WO2007135022A1 - Method for performing homologous recombination in plants - Google Patents
Method for performing homologous recombination in plants Download PDFInfo
- Publication number
- WO2007135022A1 WO2007135022A1 PCT/EP2007/054693 EP2007054693W WO2007135022A1 WO 2007135022 A1 WO2007135022 A1 WO 2007135022A1 EP 2007054693 W EP2007054693 W EP 2007054693W WO 2007135022 A1 WO2007135022 A1 WO 2007135022A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- organism
- plant
- nucleic acid
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
- C07K2319/715—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16 containing a domain for ligand dependent transcriptional activation, e.g. containing a steroid receptor domain
Definitions
- the invention relates to modified restriction enzymes capable of being used for promoting homologous recombination in organisms (mammals and plants), in particular plants, making it possible to either target gene integration or excise unwanted DNA sequences in the genome of said organisms.
- Homologous recombination is useful for specifically inserting sequences at a given target site in a genome. It can also be used to perform allele replacement. This can be used for curing genetic disease in humans, for example, or for plant improvement.
- DNA sequences As an example, in plants, this can be used for removing the selectable marker used in plant transformation, or for the irreversible controlled activation or inactivation of transgenes.
- Homologous recombination when integrating a DNA sequence in a genome also solves the problem residing in the random pattern of integration of the heterologous gene into said genome. Indeed, it is known that such random integration may lead to a wide variation in the level of expression of the genes among different transformed organisms after regeneration, thus increasing the cost and lengthening the selection of interesting transformants. Furthermore, it is always possible that these heterologous genes are integrated within endogenous genes, thus disrupting their expression. This is a real problem when these endogenous genes are necessary for the maturation, differentiation and/or viability of the cells or organism.
- Gene targeting uses the selection of integration events obtained by homologous recombination between DNA sequences present in the genome of a cell or organism and introduced heterologous DNA sequences. This provides a possibility of controlling the site of integration of these heterologous DNA sequences.
- Homologous recombination is nevertheless difficult to achieve as mammalian and plant cells have also a greater propensity to mediate nonhomologous recombination. This is in particular true for plant cells. This bad ability to mediate homologous recombination events is also problematic when the transformed organism is difficult to transform, in particular when the in vitro culture or regeneration steps of the cells is difficult.
- homologous recombination can be used for inserting new heterologous sequences, but also for eliminating, removing or substituting sequences (creating new alleles) within the organism genome.
- TK thymidine kinase
- DSB double strand break
- the inventors also postulate that the efficiency of homologous recombination may increase depending on the state of the cell. In particular, it is postulated that the efficiency will be better when the cell is at the meiosis stage.
- homologous recombination can also be used as a tool for removing exogenous DNA sequences that do not contribute to the new phenotype conferred by the transgene, such as selectable marker genes that are necessary for plant transformation and particularly those marker genes that confer herbicide or antibiotic resistance.
- DSB double strand break
- controllable / inducible enzyme of the invention responds to this question.
- the present invention relates to an isolated nucleic acid comprising a nucleic acid coding for a restriction enzyme capable of cutting a DNA sequence at a predetermined site, fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD) (Miesfeld et al. 1986) depicted in SEQ ID N° 1 (protein) coded by SEQ ID N° 2 (nucleic acid).
- GR Glucocorticoid Receptor
- LBD Ligand Binding Domain
- the GR LBD sequence used in the invention contains a first NLS (nuclear Localization Signal, NL1 ) in the LBD sequence and a second incomplete NLS (NL2) upstream of the LBD sequence.
- NLS nuclear Localization Signal
- a preferred NLS is the SV40 Large T antigen NLS (Dingwall et al. 1986, Lanford and Butel 1984, Kalderson et al. 1984) depicted in SEQ ID N° 3 (protein) coded by sequence ID N°4 (nucleic acid) but other NLS sequences can be used.
- Any restriction enzyme may be used for the purpose of the invention.
- Obtaining a fused protein is performed by classical molecular biology methods as described in Sambrook.
- the restriction enzyme does not have many cutting sites in the genome of the host.
- the restriction enzyme of the invention recognizes and cuts a site that is at least 15 bases, and preferably at least 18 bases.
- the restriction enzyme is called a meganucleases, which is by definition a sequence-specific endonuclease with large (>12 bp) recognition sites.
- said meganuclease is preferably I-Scel, described as SEQ ID N°5 (protein) and 6 (nucleic acid). Nevertheless, other meganucleases may also be used, such as HO, or the meganuclease described in Epinat et al (Nucleic Acids Research, 2003, Vol. 31 , No.
- I-Crel Wang et al (1997) Nucleic Acids Res., 25, 3767-3776) or I-Ceul (Marshall et al (1994) Eur. J. Biochem., 220, 855-859), which function as homodimers, or larger proteins bearing two (do)decapeptide motifs, such as I-Scel (Jacquier et al (1985) Cell, 41 , 383-394), Pl-Scel (Gimble, et al (1996) J. MoI. Biol., 263, 163-180) and I-Dmol (Dalgaard et al. (1993) Proc. Natl Acad. Sci. USA, 90, 5414-5417).
- the construct of the invention can be made with any restriction enzyme or meganuclease that is currently known, once its sequence has been isolated, as it is obtained through completely classical methods of molecular biology.
- the isolated nucleic acid of the invention is such that said nucleic acid coding for a rat glucocorticoid receptor is fused at the 3' end of said nucleic acid coding for a restriction enzyme.
- said nucleic acid coding for a rat glucocorticoid receptor is fused at the 5' end of said nucleic acid coding for a restriction enzyme.
- the isolated nucleic acid of the invention codes for a protein having SEQ ID N°7. It is preferred that this nucleic acid has SEQ ID N°8.
- the invention also relates to an expression cassette comprising a promoter operably linked to the nucleic acid of the invention.
- a promoter operably linked to the nucleic acid of the invention. Any promoter is suitable, and some are described below.
- the restriction enzyme of the invention is useful for improving homologous recombination in organisms such as cells, which can be issued from mammals (rodents such as rats and mice, and human cells included, when performed in vitro), or in whole organisms such as rodents, but also pigs, cattle, cats and dogs.
- mammals rodents such as rats and mice, and human cells included, when performed in vitro
- whole organisms such as rodents, but also pigs, cattle, cats and dogs.
- a mutant GR LBD (Brocard et al., 1998) which binds synthetic ligands such as dexamethasone but not natural GR ligands is most preferably used.
- the invention can also be performed on whole plants, and the invention also encompasses a transgenic plant transformed with the nucleic acid of the invention.
- said "plant” is a monocotyledon or a dicotyledonous.
- said plant is a monocotyledon, and is preferably wheat or maize. In the most preferred embodiment, said plant is maize.
- the modification to the restriction enzyme implicates that it is not active without an external stimulus (application of dexamethasone), or less active than the non-modified restriction enzyme. Upon application of this hormone, the restriction enzyme enters the nucleus of the cells, and performs the double strand break at its site of recognition.
- the invention also encompasses a restriction enzyme coded by the nucleic acid of the invention.
- the invention also relates to a method for promoting a genomic double strand break at a predetermined restriction site R in the genome of a plant, comprising the steps of transforming said plant with an nucleic acid coding for a restriction enzyme fused with a nucleic acid coding for a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), wherein said restriction enzyme is capable of cutting at said predetermined restriction site R, and applying dexamethasone to cells of said transformed plant in order to promote genomic double strand break at said predetermined restriction site R.
- the invention also relates to a method for obtaining a plant in the genome of which a specific DNA fragment has been excised, comprising the steps of: a.
- a plant comprising, in its genome, a polynucleotide X comprising said DNA fragment, wherein said polynucleotide comprises at least a restriction site R, rare or absent in the genome of said plant, at its 5' or 3' extremity, b. providing to cells of said plants the restriction enzyme of the invention, that recognizes and cuts at said restriction site(s) R and applying dexamethasone in order to generate a double strand break(s) at said site(s) thereby obtaining a plant wherein said DNA fragment has been excised after cutting at said restriction site(s) R and repair of the lesion generated by the double strand break(s).
- one or two R sites are used. When two sites are used, they preferably flank the X polynucleotide (Ae. they are located at its 3' and 5' ends).
