WO2007135022A1 - Method for performing homologous recombination in plants - Google Patents

Method for performing homologous recombination in plants Download PDF

Info

Publication number
WO2007135022A1
WO2007135022A1 PCT/EP2007/054693 EP2007054693W WO2007135022A1 WO 2007135022 A1 WO2007135022 A1 WO 2007135022A1 EP 2007054693 W EP2007054693 W EP 2007054693W WO 2007135022 A1 WO2007135022 A1 WO 2007135022A1
Authority
WO
WIPO (PCT)
Prior art keywords
organism
plant
nucleic acid
sequence
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2007/054693
Other languages
French (fr)
Inventor
Wyatt Paul
Sophie Wehrkamp-Richter
Jean-Baptiste Laffaire
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogemma SAS
Original Assignee
Biogemma SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biogemma SAS filed Critical Biogemma SAS
Priority to EP07765265A priority Critical patent/EP2018434B1/en
Priority to DE602007012858T priority patent/DE602007012858D1/en
Priority to AU2007253458A priority patent/AU2007253458B2/en
Priority to AT07765265T priority patent/ATE500337T1/en
Priority to CA2650548A priority patent/CA2650548C/en
Priority to US12/301,358 priority patent/US8273956B2/en
Publication of WO2007135022A1 publication Critical patent/WO2007135022A1/en
Anticipated expiration legal-status Critical
Priority to US13/619,082 priority patent/US8455715B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213Targeted insertion of genes into the plant genome by homologous recombination
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C07K2319/715Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16 containing a domain for ligand dependent transcriptional activation, e.g. containing a steroid receptor domain

