.4xlO 6 and 4.8xlO 6 clones, respectively (cf. table 9).
- a sample of 400 randomly picked clones from the different libraries were DNA sequenced and analyzed.
- a representative sample of reference sequences of each subgroup VH, Vlambda and Vkappa from http://imgt.cines.fr/textes/vquest/refseqhb.htmWVQUEST were locally downloaded.
- the sequences from the libraries were compared to the reference sequences with the bioinformatic tools developed by MilleGen.
- the 201 sequenced clones of the light chain libraries (MB_HS_VL_AEB01 and MB_HS_VK_AEB01) showed a high representation of the VLl (66%) and VKl (70.36%) subtypes.
- the retrotranscript of the variable heavy and light genes of the mouse hybridoma VEBA76.50 were PCR amplified and cloned.
- the DNA coding for the VH and VL domains corresponded with the germline gene IGHV5S14 and IGKVl-117 (IMGT web site: http://imgt.cines.fr/).
- a single chain antibody Fv fragment (scFv) having the structure VH-VK was cloned into the vector pCR4-topoTA to obtain the clone MG_scFv2e.
- the MG_scFv2e gene was double replicated with human polymerases beta or eta using the 5' primer VH-scFv2e-S3 5'-
- MB_scFv2e_A_E obtained from the replication with mutase A in the condition E
- MB_scFv2e_B_N from the replication with mutase B in the condition N.
- the library sizes were 6x10 5 and 5x10 5 clones, respectively.
- the alignment of 31 and 30 sequences obtained from different clones of MB_scFv2e_A_E and MB_scFv2e_B_N libraries shows an homogenous distribution of the base mutations along the DNA sequences (cf. figure 7).
- Table 11 shows the modifications of the mutated sequences analyzed with Mut analyses 2.5 (MilleGen). According to the mutation conditions used, the libraries obtained have a different mutation profile.
- the frequency of base mutations is double in the MB_scFv2e_B_N library (7.51 per kb) compared to MB_scFv2e_A_E (3.14 per kb). Furthermore, the mutase B in condition N seems to induce a higher modification of the amino acids.
- the amino acid mutation frequency was 4 times higher in the MB_scFv2e_B_N library than in MB_scFv2e_A_E library (cf. table 11).
- the two different mutagenesis conditions lead to a library with a low mutagenesis frequency (0.57 mutation per 100 amino acids) and to library with a high mutagenesis frequency (1.52 mutation per 100 amino acids).
- the number of mutations per sequence of the MB_scFv2e_B_N library is widely represented with 59% of the sequences which have between 6 and 12 base modifications (cf. table 13).
- the MB_scFv2e_A_E library has 74 % of the sequences with 1-3 base mutations.
- Table 12 Mutation diversity of MB_scFv2e_A_E and MB_scFv2e_B_N libraries
- Table 13 Base mutation distribution per sequence of MB_scFv2e_A_E and MB scFv2e B N libraries
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides an in vitro method for obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and/or the variable region of a light chain of a light chain, wherein random mutagenesis is performed on a library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain; and wherein the random mutagenesis process creates randomly distributed mutations along at least 70% of the sequence encoding the variable region.
Description
Highly diversified antibody libraries.
FIELD OF THE INVENTION
This invention relates to highly diversified antibody libraries and methods for generating highly diversified antibody libraries.
BACKGROUND OF THE INVENTION
Human antibody fragments can be directly selected from antibody gene repertoires expressed on the surface of filamentous bacteriophages (Winter et al 1994 Annu Rev Immunol 12:433-455), of yeast cells (Feldaus et al 2003 Nat Biotechnol 21 : 163-170), of bacterial cells or of ribosomes (Hanes J. and Pluckthun A. 1997 PNAS 94:4937- 42).
The use of large and diverse human antibodies libraries provide several advantages: Animal immunization can be bypassed. Antibodies may be generated against antigens which are toxic upon immunization or have a low immunogenicity. Furthermore, in contrast to murine monoclonal antibodies, the use of human antibodies diminishes the risk of allergic response.
The diversity of the library determines the probability to isolate an antibody with high affinity for a given antigen.
Antibodies libraries may be obtained from natural sources. Diverse libraries of immunoglobulin heavy (VH) and light (VL: V kappa and V lambda) chain variable (V) genes were prepared from B-cells of unimmunized donors (Marks et al 1991 J MoI Biol 222:581-597) or of immunized donors (Barbas et al, 1991 PNAS 88:7978- 7982; Clackson et al 1991 Nature 352:624-628) by polymerase chain reaction (PCR) amplification. Genes encoding single chain antibody (scFv) were made by randomly combining heavy and light chain V-genes using PCR, and the combinatorial library was cloned for display on the surface of a phage.
Alternatively libraries may be obtained through the artificial introduction of mutations into the complementarity determining regions (CDR) of the heavy chains or of the light chain domains.
The CDRH3 loop of the variable heavy genes varies in size and sequence during the rearrangement of the V-D-J segments in the process of forming the unmutated VH repertoire and plays a dominant role in the antibody diversity. CDRH3 is located at the center of the antigen binding site and it is the most variable among the CDRs in natural antibody. Synthetic libraries were constructed by the randomization with degenerate primers of the CDRH3. Several studies showed that medium size libraries (5x107 members) with variation in the CRDH3 have provided a successful selection of novel antibody specificities (Barbas et al 1992 PNAS 89:4457-4461; Hoogenboom and Winter 1992 J MoI Biol 227:381-388). Larger libraries >108 members with CDRH3 sequence lengths of 4-21 residues from 50 VH (Nissim et al 1994 EMBO 13:692-698) and 6-15 residues in 49 different VH genes (de Kruif et al 1995 J MoI Biol 248:97-105) allowed the selection of antibody fragments with different specificities. The third CDR strongly contributes to the overall specificity of an antibody. However the drawback of this approach is to shadow the remaining five CDR-loops which also contribute to the specificity and affinity of the antibody.
Another approach combines all the CDR using a CDR-Implantation Technology (cf.
WO0175091). The degree of functional variation is achieved by means of simultaneous and random combination of six biologically derived CDRs (Soderlind et al 2000 Naturel 8:852-856). The CDRs from a cDNA library prepared from peripheral blood B cell were combined within a selected framework of the DP-47 germline gene (VH3 family) by overlap extension PCR. The genetic diversity produced with this process is different from naturally created in the immune system. This means that this new type of antibody could be potentially immunogen.