- the DNA fragment to be excised may have been introduced in the plant by transforming said plant with a vector containing said fragment, by methods known in the art, such as Agrobacterium transformation.
- said polynucleotide X is flanked by two homologous regions Y and Y'.
- the Y and Y' sequences are said to be "homologous” if they present at least 90%, more preferably 95% even more preferably 100% identity, over at least 50, more preferably 100 consecutive nucleotides (nt) even more preferably 200 or 500 nt, even more preferably 1000 nt, even more preferably
- R means a restriction site of an endonuclease which has a low ( ⁇ 0.1 %, more preferably ⁇ 0.05 or 0.01 %) probability to be present in the genome of the target organism. In maize, it is believed that such restriction site is at least 15 nucleotides long, more preferably equal or greater to 18 nucleotides long.
- I-Sce I from an mobile intron of Saccharomyces cerevisiae (Jacquier and Dujon 1985, Plessis et al., 1992), which has a recognition site of 18 bp, as well as other meganucleases such as I-Dmol, I-Crel, I-Ceul, I-Ppol, Pl-Scel, (Aggarwal and Wah 1998, Wang et al., 1997, Monnat et al., 1999, Silva et al., 1999, Marshall et al., 1991 ), this list being non limitative.
- the preferred enzyme is I-Scel, having the sequence SEQ ID N° 5. As its cutting site is 18 bp long, this restriction enzyme has a low probability of cutting DNA in plants, and in maize in particular.
- the I-Scel enzyme has been isolated from Saccharomyces cerevisiae and double strand breaks induced by this enzyme increase the rate of homologous recombination in mammalian cells (Choulika et ai, 1994, 1995 and WO9614408).
- DSB Double strand break
- the repair of the lesion generated by the DSB refers to the mechanism by which a re-attachment may occur between the free strands generated by "cut-ends”. This re-attachment may occur at the site or next to the site of the "cut-end” but also at a more distal place to the DSB. This may be performed by homologous recombination (HR) or by non-homologous end-joining (NHEJ).
- said polynucleotide X comprises two restrictions sites R, one being located at its 5' end the other being at the 3' end, and there is no homologous region Y and Y'.
- said polynucleotide X comprises two restrictions sites R, one being located at its 5' end and the other being at its 3' end, and is flanked by homologous regions Y and Y'.
- said polynucleotide X comprises only one restriction site R at its 5' or 3' end and is flanked by homologous regions Y and Y'.
- said restriction enzyme may be provided by the expression, within cells of said plant, of a sequence coding for said enzyme.
- Methods for the expression of proteins from DNA sequences in plants are well known to persons skilled in the art.
- a sequence coding for this enzyme may be present in the cell under the control of a constitutive, tissue specific, developmentally regulated, inducible or meiosis promoter.
- constitutive promoters useful for expression include the 35S promoter or the 19S promoter (Kay et al., 1987), the rice actine promoter (McElroy et al., 1990), the pCRV promoter (Depigny-This et al., 1992), the CsVMV promoter (Verdaguer et al., 1998), the ubiquitin 1 promoter of maize (Chhstensen et al., 1996), the regulatory sequences of the T-DNA of Agrobacterium tumefaciens, including mannopine synthase, nopaline synthase, octopine synthase. Promoters may come from the same species or from another species
- “heterologous promoters” Although some promoters may have the same pattern of regulation when there are used in different species, it is often preferable to use monocotyledonous promoters in monocotyledons and dicotyledonous promoters in dicotyledonous plants. "Meiosis promoter” means a promoter which may allow the transcription of the operably linked sequence within cells undergoing "meiosis”.
- meiosis promoter examples include the promoter Lim10 from Lilium longifolium (Morita et al., 2003, see SEQ ID N° 13), AtXrcc3 (Bleuyard and White 2004), ⁇ /CDC45 (Stevens et al., 2004), /4flDMC1 from Arabidopsis thaliana or OsDMCI from Oriza sativa, (Klimyuk and Jones, 1997 ; Doutriaux et al., 1998 ; Kathiresan et al., 2002), AtMEM (US 6,476,297).
- Such a meiosis promoter should be ideally meiosis-specific or preferentially active during meiosis.
- expression of said restriction enzyme may be inducible.
- inducible it is meant that the enzyme only becomes active in response to an external stimulus. This stimulus may be a chemical or mechanical stimulus.
- the sequence encoding said restriction enzyme is under the control of an inducible promoter.
- the inducible promoter may be induced by a stress or a chemical agent.
- Inducible promoters may be induced by pathogens or wounding, more preferably they are induced by abiotical stress like cold, heat, UV light, high salt and water deficit. Promoters useful for targeted expression in trangenesis are reviewed in Potenza et al., 2004.
- Some abiotic stress promoters are the Arabidospsis thaliana or Oriza sativa DREB genes promoters (Dubouzet et al., 2003 ; Lee et al., 2004 ; Pellegrineschi et al., 2004) ; the Oriza sativa SISAP1 , CDPK7 or WSI gene promoters (Mukhopadhyay et ai, 2004 ; Saijo et ai, 2000; Takahashi et al., 1994) the A. thaliana rd29 gene promoters (Yamaguchi- Shinozaki and Shinozaki 1993).
- Some plant heat inducible promoters may also be used /?sp18.2 or hsp ⁇ O ⁇ from A. thaliana (Yoshida et al., 1995 ; Young et al., 2005 ), /?sp17.6 or hspM.2, from Glycine max (Severin and Schoffl, 1990 ; Saidi et al., 2005).
- DNA microarrays have been used to identify stress regulated sequences (Rabbani et ai, 2003 ; EP 1 452 596; WO 02/16655)
- the signalisation pathway of the response to stress includes abscisic acid signalisation so ABA-inducible promoters may also be powerful stress-inducible promoters, such as the Horgum vulgare A22 and hval promoters (Shen et al., 1993 ; Straub et ai., 1994), Zea maize rab 17, DBF1 and DBF2 (Villardel et ai., 1990 ; Kizis and Pages, 2002), Arabidopsis thaliana ABF3 (Genbank accession AK175851 ), and Oriza sativa rab21 (Mundy and Chua, 1988).
- the foreseen promoters are induced by chemicals (for review, see Moore et al., 2006, Padidam M. 2003 and Wang et al., 2003 and Zuo and Chua 2000).
- Some examples of couples of chemically inducible systems and chemical inducer used in plants are, the alcA promoter from A. nidulans, inducible by the Ethanol (Roslan et ai., 2001 ) or the ecdysone receptor from C. fumiferana, inducible by an ecdysone agonist (Koo et al., 2004).
- expression of the enzyme is indirectly induced by a chemical.
- GVG gene which codes for a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex.
- UAS target DNA sequences
- This complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the modified I-Scel.
- UAS target DNA sequences
- This is considered as a dexamethasone inducible (although indirectly) promoter used to control the restriction enzyme expression (Aoyama and Chua (1997). In this case, application of dexamethosone will induce both the restriction enzyme expression and its activity.
- Said restriction enzyme may also be provided by crossing a transgenic line containing said polynucleotide X, with another transgenic line containing a sequence coding for said enzyme. As previously described, this sequence may be present in this transgenic line under the control of a constitutive, developmentally regulated or inducible promoter.
- restriction enzyme by a transient expression system, such as agro-infiltration or by any other way, such as injection or spray.
- the restriction enzyme will have a peak of activity during meiosis.
- meiosis is the specific cell division leading to gametes production, and the inventors believe that meiosis is a preferred phase for recombination in plants, even though recombination may also occur during mitosis.
- dexamethasone is applied during meiosis, or just before meiosis.
- sequence encoding said restriction enzyme is under the control of a meiosis promoter.
- dexamethasone may be applied also during meiosis or can be available at any development stage.
- Dexamethasone can be applied to the cells of the plant in several ways.
- dexamethosone induction can be achieved in vitro by growing seedlings on media containing dexamethasone.
- the techniques of root drenching injection of the vasculature below the floral meristem, spraying or infiltration of buds or applying drops to the floral meristem are preferred.
- the purpose is to eliminate a specific DNA fragment in the vicinity of a restriction site recognized by a restriction enzyme according to the invention.