Definitions

  • the invention relates to modified restriction enzymes capable of being used for promoting homologous recombination in organisms (mammals and plants), in particular plants, making it possible to either target gene integration or excise unwanted DNA sequences in the genome of said organisms.
  • Homologous recombination is useful for specifically inserting sequences at a given target site in a genome. It can also be used to perform allele replacement. This can be used for curing genetic disease in humans, for example, or for plant improvement.
  • DNA sequences As an example, in plants, this can be used for removing the selectable marker used in plant transformation, or for the irreversible controlled activation or inactivation of transgenes.
  • Homologous recombination when integrating a DNA sequence in a genome also solves the problem residing in the random pattern of integration of the heterologous gene into said genome. Indeed, it is known that such random integration may lead to a wide variation in the level of expression of the genes among different transformed organisms after regeneration, thus increasing the cost and lengthening the selection of interesting transformants. Furthermore, it is always possible that these heterologous genes are integrated within endogenous genes, thus disrupting their expression. This is a real problem when these endogenous genes are necessary for the maturation, differentiation and/or viability of the cells or organism.
  • Gene targeting uses the selection of integration events obtained by homologous recombination between DNA sequences present in the genome of a cell or organism and introduced heterologous DNA sequences. This provides a possibility of controlling the site of integration of these heterologous DNA sequences.
  • Homologous recombination is nevertheless difficult to achieve as mammalian and plant cells have also a greater propensity to mediate nonhomologous recombination. This is in particular true for plant cells. This bad ability to mediate homologous recombination events is also problematic when the transformed organism is difficult to transform, in particular when the in vitro culture or regeneration steps of the cells is difficult.
  • homologous recombination can be used for inserting new heterologous sequences, but also for eliminating, removing or substituting sequences (creating new alleles) within the organism genome.
  • TK thymidine kinase
  • DSB double strand break
  • the inventors also postulate that the efficiency of homologous recombination may increase depending on the state of the cell. In particular, it is postulated that the efficiency will be better when the cell is at the meiosis stage.
  • homologous recombination can also be used as a tool for removing exogenous DNA sequences that do not contribute to the new phenotype conferred by the transgene, such as selectable marker genes that are necessary for plant transformation and particularly those marker genes that confer herbicide or antibiotic resistance.
  • DSB double strand break
  • controllable / inducible enzyme of the invention responds to this question.
  • the present invention relates to an isolated nucleic acid comprising a nucleic acid coding for a restriction enzyme capable of cutting a DNA sequence at a predetermined site, fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD) (Miesfeld et al. 1986) depicted in SEQ ID N° 1 (protein) coded by SEQ ID N° 2 (nucleic acid).
  • GR Glucocorticoid Receptor
  • LBD Ligand Binding Domain
  • the GR LBD sequence used in the invention contains a first NLS (nuclear Localization Signal, NL1 ) in the LBD sequence and a second incomplete NLS (NL2) upstream of the LBD sequence.
  • NLS nuclear Localization Signal
  • a preferred NLS is the SV40 Large T antigen NLS (Dingwall et al. 1986, Lanford and Butel 1984, Kalderson et al. 1984) depicted in SEQ ID N° 3 (protein) coded by sequence ID N°4 (nucleic acid) but other NLS sequences can be used.
  • Any restriction enzyme may be used for the purpose of the invention.
  • Obtaining a fused protein is performed by classical molecular biology methods as described in Sambrook.
  • the restriction enzyme does not have many cutting sites in the genome of the host.
  • the restriction enzyme of the invention recognizes and cuts a site that is at least 15 bases, and preferably at least 18 bases.
  • the restriction enzyme is called a meganucleases, which is by definition a sequence-specific endonuclease with large (>12 bp) recognition sites.
  • said meganuclease is preferably I-Scel, described as SEQ ID N°5 (protein) and 6 (nucleic acid). Nevertheless, other meganucleases may also be used, such as HO, or the meganuclease described in Epinat et al (Nucleic Acids Research, 2003, Vol. 31 , No.
  • I-Crel Wang et al (1997) Nucleic Acids Res., 25, 3767-3776) or I-Ceul (Marshall et al (1994) Eur. J. Biochem., 220, 855-859), which function as homodimers, or larger proteins bearing two (do)decapeptide motifs, such as I-Scel (Jacquier et al (1985) Cell, 41 , 383-394), Pl-Scel (Gimble, et al (1996) J. MoI. Biol., 263, 163-180) and I-Dmol (Dalgaard et al. (1993) Proc. Natl Acad. Sci. USA, 90, 5414-5417).
  • the construct of the invention can be made with any restriction enzyme or meganuclease that is currently known, once its sequence has been isolated, as it is obtained through completely classical methods of molecular biology.
  • the isolated nucleic acid of the invention is such that said nucleic acid coding for a rat glucocorticoid receptor is fused at the 3' end of said nucleic acid coding for a restriction enzyme.
  • said nucleic acid coding for a rat glucocorticoid receptor is fused at the 5' end of said nucleic acid coding for a restriction enzyme.
  • the isolated nucleic acid of the invention codes for a protein having SEQ ID N°7. It is preferred that this nucleic acid has SEQ ID N°8.
  • the invention also relates to an expression cassette comprising a promoter operably linked to the nucleic acid of the invention.
  • a promoter operably linked to the nucleic acid of the invention. Any promoter is suitable, and some are described below.
  • the restriction enzyme of the invention is useful for improving homologous recombination in organisms such as cells, which can be issued from mammals (rodents such as rats and mice, and human cells included, when performed in vitro), or in whole organisms such as rodents, but also pigs, cattle, cats and dogs.
  • mammals rodents such as rats and mice, and human cells included, when performed in vitro
  • whole organisms such as rodents, but also pigs, cattle, cats and dogs.
  • a mutant GR LBD (Brocard et al., 1998) which binds synthetic ligands such as dexamethasone but not natural GR ligands is most preferably used.
  • the invention can also be performed on whole plants, and the invention also encompasses a transgenic plant transformed with the nucleic acid of the invention.
  • said "plant” is a monocotyledon or a dicotyledonous.
  • said plant is a monocotyledon, and is preferably wheat or maize. In the most preferred embodiment, said plant is maize.
  • the modification to the restriction enzyme implicates that it is not active without an external stimulus (application of dexamethasone), or less active than the non-modified restriction enzyme. Upon application of this hormone, the restriction enzyme enters the nucleus of the cells, and performs the double strand break at its site of recognition.
  • the invention also encompasses a restriction enzyme coded by the nucleic acid of the invention.
  • the invention also relates to a method for promoting a genomic double strand break at a predetermined restriction site R in the genome of a plant, comprising the steps of transforming said plant with an nucleic acid coding for a restriction enzyme fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), wherein said restriction enzyme is capable of cutting at said predetermined restriction site R, and applying dexamethasone to cells of said transformed plant in order to promote genomic double strand break at said predetermined restriction site R.
  • the invention also relates to a method for obtaining a plant in the genome of which a specific DNA fragment has been excised, comprising the steps of: a.
  • a plant comprising, in its genome, a polynucleotide X comprising said DNA fragment, wherein said polynucleotide comprises at least a restriction site R, rare or absent in the genome of said plant, at its 5' or 3' extremity, b. providing to cells of said plants the restriction enzyme of the invention, that recognizes and cuts at said restriction site(s) R and applying dexamethasone in order to generate a double strand break(s) at said site(s) thereby obtaining a plant wherein said DNA fragment has been excised after cutting at said restriction site(s) R and repair of the lesion generated by the double strand break(s).
  • one or two R sites are used. When two sites are used, they preferably flank the X polynucleotide (Ae. they are located at its 3' and 5' ends).
  • the DNA fragment to be excised may have been introduced in the plant by transforming said plant with a vector containing said fragment, by methods known in the art, such as Agrobacterium transformation.
  • said polynucleotide X is flanked by two homologous regions Y and Y'.
  • the Y and Y' sequences are said to be "homologous” if they present at least 90%, more preferably 95% even more preferably 100% identity, over at least 50, more preferably 100 consecutive nucleotides (nt) even more preferably 200 or 500 nt, even more preferably 1000 nt, even more preferably
  • R means a restriction site of an endonuclease which has a low ( ⁇ 0.1 %, more preferably ⁇ 0.05 or 0.01 %) probability to be present in the genome of the target organism. In maize, it is believed that such restriction site is at least 15 nucleotides long, more preferably equal or greater to 18 nucleotides long.
  • I-Sce I from an mobile intron of Saccharomyces cerevisiae (Jacquier and Dujon 1985, Plessis et al., 1992), which has a recognition site of 18 bp, as well as other meganucleases such as I-Dmol, I-Crel, I-Ceul, I-Ppol, Pl-Scel, (Aggarwal and Wah 1998, Wang et al., 1997, Monnat et al., 1999, Silva et al., 1999, Marshall et al., 1991 ), this list being non limitative.
  • the preferred enzyme is I-Scel, having the sequence SEQ ID N° 5. As its cutting site is 18 bp long, this restriction enzyme has a low probability of cutting DNA in plants, and in maize in particular.
  • the I-Scel enzyme has been isolated from Saccharomyces cerevisiae and double strand breaks induced by this enzyme increase the rate of homologous recombination in mammalian cells (Choulika et ai, 1994, 1995 and WO9614408).
  • DSB Double strand break
  • the repair of the lesion generated by the DSB refers to the mechanism by which a re-attachment may occur between the free strands generated by "cut-ends”. This re-attachment may occur at the site or next to the site of the "cut-end” but also at a more distal place to the DSB. This may be performed by homologous recombination (HR) or by non-homologous end-joining (NHEJ).
  • said polynucleotide X comprises two restrictions sites R, one being located at its 5' end the other being at the 3' end, and there is no homologous region Y and Y'.
  • said polynucleotide X comprises two restrictions sites R, one being located at its 5' end and the other being at its 3' end, and is flanked by homologous regions Y and Y'.
  • said polynucleotide X comprises only one restriction site R at its 5' or 3' end and is flanked by homologous regions Y and Y'.
  • said restriction enzyme may be provided by the expression, within cells of said plant, of a sequence coding for said enzyme.
  • Methods for the expression of proteins from DNA sequences in plants are well known to persons skilled in the art.
  • a sequence coding for this enzyme may be present in the cell under the control of a constitutive, tissue specific, developmentally regulated, inducible or meiosis promoter.
  • constitutive promoters useful for expression include the 35S promoter or the 19S promoter (Kay et al., 1987), the rice actine promoter (McElroy et al., 1990), the pCRV promoter (Depigny-This et al., 1992), the CsVMV promoter (Verdaguer et al., 1998), the ubiquitin 1 promoter of maize (Chhstensen et al., 1996), the regulatory sequences of the T-DNA of Agrobacterium tumefaciens, including mannopine synthase, nopaline synthase, octopine synthase. Promoters may come from the same species or from another species
  • “heterologous promoters” Although some promoters may have the same pattern of regulation when there are used in different species, it is often preferable to use monocotyledonous promoters in monocotyledons and dicotyledonous promoters in dicotyledonous plants. "Meiosis promoter” means a promoter which may allow the transcription of the operably linked sequence within cells undergoing "meiosis”.
  • meiosis promoter examples include the promoter Lim10 from Lilium longifolium (Morita et al., 2003, see SEQ ID N° 13), AtXrcc3 (Bleuyard and White 2004), ⁇ /CDC45 (Stevens et al., 2004), /4flDMC1 from Arabidopsis thaliana or OsDMCI from Oriza sativa, (Klimyuk and Jones, 1997 ; Doutriaux et al., 1998 ; Kathiresan et al., 2002), AtMEM (US 6,476,297).
  • Such a meiosis promoter should be ideally meiosis-specific or preferentially active during meiosis.
  • expression of said restriction enzyme may be inducible.
  • inducible it is meant that the enzyme only becomes active in response to an external stimulus. This stimulus may be a chemical or mechanical stimulus.
  • the sequence encoding said restriction enzyme is under the control of an inducible promoter.
  • the inducible promoter may be induced by a stress or a chemical agent.
  • Inducible promoters may be induced by pathogens or wounding, more preferably they are induced by abiotical stress like cold, heat, UV light, high salt and water deficit. Promoters useful for targeted expression in trangenesis are reviewed in Potenza et al., 2004.
  • Some abiotic stress promoters are the Arabidospsis thaliana or Oriza sativa DREB genes promoters (Dubouzet et al., 2003 ; Lee et al., 2004 ; Pellegrineschi et al., 2004) ; the Oriza sativa SISAP1 , CDPK7 or WSI gene promoters (Mukhopadhyay et ai, 2004 ; Saijo et ai, 2000; Takahashi et al., 1994) the A. thaliana rd29 gene promoters (Yamaguchi- Shinozaki and Shinozaki 1993).
  • Some plant heat inducible promoters may also be used /?sp18.2 or hsp ⁇ O ⁇ from A. thaliana (Yoshida et al., 1995 ; Young et al., 2005 ), /?sp17.6 or hspM.2, from Glycine max (Severin and Schoffl, 1990 ; Saidi et al., 2005).
  • DNA microarrays have been used to identify stress regulated sequences (Rabbani et ai, 2003 ; EP 1 452 596; WO 02/16655)
  • the signalisation pathway of the response to stress includes abscisic acid signalisation so ABA-inducible promoters may also be powerful stress-inducible promoters, such as the Horgum vulgare A22 and hval promoters (Shen et al., 1993 ; Straub et ai., 1994), Zea maize rab 17, DBF1 and DBF2 (Villardel et ai., 1990 ; Kizis and Pages, 2002), Arabidopsis thaliana ABF3 (Genbank accession AK175851 ), and Oriza sativa rab21 (Mundy and Chua, 1988).
  • the foreseen promoters are induced by chemicals (for review, see Moore et al., 2006, Padidam M. 2003 and Wang et al., 2003 and Zuo and Chua 2000).
  • Some examples of couples of chemically inducible systems and chemical inducer used in plants are, the alcA promoter from A. nidulans, inducible by the Ethanol (Roslan et ai., 2001 ) or the ecdysone receptor from C. fumiferana, inducible by an ecdysone agonist (Koo et al., 2004).
  • expression of the enzyme is indirectly induced by a chemical.
  • GVG gene which codes for a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex.
  • UAS target DNA sequences
  • This complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the modified I-Scel.
  • UAS target DNA sequences
  • This is considered as a dexamethasone inducible (although indirectly) promoter used to control the restriction enzyme expression (Aoyama and Chua (1997). In this case, application of dexamethosone will induce both the restriction enzyme expression and its activity.
  • Said restriction enzyme may also be provided by crossing a transgenic line containing said polynucleotide X, with another transgenic line containing a sequence coding for said enzyme. As previously described, this sequence may be present in this transgenic line under the control of a constitutive, developmentally regulated or inducible promoter.
  • restriction enzyme by a transient expression system, such as agro-infiltration or by any other way, such as injection or spray.
  • the restriction enzyme will have a peak of activity during meiosis.
  • meiosis is the specific cell division leading to gametes production, and the inventors believe that meiosis is a preferred phase for recombination in plants, even though recombination may also occur during mitosis.
  • dexamethasone is applied during meiosis, or just before meiosis.
  • sequence encoding said restriction enzyme is under the control of a meiosis promoter.
  • dexamethasone may be applied also during meiosis or can be available at any development stage.
  • Dexamethasone can be applied to the cells of the plant in several ways.
  • dexamethosone induction can be achieved in vitro by growing seedlings on media containing dexamethasone.
  • the techniques of root drenching injection of the vasculature below the floral meristem, spraying or infiltration of buds or applying drops to the floral meristem are preferred.
  • the purpose is to eliminate a specific DNA fragment in the vicinity of a restriction site recognized by a restriction enzyme according to the invention.
  • a DSB is performed and the reattachment / repair of this DSB leads to excision of this specific DNA fragment.
  • the attachment of said DSB is performed by homologous recombination (HR) between said homologous Y and Y' sequences, and leads to the excision of the DNA fragment and one copy of the recombinated Y or Y' sequence.
  • HR homologous recombination
  • the enzyme of the invention can be used in another way of realization of the invention, where said attachment of said cut ends (repair of DSB) is performed by non homologous end joining (NHEJ) and at least part of the sequences flanking said DSB- generated fragments are attached together.
  • NHEJ non homologous end joining
  • Non homologous end joining is also known as "illegitimate recombination", this method results from the attachment of the two DNA strands produced by the DSB "double strand break", no homologous region are necessary for this method but homologous regions may be present on each DNA strand. The attachment of these strands may result to the reconstitution of the restriction enzyme recognition site.
  • said DNA fragment X to be eliminated comprises a chimeric gene consisting of a promoter linked to a selectable marker gene and a polyadenylation sequence, the selectable marker gene giving resistance to an antibiotic or an herbicide to said plant. More preferably the selectable marker gene comprises of a gene in the group consisting of the pat, the bar or the nptll genes.
  • selectable marker include, but are not limited to, antibiotic resistance genes, herbicide resistance genes or visible marker genes.
  • phenotypic markers are known in the art and may be used in this invention.
  • a number of selective agents and resistance genes are known in the art. (See, for example, Hauptmann et al., 1988 ; Dekeyser et al., 1988 ; Eichholtz et al., 1987 ; and Meijer et al., 1991 ).
  • the selectable marker used can be the bar or pat genes conferring resistance to bialaphos (White et al., 1990), the sulfonamide herbicide Asulam resistance gene, sul (described in WO 98/49316) encoding a type I dihydropterate synthase (DHPS), the nptll gene conferring resistance to a group of antibiotics including kanamycin, G418, paromomycin and neomycin (Bevan et al., 1983), the hph gene conferring resistance to hygromycin (Gritz et al., 1983), the EPSPS gene conferring tolerance to glyphosate (US 5,188,642), the HPPD gene conferring resistance to isoxazoles (WO 96/38567), the gene encoding for the GUS enzyme, the green fluorescent protein (GFP), expression of which, confers a recognisible physical characteristic to transformed cells, the chloramphenicol transferase gene, expression of which, detoxifies
  • the marker gene is preferably controlled by a promoter which allows expression in cells, thus allowing selection of cells or tissue containing the marker at any stage of development of the plant.
  • Preferred promoters are the promoter of nopaline synthase gene of Agrobacterium, the promoter derived from the gene which encodes the 35S subunit of cauliflower mosaic virus (CaMV) coat protein, and the rice actin promoter.
  • CaMV cauliflower mosaic virus
  • any other suitable second promoter may be used.
  • Any terminator may be used.
  • Other elements like introns and enhancers can also be present in the nucleic sequence of interest in order to improve the expression of the gene of interest.
  • FAD2 intron from Arabidopsis described in WO 2006/003186.
  • the restriction enzyme activity which is dependant of application of dexamethasone may be further controlled, for example through use of a meiotic promoter, or of a dexamethasone inducible promoter.
  • the sequences encoding the restriction enzyme are located within said fragment to be excised. In this embodiment, it may also be useful for the sequence encoding the restriction enzyme to be under the control of an inducible or a tissue or developmentally regulated promoter.
  • excision of the DNA fragment in particular by homologous recombination can lead to production of an expressible polynucleotide.
  • the method of the invention thus makes it possible to have conditional expression of a given gene, especially when the restriction enzyme is under the control of an inducible promoter and is located within the DNA fragment to be excised.
  • the expression cassette used in this invention may contain from 5' to 3': a promoter, a first polynucleotide Y1 , a polynucleotide Y, said sequence X to be excised, flanked in 5' or 3' or both by said restriction site R, said polynucleotide Y, a second polynucleotide Y2, and a terminator sequence.
  • the polynucleotide Y1 YY2 formed after removal of sequence X by homologous recombination makes a complete coding sequence imparting a desired phenotype in said plant.
  • the fragment to be excised is inserted in the sequence encoding for a protein in such a way, that the interrupted sequence will not lead to a correctly transcribed RNA and a functional protein.
  • the insertion may be done in the coding sequence but also in an intron or in the promoter. In this embodiment, the excision of the given fragment allows the correct expression of the protein.
  • the plant containing this construct may be re-transformed or crossed with a transgenic line containing the sequence encoding the restriction enzyme of the invention. Excision of the fragment may be observed in the lineage of the plant containing both constructs. Induction of the restriction enzyme activity by dexamethasone in the plant containing both constructs allows the precise production of the given protein.
  • one useful stimuli may be high or cold temperature.
  • the invention offers a new binary system for control expression of protein. Such system may be of interest for example for the production of recombinant proteins of therapeutics usage.
  • the restriction enzyme coding gene may also be under the control of a tissue specific promoter to induce the expression of a recombinant protein in this related tissue.
  • tissue specific promoters may be root specific, such as the rcc2 or rcc3 promoters (Xu et al., 95), seed specific such as the HMWG (Norre et al., 2002) and Zein promoters (Russell and Fromm 97) or leaf specific such as the rubisco (Bansal et al., 92) or PEPC promoters (Matsuoka et ai, 1994).
  • the invention relates to the excision of a DNA fragment from the genome of a plant. If this fragment contains a sequence coding for a protein, the excision may lead to the inactivation of this coding sequence.
  • the described methods may be used in any organisms, such as mammals or plants, or cells of mammals or plants. It is particularly useful on dicotyledonous and monocotyledonous plants, preferably for monocotyledonous, including but not limited to maize, wheat, barley, rice, rye, oat, thticale. Tomato, pepper, lettuce, beet, carrots, melon, rape, sunflower are also plants (list non limitative) in which the method of the invention may be performed. Preferably said plant is maize.
  • the invention also encompasses transformed plants containing the elements described above, or being obtained by methods of the invention.
  • the invention also encompasses cells of plants containing the elements described above, or being obtained by methods of the invention.
  • the transgenic plant containing the sequence encoding the restriction enzyme may also be crossed with another plant containing the expression cassette of the invention containing a polynucleotide X comprising the DNA fragment to be excised according to the invention, said polynucleotide comprises at least a R restriction site rare or absent in the genome at its 5' or 3' extremity or with X.
  • the excision of the fragment and selection of the plant with the excised fragment may be done as previously described for the re transformed plant.
  • Plant with an excised DNA fragment can be identified by any mean known by a person skilled in the art. Such means include PCR, Southern, Northern or Western hybridisations designed to detect the loss of the excised fragment.
  • Negative markers may also be used for this selection.
  • a “negative marker” is a marker the presence of which is deleterious to the plant generally in the presence of an inducer, so that the selection of the plant on said inducer (selective agent) allows the selection of plants in which the excision has occurred and said negative marker has been deleted.
  • Example of "negative markers” are reviewed in Miki and McHugh (2004), as cytosine deaminase (Babwah et al., 2000 ; lida and Terada 2005), or diphtheria toxin A (Terada et al., 2004).
  • An other negative marker is D-amino acid oxidase (Erikson et al., 2004). These negative markers may be under the control of an inducible promoter to allow the development of plants before the excision step.
  • D-amino acid oxidase (Erikson et al., 2004).
  • These negative markers may be under the control of an inducible promoter to allow the development of plants before the excision step.
  • the plant may be retransformed or crossed with a plant containing a sequence encoding the restriction enzyme, or infiltrated by this enzyme.
  • the expression of the given enzyme allows the excision of the DNA fragment according to the invention. Selection on a specific selective agent selects against plants that still contain the negative selection marker and allows the selection of the plants where the excision has occurred.
  • Plants in which an excision by HR according to the invention occurs may also be selected by the use of traditionally used selection markers.
  • the construct used may contain in the following order (from 5' to 3') a promoter, a first polynucleotide Y1 , a polynucleotide Y, the sequence X to be excised flanked in 5', 3' or both by a restriction site R, a second polynucleotide Y, a polynucleotide Y2 and a terminator sequence.