Furthermore, the library is based on a single framework and this hinders the ability of the antibodies of the library to bind all types of antigens.
Another approach is disclosed in US6828422 and in Knappik et al 2000 J mol Biol 296:57-86. Each of the human VH and VL subfamilies that is frequently used during an immune response was represented by one consensus framework, resulting in seven master genes for VH and seven master genes for VL to obtain 49 combinations. Diversity was created by replacing the VH and VL CDR3 regions of the master genes by CDR3 library cassettes, generated from mixed trinucleotides and biased towards natural human antibody CDR3 sequences. The sequencing of 257 members of the unselected libraries indicated that the frequency of correct and thus potentially functional sequences was 61%. However, the limited variability found in key residues in the CDR encoded by the few VH and VL used limits its ability to recognize certain target antigens. Structural incompatibility between these foreign CDRs and the fixed framework may potentially prevent the formation of functional antibody.
Various in vitro strategies were used to optimize an antibody selected from a library screening. These include site specific mutagenesis based on structural information or combinatorial mutagenesis of CDR. Mutations are usually restricted to the antigen binding surface (CDR). However, although the framework regions of the variable domains VH and VL are not directly in contact with the antigen, framework residues can have indirect effects on binding by affecting the CDR conformation. It was demonstrated that the affinity optimization could be obtained through association of mutations in the CDR and also in the framework variable fragments (Schier et al 1996 J MoI Biol 255:28-43, Boder et al 2000 PNAS 97:10701-10705, Hanes et al 2000 Naturel8:1287-1292, Irving et al 2001 J Immunol Methods 248:31-45). In the humanization process of the antibodies, simple grafting of the CDR sequences often yields humanized antibodies that bind the antigen much more weakly than the parent murine antibody. The affinity of an antibody is optimized by replacing key residues
in the framework regions (cf. Baca et al 1997, J Biol Chem 272:10678-10684 and EP1325932). However, optimization of the framework residues is time consuming and tedious.
There remains a general need in the art for antibody libraries with an increased diversity which will enable the rapid selection and production of antibodies, derivatives thereof or fragments thereof, which bind to a bait molecule with a high affinity.
SUMMARY OF THE INVENTION
The present invention provides an in vitro method for obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and/or the variable region of a light chain, wherein random mutagenesis is performed on a library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain; and wherein the random mutagenesis process creates randomly distributed mutations along at least 70% of the sequence encoding the variable region. By creating randomly distributed mutations along at least 70% of the sequence encoding the variable region, mutations within the CDRs and within the framework are created. By performing this random mutagenesis process on a library of polynucleotides comprising a sequence encoding the variable region, a highly diversified library of polynucleotides with mutations within the CDRs and/or within the framework is generated. This library with increased diversity enables the rapid selection and production of antibodies, derivatives thereof or fragments thereof, which bind to a bait molecule with a high affinity. With this library, the time consuming and tedious optimization of the framework residues is not necessary any more.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides an in vitro method for obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and/or the variable region of a light chain, wherein random mutagenesis is performed on a library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain; and wherein the random mutagenesis process creates randomly distributed mutations along at least 70% of the sequence encoding the variable region.
By library of polynucleotides it is meant a large collection (i.e. > 104 members) of diverse polynucleotides available for screening in order to isolate interesting members.
The terms "antibodies, derivatives thereof or fragments thereof are used in the broadest sense and specifically cover immunoglobulins, such as IgG, IgA, IgM, IgE, IgD, immunoglobulins with polyepitopic specificity, antibody fragments (e.g. the variable region of a heavy chain, the variable region of a light chain, Fab, Fab', F(ab')2, Fv, as well as antibody derivatives (e.g. single chain antibody (scFv)), so long they encompass the variable region of a heavy chain or the variable region of a light chain.
Typically, the random mutagenesis process creates randomly distributed mutations along at least 75%, 80%, 90% or 95% of the sequence encoding the variable region.
With this process a library of polynucleotides comprising a sequence with one or more mutations within the CDRs encoding region and/or with one or more mutations within the framework encoding regions is created. In a preferred embodiment, random mutagenesis process creates randomly distributed mutations along the whole sequence encoding the variable region.
Typically, a method according to the invention may comprise the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and the step of performing random mutagenesis of a polynucleotide encoding the variable region of a light chain.
In a preferred embodiment of the invention, the polynucleotide encoding the variable region is a polynucleotide encoding a single chain antibody.
The single chain antibody technology is well known in the art, this technology has been described in EP0281604, EP0318554 and EP0573551 for example.
In a preferred embodiment of the invention, the library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain, is obtainable from B-cells isolated from donors selected from the group consisting of healthy donors and donors afflicted with a disease. The B-cells may be obtained from diverse lymphoid sources including peripheral blood lymphocytes (PBLs), bone marrow, spleen or tonsil. Typically the library may be obtained from at least 50 donors. The donors may all be healthy or afflicted with a disease. Alternatively, part of donors may be healthy. Afflicted donors may suffer from bacterial infections, viral infections, autoimmune diseases, endocrine diseases (e.g. diabetes) and/or cancer.
It falls within the ability of the skilled person to choose the method for performing random mutagenesis and the suitable working conditions, which will enable the creation of randomly distributed mutations along at least 70% of the sequence encoding the variable region. Typically the skilled person may use error prone PCR. Alternatively, the skilled person may use the method disclosed in WO0238756 wherein random mutagenesis is performed by using one or more mutases selected from the group consisting of DNA polymerases beta, iota, eta and kappa.
Typically the sequence encoding the variable region of a heavy chain and/or the variable region of a light chain may be from any origins. Typically they may originate from primates, mice or camels. In a preferred embodiment the sequence encoding the variable region of a heavy chain and/or the variable region of a light chain is from human origin.
Typically the library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof is a library of polynucleotides encoding derivatives or fragments selected from the group consisting of the variable region of a heavy chain, the variable region of a light chain, Fv, a single chain antibody, Fab, Fab' and F(ab')2. Typically the polynucleotides encoding antibodies, derivatives thereof or fragments thereof are expression vectors.