- a DSB is performed and the reattachment / repair of this DSB leads to excision of this specific DNA fragment.
- the attachment of said DSB is performed by homologous recombination (HR) between said homologous Y and Y' sequences, and leads to the excision of the DNA fragment and one copy of the recombinated Y or Y' sequence.
- HR homologous recombination
- the enzyme of the invention can be used in another way of realization of the invention, where said attachment of said cut ends (repair of DSB) is performed by non homologous end joining (NHEJ) and at least part of the sequences flanking said DSB- generated fragments are attached together.
- NHEJ non homologous end joining
- Non homologous end joining is also known as "illegitimate recombination", this method results from the attachment of the two DNA strands produced by the DSB "double strand break", no homologous region are necessary for this method but homologous regions may be present on each DNA strand. The attachment of these strands may result to the reconstitution of the restriction enzyme recognition site.
- said DNA fragment X to be eliminated comprises a chimeric gene consisting of a promoter linked to a selectable marker gene and a polyadenylation sequence, the selectable marker gene giving resistance to an antibiotic or an herbicide to said plant. More preferably the selectable marker gene comprises of a gene in the group consisting of the pat, the bar or the nptll genes.
- selectable marker include, but are not limited to, antibiotic resistance genes, herbicide resistance genes or visible marker genes.
- phenotypic markers are known in the art and may be used in this invention.
- a number of selective agents and resistance genes are known in the art. (See, for example, Hauptmann et al., 1988 ; Dekeyser et al., 1988 ; Eichholtz et al., 1987 ; and Meijer et al., 1991 ).
- the selectable marker used can be the bar or pat genes conferring resistance to bialaphos (White et al., 1990), the sulfonamide herbicide Asulam resistance gene, sul (described in WO 98/49316) encoding a type I dihydropterate synthase (DHPS), the nptll gene conferring resistance to a group of antibiotics including kanamycin, G418, paromomycin and neomycin (Bevan et al., 1983), the hph gene conferring resistance to hygromycin (Gritz et al., 1983), the EPSPS gene conferring tolerance to glyphosate (US 5,188,642), the HPPD gene conferring resistance to isoxazoles (WO 96/38567), the gene encoding for the GUS enzyme, the green fluorescent protein (GFP), expression of which, confers a recognisible physical characteristic to transformed cells, the chloramphenicol transferase gene, expression of which, detoxifies
- the marker gene is preferably controlled by a promoter which allows expression in cells, thus allowing selection of cells or tissue containing the marker at any stage of development of the plant.
- Preferred promoters are the promoter of nopaline synthase gene of Agrobacterium, the promoter derived from the gene which encodes the 35S subunit of cauliflower mosaic virus (CaMV) coat protein, and the rice actin promoter.
- CaMV cauliflower mosaic virus
- any other suitable second promoter may be used.
- Any terminator may be used.
- Other elements like introns and enhancers can also be present in the nucleic sequence of interest in order to improve the expression of the gene of interest.
- FAD2 intron from Arabidopsis described in WO 2006/003186.
- the restriction enzyme activity which is dependant of application of dexamethasone may be further controlled, for example through use of a meiotic promoter, or of a dexamethasone inducible promoter.
- the sequences encoding the restriction enzyme are located within said fragment to be excised. In this embodiment, it may also be useful for the sequence encoding the restriction enzyme to be under the control of an inducible or a tissue or developmentally regulated promoter.
- excision of the DNA fragment in particular by homologous recombination can lead to production of an expressible polynucleotide.
- the method of the invention thus makes it possible to have conditional expression of a given gene, especially when the restriction enzyme is under the control of an inducible promoter and is located within the DNA fragment to be excised.
- the expression cassette used in this invention may contain from 5' to 3': a promoter, a first polynucleotide Y1 , a polynucleotide Y, said sequence X to be excised, flanked in 5' or 3' or both by said restriction site R, said polynucleotide Y, a second polynucleotide Y2, and a terminator sequence.
- the polynucleotide Y1 YY2 formed after removal of sequence X by homologous recombination makes a complete coding sequence imparting a desired phenotype in said plant.
- the fragment to be excised is inserted in the sequence encoding for a protein in such a way, that the interrupted sequence will not lead to a correctly transcribed RNA and a functional protein.
- the insertion may be done in the coding sequence but also in an intron or in the promoter. In this embodiment, the excision of the given fragment allows the correct expression of the protein.
- the plant containing this construct may be re-transformed or crossed with a transgenic line containing the sequence encoding the restriction enzyme of the invention. Excision of the fragment may be observed in the lineage of the plant containing both constructs. Induction of the restriction enzyme activity by dexamethasone in the plant containing both constructs allows the precise production of the given protein.
- one useful stimuli may be high or cold temperature.
- the invention offers a new binary system for control expression of protein. Such system may be of interest for example for the production of recombinant proteins of therapeutics usage.
- the restriction enzyme coding gene may also be under the control of a tissue specific promoter to induce the expression of a recombinant protein in this related tissue.
- tissue specific promoters may be root specific, such as the rcc2 or rcc3 promoters (Xu et al., 95), seed specific such as the HMWG (Norre et al., 2002) and Zein promoters (Russell and Fromm 97) or leaf specific such as the rubisco (Bansal et al., 92) or PEPC promoters (Matsuoka et ai, 1994).
- the invention relates to the excision of a DNA fragment from the genome of a plant. If this fragment contains a sequence coding for a protein, the excision may lead to the inactivation of this coding sequence.
- the described methods may be used in any organisms, such as mammals or plants, or cells of mammals or plants. It is particularly useful on dicotyledonous and monocotyledonous plants, preferably for monocotyledonous, including but not limited to maize, wheat, barley, rice, rye, oat, thticale. Tomato, pepper, lettuce, beet, carrots, melon, rape, sunflower are also plants (list non limitative) in which the method of the invention may be performed. Preferably said plant is maize.
- the invention also encompasses transformed plants containing the elements described above, or being obtained by methods of the invention.
- the invention also encompasses cells of plants containing the elements described above, or being obtained by methods of the invention.
- the transgenic plant containing the sequence encoding the restriction enzyme may also be crossed with another plant containing the expression cassette of the invention containing a polynucleotide X comprising the DNA fragment to be excised according to the invention, said polynucleotide comprises at least a R restriction site rare or absent in the genome at its 5' or 3' extremity or with X.
- the excision of the fragment and selection of the plant with the excised fragment may be done as previously described for the re transformed plant.
- Plant with an excised DNA fragment can be identified by any mean known by a person skilled in the art. Such means include PCR, Southern, Northern or Western hybridisations designed to detect the loss of the excised fragment.
- Negative markers may also be used for this selection.
- a “negative marker” is a marker the presence of which is deleterious to the plant generally in the presence of an inducer, so that the selection of the plant on said inducer (selective agent) allows the selection of plants in which the excision has occurred and said negative marker has been deleted.
- Example of "negative markers” are reviewed in Miki and McHugh (2004), as cytosine deaminase (Babwah et al., 2000 ; lida and Terada 2005), or diphtheria toxin A (Terada et al., 2004).
- An other negative marker is D-amino acid oxidase (Erikson et al., 2004). These negative markers may be under the control of an inducible promoter to allow the development of plants before the excision step.
- D-amino acid oxidase (Erikson et al., 2004).
- These negative markers may be under the control of an inducible promoter to allow the development of plants before the excision step.
- the plant may be retransformed or crossed with a plant containing a sequence encoding the restriction enzyme, or infiltrated by this enzyme.
- the expression of the given enzyme allows the excision of the DNA fragment according to the invention. Selection on a specific selective agent selects against plants that still contain the negative selection marker and allows the selection of the plants where the excision has occurred.
- Plants in which an excision by HR according to the invention occurs may also be selected by the use of traditionally used selection markers.
- the construct used may contain in the following order (from 5' to 3') a promoter, a first polynucleotide Y1 , a polynucleotide Y, the sequence X to be excised flanked in 5', 3' or both by a restriction site R, a second polynucleotide Y, a polynucleotide Y2 and a terminator sequence.
- the polynucleotide Y1 YY2 obtained after excision of the DNA fragment encodes for a selection marker.