  • the polynucleotide Y1 YY2 obtained after excision of the DNA fragment encodes for a selection marker.
  • This selection marker allows the selection of plants where the fragment excision occurs. Examples of such markers have been described above, such as gene coding for resistance to herbicide.
  • Transgenic lines containing the polynucleotide X or expressing the restriction enzyme of the invention are obtained by traditional methods for genetic transformation of plants and can be obtained by any one of the techniques known to one skilled in the art : methods of direct transfer of genes such as direct micro-injection into plant embryoids (Neuhaus et al., 1997), vacuum infiltration (Bechtold et al. 1993) or electroporation (Chupeau et al., 1989) or the bombardment by gun of particules covered with the plasmidic DNA of interest (Fromm et al., 1990, Finer et al., 1992).
  • Agrobacterium mediated transformation methods may also be used Agrobacterium tumefaciens, in particular according to the method described in the article by An et al., (1986), or Agrobacterium rhizogenes, in particular according to the method described in the article by Guerche et al., (1987). According to a preferred mode, it is possible to use the method described by lshida et al., (1996) for the transformation of maize.
  • the invention relates to methods of gene targeting and insertion of genes within the genome of an organism, in particular a plant, using the improvement of homologous recombination through the double strand breaks induced by the enzymes according to the invention.
  • the invention relates in particular to a method for integrating a DNA sequence Z at a predetermined location within the genome of a plant comprising the steps of: a. providing a plant comprising, at said determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said plant, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to cells of said plant a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c.
  • the restriction enzyme is provided either by transformation of the receiving host by a nucleic acid of the invention, or by crossing the receiving host with a host which comprises a nucleic acid of the invention in its genome.
  • Transient expression systems are also foreseen.
  • the method is also applicable to cell cultures or to other organisms such as mammals, as described above.
  • the method is applicable to mammalian cells, such as human or rodent cells.
  • the method thus comprises the steps of a. providing a cell comprising, at a determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said cell, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to said cell a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c.
  • the restriction enzyme is added to the cell through transformation, by electroporation, transfection, or any other method known in the art.
  • sequence Z to be inserted is flanked by Y3' and Y5' sequences identical to the sequences already present in the genome of the receiving host. Preferred size and identity percentages of these sequences have been described above.
  • the restriction enzyme of the invention is made active during meiosis. This may be obtained by application of dexamethasone during meiosis or by use of meiosis-specific or inducible promoters as described above, and permanent application of dexamethasone, as described above.
  • Screening of organisms which harbour integration of the cassette by homologous recombination within the genome is performed by method known to persons skilled in the art, such as PCR, Southern blots, or any other method. It is also possible to use counter-selectable markers to select these organisms, although this is not the preferred embodiment of the invention.
  • the restriction site R When the restriction site R is normally absent from the genome of the recipient organism (ie the sequence coding for this site is not naturally present in the genome of the organism), it is introduced within said genome though any transformation method known in the art, before performing the method of the invention. Thus, the recipient host possesses a "hot spot" for recombination at the place where this site has integrated. It is easy to identify the Y3' and Y5' flanking regions by known methods in the art such as chromosome walking. These methods are not described herein, as the literature already discloses such methods of identifying regions flanking the integration site of a transgene after transformation of a host.
  • dexamethasone is the preferred ligand, it is to be understood that the invention can also be performed with other ligands for the GR-LBD, such as deacylcortivazol, or other agonists. Furthermore, it is well known that some antagonists for this receptor may also have agonist activity under certain circumstances.
  • the invention also relates to an expression cassette containing a promoter inducible by a steroid, operably linked to a restriction enzyme (site specific endonuclease) coding sequence, said restriction enzyme being preferably a meganuclease as defined above, which may or may not be fused with a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), as described in the invention.
  • restriction enzyme site specific endonuclease
  • GR Glucocorticoid Receptor
  • LBD Ligand Binding Domain
  • operably linked means that the promoter and the restriction enzyme coding sequence are oriented such that the promoter directs expression of the restriction enzyme coding sequence, generally in the 5'- to 3'- direction.
  • the constructs may also contain polyadenylation sites at the 3'- end of the restriction enzyme coding sequence.
  • Said promoter is preferably inducible by a glucocorticoid, such as dexamethasone. Steroid action is generally via the action of a steroid receptor that then binds to the promoter.
  • the GVG gene codes for a modified rat glucocorticoid responsive transcription factor remaining in the cell cytosol as a complex. Upon dexamethasone application, this complex dissociates and the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the restriction enzyme.
  • UAS target DNA sequences
  • Other examples of steroid inducible promoters have been described.
  • the expression cassette according to the invention is used to provide the restriction enzyme to perform the Double Strand Break and induce recombination at the breakage site, in particular to excise a specific sequence from the genome or integrate a sequence at a predetermined locus as seen above.
  • the expression cassette according to the invention may be present on the same vector that carries said DNA sequence Z.
  • the expression cassette according to the invention may be located within said DNA sequence to be excised, or may be present in a second plant that is crossed to said first plant, thereby providing the restriction enzyme.
  • the restriction enzymes that are used in the cassette of this embodiment of the invention have been described above.
  • the transformed organisms containing a cassette of this embodiment of the invention are obtained according to methods known in the art.
  • the methods of use of the cassette of this embodiment of the invention (elimination of a sequence in the genome of a target organism, targeted insertion of a sequence at a specific site) have been described above and are performed as described above.
  • the steroid preferably dexamethasone
  • FIG. 1 Schematic map of the plasmid pBIOS1283.
  • This GATEWAY ENTR plasmid consists of sequence encoding an NLS-I-Scel-GR-LBD fusion protein followed by a CaMV 35S polyadenylation sequence. There is no promoter driving expression of the sequence.
  • FIG. 2 Schematic diagram of pBIOS925. which is used as an intrachromosomal recombination reporter in Arabidopsis.
  • Figure 3 Schematic diagram of pBIOS882. which is used as an intrachromosomal recombination reporter in maize.
  • Figure 4 Schematic diagram of pS ⁇ S-NLS-l-Scel-GR-SCV (pBIOS1316) which is a binary vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter in Arabidosis.
  • Figure 5 Schematic diagram of pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 ) which is a vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron in maize.
  • Figure 6 Schematic diagram of pAt Target Locus, which contains the target locus for GT in Arabidopsis.
  • Figure 7 Schematic diagram of pAt Target Vector which contains the target vector rescue sequence for GT in Arabidopsis and the NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter.
  • Figure 8 Schematic diagram of a gene targeting event induced by dexamethasone in Arabidopsis.
  • Figure 9 Schematic diagram of pBIOS905, which contains the target locus for
  • FIG. 10 Schematic diagram of pZm Target Vector (pBIOS1320) which contains the target vector rescue sequence for GT in maize.
  • Figure 1 1 Schematic diagram of a gene targeting event induced by dexamethasone in maize and the NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron
  • Figure 12 Map of the vector used for cis-marker gene elimination using dexamethasone inducible I-Scel expression.
  • FIG. 13 Schematic diagram of pBIOS1328 (a) and pBIOS1329 (b).
  • pBIOS1329 was constructed by removing the CaMV polyadenylation sequence from pBIOS1283 (figure 1 ).
  • pBIOS1328 (figure 13 (a)) is virtually identical to pBIOS1329 apart from lacking a Leucine residue between the NLS and I-Scel domains.
  • Example 1 Construction of a DNA sequence coding for a nuclear targeted, dexamethasone-inducible I-Scel fusion protein, (SV40NLS - I- Seel - GR LBD).
  • the I-Scel coding sequence was modified, as described below, by the 3' addition of a rat glucocorticoid ligand binding domain sequence (Miesfeld et al 1986).
  • the resulting chimeric coding sequence encodes a modified I-Scel protein (I-Scel- GR-LBD) that is only active in the presence of an appropriate chemical inducer such as dexamethasone.
  • the resulting fusion protein is significantly larger than the original I-Scel protein and thus it is possible that transfer of this fusion protein into the nucleus from the cytosol, and thus the access of I-Scel to its target DNA, will be reduced.
  • NLS nuclear localisation signal
  • a nuclear-encoded meganuclease I-Scel (SEQ ID N °6) (as in Plessis et al, (1992)), corresponding to the mitochondral groupi intron-encoded endonuclase I-Scel from yeast (Jacquier and Dujon (1985)) was amplified by PCR using modified forward (B_Kz * _NLS_Scl-Scel5' : CATGGATCCACCATGGCCTGCA- CCCCGCCGAAGAAAAAGAGGAAAGTGCTGGCCAAAAACATCAAAAA) SEQ ID N ° 9 and reverse (Scl-Scel3'_Sacl(L) : CG CG AG CTCTTTCA- GGAAAGTTTCGG) SEQ ID N°10 primers containing BamHI and Sad restriction sites respectively.
  • the forward primer contains downstream of the BamHI site an ATG codon in frame with the SV40 Nuclear Localization Signal (SEQ ID N° 3 and SEQ ID N° 4 as described in Dingwall et al. 1986, Lanford et al. 1984, Kalderson et al, 1984) coding sequence adapted to maize codon usage.
  • the forward primer was also designed in order that the ATG codon of I- Scel is deleted.
  • the reverse primer was designed so that the amplified I-Scel sequence does not contain a stop codon.
  • the PCR fragment was cloned into the pGEM®-T-easy (Promega) vector forming pBIOS1279.
  • the pBIOS1 106 vector contains a Rat GR LBD (SEQ ID N°1 ,, Miesfeld et al. 1986) behind the CaMV polyA terminator.
  • Rat GR LBD SEQ ID N°1 ,, Miesfeld et al. 1986
  • the SV40NLS-l-Scel sequence was excised from pBIOS1279 by restriction digestion with BamHI and Sacl. Then the fragment was introduced in pBIOS1106 opened with BamHI and Sacl forming a SV40NLS-l-Scel-GR-LBD in frame fusion followed by the CaMV polyA terminator.
  • the resulting plasmid pBIOS1283 is shown in figure 1.
  • Example 2 Construction of intrachromosomal Arabidopsis reporter lines for Homologous recombination (HR). lntrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome.
  • intrachromosomal homologous recombination reporter construct contained in pBIOS925 (figure 2), was introduced into Arabidopsis.
  • This reporter construct is composed of a Pea plastocyanin promoter expressed in green tissues (pPeaPC, Pwee et al., 1990) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene.
  • the truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP gene and precisely reform an entire GUS gene.
  • I-Scel meganuclease I-Scelr
  • pBIOS925 A DNA fragment containing an I-Scel restriction site (I-Scelr) was created by annealing two primers RIScel (5'AATTCTAGGGATAACAGGGTAATA 3', SEQ ID N°11 ) and H3Scel (5 'AGCTTATTACCCTGTTATCCCTAG 3', SEQ ID N °12).
  • pBIOS782 This DNA which contains Hindi 11 and EcoRI compatible overhangs was cloned into Hindlll, EcoRI-cut pBS Il SK+ (STRATAGENE) forming pBIOS782.
  • the cassette pCsVMV-GFP-Nos from pBIOS41 1 was inserted as an Xhol, Sstll (flushed) fragment, between the Xhol, Kpnl (flushed) sites of pBIOS782 forming pBIOS809.
  • pBIOS411 is a pBSII derivative which contains a CsVMV promoter (Verdaguer et al. (1996)) linked to a GFP (Green Fluorescent Protein) coding sequence followed by a 3'Nos terminator (Depicker A.
  • a GUS gene with an STLS1 intron (Vancanneyt G et al., 1990) was introduced between the BamHI and EcoRI sites of pENTRI A (Invitrogen) forming pCL50.
  • the pCsVMV-GFP BamHI, Pvul (flushed) fragment of pBIOS809 was cloned between the BamHI, SnaB1 sites of pCL50 forming the vector pBIOS821.
  • This vector was digested with Smal and Notl, to extract the cassette 'I-Scelr - pCsVMV-GFP- STLS1 intron - 3'GUS' which was introduced between the Csp45l (filled)-Notl sites of pCL50, to obtain the vector pBIOS865.
  • the 'GU-I- Scelr-pCsVMV-GFP-US' region was fused to the pea plastocyanin promoter (pPeaPC) by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pPC-R1 R2-SCV forming the binary vector pBIOS925 (pPC-R1 R2-SCV is a GATEWAY destination plant binary vector containing a pNos-nptll gene for selection of transformed plants, the Pea plastocyanin promoter followed by a GATEWAY cassette and a Chalcone synthase polyadenylation sequence) pBIOS925 was transferred into agrobacteha, and the Arabidopsis cultivar Col4 was transformed with this Agrobacteria strain via the floral dip method essentially as described by Clough et al.
  • Example 3 Construction of intrachromosomal maize reporter lines for Homologous recombination (HR).
  • Intrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome.
  • the intrachromosomal reporter construct contained in pBIOS882 (figure 3) was introduced into maize.
  • This reporter construct is composed of a constitutive promoter (pActin) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene.
  • the truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP and precisely reform an entire GUS gene.
  • I- Scelr I-Scel meganuclease
  • the 'GU-l-Scelr-pCsVMV-GFP-US' region in pBIOS865 was fused to constitutive rice Actin promoter plus a rice Actin intron by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pWP527-R12-JTT forming the binary vector pBIOS 882.
  • the vector pWP527-R12-JTT is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pSc4 (Boevink,P et al., 1995).
  • pBIOS 882 was transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants were phenotypically normal. Pollen from the transformed plants was examined histochemically for GUS activity. Histochemical detection of GUS expression was performed according to the following method.
  • Plant material was stained in a medium containing 0.5 mg/ml Xglucuronide (Clonetech, Palo Alto, CA), 0.5mM phosphate buffer, pH 7.0, 0.1 % triton X-100 and 20% (v/v) methanol. In most transformants no GUS staining was observed in roots leaves and pollen though in 2 plants a few GUS stained pollen grains were observed. This result confirms that HR (which restores GUS activity), is a rare natural event in maize.
  • Example 4 - lntrachromosomal recombination and removal of intergenic DNA sequences in Arabidopsis mediated by the dexamethasone- inducible NLS-I-Scel-GR-LBD fusion protein.
  • Arabidopsis plants containing the intrachromosomal HR reporter are retransformed with a p35S CaMV -NLS-I-Scel-GR LBD transgene.
  • This transgene is constructed by introducing the CaMV 35S promoter (p35S) upstream of the NLS-I-Scel-GR-LBD fusion in pBIOS1283 (example 1 ).
  • pBIOS11 10 is a derivative of the plant binary vector pSCV1 containing a pNos-HPT selectable marker gene and a GATEWAY cassette).
  • the plasmid pS ⁇ S-NLS-l-IScel-GR-SCV (pBIOS1316) is introduced into Agrobacteha, and the Arabidopsis lines described in example 2 are retransformed with this Agrobacteria strain essentially as described by Clough et al. (1998).
  • the transformed plants are phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences are selected.
  • the rate of DNA excision (totally blue plantlets) obtained under dexamethasone treatment is higher that without dexamethasone. This demonstrates that recombination, leading to DNA excision, mediated by the NLS-I-Scel-GR LBD fusion protein is induced by dexamethasone treatment.
  • Example 5 NLS-I-Scel-GR LBD fusion protein-mediated stimulation of intrachromosomal HR and removal of intergenic DNA sequences in maize.
  • maize plants are transformed with a vector designed for the expression of the NLS-I-Scel-GR LBD fusion protein in maize.
  • This vector is constructed by introducing the constitutive Cassava Vein Mosaic Virus (pCsVMV) promoter ((Verdaguer et al. (1996)), linked to an actin intron (McElroy et al. (1990)), upstream of the NLS-I- Scel-GR LBD fusion (example 1 ).
  • pCsVMV constitutive Cassava Vein Mosaic Virus
  • the vector pBIOS605 is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pActin-Bar gene for selection of maize transformants, and a GATEWAY cassette).
  • the resultant expression clone pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 , figure 5) obtained is introduced into the agrobacteha strain LBA4404 (pSB1 ) according to Komari et al (1996).
  • Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants are phenotypically normal.
  • T1 plants which express the NLS-I-Scel-GR-LBD gene are selected by RT-PCR and crossed with intramolecular HR reporter plants described in example 3. Progeny of those plants containing both the NLS-I-Scel-GR LBD gene and the reporter gene are selected and a proportion of these plants are treated with a solution of dexamethasone (a range around 30 ⁇ M is used) applied as drops into the whorl on those plants. Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing. Ideally dexamethosone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I- Scel-GR-LBD protein and available as a substrate for HR during meiosis.
  • dexamethasone a range around 30 ⁇ M is used
  • Example 6 Inducible-I-Sce-I expression to mediate gene targeting in Arabidopsis.
  • a barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues.
  • NHEJ non homologous end joining mechanism
  • This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In plant species where transformation rates are low this prevents the routine use of HR for gene targeting.
  • a solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity.
  • This plant line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events.
  • This approach is exemplified in Arabidopsis using HR- mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into Arabidopsis. Construction of the Target Locus' Arabidopsis' Line. Arabidopsis is transformed with the construct pAtTargetLocus (figure 6).
  • This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the p35S-BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by a nospolyA sequence and the T-DNA right border. This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended (figure 8).
  • pAtTargetLocus is transferred to agrobacteria and is transformed into Arabidopsis using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
  • the binary plasmid pAtTargetVector consists of the following components in the T-DNA; next to the T-DNA left border is a pSc4-Hyg-nosPolyA selectable marker gene, a pCsVMV-NLS-l-Scel GR-LBD chimeric gene followed by a restriction site for I-Scel, the p35S-BAR-nospolyA gene, that is required for to act as a region with homology to the Target Locus, the nos promoter linked to the 5' region of the nptll intron gene followed by a restriction site for I-Scel and the T-DNA right border (figure 7).
  • pAtTargetVector is transferred to agrobacteria and is transformed into the selected Arabidopsis Target Locus lines using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on hygromycin and selfed for two generations. T2 lines homozygous for a single copy of the TargetLocus and TargetVector T-DNAs are selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
  • Example 7 Inducible-I-Sce-I expression to mediate gene targeting in maize. It is highly desirable to be able to insert exogenous DNA into a defined site in the plant genome or replace defined DNA sequences 'gene targeting' using homologous recombination.
  • a barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues. This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In maize where transformation rates are low this prevents the routine use of HR for gene targeting.
  • a solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity.
  • This maize line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events.
  • This approach is exemplified in maize using HR-mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into maize. Construction of the Target Locus' Maize Line. Maize was transformed with the construct pBIOS905.
  • This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the pActin-actin intron -BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by an AtSac66polyA sequence and the T- DNA right border (figure 9). This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended.
  • pBIOS905 was transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al. (1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/. (1996). The transformed plants were phenotypically normal. Tranformants (TO) were selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA were selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines did not display kanamycin resistance.
  • the binary plasmid pZmTargetVector (pBIOS1320) consists of the following components in the T-DNA; next to the T-DNA left border is a restriction site for I-Scel, the pActin-actin intron-BAR-nospolyA gene, that is required as a selectable marker for plant transformation and to act as a region with homology to the Target Locus, the pCsVMV promoter linked to GFP which is a marker for the T-DNA the pSc4 promoter linked to a FAD2 intron and the 5' region of the nptll intron gene followed by a pCsVMV-NLS-l-SceI GR-LBD chimeric gene, a restriction site for I-Scel and the T-DNA right border (pBIOS1320, figure 10).
  • pBIOS1320 is transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996).
  • the transformed plants are phenotypically normal.
  • Tranformants (TO) are selected on BASTA and selfed for two generations.
  • T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance. Induction of GeneTargeting.
  • TargetLoci and TargetVector Lines are crossed and a proportion of the progeny are treated with a solution of dexamethasone (range around 30 ⁇ M) applied as drops into the whorl on those plants.
  • Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing (Dexamethasone treatment induces I-Scel activity and both excises the Target Vector from the genome and creates a DSB at the Target Locus.
  • the Target Vector can then recombine via HR at the Target Locus and reconstitute a functional nptll gene (figure 1 1 ).
  • dexamethasone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I-Scel-GR-LBD protein and available as a substrate for HR during meiosis. This is since it is likely that RH is favoured during meiosis).
  • the progeny of those plants and the progeny of dexamethasone untreated plants are analyzed at the plantlet stage for kanamycin resistance by leaf painting with a solution of kanamycin and via PCR to identify a reconstituted nptll gene.
  • the frequency of nptll resistant plantlets is obtained under dexamethasone treatment is clearly higher than without dexamethasone.
  • Example 8 Construction of intrachromosomal maize reporter lines for inducible HR and NHEJ mediated by inducible I-Scel expression and cis- elimination of the selectable marker and I-Scel genes.
  • a marker gene When a marker gene is to be eliminated and a non-inducible I-Scel is to be expressed, it is preferable to control its expression in TO plants such that it is expressed after the period where selectable marker gene expression is required.
  • a dexamethasone inducible promoter is used to control I-Scel expression (Aoyama and Chua (1997)).
  • dexamethosone induces I-Scel expression and the I-Scel gene together with the plant selectable marker is excised from the genome.
  • the following genes are cloned between two I-Scel sites:- pCsVMV-GVG + pSc4-FAD2int-nptll + pUAS-l-Scel.
  • the GVG gene product is a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex and is described in numerous articles, together with the pUAS promoter. On dexamethasone application this complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of I-Scel.
  • the GVG+nptll+l-Scel region is cloned as an I-Scel fragment into l-Scel-cut pBIOS881.
  • the 5'GUS-l-Scelr-pCsVMV-l-GVG + pSc4-FAD2int-nptll + pUAS-l- Scel 3'GUS region is transferred via an LR clonase reaction into a GATEWAY binary destination vector that is a pSB1 1 derivative containing an Actin promoter followed by a GATEWAY cassette (figure 12).
  • the resulting plasmid is transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobactehal strain essentially as described by lshida ef a/.(1996).
  • TO plantlets are either transferred to a medium containing dexamethasone then later transferred to soil.
  • TO plants are watered with or injected with a solution of dexamethasone.
  • Pollen from dexamethasone treated transformed plants is examined histochemically for GUS activity, to check that, in most transformants, GUS staining is observed at a high frequency. The pollen is then used to fertilize a wild-type plant and obtain F1 progeny that express GUS in all tissues but do not contain the I-Scel or nptll genes.
  • Example 9 - lntrachromosomal recombination and removal of intergenic DNA sequences from a PAT-PAT transgene in Arabidopsis mediated by the dexamethasone-inducible NLS-I-Scel-GR-LBD fusion protein.
  • An Arabidopsis intrachromosomal HR reporter line is used in this example, which contains a T-DNA called PAT-PAT.
  • This T-DNA is composed of two mutated phosphinothhcin acetyltransferase (PAT) genes (Block et al 1987), under the control of a 35S promoter and a Nos terminator. This construct was provided by F. Degroote and G.
  • the vector pBIOS1316 containing the 35S-NLS-I-Scel-GR-LBD chimaeric gene (example 4, figure 4) was introduced into Agrobacteria, and the Arabidopsis reporter lines were transformed with this Agrobacteria strain essentially as described by Clough et al. (1998). The transformed plants were phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences were selected.
  • the T2 seeds were treated as follows:
  • Such herbicide resistance is due to intrachromosomal HR between the 2 mutated PAT genes reconstituting a functional PAT gene and, in most cases, eliminating the region between the two PAT genes including the nptll gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Hydroponics (AREA)