"Expression vector" refers to polynucleotide sequences containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins. An embodiment of the present invention provides a library of polynucleotide encoding antibodies, derivatives thereof or fragments thereof obtainable by a method according to the invention.
Various display methods are known in the art, among them, phage display, yeast display, bacterial display and ribosome display are widely used for screening studies (cf. for example Winter et al 1994 Annu Rev Immunol 12:433-455, Feldaus et al 2003 Nat Biotechnol 21: 163-170, Hanes J. and Pluckthun A. 1997 PNAS 94:4937- 42). Typically, these techniques allow large antibody libraries to be screened against a bait molecule. Alternatively, methods allowing the detection of intracellular interaction have been developed. Within these methods, a bait protein is expressed in the cell. Examples of such methods are the yeast two hybrid method (cf. Fields and Song, 1989 and WO0200729), the cyto Trap method (cf. Broder et al, 1998 and US5776689), the protein fragment complementation (PCA) method (cf. Johnsson and
Varshavskiy, 1994 and WO9529195) and the intracellular method described in the application filed by MilleGen with application number EP 06290641.
An embodiment of the present invention provides a method for obtaining a library of cells, each comprising a polynucleotide encoding antibodies or fragments thereof, comprising the steps of: a) obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof by the method according to the invention; and b) transforming cells with the polynucleotides obtained in step a).
An embodiment of the present invention provides a library of cells obtainable by this method.
Typically, the cells comprising a polynucleotide encoding an antibody, a derivative thereof or a fragment thereof, express on their surface the antibody, the derivative thereof or the fragment thereof. Typically, the cells are bacterial cells or yeast cells.
An embodiment of the present invention provides a method for obtaining a library of phages, each comprising a polynucleotide encoding an antibody, a derivative thereof or a fragment thereof and displaying on its surface said antibody, said derivative thereof or said fragment thereof, comprising the step of: a) obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof by a method according to the invention; and b) generating the phages.
An embodiment of the present invention provides a library of phages obtainable by this method.
An embodiment of the present invention provides a method for producing an antibody, a derivative thereof or a fragment thereof which binds to a bait molecule comprising the steps of:
a) obtaining a library of polynucleotide encoding antibodies, derivatives thereof or fragments thereof obtainable by a method according to the invention; and b) isolating from the library a polynucleotide which encodes an antibody, a derivative thereof or a fragment thereof which binds to said bait molecule.
In the following, the invention will be illustrated by means of the following examples as well as the figures. In all the figures, the CDRs (usually in bold) and the framework regions (FR) were defined according to structural criteria defined by Chothia et al (1989) Nature 342, 877-883.
Figure 1: Amino acids sequences of the variable heavy chain gene VH5 (SEQ ID
N0I) and VHlO (SEQ ID N°2).
Figure 2: Mutations of the heavy variable genes VH5 and VHlO.
Figure 3: Amino acids sequences of three variable lambda genes VL6 (SEQ ID N°8), VL9 (SEQ ID N°9) and VL 18 (SEQ ID N0IO).
Figure 4: Mutations of the lambda variable genes VL6, VL9 and VLl 8.
Figure 5: Amino acids sequences of two variable kappa chain genes, VK5 (SEQ ID
N°12) and VKI l (SEQ ID N°13). The CDRs (in bold) were defined according to structural criteria defined by Chothia et al (1989) Nature 342, 877-883. Figure 6: Mutations of the kappa variable genes VK5 and VKl 1
Figure 7: Representation of the number of mutations along the sequence of single chain antibodies (scFv) of the MB_scFv2e_A_E library (A) and MB_scFv2e_B_N library (B).
EXAMPLES
In the following description, all molecular biology experiments are performed according to standard protocol (Sambrook J, Fritsch EF and Maniatis T (eds) Molecular cloning, A laboratory Manual 2nd Ed, Cold Spring Harbor Laboratory Press).
Example 1: Random mutagenesis of isolated variable domains of human antibodies A. Amplification and cloning of the human antibody repertoires of variable heavy and light chain domains.
Total peripheral blood monocyte (PBMC) RNA was isolated from 100 donors. The donors were healthy or were afflicted with diverse diseases: Bacterial or viral infections, autoimmune diseases, endocrine diseases (e.g. diabetes) and cancer. PBMC mRNA was isolated and antibody heavy and light chains (Vlambda and Vkappa) cDNA produced from the reverse transcription were PCR amplified with several mixtures of primer pair characteristics of the N-terminal and C-terminal extremities of all different families of the variable genes.
The VH were PCR amplified using 14 different VH forward primers and a mixture of 4 JH reverse primers. A second PCR with tagged primers were used to introduce restriction sites Sail in 5' and EcoRI in 3' of the VH fragments. The VH PCR products were cloned into Sail and EcoRI restriction sites of pUC18 vector.
The Vlambda cDNA were PCR amplified with 15 different Vlambda forward primers and 3 JL reverse primers and the Vkappa cDNA were PCR amplified with a mix of 13 VK forward primers and 5 JK reverse primers. The Vlambda and Vkappa fragments were PCR amplified with tagged primers to introduce Xbal in 5' and Sail in 3' and cloned into Sail and Xbal restriction site of pUC18. Each library HS_VH, HS Vlambda and HS_Vkappa contained 1-3 x 10 6 members:
Table 1 : Human antibody heavy and light chain libraries cloned
The DNA encoding the variable heavy domains of two randomly picked clones, VH5 (SEQ ID N°l) and VHlO (SEQ ID N°2), from the human library repertoire HS_VH were mutated with the MutaGen™ process. The MutaGen™ is described in WO0238756. The DNA coding for the VH5 and VHlO clones corresponded to the germline gene IGHV 1-3 and IGHV 1-24, respectively. For this determination the blast program was used on the IMGT web site: http://imgt.cines.fr/. The sequences are described in figure 1. The mutagenesis process was designed to modify the complete variable gene without the JH region. This region was not mutated in prevision of possible future use as template in an overlap PCR to associate the VH and the VL libraries. Two randomly mutated libraries were constructed MB-VH5 and MB-VHlO.
a. Mutagenesis of the VH domains The VH genes were double replicated with human polymerase beta using the 5' primer Mut-PD-Sl 5'-CGAGCGTCTACTAGCGCATGCCTGCAGGTCGAC-S' (SEQ ID N°3), the 3' primer as an equimolar mixture of 4 primers [JH-l/2-for-mut: 5'-ATGCGTGAATTCTGAGGAGACGGTGACCAGGGTGCC (SEQ ID N°4), JH- 3-for-mut: 5'-ATGCGTGAATTCTGAAGAGACGGTGACCATTGTCCC-S ' (SEQ ID N°5), JH-4/5-for-mut: 5'-
ATGCGTGAATTCTGAGGAGACGGTGACCAGGGTTCC-3' (SEQ ID N°6), JH- 6-for-mut: 5 '-ATGCGTGAATTCTGAGGAGACGGTGACCGTGGTCCC-S ' (SEQ ID N°7)] andl μg of plasmid pUC18-VH (pUC18-VH5 or pUC18-VH10) as template in the replication buffer A, B or E (cf. table 2).