- This selection marker allows the selection of plants where the fragment excision occurs. Examples of such markers have been described above, such as gene coding for resistance to herbicide.
- Transgenic lines containing the polynucleotide X or expressing the restriction enzyme of the invention are obtained by traditional methods for genetic transformation of plants and can be obtained by any one of the techniques known to one skilled in the art : methods of direct transfer of genes such as direct micro-injection into plant embryoids (Neuhaus et al., 1997), vacuum infiltration (Bechtold et al. 1993) or electroporation (Chupeau et al., 1989) or the bombardment by gun of particules covered with the plasmidic DNA of interest (Fromm et al., 1990, Finer et al., 1992).
- Agrobacterium mediated transformation methods may also be used Agrobacterium tumefaciens, in particular according to the method described in the article by An et al., (1986), or Agrobacterium rhizogenes, in particular according to the method described in the article by Guerche et al., (1987). According to a preferred mode, it is possible to use the method described by lshida et al., (1996) for the transformation of maize.
- the invention relates to methods of gene targeting and insertion of genes within the genome of an organism, in particular a plant, using the improvement of homologous recombination through the double strand breaks induced by the enzymes according to the invention.
- the invention relates in particular to a method for integrating a DNA sequence Z at a predetermined location within the genome of a plant comprising the steps of: a. providing a plant comprising, at said determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said plant, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to cells of said plant a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c.
- the restriction enzyme is provided either by transformation of the receiving host by a nucleic acid of the invention, or by crossing the receiving host with a host which comprises a nucleic acid of the invention in its genome.
- Transient expression systems are also foreseen.
- the method is also applicable to cell cultures or to other organisms such as mammals, as described above.
- the method is applicable to mammalian cells, such as human or rodent cells.
- the method thus comprises the steps of a. providing a cell comprising, at a determined location in its genome, a restriction site R, that is preferably rare or normally absent in the genome of said cell, wherein said site is flanked by a sequence Y3' and a sequence Y5' respectively at its 3' and 5' ends, b. providing to said cell a nucleic acid comprising said DNA sequence Z flanked by sequences homologous or identical to Y3' and Y5', respectively at its 3' and 5' ends, c.
- the restriction enzyme is added to the cell through transformation, by electroporation, transfection, or any other method known in the art.
- sequence Z to be inserted is flanked by Y3' and Y5' sequences identical to the sequences already present in the genome of the receiving host. Preferred size and identity percentages of these sequences have been described above.
- the restriction enzyme of the invention is made active during meiosis. This may be obtained by application of dexamethasone during meiosis or by use of meiosis-specific or inducible promoters as described above, and permanent application of dexamethasone, as described above.
- Screening of organisms which harbour integration of the cassette by homologous recombination within the genome is performed by method known to persons skilled in the art, such as PCR, Southern blots, or any other method. It is also possible to use counter-selectable markers to select these organisms, although this is not the preferred embodiment of the invention.
- the restriction site R When the restriction site R is normally absent from the genome of the recipient organism (ie the sequence coding for this site is not naturally present in the genome of the organism), it is introduced within said genome though any transformation method known in the art, before performing the method of the invention. Thus, the recipient host possesses a "hot spot" for recombination at the place where this site has integrated. It is easy to identify the Y3' and Y5' flanking regions by known methods in the art such as chromosome walking. These methods are not described herein, as the literature already discloses such methods of identifying regions flanking the integration site of a transgene after transformation of a host.
- dexamethasone is the preferred ligand, it is to be understood that the invention can also be performed with other ligands for the GR-LBD, such as deacylcortivazol, or other agonists. Furthermore, it is well known that some antagonists for this receptor may also have agonist activity under certain circumstances.
- the invention also relates to an expression cassette containing a promoter inducible by a steroid, operably linked to a restriction enzyme (site specific endonuclease) coding sequence, said restriction enzyme being preferably a meganuclease as defined above, which may or may not be fused with a rat Glucocorticoid Receptor (GR) Ligand Binding Domain (LBD), as described in the invention.
- restriction enzyme site specific endonuclease
- GR Glucocorticoid Receptor
- LBD Ligand Binding Domain
- operably linked means that the promoter and the restriction enzyme coding sequence are oriented such that the promoter directs expression of the restriction enzyme coding sequence, generally in the 5'- to 3'- direction.
- the constructs may also contain polyadenylation sites at the 3'- end of the restriction enzyme coding sequence.
- Said promoter is preferably inducible by a glucocorticoid, such as dexamethasone. Steroid action is generally via the action of a steroid receptor that then binds to the promoter.
- the GVG gene codes for a modified rat glucocorticoid responsive transcription factor remaining in the cell cytosol as a complex. Upon dexamethasone application, this complex dissociates and the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of the restriction enzyme.
- UAS target DNA sequences
- Other examples of steroid inducible promoters have been described.
- the expression cassette according to the invention is used to provide the restriction enzyme to perform the Double Strand Break and induce recombination at the breakage site, in particular to excise a specific sequence from the genome or integrate a sequence at a predetermined locus as seen above.
- the expression cassette according to the invention may be present on the same vector that carries said DNA sequence Z.
- the expression cassette according to the invention may be located within said DNA sequence to be excised, or may be present in a second plant that is crossed to said first plant, thereby providing the restriction enzyme.
- the restriction enzymes that are used in the cassette of this embodiment of the invention have been described above.
- the transformed organisms containing a cassette of this embodiment of the invention are obtained according to methods known in the art.
- the methods of use of the cassette of this embodiment of the invention (elimination of a sequence in the genome of a target organism, targeted insertion of a sequence at a specific site) have been described above and are performed as described above.
- the steroid preferably dexamethasone
- FIG. 1 Schematic map of the plasmid pBIOS1283.
- This GATEWAY ENTR plasmid consists of sequence encoding an NLS-I-Scel-GR-LBD fusion protein followed by a CaMV 35S polyadenylation sequence. There is no promoter driving expression of the sequence.
- FIG. 2 Schematic diagram of pBIOS925. which is used as an intrachromosomal recombination reporter in Arabidopsis.
- Figure 3 Schematic diagram of pBIOS882. which is used as an intrachromosomal recombination reporter in maize.
- Figure 4 Schematic diagram of pS ⁇ S-NLS-l-Scel-GR-SCV (pBIOS1316) which is a binary vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter in Arabidosis.
- Figure 5 Schematic diagram of pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 ) which is a vector used for the expression of an NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron in maize.
- Figure 6 Schematic diagram of pAt Target Locus, which contains the target locus for GT in Arabidopsis.
- Figure 7 Schematic diagram of pAt Target Vector which contains the target vector rescue sequence for GT in Arabidopsis and the NLS-I-Scel-GR-LBD fusion protein under the control of the p35S promoter.
- Figure 8 Schematic diagram of a gene targeting event induced by dexamethasone in Arabidopsis.
- Figure 9 Schematic diagram of pBIOS905, which contains the target locus for
- FIG. 10 Schematic diagram of pZm Target Vector (pBIOS1320) which contains the target vector rescue sequence for GT in maize.
- Figure 1 1 Schematic diagram of a gene targeting event induced by dexamethasone in maize and the NLS-I-Scel-GR-LBD fusion protein under the control of the pCsVMV promoter followed by the actin intron
- Figure 12 Map of the vector used for cis-marker gene elimination using dexamethasone inducible I-Scel expression.
- FIG. 13 Schematic diagram of pBIOS1328 (a) and pBIOS1329 (b).
- pBIOS1329 was constructed by removing the CaMV polyadenylation sequence from pBIOS1283 (figure 1 ).
- pBIOS1328 (figure 13 (a)) is virtually identical to pBIOS1329 apart from lacking a Leucine residue between the NLS and I-Scel domains.
- Example 1 Construction of a DNA sequence coding for a nuclear targeted, dexamethasone-inducible I-Scel fusion protein, (SV40NLS - I- Seel - GR LBD).
- the I-Scel coding sequence was modified, as described below, by the 3' addition of a rat glucocorticoid ligand binding domain sequence (Miesfeld et al 1986).