Abstract

The invention relates to modified restriction enzymes capable of being used for promoting homologous recombination in organisms, in particular plants, making it possible to either target gene integration or excise unwanted DNA sequences in the genome of said organisms.

Description

Method for performing Homologous Recombination in plants
The invention relates to modified restriction enzymes capable of being used for promoting homologous recombination in organisms (mammals and plants), in particular plants, making it possible to either target gene integration or excise unwanted DNA sequences in the genome of said organisms.
Homologous recombination (HR) is useful for specifically inserting sequences at a given target site in a genome. It can also be used to perform allele replacement. This can be used for curing genetic disease in humans, for example, or for plant improvement.
Furthermore, it is possible to use homologous recombination for nuclear genomic DNA excision, which allows the removal of undesirable exogenous
DNA sequences. As an example, in plants, this can be used for removing the selectable marker used in plant transformation, or for the irreversible controlled activation or inactivation of transgenes.
Homologous recombination when integrating a DNA sequence in a genome also solves the problem residing in the random pattern of integration of the heterologous gene into said genome. Indeed, it is known that such random integration may lead to a wide variation in the level of expression of the genes among different transformed organisms after regeneration, thus increasing the cost and lengthening the selection of interesting transformants. Furthermore, it is always possible that these heterologous genes are integrated within endogenous genes, thus disrupting their expression. This is a real problem when these endogenous genes are necessary for the maturation, differentiation and/or viability of the cells or organism.
Gene targeting uses the selection of integration events obtained by homologous recombination between DNA sequences present in the genome of a cell or organism and introduced heterologous DNA sequences. This provides a possibility of controlling the site of integration of these heterologous DNA sequences.
Homologous recombination is nevertheless difficult to achieve as mammalian and plant cells have also a greater propensity to mediate nonhomologous recombination. This is in particular true for plant cells. This bad ability to mediate homologous recombination events is also problematic when the transformed organism is difficult to transform, in particular when the in vitro culture or regeneration steps of the cells is difficult.
As an example, even though it is now widely possible to transform maize, the rate of transformation is still quite poor and necessitates to perform multiple transformation experiments to obtain an adequate number of transformed plants (transformation rate of about 4%). As the homologous recombination rate in regular maize plants is very low, one can thus conceive that it is very difficult and time consuming to select transformed maize where HR occurred if the system is not improved.
Thus, there is a need for developing gene targeting systems allowing the possibility to routinely obtain and select homologous recombinants at a high enough frequency with the selection and screening protocols.
As indicated above, homologous recombination can be used for inserting new heterologous sequences, but also for eliminating, removing or substituting sequences (creating new alleles) within the organism genome.
Replacement by homologous recombination of a wild type gene on a chromosome (the target gene) by either a target gene with a new expression cassette, an inactivated gene or a modified gene (new allele) is hampered by the high frequency of random insertion of the whole vector (non-homologous recombination) in animal cells, rather than gene replacement (homologous recombination).
It is possible to use positive/negative selection markers for counter- selection of random insertion events. For example, the thymidine kinase (TK) gene from herpes simplex virus may be used as the negative selection marker. Nevertheless, the vectors are sometimes unstable, and need multiple cloning steps to be made, increasing the time needed to produce them.
Thus, there remains a need for developing new systems for gene targeting by homologous recombination in various organisms and in particular in plants.
It has been reported that creation of a double strand break (DSB) or breaks in the vicinity of the site in which homologous recombination is wished will increase the frequency of HR. These DSB may be created by the use of a restriction enzyme, or a meganuclease, which is a specific restriction enzyme that recognizes and cut DNA at long (more than 15 bp) sites.
The inventors also postulate that the efficiency of homologous recombination may increase depending on the state of the cell. In particular, it is postulated that the efficiency will be better when the cell is at the meiosis stage.
It is therefore desirable to provide a system that will improve the frequency of homologous recombination, through a control of the double-strand breaks in the genome of the target host.
It is to be noted that homologous recombination can also be used as a tool for removing exogenous DNA sequences that do not contribute to the new phenotype conferred by the transgene, such as selectable marker genes that are necessary for plant transformation and particularly those marker genes that confer herbicide or antibiotic resistance.
It can be performed by the use of a restriction enzyme or a meganuclease to create a double strand break (DSB) or breaks in the vicinity of duplicated (homologous) DNA. Such DSBs increase the frequency of HR and intervening DNA excision in the target organism thus allowing precise and efficient DNA excision. Additionally the creation of DSBs flanking the DNA to be excised allows DNA excision via NHEJ.
For this purpose, it is also important to have a good percentage of excision for it to be useful from an industrial point of view, and in particular to have a high level of T1 plants in which excision of the marker gene has occurred. Use of the controllable / inducible enzyme of the invention responds to this question.
Systems for excision of DNA sequences by producing a transgenic line containing a target vector and crossing this line to an I-Scel expressing line to excise the DNA fragment are also proposed, as well as the construction of a target vector containing the sequence coding for an inducible I-Scel sequence on the DNA fragment to be excised. Both methods allow excision of the DNA fragment in a protocol with few steps. In a first embodiment, the present invention relates to an isolated nucleic acid comprising a nucleic acid coding for a restriction enzyme capable of cutting a DNA sequence at a predetermined site, fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD) (Miesfeld et al. 1986) depicted in SEQ ID N° 1 (protein) coded by SEQ ID N° 2 (nucleic acid).
In a preferred embodiment, the GR LBD sequence used in the invention contains a first NLS (nuclear Localization Signal, NL1 ) in the LBD sequence and a second incomplete NLS (NL2) upstream of the LBD sequence. Indeed, although such a restriction enzyme GR-LDB fusion can be imported into the nucleus on hormone binding, more efficient nuclear importation in the presence of the hormone can be assured by adding a further nuclear Localization Signal (NLS) to the fusion. A preferred NLS is the SV40 Large T antigen NLS (Dingwall et al. 1986, Lanford and Butel 1984, Kalderson et al. 1984) depicted in SEQ ID N° 3 (protein) coded by sequence ID N°4 (nucleic acid) but other NLS sequences can be used.
Any restriction enzyme may be used for the purpose of the invention. In particular, one can use EcoRI, EcoRV, BamHI, Hindi 11, or any enzyme described in the literature or on internet sites such as http://rebase.neb.com/rebase/rebase.html. All these enzymes are well known to the person skilled in the art, and their sequences and origin can easily be found in the literature or on internet sits such as the NCBI site at http://www.ncbi.nlm.nih.gov. These enzymes are also named sequence specific endonucleases.
Obtaining a fused protein is performed by classical molecular biology methods as described in Sambrook. As an example, one can amplify the DNA sequence coding for the restriction enzyme, using a set of primers, one of them comprising a linker sequence, then amplify the DNA sequence coding for the rat glucocorticoid receptor with an appropriate set of primers, one of them also comprising a linker sequence, and perform the fusion by ligation between the two linker sequences. For the purpose of the invention, it is nevertheless preferable that the restriction enzyme does not have many cutting sites in the genome of the host. Thus in a preferred embodiment, the restriction enzyme of the invention recognizes and cuts a site that is at least 15 bases, and preferably at least 18 bases. Indeed, it is statistically demonstrated that the longer the restriction site, the less chance it is present in a genome. In this case, the restriction enzyme is called a meganucleases, which is by definition a sequence-specific endonuclease with large (>12 bp) recognition sites.
In the context of the present invention, said meganuclease is preferably I-Scel, described as SEQ ID N°5 (protein) and 6 (nucleic acid). Nevertheless, other meganucleases may also be used, such as HO, or the meganuclease described in Epinat et al (Nucleic Acids Research, 2003, Vol. 31 , No. 1 1 2952- 2962), in particular the hybrid meganuclease, in Chames et al (Nucleic Acids Res., November 23, 2005; 33(20): e178 - e178), or in Nomura et al (I-Apel, Nucleic Acids Res., July 26, 2005; 33(13): e1 16 - e1 16.), or in Silva et al (I- Dmol, Nucleic Acids Res., June 9, 2004; 32(10): 3156 - 3168).
One can also cite I-Crel (Wang et al (1997) Nucleic Acids Res., 25, 3767-3776) or I-Ceul (Marshall et al (1994) Eur. J. Biochem., 220, 855-859), which function as homodimers, or larger proteins bearing two (do)decapeptide motifs, such as I-Scel (Jacquier et al (1985) Cell, 41 , 383-394), Pl-Scel (Gimble, et al (1996) J. MoI. Biol., 263, 163-180) and I-Dmol (Dalgaard et al. (1993) Proc. Natl Acad. Sci. USA, 90, 5414-5417).
The construct of the invention can be made with any restriction enzyme or meganuclease that is currently known, once its sequence has been isolated, as it is obtained through completely classical methods of molecular biology.
In the preferred embodiment of the invention, the isolated nucleic acid of the invention is such that said nucleic acid coding for a rat glucocorticoid receptor is fused at the 3' end of said nucleic acid coding for a restriction enzyme. The person skilled in the art understands that in another embodiment, said nucleic acid coding for a rat glucocorticoid receptor is fused at the 5' end of said nucleic acid coding for a restriction enzyme. In a preferred embodiment, the isolated nucleic acid of the invention codes for a protein having SEQ ID N°7. It is preferred that this nucleic acid has SEQ ID N°8.
The invention also relates to an expression cassette comprising a promoter operably linked to the nucleic acid of the invention. Any promoter is suitable, and some are described below.
As indicated above, the restriction enzyme of the invention is useful for improving homologous recombination in organisms such as cells, which can be issued from mammals (rodents such as rats and mice, and human cells included, when performed in vitro), or in whole organisms such as rodents, but also pigs, cattle, cats and dogs. In those cases a mutant GR LBD (Brocard et al., 1998) which binds synthetic ligands such as dexamethasone but not natural GR ligands is most preferably used. The invention can also be performed on whole plants, and the invention also encompasses a transgenic plant transformed with the nucleic acid of the invention. In the embodiments of the invention, said "plant" is a monocotyledon or a dicotyledonous. In preferred embodiments, said plant is a monocotyledon, and is preferably wheat or maize. In the most preferred embodiment, said plant is maize.
The modification to the restriction enzyme implicates that it is not active without an external stimulus (application of dexamethasone), or less active than the non-modified restriction enzyme. Upon application of this hormone, the restriction enzyme enters the nucleus of the cells, and performs the double strand break at its site of recognition. The invention also encompasses a restriction enzyme coded by the nucleic acid of the invention. The invention also relates to a method for promoting a genomic double strand break at a predetermined restriction site R in the genome of a plant, comprising the steps of transforming said plant with an nucleic acid coding for a restriction enzyme fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), wherein said restriction enzyme is capable of cutting at said predetermined restriction site R, and applying dexamethasone to cells of said transformed plant in order to promote genomic double strand break at said predetermined restriction site R. In another embodiment, the invention also relates to a method for obtaining a plant in the genome of which a specific DNA fragment has been excised, comprising the steps of: a. providing a plant comprising, in its genome, a polynucleotide X comprising said DNA fragment, wherein said polynucleotide comprises at least a restriction site R, rare or absent in the genome of said plant, at its 5' or 3' extremity, b. providing to cells of said plants the restriction enzyme of the invention, that recognizes and cuts at said restriction site(s) R and applying dexamethasone in order to generate a double strand break(s) at said site(s) thereby obtaining a plant wherein said DNA fragment has been excised after cutting at said restriction site(s) R and repair of the lesion generated by the double strand break(s). In preferred embodiments, one or two R sites are used. When two sites are used, they preferably flank the X polynucleotide (Ae. they are located at its 3' and 5' ends).
The DNA fragment to be excised may have been introduced in the plant by transforming said plant with a vector containing said fragment, by methods known in the art, such as Agrobacterium transformation.
In a specific embodiment, said polynucleotide X is flanked by two homologous regions Y and Y'.
The Y and Y' sequences are said to be "homologous" if they present at least 90%, more preferably 95% even more preferably 100% identity, over at least 50, more preferably 100 consecutive nucleotides (nt) even more preferably 200 or 500 nt, even more preferably 1000 nt, even more preferably
2000 nt.
"Rare cutting enzyme restriction site "R" means a restriction site of an endonuclease which has a low (< 0.1 %, more preferably <0.05 or 0.01 %) probability to be present in the genome of the target organism. In maize, it is believed that such restriction site is at least 15 nucleotides long, more preferably equal or greater to 18 nucleotides long. As indicated above, as an example of rare cutting enzyme restriction sites, one can cite I-Sce I, from an mobile intron of Saccharomyces cerevisiae (Jacquier and Dujon 1985, Plessis et al., 1992), which has a recognition site of 18 bp, as well as other meganucleases such as I-Dmol, I-Crel, I-Ceul, I-Ppol, Pl-Scel, (Aggarwal and Wah 1998, Wang et al., 1997, Monnat et al., 1999, Silva et al., 1999, Marshall et al., 1991 ), this list being non limitative.
The preferred enzyme is I-Scel, having the sequence SEQ ID N° 5. As its cutting site is 18 bp long, this restriction enzyme has a low probability of cutting DNA in plants, and in maize in particular. The I-Scel enzyme has been isolated from Saccharomyces cerevisiae and double strand breaks induced by this enzyme increase the rate of homologous recombination in mammalian cells (Choulika et ai, 1994, 1995 and WO9614408).
"Double strand break (DSB)", is the lesion on both strands of a double strand DNA, caused by the restriction enzyme at this rare cutting enzyme restriction site R. This DSB induced the formation of "cut-ends". "The repair of the lesion generated by the DSB" refers to the mechanism by which a re-attachment may occur between the free strands generated by "cut-ends". This re-attachment may occur at the site or next to the site of the "cut-end" but also at a more distal place to the DSB. This may be performed by homologous recombination (HR) or by non-homologous end-joining (NHEJ). According to an embodiment, said polynucleotide X comprises two restrictions sites R, one being located at its 5' end the other being at the 3' end, and there is no homologous region Y and Y'.
According to another embodiment, said polynucleotide X comprises two restrictions sites R, one being located at its 5' end and the other being at its 3' end, and is flanked by homologous regions Y and Y'.
In yet another embodiment, said polynucleotide X comprises only one restriction site R at its 5' or 3' end and is flanked by homologous regions Y and Y'.
In the present invention, said restriction enzyme may be provided by the expression, within cells of said plant, of a sequence coding for said enzyme. Methods for the expression of proteins from DNA sequences in plants are well known to persons skilled in the art. For being expressed, a sequence coding for this enzyme may be present in the cell under the control of a constitutive, tissue specific, developmentally regulated, inducible or meiosis promoter. Examples of constitutive promoters useful for expression include the 35S promoter or the 19S promoter (Kay et al., 1987), the rice actine promoter (McElroy et al., 1990), the pCRV promoter (Depigny-This et al., 1992), the CsVMV promoter (Verdaguer et al., 1998), the ubiquitin 1 promoter of maize (Chhstensen et al., 1996), the regulatory sequences of the T-DNA of Agrobacterium tumefaciens, including mannopine synthase, nopaline synthase, octopine synthase. Promoters may come from the same species or from another species
(heterologous promoters). Although some promoters may have the same pattern of regulation when there are used in different species, it is often preferable to use monocotyledonous promoters in monocotyledons and dicotyledonous promoters in dicotyledonous plants. "Meiosis promoter" means a promoter which may allow the transcription of the operably linked sequence within cells undergoing "meiosis". Examples of meiosis promoter are the promoter Lim10 from Lilium longifolium (Morita et al., 2003, see SEQ ID N° 13), AtXrcc3 (Bleuyard and White 2004), Λ/CDC45 (Stevens et al., 2004), /4flDMC1 from Arabidopsis thaliana or OsDMCI from Oriza sativa, (Klimyuk and Jones, 1997 ; Doutriaux et al., 1998 ; Kathiresan et al., 2002), AtMEM (US 6,476,297). Such a meiosis promoter should be ideally meiosis-specific or preferentially active during meiosis.
According to another embodiment, expression of said restriction enzyme may be inducible. By "inducible", it is meant that the enzyme only becomes active in response to an external stimulus. This stimulus may be a chemical or mechanical stimulus.
In a preferred embodiment, the sequence encoding said restriction enzyme is under the control of an inducible promoter. As an illustration, the inducible promoter may be induced by a stress or a chemical agent.