Table 2: Conditions of replication for the random mutagenesis
The mixture was denatured for 5 min at 95°C and cooled down to 4°C. An equal volume of a solution containing 4 units of human polymerase beta in replication buffer A, B or E was added to each replication reaction A, B and E. The reactions of replication were carried out at 37°C for one hour. The replication products were then purified through phenol-chloroform and ethanol precipitation.
b. Selective amplification and cloning of mutated fragments
The replication products obtained in replication conditions A, B and E were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is non-specific to the template and allowed to specifically amplify the DNA fragments synthesized by the mutases. A fraction of each replication product obtained in the replication conditions A, B and E was added to a mixture containing the PCR buffer (20 mM Tris HCl pH 8.4, 50 mM KCl) (Life Technologies), 1.5 mM MgCl2, 10 pmol of the 5' and 31 primers, 200 microM of the 4 dNTPs and 1.25 U Platinum Taq DNA polymerase (Life Technologies). This mixture was incubated 5 min at 95°C, 5 sec at 55 C, 30 sec at 72°C following by 30 selective cycles of 20 sec at 94 0C and 30 sec at 72°C.
The amplified replication products were cloned into Sail and EcoRI restriction sites of pUC18 to obtain MB-VH5 and MB-VHlO libraries.
c. Analyze of randomly mutated libraries of the selected VH domains.
A repertoire of randomly mutated VH domains was obtained. Test screening of individual randomly picked library clones by DNA sequencing revealed an intact insert that contained randomly mutated VH5 or VHlO gene (cf. figure 2). The mutations are distributed randomly along the entire VH gene (i.e. the framework regions and the CDR loops).
The modifications of the mutated sequences were analyzed with the software Mutanalyse 2.5 (MilleGen). The frequency of mutations (cf. table 3) of the MB-VH5 and MB-VHlO libraries were 5.55 and 9.64 mutation per kilo bases, respectively. The average frequency of mutations of 7.58 per kilobases of the MB-VH5 and MB-VHlO libraries means 2.41 base mutations per gene.
By active part of the library, it is meant the quantity of clones with open reading frames and thus potentially coding for functional variable antibody domains.
Table 3: Mutation frequencies of the heavy and light variable genes of the isolated genes
All different kinds of base mutations are represented (cf. table 4). The different transitions represented 82 % (MB-VH5) and 52 % (MB-VHlO) and the transversions 18% and 48% (cf. table 4). The majority of the clones have 1 base mutation, however, some clones could have up to 11 base mutations (cf. table 5). Because of the silence mutation, this high level of base mutations does not result in a high level of amino acid change. The base mutations could also induce a silence mutation or a stop codon. The amino-acid mutation frequencies of the active part of the library were 1.27% and 1.97% for MB-VH5 and MB-VHlO, respectively (cf. table 3). Table 6 shows the frequency of amino acid mutations according to the position in the frameworks and the CDR.
Table 4: Mutation diversity
Table 5: Base mutation distribution per sequence
Table 6: Frequency of amino acid mutations in the different frameworks (FR) and CDR of the MB-VH5 and MB-VHlO
* number of residues x number of mutated genes studied.
FR: framework of the variable domain, CDR: Complementary determining region of the variable domain
C. Mutagenesis of three variable lambda (VL) domains from the human antibody repertoire
The DNA encoding the variable lambda domains of three clones, VL6 (SEQ ID N°8), VL9 (SEQ ID N°9) and VL 18 (SEQ ID N°10), picked randomly from the human library repertoire HS Vlambda were randomly mutated with the MutaGen™ process.
The sequences of the clones are described in figure 3. The VL6, VL9 and VLl 8 clones corresponded to the germline gene IGLV2-8, IGLV 1-51 and IGLV3-21, respectively. Three highly diversified libraries were constructed MB-VL6, MB-VL9 and MB-VLl 8.
a. Mutagenesis of the selected Vlambda domains
The VL genes were double replicated with human polymerase beta using the 5' primer Mut-PD-Sl 5 '-CGAGCGTCTACTAGCGCATGCCTGCAGGTCGAC-S'
(SEQ ID N°3), the 3' primer VL-Kl-R 5'-
TCAGTCTATCGTCACGTCAACGGCGGCGGATCTTCTAGA-S' (SEQ ID N0I l) and 1 μg of plasmid pUC18-VL (pUC18-VL6, pUC18-VL9 or pUC18-VL18) as template in the replication buffer A, B or E (cf. table 2). Each mixture was denatured for 5 min at 95°C and cool down to 4°C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reactions of replication were carried out at 370C for one hour. The replication products were then purified.
b. Selective amplification and cloning of mutated fragments
The replication products were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the mutases. A fraction of each replication product obtained in the replication conditions A, B and E was added to a mixture containing the PCR buffer (20 mM Tris HCl pH 8.4, 50 mM KCl) (Life Technologies), 1.5 mM MgCl2, 10 pmol of the 5' and 3' primers, 200 microM of the 4 dNTPs and 1.25 U PlatinumTaq DNA polymerase (Life Technologies). This mixture was incubated 5 min at 950C, 5 sec at 550C, 30 sec at 72°C following by 30 selective cycles of 20 sec at 94°C and 30 sec at 720C.