- the resulting chimeric coding sequence encodes a modified I-Scel protein (I-Scel- GR-LBD) that is only active in the presence of an appropriate chemical inducer such as dexamethasone.
- the resulting fusion protein is significantly larger than the original I-Scel protein and thus it is possible that transfer of this fusion protein into the nucleus from the cytosol, and thus the access of I-Scel to its target DNA, will be reduced.
- NLS nuclear localisation signal
- a nuclear-encoded meganuclease I-Scel (SEQ ID N °6) (as in Plessis et al, (1992)), corresponding to the mitochondral groupi intron-encoded endonuclase I-Scel from yeast (Jacquier and Dujon (1985)) was amplified by PCR using modified forward (B_Kz * _NLS_Scl-Scel5' : CATGGATCCACCATGGCCTGCA- CCCCGCCGAAGAAAAAGAGGAAAGTGCTGGCCAAAAACATCAAAAA) SEQ ID N ° 9 and reverse (Scl-Scel3'_Sacl(L) : CG CG AG CTCTTTCA- GGAAAGTTTCGG) SEQ ID N°10 primers containing BamHI and Sad restriction sites respectively.
- the forward primer contains downstream of the BamHI site an ATG codon in frame with the SV40 Nuclear Localization Signal (SEQ ID N° 3 and SEQ ID N° 4 as described in Dingwall et al. 1986, Lanford et al. 1984, Kalderson et al, 1984) coding sequence adapted to maize codon usage.
- the forward primer was also designed in order that the ATG codon of I- Scel is deleted.
- the reverse primer was designed so that the amplified I-Scel sequence does not contain a stop codon.
- the PCR fragment was cloned into the pGEM®-T-easy (Promega) vector forming pBIOS1279.
- the pBIOS1 106 vector contains a Rat GR LBD (SEQ ID N°1 ,, Miesfeld et al. 1986) behind the CaMV polyA terminator.
- Rat GR LBD SEQ ID N°1 ,, Miesfeld et al. 1986
- the SV40NLS-l-Scel sequence was excised from pBIOS1279 by restriction digestion with BamHI and Sacl. Then the fragment was introduced in pBIOS1106 opened with BamHI and Sacl forming a SV40NLS-l-Scel-GR-LBD in frame fusion followed by the CaMV polyA terminator.
- the resulting plasmid pBIOS1283 is shown in figure 1.
- Example 2 Construction of intrachromosomal Arabidopsis reporter lines for Homologous recombination (HR). lntrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome.
- intrachromosomal homologous recombination reporter construct contained in pBIOS925 (figure 2), was introduced into Arabidopsis.
- This reporter construct is composed of a Pea plastocyanin promoter expressed in green tissues (pPeaPC, Pwee et al., 1990) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene.
- the truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP gene and precisely reform an entire GUS gene.
- I-Scel meganuclease I-Scelr
- pBIOS925 A DNA fragment containing an I-Scel restriction site (I-Scelr) was created by annealing two primers RIScel (5'AATTCTAGGGATAACAGGGTAATA 3', SEQ ID N°11 ) and H3Scel (5 'AGCTTATTACCCTGTTATCCCTAG 3', SEQ ID N °12).
- pBIOS782 This DNA which contains Hindi 11 and EcoRI compatible overhangs was cloned into Hindlll, EcoRI-cut pBS Il SK+ (STRATAGENE) forming pBIOS782.
- the cassette pCsVMV-GFP-Nos from pBIOS41 1 was inserted as an Xhol, Sstll (flushed) fragment, between the Xhol, Kpnl (flushed) sites of pBIOS782 forming pBIOS809.
- pBIOS411 is a pBSII derivative which contains a CsVMV promoter (Verdaguer et al. (1996)) linked to a GFP (Green Fluorescent Protein) coding sequence followed by a 3'Nos terminator (Depicker A.
- a GUS gene with an STLS1 intron (Vancanneyt G et al., 1990) was introduced between the BamHI and EcoRI sites of pENTRI A (Invitrogen) forming pCL50.
- the pCsVMV-GFP BamHI, Pvul (flushed) fragment of pBIOS809 was cloned between the BamHI, SnaB1 sites of pCL50 forming the vector pBIOS821.
- This vector was digested with Smal and Notl, to extract the cassette 'I-Scelr - pCsVMV-GFP- STLS1 intron - 3'GUS' which was introduced between the Csp45l (filled)-Notl sites of pCL50, to obtain the vector pBIOS865.
- the 'GU-I- Scelr-pCsVMV-GFP-US' region was fused to the pea plastocyanin promoter (pPeaPC) by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pPC-R1 R2-SCV forming the binary vector pBIOS925 (pPC-R1 R2-SCV is a GATEWAY destination plant binary vector containing a pNos-nptll gene for selection of transformed plants, the Pea plastocyanin promoter followed by a GATEWAY cassette and a Chalcone synthase polyadenylation sequence) pBIOS925 was transferred into agrobacteha, and the Arabidopsis cultivar Col4 was transformed with this Agrobacteria strain via the floral dip method essentially as described by Clough et al.
- Example 3 Construction of intrachromosomal maize reporter lines for Homologous recombination (HR).
- Intrachromosomal recombination can be used to precisely remove genomic DNA sequences from the genome.
- the intrachromosomal reporter construct contained in pBIOS882 (figure 3) was introduced into maize.
- This reporter construct is composed of a constitutive promoter (pActin) linked to a 3' truncated GUS gene followed by an intervening sequence containing a pCsVMV-GFP gene and a 5' truncated GUS gene.
- the truncated GUS genes have a I OOObp region in common such that HR between these GUS duplicated sequences will excise the intervening pCsVMV-GFP and precisely reform an entire GUS gene.
- I- Scelr I-Scel meganuclease
- the 'GU-l-Scelr-pCsVMV-GFP-US' region in pBIOS865 was fused to constitutive rice Actin promoter plus a rice Actin intron by performing an LR clonase reaction (Invitrogen) with the GATEWAY binary destination vector pWP527-R12-JTT forming the binary vector pBIOS 882.
- the vector pWP527-R12-JTT is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pSc4 (Boevink,P et al., 1995).
- pBIOS 882 was transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants were phenotypically normal. Pollen from the transformed plants was examined histochemically for GUS activity. Histochemical detection of GUS expression was performed according to the following method.
- Plant material was stained in a medium containing 0.5 mg/ml Xglucuronide (Clonetech, Palo Alto, CA), 0.5mM phosphate buffer, pH 7.0, 0.1 % triton X-100 and 20% (v/v) methanol. In most transformants no GUS staining was observed in roots leaves and pollen though in 2 plants a few GUS stained pollen grains were observed. This result confirms that HR (which restores GUS activity), is a rare natural event in maize.
- Example 4 - lntrachromosomal recombination and removal of intergenic DNA sequences in Arabidopsis mediated by the dexamethasone- inducible NLS-I-Scel-GR-LBD fusion protein.
- Arabidopsis plants containing the intrachromosomal HR reporter are retransformed with a p35S CaMV -NLS-I-Scel-GR LBD transgene.
- This transgene is constructed by introducing the CaMV 35S promoter (p35S) upstream of the NLS-I-Scel-GR-LBD fusion in pBIOS1283 (example 1 ).
- pBIOS11 10 is a derivative of the plant binary vector pSCV1 containing a pNos-HPT selectable marker gene and a GATEWAY cassette).
- the plasmid pS ⁇ S-NLS-l-IScel-GR-SCV (pBIOS1316) is introduced into Agrobacteha, and the Arabidopsis lines described in example 2 are retransformed with this Agrobacteria strain essentially as described by Clough et al. (1998).
- the transformed plants are phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences are selected.
- the rate of DNA excision (totally blue plantlets) obtained under dexamethasone treatment is higher that without dexamethasone. This demonstrates that recombination, leading to DNA excision, mediated by the NLS-I-Scel-GR LBD fusion protein is induced by dexamethasone treatment.
- Example 5 NLS-I-Scel-GR LBD fusion protein-mediated stimulation of intrachromosomal HR and removal of intergenic DNA sequences in maize.
- maize plants are transformed with a vector designed for the expression of the NLS-I-Scel-GR LBD fusion protein in maize.