Inducible promoters may be induced by pathogens or wounding, more preferably they are induced by abiotical stress like cold, heat, UV light, high salt and water deficit. Promoters useful for targeted expression in trangenesis are reviewed in Potenza et al., 2004. Some abiotic stress promoters are the Arabidospsis thaliana or Oriza sativa DREB genes promoters (Dubouzet et al., 2003 ; Lee et al., 2004 ; Pellegrineschi et al., 2004) ; the Oriza sativa SISAP1 , CDPK7 or WSI gene promoters (Mukhopadhyay et ai, 2004 ; Saijo et ai, 2000; Takahashi et al., 1994) the A. thaliana rd29 gene promoters (Yamaguchi- Shinozaki and Shinozaki 1993). Some plant heat inducible promoters may also be used /?sp18.2 or hspλ Oλ from A. thaliana (Yoshida et al., 1995 ; Young et al., 2005 ), /?sp17.6 or hspM.2, from Glycine max (Severin and Schoffl, 1990 ; Saidi et al., 2005). DNA microarrays have been used to identify stress regulated sequences (Rabbani et ai, 2003 ; EP 1 452 596; WO 02/16655) The signalisation pathway of the response to stress includes abscisic acid signalisation so ABA-inducible promoters may also be powerful stress-inducible promoters, such as the Horgum vulgare A22 and hval promoters (Shen et al., 1993 ; Straub et ai., 1994), Zea maize rab 17, DBF1 and DBF2 (Villardel et ai., 1990 ; Kizis and Pages, 2002), Arabidopsis thaliana ABF3 (Genbank accession AK175851 ), and Oriza sativa rab21 (Mundy and Chua, 1988).
In another embodiment, the foreseen promoters are induced by chemicals (for review, see Moore et al., 2006, Padidam M. 2003 and Wang et al., 2003 and Zuo and Chua 2000). Some examples of couples of chemically inducible systems and chemical inducer used in plants are, the alcA promoter from A. nidulans, inducible by the Ethanol (Roslan et ai., 2001 ) or the ecdysone receptor from C. fumiferana, inducible by an ecdysone agonist (Koo et al., 2004).
In another embodiment, expression of the enzyme is indirectly induced by a chemical. As an illustration, one can use the GVG gene, which codes for a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex. On dexamethasone application, this complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the modified I-Scel. This is considered as a dexamethasone inducible (although indirectly) promoter used to control the restriction enzyme expression (Aoyama and Chua (1997). In this case, application of dexamethosone will induce both the restriction enzyme expression and its activity.
Said restriction enzyme may also be provided by crossing a transgenic line containing said polynucleotide X, with another transgenic line containing a sequence coding for said enzyme. As previously described, this sequence may be present in this transgenic line under the control of a constitutive, developmentally regulated or inducible promoter.
It is also foreseen to provide said restriction enzyme by a transient expression system, such as agro-infiltration or by any other way, such as injection or spray.
According to a preferred embodiment, the restriction enzyme will have a peak of activity during meiosis. "Meiosis" is the specific cell division leading to gametes production, and the inventors believe that meiosis is a preferred phase for recombination in plants, even though recombination may also occur during mitosis.
In an embodiment, dexamethasone is applied during meiosis, or just before meiosis.
In another embodiment, the sequence encoding said restriction enzyme is under the control of a meiosis promoter. In this case, dexamethasone may be applied also during meiosis or can be available at any development stage.
Dexamethasone can be applied to the cells of the plant in several ways.
As a solution it can be sprayed on to leaves (Aoyama et al., 1997) or floral organs, applied in drops to the plant surface, for example onto the whorls, added as a drench in watering, it can be injected into the vasculature or infiltrated under vacuum. Seeds can be imbibed in a dexamethosone solution.
Additionally dexamethosone induction can be achieved in vitro by growing seedlings on media containing dexamethasone. For induction just prior to meiosis the techniques of root drenching, injection of the vasculature below the floral meristem, spraying or infiltration of buds or applying drops to the floral meristem are preferred.
In an embodiment of the above-described method, the purpose is to eliminate a specific DNA fragment in the vicinity of a restriction site recognized by a restriction enzyme according to the invention. A DSB is performed and the reattachment / repair of this DSB leads to excision of this specific DNA fragment.
In a preferred way of realization of the invention, the attachment of said DSB is performed by homologous recombination (HR) between said homologous Y and Y' sequences, and leads to the excision of the DNA fragment and one copy of the recombinated Y or Y' sequence.
For HR recombination, strong sequence homology (more than about 90% identity) needs to be present between the two sequences Y and Y', and preferably identity. It is also to be noted that the enzyme of the invention can be used in another way of realization of the invention, where said attachment of said cut ends (repair of DSB) is performed by non homologous end joining (NHEJ) and at least part of the sequences flanking said DSB- generated fragments are attached together. Non homologous end joining is also known as "illegitimate recombination", this method results from the attachment of the two DNA strands produced by the DSB "double strand break", no homologous region are necessary for this method but homologous regions may be present on each DNA strand. The attachment of these strands may result to the reconstitution of the restriction enzyme recognition site.
In specific embodiments of the present invention said DNA fragment X to be eliminated comprises a chimeric gene consisting of a promoter linked to a selectable marker gene and a polyadenylation sequence, the selectable marker gene giving resistance to an antibiotic or an herbicide to said plant. More preferably the selectable marker gene comprises of a gene in the group consisting of the pat, the bar or the nptll genes. In the present invention, the term "selectable marker", "selectable gene", "selectable marker gene", "selection marker gene", "marker gene" are used interchangeably. These selectable markers include, but are not limited to, antibiotic resistance genes, herbicide resistance genes or visible marker genes.
Other phenotypic markers are known in the art and may be used in this invention. A number of selective agents and resistance genes are known in the art. (See, for example, Hauptmann et al., 1988 ; Dekeyser et al., 1988 ; Eichholtz et al., 1987 ; and Meijer et al., 1991 ). Notably the selectable marker used can be the bar or pat genes conferring resistance to bialaphos (White et al., 1990), the sulfonamide herbicide Asulam resistance gene, sul (described in WO 98/49316) encoding a type I dihydropterate synthase (DHPS), the nptll gene conferring resistance to a group of antibiotics including kanamycin, G418, paromomycin and neomycin (Bevan et al., 1983), the hph gene conferring resistance to hygromycin (Gritz et al., 1983), the EPSPS gene conferring tolerance to glyphosate (US 5,188,642), the HPPD gene conferring resistance to isoxazoles (WO 96/38567), the gene encoding for the GUS enzyme, the green fluorescent protein (GFP), expression of which, confers a recognisible physical characteristic to transformed cells, the chloramphenicol transferase gene, expression of which, detoxifies chloramphenicol. Advantageously, the selectable marker gene is inserted between a promoter and a terminator.
According to this advantageous embodiment, the marker gene is preferably controlled by a promoter which allows expression in cells, thus allowing selection of cells or tissue containing the marker at any stage of development of the plant. Preferred promoters are the promoter of nopaline synthase gene of Agrobacterium, the promoter derived from the gene which encodes the 35S subunit of cauliflower mosaic virus (CaMV) coat protein, and the rice actin promoter. However, any other suitable second promoter may be used. Any terminator may be used. Other elements like introns and enhancers can also be present in the nucleic sequence of interest in order to improve the expression of the gene of interest. One could in particular note the FAD2 intron from Arabidopsis described in WO 2006/003186. In this specific embodiment one can obtain a transformed plant by the use of the marker gene selection and, in a further step remove the marker gene by the protocol of the invention, the marker gene being located on the fragment X. In this particular protocol the restriction enzyme activity which is dependant of application of dexamethasone may be further controlled, for example through use of a meiotic promoter, or of a dexamethasone inducible promoter.
In one of the embodiment of this invention, the sequences encoding the restriction enzyme are located within said fragment to be excised. In this embodiment, it may also be useful for the sequence encoding the restriction enzyme to be under the control of an inducible or a tissue or developmentally regulated promoter.
It is to be noted that, in another embodiment, excision of the DNA fragment, in particular by homologous recombination can lead to production of an expressible polynucleotide. The method of the invention thus makes it possible to have conditional expression of a given gene, especially when the restriction enzyme is under the control of an inducible promoter and is located within the DNA fragment to be excised. In this embodiment, the expression cassette used in this invention, may contain from 5' to 3': a promoter, a first polynucleotide Y1 , a polynucleotide Y, said sequence X to be excised, flanked in 5' or 3' or both by said restriction site R, said polynucleotide Y, a second polynucleotide Y2, and a terminator sequence. In this embodiment, the polynucleotide Y1 YY2 formed after removal of sequence X by homologous recombination makes a complete coding sequence imparting a desired phenotype in said plant.
For irreversible control activation of a protein, the fragment to be excised is inserted in the sequence encoding for a protein in such a way, that the interrupted sequence will not lead to a correctly transcribed RNA and a functional protein. The insertion may be done in the coding sequence but also in an intron or in the promoter. In this embodiment, the excision of the given fragment allows the correct expression of the protein.
The plant containing this construct may be re-transformed or crossed with a transgenic line containing the sequence encoding the restriction enzyme of the invention. Excision of the fragment may be observed in the lineage of the plant containing both constructs. Induction of the restriction enzyme activity by dexamethasone in the plant containing both constructs allows the precise production of the given protein. For this embodiment, one useful stimuli may be high or cold temperature. In such a mode of realization the invention offers a new binary system for control expression of protein. Such system may be of interest for example for the production of recombinant proteins of therapeutics usage. For this particular usage, the restriction enzyme coding gene may also be under the control of a tissue specific promoter to induce the expression of a recombinant protein in this related tissue. Examples of tissue specific promoters may be root specific, such as the rcc2 or rcc3 promoters (Xu et al., 95), seed specific such as the HMWG (Norre et al., 2002) and Zein promoters (Russell and Fromm 97) or leaf specific such as the rubisco (Bansal et al., 92) or PEPC promoters (Matsuoka et ai, 1994).
The invention relates to the excision of a DNA fragment from the genome of a plant. If this fragment contains a sequence coding for a protein, the excision may lead to the inactivation of this coding sequence.
As previously indicated, the described methods may be used in any organisms, such as mammals or plants, or cells of mammals or plants. It is particularly useful on dicotyledonous and monocotyledonous plants, preferably for monocotyledonous, including but not limited to maize, wheat, barley, rice, rye, oat, thticale. Tomato, pepper, lettuce, beet, carrots, melon, rape, sunflower are also plants (list non limitative) in which the method of the invention may be performed. Preferably said plant is maize. The invention also encompasses transformed plants containing the elements described above, or being obtained by methods of the invention. The invention also encompasses cells of plants containing the elements described above, or being obtained by methods of the invention.
The transgenic plant containing the sequence encoding the restriction enzyme may also be crossed with another plant containing the expression cassette of the invention containing a polynucleotide X comprising the DNA fragment to be excised according to the invention, said polynucleotide comprises at least a R restriction site rare or absent in the genome at its 5' or 3' extremity or with X. In the obtained plants containing both constructs, the excision of the fragment and selection of the plant with the excised fragment, may be done as previously described for the re transformed plant. Plant with an excised DNA fragment can be identified by any mean known by a person skilled in the art. Such means include PCR, Southern, Northern or Western hybridisations designed to detect the loss of the excised fragment. If the excised fragment contains a sequence encoding a selectable marker the absence of this marker may be the way for identification of these plants. "Negative markers" may also be used for this selection. A "negative marker" is a marker the presence of which is deleterious to the plant generally in the presence of an inducer, so that the selection of the plant on said inducer (selective agent) allows the selection of plants in which the excision has occurred and said negative marker has been deleted. Example of "negative markers" are reviewed in Miki and McHugh (2004), as cytosine deaminase (Babwah et al., 2000 ; lida and Terada 2005), or diphtheria toxin A (Terada et al., 2004). An other negative marker is D-amino acid oxidase (Erikson et al., 2004). These negative markers may be under the control of an inducible promoter to allow the development of plants before the excision step. In this particular way of achieving the invention, one can transform a plant with the given construct containing the sequence encoding for the negative marker under the control of an inducible promoter. The plant may be retransformed or crossed with a plant containing a sequence encoding the restriction enzyme, or infiltrated by this enzyme. The expression of the given enzyme allows the excision of the DNA fragment according to the invention. Selection on a specific selective agent selects against plants that still contain the negative selection marker and allows the selection of the plants where the excision has occurred.
Plants in which an excision by HR according to the invention occurs may also be selected by the use of traditionally used selection markers. For this specific embodiment, the construct used may contain in the following order (from 5' to 3') a promoter, a first polynucleotide Y1 , a polynucleotide Y, the sequence X to be excised flanked in 5', 3' or both by a restriction site R, a second polynucleotide Y, a polynucleotide Y2 and a terminator sequence. In this example the polynucleotide Y1 YY2 obtained after excision of the DNA fragment encodes for a selection marker. The use of this selection marker allows the selection of plants where the fragment excision occurs. Examples of such markers have been described above, such as gene coding for resistance to herbicide.
Transgenic lines containing the polynucleotide X or expressing the restriction enzyme of the invention are obtained by traditional methods for genetic transformation of plants and can be obtained by any one of the techniques known to one skilled in the art : methods of direct transfer of genes such as direct micro-injection into plant embryoids (Neuhaus et al., 1997), vacuum infiltration (Bechtold et al. 1993) or electroporation (Chupeau et al., 1989) or the bombardment by gun of particules covered with the plasmidic DNA of interest (Fromm et al., 1990, Finer et al., 1992). Agrobacterium mediated transformation methods may also be used Agrobacterium tumefaciens, in particular according to the method described in the article by An et al., (1986), or Agrobacterium rhizogenes, in particular according to the method described in the article by Guerche et al., (1987). According to a preferred mode, it is possible to use the method described by lshida et al., (1996) for the transformation of maize.
In another embodiment, the invention relates to methods of gene targeting and insertion of genes within the genome of an organism, in particular a plant, using the improvement of homologous recombination through the double strand breaks induced by the enzymes according to the invention.
The invention relates in particular to a method for integrating a DNA sequence Z at a predetermined location within the genome of a plant comprising the steps of: a. providing a plant comprising, at said determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said plant, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to cells of said plant a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c. providing to said cells said restriction enzyme of the invention, and applying dexamethasone in order to induce a double strand break at said restriction site R, thereby leading to integration of said DNA sequence Z within the plant genome by homologous recombination between said Y3' and Y5' sequences present in the genome of the plant, and said sequences homologous or identical to Y3' and Y5' flanking said sequence Z.
As for the method of excision of a DNA fragment that is described above, the restriction enzyme is provided either by transformation of the receiving host by a nucleic acid of the invention, or by crossing the receiving host with a host which comprises a nucleic acid of the invention in its genome.
Transient expression systems are also foreseen.
It is also clear that this method is also applicable to cell cultures or to other organisms such as mammals, as described above. In particular, the method is applicable to mammalian cells, such as human or rodent cells. The method thus comprises the steps of a. providing a cell comprising, at a determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said cell, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to said cell a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c. providing to said cell said restriction enzyme of the invention, and applying dexamethasone in order to induce a double strand break at said restriction site R, thereby leading to integration of said DNA sequence Z within the cell genome by homologous recombination between said Y3' and Y5' sequences present in the genome of the cell, and said sequences homologous or identical to Y3' and Y5' flanking said sequence Z.
The restriction enzyme is added to the cell through transformation, by electroporation, transfection, or any other method known in the art.
The promoters, marker, genes and any other elements for use in this embodiment have been described above.