The amplified replication products were cloned into Xbal and Sail restriction sites of pUC18 to obtain: MB-VL6, MB-VL9 and MB-VLl 8 libraries.
c. Analysis of randomly mutated libraries of the selected Vlambda domains A repertoire of randomly mutated VL domains was obtained: MB-VL6, MB-VL9 and MB-VLl 8. Test screening of individual randomly picked library clones by DNA sequencing revealed an intact insert that contained randomly mutated VL6, VL9 or VLl 8 gene (cf. figure 4). The mutations are distributed randomly along the entire VL
gene (i.e. the framework regions and the CDR loops). The modifications of the mutated sequences were analyzed with the software Mutanalyse 2.5 (MilleGen). The frequencies of mutations (cf. table 3) of the MB-VL6, MB-VL9 and MB-VLl 8 libraries were 8.72, 8.14 and 8.89 mutation per kilo bases, respectively. The average frequency of mutations of 8.58 per kilobases of the three MB-VL libraries means 2.80 base mutations per gene.
All different kinds of base mutations are represented (cf. table 4). The average of the different transitions represented 69 % and the transversions 31% (cf. table 4). The majority of the clones have 1 base mutation, however, some clones could have up to 12 base mutations (table 5). Because of the silence mutation, this high level of base mutations does not result in a high level of amino acid change. The base mutations could also induce a silence mutation or a stop codon. The amino-acid mutation frequencies of the active part of the library were 1.92 % 1.68 % and 2.10 % for MB- VL6, MB-VL9 and MB-VLl 8, respectively (cf. table 3). Table 7 shows a homogenous distribution of the amino acid mutations according to the position in the frameworks and the CDR.
Table 7: Frequency of amino acid mutations in the different frameworks (FR) and CDR of the MB- VL6, MB- VL9 and MB-VL 18
FR: framework of the variable domain, CDR: Complementary determining region of the variable domain D. Mutagenesis of the variable kappa (VK) domains from the human antibody repertoire
The DNA coding the variable kappa domains of two clones, VK5 (SEQ ID N°12) and VKI l (SEQ ID N°13), picked randomly from the human library repertoire HS- Vkappa were randomly mutated with the MutaGen™ process. The sequences of the clones are described in figure 5. The VK5 and VKI l clones corresponded with the germline gene IGKV4-1 and IGKV6-57, respectively. Two randomly mutated libraries were constructed MB-VK5 and MB-VKl 1.
a. Mutagenesis of the selected VK domains The VK genes were double replicated with human polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N0I l) and 1 μg of plasmid pUC18-VK (pUC18-VK5 or pUC18-VKl 1) as template in three different replication buffers A, B or E (cf. table 2). Each mixture was denatured for 5 min. at 95°C and cooled down to 40C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reactions of replication were carried out at 37°C for one hour. The replication products were then purified.
b. Selective amplification and cloning of mutated fragments The replication products were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the mutases.
A fraction of each replication product obtained in conditions A, B and E was added to a mixture containing the PCR buffer (20 mM Tris HCl pH 8.4, 50 mM KCl) (Life
Technologies), 1.5 mM MgCl2, 10 pmol of the 5' and 3' primers, 200 μM of the 4 dNTPs and 1.25 U Platinum Taq DNA polymerase (Life Technologies). This mixture was incubated 5 min at 950C, 5 sec at 55°C, 30 sec at 72°C followed by 30 selective cycles of 20 sec at 94°C and 30 sec at 72°C.
The amplified replication products were cloned into Xbal and Sail restriction sites of pUC18 to obtain MB-VK5 and MB-VKl 1 libraries.
c. Analysis of randomly mutated libraries of the selected VK domains A repertoire of randomly mutated VK domains was obtained: MB-VK5 and MB- VKI l. Test screening of individual randomly picked library clones by DNA sequencing revealed an intact insert that contained randomly mutated VK5 or VKl 1 gene (cf. figure 6). The mutations are distributed randomly along the entire VK gene, in the frameworks and/or in the CDR loops. The modifications of the mutated sequences were analyzed with the software Mutanalyse 2.5 (MilleGen).
The frequencies of mutations (cf. table 3) of the MB-VK5 and MB-VKl 1 libraries were 8.97 and 5.15 mutations per kilo bases, respectively. The average frequency of mutations of 7.06 per kilobases of the MB-VK libraries means 2.31 base mutations per gene.
All different kinds of base mutations are represented (cf. table 4). The average of the different transitions represented 83% and the transversions 27% (cf. table 4). The majority of the clones have 1 base mutation, however, some clones could have up to 9 base mutations (cf. table 5). Because of the silence mutation, this high level of base mutations did not result in a high level of amino acid change. The base mutations could also induce a silence mutation or a stop codon. The amino-acid mutation frequencies of the active part of the library were 2.26 % and 1.28 % for MB-VK5 and MB-VKI l, respectively (cf. table 1). Table 8 shows an homogenous distribution of the amino acid mutations according to the position in the frameworks and the CDR.
Table 8: Frequency of amino acid mutations in the different frameworks (FR) and CDR of the MB-VK5 and MB-VKl 1
* number of residues x number of mutated genes studied.
FR: framework of the variable domain, CDR: Complementary determining region of the variable domain Example 2: Random mutagenesis applied to variable domain libraries. A. Random mutagenesis of the HS-VH library
The HS-VH library (c.f. table 1) obtained as described before was double replicated with human polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer as an equimolar mixture of 4 primers [JH-l/2-for-mut (SEQ ID N°4), JH-3- for-mut (SEQ ID N°5), JH-4/5-for-mut (SEQ ID N°6), JH-6-for-mut (SEQ ID N°7)] and 1 μg of plasmid pUC18-VH (HS-VH DNA library) as template in the replication buffer A, B or E (cf. table 2). Each mixture was denatured for 5 min at 95°C and cooled down to 4°C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reaction of replication was carried out at 37°C for one hour.
The replication products obtained in condition A, B and E were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the polymerase beta. The replication products selectively PCR amplified were cloned into Sail and EcoRI restriction sites of pUC18 to obtain the library MB_HS_VH_AEB01 (cf. table 9).
B. Random mutagenesis of the HS-Vlambda library.
The HS-VL library (cf. table 1) was double replicated with polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N0I l) and 1 μg of plasmid pUC18-VL (MB-VL DNA library) as template in the replication buffer A, B or E (cf. table 2). Each mixture was denatured for 5 min at 95°C and cooled down to 4°C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. The reaction of replication was carried out at 37°C for one hour. The replication products obtained in condition A, B and E were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is not specific to the template and allow specific amplification of DNA fragments synthesized by the polymerase beta. The replication products selectively PCR amplified were cloned into Sail and EcoRI restriction site of pUC18 to obtain the library MB_HS_VL_AEB01 (cf. table 9).