- This vector is constructed by introducing the constitutive Cassava Vein Mosaic Virus (pCsVMV) promoter ((Verdaguer et al. (1996)), linked to an actin intron (McElroy et al. (1990)), upstream of the NLS-I- Scel-GR LBD fusion (example 1 ).
- pCsVMV constitutive Cassava Vein Mosaic Virus
- the vector pBIOS605 is a derivative of pSB1 1 (Komari et a/.(1996)) containing a pActin-Bar gene for selection of maize transformants, and a GATEWAY cassette).
- the resultant expression clone pCsVMV-NLS-l-Scel-GR-JT (pBIOS1371 , figure 5) obtained is introduced into the agrobacteha strain LBA4404 (pSB1 ) according to Komari et al (1996).
- Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996). The transformed plants are phenotypically normal.
- T1 plants which express the NLS-I-Scel-GR-LBD gene are selected by RT-PCR and crossed with intramolecular HR reporter plants described in example 3. Progeny of those plants containing both the NLS-I-Scel-GR LBD gene and the reporter gene are selected and a proportion of these plants are treated with a solution of dexamethasone (a range around 30 ⁇ M is used) applied as drops into the whorl on those plants. Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing. Ideally dexamethosone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I- Scel-GR-LBD protein and available as a substrate for HR during meiosis.
- dexamethasone a range around 30 ⁇ M is used
- Example 6 Inducible-I-Sce-I expression to mediate gene targeting in Arabidopsis.
- a barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues.
- NHEJ non homologous end joining mechanism
- This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In plant species where transformation rates are low this prevents the routine use of HR for gene targeting.
- a solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity.
- This plant line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events.
- This approach is exemplified in Arabidopsis using HR- mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into Arabidopsis. Construction of the Target Locus' Arabidopsis' Line. Arabidopsis is transformed with the construct pAtTargetLocus (figure 6).
- This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the p35S-BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by a nospolyA sequence and the T-DNA right border. This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended (figure 8).
- pAtTargetLocus is transferred to agrobacteria and is transformed into Arabidopsis using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
- the binary plasmid pAtTargetVector consists of the following components in the T-DNA; next to the T-DNA left border is a pSc4-Hyg-nosPolyA selectable marker gene, a pCsVMV-NLS-l-Scel GR-LBD chimeric gene followed by a restriction site for I-Scel, the p35S-BAR-nospolyA gene, that is required for to act as a region with homology to the Target Locus, the nos promoter linked to the 5' region of the nptll intron gene followed by a restriction site for I-Scel and the T-DNA right border (figure 7).
- pAtTargetVector is transferred to agrobacteria and is transformed into the selected Arabidopsis Target Locus lines using a floral dip method (Clough et al., 1998). Tranformants (TO) are selected on hygromycin and selfed for two generations. T2 lines homozygous for a single copy of the TargetLocus and TargetVector T-DNAs are selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance.
- Example 7 Inducible-I-Sce-I expression to mediate gene targeting in maize. It is highly desirable to be able to insert exogenous DNA into a defined site in the plant genome or replace defined DNA sequences 'gene targeting' using homologous recombination.
- a barrier to the use of HR for gene targeting is the inefficiency of HR in plants, particularly the fact that at a DNA double strand break the competing non homologous end joining mechanism (NHEJ) predominates in most plant tissues. This inefficiency of HR leads to a need to produce many thousands of plant transformation events to find a single HR gene targeting event. In maize where transformation rates are low this prevents the routine use of HR for gene targeting.
- a solution is to produce a stably transformed plant line where the DNA substrate for HR mediated gene targeting Target Vector' can be made available by induction of I-Scel activity.
- This maize line can be multiplied indefinitely in the absence of induction and a large population of I-Scel induced plants can be screened for rare HR gene targeting events.
- This approach is exemplified in maize using HR-mediated gene targeting to reconstitute an inactive 5' truncated nptll gene, though the approach can be applied to target endogenous genes. In this case only the Target Vector' needs to be transformed into maize. Construction of the Target Locus' Maize Line. Maize was transformed with the construct pBIOS905.
- This binary plasmid consists of the following components in the T-DNA; next to the T-DNA left border is the pActin-actin intron -BAR-nospolyA selectable marker gene that is required for plant transformation and also to act as a region with homology to the Target Vector, followed by a restriction site for I-Scel. 3' of this I-Scel site is a 5' truncated nptll gene followed by an AtSac66polyA sequence and the T- DNA right border (figure 9). This nptll gene contains a rice tubulin intron such that the region of homology with the target vector is extended.
- pBIOS905 was transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al. (1996) and the Maize cultivar A188 was transformed with this agrobacterial strain essentially as described by lshida et a/. (1996). The transformed plants were phenotypically normal. Tranformants (TO) were selected on BASTA and selfed for two generations. T2 lines homozygous for a single copy of the T-DNA were selected, and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines did not display kanamycin resistance.
- the binary plasmid pZmTargetVector (pBIOS1320) consists of the following components in the T-DNA; next to the T-DNA left border is a restriction site for I-Scel, the pActin-actin intron-BAR-nospolyA gene, that is required as a selectable marker for plant transformation and to act as a region with homology to the Target Locus, the pCsVMV promoter linked to GFP which is a marker for the T-DNA the pSc4 promoter linked to a FAD2 intron and the 5' region of the nptll intron gene followed by a pCsVMV-NLS-l-SceI GR-LBD chimeric gene, a restriction site for I-Scel and the T-DNA right border (pBIOS1320, figure 10).
- pBIOS1320 is transferred into agrobacteria LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobacterial strain essentially as described by lshida et a/.(1996).
- the transformed plants are phenotypically normal.
- Tranformants (TO) are selected on BASTA and selfed for two generations.
- T2 lines homozygous for a single copy of the T-DNA are selected and the integrity of the T-DNA verified by PCR and Southern analysis. The selected lines do not display kanamycin resistance. Induction of GeneTargeting.
- TargetLoci and TargetVector Lines are crossed and a proportion of the progeny are treated with a solution of dexamethasone (range around 30 ⁇ M) applied as drops into the whorl on those plants.
- Dexamethasone treatment is repeated each 2 days between 10 to 40 days after sowing (Dexamethasone treatment induces I-Scel activity and both excises the Target Vector from the genome and creates a DSB at the Target Locus.
- the Target Vector can then recombine via HR at the Target Locus and reconstitute a functional nptll gene (figure 1 1 ).
- dexamethasone should be applied just prior to the stage of meiosis such that the targeting vector is excised by the NLS-I-Scel-GR-LBD protein and available as a substrate for HR during meiosis. This is since it is likely that RH is favoured during meiosis).
- the progeny of those plants and the progeny of dexamethasone untreated plants are analyzed at the plantlet stage for kanamycin resistance by leaf painting with a solution of kanamycin and via PCR to identify a reconstituted nptll gene.
- the frequency of nptll resistant plantlets is obtained under dexamethasone treatment is clearly higher than without dexamethasone.
- Example 8 Construction of intrachromosomal maize reporter lines for inducible HR and NHEJ mediated by inducible I-Scel expression and cis- elimination of the selectable marker and I-Scel genes.
- a marker gene When a marker gene is to be eliminated and a non-inducible I-Scel is to be expressed, it is preferable to control its expression in TO plants such that it is expressed after the period where selectable marker gene expression is required.
- a dexamethasone inducible promoter is used to control I-Scel expression (Aoyama and Chua (1997)).
- dexamethosone induces I-Scel expression and the I-Scel gene together with the plant selectable marker is excised from the genome.
- the following genes are cloned between two I-Scel sites:- pCsVMV-GVG + pSc4-FAD2int-nptll + pUAS-l-Scel.
- the GVG gene product is a modified rat glucocorticoid responsive transcription factor that remains in the plant cytosol as a complex and is described in numerous articles, together with the pUAS promoter. On dexamethasone application this complex dissociates such that the GVG protein enters the nucleus and binds to the target DNA sequences (UAS). Transcription from the UAS promoter allows the production of I-Scel.
- the GVG+nptll+l-Scel region is cloned as an I-Scel fragment into l-Scel-cut pBIOS881.