It is preferred when the sequence Z to be inserted is flanked by Y3' and Y5' sequences identical to the sequences already present in the genome of the receiving host. Preferred size and identity percentages of these sequences have been described above.
As described above, when applying this method to a whole organism and in particular a plant, it is preferred that the restriction enzyme of the invention is made active during meiosis. This may be obtained by application of dexamethasone during meiosis or by use of meiosis-specific or inducible promoters as described above, and permanent application of dexamethasone, as described above.
Screening of organisms which harbour integration of the cassette by homologous recombination within the genome is performed by method known to persons skilled in the art, such as PCR, Southern blots, or any other method. It is also possible to use counter-selectable markers to select these organisms, although this is not the preferred embodiment of the invention.
When the restriction site R is normally absent from the genome of the recipient organism (ie the sequence coding for this site is not naturally present in the genome of the organism), it is introduced within said genome though any transformation method known in the art, before performing the method of the invention. Thus, the recipient host possesses a "hot spot" for recombination at the place where this site has integrated. It is easy to identify the Y3' and Y5' flanking regions by known methods in the art such as chromosome walking. These methods are not described herein, as the literature already discloses such methods of identifying regions flanking the integration site of a transgene after transformation of a host.
Although dexamethasone is the preferred ligand, it is to be understood that the invention can also be performed with other ligands for the GR-LBD, such as deacylcortivazol, or other agonists. Furthermore, it is well known that some antagonists for this receptor may also have agonist activity under certain circumstances.
The invention also relates to an expression cassette containing a promoter inducible by a steroid, operably linked to a restriction enzyme (site specific endonuclease) coding sequence, said restriction enzyme being preferably a meganuclease as defined above, which may or may not be fused with a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), as described in the invention. One thus cite a I-Scel meganuclease (SEQ ID N° 5) or the inducible I-Scel protein as described in SEQ ID N° 7. Transformed organisms containing this expression cassette are also subject of the invention. The term "operably linked" as used herein means that the promoter and the restriction enzyme coding sequence are oriented such that the promoter directs expression of the restriction enzyme coding sequence, generally in the 5'- to 3'- direction. The constructs may also contain polyadenylation sites at the 3'- end of the restriction enzyme coding sequence. Said promoter is preferably inducible by a glucocorticoid, such as dexamethasone. Steroid action is generally via the action of a steroid receptor that then binds to the promoter.
Once can cite, for example the GVG gene / UAS promoter system, mentioned above, as an indirect inducible promoter system. The GVG gene codes for a modified rat glucocorticoid responsive transcription factor remaining in the cell cytosol as a complex. Upon dexamethasone application, this complex dissociates and the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the restriction enzyme. Other examples of steroid inducible promoters have been described.
One can cite the promoters described by Mader and White (1993), the review of White (1997), the sip48 promoter described by Pruneda-Paz et al (2004), the promoter described by Schena et al (1991 ).
The expression cassette according to the invention is used to provide the restriction enzyme to perform the Double Strand Break and induce recombination at the breakage site, in particular to excise a specific sequence from the genome or integrate a sequence at a predetermined locus as seen above.
In the case where targeted insertion of a DNA sequence Z is intended, as described above, the expression cassette according to the invention may be present on the same vector that carries said DNA sequence Z.
In the case where excision of a specific DNA sequence is desired in a first plant, as described above, the expression cassette according to the invention may be located within said DNA sequence to be excised, or may be present in a second plant that is crossed to said first plant, thereby providing the restriction enzyme.
The restriction enzymes that are used in the cassette of this embodiment of the invention have been described above. The transformed organisms containing a cassette of this embodiment of the invention are obtained according to methods known in the art. The methods of use of the cassette of this embodiment of the invention (elimination of a sequence in the genome of a target organism, targeted insertion of a sequence at a specific site) have been described above and are performed as described above. In particular, it is preferred that the steroid (preferably dexamethasone) is applied on or just before meiosis.
The present invention will be further understood in view of the annexed figures and following examples.
FIGURES
Figure 1 : Schematic map of the plasmid pBIOS1283. This GATEWAY ENTR plasmid consists of sequence encoding an NLS-I-Scel-GR-LBD fusion protein followed by a CaMV 35S polyadenylation sequence. There is no promoter driving expression of the sequence.
Figure 2: Schematic diagram of pBIOS925. which is used as an intrachromosomal recombination reporter in Arabidopsis.
Figure 3: Schematic diagram of pBIOS882. which is used as an intrachromosomal recombination reporter in maize.
Figure 4: Schematic diagram of pSδS-NLS-l-Scel-GR-SCV (pBIOS1316) which is a binary vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter in Arabidosis.
Figure 5: Schematic diagram of pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 ) which is a vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron in maize. Figure 6: Schematic diagram of pAt Target Locus, which contains the target locus for GT in Arabidopsis.
Figure 7: Schematic diagram of pAt Target Vector which contains the target vector rescue sequence for GT in Arabidopsis and the NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter.
Figure 8: Schematic diagram of a gene targeting event induced by dexamethasone in Arabidopsis.
Figure 9: Schematic diagram of pBIOS905, which contains the target locus for
GT in maize. Figure 10: Schematic diagram of pZm Target Vector (pBIOS1320) which contains the target vector rescue sequence for GT in maize.
Figure 1 1 : Schematic diagram of a gene targeting event induced by dexamethasone in maize and the NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron Figure 12: Map of the vector used for cis-marker gene elimination using dexamethasone inducible I-Scel expression.
Figure 13: Schematic diagram of pBIOS1328 (a) and pBIOS1329 (b). pBIOS1329 was constructed by removing the CaMV polyadenylation sequence from pBIOS1283 (figure 1 ). pBIOS1328 (figure 13 (a)) is virtually identical to pBIOS1329 apart from lacking a Leucine residue between the NLS and I-Scel domains.
EXAMPLES :
The invention will now be described by the way of the following examples, which should not be construed as in any way limiting the scope of the invention.
Example 1 - Construction of a DNA sequence coding for a nuclear targeted, dexamethasone-inducible I-Scel fusion protein, (SV40NLS - I- Seel - GR LBD).
In order to precisely control the activity of the I-Scel meganuclease the I-Scel coding sequence was modified, as described below, by the 3' addition of a rat glucocorticoid ligand binding domain sequence (Miesfeld et al 1986). The resulting chimeric coding sequence encodes a modified I-Scel protein (I-Scel- GR-LBD) that is only active in the presence of an appropriate chemical inducer such as dexamethasone. The resulting fusion protein is significantly larger than the original I-Scel protein and thus it is possible that transfer of this fusion protein into the nucleus from the cytosol, and thus the access of I-Scel to its target DNA, will be reduced. The addition of a nuclear localisation signal (NLS) to the I-Scel-GR-LBD protein is likely to improve the transfer, after dexamethosone induction, of the fusion protein to the nucleus. The cloning of a NLS-I-Scel-GR-LBD chimeric coding sequence is described below. A nuclear-encoded meganuclease I-Scel (SEQ ID N °6) (as in Plessis et al, (1992)), corresponding to the mitochondral groupi intron-encoded endonuclase I-Scel from yeast (Jacquier and Dujon (1985)) was amplified by PCR using modified forward (B_Kz*_NLS_Scl-Scel5' : CATGGATCCACCATGGCCTGCA- CCCCGCCGAAGAAAAAGAGGAAAGTGCTGGCCAAAAACATCAAAAA) SEQ ID N ° 9 and reverse (Scl-Scel3'_Sacl(L) : CG CG AG CTCTTTCA- GGAAAGTTTCGG) SEQ ID N°10 primers containing BamHI and Sad restriction sites respectively. The forward primer contains downstream of the BamHI site an ATG codon in frame with the SV40 Nuclear Localization Signal (SEQ ID N° 3 and SEQ ID N° 4 as described in Dingwall et al. 1986, Lanford et al. 1984, Kalderson et al, 1984) coding sequence adapted to maize codon usage. The forward primer was also designed in order that the ATG codon of I- Scel is deleted. The reverse primer was designed so that the amplified I-Scel sequence does not contain a stop codon. The PCR fragment was cloned into the pGEM®-T-easy (Promega) vector forming pBIOS1279. The pBIOS1 106 vector contains a Rat GR LBD (SEQ ID N°1 ,, Miesfeld et al. 1986) behind the CaMV polyA terminator. The SV40NLS-l-Scel sequence was excised from pBIOS1279 by restriction digestion with BamHI and Sacl. Then the fragment was introduced in pBIOS1106 opened with BamHI and Sacl forming a SV40NLS-l-Scel-GR-LBD in frame fusion followed by the CaMV polyA terminator. The resulting plasmid pBIOS1283 is shown in figure 1.
Example 2 - Construction of intrachromosomal Arabidopsis reporter lines for Homologous recombination (HR). lntrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome. In order to demonstrate precise intrachromosomal homologous recombination mediated by the NLS-I-Scel-GR- LBD hormone-inducible fusion protein in Arabidopsis the intrachromosomal homologous recombination reporter construct, contained in pBIOS925 (figure 2), was introduced into Arabidopsis. This reporter construct is composed of a Pea plastocyanin promoter expressed in green tissues (pPeaPC, Pwee et al., 1990) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene. The truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP gene and precisely reform an entire GUS gene. In addition, between the 3' truncated GUS gene and the CsVMV promoter, there is an I-Scel meganuclease (I-Scelr) restriction site. This allows the creation of an l-Scel-mediated double strand DNA break at this l-Scel-target site. In this and in subsequent examples the GUS gene is used as an example of a gene of interest to be excised in the plant. The details of the construction of pBIOS925 are described below: A DNA fragment containing an I-Scel restriction site (I-Scelr) was created by annealing two primers RIScel (5'AATTCTAGGGATAACAGGGTAATA 3', SEQ ID N°11 ) and H3Scel (5 'AGCTTATTACCCTGTTATCCCTAG 3', SEQ ID N °12). This DNA which contains Hindi 11 and EcoRI compatible overhangs was cloned into Hindlll, EcoRI-cut pBS Il SK+ (STRATAGENE) forming pBIOS782. The cassette pCsVMV-GFP-Nos from pBIOS41 1 was inserted as an Xhol, Sstll (flushed) fragment, between the Xhol, Kpnl (flushed) sites of pBIOS782 forming pBIOS809.(pBIOS411 is a pBSII derivative which contains a CsVMV promoter (Verdaguer et al. (1996)) linked to a GFP (Green Fluorescent Protein) coding sequence followed by a 3'Nos terminator (Depicker A. et al., 1982)) A GUS gene with an STLS1 intron (Vancanneyt G et al., 1990) was introduced between the BamHI and EcoRI sites of pENTRI A (Invitrogen) forming pCL50. The pCsVMV-GFP BamHI, Pvul (flushed) fragment of pBIOS809 was cloned between the BamHI, SnaB1 sites of pCL50 forming the vector pBIOS821. This vector was digested with Smal and Notl, to extract the cassette 'I-Scelr - pCsVMV-GFP- STLS1 intron - 3'GUS' which was introduced between the Csp45l (filled)-Notl sites of pCL50, to obtain the vector pBIOS865. The 'GU-I- Scelr-pCsVMV-GFP-US' region was fused to the pea plastocyanin promoter (pPeaPC) by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pPC-R1 R2-SCV forming the binary vector pBIOS925 (pPC-R1 R2-SCV is a GATEWAY destination plant binary vector containing a pNos-nptll gene for selection of transformed plants, the Pea plastocyanin promoter followed by a GATEWAY cassette and a Chalcone synthase polyadenylation sequence) pBIOS925 was transferred into agrobacteha, and the Arabidopsis cultivar Col4 was transformed with this Agrobacteria strain via the floral dip method essentially as described by Clough et al. (1998). The transformed plants were phenotypically normal. Leaves from the transformed plants were examined histochemically for GUS activity. Histochemical detection of GUS expression was performed according to the following method. Plant material was stained in a medium containing 0.5 mg/ml Xglucuronide (Clonetech, Palo Alto, CA), 0.5mM phosphate buffer, pH 7.0, 0.1 % triton X-100 and 20% (v/v) methanol. In most transformed plants no GUS staining was observed in leaves. This result confirms that HR (which restores GUS activity), is a rare natural event in Arabidopsis.
Example 3 - Construction of intrachromosomal maize reporter lines for Homologous recombination (HR).
Intrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome. In order to demonstrate precise intrachromosomal homologous recombination in maize the intrachromosomal reporter construct contained in pBIOS882 (figure 3) was introduced into maize. This reporter construct is composed of a constitutive promoter (pActin) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene. The truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP and precisely reform an entire GUS gene. In addition, between the 3' truncated GUS gene and the CsVMV promoter, there is a restriction site' for the I-Scel meganuclease (I- Scelr). This allows the creation of an l-Scel-mediated double strand DNA break at this l-Scel-target site. In this and in subsequent examples the GFP gene is used as an example of a gene of interest to be excised in the plant, and the GUS gene as an example of a gene that will be made active upon excision of the DNA fragment. The details of the construction of pBIOS882 are described below:-
. The 'GU-l-Scelr-pCsVMV-GFP-US' region in pBIOS865 (example 2) was fused to constitutive rice Actin promoter plus a rice Actin intron by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pWP527-R12-JTT forming the binary vector pBIOS 882. (The vector pWP527-R12-JTT is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pSc4 (Boevink,P et al., 1995). -Nptll (Bevan MW, 1992 ; Berg et Berg, 1983 ) gene for selection of maize transformants, a rice pActin promoter linked to a rice actin intron in front of a GATEWAY cassette). pBIOS 882 was transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants were phenotypically normal. Pollen from the transformed plants was examined histochemically for GUS activity. Histochemical detection of GUS expression was performed according to the following method. Plant material was stained in a medium containing 0.5 mg/ml Xglucuronide (Clonetech, Palo Alto, CA), 0.5mM phosphate buffer, pH 7.0, 0.1 % triton X-100 and 20% (v/v) methanol. In most transformants no GUS staining was observed in roots leaves and pollen though in 2 plants a few GUS stained pollen grains were observed. This result confirms that HR (which restores GUS activity), is a rare natural event in maize.
Example 4 - lntrachromosomal recombination and removal of intergenic DNA sequences in Arabidopsis mediated by the dexamethasone- inducible NLS-I-Scel-GR-LBD fusion protein.
In order to assess the effect of inducible NLS-I-Scel-GR-LBD fusion protein expression on the frequency of HR-mediated DNA excision, Arabidopsis plants containing the intrachromosomal HR reporter (example 2) are retransformed with a p35S CaMV -NLS-I-Scel-GR LBD transgene. This transgene is constructed by introducing the CaMV 35S promoter (p35S) upstream of the NLS-I-Scel-GR-LBD fusion in pBIOS1283 (example 1 ). The resulting chimeric pSδS-NLS-l-Scel-GE-LBD-CaMVpolyA gene is transferred into the plant binary vector pBIOS1 1 10 via an LR clonase reaction forming the vector p35S-NLS-l- Scel-GR-SCV (pBIOS1316, figure 4) (pBIOS11 10 is a derivative of the plant binary vector pSCV1 containing a pNos-HPT selectable marker gene and a GATEWAY cassette). The plasmid pSδS-NLS-l-IScel-GR-SCV (pBIOS1316) is introduced into Agrobacteha, and the Arabidopsis lines described in example 2 are retransformed with this Agrobacteria strain essentially as described by Clough et al. (1998). The transformed plants are phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences are selected. Then Arabidopsis buds of different developmental stages (<0,5 to 1 mm long) are infiltrated under vacuum in a dexamethasone solution (30 μM) (buds are used since ideally the targeting vector is excised by the NLS-I-Scel- GR-LBD protein and available as a substrate for HR during meiosis). The progeny of those plants and the progeny of dexamethasone untreated plants are analyzed at the seedling stage for GUS activity histochemically. Such analysis provides an estimate of the frequency of intrachromosomal HR giving rise to excision of the pCsVMV-GFP gene and the reconstitution of the GUS gene. The rate of DNA excision (totally blue plantlets) obtained under dexamethasone treatment is higher that without dexamethasone. This demonstrates that recombination, leading to DNA excision, mediated by the NLS-I-Scel-GR LBD fusion protein is induced by dexamethasone treatment.
Example 5 - NLS-I-Scel-GR LBD fusion protein-mediated stimulation of intrachromosomal HR and removal of intergenic DNA sequences in maize.
In order to assess the effect of inducible NLS-I-Scel-GR-LBD fusion protein expression on the frequency of HR-mediated DNA excision, maize plants are transformed with a vector designed for the expression of the NLS-I-Scel-GR LBD fusion protein in maize. This vector is constructed by introducing the constitutive Cassava Vein Mosaic Virus (pCsVMV) promoter ((Verdaguer et al. (1996)), linked to an actin intron (McElroy et al. (1990)), upstream of the NLS-I- Scel-GR LBD fusion (example 1 ). The created chimeric gene is then transferred via an LR clonase reaction into the binary vector pBIOS605. (The vector pBIOS605 is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pActin-Bar gene for selection of maize transformants, and a GATEWAY cassette). The resultant expression clone pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 , figure 5) obtained is introduced into the agrobacteha strain LBA4404 (pSB1 ) according to Komari et al (1996). Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants are phenotypically normal. T1 plants which express the NLS-I-Scel-GR-LBD gene are selected by RT-PCR and crossed with intramolecular HR reporter plants described in example 3. Progeny of those plants containing both the NLS-I-Scel-GR LBD gene and the reporter gene are selected and a proportion of these plants are treated with a solution of dexamethasone (a range around 30μM is used) applied as drops into the whorl on those plants. Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing. Ideally dexamethosone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I- Scel-GR-LBD protein and available as a substrate for HR during meiosis. This is since it is likely that RH is favoured during meiosis. The mature pollen of dexamethasone treated and untreated plants are analyzed for GUS activity histochemically since such analysis provides an estimate of the frequency of intrachromosomal HR giving rise to excision of the pCsVMV-GFP gene and the reconstitution of the GUS gene. The DNA excision activity and thus frequency of GUS staining, was substantially greater in pollen of lines treated with dexamethasone than in untreated lines. This demonstrates a stimulation of HR and DNA excision in the presence of dexamethasone-induction of NLS-I-Scel-GR LBD expression.