C. Random mutagenesis of the HS-Vkappa library.
The HS-Vkappa library (cf. table 1) was double replicated with polymerase beta using the 5' primer Mut-PD-Sl (SEQ ID N°3), the 3' primer VL-Kl-R (SEQ ID N0I l), 1 μg of plasmid pUC18-VK (HS_VK DNA library) as template in the replication buffer A, B or E (cf. table 2). The mixture was denatured for 5 min at 95° C and cooled down to 4°C. An equal volume of a solution containing 4 units of polymerase beta in replication buffer A, B or E was added. Each reaction of replication was carried out at 370C for one hour. The replication products were selectively amplified through a selective PCR amplification with tail primers. The primers were designed with a tail that is non-specific to the template and allowed to specifically amplify the DNA fragments synthesized by the polymerase beta. The replication products selectively PCR amplify were cloned into Sail and EcoRI restriction site of pUC18 to obtain the library MB_HS_VK_AEB01 (cf. table 9).
D. Analysis of randomly mutated libraries
The random mutagenesis of the human repertoires of HS_VH, HS_VL and HS VK domains has provided three libraries: MB_HS_VH_AEB01, MB_HS_VK_AEB01 and MB_HS_VL_AEB01, with library sizes of 1.17xlO7, 9.4xlO6 and 4.8xlO6 clones, respectively (cf. table 9).
A sample of 400 randomly picked clones from the different libraries were DNA sequenced and analyzed. A representative sample of reference sequences of each subgroup VH, Vlambda and Vkappa from http://imgt.cines.fr/textes/vquest/refseqhb.htmWVQUEST were locally downloaded. The sequences from the libraries were compared to the reference sequences with the bioinformatic tools developed by MilleGen.
A sample of 199 clones of the heavy chain library MB_HS_VH_AEB01 showed a distribution of the subtype different to that was reported in the natural representation (cf. Table 10). The VHl and VH3 are the most represented as in the natural representation of the subtype, however, VHl is largely more represented with 56.78%.
The 201 sequenced clones of the light chain libraries (MB_HS_VL_AEB01 and MB_HS_VK_AEB01) showed a high representation of the VLl (66%) and VKl (70.36%) subtypes.
The difference of the subtype distribution in the MutalBank libraries compared to the reported frequencies showed the originality of the constructed libraries. This difference is probably due to the origins of donors which are donors afflicted with diverse diseases.
Table 9: Size of the different libraries
Table 10: Representation of the germline families
<1> IMGT htt://imgt.cnusc.fr:8104
Example 3: Random mutagenesis applied to scFv libraries.
The retrotranscript of the variable heavy and light genes of the mouse hybridoma VEBA76.50 were PCR amplified and cloned. The DNA coding for the VH and VL domains corresponded with the germline gene IGHV5S14 and IGKVl-117 (IMGT web site: http://imgt.cines.fr/). A single chain antibody Fv fragment (scFv) having the structure VH-VK was cloned into the vector pCR4-topoTA to obtain the clone MG_scFv2e.
The MG_scFv2e gene was double replicated with human polymerases beta or eta using the 5' primer VH-scFv2e-S3 5'-
TGACGAGTACTAGCTGCTACACCAGGATCCGAAGTGAAGTT-S' (SEQ ID
N°14) and the 3' primer VK-scFv2e-R3 5'
ACAGCTACGTGATACGACTCACAGAATTCCCGTTTGATTTCCA -3' (SEQ ID
N°15) and 1 μg MG_scFv2e plasmid DNA as template in the replication buffer E or N (cf. table 2). The mixture was denatured for 5 min at 95°C and cool down to 4°C.
An equal volume of a solution containing 4 units of human polymerase beta (mutase
A) or human polymerase eta (mutase B) was added in replication buffer E or N. The reaction of replication was carried out at 37°C for two hours. The replication products selectively PCR amplified were cloned into BamHI and EcoRI restriction sites of the vector p03.
Two libraries were constructed: MB_scFv2e_A_E obtained from the replication with mutase A in the condition E and MB_scFv2e_B_N from the replication with mutase B in the condition N. The library sizes were 6x105 and 5x105 clones, respectively. The alignment of 31 and 30 sequences obtained from different clones of MB_scFv2e_A_E and MB_scFv2e_B_N libraries shows an homogenous distribution of the base mutations along the DNA sequences (cf. figure 7). Table 11 shows the modifications of the mutated sequences analyzed with Mutanalyse 2.5 (MilleGen). According to the mutation conditions used, the libraries obtained have a different
mutation profile. The frequency of base mutations is double in the MB_scFv2e_B_N library (7.51 per kb) compared to MB_scFv2e_A_E (3.14 per kb). Furthermore, the mutase B in condition N seems to induce a higher modification of the amino acids. The amino acid mutation frequency was 4 times higher in the MB_scFv2e_B_N library than in MB_scFv2e_A_E library (cf. table 11). The two different mutagenesis conditions lead to a library with a low mutagenesis frequency (0.57 mutation per 100 amino acids) and to library with a high mutagenesis frequency (1.52 mutation per 100 amino acids).
The different transitions represented 80% and the transversions 20% with the two libraries (cf. table 12).
The number of mutations per sequence of the MB_scFv2e_B_N library is widely represented with 59% of the sequences which have between 6 and 12 base modifications (cf. table 13). In contrast, the MB_scFv2e_A_E library has 74 % of the sequences with 1-3 base mutations.
Table 11: Mutation frequencies of MB_scFv2e_A_E and MB_scFv2e_B_N libraries
Table 13: Base mutation distribution per sequence of MB_scFv2e_A_E and MB scFv2e B N libraries
References:
Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.
Claims
1. An in vitro method for obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and/or the variable region of a light chain, wherein random mutagenesis is performed on a library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain; and wherein the random mutagenesis process creates randomly distributed mutations along at least 70% of the sequence encoding the variable region.
2. The method according to claim 1, wherein the random mutagenesis process creates randomly distributed mutations along at least 90% of the sequence encoding the variable region.
3. The method according to claim 1, wherein the random mutagenesis process creates randomly distributed mutations along the whole sequence encoding the variable region.