- the 5'GUS-l-Scelr-pCsVMV-l-GVG + pSc4-FAD2int-nptll + pUAS-l- Scel 3'GUS region is transferred via an LR clonase reaction into a GATEWAY binary destination vector that is a pSB1 1 derivative containing an Actin promoter followed by a GATEWAY cassette (figure 12).
- the resulting plasmid is transferred into agrobacteha LBA4404 (pSB1 ) according to Komari et al.( 1996) and the Maize cultivar A188 is transformed with this agrobactehal strain essentially as described by lshida ef a/.(1996).
- TO plantlets are either transferred to a medium containing dexamethasone then later transferred to soil.
- TO plants are watered with or injected with a solution of dexamethasone.
- Pollen from dexamethasone treated transformed plants is examined histochemically for GUS activity, to check that, in most transformants, GUS staining is observed at a high frequency. The pollen is then used to fertilize a wild-type plant and obtain F1 progeny that express GUS in all tissues but do not contain the I-Scel or nptll genes.
- Example 9 - lntrachromosomal recombination and removal of intergenic DNA sequences from a PAT-PAT transgene in Arabidopsis mediated by the dexamethasone-inducible NLS-I-Scel-GR-LBD fusion protein.
- An Arabidopsis intrachromosomal HR reporter line is used in this example, which contains a T-DNA called PAT-PAT.
- This T-DNA is composed of two mutated phosphinothhcin acetyltransferase (PAT) genes (Block et al 1987), under the control of a 35S promoter and a Nos terminator. This construct was provided by F. Degroote and G.
- the vector pBIOS1316 containing the 35S-NLS-I-Scel-GR-LBD chimaeric gene (example 4, figure 4) was introduced into Agrobacteria, and the Arabidopsis reporter lines were transformed with this Agrobacteria strain essentially as described by Clough et al. (1998). The transformed plants were phenotypically normal. T1 plants containing both the I-Scel inducible system and the reporter sequences were selected.
- the T2 seeds were treated as follows:
- Such herbicide resistance is due to intrachromosomal HR between the 2 mutated PAT genes reconstituting a functional PAT gene and, in most cases, eliminating the region between the two PAT genes including the nptll gene.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Hydroponics (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP07765265A EP2018434B1 (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
| DE602007012858T DE602007012858D1 (en) | 2006-05-18 | 2007-05-15 | METHOD FOR IMPLEMENTING HOMOLOGOUS RECOMBINATIONS IN PLANTS |
| AU2007253458A AU2007253458B2 (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
| AT07765265T ATE500337T1 (en) | 2006-05-18 | 2007-05-15 | METHOD FOR CARRYING OUT HOMOLOGOUS RECOMBINATIONS IN PLANTS |
| CA2650548A CA2650548C (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
| US12/301,358 US8273956B2 (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
| US13/619,082 US8455715B2 (en) | 2006-05-18 | 2012-09-14 | Method for performing homologous recombination in plants |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP06114137 | 2006-05-18 | ||
| EP06114137.0 | 2006-05-18 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/301,358 A-371-Of-International US8273956B2 (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
| US13/619,082 Division US8455715B2 (en) | 2006-05-18 | 2012-09-14 | Method for performing homologous recombination in plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007135022A1 true WO2007135022A1 (en) | 2007-11-29 |
Family
ID=37075092
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2007/054693 Ceased WO2007135022A1 (en) | 2006-05-18 | 2007-05-15 | Method for performing homologous recombination in plants |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US8273956B2 (en) |
| EP (2) | EP2316954B1 (en) |
| AT (1) | ATE500337T1 (en) |
| AU (1) | AU2007253458B2 (en) |
| CA (1) | CA2650548C (en) |
| DE (1) | DE602007012858D1 (en) |
| WO (1) | WO2007135022A1 (en) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008145731A1 (en) * | 2007-05-31 | 2008-12-04 | Basf Plant Science Gmbh | Method of excising a nucleic acid sequence from a plant genome |
| WO2011003850A1 (en) * | 2009-07-10 | 2011-01-13 | Enza Zaden Beheer B.V. | Method for providing fertile plants via induction of bbm during transformation |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| DE112010004584T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| WO2013050593A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013050611A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013050318A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013053711A1 (en) | 2011-10-10 | 2013-04-18 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013053686A1 (en) | 2011-10-10 | 2013-04-18 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
| EP2687605A1 (en) | 2012-07-19 | 2014-01-22 | Biogemma | Method for performing homologous recombination |
| WO2017134137A1 (en) * | 2016-02-05 | 2017-08-10 | Polygene Ag | Glucocorticoid-based gene regulation system |
| EP4311430A1 (en) | 2022-07-28 | 2024-01-31 | Limagrain Europe | Chlorotoluron tolerance gene and methods of use thereof |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130071884A1 (en) | 2009-11-06 | 2013-03-21 | Agrivida, Inc. | Plants expressing cell wall degrading enzymes and expression vectors |
| WO2011154158A1 (en) * | 2010-06-09 | 2011-12-15 | Bayer Bioscience N.V. | Methods and means to modify a plant genome at a nucleotide sequence commonly used in plant genome engineering |
| CN103119169B (en) * | 2010-06-09 | 2018-11-20 | 拜尔作物科学公司 | Methods and tools for modifying plant genomes in nucleotide sequences commonly used in plant genome engineering |
| US10443068B2 (en) | 2010-06-25 | 2019-10-15 | Agrivida, Inc. | Plants with engineered endogenous genes |
| US9598700B2 (en) | 2010-06-25 | 2017-03-21 | Agrivida, Inc. | Methods and compositions for processing biomass with elevated levels of starch |
| CN106244622B (en) | 2011-03-07 | 2020-06-12 | 谷万达公司 | Expression cassette and expression vector for expressing multiple proteins in engineering plant, method for preparing engineering plant and method for producing soluble sugar |
| WO2014104878A1 (en) | 2012-12-27 | 2014-07-03 | Keygene N.V. | Method for removing genetic linkage in a plant |
| JP6521669B2 (en) * | 2014-02-25 | 2019-05-29 | 国立研究開発法人農業・食品産業技術総合研究機構 | Plant cell in which mutation is introduced into target DNA, and method for producing the same |
| EP3075741A1 (en) | 2015-03-31 | 2016-10-05 | Biogemma | Method of plant improvement using aspartate kinase - homoserine dehydrogenase |
| EP3115458A1 (en) | 2015-07-06 | 2017-01-11 | Genective | Method for gene optimization |
| CN109937209A (en) | 2016-10-10 | 2019-06-25 | 利马格兰集团 | Encode the nucleic acid and application method of the SM1 resistance to orange wheat flower mosquito |
| EP3708669A1 (en) | 2019-03-13 | 2020-09-16 | Genective | Pesticidal genes and methods of use |
| EP3808170A1 (en) | 2019-10-17 | 2021-04-21 | Bejo Zaden B.V. | Lactuca sativa resistance to bremia lactucae |
| JP2022087881A (en) * | 2020-12-02 | 2022-06-14 | トヨタ自動車株式会社 | Plasmid for transformation, method for producing transformant using the same, and transformation method |
| CA3259168A1 (en) | 2022-06-30 | 2024-01-04 | Genective | Gpp(cry)34-like insecticidal proteins |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997031108A1 (en) * | 1996-02-20 | 1997-08-28 | Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) | Modified nuclear glucocorticoid receptor, fusion protein, and dna fragments coding for said receptor and said fusion protein |
| WO2005049842A2 (en) * | 2003-11-18 | 2005-06-02 | Bayer Bioscience N.V. | Improved targeted dna insertion in plants |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NZ217113A (en) | 1985-08-07 | 1988-06-30 | Monsanto Co | Production of eucaryotic plants which are glyphosate resistant, vectors (transformation and expression), chimeric gene and plant cells |