Example 6 - Inducible-I-Sce-I expression to mediate gene targeting in Arabidopsis.
It is highly desirable to be able to insert exogenous DNA into a defined site in the plant genome or replace defined DNA sequences 'gene targeting' using homologous recombination. A barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues. This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In plant species where transformation rates are low this prevents the routine use of HR for gene targeting. A solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity. This plant line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events. This approach is exemplified in Arabidopsis using HR- mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into Arabidopsis. Construction of the Target Locus' Arabidopsis' Line. Arabidopsis is transformed with the construct pAtTargetLocus (figure 6). This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the p35S-BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by a nospolyA sequence and the T-DNA right border. This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended (figure 8). pAtTargetLocus is transferred to agrobacteria and is transformed into Arabidopsis using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
Construction of the Target Vector'.
The binary plasmid pAtTargetVector consists of the following components in the T-DNA; next to the T-DNA left border is a pSc4-Hyg-nosPolyA selectable marker gene, a pCsVMV-NLS-l-Scel GR-LBD chimeric gene followed by a restriction site for I-Scel, the p35S-BAR-nospolyA gene, that is required for to act as a region with homology to the Target Locus, the nos promoter linked to the 5' region of the nptll intron gene followed by a restriction site for I-Scel and the T-DNA right border (figure 7). pAtTargetVector is transferred to agrobacteria and is transformed into the selected Arabidopsis Target Locus lines using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on hygromycin and selfed for two generations. T2 lines homozygous for a single copy of the TargetLocus and TargetVector T-DNAs are selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
Induction of GeneTargeting. T3 Arabidopsis buds of different developmental stages (<0,5 to 1 mm long), are infiltrated under vacuum in a dexamethasone solution (30 μM). (Dexamethosone treatment induces I-Scel activity and both excises the Target Vector from the genome and creates a DSB at the Target Locus. The Target Vector can then recombine via HR at the Target Locus and reconstitute a functional nptll gene (figure 8). Ideally dexamethosone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I-Scel-GR-LBD protein and available as a substrate for HR during meiosis. This is since it is likely that RH is favoured during meiosis. The progeny of those plants and the progeny of dexamethasone untreated plants are analyzed at the seedling stage for resistance to nptll. The frequency of nptll resistant plantlets is obtained under dexamethasone treatment is clearly higher than without dexamethasone. Southern analysis of several nptll resistant plants demonstrated precise reconstitution of a functional nptll gene at the TargetLocus. This demonstrates that gene targeting mediated by the NLS-I- Scel-GR LBD fusion protein is induced by dexamethasone treatment.
Example 7 - Inducible-I-Sce-I expression to mediate gene targeting in maize. It is highly desirable to be able to insert exogenous DNA into a defined site in the plant genome or replace defined DNA sequences 'gene targeting' using homologous recombination. A barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues. This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In maize where transformation rates are low this prevents the routine use of HR for gene targeting. A solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity. This maize line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events. This approach is exemplified in maize using HR-mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into maize. Construction of the Target Locus' Maize Line. Maize was transformed with the construct pBIOS905. This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the pActin-actin intron -BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by an AtSac66polyA sequence and the T- DNA right border (figure 9). This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended. pBIOS905 was transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al. (1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/. (1996). The transformed plants were phenotypically normal. Tranformants (TO) were selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA were selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines did not display kanamycin resistance.
Construction of the Target Vector'.
The binary plasmid pZmTargetVector (pBIOS1320) consists of the following components in the T-DNA; next to the T-DNA left border is a restriction site for I-Scel, the pActin-actin intron-BAR-nospolyA gene, that is required as a selectable marker for plant transformation and to act as a region with homology to the Target Locus, the pCsVMV promoter linked to GFP which is a marker for the T-DNA the pSc4 promoter linked to a FAD2 intron and the 5' region of the nptll intron gene followed by a pCsVMV-NLS-l-SceI GR-LBD chimeric gene, a restriction site for I-Scel and the T-DNA right border (pBIOS1320, figure 10). pBIOS1320 is transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants are phenotypically normal. Tranformants (TO) are selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance. Induction of GeneTargeting. Homozygous TargetLoci and TargetVector Lines are crossed and a proportion of the progeny are treated with a solution of dexamethasone (range around 30μM) applied as drops into the whorl on those plants. Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing (Dexamethasone treatment induces I-Scel activity and both excises the Target Vector from the genome and creates a DSB at the Target Locus. The Target Vector can then recombine via HR at the Target Locus and reconstitute a functional nptll gene (figure 1 1 ). Ideally dexamethasone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I-Scel-GR-LBD protein and available as a substrate for HR during meiosis. This is since it is likely that RH is favoured during meiosis). The progeny of those plants and the progeny of dexamethasone untreated plants are analyzed at the plantlet stage for kanamycin resistance by leaf painting with a solution of kanamycin and via PCR to identify a reconstituted nptll gene. The frequency of nptll resistant plantlets is obtained under dexamethasone treatment is clearly higher than without dexamethasone. Southern analysis of several nptll resistant plants demonstrated precise reconstitution of a functional nptll gene at the TargetLocus. This demonstrates that gene targeting mediated by the NLS-I-Scel-GR LBD fusion protein is induced by dexamethasone treatment.
Example 8 - Construction of intrachromosomal maize reporter lines for inducible HR and NHEJ mediated by inducible I-Scel expression and cis- elimination of the selectable marker and I-Scel genes.
When a marker gene is to be eliminated and a non-inducible I-Scel is to be expressed, it is preferable to control its expression in TO plants such that it is expressed after the period where selectable marker gene expression is required. In this example a dexamethasone inducible promoter is used to control I-Scel expression (Aoyama and Chua (1997)). The application of dexamethosone induces I-Scel expression and the I-Scel gene together with the plant selectable marker is excised from the genome. The following genes are cloned between two I-Scel sites:- pCsVMV-GVG + pSc4-FAD2int-nptll + pUAS-l-Scel. (The GVG gene product is a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex and is described in numerous articles, together with the pUAS promoter. On dexamethasone application this complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of I-Scel.) The GVG+nptll+l-Scel region is cloned as an I-Scel fragment into l-Scel-cut pBIOS881. The 5'GUS-l-Scelr-pCsVMV-l-GVG + pSc4-FAD2int-nptll + pUAS-l- Scel 3'GUS region is transferred via an LR clonase reaction into a GATEWAY binary destination vector that is a pSB1 1 derivative containing an Actin promoter followed by a GATEWAY cassette (figure 12).
The resulting plasmid is transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobactehal strain essentially as described by lshida ef a/.(1996). TO plantlets are either transferred to a medium containing dexamethasone then later transferred to soil. Alternatively, TO plants are watered with or injected with a solution of dexamethasone. Pollen from dexamethasone treated transformed plants is examined histochemically for GUS activity, to check that, in most transformants, GUS staining is observed at a high frequency. The pollen is then used to fertilize a wild-type plant and obtain F1 progeny that express GUS in all tissues but do not contain the I-Scel or nptll genes.
Example 9 - lntrachromosomal recombination and removal of intergenic DNA sequences from a PAT-PAT transgene in Arabidopsis mediated by the dexamethasone-inducible NLS-I-Scel-GR-LBD fusion protein. An Arabidopsis intrachromosomal HR reporter line is used in this example, which contains a T-DNA called PAT-PAT. This T-DNA is composed of two mutated phosphinothhcin acetyltransferase (PAT) genes (Block et al 1987), under the control of a 35S promoter and a Nos terminator. This construct was provided by F. Degroote and G. Picard (UMR CNRS/UBP 6547, unpublished). These mutated PAT genes do not produce the functional enzyme which confers glufosinate resistance. An I-Scel restriction site and an Nptll gene, under the control of a pNos promoter and a Nos terminator are present between the two mutated PAT genes.
The vector pBIOS1316 containing the 35S-NLS-I-Scel-GR-LBD chimaeric gene (example 4, figure 4) was introduced into Agrobacteria, and the Arabidopsis reporter lines were transformed with this Agrobacteria strain essentially as described by Clough et al. (1998). The transformed plants were phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences were selected.
Northern Blots were performed on these T1 plants to investigate the level of transcripts expression.
The T2 seeds were treated as follows:
• 500 seeds were sown on media, containing Glufosinate.
• 500 seeds were sown on a media, containing Glufosinate and dexamethasone 30 μM. Results show clearly a difference with and without dexamethasone (Table I). In the presence of dexamethasone, there are more herbicide resistant plantlets than in the absence of dexamethasone treatment (basal level of intrachromosomal HR).
Such herbicide resistance is due to intrachromosomal HR between the 2 mutated PAT genes reconstituting a functional PAT gene and, in most cases, eliminating the region between the two PAT genes including the nptll gene.
Figure imgf000036_0001
Table I - number of plants resistant to glufosinate (GlufoR) in the presence or in absence of induction with dexamethasone
It is to be noted that, for some other events, the stimulation of intrachromosomal HR in the presence of dexamethasone was as high as 80 fold (not shown).
References
Aggarwal AK, Wah DA. (1998) Curr Opin Struct Biol. Feb;8(1 ):19-25.
An et al. (1986), Plant Physiology, 81 :86-91 Aoyama T, Chua NH. (1997). Plant J.1 1 :605-12.
Araki H et al. (1985) J MoI Biol. 182:191 -203.
Babwah A. V., Waddell CS. (2000). Theor. Appl Genet. 100:802-809.
Bansal KC et al. (1992) Proc Natl Acad Sci U S A. Apr 15;89(8):3654-8.
Baran G, Echt C, Bureau T, Wessler S. (1992). Genetics. Feb;130(2):377-84. Bechtold N, Ellis J, Pelletier G. (1993) C R Acad Sci 111. 316(10) : 1 194-1 199
Bevan et al. (1983), Nature, 304 :184-187
Berg et Berg, (1983), Biotechnology 1 : 417-435
Bevan MW et al. (1992). Biotechnology. 1992 24:367-70
Bleuyard JY, White Cl. (2004) EMBO J. Jan 28;23(2):439-49. Block et al (1987) EMBO J. 6: 2513-2518.
Boevink,P., Chu,P.W. and Keese,P. (1995) Virology 207 (2), 354-361
Boyko A, Zemp F, Filkowski J, Kovalchuk I. (2006) Plant Physiol. Feb 10;
Boyko A et al. (2006) Mutat Res. Jan 25 Boyko A, Filkowski J, Kovalchuk I. (2005) Mutat Res. May 2;572(1 -2):73-83
Broach J R, Guarascio VR, Jayaram M. (1982). Cell. 29:227-34.
Brocard J et al. Nucleic Acids Research, 1998, Vol. 26, No. 17
Chiurazzi M et al. (1996) Plant Cell. 8:2057-66.
Christensen AH, Quail PH. (1996) Transgenic Res. May;5(3):213-8. Choulika A, et al. (1994) C R Acad Sci III. Nov;317(1 1 ):1013-9.
Choulika A, et al. (1995) MoI Cell Biol. Apr;15(4):1968-73.
Chupeau, MC et al (1989). Biotechnology vol.7: pp. 503-508
Clough SJ, Bent AF. (1998). Plant J;16:735-43.
Coppoolse ER et al. (2003) Plant MoI Biol. 51 :263-79. Dekeyser et al. (1988), Plant Physiology, 90 :217-223
De Neve M et al . (1997). Plant J. 1 1 :15-29.
Depicker A et al. (1982) J MoI Appl Genet.1 :561 -73.
Depigny-This D, et al. (1992), Plant MoI Biol.;20(3):467-79.
Dingwall C. et al (1986), Cell Biol. 2, 367-390. Doutriaux et al. (1998) MoI Gen Genet. Feb;257(3):283-91.
Dubouzet et al. (2003) Plant J. 2003 Feb;33(4):751 -63.
Ebinuma H et al. (2005). Methods MoI Biol. 286:237-54.
Eichholtz DA et al. (1987), Somat Cell MoI Genet. Jan;13(1 ):67-76
Erikson O., et al. (2004). Nat Biotechnol. Apr;22(4):455-8 Finer J. (1992) Plant Cell Report 11 : 323-328.
Fromm ME et al. (1986) Nature. Feb 27-Mar 5;319(6056):791 -3..
Goldsbrough AP et al. (1993). Bio/Technology 1 1 :1286-1292.
Gritz L, Davies J. (1983), Gene. Nov;25(2-3):179-88.
Guerche P, et al. (1987), Biochimie. Jun-Jul;69(6-7):621 -8. Hauptmann et al. (1988), Plant Physiology, 86 :602-606
Hoess RH, et al. (1982) Proc Natl Acad Sci U S A. 79:3398-402.
Hohn B, Levy AA, Puchta H. (2001 ). Curr Opin Biotechnol.12:139-43. lida S, Terada R. (2005) Plant MoI Biol. 2005 Sep;59(1 ):205-19. lshida Y et al. (1996) Nature Biotechnol. 14, 745-50.
Jacquier, A. and Dujon, B. (1985). Cell 41 , 383-394.
Jefferson, R.A., et al. (1987). EMBO J 6, 3901 -3907.
Jefferson RA. (1989). The GUS reporter gene system. Nature. 342:837-8. Jenkins E et al. (1999) Plant Cell Environ 22: 159-167
Kaiser J (2005) Putting the finger on gene repair. Science 310: 1894-1896.
Kalderson D. et al. (1984) Nature 31 1 , 33-38.
Kathiresan, A. et al. (2002) Sex. Plant Reprod. 14, 257-267
Kay et al. (1987), Science, 236 :1299-1302 Kerbach S, Lorz H, Becker D. (2005) Theor Appl Genet. 1 1 1 :1608-16.
Klimyuk Vl, Jones J D. (1997) Plant J. Jan;1 1 (1 ):1 -14.
Kizis D, Pages M. (2002) Plant J. Jun;30(6):679-89.
Koo JC et al. (2004) Plant J. Feb;37(3):439-48.
Komari T et al. (1996) Plant J. 10:165-74. Lanford R.E., Butel J. S., (1984) Cell 37, 801 -813
Lee SC et al. (2004) MoI Cells. Aug 31 ;18(1 ):107-14.
Lyznik LA, Rao KV, Hodges TK. (1996) Nucleic Acids Res. 24:3784-9.
Mader S, White JH, (1993) Proc Natl Acad Sci USA. 90(12): 5603-5607
Marshall P, Lemieux C. (1991 ) Gene. Aug 15;104(2):241 -5. Matsuoka M et al. (1994) Plant J. Sep;6(3):31 1 -9.
McElroy,D. Zhang,W. Cao,J. Wu, R. (1990) Plant Cell 2(2):163
McElroy D, Blowers AD, Jenes B, Wu R. (1991 ) MoI Gen Genet. 1 :150-60.
Meijer EG et al. (1991 ), Plant MoI Biol. 1991 May;16(5):807-20.
Miesfeld R. et al. (1986) Cell 46 (3), 389-399. Miki B., McHugh S. (2004) Journal of Biotechnology 107 : 193-232
Monnat Jr et al. (1999) Biochem Biophys Res Commun. Feb 5;255(1 ):88-93.
Morita R et al. (2003) Plant Cell Physiol. 44:637-42.
Moore I et al. (2006) Plant J. 45:651 -83.
Mukhopadhyay A, et al. (2004) Proc Natl Acad Sci USA.;101 (16):6309-14. Mundy J, Chua NH. (1988) EMBO J. 1988 Aug;7(8):2279-86.
Nielsen K., et al. (1999) Physiological and Molecular Plant Pathology 54,1 -12
Orel N, Kyryk A, Puchta H. (2003). Plant J. 35:604-12.
Padidam M. (2003) Curr Opin Plant Biol. Apr;6(2):169-77. Pellegrineschi A et al. (2004) Genome. Jun;47(3):493-500.
Pwee K-H and Grey JC (1990) Plant Journal 3, 4370-4449
Plessis A, et al. (1992). Genetics 130, 451 -60.
Potenza C, et al. (2004) In Vitro Cell. Dev. Biol. 40:1 -22. Pruneda-Paz JL, et al. (2004) J Steroid Biochem MoI Biol ;88(1 ):91 -100
Puchta H. (2003). J Plant Physiol. 160:743-54.
Que Q. (2005) 47th Maize Genetics Conference, March 10-13, 2005
Rabbani MA et al. (2003) Plant Physiol. Dec;133(4):1755-67.
Raeymaekers L. (1993) Anal Biochem. Nov 1 ;214(2):582-5. Radhakrishnan P, Srivastava V. (2005) Plant Cell Rep. 23:721 -6.
Roslan HA et al. (2001 ) Plant J. Oct;28(2):225-35.
Russell DA, Fromm ME. (1997) Transgenic Res. Mar;6(2):157-68.
Saijo Y et al. (2000) Plant J. Aug;23(3):319-27.
Saidi Y et al. (2005) Plant MoI Biol. 2005 Nov;59(5):697-71 1. Scott L, LaFoe D, Weil CF. (1996) Genetics. Jan;142(1 ):237-46.
Sambrook J. et Russell D. W. (2001 ) "Molecular Cloning-A laboratory Manual, third edition", chapitre 1.1 , Editeur. : CSHL Press
Schena et al. (1991 ) Proc Natl Acad Sci USA, Vol. 88, No. 23, pp 10421 -25
Severin K, Schoffl F. (1990) Plant MoI Biol. Dec;15(6):827-33. Shen Q, Uknes SJ, Ho TH. (1993) J Biol Chem. Nov 5;268(31 ):23652-60.
Siebert R, Puchta H. (2002). Plant Cell.14:1 121 -31.
Silva GH et al. (1999) J MoI Biol. Mar 5;286(4):1 123-36.
Scott L., Daniel L., CF. Weil (1996) Genetics 142:237-246.
Scutt CP, Zubko E, Meyer P. (2002) Biochimie. 84:11 19-26. Stevens R et al. (2004). Plant Cell. Jan;16(1 ):99-1 13. Epub 2003 Dec 5.
Straub PF, Shen Q, Ho TD. (1994) Plant MoI Biol. Oct;26(2):617-30.
Swoboda P, GaI S, Hohn B, Puchta H. (1994) EMBO J. 13:484-9.
Takahashi R, Joshee N, Kitagawa Y. (1994) Plant MoI Biol. Oct;26(1 ):339-52.
Terada R et al. (2004) Plant Cell Rep. Apr;22(9):653-9. Epub 2004 Jan 23. Vancanneyt G et al. (1990) MGG 220:245-250
Verdaguer B et al. (1996). Plant MoI Biol. 6:1 129-39.
Vergunst AC et al. (2000) Chromosoma.109:287-97.
Vilardell J et al. (1990) Plant MoI Biol. Mar;14(3):423-32. Wang et al. (1997) Nucleic Acids Res. Oct 1 ;25(19):3767-76.
Wang R, Zhou X, Wang X (2003) Transgenic Res. 2003 Oct;12(5):529-40.
White J et al. (1990) Nucleic Acids Res. 1990 Feb 25;18(4):1062.
White J (1997) Adv Pharmacol. 1997;40:339-67 Wright DA, et al. (2005) Plant J. Nov;44(4):693-705.
Xu Y et al. (1995) Plant MoI Biol Mar;27(5):1060.
Yamaguchi-Shinozaki K, et al. (1993) MoI Gen Genet. Jan;236(2-3):331 -40.
Yoshida K, et al. (1995) Appl Microbiol Biotechnol. Dec;44(3-4):466-72.
Young LW et al. (2005) Genome. Jun;48(3):547-55. Zhang W et al. (2003). Theor Appl Genet. 107:1 157-68.
Zubko E, Scutt C, Meyer P. (2000) Nat Biotechnol. 2000 Apr;18(4):442-5.
Zuo J, Chua NH. (2000) Curr Opin Biotechnol. Apr;11 (2):146-51.