4. The method according to any one of claims 1 to 3, comprising the step of performing random mutagenesis of a polynucleotide encoding the variable region of a heavy chain and the step of performing random mutagenesis of a polynucleotide encoding the variable region of a light chain.
5. The method according to any one of claims 1 to 4, wherein the polynucleotide encoding the variable region is a polynucleotide encoding a single chain antibody.
6. The method according to any one of claims 1 to 5, wherein the library of polynucleotides comprising a sequence encoding the variable region of a heavy chain and/or the variable region of a light chain, is obtainable from B cells isolated from donors selected from the group consisting of healthy donors and donors afflicted with a disease.
7. The method according to any one of claims 1 to 6, wherein random mutagenesis is performed by using one or more mutases selected from the group consisting of DNA polymerases beta, iota, eta and kappa.
8. The method according to any one of claims 1 to 7, wherein the sequence encoding the variable region of a heavy chain and/or the variable region of a light chain is from human origin.
9. The method according to any one of claims 1 to 8, wherein the library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof is a library of polynucleotides encoding derivatives or fragments selected from the group consisting of the variable region of a heavy chain, the variable region of a light chain, Fv, a single chain antibody, Fab, Fab' and F(ab')2.
10. The method according to any one of claims 1 to 9, wherein the polynucleotides encoding antibodies, derivatives thereof or fragments thereof are expression vectors.
11. A method for obtaining a library of cells, each comprising a polynucleotide encoding antibodies or fragments thereof, comprising the steps of: a) obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof by the method according to any one of claims 1 to 10; and b) transforming cells with the polynucleotides obtained in step a).
12. The method according to claim 11 wherein the cells comprising a polynucleotide encoding an antibody, a derivative thereof or a fragment thereof, express on their surface the antibody, the derivative thereof or the fragment thereof.
13. The method according to claim 11 or 12, wherein the cells are bacterial cells or yeast cells.
14. A method for obtaining a library of phages, each comprising a polynucleotide encoding an antibody, a derivative thereof or a fragment thereof and displaying on its surface said antibody, said derivative thereof or said fragment thereof, comprising the step of: a) obtaining a library of polynucleotides encoding antibodies, derivatives thereof or fragments thereof by the method according to any one of claims 1 to 10; and b) generating the phages.
15. A library of polynucleotide encoding antibodies, derivatives thereof or fragments thereof obtainable by the method according to any one of claims 1 to 10.
16. A library of cells obtainable by the method according to any one of claims 11 to 13.
17. A library of phages obtainable by the method according to claim 14.
18. A method for producing an antibody, a derivative thereof or a fragment thereof which binds to a bait molecule comprising the steps of: a) obtaining a library of polynucleotide encoding antibodies, derivatives thereof or fragments thereof obtainable by the method according to any one of claims 1 to 10; and b) isolating from the library a polynucleotide which encodes an antibody, a derivative thereof or a fragment thereof which binds to said bait molecule.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/EP2006/006339 WO2007137616A1 (en) | 2006-05-30 | 2006-05-30 | Highly diversified antibody libraries |
| US12/302,918 US20090318308A1 (en) | 2006-05-30 | 2006-05-30 | Highly diversified antibody libraries |
| EP06762288A EP2027265A1 (en) | 2006-05-30 | 2006-05-30 | Highly diversified antibody libraries |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/EP2006/006339 WO2007137616A1 (en) | 2006-05-30 | 2006-05-30 | Highly diversified antibody libraries |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007137616A1 true WO2007137616A1 (en) | 2007-12-06 |
Family
ID=37564233
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2006/006339 Ceased WO2007137616A1 (en) | 2006-05-30 | 2006-05-30 | Highly diversified antibody libraries |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20090318308A1 (en) |
| EP (1) | EP2027265A1 (en) |
| WO (1) | WO2007137616A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011056997A1 (en) | 2009-11-04 | 2011-05-12 | Fabrus Llc | Methods for affinity maturation-based antibody optimization |
| US9221902B2 (en) | 2008-11-07 | 2015-12-29 | Fabrus, Inc. | Combinatorial antibody libraries and uses thereof |
| US9593327B2 (en) | 2008-03-05 | 2017-03-14 | Agenus Inc. | Identification of antigen or ligand-specific binding proteins |
| EP3466975A1 (en) | 2017-10-05 | 2019-04-10 | Laboratoire Français du Fractionnement et des Biotechnologies | A specific binding molecule directed against galectin-3 protein |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040110294A1 (en) * | 2000-11-08 | 2004-06-10 | Khalil Bouayadi | Use of mutagenic dna polymerase for producing random mutations |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU7247191A (en) * | 1990-01-11 | 1991-08-05 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| ATE414768T1 (en) * | 1991-04-10 | 2008-12-15 | Scripps Research Inst | LIBRARIES OF HETERODIMER RECEPTORS USING PHAGEMIDS |
| US5962255A (en) * | 1992-03-24 | 1999-10-05 | Cambridge Antibody Technology Limited | Methods for producing recombinant vectors |
| US7067284B1 (en) * | 1992-01-27 | 2006-06-27 | The Scripps Research Institute | Methods for producing antibody libraries using universal or randomized immunoglobulin light chains |
| US6696251B1 (en) * | 1996-05-31 | 2004-02-24 | Board Of Trustees Of The University Of Illinois | Yeast cell surface display of proteins and uses thereof |
| DK1144616T4 (en) * | 1999-01-19 | 2009-03-30 | Unilever Nv | Method for producing antibody fragments |
| US6406863B1 (en) * | 2000-06-23 | 2002-06-18 | Genetastix Corporation | High throughput generation and screening of fully human antibody repertoire in yeast |
| US20030166170A1 (en) * | 2002-01-17 | 2003-09-04 | Invitrogen Corporation | Methods of random mutagenesis and methods of modifying nucleic acids using translesion DNA polymerases |
-
2006