| US5792632A (en) | 1992-05-05 | 1998-08-11 | Institut Pasteur | Nucleotide sequence encoding the enzyme I-SceI and the uses thereof |
| FR2734842B1 (en) | 1995-06-02 | 1998-02-27 | Rhone Poulenc Agrochimie | DNA SEQUENCE OF A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE AND OBTAINING PLANTS CONTAINING A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE, TOLERANT TO CERTAIN HERBICIDES |
| GB9708542D0 (en) | 1997-04-25 | 1997-06-18 | Nickerson Biocem Ltd | Resistance marker |
| US6476297B1 (en) | 1998-07-10 | 2002-11-05 | The Research Foundation Of State University Of Ny | Meiosis promoter |
| CA2420555C (en) | 2000-08-24 | 2012-10-23 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
| DE10131786A1 (en) | 2001-07-04 | 2003-01-16 | Sungene Gmbh & Co Kgaa | Recombination systems and methods for removing nucleic acid sequences from the genome of eukaryotic organisms |
| EP1803813A3 (en) | 2001-11-19 | 2007-11-14 | Riken | An environmental stress-responsive promoter and an gene encoding environmental stress-responsive transcriptional factor |
| EP1614754A1 (en) | 2004-07-06 | 2006-01-11 | Biogemma | Method for enhancing gene expression in plants |
-
2007
- 2007-05-15 EP EP11155147.9A patent/EP2316954B1/en not_active Not-in-force
- 2007-05-15 DE DE602007012858T patent/DE602007012858D1/en active Active
- 2007-05-15 US US12/301,358 patent/US8273956B2/en not_active Expired - Fee Related
- 2007-05-15 AT AT07765265T patent/ATE500337T1/en not_active IP Right Cessation
- 2007-05-15 CA CA2650548A patent/CA2650548C/en not_active Expired - Fee Related
- 2007-05-15 EP EP07765265A patent/EP2018434B1/en not_active Not-in-force
- 2007-05-15 WO PCT/EP2007/054693 patent/WO2007135022A1/en not_active Ceased
- 2007-05-15 AU AU2007253458A patent/AU2007253458B2/en not_active Ceased
-
2012
- 2012-09-14 US US13/619,082 patent/US8455715B2/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997031108A1 (en) * | 1996-02-20 | 1997-08-28 | Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) | Modified nuclear glucocorticoid receptor, fusion protein, and dna fragments coding for said receptor and said fusion protein |
| WO2005049842A2 (en) * | 2003-11-18 | 2005-06-02 | Bayer Bioscience N.V. | Improved targeted dna insertion in plants |
Non-Patent Citations (5)
| Title |
|---|
| BROCARD JACQUES ET AL: "A chimeric Cre recombinase inducible by synthetic, but not by natural ligands of the glucocorticoid receptor", NUCLEIC ACIDS RESEARCH, IRL PRESS LTD., OXFORD, GB, vol. 26, no. 17, 1998, pages 4086 - 4090, XP002144710, ISSN: 0305-1048 * |
| CHANDRASEGARAN S ET AL: "CHIMERIC RESTRICTION ENZYMES: WHAT IS NEXT?", BIOLOGICAL CHEMISTRY, vol. 380, no. 7/8, July 1999 (1999-07-01), pages 841 - 848, XP008019125, ISSN: 1431-6730 * |
| DURAI SUNDAR ET AL: "Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells", NUCLEIC ACIDS RESEARCH, vol. 33, no. 18, 2005, pages 5978 - 5990, XP002403200, ISSN: 0305-1048 * |
| JOUBES JEROME ET AL: "Conditional, recombinase-mediated expression of genes in plant cell cultures.", PLANT JOURNAL, vol. 37, no. 6, March 2004 (2004-03-01), pages 889 - 896, XP002403199, ISSN: 0960-7412 * |
| WRIGHT DAVID A ET AL: "High-frequency homologous recombination in plants mediated by zinc-finger nucleases", PLANT JOURNAL, vol. 44, no. 4, November 2005 (2005-11-01), pages 693 - 705, XP002403198, ISSN: 0960-7412 * |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008145731A1 (en) * | 2007-05-31 | 2008-12-04 | Basf Plant Science Gmbh | Method of excising a nucleic acid sequence from a plant genome |
| JP2012532587A (en) * | 2009-07-10 | 2012-12-20 | エンザ・ザデン・ビヘーア・ベスローテン・フエンノートシャップ | Method for providing fertile plants by induction of BBM during transformation |
| US9212369B2 (en) | 2009-07-10 | 2015-12-15 | Enza Zaden Beheer B.V. | Method for providing fertile plants via induction of BBM during transformation |
| WO2011003850A1 (en) * | 2009-07-10 | 2011-01-13 | Enza Zaden Beheer B.V. | Method for providing fertile plants via induction of bbm during transformation |
| EP2504429A4 (en) * | 2009-11-27 | 2013-06-05 | Basf Plant Science Co Gmbh | CHIMERIC ENDONUCLEASES AND USES THEREOF |
| EP2504430A4 (en) * | 2009-11-27 | 2013-06-05 | Basf Plant Science Co Gmbh | CHIMERIC ENDONUCLEASES AND USES THEREOF |
| DE112010004584T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| DE112010004582T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Optimized endonucleases and applications thereof |
| CN102686726A (en) * | 2009-11-27 | 2012-09-19 | 巴斯夫植物科学有限公司 | Chimeric endonucleases and uses thereof |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| CN105384827A (en) * | 2009-11-27 | 2016-03-09 | 巴斯夫植物科学有限公司 | Chimeric endonucleases and uses thereof |
| DE112010004583T5 (en) | 2009-11-27 | 2012-10-18 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| US10316304B2 (en) | 2009-11-27 | 2019-06-11 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| US9404099B2 (en) | 2009-11-27 | 2016-08-02 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2013050593A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013050318A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013050611A1 (en) | 2011-10-07 | 2013-04-11 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013053711A1 (en) | 2011-10-10 | 2013-04-18 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013053686A1 (en) | 2011-10-10 | 2013-04-18 | Basf Plant Science Company Gmbh | Method of producing plants having increased resistance to pathogens |
| WO2013102875A1 (en) | 2012-01-06 | 2013-07-11 | Basf Plant Science Company Gmbh | In planta recombination |
| EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
| WO2014013056A1 (en) | 2012-07-19 | 2014-01-23 | Biogemma | Method for performing homologous recombination |
| EP2687605A1 (en) | 2012-07-19 | 2014-01-22 | Biogemma | Method for performing homologous recombination |
| WO2017134137A1 (en) * | 2016-02-05 | 2017-08-10 | Polygene Ag | Glucocorticoid-based gene regulation system |
| EP4311430A1 (en) | 2022-07-28 | 2024-01-31 | Limagrain Europe | Chlorotoluron tolerance gene and methods of use thereof |
| WO2024023210A1 (en) | 2022-07-28 | 2024-02-01 | Limagrain Europe | Chlorotoluron tolerance gene and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US8273956B2 (en) | 2012-09-25 |
| EP2316954A1 (en) | 2011-05-04 |
| AU2007253458A1 (en) | 2007-11-29 |
| CA2650548C (en) | 2015-12-22 |
| CA2650548A1 (en) | 2007-11-29 |
| DE602007012858D1 (en) | 2011-04-14 |
| EP2018434A1 (en) | 2009-01-28 |
| EP2018434B1 (en) | 2011-03-02 |
| AU2007253458B2 (en) | 2013-04-04 |
| US20090293155A1 (en) | 2009-11-26 |
| EP2316954B1 (en) | 2013-10-30 |
| ATE500337T1 (en) | 2011-03-15 |
| US20130024998A1 (en) | 2013-01-24 |
| US8455715B2 (en) | 2013-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2316954B1 (en) | Method for performing homologous recombination in plants | |
| CN102812034B (en) | Targeted Genome Modification | |
| EP2415873B1 (en) | Optimized non-canonical zinc finger proteins | |
| TWI424061B (en) | Method for homologous recombination of zinc finger nuclease vector | |
| CN101668856B (en) | Optimized non-canonical zinc finger proteins | |
| US20150189844A1 (en) | Method for performing homologous recombination | |
| EP2258859A1 (en) | Method for performing homologous recombination | |
| HK1195777A (en) | Optimized non-canonical zinc finger proteins | |
| HK1142096A (en) | Optimized non-canonical zinc finger proteins | |
| HK1178907A (en) | Targeted genomic alteration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07765265 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007253458 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2650548 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007765265 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007253458 Country of ref document: AU Date of ref document: 20070515 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12301358 Country of ref document: US |