Claims

1. An isolated nucleic acid comprising a nucleic acid coding for a restriction enzyme capable of cutting a DNA sequence at a predetermined site, fused with a nucleic acid coding for a rat glucocorticoid receptor depicted in SEQ ID N0 I .
2. The isolated nucleic acid of claim 1 , wherein said restriction enzyme is a meganuclease, cutting at a predetermined site of at least 15 bases.
3. The isolated nucleic acid of claim 2, wherein said meganuclease is chosen in the group consisting of I-Scel, I-Crel, I-Ceul, Pl-Scel, and I- Dmol.
4. The isolated nucleic acid of any of claims 1 to 3, wherein said nucleic acid coding for a rat glucocorticoid receptor is fused a the 3' end of said nucleic acid coding for a restriction enzyme.
5. The isolated nucleic acid of any of claims 1 to 4, further comprising at least one sequence coding for a nuclear localisation signal.
6. The isolated nucleic acid of any of claims 1 to 5, having SEQ ID N° 8.
7. An expression cassette comprising a promoter operably linked to the isolated nucleic acid of any of claims 1 to 6, wherein said promoter is inducible by a steroid.
8. A transgenic plant transformed with and comprising the nucleic acid of any of claims 1 to 6, or containing the expression cassette of claim 7.
9. A restriction enzyme coded by the nucleic acid of any of claims 1 to 6.
10. A method for promoting a genomic double strand break at a predetermined restriction site R in the genome of an organism, comprising the steps of transforming said organism with the nucleic acid of any of claims 1 to 6, wherein said restriction enzyme is capable of cutting at said predetermined restriction site R, and applying dexamethasone to cells of said transformed organism in order to promote genomic double strand break at said predetermined restriction site R.
1 1.The method of claim 10, wherein said organism is a plant.
12. A method for obtaining an organism in the genome of which a specific DNA fragment has been excised, comprising the steps of: a. providing an organism comprising, in its genome, a polynucleotide X comprising said DNA fragment, wherein said polynucleotide comprises at least a restriction site R, rare or absent in the genome of said plant, at its 5' or 3' extremity, b. providing, to cells of said organism, the restriction enzyme of claim 9, that recognizes and cuts at said restriction site(s) R and applying dexamethasone in order to generate a double strand break(s) at said site(s) thereby obtaining an organism wherein said DNA fragment has been excised after cutting at said restriction site(s) R and repair of the lesion generated by the double strand break(s).
13. The method of claim 12 wherein said organism is a plant.
14. The method of claim 12 or 13, wherein said polynucleotide X comprises two restrictions sites R, one being located at its 5' end, the other being at the 3' end.
15. The method of any of claims 12 to 14, wherein said polynucleotide X is flanked by two homologous regions Y and Y'.
16. A method for integrating a DNA sequence Z at a predetermined location within the genome of an organism comprising the steps of a. providing an organism comprising, at said predetermined location in its genome, a restriction site R, that is rare or normally absent in the genome of said organism, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to cells of said organism a nucleic acid comprising said DNA sequence Z flanked by sequences Y3' and Y5' respectively at its 3' and 5' ends, c. providing to said cells said restriction enzyme of claim 8, and applying dexamethasone in order to induce a double strand break at said restriction site R, thereby leading to integration of said DNA sequence Z within the organism genome by homologous recombination between said Y3' and Y5' sequences.
17. The method of claim 16, wherein said organism is a plant.
18. The method of any of claims 12 to 17, wherein said restriction enzyme is provided by expression, within cells of said organism, of a sequence coding said enzyme.
19. The method of any of claims 12 to 17, wherein said restriction enzyme is provided by crossing a transgenic organism containing said polynucleotide X, with another transgenic organism containing a sequence coding for said restriction enzyme of claim 9.
20. The method of any of claims 10 to 19, wherein said dexamethasone is applied during or just before meiosis.
PCT/EP2007/054693 2006-05-18 2007-05-15 Method for performing homologous recombination in plants Ceased WO2007135022A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP07765265A EP2018434B1 (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants
DE602007012858T DE602007012858D1 (en) 2006-05-18 2007-05-15 METHOD FOR IMPLEMENTING HOMOLOGOUS RECOMBINATIONS IN PLANTS
AU2007253458A AU2007253458B2 (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants
AT07765265T ATE500337T1 (en) 2006-05-18 2007-05-15 METHOD FOR CARRYING OUT HOMOLOGOUS RECOMBINATIONS IN PLANTS
CA2650548A CA2650548C (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants
US12/301,358 US8273956B2 (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants
US13/619,082 US8455715B2 (en) 2006-05-18 2012-09-14 Method for performing homologous recombination in plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP06114137 2006-05-18
EP06114137.0 2006-05-18

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/301,358 A-371-Of-International US8273956B2 (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants
US13/619,082 Division US8455715B2 (en) 2006-05-18 2012-09-14 Method for performing homologous recombination in plants

Publications (1)

Publication Number Publication Date
WO2007135022A1 true WO2007135022A1 (en) 2007-11-29

Family

ID=37075092

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2007/054693 Ceased WO2007135022A1 (en) 2006-05-18 2007-05-15 Method for performing homologous recombination in plants

Country Status (7)

Country Link
US (2) US8273956B2 (en)
EP (2) EP2316954B1 (en)
AT (1) ATE500337T1 (en)
AU (1) AU2007253458B2 (en)
CA (1) CA2650548C (en)
DE (1) DE602007012858D1 (en)
WO (1) WO2007135022A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008145731A1 (en) * 2007-05-31 2008-12-04 Basf Plant Science Gmbh Method of excising a nucleic acid sequence from a plant genome
WO2011003850A1 (en) * 2009-07-10 2011-01-13 Enza Zaden Beheer B.V. Method for providing fertile plants via induction of bbm during transformation
WO2011064750A1 (en) 2009-11-27 2011-06-03 Basf Plant Science Company Gmbh Chimeric endonucleases and uses thereof
WO2011064736A1 (en) 2009-11-27 2011-06-03 Basf Plant Science Company Gmbh Optimized endonucleases and uses thereof
DE112010004584T5 (en) 2009-11-27 2012-11-29 Basf Plant Science Company Gmbh Chimeric endonucleases and applications thereof
WO2013050593A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013050611A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013050318A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013053711A1 (en) 2011-10-10 2013-04-18 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013053686A1 (en) 2011-10-10 2013-04-18 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
EP2612918A1 (en) 2012-01-06 2013-07-10 BASF Plant Science Company GmbH In planta recombination
EP2687605A1 (en) 2012-07-19 2014-01-22 Biogemma Method for performing homologous recombination
WO2017134137A1 (en) * 2016-02-05 2017-08-10 Polygene Ag Glucocorticoid-based gene regulation system
EP4311430A1 (en) 2022-07-28 2024-01-31 Limagrain Europe Chlorotoluron tolerance gene and methods of use thereof

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130071884A1 (en) 2009-11-06 2013-03-21 Agrivida, Inc. Plants expressing cell wall degrading enzymes and expression vectors
WO2011154158A1 (en) * 2010-06-09 2011-12-15 Bayer Bioscience N.V. Methods and means to modify a plant genome at a nucleotide sequence commonly used in plant genome engineering
CN103119169B (en) * 2010-06-09 2018-11-20 拜尔作物科学公司 Methods and tools for modifying plant genomes in nucleotide sequences commonly used in plant genome engineering
US10443068B2 (en) 2010-06-25 2019-10-15 Agrivida, Inc. Plants with engineered endogenous genes
US9598700B2 (en) 2010-06-25 2017-03-21 Agrivida, Inc. Methods and compositions for processing biomass with elevated levels of starch
CN106244622B (en) 2011-03-07 2020-06-12 谷万达公司 Expression cassette and expression vector for expressing multiple proteins in engineering plant, method for preparing engineering plant and method for producing soluble sugar
WO2014104878A1 (en) 2012-12-27 2014-07-03 Keygene N.V. Method for removing genetic linkage in a plant
JP6521669B2 (en) * 2014-02-25 2019-05-29 国立研究開発法人農業・食品産業技術総合研究機構 Plant cell in which mutation is introduced into target DNA, and method for producing the same
EP3075741A1 (en) 2015-03-31 2016-10-05 Biogemma Method of plant improvement using aspartate kinase - homoserine dehydrogenase
EP3115458A1 (en) 2015-07-06 2017-01-11 Genective Method for gene optimization
CN109937209A (en) 2016-10-10 2019-06-25 利马格兰集团 Encode the nucleic acid and application method of the SM1 resistance to orange wheat flower mosquito
EP3708669A1 (en) 2019-03-13 2020-09-16 Genective Pesticidal genes and methods of use
EP3808170A1 (en) 2019-10-17 2021-04-21 Bejo Zaden B.V. Lactuca sativa resistance to bremia lactucae
JP2022087881A (en) * 2020-12-02 2022-06-14 トヨタ自動車株式会社 Plasmid for transformation, method for producing transformant using the same, and transformation method
CA3259168A1 (en) 2022-06-30 2024-01-04 Genective Gpp(cry)34-like insecticidal proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997031108A1 (en) * 1996-02-20 1997-08-28 Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) Modified nuclear glucocorticoid receptor, fusion protein, and dna fragments coding for said receptor and said fusion protein
WO2005049842A2 (en) * 2003-11-18 2005-06-02 Bayer Bioscience N.V. Improved targeted dna insertion in plants

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ217113A (en) 1985-08-07 1988-06-30 Monsanto Co Production of eucaryotic plants which are glyphosate resistant, vectors (transformation and expression), chimeric gene and plant cells
US5792632A (en) 1992-05-05 1998-08-11 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
FR2734842B1 (en) 1995-06-02 1998-02-27 Rhone Poulenc Agrochimie DNA SEQUENCE OF A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE AND OBTAINING PLANTS CONTAINING A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE, TOLERANT TO CERTAIN HERBICIDES
GB9708542D0 (en) 1997-04-25 1997-06-18 Nickerson Biocem Ltd Resistance marker
US6476297B1 (en) 1998-07-10 2002-11-05 The Research Foundation Of State University Of Ny Meiosis promoter
CA2420555C (en) 2000-08-24 2012-10-23 The Scripps Research Institute Stress-regulated genes of plants, transgenic plants containing same, and methods of use
DE10131786A1 (en) 2001-07-04 2003-01-16 Sungene Gmbh & Co Kgaa Recombination systems and methods for removing nucleic acid sequences from the genome of eukaryotic organisms
EP1803813A3 (en) 2001-11-19 2007-11-14 Riken An environmental stress-responsive promoter and an gene encoding environmental stress-responsive transcriptional factor
EP1614754A1 (en) 2004-07-06 2006-01-11 Biogemma Method for enhancing gene expression in plants

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997031108A1 (en) * 1996-02-20 1997-08-28 Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) Modified nuclear glucocorticoid receptor, fusion protein, and dna fragments coding for said receptor and said fusion protein
WO2005049842A2 (en) * 2003-11-18 2005-06-02 Bayer Bioscience N.V. Improved targeted dna insertion in plants

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BROCARD JACQUES ET AL: "A chimeric Cre recombinase inducible by synthetic, but not by natural ligands of the glucocorticoid receptor", NUCLEIC ACIDS RESEARCH, IRL PRESS LTD., OXFORD, GB, vol. 26, no. 17, 1998, pages 4086 - 4090, XP002144710, ISSN: 0305-1048 *
CHANDRASEGARAN S ET AL: "CHIMERIC RESTRICTION ENZYMES: WHAT IS NEXT?", BIOLOGICAL CHEMISTRY, vol. 380, no. 7/8, July 1999 (1999-07-01), pages 841 - 848, XP008019125, ISSN: 1431-6730 *
DURAI SUNDAR ET AL: "Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells", NUCLEIC ACIDS RESEARCH, vol. 33, no. 18, 2005, pages 5978 - 5990, XP002403200, ISSN: 0305-1048 *
JOUBES JEROME ET AL: "Conditional, recombinase-mediated expression of genes in plant cell cultures.", PLANT JOURNAL, vol. 37, no. 6, March 2004 (2004-03-01), pages 889 - 896, XP002403199, ISSN: 0960-7412 *
WRIGHT DAVID A ET AL: "High-frequency homologous recombination in plants mediated by zinc-finger nucleases", PLANT JOURNAL, vol. 44, no. 4, November 2005 (2005-11-01), pages 693 - 705, XP002403198, ISSN: 0960-7412 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008145731A1 (en) * 2007-05-31 2008-12-04 Basf Plant Science Gmbh Method of excising a nucleic acid sequence from a plant genome
JP2012532587A (en) * 2009-07-10 2012-12-20 エンザ・ザデン・ビヘーア・ベスローテン・フエンノートシャップ Method for providing fertile plants by induction of BBM during transformation
US9212369B2 (en) 2009-07-10 2015-12-15 Enza Zaden Beheer B.V. Method for providing fertile plants via induction of BBM during transformation
WO2011003850A1 (en) * 2009-07-10 2011-01-13 Enza Zaden Beheer B.V. Method for providing fertile plants via induction of bbm during transformation
EP2504429A4 (en) * 2009-11-27 2013-06-05 Basf Plant Science Co Gmbh CHIMERIC ENDONUCLEASES AND USES THEREOF
EP2504430A4 (en) * 2009-11-27 2013-06-05 Basf Plant Science Co Gmbh CHIMERIC ENDONUCLEASES AND USES THEREOF
DE112010004584T5 (en) 2009-11-27 2012-11-29 Basf Plant Science Company Gmbh Chimeric endonucleases and applications thereof
DE112010004582T5 (en) 2009-11-27 2012-11-29 Basf Plant Science Company Gmbh Optimized endonucleases and applications thereof
CN102686726A (en) * 2009-11-27 2012-09-19 巴斯夫植物科学有限公司 Chimeric endonucleases and uses thereof
WO2011064750A1 (en) 2009-11-27 2011-06-03 Basf Plant Science Company Gmbh Chimeric endonucleases and uses thereof
CN105384827A (en) * 2009-11-27 2016-03-09 巴斯夫植物科学有限公司 Chimeric endonucleases and uses thereof
DE112010004583T5 (en) 2009-11-27 2012-10-18 Basf Plant Science Company Gmbh Chimeric endonucleases and applications thereof
WO2011064736A1 (en) 2009-11-27 2011-06-03 Basf Plant Science Company Gmbh Optimized endonucleases and uses thereof
US10316304B2 (en) 2009-11-27 2019-06-11 Basf Plant Science Company Gmbh Chimeric endonucleases and uses thereof
US9404099B2 (en) 2009-11-27 2016-08-02 Basf Plant Science Company Gmbh Optimized endonucleases and uses thereof
WO2013050593A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013050318A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013050611A1 (en) 2011-10-07 2013-04-11 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013053711A1 (en) 2011-10-10 2013-04-18 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013053686A1 (en) 2011-10-10 2013-04-18 Basf Plant Science Company Gmbh Method of producing plants having increased resistance to pathogens
WO2013102875A1 (en) 2012-01-06 2013-07-11 Basf Plant Science Company Gmbh In planta recombination
EP2612918A1 (en) 2012-01-06 2013-07-10 BASF Plant Science Company GmbH In planta recombination
WO2014013056A1 (en) 2012-07-19 2014-01-23 Biogemma Method for performing homologous recombination
EP2687605A1 (en) 2012-07-19 2014-01-22 Biogemma Method for performing homologous recombination
WO2017134137A1 (en) * 2016-02-05 2017-08-10 Polygene Ag Glucocorticoid-based gene regulation system
EP4311430A1 (en) 2022-07-28 2024-01-31 Limagrain Europe Chlorotoluron tolerance gene and methods of use thereof
WO2024023210A1 (en) 2022-07-28 2024-02-01 Limagrain Europe Chlorotoluron tolerance gene and methods of use thereof

Also Published As

Publication number Publication date
US8273956B2 (en) 2012-09-25
EP2316954A1 (en) 2011-05-04
AU2007253458A1 (en) 2007-11-29
CA2650548C (en) 2015-12-22
CA2650548A1 (en) 2007-11-29
DE602007012858D1 (en) 2011-04-14
EP2018434A1 (en) 2009-01-28
EP2018434B1 (en) 2011-03-02
AU2007253458B2 (en) 2013-04-04
US20090293155A1 (en) 2009-11-26
EP2316954B1 (en) 2013-10-30
ATE500337T1 (en) 2011-03-15
US20130024998A1 (en) 2013-01-24
US8455715B2 (en) 2013-06-04

Similar Documents

Publication Publication Date Title
EP2316954B1 (en) Method for performing homologous recombination in plants
CN102812034B (en) Targeted Genome Modification
EP2415873B1 (en) Optimized non-canonical zinc finger proteins
TWI424061B (en) Method for homologous recombination of zinc finger nuclease vector
CN101668856B (en) Optimized non-canonical zinc finger proteins
US20150189844A1 (en) Method for performing homologous recombination
EP2258859A1 (en) Method for performing homologous recombination
HK1195777A (en) Optimized non-canonical zinc finger proteins
HK1142096A (en) Optimized non-canonical zinc finger proteins
HK1178907A (en) Targeted genomic alteration

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07765265

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2007253458

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2650548

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007765265

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2007253458

Country of ref document: AU

Date of ref document: 20070515

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12301358

Country of ref document: US