- 2006-05-30 WO PCT/EP2006/006339 patent/WO2007137616A1/en not_active Ceased
- 2006-05-30 US US12/302,918 patent/US20090318308A1/en not_active Abandoned
- 2006-05-30 EP EP06762288A patent/EP2027265A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040110294A1 (en) * | 2000-11-08 | 2004-06-10 | Khalil Bouayadi | Use of mutagenic dna polymerase for producing random mutations |
Non-Patent Citations (10)
| Title |
|---|
| CASSON L P ET AL: "Evaluation of loss and change of specificity resulting from random mutagenesis of an antibody VH region.", JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 15 DEC 1995, vol. 155, no. 12, 15 December 1995 (1995-12-15), pages 5647 - 5654, XP002413823, ISSN: 0022-1767 * |
| DAUGHERTY P S ET AL: "Quantitative analysis of the effect of the mutation frequency on the affinity maturation of single chain Fv antibodies.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 29 FEB 2000, vol. 97, no. 5, 29 February 2000 (2000-02-29), pages 2029 - 2034, XP002413824, ISSN: 0027-8424 * |
| GRAM H ET AL: "In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 89, no. 8, 15 April 1992 (1992-04-15), pages 3576 - 3580, XP000384398, ISSN: 0027-8424 * |
| HAWKINS R E ET AL: "The Contribution of Contact and Non-contact Residues of Antibody in the Affinity of Binding to Antigen", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 234, 1993, pages 958 - 964, XP002920236, ISSN: 0022-2836 * |
| KOEFOED K ET AL: "Molecular characterization of the circulating anti-HIV-1 gp120-specific B cell repertoire using antibody phage display libraries generated from pre-selected HIV-1 gp120 binding PBLs", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 297, no. 1-2, February 2005 (2005-02-01), pages 187 - 201, XP004793118, ISSN: 0022-1759 * |
| MIYAZAKI C ET AL: "Changes in the specificity of antibodies by site-specific mutagenesis followed by random mutagenesis.", PROTEIN ENGINEERING. MAY 1999, vol. 12, no. 5, May 1999 (1999-05-01), pages 407 - 415, XP002413822, ISSN: 0269-2139 * |
| SALOMONSSON STINA ET AL: "Cloning and characterization of two human Ro52-specific monoclonal autoantibodies directed towards a domain associated with congenital heart block.", JOURNAL OF AUTOIMMUNITY. MAR 2004, vol. 22, no. 2, March 2004 (2004-03-01), pages 167 - 177, XP002413825, ISSN: 0896-8411 * |
| SAVIRANTA P ET AL: "Engineering the steroid-specificity of an anti-17beta-estradiol Fab by random mutagenesis and competitive phage panning", PROTEIN ENGINEERING, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 11, February 1998 (1998-02-01), pages 143 - 152, XP000941075, ISSN: 0269-2139 * |
| See also references of EP2027265A1 * |
| YIP Y L ET AL: "Evaluation of different lymphoid tissue sources for the construction of human immunoglobulin gene libraries", IMMUNOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS BV, NL, vol. 3, no. 3, October 1997 (1997-10-01), pages 195 - 203, XP004097003, ISSN: 1380-2933 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9593327B2 (en) | 2008-03-05 | 2017-03-14 | Agenus Inc. | Identification of antigen or ligand-specific binding proteins |
| US10502745B2 (en) | 2008-03-05 | 2019-12-10 | Agenus Inc. | Identification of antigen- or ligand-specific binding proteins |
| US9221902B2 (en) | 2008-11-07 | 2015-12-29 | Fabrus, Inc. | Combinatorial antibody libraries and uses thereof |
| US10774138B2 (en) | 2008-11-07 | 2020-09-15 | Taurus Biosciences, Llc | Combinatorial antibody libraries and uses thereof |
| WO2011056997A1 (en) | 2009-11-04 | 2011-05-12 | Fabrus Llc | Methods for affinity maturation-based antibody optimization |
| US10101333B2 (en) | 2009-11-04 | 2018-10-16 | Taurus Biosciences, Inc. | Methods for affinity maturation-based antibody optimization |
| EP3466975A1 (en) | 2017-10-05 | 2019-04-10 | Laboratoire Français du Fractionnement et des Biotechnologies | A specific binding molecule directed against galectin-3 protein |
| WO2019068863A1 (en) | 2017-10-05 | 2019-04-11 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | A specific binding molecule directed against galectin-3 protein |
Also Published As
| Publication number | Publication date |
|---|---|
| US20090318308A1 (en) | 2009-12-24 |
| EP2027265A1 (en) | 2009-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Prassler et al. | HuCAL PLATINUM, a synthetic Fab library optimized for sequence diversity and superior performance in mammalian expression systems | |
| JP5473603B2 (en) | Design and construction of diverse synthetic peptide and polypeptide libraries | |
| US10647757B2 (en) | Collection and methods for its use | |
| JP6867302B2 (en) | How to improve protein characteristics | |
| CN105924499B (en) | Novel methods for protein evolution | |
| CA2736430A1 (en) | Improved antibody libraries | |
| JP2022541697A (en) | A Sequence-Based, High-Throughput Method to Generate Camelid Antibodies for Broad Epitope Coverage at High Resolution | |
| CA2627075A1 (en) | Antibody ultrahumanization by predicted mature cdr blasting and cohort library generation and screening | |
| JP7332691B2 (en) | Antibody library with maximized antibody development potential | |
| Groves et al. | Applications of ribosome display to antibody drug discovery | |
| Mondon et al. | Method for generation of human hyperdiversified antibody fragment library | |
| KR102194203B1 (en) | Method for producing antibody naive library, the library and its application(s) | |
| US20090318308A1 (en) | Highly diversified antibody libraries | |
| JP7337850B2 (en) | ANTIBODY LIBRARY AND ANTIBODY SCREENING METHOD USING THE SAME | |
| JP2025506683A (en) | Single domain antibody libraries with maximized antibody developability properties | |
| CN105849564B (en) | Ortholog-targeting proteins | |
| WO2010130824A2 (en) | Collections and uses thereof | |
| Langer | Maturation of scFv 80r for the neutralization of Sars-CoV-2 Rbd using Ribosome Display | |
| HK40053220A (en) | Proteins targeting orthologs | |
| HK1168635B (en) | A collection and methods for its use | |
| HK1231889A1 (en) | Novel methods of protein evolution | |
| HK1231889A (en) | Novel methods of protein evolution | |
| AU2015242961A1 (en) | Novel methods of protein evolution | |
| HK1194440A (en) | Design and construction of diverse synthetic peptide and polypeptide libraries |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 06762288 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12302918 Country of ref document: US Ref document number: 2006762288 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |













