WO2007109908A1 - Therapeutic yb-1 phosphorylation decoys - Google Patents

Therapeutic yb-1 phosphorylation decoys Download PDF

Info

Publication number
WO2007109908A1
WO2007109908A1 PCT/CA2007/000526 CA2007000526W WO2007109908A1 WO 2007109908 A1 WO2007109908 A1 WO 2007109908A1 CA 2007000526 W CA2007000526 W CA 2007000526W WO 2007109908 A1 WO2007109908 A1 WO 2007109908A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
phosphorylation
cell
phosphorylation inhibitor
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2007/000526
Other languages
French (fr)
Inventor
Sandra E. Dunn
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of British Columbia
Original Assignee
University of British Columbia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of British Columbia filed Critical University of British Columbia
Publication of WO2007109908A1 publication Critical patent/WO2007109908A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif

Definitions

  • aspects of the invention relate to inhibitors of transcription factor phosphorylation, more specifically, selective peptidic inhibitors of YB-1 phosphorylation that have therapeutic activity.
  • Y-box binding protein-1 (YB-1 ) is a transcription and translation factor that alters the expression of at least ten genes associated with drug resistance and tumour cell growth (JANZ et al 2002, lnt J Cancer 97:278-282; JURCHOTT et al 2003, J Biol Chem 278:27988-27996; EN-NIA et al 2004, J boil Chem 280:7702-7711; SHIBAO et al 1999, In J Cancer 83:732-737).
  • the YB-1 protein is highly expressed in cancers of the breast (BARGOU et al 1997, Nature Med 3: 447-450), prostate (GIMENEZ-BONAFE et al 2004,
  • YB-1 is associated with particularly aggressive tumors and a prognosis of poor survival (RUBENSTEIN et al 2002 Cancer Res. 62:4985-4991; JANZ, supra). YB-1 is not expressed at detectable levels in normal tissues (BARGOU, supra; RUBENSTEIN, supra).
  • YB-1 was originally isolated in an attempt to identify DNA binding proteins that interact with the epidermal growth factors EGFR and HER2
  • YB-1 resides primarily in the cytoplasm but translocates to the nucleus, in a yet-undefined manner, where it binds to promoters with a 5'- CTGATTG -3' motif.
  • YB-1 interacts with RNA to regulate translation (EVDOKIMOVA et al 2001 EMBO J 20:5491-5502), while in the nucleus it binds to DNA and controls transcription (KUWANO et al 2003, Cancer Sci 94:9-14).
  • YB-1 has been characterized for its ability to regulate at least ten genes that promote tumour growth and/or drug resistance.
  • cyclin A cyclin A
  • cyclin B egfr
  • her-2 YB-1 also partners with other transcription factors such as p53 (LASHAM et al 2003 J Biol Chem 35516-35523) and AP-2 ⁇ MERTENS et al 1998 J Biol Chem 273:32957-32965), and with cofactors (e.g., p300), to regulate gene expression (HIGASHI et al 2003 J Biol Chem 278:43470-43479).
  • p53 LASHAM et al 2003 J Biol Chem 35516-35523
  • AP-2 ⁇ MERTENS et al 1998 J Biol Chem 273:32957-32965
  • cofactors e.g., p300
  • YB-1 is phosphorylated at serine 102 by AKT, and this phosphorylation event is important in nuclear trafficking and DNA binding of YB-1. Inhibition of this phosphorylation halts tumor cell growth (SUTHERLAND et al 2005 Oncogene 24:4281-4292).
  • the effect of YB-1 on cell growth may be cell-type specific, as YB-1 has demonstrated growth- suppressing effects in chicken embryo fibroblasts (BADER et al 2003. Proc Nat Acad Sci 100:12384-12389). YB-1's expression across several cancer types is consistent with this.
  • Tumor cells are dependent on YB-1 - melanoma, adenocarcinoma, hepatoma, fibrosarcoma, colon cancer and breast tumor cells die when its expression is knocked out with antisense RNA (LASHAM supra).
  • the human epidermal growth factor receptors (HER1/EGFR, HER2, HER3 and HER4) are important for sustaining the growth of breast cancer cells (YARDEN 2001. Oncology 61:1-13). These receptors form homodimers and heterodimers to activate signal transduction in response ligands such as EGF, amphiregulin, and heregulin.
  • EGFR and HER2 are over-expressed in a subset of breast cancers (NIELSEN et al. 2004 CHn Cancer Res 10:5367- 5374; SLAMON et al 1987, Science 235:177-182). Over-expression of EGFR is generally due to transcriptional activation (KERSTING etal 2004.
  • YB-1 has been implicated as having a causative or pathological role in a variety of diseases (which may therefore be identified as YB-1 mediated diseases), apart from cancer, including: heart disease (Kamalov et al 2005,
  • Protein transduction domains have been used to deliver a wide variety of therapeutics, such as protein-based drugs for treating breast cancer (Harada et al 2006, Breast Cancer 13(1 ):16-26).
  • liposomal formulations including liposomal formulations that are decorated with protein transduction domans, may be useful for delivering protein-based drugs (Torchilin et al 2001 , Proc Natl Acad Sci USA 98:8786-8791).
  • An extensive reference list is provided below, incorporated herein by reference, documenting the use of protein transduction domains and related molecules. Table 1 sets out a number of protein transduction domains described in the literature.
  • the invention provides analogues of the YB-1 Akt phosphorylation site that are capable of inhibiting pathological cellular activities.
  • the invention provides cell permeable YB-1 phosphorylation inhibitors having a peptidic sequence that is a YB-1 selective Akt phosphorylation site.
  • a method of inhibiting YB-1 mediated transcription comprising contacting a cell with an inhibitor of Akt mediated YB-1 phosphorylation, so that transcriptional activation of YB-1 is in turn inhibited.
  • a method of treating a YB-1 expressing cell such as a cancer cell, for example a cell in a patient or test subject, the method comprising administering a chemotherapeutic regimen comprising an inhibitor of YB-1 phosphorylation or YB-1 mediated transcription.
  • a method of modulating metastasis of a cell expressing YB-1 comprising contacting a cell with an inhibitor of YB-1 phosphorylation and transcriptional activation.
  • the inhibitor of YB-1 phosphorylation or YB- 1 mediated transcription may be a fragment of YB-1 , or may be a peptide substantially similar to a fragment of YB-1.
  • the inhibitor of YB-1 phosphorylation or transcriptional activation may be a peptidomimetic
  • the inhibitor of YB-1 phosphorylation may be a peptide according to SEQ ID NO: 12, or a peptide substantially similar to SEQ ID NO: 12.
  • the inhibitor of YB-1 phosphorylation or YB-1 mediated transcription may be an antibody that binds a protein having a sequence according to SEQ ID NO: 12, or a sequence substantially similar to SEQ ID NO: 12.
  • a YB-1 expressing cell such as a cancer cell
  • Cancers or cancer cells amenable for treatment may for example be identifiable as a cancer of the pancreas, breast, thyroid, ovary, uterus, testis, prostate, thyroid, pituitary gland, adrenal gland, kidney, stomach, esophagus or rectum, head and neck, bone, nervous system, skin, blood, nasopharyngeal tissue, lung, urinary tract, cervix, vagina, exocrine glands or endocrine glands, or a cancer of unknown primary site.
  • a method of screening for an inhibitor of YB-1 phosphorylation or transcriptional activation comprising: providing a system comprising a reporter gene construct having a reporter gene and a YB-1 transcriptional activation sequence and transcriptionally active YB-1 ; providing an inhibitor of YB-1 transcriptional activation; providing a test compound; and contacting said system with said test compound and determining whether said test compound modulates YB-1 transcriptional activation.
  • polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12.
  • polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament, for example for use in a chemotherapeutic regimen.
  • a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a radiotherapeutic regimen.
  • a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a combination chemotherapeutic regimen.
  • polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a alternative therapeutic regimen.
  • Figure 1 The impact of YB-1 expression on patient survival. A total of 389 tumours were examined for YB-1 expression and patient survival was monitored over 20 years. Patients with tumours expressing YB-1 were less likely to survive long term based on log rank and Breslow (Gehan- Wilcoxon) survival analyses. Survival was based on disease specific survival (DSS).
  • DSS disease specific survival
  • FIG. 2 YB-1 binds directly to the EGFR promoter.
  • Endogenous YB-1 was immunoprecipitated from MDA-MB-231 cells and Chip was performed using primers to EGFRIb, EGFR2a, EGFR3 (lanes 1-4). The IgY ChIP was also performed as a negative control (lanes 6-9).
  • the expected product size for EGFR1 b, EGFR2a, EGFR2b and EGFR3 was 191 bp, 510 bp, 530 bp, and 493 bp (Lanes 10-13), respectively.
  • the no template control was also tested (lane 5-8).
  • Figure 3 Over-expression of YB-1 but not YB-1 (A102) results in induction of Her-2 and EGFR.
  • Flag:YB-1 increased levels of Her-2 and EGFR protein while the mutant Flag:YB-1(A102) did not. Proteins were isolated from cells stably expressing either the empty vector (EV), Flag:YB-1 , or Flag:YB- 1(A102). The relative levels of the transgenes were assessed using an antibody to Flag and YB-1. Vinculin was examined to ensure that the samples were equally loaded.
  • Flag:YB-1(A102) were serum starved for 24 hrs then stimulated with EGF (40 ng/ml) for 30 min. The cell lines were compared for relative amounts of P- ERK1/2. Total Erk1/2 was included as a control for sample loading.
  • FIG. 4 Small interfering RNA targeting YB-1 results in loss of EGFR and Her-2 expression.
  • SiYB-1#1 and siYB-1#2 differ in the amount of lipofectamine used (12.5 and 25 ul respectively), both were transfected with 0.8 ug of pSuperDuper targeting YB-1.
  • FIG. 5 Cell permeable peptide targeting YB-1 inhibits tumor growth.
  • MDA-MB-453 or SUM149 cells were plated at a density of 1000 cells/well in a 96-well plate and allowed to attach overnight. The next day, the cells were treated with increasing concentration of the peptide (12.5-50 uM) and tumour cell growth was measured after one week using the MTT assay.
  • Figure 6 YB-1 binds to the HER2 promoter
  • YB-1 :DNA complexes were isolated from MDA-MB-453 cells and amplified for Her-2 to confirm endogenous YB-1 binding. YB-1 bound to the Her-2 promoter (lane 2) whereas the IgY negative control did not (lane 3). The sheared input DNA served as a positive control
  • Figure 7 YB-1 binding to the EGFR promoter is inhibited with a peptide SEQ ID NO: 11.
  • EGFR promoter (lane 2) compared to the unbound biotin labeled oligonucleotide (lane 1 ). Binding was specific because cold competitive oligonucleotides to the same sequence diminished binding (lane 3).
  • the transcription factor responsible for binding was YB-1 because introducing either 1 or 2 ug (lanes 4-5) cause a super-shift in the binding product.
  • Figure 8 Cell permeable peptide inhibiting YB-1 phosphorylation inhibits growth of prostate tumor cells.
  • PC3 cells were plated at a density of 1000 cells/well in a 96 well plate and allowed to attach overnight. The next day, the cells were treated with increasing concentration of a peptide inhibitor of YB-1 phosphorylation (12.5-50 uM) and tumour cell growth was measured after one week using the MTT assay.
  • Cell treatment indicated on X-axis, % Absorbance at 490 nm on Y axis.
  • Figure 9 is a bar graph illustrating data that shows that a YB-1 phosphorylation inhibiting peptide does not affect the viability of primary, normal mammary EpCAM+ cells. Cell viability was measured using MTS assay after 72-hour exposure of two different patient samples to either a scrambled control peptide or the YB-1 specific peptide.
  • Figure 10 illustrates that a YB-1 phosphorylation inhibiting peptide is more toxic to a breast cancer cell line than to an immortalized line of "normal" breast epithelial cells.
  • 'peptide', 'polypeptide' and protein' may be used interchangeably, and refer to a compound comprised of at least two amino acid residues covalently linked by peptide bonds or modified peptide bonds, for example peptide isosteres (modified peptide bonds) that may provide additional desired properties to the peptide, such as increased half-life.
  • a peptide may comprise at least two amino acids.
  • the amino acids comprising a peptide or protein described herein may also be modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in a peptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It is understood that the same type of modification may be present in the same or varying degrees at several sites in a given peptide.
  • modifications to peptides may include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer- RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See,
  • Amino acid or nucleic acid sequence similarity or identity may be computed by using the BLASTP and TBLASTN programs which employ the
  • BLAST basic local alignment search tool 2.0 algorithm. Techniques for computing amino acid sequence similarity or identity are well known to those skilled in the art, and the use of the BLAST algorithm is described in ALTSCHUL et al. 1990, J MoI. Biol. 215: 403- 410 and ALTSCHUL et al. (1997), Nucleic Acids Res. 25: 3389-3402.
  • sequence identity may for example be at least 75%, at least 90% or at least 95%.
  • Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer
  • Sequence alignment may also be carried out using the BLAST algorithm, described in Altschul et al., 1990, J. MoI. Biol. 215:403-10 (using the published default settings).
  • Software for performing BLAST analysis may be available through the National Center for Biotechnology Information (through the internet at ncbi.nlm.nih.gov/).
  • BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold.
  • Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • the BLAST programs may use as defaults a word length (W) of 11 , the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc.
  • the BLOSUM matrix assigns a probability score for each position in an alignment that is based on the frequency with which that substitution is known to occur among consensus blocks within related proteins.
  • a variety of other matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1 ,0.87); PAM70 (10,1 ,0.87) BLOSUM80 (10,1 ,0.87); BLOSUM62 (11 ,1 ,0.82) and BLOSUM45 (14,2,0.87), the latter of which is set out below.
  • nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
  • Amino acids may be described as, for example, polar, non-polar, acidic, basic, aromatic or neutral.
  • a polar amino acid is an amino acid that may interact with water by hydrogen bonding at biological or near-neutral pH.
  • the polarity of an amino acid is an indicator of the degree of hydrogen bonding at biological or near-neutral pH.
  • Examples of polar amino acids include serine, praline, threonine, cysteine, asparagine, glutamine, lysine, histidine, arginine, aspartate, tyrosine and glutamate.
  • non-polar amino acids examples include glycine, alanine, valine leucine, isoleucine, methionine, phenylalanine, and tryptophan.
  • Acidic amino acids have a net negative charge at a neutral pH.
  • acidic amino acids include aspartate and glutamate.
  • Basic amino acids have a net positive charge at a neutral pH.
  • Examples of basic amino acids include arginine, lysine and histidine.
  • Aromatic amino acids are generally nonpolar, and may participate in hydrophobic interactions. Examples of aromatic amino acids include phenylalanine, tyrosine and tryptophan. Tyrosine may also participate in hydrogen bonding through the hydroxyl group on the aromatic side chain.
  • Neutral, aliphatic amino acids are generally nonpolar and hydrophobic. Examples of neutral amino acids include alanine, valine, leucine, isoleucine and methionine.
  • An amino acid may be described by more than one descriptive category. Amino acids sharing a common descriptive category may be substitutable for each other in a peptide.
  • peptides or peptidic sequences having a sequence derived from the sequence of the Ser102 phosphorylation site of YB-1. That site has the sequence PRKYLRSVG, encompassing an Akt phosphorylation consensus seqeunce of RXXXRS. This sequence differs from the typical consensus sequence for Akt phosphorylation, which is RXRXXS/T. Accordingly, the distinct phosphorylation consensus sequence of the invention provides a YB-1 selective Akt phosphorylation site.
  • YB-1 phosphorylation inhibitors may include peptides that differ from a portion of the native YB-1 phosphorylation site by conservative amino acid substitutions.
  • conservative amino acid substitutions refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without loss of function.
  • substitutions of like amino acid residues can be made, for example, on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing.
  • conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0), where the following hydrophilicity values are assigned to amino acid residues (as detailed in United States Patent No.
  • conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydropathic index (e.g., within a value of plus or minus 2.0).
  • each amino acid residue may be assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics, as follows: He
  • conserved amino acid substitutions may be made where an amino acid residue is substituted for another in the same class, where the amino acids are divided into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala, VaI, Leu, lie, Phe, Trp, Pro, Met; acidic: Asp, GIu; basic: Lys, Arg, His; neutral: GIy, Ser, Thr, Cys, Asn, GIn, Tyr.
  • the invention provides YB-1 phosphorylation inhibitors comprising a contiguous sequence of at least nine residues of the formula:
  • Xi is Z or N or D or H or S or X
  • X 2 is Z or N or D or H or S or X
  • X 3 is Z or P
  • X 4 is R X 5 is K or R or E or Q or X
  • X 6 is Y or F or W or X
  • X 7 is L or M or I or V or F or X X 8 is R X 9 is S
  • X-io is Z or V or I or L or M or X Xn is Z or G or X in which
  • the YB-1 phosphorylation inhibitor of the foregoing formula may have:
  • X 1 is Z or N or D
  • X 2 is Z or N or D
  • X 3 is Z or P
  • X 5 is K or R
  • X 6 is Y or F or W
  • X 7 is L or M or I
  • X 10 is Z or V or I
  • X 12 is Z or D or N or E.
  • sequence variants of the invention encompassing the forging sequences, in which a number of the residues of the Ser102 phosphorylation site of YB-1 may be replaced with conservative amino acid substitutions, in which these substitutions have positive (favourable) substitution scores on the BLOSUM 45 matrix (set out above).
  • Amino acids comprising the peptides described herein will be understood to be in the L- or D- configuration.
  • D-amino acids may be substitutable for L-amino acids.
  • Amino acids contained within the peptides of the present invention, and particularly at the carboxy-or amino-terminus, may be modified by methylation, amidation, acetylation or substitution with other chemical groups which may change the circulating half-life of the peptide without adversely affecting their biological activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
  • Nonstandard amino acids may occur in nature, and may or may not be genetically encoded.
  • examples of genetically encoded nonstandard amino acids include selenocysteine, sometimes incorporated into some proteins at a UGA codon, which may normally be a stop codon, or pyrrolysine, sometimes incorporated into some proteins at a UAG codon, which may normally be a stop codon.
  • Some nonstandard amino acids that are not genetically encoded may result from modification of standard amino acids already incorporated in a peptide, or may be metabolic intermediates or precursors, for example.
  • nonstandard amino acids examples include 4-hydroxyproline, 5- hydroxylysine, 6-N-methyllysine, gamma-carboxyglutamate, desmosine, selenocysteine, ornithine, citrulline, lanthionine, 1-aminocyclopropane-1- carboxylic acid, gamma-aminobutyric acid, carnitine, sarcosine, or N- formylmethionine.
  • Synthetic variants of standard and non-standard amino acids are also known and may include chemically derivatized amino acids, amino acids labeled for identification or tracking, or amino acids with a variety of side groups on the alpha carbon.
  • side groups examples include aliphatic, single aromatic, polycyclic aromatic, heterocyclic, heteronuclear, amino, alkylamino, carboxyl, carboxamide, carboxyl ester, guanidine, amidine, hydroxyl, alkoxy, mercapto-, alkylmercapto-, or other heteroatom-containing side chains.
  • Other synthetic amino acids may include alpha-imino acids, non-alpha amino acids such as beta-amino acids, des-carboxy or des-amino acids. Synthetic variants of amino acids may be synthesized using general methods known in the art, or may be purchased from commercial suppliers, for example RSP Amino Acids LLC (Shirley, MA).
  • a peptidomimetic is a compound comprising non-peptidic structural elements that mimics the biological action of a parent peptide.
  • a peptidomimetic may not have classical peptide characteristics such as an enzymatically scissile peptidic bond.
  • a parent peptide may initially be identified as a binding sequence or phosphorylation site on a protein of interest, or may be a naturally occurring peptide, for example a peptide hormone.
  • Assays to identify peptidomimetics may include a parent peptide as a positive control for comparison purposes, when screening a library, such as a peptidomimetic library.
  • a peptidomimetic library is a library of compounds that may have biological activity similar to that of a parent peptide.
  • the term 'antibody' as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, or humanized antibodies, as well as Fab or F(ab) 2 fragments, including the products of an Fab or other immunoglobulin expression library.
  • Peptides according to one embodiment of the invention may include peptides comprising the amino acid sequence PRKYLRSVG (SEQ ID NO: 12).
  • Other peptides according to other embodiments of the invention may include peptides having a substantially similar sequence to that of SEQ ID NO: 12.
  • Such peptides may be in isolation, or may be linked to or in combination with tracer compounds, protein translocation sequences, liposomes, carbohydrate carriers, polymeric carriers or other agents or excipients as will be apparent to one of skill in the art.
  • such peptides may comprise a medicament, wherein such peptides may be present in a pharmacologically effective amount.
  • a “medicament” refers to a composition that may be administered to a patient or test subject and is capable of producing an effect in the patient or test subject.
  • the effect may be chemical, biological or physical, and the patient or test subject may be human, or a non-human animal, such as a rodent or transgenic mouse, or a dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit or pig.
  • the medicament may be comprised of the effective chemical entity alone or in combination with a pharmaceutically acceptable excipient.
  • excipient' may include any and all solvents, dispersion media, coatings, antibacterial, antimicrobial or antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • An excipient may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal or oral administration.
  • An excipient may include sterile aqueous solutions or dispersions for extemporaneous preparation of sterile injectable solutions or dispersion. Use of such media for preparation of medicaments is known in the art.
  • bioactive molecules such as peptides
  • Delivery of bioactive molecules such as peptides, to a cell or cells in a reasonably efficient manner may require more than just the 'dumping' of the naked peptide onto the cell, or administering the naked peptide into the patient or test subject.
  • Agents that enable delivery of bioactive molecules into cells in a suitable manner so as to provide an effective amount, such as a pharmacologically effective amount are known in the art, and are described in, for example, DIETZ et al 2004. MoI Cell. Neurosci 27:85-131.
  • agents include liposomes, antibodies or receptor ligands that may be coupled to the bioactive molecule, viral vectors, and protein transduction domains (PTD).
  • PTDs include Antennapedia homeodomain (PEREZ et al 1992 J. Cell Sci 102:717-722), transportan (POOGA et al 1998 FASEB J 12: 67-77), the translocation domains of diphtheria toxin
  • the term 'pharmacologically effective amount' of a medicament may refer to an amount of a medicament present in such a concentration to result in a therapeutic level of drug delivered over the term that the drug is used and producing a chemical, biological or physical effect in the patient or test subject.
  • the pharmacologically effective amount may be dependent on the mode of delivery, site of administration of the medicament, time period of the dosage, age, weight, general health, sex or diet of the patient or test subject receiving the medicament.
  • cancer refers to a proliferative disorder caused or characterized by the proliferation of cells which have lost susceptibility to normal growth control.
  • the term cancer as used in the present application, includes tumors and any other proliferative disorders.
  • Cancers of the same tissue type usually originate in the same tissue, and may be divided into different subtypes based on their biological characteristics.
  • Four general categories of cancers are carcinoma (epithelial tissue derived), sarcoma (connective tissue or mesodermal derived), leukemia (blood-forming tissue derived) and lymphoma (lymph tissue derived). Over 200 different types of cancers are known, and every organ and tissue of the body may be affected. Specific examples of cancers that do not limit the definition of cancer may include melanoma, leukemia, astrocytoma, glioblastoma, retinoblastoma, lymphoma, glioma, Hodgkins' lymphoma and chronic lymphocyte leukemia.
  • organs and tissues that may be affected by various cancers include pancreas, breast, thyroid, ovary, uterus, testis, prostate, thyroid, pituitary gland, adrenal gland, kidney, stomach, esophagus or rectum, head and neck, bone, nervous system, skin, blood, nasopharyngeal tissue, lung, urinary tract, cervix, vagina, exocrine glands and endocrine glands.
  • a cancer may be multicentric or of unknown primary site (CUPS).
  • a 'cancerous cell' refers to a cell that has undergone a transformation event and whose growth is no longer regulated to the same extent as before said transformation event.
  • a tumor refers to a collection of cancerous cells, often found as a solid or semi-solid lump in or on the tissue or a patient or test subject.
  • a cancer or cancerous cell may be described as "sensitive to” or “resistant to” a given therapeutic regimen or chemotherapeutic agent based on the ability of the regimen to kill cancer cells or decrease tumor size, reduce overall cancer growth (i.e. through reduction of angiogenesis), and/or inhibit metastasis. Cancer cells that are resistant to a therapeutic regimen may not respond to the regimen and may continue to proliferate. Cancer cells that are sensitive to a therapeutic regimen may respond to the regimen resulting in cell death, a reduction in tumor size, reduced overall growth or inhibition of metastasis. Monitoring of a response may be accomplished by numerous pathological, clinical and imaging methods as described herein and known to persons of skill in the art.
  • a common theme for a chemotherapeutic agent or combination of agents is to induce death of the cancerous cells.
  • DNA adducts such as nitrosoureas, busulfan, thiotepa, chlorambucil, cisplatin, mitomycin, procarbazine, or dacacarbazine slow the growth of the cancerous cell by forcing the replicating cell to repair the damaged DNA before the M-phase of the cell cycle, or may by themselves cause sufficient damage to trigger apoptosis of the cancerous cell.
  • chemotherapeutic agents may enable the cancerous cell to be killed by aspects of the patient or test subject's humoral or acquired immune system, for example, the complement cascade or lymphocyte attack.
  • a cancerous cell resistant to a chemotherapeutic agent or combination of agents may fight for its survival by actively transporting the drug out of the cell for example, by overexpression of the ABC transporter MDR1 p-glycoprotein (FORD et al 1993. Cytotechnol. 12:171-212) or acquiring 'counter-mutations' to counteract the drugs.
  • mutations in the DNA repair enzymes that affect the ability to detect damage to the cells' DNA may enable replication of the damaged DNA and permit the cancerous cells to continue replicating, enlarging the tumor. As mutations accumulate, other regulatory points that would otherwise act in a normal cell cycle cease to function, and the cycle of unrequlated growth cascades.
  • chemotherapeutic resistance involves the tumor cells' avoidance of apoptosis.
  • a host organism's normal response to dysregulated cell growth is to initiate apoptosis and eliminate the defective cell before the cascade into uncontrolled replication begins, however this may be subverted by a cancerous cell, for example, by disruption of signal transduction events, loss of adhesion dependence or contact inhibition in the cancerous cell, or loss of apoptosis-promoting factors, often considered 'tumor suppressors', for example p53, BRCA1 or RB.
  • a 'therapeutic regimen refers to a chemotherapeutic regimen or a radiotherapy regimen, or a combination thereof.
  • a "chemotherapeutic regimen” or “chemotherapy” refers to the use of at least one chemotherapy agent to destroy cancerous cells. There are a myriad of such chemotherapy agents available to a clinician. Chemotherapy agents may be administered to a subject in a single bolus dose, or may be administered in smaller doses over time. A single chemotherapeutic agent may be used (single-agent therapy) or more than one agent may be used in combination (combination therapy). Chemotherapy may be used alone to treat some types of cancer. Alternatively, chemotherapy may be used in combination with other types of treatment, for example, radiotherapy or alternative therapies (for example immunotherapy) as described herein. Additionally, a chemosensitizer may be administered as a combination therapy with a chemotherapy agent.
  • a 'chemotherapeutic agent' refers to a medicament that may be used to treat cancer, and generally has the ability to kill cancerous cells directly.
  • chemotherapeutic agents include alkylating agents, antimetabolites, natural products, hormones and antagonists, and miscellaneous agents. Examples of alternate names are indicated in brackets.
  • alkylating agents include nitrogen mustards such as mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine and thiotepa; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozocin (streptozotocin); DNA synthesis antagonists such as estramustine phosphate; and triazines such as dacarbazine (DTIC, dimethyl-triazenoimidazolecarboxamide) and temozolomide .
  • nitrogen mustards such as mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil
  • antimetabolites include folic acid analogs such as methotrexate (amethopterin); pyrimidine analogs such as fluorouracin (5- fluorouracil, 5-FU, 5FU), floxuridine (fluorodeoxyuridine, FUdR), cytarabine
  • folic acid analogs such as methotrexate (amethopterin)
  • pyrimidine analogs such as fluorouracin (5- fluorouracil, 5-FU, 5FU), floxuridine (fluorodeoxyuridine, FUdR), cytarabine
  • cytosine arabinoside and gemcitabine
  • purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG) and pentostatin (2'-deoxycoformycin, deoxycoformycin), cladribine and fludarabine
  • topoisomerase inhibitors such as amsacrine.
  • Examples of natural products include vinca alkaloids such as vinblastine (VLB) and vincristine; taxanes such as paclitaxel and docetaxel (Taxotere); epipodophyllotoxins such as etoposide and teniposide; camptothecins such as topotecan and irinotecan; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, bleomycin, mitomycin (mitomycin C), idarubicin, epirubicin; enzymes such as L- asparaginase; and biological response modifiers such as interferon alpha and interlelukin 2.
  • VLB vinblastine
  • Taxanes such as paclitaxel and docetaxel (Taxotere)
  • epipodophyllotoxins such as etoposide and teniposide
  • camptothecins such as to
  • hormones and antagonists include luteinising releasing hormone agonists such as buserelin; adrenocorticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and fluoxymesterone and related preparations; androgen antagonists such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs such as leuprolide.
  • releasing hormone agonists such as buserelin
  • adrenocorticosteroids such as prednisone and related preparations
  • progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol
  • miscellaneous agents include thalidomide; platinum coordination complexes such as cisplatin (c/s-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methyl hydrazine derivatives such as procarbazine (N-methylhydrazine, MIH); adrenocortical suppressants such as mitotane (o,p'-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as imatinib.
  • platinum coordination complexes such as cisplatin (c/s-DDP), oxaliplatin and carboplatin
  • anthracenediones such as mitoxantrone
  • substituted ureas such as hydroxyurea
  • methyl hydrazine derivatives such as procarbazine (
  • a 'chemosensitizer' refers to a medicament that may enhance the therapeutic effect of a chemotherapeutic agent or radiotherapy treatment and therefore improve efficacy of such treatment or agent.
  • examples of chemosensitizers may be found in Table 3.
  • the sensitivity or resistance of a tumor or cancerous cell to treatment may also be measured in an animal, such as a human or rodent, by measuring the tumor size reduction over a period of time. For example, 6 months for a human and 4-6 weeks for a mouse.
  • a composition or a method of treatment may sensitize a tumor or cancerous cell's response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 10% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method.
  • the determination of sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician.
  • WellStat triacetyluridine a prodrug of the nucleoside uridine, to enable higher dosage of 5-FU to be administered to cancer patients
  • radiotherapeutic regimen refers to the administration of radiation to kill cancerous cells. Radiation interacts with various molecules within the cell, but the primary target, which results in cell death is the deoxyribonucleic acid (DNA). However, radiotherapy often also results in damage to the cellular and nuclear membranes and other organelles. DNA damage usually involves single and double strand breaks in the sugar-phosphate backbone. Furthermore, there can be cross-linking of DNA and proteins, which can disrupt cell function.
  • DNA damage usually involves single and double strand breaks in the sugar-phosphate backbone. Furthermore, there can be cross-linking of DNA and proteins, which can disrupt cell function.
  • Electromagnetic radiation results in indirect ionization acting through short-lived, hydroxyl free radicals produced primarily by the ionization of cellular water.
  • Clinical applications of radiation consist of external beam radiation (from an outside source) and brachytherapy (using a source of radiation implanted or inserted into the patient).
  • External beam radiation consists of X-rays and/or gamma rays, while brachytherapy employs radioactive nuclei that decay and emit alpha particles, or beta particles along with a gamma ray.
  • Radiotherapy may further be used in combination chemotherapy, with the chemotherapeutic agent acting as a radiosensitizer.
  • the specific choice of radiotherapy suited to an individual patient may be determined by a physician or oncologist, taking into consideration the tissue and stage of the cancer. Examples of radiotherapy approaches to various cancers may be found in, for example "Clinical Oncology", 3 rd edition. Churchill Livingstone/ Elsevier Press, 2004. ABELOFF, MD. editor.
  • alternative therapeutic regimen or “alternative therapy” may include for example, receptor tyrosine kinase inhibitors (for example IressaTM (gefitinib), TarcevaTM (erlotinib), ErbituxTM (cetuximab), imatinib mesilate (GleevecTM), proteosome inhibitors (for example bortezomib, VelcadeTM); VEGFR2 inhibitors such as PTK787
  • receptor tyrosine kinase inhibitors for example IressaTM (gefitinib), TarcevaTM (erlotinib), ErbituxTM (cetuximab), imatinib mesilate (GleevecTM), proteosome inhibitors (for example bortezomib, VelcadeTM); VEGFR2 inhibitors such as PTK787
  • aurora kinase inhibitors for example ZM447439
  • an immunotherapeutic agent would also be considered an alternative therapeutic regimen.
  • alternative therapies may include other biological-based chemical entities such as polynucleotides, including antisense molecules, polypeptides, antibodies, gene therapy vectors and the like.
  • Such alternative therapeutics may be administered alone or in combination, or in combination with other therapeutic regimens described herein.
  • Alternate names and trade-names of these agents used in alternative therapeutic regimens and additional examples of agents used in alternative therapeutic regimens, and their methods of use including dosing and administration regimens will be known to a physician versed in the art.
  • methods of use of chemotherapeutic agents and other agents used in alternative therapeutic regimens in combination therapies, including dosing and administration regimens will also be known to a physician versed in the art.
  • a 'YB-1 expressing cancer' or a 'YB-1 expressing cancerous cell' refers to a cancer or cancerous cell that expresses Y-box protein 1 (YB-1 ).
  • the relative level of YB-1 protein or nucleic acid transcript may be at the same level as a non-cancerous cell, or may be found at a level higher than that in a non-cancerous cell.
  • the level of YB-1 protein or nucleic acid transcript expression may be at least 10% higher than that in a noncancerous cell.
  • the level of YB-1 protein or nucleic acid transcript expression may be 25%, 50%, 100%, 200% or greater than that in a non-cancerous cell.
  • Levels of expression of specific protein or nucleic acids may be determined using methods known to those of skill in the art, and are described in, for example AUSUBEL et a/., Current Protocols in Molecular
  • YB-1 acts as a transcriptional activator of some genes, some of which have key roles in the development and progression of some cancers. For example, expression of YB-1 in some cell lines induces expression of
  • methods of inhibiting expression of YB-1 in a YB-1 expressing cancer or a YB-1 expressing cancerous cell may include contacting the cell or cells with an inhibitor of YB-1 expression, for example an siRNA of YB-1.
  • YB-1 transcriptional activation may also be inhibited, and reduce the expression of a gene having YB-1 binding sequences or motifs. Inhibiting the binding of YB-1 to a promoter motif of a YB-1 responsive gene, for example EGFR, inhibits cell growth.
  • methods of inhibiting YB-1 mediated transcription in a YB-1 expressing cancer or cancerous cell may include contacting the cell or cells with an inhibitor of YB-1 transcriptional activation, or a peptidic sequence that is a YB-1 selective Akt phosphorylation recognition site, for example, a peptide corresponding to SEQ ID NO: 12, or a substantially similar sequence thereof. While a YB-1 selective Akt phosphorylation recognition site may have sequence similarity to a native YB- 1 site recognized by Akt, there is no requirement for such recognition to result in phosphorylation of the peptidic sequence in each embodiement.
  • an inhibitor of YB-1 transcriptional activation may include an antibody or antibody fragment capable of binding to a sequence corresponding to SEQ ID NO: 12.
  • YB-1 transcriptional inhibitors in combination therapy with known chemotherapeutic agents or alternative therapeutic agents, for example ERBITUXTM (cetuximab) or HERCEPTIN TM (trastuzumab).
  • chemotherapeutic agents or alternative therapeutic agents for example ERBITUXTM (cetuximab) or HERCEPTIN TM (trastuzumab).
  • HERCEPTIN TM trastuzumab
  • a cancerous cell must express EGFR to be sensitive to cetuximab, or express HER2 to be sensitive to trastuzumab, however a subset of cancerous cells expressing either of these receptors are resistant to these therapeutic agents.
  • a YB-1 transcriptional inhibitor for example a peptide corresponding to SEQ ID NO: 12 or a substantially similar sequence
  • chemotherapeutic agents may sensitize the cancerous cells to the chemotherapeutic agent, or may enable a lower dosage of the chemotherapeutic agent.
  • a YB-1 transcriptional inhibitor used in this manner may also be described as a chemosensitizer, or if used in combination with radiotherapy, a radiosensitizer.
  • Tissue microarrays were constructed from 438 cases of breast carcinoma from the archives at Vancouver General Hospital, as described previously (SUTHERLAND et al 2005. Oncogene 24:4281-4292; MAKRETSOV et al 2003. Hum. Pathol 34:1001-1008). Duplicate 0.6 mm cores of formalin-fixed paraffin embedded cores were used for array construction. Tissue microarray (TMA) slides were immunostained for EGFR and Her-2 as previously described (KUCAB et al 2005. Breast Cancer Res
  • YB-1 tumors showing no staining or weak focal staining were considered to be YB-1 negative, while moderate or intense staining was considered positive.
  • YB-1 immunostaining was predominantly found in the cytoplasm. The statistical analyses were based on the amount of YB-1 expressed in the cytoplasm.
  • Tissue microarray slides were digitized using Bliss slide scanner based on Olympus BX61 microscope (Bacus Laboratories, Inc., Lombard, IL). Nine pictures were taken from each core, and the pixel dimensions were tiled to create a composite image. The images were viewed using the WebSlide Browser program (Bacus Laboratories).
  • a Kaplan-Meier curve was generated using a non-parametric method for survival. Survival estimates (log rank and Breslow) are based on the weighted differences between actual and expected numbers of deaths at the observed time points. The log rank test factors in all deaths equally, while Breslow tests give more weight to early deaths. All statistical analyses were performed using the SPSS 11.0 statistical package.
  • Cox regression model is used for multivariate survival analysis. Tumor collection and analyses were performed in accordance with the guidelines established by the Vancouver General Hospital Research Ethics Board.
  • PC-3, MCF-7, MDA-MB-231 , MDA-MB-468 and MDA-MB-453 breast cancer cell lines were obtained from the American Type Culture Collection (Manassas, VA). SUM149 cells were obtained from Astrand. JMIT-1 cells were obtained from the BC Cancer Agency (Dr. M. Bally). The C-terminal rabbit polyclonal antisera was produced as previously described
  • MCF-7 cells expressing the various constructs were also serum starved overnight then stimulated with EGF (40 ng/ml) for 30 min. The extracts were then evaluated for activation of signaling through the MAP kinase pathway using P-Erk 1/2 antibody (Thr 202/Tyr 204,1 :1000, Cell Signaling).
  • TATA box binding protein mRNA was measured as a housekeeping gene (Applied Biosystems) as previously described (OH et al 2002 Neoplasia 4:204-217). Each sample was analyzed in replicates of four on two separate occasions.
  • MTT assay 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy- methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) and phenazine methosulfate (PMS), were mixed in the proportions 2:0.92 ⁇ g/ml, and 25 ⁇ l of the mixture was added to each well. After incubation at 37 0 C with
  • Chromatin Immunoprecipitation [0085] ChIP assays were performed using the ChIP-IT kit (Active Motif
  • MCF7/Flag:YB-1 and MCF7/Flag:YB-1A102 cells were grown on 15-cm plates in phenol-red free RPMI with 5%FBS and 400 ⁇ g/ml G418. The cells (8x10 6 cells/150 mm dish, 80% confluent) were fixed for 10min with 1% formaldehyde. After quenching the reaction with glycine for 5min, cells were treated with Lysis Buffer and extracted using a Dounce homogenizer.
  • the nuclei were isolated and chromatin was sonicated in Shearing Buffer using a Cole Parmer Ultrasonic Processor at 25% power with 10 pulses of 20 seconds each and a 30 seconds rest on ice between each pulse to give chromatin fragments between 200bp and 1 kb. Chromatin was then pre- cleared with salmon sperm DNA/protein G agarose and incubated with 3 ⁇ g anti-FLAG M2 monoclonal antibody (Sigma #F3165) overnight at 4 0 C. Chromatin incubated with 3 ⁇ g mouse IgG overnight at 4 0 C was used as a negative control. Salmon sperm DNA/protein G agarose was subsequently incubated with the chromatin and antibody for 1.5hr at 4 0 C.
  • the immunoprecipitated material was washed twice with ChIP IP Buffer, 5 times with Wash Buffer 1 , twice with Wash Buffer 2, and 3 times with Wash Buffer 3.
  • the immunoprecipitated material was incubated in 20OmM NaCI and 10 ⁇ g RNase A overnight at 65 0 C.
  • the proteins were then removed by proteinase K treatment, and DNA was purified using the DNA purification minicolumns provided with the kit.
  • Eluted DNA (5 ul) was amplified by PCR with the following primers: EGFR1 b: 5'- TCGCCGCCAACGCCACAAC-3' (forward) (SEQ ID NO: 1 ) and
  • EGFR2a 5'- CCGCGAG ⁇ TCCCTCGCATTTCT-3' (forward) (SEQ ID NO: 3) and 5'- CCTTCCCCCTTTCCCTTCTTTTGTTTTTTAC-3' (reverse) (SEQ ID NO: 4);
  • EGFR2b 5'- TCCCATTTGCCTTTCTCTAGTTTTGTTTTC-3' (forward) (SEQ ID NO: 5) and 5'- GTCCACCCCATCCCCACTGTTCC ⁇ CTC-3' (reverse) (SEQ ID NO: 6);
  • EGFR3 5'- TTCAGCAAACCCATTCTTCT-3' (forward) (SEQ ID NO: 7) and 5' GCTTCCTGCACACCTGGGCTGAG-3'
  • Endogenous YB-1 was subjected to ChIP using a chicken anti- human YB-1 polyclonal antibody, using a protocol adapted from the
  • Chromatin lmmunoprecipitation Assay Kit Upstate. In brief, 7.5 x 10 6 cells per plate were treated with 1 % formaldehyde in growth media then harvested, pelleted and washed with PBS. Pellets were resuspended in lysis buffer (1 % SDS, 1OmM EDTA, 5OmM Tris, (pH 8.1 )) and sheared on ice by sonication (25% power, 10 cycles of 20 seconds on, 30 seconds off).
  • Chromatin solution was diluted 5-fold in immunoprecipitation buffer (0.01 % SDS, 1% Triton X- 100, 1.2mM EDTA, 16.7mM Tris (pH 8.1 ), 50OmM NaCI) and precleared with PrecipHen beads (Aves Labs #P-1010) in lysis buffer (1 :3). The solution was then incubated with anti-YB-1 , chicken IgY, or pre-immune chicken IgY overnight. Complexes were incubated with 100ul of PrecipHen beads in lysis buffer (1 :3) for 1.5 hrs.
  • Tris-EDTA buffer (1OmM Tris pH 8.0, 1mM EDTA). Protein:DNA complexes were eluted twice with elution buffer (1 % SDS, 0.1 M NaHCO 3 ) and brief vortex. Eluates and input controls were treated with 5M NaCI at 65 0 C overnight followed by proteinase K at 45 0 C for 1 hr. DNA was purified by phenol/chloroform extraction and alcohol precipitation. PCR was performed with primers to EGFR as described above, or to Her-2. Her-2 primers used were: ⁇ '-AGGGGCTCCAAATAGAATGT (forward) (SEQ ID NO: 9), 5'-
  • the Her-2 primers produced a 464 bp product that spanned -978 to -514 of the HER2 promoter.
  • the DNA was amplified using the following PCR conditions: 95 0 C for 2min, 40 cycles of 95 0 C for 20sec, 57 0 C for 30sec, 72 0 C for 30sec.
  • RNA targeting YB-1 was expressed in pSuperDuper as previously described (EN-NIA et al. 2004 J Biol Chem 280:7702-7711).
  • the targeting vector was used to silence YB-1 in MCF- 7(Flag:YB-1 ) cells.
  • MCF- 7(Flag:YB-1 ) cells were plated in a 6-well dish and transfected with 0.8 ug of targeting vector plasmid DNA.
  • the plasmid DNA was added to the transfection reagent (Lipofectamine 2000, InVitrogen) at a ratio of 1 :12.5 (siYB-1 #1 ) or 1 :25 (siYB-1#2), 96 hrs later the cells were lysed in ELB buffer and evaluated for changes in YB-1 , EGFR and Her-2 by Western immunoblotting.
  • the transfection reagent Lipofectamine 2000, InVitrogen
  • Electrophoreic mobility shift assays were performed using the LightShift Chemiluminescent EMSA Kit (Pierce product # 20148), following manufacturer's instructions, with some modifications. Briefly, nuclear protein extracts from MDA-MB-468 cells were obtained with the NEPER Nuclear and Cytoplasmic Extraction Reagent Kit (Pierce, product # 78833), following manufacturer's instructions. 4 ug of nuclear extract protein was used per reaction. Oligonucleotide probes corresponding to EGFR promoter sequences (SEQ ID NO: 13 and SEQ ID NO: 14) were synthesized and labelled at the 5' end with biotin.
  • YB-1 antibody supershift assays 1 or 2 ug of YB-1 chicken polyclonal antibody was combined with the labelled probe and nuclear extract (no unlabelled probe).
  • nuclear extracts were pretreated with 0 (DMSO control), 12,5, 25 or 50 uM peptide corresponding to SEQ ID NO: 11 , followed by incubation with labelled EGFR peptide. Samples were electrophoretically separated on 6% non-denaturing polyacrylamide gel, transferred to nylon membrane and crosslinked, and visualized using chemiluminescence.
  • Biotin conjugated 25-mer peptides comprising the Antennapedia translocation domain and an additional 9 amino acids were synthesized using methods known in the art (Sigma, St. Louis MO) (RQIKIWFQNRRMKWKKPRKYLRSVG) (SEQ ID NO: 11 ).
  • Genomic DNA was amplified with each of the primer sets to produce a single gene product of the expected size. ChIP was then performed using an antibody to Flag. The anti-Flag:YB-1 antibody was able to precipitate DNA that was amplified with each of the EGFR primer sets, suggesting that YB-1 bound directly to the EGFR promoter region ( Figure 2B, lanes 1-4). DNA pulled down from MCF-7/Flag:YB-1(A102) could be amplified by the EGFR 2b and EGFR3 primer sets ( Figure 2B, lanes 7-8); however, there was no amplification when EGFR 1b and EGFR2a primer sets were used ( Figure 2B, lanes 5-6). The absence of PCR product from these sites with MCF-
  • EGFR and HER2 are regulated by YB-1
  • Flag:YB-1 was stably transfected into MCF-7 cells, to investigate a possible mechanistic link between YB-1 and expression of EGFR and HER2.
  • Example 3 YB-1 positively correlates with EGFR and Her-2 in primary breast tumours
  • Tumour tissue microarrays representing 389 primary breast tumours were immunostained for YB-1 , EGFR, Her-2, ER and Ki67.
  • YB-1 protein was coordinately expressed with Her-2 and EGFR as well as the proliferation marker Ki67 (Table 4).
  • Ki67 proliferation marker
  • YB-1 had a comparable impact on the relative risk of dying from breast cancer to expression of either HER2 or tumor size.
  • the relative risk ratios for YB-1 , HER2, lymph node status and tumor size were 1.792, 1.994, 2.436 and 1.788, respectively.
  • YB-1 siRNA results in decrease of EGFR, HER2 protein expression
  • the expression of YB-1 was silenced using small interfering RNA's.
  • MCF-7(Flag:YB-1 ) cells were transfected with pSuperDuper vector expressing small interfering RNA targeting YB-1 , and proteins were harvested 96 hours later.
  • the targeting vector suppressed the expression of Flag:YB-1 and endogenous YB-1 ( Figure 4A, lanes 2&3) compared to the empty vector ( Figure 4A, lane 1 ). Loss of YB-1 expression correlated with a decrease in EGFR protein expression ( Figure 4A, second panel).
  • YB-1#1 and siYB-1#2 Two different concentrations of the targeting vector were used (siYB-1#1 and siYB-1#2) and both resulted in suppression of EGFR. Likewise, knocking down YB-1 inhibited the expression of Her-2 ( Figure 4B). Similarly, knocking down YB-1 with a pSuper vector targeting different portion of YB-1 suppressed the expression of Her-2 in MDA-MB-453 cells (not shown). YB-1 was necessary for the expression of these receptors.
  • YB-1 inhibition suppresses growth of Herceptin resistant and EGFR- expressing cells
  • Herceptin resistant cells MDA-MB-453; see Kucab et al 2005, Breast Cancer Res. 7(5):R796-807; Menendez et al 2005, J Natl Cancer Inst. 2;97(21):1611-5) or EGFR over-expressing (SUM 149; see Kleer et al 2002, Oncogene 9;21 (20) :3172-80; Kleer et al 2004, Neoplasia 6(2): 179-85; Van den Eynden GG, Van Laere SJ, Van der Auwera I, Merajver SD, Van Marck EA, van Dam P, Vermeulen et al 2005, Breast Cancer Res Treat.
  • MDA-MB-453 cells demonstrate significant growth inhibition at peptide concentrations of 25 ⁇ M and greater, knocking back cell survival to less than 10% of control cells.
  • SUM 149 cells also demonstrated significant growth inhibition at peptide concentrations of 25 ⁇ M, with cell survival decreased to -60% of control, and less than 5% of control at 50 ⁇ M.
  • Nuclear extracts were taken from a breast cancer cell line that expresses high levels of EGFR, the MDA-MB-468 line, and assayed for EGFR-promoter binding and the presence of YB-1.
  • YB-1 binds directly to the EGFR promoter using a gel shift assay (Figure 7A).
  • Lane 1 shows the unbound, biotin-labelled EGFR probe
  • lane 2 shows the shift of the EGFR probe when bound by protein in the nuclear extract.
  • Lane 3 demonstrates the specificity of the binding to the EGFR probe by pre-incubation of the nuclear extract with unlabelled probe.
  • YB-1 specific antisera (lanes 4 and 5) was combined with bound, labeled probe, demonstrating the 'supershift' effect of the bound YB-1 antibody.
  • AP-CSD SEQ ID NO: 11
  • Lane 1 shows the labeled EGFR probe bound by protein from the nuclear extract.
  • the nuclear extract was pre-incubated with 12.5, 25 or 50 uM biotin labeled peptide before incubating with the labeled EGFR probe.
  • YB-1 to the EGFR promoter sequence was inhibited by the AP-CSD peptide.
  • PC3 prostate adenocarcinoma cells represent an aggressive, incurable form of prostate cancer.
  • biotin- labelled AP-CSB peptide SEQ ID NO: 11
  • concentration of 0 DMSO control
  • 12.5, 25 or 50 ⁇ M for 72 hours and allowed to grow.
  • Growth of cells under these conditions were assessed by MTT assay ( Figure 8). Growth of PC3 cells was suppressed in a dose-dependent manner by the peptide.
  • YB- 1 phosphorylation inhibiting peptide does not significantly inhibit normal breast epithelial cell growth
  • the peptides were tested as above against pre-neoplastic 184htrt cells (shown to lack YB-1 expression, data not illustrated herein, a cell line previously described in Oh et al 2002, Neoplasia 4(3) 204-217) and compared to the breast cancer SUM149 cells, to test for specificity.
  • the YB-1 inhibitory peptide (SEQ ID No: 11) killed >90% of the SUM149 cells at concentrations above 12.5 uM, whereas there was only a modest deleterious effect on the 184htrt cells, particularly at concentrations below 12.5 uM, demonstrating that the peptide has modest off target effects, as illustrated in Figure 10.
  • BASHOUR AM, MENG JJ, IP W, MACCOLLIN M, RATNER N The neurofibromatosis Type 2 gene product, merlin, reverses the F-actin cytoskeletal defects in primary human Schwannoma cells. MoI. Cell Biol. (2002) 22(4): 1150-1157.
  • CONNER SD, SCHMID SL Regulated portals of entry into the cell. Nature (2003) 422(6927):37-44.
  • DATTA K, NAMBUDRIPAD R, PAL S et al. Inhibition of insulin- like growth factor-l-mediated cell signaling by the von Hippel-Lindau gene product in renal cancer. J. Biol. Chem. (2000) 275(27):20700-20706.
  • DATTA K, SUNDBERG C, KARUMANCHI SA, MUKHOPADHYAY D The 104-123 amino acid sequence of the ⁇ -domain of von Hippel-Lindau gene product is sufficient to inhibit renal tumor growth and invasion. Cancer Res. (2001 ) 61(5):1768-1775.
  • EGUCHI A, AKUTA T, OKUYAMA H et al. Protein transduction domain of HIV-1 TAT protein promotes efficient delivery of DNA into mammalian cells. J. Biol. Chem. (2001 ) 276(28):26204-26210.
  • FISCHER R, KOHLER K, FOTIN-MLECZEK M, BROCK R A stepwise dissection of the intracellular fate of cationic cell-penetrating peptides. J. Biol. Chem. (2004) 279(13):12625-12635.
  • FRANKEL AD PABO CO: Cellular uptake of the TAT protein from human immunodeficiency virus. Cell (1988) 55(6): 1189-1193.
  • FUKI IV, MEYER ME, WILLIAMS KJ Transmembrane and cytoplasmic domains of syndecan mediate a multi-step endocytic pathway involving detergent-insoluble membrane rafts. Biochem. J. (2000) 351(Pt
  • HAKANSSON S, JACOBS A, CAFFREY M Heparin binding by the HIV-1 TAT protein transduction domain. Protein Sci. (2001 ) 10(10):2138- 2139.
  • HARADA H, HIRAOKA M, KIZAKA-KONDOH S Antitumor effect of TAT-oxygen-dependent degradation-caspase-3 fusion protein specifically stabilized and activated in hypoxic tumor cells. Cancer Res. (2002) 62(7):2013-2018.
  • HEWLETT LJ, PRESCOTT AR, WATTS C The coated pit and macropinocytic pathways serve distinct endosome populations. J. Cell Biol. (1994) 124(5):689-703.
  • INAGAKI K, CHEN L, IKENO F et al. Inhibition of delta-protein kinase C protects against reperfusion injury of the ischemic heart in vivo. Circulation (2003) 108(19):2304-2307.
  • JOLIOT A, PROCHIANTZ A Transduction peptides: from technology to physiology. Nat. Cell. Biol. (2004) 6(3):189-196.
  • KAPLAN IM, WADIA JS, DOWDY SF Cationic TAT peptide transduction domain enters cells by macropinocytosis. J. Control. Release (2005) 102(1 ):247-253.
  • LEE CM, TANNOCK IF Inhibition of endosomal sequestration of basic anticancer drugs: influence on cytotoxicity and tissue penetration. Br. J. Cancer (2006) 94(6):863-869.
  • LINDSAY MA Peptide-mediated cell delivery: application in protein target validation. Curr. Opin. Pharmacol. (2002) 2(5):587-594.
  • LUNDBERG M JOHANSSON M: Positively charged DNA- binding proteins cause apparent cell membrane translocation. Biochem. Biophys. Res. Commun. (2002) 291(2):367-371.
  • MAGZOUB M PRAMANIK A, GRASLUND A: Modeling the endosomal escape of cell-penetrating peptides: transmembrane pH gradient driven translocation across phospholipid bilayers. Biochemistry (2005) 44(45): 14890-14897.
  • MAI JC, Ml Z 1 KIM SH, NG B, ROBBINS PD A proapoptotic peptide for the treatment of solid tumors. Cancer Res. (2001 ) 61 (21 ):7709- 7712.
  • MURRIEL CL, MOCHLY-ROSEN D Opposing roles of delta and epsilon PKC in cardiac ischemia and reperfusion: targeting the apoptotic machinery. Arch. Biochem. Biophys. (2003) 420(2):246-254.
  • NAKASE I, NIWA M, TAKEUCHI T et al. Cellular uptake of arginine-rich peptides: roles for macropinocytosis and actin rearrangement. MoI. Then (2004) 10(6): 1011-1022.
  • NORBURY CC HEWLETT LJ, PRESCOTT AR, SHASTRI N, WATTS C: Class I MHC presentation of exogenous soluble antigen via macropinocytosis in bone marrow macrophages. Immunity (1995) 3(6):783- 791.
  • PEREZ F JOLIOT A, BLOCH-GALLEGO E et al.: Antennapedia homeobox as a signal for the cellular internalization and nuclear addressing of a small exogenous peptide. J. Cell Sci. (1992) 102(Pt 4):717-722.
  • POTOCKY TB, MENON AK, GELLMAN SH Cytoplasmic and nuclear delivery of a TAT-derived peptide and a ⁇ -peptide after endocytic uptake into HeLa cells. J. Biol. Chem. (2003) 278(50):50188-50194.
  • RUSNATI M, TULIPANO G, URBINATI C et al. The basic domain in HIV-1 TAT protein as a target for polysulfonated heparin-mimicking extracellular TAT antagonists. J. Biol. Chem. (1998) 273(26): 16027-16037.
  • SCHWARZE SR, HO A, VOCERO-AKBANI A, DOWDY SF In vivo protein transduction: delivery of a biologically active protein into the mouse. Science (1999) 285(5433): 1569-1572.
  • SHERR CJ, MCCORMICK F The RB and p53 pathways in cancer. Cancer Cell (2002) 2(2): 103-112.
  • SHIRAISHI T, NIELSEN PE Photochemically enhanced cellular delivery of cell penetrating peptide-PNA conjugates. FEBS Lett. (2006) 580(5):1451-1456.
  • SNYDER EL, DOWDY SF Recent advances in the use of protein transduction domains for the delivery of peptides, proteins and nucleic acids in vivo. Expert Opin. Drug Deliv. (2005) 2(1 ):43-51.
  • SNYDER EL, MEADE BR, SAENZ CC, DOWDY SF Treatment of terminal peritoneal carcinomatosis by a transducible p53-activating peptide.
  • THOREN PE, PERSSON D, KARLSSON M, NORDEN B The antennapedia peptide penetratin translocates across lipid bilayers - the first direct observation. FEBS Lett. (2000) 482(3):265-268.
  • TORCHILIN VP, LEVCHENKO TS, RAMMOHAN R et al. Cell transfection in vitro and in vivo with nontoxic TAT peptide-liposome-DNA complexes. Proc. Natl. Acad. Sci. USA (2003) 100(4): 1972-1977.
  • TORCHILIN VP, RAMMOHAN R 1 WEISSIG V, LEVCHENKO TS TAT peptide on the surface of liposomes affords their efficient intracellular delivery even at low temperature and in the presence of metabolic inhibitors. Proc. Natl. Acad. Sci. USA (2001 ) 98(15):8786-8791.
  • TYAGI M, RUSNATI M, PRESTA M, GIACCA M Internalization of HIV-1 TAT requires cell surface heparan sulfate proteoglycans. J. Biol. Chem. (2001 ) 276(5):3254-3261.
  • VIVES E, RICHARD JP, RISPAL C, LEBLEU B TAT peptide internalization: seeking the mechanism of entry. Curr. Protein Pept. Sci. (2003) 4(2): 125-132.
  • WADIA JS DOWDY SF: Transmembrane delivery of protein and peptide drugs by TAT-mediated transduction in the treatment of cancer.
  • WADIA JS STAN RV
  • DOWDY SF Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat. Med. (2004) 10(3):310-315.
  • WENDER PA MITCHELL DJ
  • PATTABIRAMAN K et al. The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters. Proc. Natl. Acad. Sci. USA (2000) 97(24): 13003-13008.
  • WENDER PA, ROTHBARD JB, JESSOP TC, KREIDER EL, WYLIE BL Oligocarbamate molecular transporters: design, synthesis, and biological evaluation of a new class of transporters for drug delivery. J. Am. Chem. Soc. (2002) 124(45):13382-13383.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

In various aspects, the invention provides cell permeable Y-box binding protein-1 (YB-1) phosphorylation inhibitors, such as compounds comprising a peptidic sequence that is YB-1 selective protein kinase B (Akt) phosphorylation site. Compounds of the invention may take the form of peptide therapeutics for use, for example, in treating cancers.

Description

THERAPEUTIC YB-1 PHOSPHORYLATION DECOYS
FIELD
[0001] Aspects of the invention relate to inhibitors of transcription factor phosphorylation, more specifically, selective peptidic inhibitors of YB-1 phosphorylation that have therapeutic activity.
BACKGROUND
[0002] Y-box binding protein-1 (YB-1 ) is a transcription and translation factor that alters the expression of at least ten genes associated with drug resistance and tumour cell growth (JANZ et al 2002, lnt J Cancer 97:278-282; JURCHOTT et al 2003, J Biol Chem 278:27988-27996; EN-NIA et al 2004, J boil Chem 280:7702-7711; SHIBAO et al 1999, In J Cancer 83:732-737). The YB-1 protein is highly expressed in cancers of the breast (BARGOU et al 1997, Nature Med 3: 447-450), prostate (GIMENEZ-BONAFE et al 2004,
Prostate 59:337-349, colon (SHIBAO, supra), ovary (YAHATA et al 2002 J Cancer Res Clin Oncol 128:621-626) and bone (ODA et al 1998 Clin Cancer Res 4: 2273-2277). In some breast cancers, expression of YB-1 is associated with particularly aggressive tumors and a prognosis of poor survival (RUBENSTEIN et al 2002 Cancer Res. 62:4985-4991; JANZ, supra). YB-1 is not expressed at detectable levels in normal tissues (BARGOU, supra; RUBENSTEIN, supra).
[0003] YB-1 was originally isolated in an attempt to identify DNA binding proteins that interact with the epidermal growth factors EGFR and HER2
(SAKURA et al 1988, Gene 73:499-507). At the cellular level, YB-1 resides primarily in the cytoplasm but translocates to the nucleus, in a yet-undefined manner, where it binds to promoters with a 5'- CTGATTG -3' motif. In the cytoplasm, YB-1 interacts with RNA to regulate translation (EVDOKIMOVA et al 2001 EMBO J 20:5491-5502), while in the nucleus it binds to DNA and controls transcription (KUWANO et al 2003, Cancer Sci 94:9-14). As a transcription factor, YB-1 has been characterized for its ability to regulate at least ten genes that promote tumour growth and/or drug resistance. Among the most notable genes are cyclin A, cyclin B, egfr and her-2. YB-1 also partners with other transcription factors such as p53 (LASHAM et al 2003 J Biol Chem 35516-35523) and AP-2 {MERTENS et al 1998 J Biol Chem 273:32957-32965), and with cofactors (e.g., p300), to regulate gene expression (HIGASHI et al 2003 J Biol Chem 278:43470-43479).
[0004] YB-1 is phosphorylated at serine 102 by AKT, and this phosphorylation event is important in nuclear trafficking and DNA binding of YB-1. Inhibition of this phosphorylation halts tumor cell growth (SUTHERLAND et al 2005 Oncogene 24:4281-4292). The effect of YB-1 on cell growth may be cell-type specific, as YB-1 has demonstrated growth- suppressing effects in chicken embryo fibroblasts (BADER et al 2003. Proc Nat Acad Sci 100:12384-12389). YB-1's expression across several cancer types is consistent with this. Tumor cells are dependent on YB-1 - melanoma, adenocarcinoma, hepatoma, fibrosarcoma, colon cancer and breast tumor cells die when its expression is knocked out with antisense RNA (LASHAM supra).
[0005] The human epidermal growth factor receptors (HER1/EGFR, HER2, HER3 and HER4) are important for sustaining the growth of breast cancer cells (YARDEN 2001. Oncology 61:1-13). These receptors form homodimers and heterodimers to activate signal transduction in response ligands such as EGF, amphiregulin, and heregulin. EGFR and HER2 are over-expressed in a subset of breast cancers (NIELSEN et al. 2004 CHn Cancer Res 10:5367- 5374; SLAMON et al 1987, Science 235:177-182). Over-expression of EGFR is generally due to transcriptional activation (KERSTING etal 2004. Lab Invest 84:582-587), and a number of cis- and trans- activating elements regulating EGFR expression have been identified, including the EGF- responsive DNA binding protein-1 , c-JUN, and SP-1 (CHEN et al 1993. Cell Growth Diff 4:975-983; ZENZ et al 2003. Dev Cell 4:879-889; KA GEYAMA et al 1988 J Biol chem. 263:6329-6336). YB-1 has also been shown to regulate EGFR in human mammary epithelial cells (BERQUIN et al 2005. Oncogene 25:3177-3186).
[0006] The widespread involvement of YB-1 in multiple tumour types suggests a central role in the regulation of growth and development of cancers.
[0007] YB-1 has been implicated as having a causative or pathological role in a variety of diseases (which may therefore be identified as YB-1 mediated diseases), apart from cancer, including: heart disease (Kamalov et al 2005,
Biochem Biophys Res Commun. 19;334(1):239-44; Zhang et al 2005, MoI Biol Cell. 16(10):4931-40); kidney disease (van Roeyen et al 2005, JAm Soc Nephrol. 16(10): 2985-96); diabetes (Fukada and Tonks 2003, EMBO J. 3;22(3):479-93); autoimmune disease (Seko et al 2006, Autoimmun Rev. 5(5): 299-305); cerebral palsy (Liverman et al 2006, Neurosci Lett
22;399(3):220-5); and, infection (including viral infection) (Chen et al 1995, Proc Natl Acad Sci U S A. 14;92(4):1087-91).
[0008] Protein transduction domains (PTDs) have been used to deliver a wide variety of therapeutics, such as protein-based drugs for treating breast cancer (Harada et al 2006, Breast Cancer 13(1 ):16-26). Similarly, liposomal formulations, including liposomal formulations that are decorated with protein transduction domans, may be useful for delivering protein-based drugs (Torchilin et al 2001 , Proc Natl Acad Sci USA 98:8786-8791). An extensive reference list is provided below, incorporated herein by reference, documenting the use of protein transduction domains and related molecules. Table 1 sets out a number of protein transduction domains described in the literature.
Table 1
Figure imgf000005_0001
Figure imgf000006_0001
Figure imgf000007_0001
SUMMARY OF THE INVENTION
[0009] In various aspects, the invention provides analogues of the YB-1 Akt phosphorylation site that are capable of inhibiting pathological cellular activities.
In selected embodiments, the invention provides cell permeable YB-1 phosphorylation inhibitors having a peptidic sequence that is a YB-1 selective Akt phosphorylation site.
[0010] In accordance with one aspect of the invention, there is provided a method of inhibiting YB-1 mediated transcription, the method comprising contacting a cell with an inhibitor of Akt mediated YB-1 phosphorylation, so that transcriptional activation of YB-1 is in turn inhibited.
[0011] In accordance with another aspect of the invention, there is provided a method of treating a YB-1 expressing cell, such as a cancer cell, for example a cell in a patient or test subject, the method comprising administering a chemotherapeutic regimen comprising an inhibitor of YB-1 phosphorylation or YB-1 mediated transcription.
[0012] In accordance with another aspect of the invention, there is provided a method of modulating metastasis of a cell expressing YB-1 , the method comprising contacting a cell with an inhibitor of YB-1 phosphorylation and transcriptional activation. [0013] In some embodiments, the inhibitor of YB-1 phosphorylation or YB- 1 mediated transcription may be a fragment of YB-1 , or may be a peptide substantially similar to a fragment of YB-1. In other embodiments, the inhibitor of YB-1 phosphorylation or transcriptional activation may be a peptidomimetic
[0014] In accordance with another aspect of the invention, the inhibitor of YB-1 phosphorylation may be a peptide according to SEQ ID NO: 12, or a peptide substantially similar to SEQ ID NO: 12.
[0015] In accordance with another aspect of the invention, the inhibitor of YB-1 phosphorylation or YB-1 mediated transcription may be an antibody that binds a protein having a sequence according to SEQ ID NO: 12, or a sequence substantially similar to SEQ ID NO: 12.
[0016] In selected embodiements, a YB-1 expressing cell, such as a cancer cell, may be treated with compounds of the invention. Cancers or cancer cells amenable for treatment may for example be identifiable as a cancer of the pancreas, breast, thyroid, ovary, uterus, testis, prostate, thyroid, pituitary gland, adrenal gland, kidney, stomach, esophagus or rectum, head and neck, bone, nervous system, skin, blood, nasopharyngeal tissue, lung, urinary tract, cervix, vagina, exocrine glands or endocrine glands, or a cancer of unknown primary site.
[0017] In accordance with another aspect of the invention, there is provided a method of screening for an inhibitor of YB-1 phosphorylation or transcriptional activation, the method comprising: providing a system comprising a reporter gene construct having a reporter gene and a YB-1 transcriptional activation sequence and transcriptionally active YB-1 ; providing an inhibitor of YB-1 transcriptional activation; providing a test compound; and contacting said system with said test compound and determining whether said test compound modulates YB-1 transcriptional activation.
[0018] In accordance with another aspect of the invention, there is provided a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12.
[0019] In accordance with another aspect of the invention, there is provided a use of a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament, for example for use in a chemotherapeutic regimen.
[0020] In accordance with another aspect of the invention, there is provided a use of a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a radiotherapeutic regimen.
[0021] In accordance with another aspect of the invention, there is provided a use of a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a combination chemotherapeutic regimen.
[0022] In accordance with another aspect of the invention, there is provided a use of a polypeptide comprising an amino acid sequence substantially similar to the sequence SEQ ID NO: 12 for the preparation of a medicament for use in a alternative therapeutic regimen.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 : The impact of YB-1 expression on patient survival. A total of 389 tumours were examined for YB-1 expression and patient survival was monitored over 20 years. Patients with tumours expressing YB-1 were less likely to survive long term based on log rank and Breslow (Gehan- Wilcoxon) survival analyses. Survival was based on disease specific survival (DSS).
[0024] Figure 2: YB-1 binds directly to the EGFR promoter. A) Schematic representation of potential YB-1 EGFR binding sites and the location of the primers used for ChIP. B) DNA:protein complexes were cross- linked from MCF-7/Flag:YB-1 and MCF-7/Flag:YB-1(Ala102) cells. ChIP of Flag:YB-1 and Flag:YB-1(Ala102) from MCF-7 cells using an anti-Flag M2 antibody. The immunoprecipitated DNA from Flag:YB-1 (lanes 1-4) or YB- 1(Ala102) (lanes 5-8) were amplified using sequence specific primers EGFR
1 b, 2a, 2b and 3. Flag:YB-1 bound to several of the loci on the EGFR promoter while loss of the Ser102 site by mutation to Ala102 disrupted binding to the EGFRI b and EGFR2a sites. The IgG negative control was also evaluated using each of the EGFR primer sets (lanes 9-12). Input DNA for each sample was also titrated (1 , 3, 5 ul) and amplified with EGFR 2a primers to demonstrate that the sample input was equivalent (Lanes 13-18). An aliquot from sheared inputs were evaluated to illustrate that the chromatin was sheared to fragments between 200bp to 1 kb and that the amounts of input DNA for the subsequent ChIP assays were equal. C) Endogenous YB-1 was immunoprecipitated from MDA-MB-231 cells and Chip was performed using primers to EGFRIb, EGFR2a, EGFR3 (lanes 1-4). The IgY ChIP was also performed as a negative control (lanes 6-9). D) input DNA (lanes 1-4) and genomic DNA was amplified with each of the primers to demonstrate their specificity and the production of an expected product. The expected product size for EGFR1 b, EGFR2a, EGFR2b and EGFR3 was 191 bp, 510 bp, 530 bp, and 493 bp (Lanes 10-13), respectively. The no template control was also tested (lane 5-8).
[0025] Figure 3: Over-expression of YB-1 but not YB-1 (A102) results in induction of Her-2 and EGFR.
A) The stable expression of Flag:YB-1 increased levels of Her-2 and EGFR protein while the mutant Flag:YB-1(A102) did not. Proteins were isolated from cells stably expressing either the empty vector (EV), Flag:YB-1 , or Flag:YB- 1(A102). The relative levels of the transgenes were assessed using an antibody to Flag and YB-1. Vinculin was examined to ensure that the samples were equally loaded. B) Expression of Flag:YB-1 increases EGFR mRNA and C) HER2 mRNA. The mRNA was harvested from cells growing in log phase, reverse transcribed and then amplified for Her-2 or EGFR expression by qRT- PCR. Each cell line was evaluated in quadruplicates and the data were normalized to TBP. The relative level of induction was compared to the MCF- 7(EV) cell line. D) Cells that over-express YB-1 are more responsive to EGF stimulation. MCF-7 cells expressing the empty vector (EV), Flag.YB- 1 , or
Flag:YB-1(A102) were serum starved for 24 hrs then stimulated with EGF (40 ng/ml) for 30 min. The cell lines were compared for relative amounts of P- ERK1/2. Total Erk1/2 was included as a control for sample loading.
[0026] Figure 4: Small interfering RNA targeting YB-1 results in loss of EGFR and Her-2 expression. A) MCF-7/Flag:YB-1 cells were transfected with siRNA targeting YB-1 for 96 hrs. Compared to the empty vector (lane 1 ), the targeting vector silenced YB-1 (lanes 2, siYB-1#1 , approx. ~50%; Iane3, siYB-1#2, approx. -70%). Knocking down YB-1 inhibited the expression of EGFR (middle panel) but had no effect on the housekeeping protein actin
(bottom panel). SiYB-1#1 and siYB-1#2 differ in the amount of lipofectamine used (12.5 and 25 ul respectively), both were transfected with 0.8 ug of pSuperDuper targeting YB-1. B) Inhibition of YB-1 using siRNA (top panel) also correlated with a loss of Her-2 protein expression (middle panel) but did not suppress actin (bottom panel).
[0027] Figure 5: Cell permeable peptide targeting YB-1 inhibits tumor growth. MDA-MB-453 or SUM149 cells were plated at a density of 1000 cells/well in a 96-well plate and allowed to attach overnight. The next day, the cells were treated with increasing concentration of the peptide (12.5-50 uM) and tumour cell growth was measured after one week using the MTT assay. [0028] Figure 6: YB-1 binds to the HER2 promoter
A) Schematic representation of potential YB-1 binding sites and the location of the primers used for ChIP. B) MCF-1(Flag:YB-1 ) and MCF- 7(Flag:YB- 1 :A102) cells were subjected to ChIP and the DNA was amplified for Her-2. Flag:YB-1 bound to the Her-2 promoter (lane 1 ); however the FlagΥB-
1(A102) mutant did not bind effectively (lane 2) and was similar to background amplification with control IgG (lane 3). C) YB-1 :DNA complexes were isolated from MDA-MB-453 cells and amplified for Her-2 to confirm endogenous YB-1 binding. YB-1 bound to the Her-2 promoter (lane 2) whereas the IgY negative control did not (lane 3). The sheared input DNA served as a positive control
(lane 4).
[0029] Figure 7: YB-1 binding to the EGFR promoter is inhibited with a peptide SEQ ID NO: 11. A) We demonstrate that nuclear proteins from breast cancer cells bind to the
EGFR promoter (lane 2) compared to the unbound biotin labeled oligonucleotide (lane 1 ). Binding was specific because cold competitive oligonucleotides to the same sequence diminished binding (lane 3). The transcription factor responsible for binding was YB-1 because introducing either 1 or 2 ug (lanes 4-5) cause a super-shift in the binding product. B) The nuclear extracts from the breast cancer cells were pre-incubated with the cell permeable peptide. YB-1 bound with high affinity in the absence of the inhibitor (DMSO control lane 1 ) whereas incubation with the cold competitive inhibitor (lane 2), 25 or 50 uM of the peptide blocked binding (lanes 3-4).
[0030] Figure 8 Cell permeable peptide inhibiting YB-1 phosphorylation inhibits growth of prostate tumor cells. PC3 cells were plated at a density of 1000 cells/well in a 96 well plate and allowed to attach overnight. The next day, the cells were treated with increasing concentration of a peptide inhibitor of YB-1 phosphorylation (12.5-50 uM) and tumour cell growth was measured after one week using the MTT assay. Cell treatment indicated on X-axis, % Absorbance at 490 nm on Y axis. [0031] Figure 9 is a bar graph illustrating data that shows that a YB-1 phosphorylation inhibiting peptide does not affect the viability of primary, normal mammary EpCAM+ cells. Cell viability was measured using MTS assay after 72-hour exposure of two different patient samples to either a scrambled control peptide or the YB-1 specific peptide.
[0032] Figure 10 illustrates that a YB-1 phosphorylation inhibiting peptide is more toxic to a breast cancer cell line than to an immortalized line of "normal" breast epithelial cells.
DETAILED DESCRIPTION
[0033] In the description that follows, a number of terms are used extensively, the following definitions are provided to facilitate understanding of the invention.
[0034] The terms 'peptide', 'polypeptide' and protein' may be used interchangeably, and refer to a compound comprised of at least two amino acid residues covalently linked by peptide bonds or modified peptide bonds, for example peptide isosteres (modified peptide bonds) that may provide additional desired properties to the peptide, such as increased half-life. A peptide may comprise at least two amino acids. The amino acids comprising a peptide or protein described herein may also be modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in a peptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It is understood that the same type of modification may be present in the same or varying degrees at several sites in a given peptide.
[0035] Examples of modifications to peptides may include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer- RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Proteins-Structure and Molecular Properties, 2nd ed., T. E.
Creighton, W. H. Freeman and Company, New York, 1993 and Wold F, Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1- 12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, ed., Academic Press, New York, 1983; Seifter et al, Analysis for protein modifications and nonprotein cof actors, Meth. Enzymol. (1990) 182: 626-646 and Rattan et al. (1992), Protein Synthesis: Posttranslational Modifications and Aging, " Ann NY Acad Sci 663: 48-62.
[0036] Amino acid or nucleic acid sequence similarity or identity may be computed by using the BLASTP and TBLASTN programs which employ the
BLAST (basic local alignment search tool) 2.0 algorithm. Techniques for computing amino acid sequence similarity or identity are well known to those skilled in the art, and the use of the BLAST algorithm is described in ALTSCHUL et al. 1990, J MoI. Biol. 215: 403- 410 and ALTSCHUL et al. (1997), Nucleic Acids Res. 25: 3389-3402.
[0037] Two nucleic acid or protein sequences are considered substantially identical if, when optimally aligned, they share at least about 70% sequence identity. In alternative embodiments, sequence identity may for example be at least 75%, at least 90% or at least 95%. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer
Group, Madison, Wl, U.S.A.). Sequence alignment may also be carried out using the BLAST algorithm, described in Altschul et al., 1990, J. MoI. Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information (through the internet at ncbi.nlm.nih.gov/). The
BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold. Initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST programs may use as defaults a word length (W) of 11 , the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc.
Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (which may be changed in alternative embodiments to 1 or 0.1 or 0.01 or 0.001 or 0.0001 ; although E values much higher than 0.1 may not identify functionally similar sequences, it is useful to examine hits with lower significance, E values between 0.1 and 10, for short regions of similarity),
M=5, N=4, for nucleic acids a comparison of both strands. For protein comparisons, BLASTP may be used with defaults as follows: G=11 (cost to open a gap); E=1 (cost to extend a gap); E=10 (expectation value, at this setting, 10 hits with scores equal to or better than the defined alignment score, S, are expected to occur by chance in a database of the same size as the one being searched; the E value can be increased or decreased to alter the stringency of the search.); and W=3 (word size, default is 11 for BLASTN,
3 for other blast programs).
[0038] The BLOSUM matrix assigns a probability score for each position in an alignment that is based on the frequency with which that substitution is known to occur among consensus blocks within related proteins. The
BLOSUM62 (gap existence cost = 11 ; per residue gap cost = 1 ; lambda ratio = 0.85) substitution matrix is used by default in BLAST 2.0. A variety of other matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1 ,0.87); PAM70 (10,1 ,0.87) BLOSUM80 (10,1 ,0.87); BLOSUM62 (11 ,1 ,0.82) and BLOSUM45 (14,2,0.87), the latter of which is set out below.
One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
BLOSSUM 45 Matrix
G 7
P -2 9
D -1 -1 7
E -2 0 2 6
N 0 -2 0 6
H -2 -2 0 0 1 10
Q -2 -1 0 2 0 1 6
K -2 -1 0 1 0 -1 1 5
R -2 -2 -1 0 0 0 1 3 7
S 0 -1 0 0 1 -1 0 — 1 -1 4
T -2 -1 -1 -1 0 -2 -1 -1 -1 5
A 0 -1 -2 -1 -1 -2 -1 -1 -2 1 0 5
M -2 -2 -3 -2 0 0 -1 -1 -2 -1 -1 6
V — 3 -3 -3 -3 -3 -3 -3 -2 -1 0 0 1 5
I -4 -2 -4 -3 -2 — "3 -2 -3 -3 -2 -1 -1 2 3 5
L -3 -3 -3 -2 -3 -2 -2 -3 -2 -3 -1 -1 2 1 2 5
F -3 -3 -4 -3 -2 -2 -4 -3 -2 -2 -1 -2 0 0 0 1 8
Y -3 -3 -2 -2 -1 -1 -2 -1 -2 0 -1 0 0 3
W W --22 --33 --44 --33 --44 --33 --22 --22 -2 --44 --33 --22 --22 --33 -2 --22 11 3 15 C -3 -4 -3 -3 -2 -3 -3 -3 -3 -1 -1 -1 -2 -1 -3 -2 -2 -3 -5 12 G P D E N H Q K R S T A M V I L F Y W C
[0039] Amino acids may be described as, for example, polar, non-polar, acidic, basic, aromatic or neutral. A polar amino acid is an amino acid that may interact with water by hydrogen bonding at biological or near-neutral pH. The polarity of an amino acid is an indicator of the degree of hydrogen bonding at biological or near-neutral pH. Examples of polar amino acids include serine, praline, threonine, cysteine, asparagine, glutamine, lysine, histidine, arginine, aspartate, tyrosine and glutamate. Examples of non-polar amino acids include glycine, alanine, valine leucine, isoleucine, methionine, phenylalanine, and tryptophan. Acidic amino acids have a net negative charge at a neutral pH. Examples of acidic amino acids include aspartate and glutamate. Basic amino acids have a net positive charge at a neutral pH.
Examples of basic amino acids include arginine, lysine and histidine. Aromatic amino acids are generally nonpolar, and may participate in hydrophobic interactions. Examples of aromatic amino acids include phenylalanine, tyrosine and tryptophan. Tyrosine may also participate in hydrogen bonding through the hydroxyl group on the aromatic side chain. Neutral, aliphatic amino acids are generally nonpolar and hydrophobic. Examples of neutral amino acids include alanine, valine, leucine, isoleucine and methionine. An amino acid may be described by more than one descriptive category. Amino acids sharing a common descriptive category may be substitutable for each other in a peptide.
[0040] In accordance with various aspects of the invention, peptides or peptidic sequences, are provided having a sequence derived from the sequence of the Ser102 phosphorylation site of YB-1. That site has the sequence PRKYLRSVG, encompassing an Akt phosphorylation consensus seqeunce of RXXXRS. This sequence differs from the typical consensus sequence for Akt phosphorylation, which is RXRXXS/T. Accordingly, the distinct phosphorylation consensus sequence of the invention provides a YB-1 selective Akt phosphorylation site.
[0041] In one aspect of the invention, YB-1 phosphorylation inhibitors may include peptides that differ from a portion of the native YB-1 phosphorylation site by conservative amino acid substitutions. As used herein, the term "conserved amino acid substitutions" refers to the substitution of one amino acid for another at a given location in the peptide, where the substitution can be made without loss of function. In making such changes, substitutions of like amino acid residues can be made, for example, on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the peptide by routine testing.
[0042] In some embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0), where the following hydrophilicity values are assigned to amino acid residues (as detailed in United States Patent No. 4,554,101 , incorporated herein by reference): Arg (+3.0); Lys (+3.0); Asp (+3.0); GIu (+3.0); Ser (+0.3); Asn (+0.2); GIn (+0.2); GIy (0); Pro (-0.5); Thr (-0.4); Ala (-0.5); His (-0.5); Cys (- 1.0); Met (-1.3); VaI (-1.5); Leu (-1.8); lie (-1.8); Tyr (-2.3); Phe (-2.5); and Trp (-3.4).
[0043] In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydropathic index (e.g., within a value of plus or minus 2.0). In such embodiments, each amino acid residue may be assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics, as follows: He
(+4.5); VaI (+4.2); Leu (+3.8); Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); GIy (-0.4); Thr (-0.7); Ser (-0.8); Trp (-0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); GIu (-3.5); GIn (-3.5); Asp (-3.5); Asn (-3.5); Lys (-3.9); and Arg (-4.5).
[0044] In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another in the same class, where the amino acids are divided into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala, VaI, Leu, lie, Phe, Trp, Pro, Met; acidic: Asp, GIu; basic: Lys, Arg, His; neutral: GIy, Ser, Thr, Cys, Asn, GIn, Tyr.
[0045] For example, the invention provides YB-1 phosphorylation inhibitors comprising a contiguous sequence of at least nine residues of the formula:
Xi X2 X3 X4 X5 Xβ X7 Xe X9 X10 Xi 1 X12 wherein:
Xi is Z or N or D or H or S or X
X2 is Z or N or D or H or S or X
X3 is Z or P
X4 is R X5 is K or R or E or Q or X
X6 is Y or F or W or X
X7 is L or M or I or V or F or X X8 is R X9 is S
X-io is Z or V or I or L or M or X Xn is Z or G or X
Figure imgf000020_0001
in which
X = any amino acid or amino acid analogue, Z = not present.
[0046] In alternative embodiments, the YB-1 phosphorylation inhibitor of the foregoing formula may have:
X1 is Z or N or D
X2 is Z or N or D
X3 is Z or P
X4 is R
X5 is K or R
X6 is Y or F or W
X7 is L or M or I
X8 is R
X9 is S
X10 is Z or V or I
Figure imgf000020_0002
X12 is Z or D or N or E.
[0047] In accordance with this aspect of the invention, the following matrix sets out sequence variants of the invention, encompassing the forging sequences, in which a number of the residues of the Ser102 phosphorylation site of YB-1 may be replaced with conservative amino acid substitutions, in which these substitutions have positive (favourable) substitution scores on the BLOSUM 45 matrix (set out above).
Figure imgf000020_0003
Figure imgf000021_0001
Figure imgf000022_0001
Figure imgf000023_0001
Where X = any amino acid, Z = not present, and alternative amino acids are indicated by a T
[0048] Nomenclature used to describe the peptide compounds of the present invention follows the conventional practice where the amino group is presented to the left and the carboxy group to the right of each amino acid residue. In the sequences representing selected specific embodiments of the present invention, the amino- and carboxy-terminal groups, although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified. In the amino acid structure formulae, each residue may be generally represented by a one-letter or three- letter designation, corresponding to the trivial name of the amino acid, in accordance with the following Table 2:
[0049] Table 2 Nomenclature and abbreviations of the 20 standard L- amino acids commonly found in naturally occurring peptides.
Figure imgf000023_0002
Figure imgf000024_0001
[0050] Amino acids comprising the peptides described herein will be understood to be in the L- or D- configuration. In peptides and peptidomimetics of the present invention, D-amino acids may be substitutable for L-amino acids.
[0051] Amino acids contained within the peptides of the present invention, and particularly at the carboxy-or amino-terminus, may be modified by methylation, amidation, acetylation or substitution with other chemical groups which may change the circulating half-life of the peptide without adversely affecting their biological activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
[0052] Nonstandard amino acids may occur in nature, and may or may not be genetically encoded. Examples of genetically encoded nonstandard amino acids include selenocysteine, sometimes incorporated into some proteins at a UGA codon, which may normally be a stop codon, or pyrrolysine, sometimes incorporated into some proteins at a UAG codon, which may normally be a stop codon. Some nonstandard amino acids that are not genetically encoded may result from modification of standard amino acids already incorporated in a peptide, or may be metabolic intermediates or precursors, for example. Examples of nonstandard amino acids include 4-hydroxyproline, 5- hydroxylysine, 6-N-methyllysine, gamma-carboxyglutamate, desmosine, selenocysteine, ornithine, citrulline, lanthionine, 1-aminocyclopropane-1- carboxylic acid, gamma-aminobutyric acid, carnitine, sarcosine, or N- formylmethionine. Synthetic variants of standard and non-standard amino acids are also known and may include chemically derivatized amino acids, amino acids labeled for identification or tracking, or amino acids with a variety of side groups on the alpha carbon. Examples of such side groups are known in the art and may include aliphatic, single aromatic, polycyclic aromatic, heterocyclic, heteronuclear, amino, alkylamino, carboxyl, carboxamide, carboxyl ester, guanidine, amidine, hydroxyl, alkoxy, mercapto-, alkylmercapto-, or other heteroatom-containing side chains. Other synthetic amino acids may include alpha-imino acids, non-alpha amino acids such as beta-amino acids, des-carboxy or des-amino acids. Synthetic variants of amino acids may be synthesized using general methods known in the art, or may be purchased from commercial suppliers, for example RSP Amino Acids LLC (Shirley, MA).
[0053] A peptidomimetic is a compound comprising non-peptidic structural elements that mimics the biological action of a parent peptide. A peptidomimetic may not have classical peptide characteristics such as an enzymatically scissile peptidic bond. A parent peptide may initially be identified as a binding sequence or phosphorylation site on a protein of interest, or may be a naturally occurring peptide, for example a peptide hormone. Assays to identify peptidomimetics may include a parent peptide as a positive control for comparison purposes, when screening a library, such as a peptidomimetic library. A peptidomimetic library is a library of compounds that may have biological activity similar to that of a parent peptide.
[0054] The term 'antibody' as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, or humanized antibodies, as well as Fab or F(ab)2 fragments, including the products of an Fab or other immunoglobulin expression library.
[0055] Peptides according to one embodiment of the invention may include peptides comprising the amino acid sequence PRKYLRSVG (SEQ ID NO: 12). Other peptides according to other embodiments of the invention may include peptides having a substantially similar sequence to that of SEQ ID NO: 12. Such peptides may be in isolation, or may be linked to or in combination with tracer compounds, protein translocation sequences, liposomes, carbohydrate carriers, polymeric carriers or other agents or excipients as will be apparent to one of skill in the art. In an alternate embodiment, such peptides may comprise a medicament, wherein such peptides may be present in a pharmacologically effective amount.
[0056] The term 'medicament' as used herein, a "medicament" refers to a composition that may be administered to a patient or test subject and is capable of producing an effect in the patient or test subject. The effect may be chemical, biological or physical, and the patient or test subject may be human, or a non-human animal, such as a rodent or transgenic mouse, or a dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit or pig. The medicament may be comprised of the effective chemical entity alone or in combination with a pharmaceutically acceptable excipient.
[0057] The term 'pharmaceutically acceptable excipient' may include any and all solvents, dispersion media, coatings, antibacterial, antimicrobial or antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. An excipient may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal or oral administration. An excipient may include sterile aqueous solutions or dispersions for extemporaneous preparation of sterile injectable solutions or dispersion. Use of such media for preparation of medicaments is known in the art.
[0058] Delivery of bioactive molecules such as peptides, to a cell or cells in a reasonably efficient manner may require more than just the 'dumping' of the naked peptide onto the cell, or administering the naked peptide into the patient or test subject. Agents that enable delivery of bioactive molecules into cells in a suitable manner so as to provide an effective amount, such as a pharmacologically effective amount are known in the art, and are described in, for example, DIETZ et al 2004. MoI Cell. Neurosci 27:85-131. Examples of such agents include liposomes, antibodies or receptor ligands that may be coupled to the bioactive molecule, viral vectors, and protein transduction domains (PTD). Examples of PTDs include Antennapedia homeodomain (PEREZ et al 1992 J. Cell Sci 102:717-722), transportan (POOGA et al 1998 FASEB J 12: 67-77), the translocation domains of diphtheria toxin
(STENMARK et al 1991 J Cell Biol 113:1025-1032; WIEDLOCHA et al 1994 Cell 76:1039-1051), anthrax toxin (BALLARD et al 1998 Infect, lmmun 66:615-619; BLANKE et al 1996 Proc Natl Acad Sci 93: 8437-8442) and Pseudomonas exotoxin A (PRIOR et al 1992 Biochemistry 31:3555-3559), protegrin derivatives such as dermaseptin S4 (HARITON-GAZAL et al 2002
Biochemistry 41:9208-9214), HSV-1 VP22 (DILBER et al 1999 Gene Ther. 6:12-21), PEP-1 (MORRIS et al 2001 Nature Biotechnol 19:1173-1176), basic peptides such as poly-L and poly-D-lysine (WOLFERT et al 1996 Gene Ther. 3:269-273 ; RYSER et al 1980 Cancer 45:1207-1211; SHEN et al 1978 Proc Natl Acad Sci 75:1872-1876), HSP70 (FUJIHARA et al 1999 EMBO J 18:411- 419) and HIV-TAT (DEMARCHI et al 1996 J Virol 70:4427-4437). Other examples and related details of such protein transduction domains are described in DIETZ, supra and references therein.
[0059] The term 'pharmacologically effective amount' of a medicament may refer to an amount of a medicament present in such a concentration to result in a therapeutic level of drug delivered over the term that the drug is used and producing a chemical, biological or physical effect in the patient or test subject. The pharmacologically effective amount may be dependent on the mode of delivery, site of administration of the medicament, time period of the dosage, age, weight, general health, sex or diet of the patient or test subject receiving the medicament.
[0060] As used herein, the term "cancer" refers to a proliferative disorder caused or characterized by the proliferation of cells which have lost susceptibility to normal growth control. The term cancer, as used in the present application, includes tumors and any other proliferative disorders.
Cancers of the same tissue type usually originate in the same tissue, and may be divided into different subtypes based on their biological characteristics. Four general categories of cancers are carcinoma (epithelial tissue derived), sarcoma (connective tissue or mesodermal derived), leukemia (blood-forming tissue derived) and lymphoma (lymph tissue derived). Over 200 different types of cancers are known, and every organ and tissue of the body may be affected. Specific examples of cancers that do not limit the definition of cancer may include melanoma, leukemia, astrocytoma, glioblastoma, retinoblastoma, lymphoma, glioma, Hodgkins' lymphoma and chronic lymphocyte leukemia. Examples of organs and tissues that may be affected by various cancers include pancreas, breast, thyroid, ovary, uterus, testis, prostate, thyroid, pituitary gland, adrenal gland, kidney, stomach, esophagus or rectum, head and neck, bone, nervous system, skin, blood, nasopharyngeal tissue, lung, urinary tract, cervix, vagina, exocrine glands and endocrine glands. Alternatively, a cancer may be multicentric or of unknown primary site (CUPS).
[0061] As used herein, a 'cancerous cell' refers to a cell that has undergone a transformation event and whose growth is no longer regulated to the same extent as before said transformation event. A tumor refers to a collection of cancerous cells, often found as a solid or semi-solid lump in or on the tissue or a patient or test subject.
[0062] A cancer or cancerous cell may be described as "sensitive to" or "resistant to" a given therapeutic regimen or chemotherapeutic agent based on the ability of the regimen to kill cancer cells or decrease tumor size, reduce overall cancer growth (i.e. through reduction of angiogenesis), and/or inhibit metastasis. Cancer cells that are resistant to a therapeutic regimen may not respond to the regimen and may continue to proliferate. Cancer cells that are sensitive to a therapeutic regimen may respond to the regimen resulting in cell death, a reduction in tumor size, reduced overall growth or inhibition of metastasis. Monitoring of a response may be accomplished by numerous pathological, clinical and imaging methods as described herein and known to persons of skill in the art.
[0063] A common theme for a chemotherapeutic agent or combination of agents is to induce death of the cancerous cells. For example, DNA adducts such as nitrosoureas, busulfan, thiotepa, chlorambucil, cisplatin, mitomycin, procarbazine, or dacacarbazine slow the growth of the cancerous cell by forcing the replicating cell to repair the damaged DNA before the M-phase of the cell cycle, or may by themselves cause sufficient damage to trigger apoptosis of the cancerous cell. Other events such as gene expression or transcription, protein translation, or methylation of the replicated DNA, for example, may also be interfered with by the varied arsenal of chemotherapeutic agents available to the clinician and help to trigger apoptotic processes within the cancerous cells. Alternately, a chemotherapeutic agent may enable the cancerous cell to be killed by aspects of the patient or test subject's humoral or acquired immune system, for example, the complement cascade or lymphocyte attack.
[0064] A cancerous cell resistant to a chemotherapeutic agent or combination of agents may fight for its survival by actively transporting the drug out of the cell for example, by overexpression of the ABC transporter MDR1 p-glycoprotein (FORD et al 1993. Cytotechnol. 12:171-212) or acquiring 'counter-mutations' to counteract the drugs. For example, mutations in the DNA repair enzymes that affect the ability to detect damage to the cells' DNA may enable replication of the damaged DNA and permit the cancerous cells to continue replicating, enlarging the tumor. As mutations accumulate, other regulatory points that would otherwise act in a normal cell cycle cease to function, and the cycle of unrequlated growth cascades. Another aspect of chemotherapeutic resistance involves the tumor cells' avoidance of apoptosis. A host organism's normal response to dysregulated cell growth is to initiate apoptosis and eliminate the defective cell before the cascade into uncontrolled replication begins, however this may be subverted by a cancerous cell, for example, by disruption of signal transduction events, loss of adhesion dependence or contact inhibition in the cancerous cell, or loss of apoptosis-promoting factors, often considered 'tumor suppressors', for example p53, BRCA1 or RB. The importance of this sensitivity to apoptosis in the treatment of cancer is supported by recent evidence indicating that the selectivity of chemotherapy for the relatively few tumors ever cured solely by drugs depends, to a large extent, upon their easy susceptibility to undergo apoptosis (JOHNSTONE et al., 2002. Cell. 108(2): 153-64)
[0065] As used herein, a 'therapeutic regimen refers to a chemotherapeutic regimen or a radiotherapy regimen, or a combination thereof. [0066] As used herein, a "chemotherapeutic regimen" or "chemotherapy" refers to the use of at least one chemotherapy agent to destroy cancerous cells. There are a myriad of such chemotherapy agents available to a clinician. Chemotherapy agents may be administered to a subject in a single bolus dose, or may be administered in smaller doses over time. A single chemotherapeutic agent may be used (single-agent therapy) or more than one agent may be used in combination (combination therapy). Chemotherapy may be used alone to treat some types of cancer. Alternatively, chemotherapy may be used in combination with other types of treatment, for example, radiotherapy or alternative therapies (for example immunotherapy) as described herein. Additionally, a chemosensitizer may be administered as a combination therapy with a chemotherapy agent.
[0067] As used herein, a 'chemotherapeutic agent' refers to a medicament that may be used to treat cancer, and generally has the ability to kill cancerous cells directly. Examples of chemotherapeutic agents include alkylating agents, antimetabolites, natural products, hormones and antagonists, and miscellaneous agents. Examples of alternate names are indicated in brackets. Examples of alkylating agents include nitrogen mustards such as mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine and thiotepa; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozocin (streptozotocin); DNA synthesis antagonists such as estramustine phosphate; and triazines such as dacarbazine (DTIC, dimethyl-triazenoimidazolecarboxamide) and temozolomide . Examples of antimetabolites include folic acid analogs such as methotrexate (amethopterin); pyrimidine analogs such as fluorouracin (5- fluorouracil, 5-FU, 5FU), floxuridine (fluorodeoxyuridine, FUdR), cytarabine
(cytosine arabinoside) and gemcitabine; purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG) and pentostatin (2'-deoxycoformycin, deoxycoformycin), cladribine and fludarabine; and topoisomerase inhibitors such as amsacrine. Examples of natural products include vinca alkaloids such as vinblastine (VLB) and vincristine; taxanes such as paclitaxel and docetaxel (Taxotere); epipodophyllotoxins such as etoposide and teniposide; camptothecins such as topotecan and irinotecan; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, bleomycin, mitomycin (mitomycin C), idarubicin, epirubicin; enzymes such as L- asparaginase; and biological response modifiers such as interferon alpha and interlelukin 2. Examples of hormones and antagonists include luteinising releasing hormone agonists such as buserelin; adrenocorticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and fluoxymesterone and related preparations; androgen antagonists such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs such as leuprolide. Examples of miscellaneous agents include thalidomide; platinum coordination complexes such as cisplatin (c/s-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methyl hydrazine derivatives such as procarbazine (N-methylhydrazine, MIH); adrenocortical suppressants such as mitotane (o,p'-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as imatinib. Alternate names and trade-names of these and additional examples of chemotherapeutic agents, and their methods of use including dosing and administration regimens, will be known to a physician versed in the art, and may be found in, for example "The Pharmacological basis of therapeutics", 10th edition. HARDMAN HG., LIMBIRD LE. editors. McGraw-Hill, New York, and in "Clinical Oncology", 3rd edition. Churchill
Livingstone/ Elsevier Press, 2004. ABELOFF, MD. editor. [0068] As used herein, a 'chemosensitizer' refers to a medicament that may enhance the therapeutic effect of a chemotherapeutic agent or radiotherapy treatment and therefore improve efficacy of such treatment or agent. Examples of chemosensitizers may be found in Table 3. The sensitivity or resistance of a tumor or cancerous cell to treatment may also be measured in an animal, such as a human or rodent, by measuring the tumor size reduction over a period of time. For example, 6 months for a human and 4-6 weeks for a mouse. A composition or a method of treatment may sensitize a tumor or cancerous cell's response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 10% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method. The determination of sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician.
Table 3 Radio- and Chemo- sensitizing drugs.
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
WellStat triacetyluridine a prodrug of the nucleoside uridine, to enable higher dosage of 5-FU to be administered to cancer patients
YM Biosciences tesmilifene Histamine Antagonist hydrochloride
[0069] As used herein, the term "radiotherapeutic regimen" or "radiotherapy" refers to the administration of radiation to kill cancerous cells. Radiation interacts with various molecules within the cell, but the primary target, which results in cell death is the deoxyribonucleic acid (DNA). However, radiotherapy often also results in damage to the cellular and nuclear membranes and other organelles. DNA damage usually involves single and double strand breaks in the sugar-phosphate backbone. Furthermore, there can be cross-linking of DNA and proteins, which can disrupt cell function.
Depending on the radiation type, the mechanism of DNA damage may vary as does the relative biologic effectiveness. For example, heavy particles (i.e. protons, neutrons) damage DNA directly and have a greater relative biologic effectiveness. Electromagnetic radiation results in indirect ionization acting through short-lived, hydroxyl free radicals produced primarily by the ionization of cellular water. Clinical applications of radiation consist of external beam radiation (from an outside source) and brachytherapy (using a source of radiation implanted or inserted into the patient). External beam radiation consists of X-rays and/or gamma rays, while brachytherapy employs radioactive nuclei that decay and emit alpha particles, or beta particles along with a gamma ray.
[0070] Radiotherapy may further be used in combination chemotherapy, with the chemotherapeutic agent acting as a radiosensitizer. The specific choice of radiotherapy suited to an individual patient may be determined by a physician or oncologist, taking into consideration the tissue and stage of the cancer. Examples of radiotherapy approaches to various cancers may be found in, for example "Clinical Oncology", 3rd edition. Churchill Livingstone/ Elsevier Press, 2004. ABELOFF, MD. editor.
[0071] As used herein, the term "alternative therapeutic regimen" or "alternative therapy" may include for example, receptor tyrosine kinase inhibitors (for example Iressa™ (gefitinib), Tarceva™ (erlotinib), Erbitux™ (cetuximab), imatinib mesilate (Gleevec™), proteosome inhibitors (for example bortezomib, Velcade™); VEGFR2 inhibitors such as PTK787
(ZK222584), aurora kinase inhibitors (for example ZM447439); mammalian target of rapamycin (mTOR) inhibitors, cyclooxygenase-2 (COX-2) inhibitors, rapamycin inhibitors (for example sirolimus, Rapamune™); farnesyltransferase inhibitors (for example tipifarnib, Zamestra); matrix metalloproteinase inhibitors (for example BAY 12-9566; sulfated polysaccharide tecogalan); angiogenesis inhibitors (for example Avastin™ (bevacizumab); analogues of fumagillin such as TNP-4; carboxyaminotriazole; BB-94 and BB-2516; thalidomide; interleukin-12; linomide; peptide fragments; and antibodies to vascular growth factors and vascular growth factor receptors); platelet derived growth factor receptor inhibitors, protein kinase C inhibitors, mitogen-activated kinase inhibitors, mitogen-activated protein kinase kinase inhibitors, Rous sarcoma virus transforming oncogene (SRC) inhibitors, histonedeacetylase inhibitors, small hypoxia-inducible factor inhibitors, hedgehog inhibitors, and TGF-β signalling inhibitors. Furthermore, an immunotherapeutic agent would also be considered an alternative therapeutic regimen. For example, serum or gamma globulin containing preformed antibodies; nonspecific immunostimulating adjuvants; active specific immunotherapy; and adoptive immunotherapy. In addition, alternative therapies may include other biological-based chemical entities such as polynucleotides, including antisense molecules, polypeptides, antibodies, gene therapy vectors and the like. Such alternative therapeutics may be administered alone or in combination, or in combination with other therapeutic regimens described herein. Alternate names and trade-names of these agents used in alternative therapeutic regimens and additional examples of agents used in alternative therapeutic regimens, and their methods of use including dosing and administration regimens, will be known to a physician versed in the art. Furthermore, methods of use of chemotherapeutic agents and other agents used in alternative therapeutic regimens in combination therapies, including dosing and administration regimens, will also be known to a physician versed in the art.
[0072] A 'YB-1 expressing cancer' or a 'YB-1 expressing cancerous cell' refers to a cancer or cancerous cell that expresses Y-box protein 1 (YB-1 ). The relative level of YB-1 protein or nucleic acid transcript may be at the same level as a non-cancerous cell, or may be found at a level higher than that in a non-cancerous cell. For example, the level of YB-1 protein or nucleic acid transcript expression may be at least 10% higher than that in a noncancerous cell. Alternatively, the level of YB-1 protein or nucleic acid transcript expression may be 25%, 50%, 100%, 200% or greater than that in a non-cancerous cell. Levels of expression of specific protein or nucleic acids may be determined using methods known to those of skill in the art, and are described in, for example AUSUBEL et a/., Current Protocols in Molecular
Biology, John Wiley & Sons, New York, N.Y., 1998: ABELOFF, Clinical Oncology, 3rd edition. Churchill Livingstone/ Elsevier Press, 2004; HARLOW, E and LANE D. Antibodies: A Laboratory Manual. 1988. Cold Spring Harbor Laboratory Press; SAMBROOK J and RUSSELL DW. Molecular cloning: A Laboratory Manual 2001 Cold Spring Harbor Laboratory Press; Harrison's
Principles of Internal Medicine 15th ed. BRAUNWALD et al eds. McGraw-Hill.
[0073] YB-1 acts as a transcriptional activator of some genes, some of which have key roles in the development and progression of some cancers. For example, expression of YB-1 in some cell lines induces expression of
EGFR and HER2. Knocking down YB-1 expression inhibits cell growth in cancer cell lines. [0074] In one embodiment of the invention, methods of inhibiting expression of YB-1 in a YB-1 expressing cancer or a YB-1 expressing cancerous cell may include contacting the cell or cells with an inhibitor of YB-1 expression, for example an siRNA of YB-1.
[0075] YB-1 transcriptional activation may also be inhibited, and reduce the expression of a gene having YB-1 binding sequences or motifs. Inhibiting the binding of YB-1 to a promoter motif of a YB-1 responsive gene, for example EGFR, inhibits cell growth.
[0076] In another embodiment of the invention, methods of inhibiting YB-1 mediated transcription in a YB-1 expressing cancer or cancerous cell may include contacting the cell or cells with an inhibitor of YB-1 transcriptional activation, or a peptidic sequence that is a YB-1 selective Akt phosphorylation recognition site, for example, a peptide corresponding to SEQ ID NO: 12, or a substantially similar sequence thereof. While a YB-1 selective Akt phosphorylation recognition site may have sequence similarity to a native YB- 1 site recognized by Akt, there is no requirement for such recognition to result in phosphorylation of the peptidic sequence in each embodiement. In another example, an inhibitor of YB-1 transcriptional activation may include an antibody or antibody fragment capable of binding to a sequence corresponding to SEQ ID NO: 12.
[0077] It may be advantageous to incorporate aspects of the present invention, for example YB-1 transcriptional inhibitors in combination therapy with known chemotherapeutic agents or alternative therapeutic agents, for example ERBITUX™ (cetuximab) or HERCEPTIN ™ (trastuzumab). It is known in the art that a cancerous cell must express EGFR to be sensitive to cetuximab, or express HER2 to be sensitive to trastuzumab, however a subset of cancerous cells expressing either of these receptors are resistant to these therapeutic agents. Combining a YB-1 transcriptional inhibitor, for example a peptide corresponding to SEQ ID NO: 12 or a substantially similar sequence, with one of these examples of chemotherapeutic agents may sensitize the cancerous cells to the chemotherapeutic agent, or may enable a lower dosage of the chemotherapeutic agent. A YB-1 transcriptional inhibitor used in this manner, for example, may also be described as a chemosensitizer, or if used in combination with radiotherapy, a radiosensitizer.
EXAMPLES
Methods and Materials
Sequences of Peptides and Primers
Figure imgf000040_0001
Figure imgf000041_0001
Tumor Tissue Microarray
[0078] Tissue microarrays (TMA) were constructed from 438 cases of breast carcinoma from the archives at Vancouver General Hospital, as described previously (SUTHERLAND et al 2005. Oncogene 24:4281-4292; MAKRETSOV et al 2003. Hum. Pathol 34:1001-1008). Duplicate 0.6 mm cores of formalin-fixed paraffin embedded cores were used for array construction. Tissue microarray (TMA) slides were immunostained for EGFR and Her-2 as previously described (KUCAB et al 2005. Breast Cancer Res
7.R796-R807). To detect YB-1 , the tissues underwent antigen retrieval by heating to 1000C in a citrate buffer for 30 minutes, and the slides were incubated with anti-YB- 1 antibody at 1 :2000 overnight. YB-1 was detected using the LSAB+ system (Dako, Carpinteria, CA) (SUTHERLAND, supra). For interpretation of immunostaining, only cores containing invasive carcinoma were considered interpretable. Results from duplicate cores were combined to give a single result per case. Where there were discordant results for the duplicate cores, the higher result was accepted for that case as described previously (MAKRETSOV, supra). For YB-1 , tumors showing no staining or weak focal staining were considered to be YB-1 negative, while moderate or intense staining was considered positive. YB-1 immunostaining was predominantly found in the cytoplasm. The statistical analyses were based on the amount of YB-1 expressed in the cytoplasm. [0079] Tissue microarray slides were digitized using Bliss slide scanner based on Olympus BX61 microscope (Bacus Laboratories, Inc., Lombard, IL). Nine pictures were taken from each core, and the pixel dimensions were tiled to create a composite image. The images were viewed using the WebSlide Browser program (Bacus Laboratories). A Kaplan-Meier curve was generated using a non-parametric method for survival. Survival estimates (log rank and Breslow) are based on the weighted differences between actual and expected numbers of deaths at the observed time points. The log rank test factors in all deaths equally, while Breslow tests give more weight to early deaths. All statistical analyses were performed using the SPSS 11.0 statistical package.
Cox regression model is used for multivariate survival analysis. Tumor collection and analyses were performed in accordance with the guidelines established by the Vancouver General Hospital Research Ethics Board.
Cell Lines and Reagents
[0080] The PC-3, MCF-7, MDA-MB-231 , MDA-MB-468 and MDA-MB-453 breast cancer cell lines were obtained from the American Type Culture Collection (Manassas, VA). SUM149 cells were obtained from Astrand. JMIT-1 cells were obtained from the BC Cancer Agency (Dr. M. Bally). The C-terminal rabbit polyclonal antisera was produced as previously described
(GIMENEZ-BONAFE supra). The N-terminal chicken polyclonal antibody was raised against a YB-1 amino-terminus peptide MSSEAETQQPPAA (BERQUIN supra). Flag:YB-1 transgenes were detected using a M2 mouse monoclonal antibody to Flag (Sigma, St Louis MO). Flag:YB- 1(S102) was mutated to Flag:YB-1(A102) by site directed mutagenesis as previously described (SUTHERLAND, supra).
[0081] Cells were transfected using Lipofectamine 2000 (InVitrogen), following manufacturer's instructions
Western Blotting [0082] Proteins were isolated from MCF-7 cells expressing either the empty vector
(EV), Flag:YB-1 or Flag:YB-1(A102). Cells were 80% confluent when harvested by scraping. Cells were lysed in ELB buffer (5mM Hepes pH 7.4, 15OmM NaCI, 1 mM EDTA (pH 8), 1 % Triton-X 100, 1 % deoxycholate, and
0.1% SDS) with protease inhibitors and sheared through a 21 gauge needle. Proteins (100 ug/lane) were run on a 12% SDS polyacrylamide gel and transferred to a nitrocellulose membrane at 40V overnight at 40C. The membrane was then probed with anti-EGFR (1 :275, StressGen CSA330) or anti-Her-2 (1 :500, Abeam ab 2428) antibodies. Vinculin (1 :2000, Sigma Clone
Vin 11-5, V4505 antibody) and actin (Sigma) were used as loading controls. MCF-7 cells expressing the various constructs were also serum starved overnight then stimulated with EGF (40 ng/ml) for 30 min. The extracts were then evaluated for activation of signaling through the MAP kinase pathway using P-Erk 1/2 antibody (Thr 202/Tyr 204,1 :1000, Cell Signaling).
Real Time qRT-PCR
[0083] RNA was isolated from MCF-7 cells (transfected with empty vector,
Flag:YB-1 or Flag:YB-(A102) grown in log phase The RNA was reverse transcribed and amplified using Her-2 or EGFR specific primers and probes
(Applied Biosystems, Foster City, CA). TATA box binding protein mRNA was measured as a housekeeping gene (Applied Biosystems) as previously described (OH et al 2002 Neoplasia 4:204-217). Each sample was analyzed in replicates of four on two separate occasions.
MTT assay for cell growth
[0084] For the MTT assay, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy- methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) and phenazine methosulfate (PMS), were mixed in the proportions 2:0.92 μg/ml, and 25 μl of the mixture was added to each well. After incubation at 37 0C with
5% CO2 for 2 h, the absorbance of each well at 490 nm was measured in a 96-well plate reader according to the manufacturer's instructions. Cell viability was expressed as a percentage of control.
Chromatin Immunoprecipitation: [0085] ChIP assays were performed using the ChIP-IT kit (Active Motif
#101198) according to manufacturer's instructions. Buffers and reagents were provided with the ChIP-IT kits unless otherwise indicated. In brief, MCF7/Flag:YB-1 and MCF7/Flag:YB-1A102 cells were grown on 15-cm plates in phenol-red free RPMI with 5%FBS and 400μg/ml G418. The cells (8x106 cells/150 mm dish, 80% confluent) were fixed for 10min with 1% formaldehyde. After quenching the reaction with glycine for 5min, cells were treated with Lysis Buffer and extracted using a Dounce homogenizer. The nuclei were isolated and chromatin was sonicated in Shearing Buffer using a Cole Parmer Ultrasonic Processor at 25% power with 10 pulses of 20 seconds each and a 30 seconds rest on ice between each pulse to give chromatin fragments between 200bp and 1 kb. Chromatin was then pre- cleared with salmon sperm DNA/protein G agarose and incubated with 3μg anti-FLAG M2 monoclonal antibody (Sigma #F3165) overnight at 40C. Chromatin incubated with 3μg mouse IgG overnight at 40C was used as a negative control. Salmon sperm DNA/protein G agarose was subsequently incubated with the chromatin and antibody for 1.5hr at 40C. The immunoprecipitated material was washed twice with ChIP IP Buffer, 5 times with Wash Buffer 1 , twice with Wash Buffer 2, and 3 times with Wash Buffer 3. To reverse crosslink and to remove RNA, the immunoprecipitated material was incubated in 20OmM NaCI and 10μg RNase A overnight at 650C. The proteins were then removed by proteinase K treatment, and DNA was purified using the DNA purification minicolumns provided with the kit.
[0086] Eluted DNA (5 ul) was amplified by PCR with the following primers: EGFR1 b: 5'- TCGCCGCCAACGCCACAAC-3' (forward) (SEQ ID NO: 1 ) and
5'- ACACGCCCTTACCTTTCTTTTCCTCCAG-3' (reverse) (SEQ ID NO: 2); EGFR2a: 5'- CCGCGAGπTCCCTCGCATTTCT-3' (forward) (SEQ ID NO: 3) and 5'- CCTTCCCCCTTTCCCTTCTTTTGTTTTAC-3' (reverse) (SEQ ID NO: 4); EGFR2b: 5'- TCCCATTTGCCTTTCTCTAGTTTTGTTTTC-3' (forward) (SEQ ID NO: 5) and 5'- GTCCACCCCATCCCCACTGTTCCπCTC-3' (reverse) (SEQ ID NO: 6); EGFR3: 5'- TTCAGCAAACCCATTCTTCT-3' (forward) (SEQ ID NO: 7) and 5' GCTTCCTGCACACCTGGGCTGAG-3'
(reverse) (SEQ ID NO: 8). The PCR program was set with an initial melting step at 940C for 3min, then 35 cycles of (940C for 20 sec, 590C for 30 sec, and 720C for 30 sec). The PCR products were then analyzed on agarose gel by electrophoresis. PCR products were taken out after 32, 36 and 40 cycles to ensure that the reaction was in the linear range. 35 cycles was sufficient to produce amplicons in the linear range, and was used to establish optimal PCR conditions for the EGFR primers.
[0087] Endogenous YB-1 was subjected to ChIP using a chicken anti- human YB-1 polyclonal antibody, using a protocol adapted from the
Chromatin lmmunoprecipitation Assay Kit (Upstate). In brief, 7.5 x 106 cells per plate were treated with 1 % formaldehyde in growth media then harvested, pelleted and washed with PBS. Pellets were resuspended in lysis buffer (1 % SDS, 1OmM EDTA, 5OmM Tris, (pH 8.1 )) and sheared on ice by sonication (25% power, 10 cycles of 20 seconds on, 30 seconds off). Chromatin solution was diluted 5-fold in immunoprecipitation buffer (0.01 % SDS, 1% Triton X- 100, 1.2mM EDTA, 16.7mM Tris (pH 8.1 ), 50OmM NaCI) and precleared with PrecipHen beads (Aves Labs #P-1010) in lysis buffer (1 :3). The solution was then incubated with anti-YB-1 , chicken IgY, or pre-immune chicken IgY overnight. Complexes were incubated with 100ul of PrecipHen beads in lysis buffer (1 :3) for 1.5 hrs. lmmunoprecipitates were washed once with low salt buffer (0.1 % SDS, 1 % Triton X-100, 2mM EDTA, 2OmM Tris (pH 8.0), 15OmM NaCI), once with high salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 2OmM Tris (pH 8.0), 50OmM NaCI), once with LiCI buffer (0.25M LiCI, 1% IGEPAL, 1 % deoxycholate, 1 mM EDTA, 1OmM Tris (pH 8.0)), and twice with
Tris-EDTA buffer (1OmM Tris pH 8.0, 1mM EDTA). Protein:DNA complexes were eluted twice with elution buffer (1 % SDS, 0.1 M NaHCO3) and brief vortex. Eluates and input controls were treated with 5M NaCI at 650C overnight followed by proteinase K at 450C for 1 hr. DNA was purified by phenol/chloroform extraction and alcohol precipitation. PCR was performed with primers to EGFR as described above, or to Her-2. Her-2 primers used were: δ'-AGGGGCTCCAAATAGAATGT (forward) (SEQ ID NO: 9), 5'-
AATTTGGGAGGAGACAGTCA (reverse) (SEQ ID NO: 10). The Her-2 primers produced a 464 bp product that spanned -978 to -514 of the HER2 promoter. The DNA was amplified using the following PCR conditions: 950C for 2min, 40 cycles of 950C for 20sec, 570C for 30sec, 720C for 30sec.
Small interfering RNA
[0088] Small interfering RNA targeting YB-1 was expressed in pSuperDuper as previously described (EN-NIA et al. 2004 J Biol Chem 280:7702-7711). The targeting vector was used to silence YB-1 in MCF- 7(Flag:YB-1 ) cells. MCF- 7(Flag:YB-1 ) cells were plated in a 6-well dish and transfected with 0.8 ug of targeting vector plasmid DNA. The plasmid DNA was added to the transfection reagent (Lipofectamine 2000, InVitrogen) at a ratio of 1 :12.5 (siYB-1 #1 ) or 1 :25 (siYB-1#2), 96 hrs later the cells were lysed in ELB buffer and evaluated for changes in YB-1 , EGFR and Her-2 by Western immunoblotting.
Electrophoretic mobility shift and supershift assays
[0089] Electrophoreic mobility shift assays (EMSA) were performed using the LightShift Chemiluminescent EMSA Kit (Pierce product # 20148), following manufacturer's instructions, with some modifications. Briefly, nuclear protein extracts from MDA-MB-468 cells were obtained with the NEPER Nuclear and Cytoplasmic Extraction Reagent Kit (Pierce, product # 78833), following manufacturer's instructions. 4 ug of nuclear extract protein was used per reaction. Oligonucleotide probes corresponding to EGFR promoter sequences (SEQ ID NO: 13 and SEQ ID NO: 14) were synthesized and labelled at the 5' end with biotin. For YB-1 antibody supershift assays, 1 or 2 ug of YB-1 chicken polyclonal antibody was combined with the labelled probe and nuclear extract (no unlabelled probe). For the peptide inhibition assays, nuclear extracts were pretreated with 0 (DMSO control), 12,5, 25 or 50 uM peptide corresponding to SEQ ID NO: 11 , followed by incubation with labelled EGFR peptide. Samples were electrophoretically separated on 6% non-denaturing polyacrylamide gel, transferred to nylon membrane and crosslinked, and visualized using chemiluminescence.
Peptide synthesis
[0090] Biotin conjugated 25-mer peptides (AP-CSD) comprising the Antennapedia translocation domain and an additional 9 amino acids were synthesized using methods known in the art (Sigma, St. Louis MO) (RQIKIWFQNRRMKWKKPRKYLRSVG) (SEQ ID NO: 11 ).
Example 1 [0091] YB-1 binds directly to the EGFR and Her-2 promoters
Nine putative YB-1 responsive elements were identified in the first 2 kb of the EGFR promoter (Figure 2A). DNA:protein complexes were isolated from MCF-7/Flag:YB-1 and MCF- 7/Flag:YB-1(A102) expressing cells. The input DNA was evaluated in several ways prior to chromatin immunoprecipitation (ChIP). First, a sample of the sheared DNA was evaluated from each sample.
The degree of shearing and the amount of input DNA appeared equal. Genomic DNA was amplified with each of the primer sets to produce a single gene product of the expected size. ChIP was then performed using an antibody to Flag. The anti-Flag:YB-1 antibody was able to precipitate DNA that was amplified with each of the EGFR primer sets, suggesting that YB-1 bound directly to the EGFR promoter region (Figure 2B, lanes 1-4). DNA pulled down from MCF-7/Flag:YB-1(A102) could be amplified by the EGFR 2b and EGFR3 primer sets (Figure 2B, lanes 7-8); however, there was no amplification when EGFR 1b and EGFR2a primer sets were used (Figure 2B, lanes 5-6). The absence of PCR product from these sites with MCF-
7/Flag:YB-1(A102) samples was not due to primer inefficiency as the EGFR 2a primers were able to produce PCR products from the MCF-7/Flag:YB- 1(A102) genomic DNA (Figure 2B, lanes 16-18) . To ensure that the input DNA was equal prior to performing ChIP, aliquots of the input DNA from each sample was titrated (1 , 3, 5 ul). The input DNA was amplified with primers to EGFR 2a and the amount of PCR products from MCF-7/Flag:YB-1 and MCF- 7/Flag:YB-1(A102) appeared the same (Figure 2B, lanes 13-18). Given these data, we were confident that our ChIP starting material was unbiased. The loss of YB-1(S102) thus disrupted binding to both the EGFR 1 b and EGFR 2a sites located in the proximal promoter. These data indicated that YB-1(A102) does not optimally bind to the first 1 kb of the EGFR promoter, which could explain why loss of S102 prevents the induction of EGFR.
[0092] Following this series of experiments, ChIP was performed on the MDA-MB-231 breast cancer cells to confirm that endogenous YB-1 bound to the EGFR promoter. The primers EGFRI b, EGFR2a and EGFR2b amplified products of the expected size; however EGFR3 did not (Figure 2C, lanes 2-5).
Amplification was not due to non-specific binding to the IgY given that the control reactions produced little or no product (Figure 2C, lanes 6-9). The sheared input DNA (Figure 2D, lanes 2-6) and the no template DNA reactions (Figure 2D, lanes 6-9) served as positive and negative controls for ChIP. The primers were also used to amplify genomic DNA (Figure 2D, lanes 10-13). We concluded that Flag:YB-1 and endogenous YB-1 bound to the EGFR promoter and that loss of the S102 site on YB-1 destabilized the interaction.
[0093] Similarly, we investigated whether disrupting YB-1 at S102 has an impact on the binding of this transcription factor to Her-2. There are four potential YB-1 responsive elements (YRE's) on the Her-2 promoter (Figure 6A). Primers were designed to capture three out of four binding sites excluding the one that was juxtaposed to the AP-2 and Ets sites. Flag:YB-1 bound to Her-2 while the Flag:YB-1(A102) mutant did not (Figure 6B). We further questioned whether endogenous YB-1 also bound to Her-2 and to interrogate this possibility we used the MDA-MB- 453 breast cancer cells because they express very high levels of Her-2 in the absence of gene amplification. Endogenous YB-1 :DNA complexes were pulled down and the precipitated DNA was amplified for Her-2. In this breast cancer cell line, YB-1 specifically bound to the Her-2 promoter (Figure 6C, lane 2), further supported by the absence of binding to the IgY (Figure 6C, lane 3). Input sheared DNA served as a positive control (Figure 6C, lane 4).
Example 2
EGFR and HER2 are regulated by YB-1 [0094] Flag:YB-1 was stably transfected into MCF-7 cells, to investigate a possible mechanistic link between YB-1 and expression of EGFR and HER2.
Comparisons were made to cells expressing mutant YB-1 (A102) that had the S102 site disrupted by site-directed mutagenesis. The level of the transgene expression was approximately the same as endogenous YB-1. Surprisingly, , Her-2 and EGFR proteins were induced as a result of YB-1 over-expression (Figure 3A). However, mutating YB-1 on its DNA binding domain from S102 to A102 prevented the induction of those proteins (Figure 3A). Additionally, the expression of YB-1 caused an increase in EGFR and Her-2 mRNA whereas the mutant did not (Figure 3B, C). Cells expressing Flag:YB-1 were also more responsive to EGF because there was more signaling through the MAP kinase pathway (Figure 3D, middle lane) as compared to the cells expressing either the YB-1 (A102) (Figure 3D, right lane) or empty vector (Figure 3D, left lane).
Example 3 YB-1 positively correlates with EGFR and Her-2 in primary breast tumours
[0095] Tumour tissue microarrays representing 389 primary breast tumours were immunostained for YB-1 , EGFR, Her-2, ER and Ki67. YB-1 protein was coordinately expressed with Her-2 and EGFR as well as the proliferation marker Ki67 (Table 4). YB-1 expression was also strongly associated with ER negative breast cancers. Nodal status and tumor size did not relate to high levels of YB-1. YB-1 was moderately to highly expressed in 43% (167/389) of the cases, which showed decreased patient survival based on Breslow (p=0.0065) and log rank (p= 0.01 ) analyses, respectively (Figure 1 ). The Breslow test is predictive of early deaths. These data indicate that YB- 1 expression is associated with early death due to breast cancer. In a multivariate analysis, YB-1 had independent prognostic significance (p=0.019) (Table 5); the Cox regression model included Her-2 (p=0.018), lymph node status (p<0.001 ) and tumor size (p= 0.022), which are also known to be independently associated with poor survival. YB-1 had a comparable impact on the relative risk of dying from breast cancer to expression of either HER2 or tumor size. The relative risk ratios for YB-1 , HER2, lymph node status and tumor size were 1.792, 1.994, 2.436 and 1.788, respectively.
Table 4. YB-1 correlation with primary breast tumor markers
Figure imgf000050_0001
Correlations were considered significant if the Fisher's Exact test were p<0.05
Table 5. Multivariate analysis of YB-1 in comparison to other prognostic markers for breast cancer.
Figure imgf000050_0002
Example 4
YB-1 siRNA results in decrease of EGFR, HER2 protein expression [0096] The expression of YB-1 was silenced using small interfering RNA's. MCF-7(Flag:YB-1 ) cells were transfected with pSuperDuper vector expressing small interfering RNA targeting YB-1 , and proteins were harvested 96 hours later. The targeting vector suppressed the expression of Flag:YB-1 and endogenous YB-1 (Figure 4A, lanes 2&3) compared to the empty vector (Figure 4A, lane 1 ). Loss of YB-1 expression correlated with a decrease in EGFR protein expression (Figure 4A, second panel). Two different concentrations of the targeting vector were used (siYB-1#1 and siYB-1#2) and both resulted in suppression of EGFR. Likewise, knocking down YB-1 inhibited the expression of Her-2 (Figure 4B). Similarly, knocking down YB-1 with a pSuper vector targeting different portion of YB-1 suppressed the expression of Her-2 in MDA-MB-453 cells (not shown). YB-1 was necessary for the expression of these receptors.
Example 5
YB-1 inhibition suppresses growth of Herceptin resistant and EGFR- expressing cells
[0097] Herceptin resistant cells (MDA-MB-453; see Kucab et al 2005, Breast Cancer Res. 7(5):R796-807; Menendez et al 2005, J Natl Cancer Inst. 2;97(21):1611-5) or EGFR over-expressing (SUM 149; see Kleer et al 2002, Oncogene 9;21 (20) :3172-80; Kleer et al 2004, Neoplasia 6(2): 179-85; Van den Eynden GG, Van Laere SJ, Van der Auwera I, Merajver SD, Van Marck EA, van Dam P, Vermeulen et al 2005, Breast Cancer Res Treat. 22;: 1-10; Lev et al 2004, Br J Cancer. 16;91(4):795-802) were exposed AP-CSD (SEQ ID NO: 11 ) peptide conjugated to a biotin tracer at a concentration of 0 (DMSO control), 12.5, 25 or 50 μM for 72 hours, and allowed to grow. Growth of cells under these conditions was assessed by MTT assay. MDA-MB-453 cells (Figure 5A) demonstrate significant growth inhibition at peptide concentrations of 25 μM and greater, knocking back cell survival to less than 10% of control cells. SUM 149 cells (Figure 5B) also demonstrated significant growth inhibition at peptide concentrations of 25 μM, with cell survival decreased to -60% of control, and less than 5% of control at 50 μM.
Example 6
YB-1 :DNA binding to the EGFR promoter is inhibited with the cell permeable peptide
[0098] Nuclear extracts were taken from a breast cancer cell line that expresses high levels of EGFR, the MDA-MB-468 line, and assayed for EGFR-promoter binding and the presence of YB-1. YB-1 binds directly to the EGFR promoter using a gel shift assay (Figure 7A). Lane 1 shows the unbound, biotin-labelled EGFR probe, lane 2 shows the shift of the EGFR probe when bound by protein in the nuclear extract. Lane 3 demonstrates the specificity of the binding to the EGFR probe by pre-incubation of the nuclear extract with unlabelled probe. YB-1 specific antisera (lanes 4 and 5) was combined with bound, labeled probe, demonstrating the 'supershift' effect of the bound YB-1 antibody.
[0099] AP-CSD (SEQ ID NO: 11 ) peptide conjugated to biotin was used to inhibit binding of YB-1 to the labelled EGFR probe (Figure 7B). Lane 1 shows the labeled EGFR probe bound by protein from the nuclear extract. For lanes 2, 3 and 4, the nuclear extract was pre-incubated with 12.5, 25 or 50 uM biotin labeled peptide before incubating with the labeled EGFR probe. Binding of
YB-1 to the EGFR promoter sequence was inhibited by the AP-CSD peptide.
Example 7
Efficacy of peptide in other cell lines [00100] PC3 prostate adenocarcinoma cells represent an aggressive, incurable form of prostate cancer. When PC3 cells were exposed biotin- labelled AP-CSB peptide (SEQ ID NO: 11) at a concentration of 0 (DMSO control), 12.5, 25 or 50 μM for 72 hours and allowed to grow. Growth of cells under these conditions were assessed by MTT assay (Figure 8). Growth of PC3 cells was suppressed in a dose-dependent manner by the peptide.
Example 8
YB- 1 phosphorylation inhibiting peptide does not significantly inhibit normal breast epithelial cell growth
[00101] The two protocols set out in this example together provided evidence that YB-1 inhibitory peptides of the invention preferentially kill breast cancer cells.
[00102] Normal mammary EpCAM+ breast epithelial cells were taken from two women who had undergone a reduction mammoplasty. The cells were isolated, plated at a density of 1000 cells/well, treated with either a control (RQIKIWFQNRRMKWKKRALKYGVRP) or YB-1 inhibitory peptides (6 or 25 uM RQIKIWFQNRRMKWKKPRKYLRSVG Seq ID no: 11 ) for 72 hrs and then assessed for viability using the MTS assay. Both peptides were synthesized by Sigma to >95% Purity, 50mg according to Mass Spectral and HPLC Analyses and were reconstituted in acetic acid. The samples were evaluated in replicates of six. The results illustrated in Figure 9 confirm that the YB-1 inhibitory peptide has essentially no toxicity on normal mammary EpCAM+ cells. The results of a colony forming assays for the normal breast epithelial cells (data not shown) also confirmed that the YB-1 peptide has essentially no adverse effect on the ability of the normal cells to form colonies.
[00103] The peptides were tested as above against pre-neoplastic 184htrt cells (shown to lack YB-1 expression, data not illustrated herein, a cell line previously described in Oh et al 2002, Neoplasia 4(3) 204-217) and compared to the breast cancer SUM149 cells, to test for specificity. The YB-1 inhibitory peptide (SEQ ID No: 11) killed >90% of the SUM149 cells at concentrations above 12.5 uM, whereas there was only a modest deleterious effect on the 184htrt cells, particularly at concentrations below 12.5 uM, demonstrating that the peptide has modest off target effects, as illustrated in Figure 10.
REFERENCES [00104] The following list of references is a specific listing that goes beyond the references cited above, to provide a bibliographic summary of art that relates in large part to protein transduction domains. These references are hereby incorporated by reference, as are the other documents cited herein:
[00105] BASHOUR AM, MENG JJ, IP W, MACCOLLIN M, RATNER N: The neurofibromatosis Type 2 gene product, merlin, reverses the F-actin cytoskeletal defects in primary human Schwannoma cells. MoI. Cell Biol. (2002) 22(4): 1150-1157.
[00106] BEGLEY R, LIRON T, BARYZA J, MOCHLY-ROSEN D: Biodistribution of intracellular^ acting peptides conjugated reversibly to TAT. Biochem. Biophys. Res. Commun. (2004) 318(4):949-954.
[00107] BRIGHT R, MOCHLY-ROSEN D: The role of protein kinase C in cerebral ischemic and reperfusion injury. Stroke (2005) 36(12):2781 -2790.
[00108] CHEN YN, SHARMA SK, RAMSEY TM et al.: Selective killing of transformed cells by cyclin/cyclin-dependent kinase 2 antagonists. Proc. Natl. Acad. Sci. USA (1999) 96(8):4325-4329.
[00109] CONNER SD, SCHMID SL: Regulated portals of entry into the cell. Nature (2003) 422(6927):37-44.
[00110] DATTA K, NAMBUDRIPAD R, PAL S et al.: Inhibition of insulin- like growth factor-l-mediated cell signaling by the von Hippel-Lindau gene product in renal cancer. J. Biol. Chem. (2000) 275(27):20700-20706. [00111] DATTA K, SUNDBERG C, KARUMANCHI SA, MUKHOPADHYAY D: The 104-123 amino acid sequence of the β-domain of von Hippel-Lindau gene product is sufficient to inhibit renal tumor growth and invasion. Cancer Res. (2001 ) 61(5):1768-1775.
[00112] EGUCHI A, AKUTA T, OKUYAMA H et al.: Protein transduction domain of HIV-1 TAT protein promotes efficient delivery of DNA into mammalian cells. J. Biol. Chem. (2001 ) 276(28):26204-26210.
[00113] FISCHER R, KOHLER K, FOTIN-MLECZEK M, BROCK R: A stepwise dissection of the intracellular fate of cationic cell-penetrating peptides. J. Biol. Chem. (2004) 279(13):12625-12635.
[00114] FRANKEL AD, PABO CO: Cellular uptake of the TAT protein from human immunodeficiency virus. Cell (1988) 55(6): 1189-1193.
[00115] FUJIMOTO K, HOSOTANI R, MIYAMOTO Y et al.: Inhibition of pRb phosphorylation and cell cycle progression by an antennapedia- p16(INK4A) fusion peptide in pancreatic cancer cells. Cancer Lett. (2000)
159(2):151-158.
[00116] FUKI IV, MEYER ME, WILLIAMS KJ: Transmembrane and cytoplasmic domains of syndecan mediate a multi-step endocytic pathway involving detergent-insoluble membrane rafts. Biochem. J. (2000) 351(Pt
3):607-612.
FUTAKI S, SUZUKI T, OHASHI W et al.: Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J. Biol. Chem. (2001 ) 276(8):5836-5840. [00117] GREEN M, LOEWENSTEIN PM: Autonomous functional domains of chemically synthesized human immunodeficiency virus TAT trans- activator protein. Cell (1988) 55(6):1179-1188.
[00118] HAKANSSON S, JACOBS A, CAFFREY M: Heparin binding by the HIV-1 TAT protein transduction domain. Protein Sci. (2001 ) 10(10):2138- 2139.
[00119] HARADA H, HIRAOKA M, KIZAKA-KONDOH S: Antitumor effect of TAT-oxygen-dependent degradation-caspase-3 fusion protein specifically stabilized and activated in hypoxic tumor cells. Cancer Res. (2002) 62(7):2013-2018.
[00120] HARBOUR JW, WORLEY L, MA D, COHEN M: Transducible peptide therapy for uveal melanoma and retinoblastoma. Arch. Ophthalmol.
(2002) 120(10): 1341 -1346.
[00121] HEWLETT LJ, PRESCOTT AR, WATTS C: The coated pit and macropinocytic pathways serve distinct endosome populations. J. Cell Biol. (1994) 124(5):689-703.
[00122] HOSOTANI R, MIYAMOTO Y, FUJIMOTO K et al.: Trojan p16 peptide suppresses pancreatic cancer growth and prolongs survival in mice. Clin. Cancer Res. (2002) 8(4):1271-1276.
[00123] HUPP TR, SPARKS A, LANE DP: Small peptides activate the latent sequence-specific DNA binding function of p53. Cell (1995) 83(2):237- 245.
[00124] INAGAKI K, CHEN L, IKENO F et al.: Inhibition of delta-protein kinase C protects against reperfusion injury of the ischemic heart in vivo. Circulation (2003) 108(19):2304-2307. [00125] JOLIOT A, PROCHIANTZ A: Transduction peptides: from technology to physiology. Nat. Cell. Biol. (2004) 6(3):189-196.
[00126] KAPLAN IM, WADIA JS, DOWDY SF: Cationic TAT peptide transduction domain enters cells by macropinocytosis. J. Control. Release (2005) 102(1 ):247-253.
[00127] KATO D, MIYAZAWA K, RUAS M et al.: Features of replicative senescence induced by direct addition of antennapedia-p16INK4A fusion protein to human diploid fibroblasts. FEBS Lett. (1998) 427(2):203-208.
[00128] KOCH AM, REYNOLDS F, KIRCHER MF et al.: Uptake and metabolism of a dual fluorochrome TAT-nanoparticle in HeLa cells. Bioconjug. Chem. (2003) 14(6):1115-1121.
[00129] LEE CM, TANNOCK IF: Inhibition of endosomal sequestration of basic anticancer drugs: influence on cytotoxicity and tissue penetration. Br. J. Cancer (2006) 94(6):863-869.
[00130] LEWIN M, CARLESSO N, TUNG CH et al.: TAT peptide- derivatized magnetic nanoparticles allow in vivo tracking and recovery of progenitor cells. Nat. Biotechnol. (2000) 18(4):410-414.
[00131] LINDSAY MA: Peptide-mediated cell delivery: application in protein target validation. Curr. Opin. Pharmacol. (2002) 2(5):587-594.
[00132] LUNDBERG M, JOHANSSON M: Positively charged DNA- binding proteins cause apparent cell membrane translocation. Biochem. Biophys. Res. Commun. (2002) 291(2):367-371. [00133] MAGZOUB M, PRAMANIK A, GRASLUND A: Modeling the endosomal escape of cell-penetrating peptides: transmembrane pH gradient driven translocation across phospholipid bilayers. Biochemistry (2005) 44(45): 14890-14897.
[00134] MAI JC, Ml Z1 KIM SH, NG B, ROBBINS PD: A proapoptotic peptide for the treatment of solid tumors. Cancer Res. (2001 ) 61 (21 ):7709- 7712.
[00135] MEIER O, BOUCKE K, HAMMER SV et al.: Adenovirus triggers macropinocytosis and endosomal leakage together with its clathrin-mediated uptake. J. Cell Biol. (2002) 158(6):1119-1131.
[00136] MENDOZA N, FONG S, MARSTERS J et al.: Selective cyclin- dependent kinase 2/cyclin A antagonists that differ from ATP site inhibitors block tumor growth. Cancer Res. (2003) 63(5): 1020-1024.
[00137] MURRIEL CL, MOCHLY-ROSEN D: Opposing roles of delta and epsilon PKC in cardiac ischemia and reperfusion: targeting the apoptotic machinery. Arch. Biochem. Biophys. (2003) 420(2):246-254.
[00138] NAKASE I, NIWA M, TAKEUCHI T et al.: Cellular uptake of arginine-rich peptides: roles for macropinocytosis and actin rearrangement. MoI. Then (2004) 10(6): 1011-1022.
[00139] NORBURY CC, HEWLETT LJ, PRESCOTT AR, SHASTRI N, WATTS C: Class I MHC presentation of exogenous soluble antigen via macropinocytosis in bone marrow macrophages. Immunity (1995) 3(6):783- 791. [00140] PEREZ F, JOLIOT A, BLOCH-GALLEGO E et al.: Antennapedia homeobox as a signal for the cellular internalization and nuclear addressing of a small exogenous peptide. J. Cell Sci. (1992) 102(Pt 4):717-722.
[00141] POTOCKY TB, MENON AK, GELLMAN SH: Cytoplasmic and nuclear delivery of a TAT-derived peptide and a β-peptide after endocytic uptake into HeLa cells. J. Biol. Chem. (2003) 278(50):50188-50194.
[00142] ROTHBARD JB, KREIDER E, VANDEUSEN CL et al.: Arginine- rich molecular transporters for drug delivery: role of backbone spacing in cellular uptake. J. Med. Chem. (2002) 45(17):3612-3618.
[00143] RUSNATI M, COLTRINI D, ORESTE P et al.: Interaction of HIV- 1 TAT protein with heparin. Role of the backbone structure, sulfation, and size. J. Biol. Chem. (1997) 272(17): 11313-11320.
[00144] RUSNATI M, TULIPANO G, URBINATI C et al.: The basic domain in HIV-1 TAT protein as a target for polysulfonated heparin-mimicking extracellular TAT antagonists. J. Biol. Chem. (1998) 273(26): 16027-16037.
[00145] SCHWARZE SR, HO A, VOCERO-AKBANI A, DOWDY SF: In vivo protein transduction: delivery of a biologically active protein into the mouse. Science (1999) 285(5433): 1569-1572.
[00146] SELIVANOVA G, IOTSOVA V, OKAN I et al.: Restoration of the growth suppression function of mutant p53 by a synthetic peptide derived from the p53 C-terminal domain. Nat. Med. (1997) 3(6):632-638.
[00147] SHERR CJ, MCCORMICK F: The RB and p53 pathways in cancer. Cancer Cell (2002) 2(2): 103-112. [00148] SHIRAISHI T, NIELSEN PE: Photochemically enhanced cellular delivery of cell penetrating peptide-PNA conjugates. FEBS Lett. (2006) 580(5):1451-1456.
[00149] SNYDER EL, DOWDY SF: Recent advances in the use of protein transduction domains for the delivery of peptides, proteins and nucleic acids in vivo. Expert Opin. Drug Deliv. (2005) 2(1 ):43-51.
[00150] SNYDER EL, MEADE BR, SAENZ CC, DOWDY SF: Treatment of terminal peritoneal carcinomatosis by a transducible p53-activating peptide.
PLoS Biol. (2004) 2(2):E36. [CrossRef]
[00151] SOUROUJON MC, MOCHLY-ROSEN D: Peptide modulators of protein-protein interactions in intracellular signaling. Nat. Biotechnol. (1998) 16(10):919-924.
[00152] STEIN S, WEISS A, ADERMANN K et al.: A disulfide conjugate between anti-tetanus antibodies and HIV (37-72)TAT neutralizes tetanus toxin inside chromaffin cells. FEBS Lett. (1999) 458(3):383-386.
[00153] SWANSON JA, WATTS C: Macropinocytosis. Trends Cell Biol. (1995) 5(11 ):424-428.
[00154] THOREN PE, PERSSON D, KARLSSON M, NORDEN B: The antennapedia peptide penetratin translocates across lipid bilayers - the first direct observation. FEBS Lett. (2000) 482(3):265-268.
[00155] TORCHILIN VP, LEVCHENKO TS, RAMMOHAN R et al.: Cell transfection in vitro and in vivo with nontoxic TAT peptide-liposome-DNA complexes. Proc. Natl. Acad. Sci. USA (2003) 100(4): 1972-1977. [00156] TORCHILIN VP, RAMMOHAN R1 WEISSIG V, LEVCHENKO TS: TAT peptide on the surface of liposomes affords their efficient intracellular delivery even at low temperature and in the presence of metabolic inhibitors. Proc. Natl. Acad. Sci. USA (2001 ) 98(15):8786-8791.
[00157] TREHIN R, MERKLE HP: Chances and pitfalls of cell penetrating peptides for cellular drug delivery. Eur. J. Pharm. Biopharm. (2004) 58(2):209-223.
[00158] TYAGI M, RUSNATI M, PRESTA M, GIACCA M: Internalization of HIV-1 TAT requires cell surface heparan sulfate proteoglycans. J. Biol. Chem. (2001 ) 276(5):3254-3261.
[00159] UEMURA S, ROTHBARD JB, MATSUSHITA H et al.: Short polymers of arginine rapidly translocate into vascular cells: effects on nitric oxide synthesis. Circ. J. (2002) 66(12):1155-1160.
[00160] Vives E, Lebleu B (1997) Selective coupling of a highly basic peptide to an oligonucleotide. Tetrahedron Letters 38: 1183-1186
[00161] VIVES E, RICHARD JP, RISPAL C, LEBLEU B: TAT peptide internalization: seeking the mechanism of entry. Curr. Protein Pept. Sci. (2003) 4(2): 125-132.
[00162] WADIA JS, DOWDY SF: Modulation of cellular function by TAT mediated transduction of full length proteins. Curr. Protein Pept. Sci. (2003) 4(2):97-104.
[00163] WADIA JS, DOWDY SF: Transmembrane delivery of protein and peptide drugs by TAT-mediated transduction in the treatment of cancer.
Adv. Drug Deliv. Rev. (2005) 57(4):579-596. [00164] WADIA JS, STAN RV, DOWDY SF: Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat. Med. (2004) 10(3):310-315.
[00165] WAGSTAFF KM, JANS DA: Protein transduction: cell penetrating peptides and their therapeutic applications. Curr. Med. Chem. (2006) 13(12):1371-1387.
[00166] WENDER PA, MITCHELL DJ, PATTABIRAMAN K et al.: The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters. Proc. Natl. Acad. Sci. USA (2000) 97(24): 13003-13008.
[00167] WENDER PA, ROTHBARD JB, JESSOP TC, KREIDER EL, WYLIE BL: Oligocarbamate molecular transporters: design, synthesis, and biological evaluation of a new class of transporters for drug delivery. J. Am. Chem. Soc. (2002) 124(45):13382-13383.
CONCLUSION [00168] Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word "comprising" is used herein as an open-ended term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning. As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a thing" includes more than one such thing. Citation of references herein is not an admission that such references are prior art to the present invention. Any priority document(s) and all publications, including but not limited to patents and patent applications, cited in this specification are incorporated herein by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein and as though fully set forth herein. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings.

Claims

1. A cell permeable Y-box binding protein-1 (YB-1) phosphorylation inhibitor comprising a peptidic sequence that is a YB-1 selective protein kinase B (Akt) phosphorylation recognition site.
2. The YB-1 phosphorylation inhibitor of claim 1 , wherein the Akt phosphorylation site comprises the sequence RXXXRS, wherein X is any amino acid or amino acid analogue.
3. The YB-1 phosphorylation inhibitor of claim 1 , comprising a contiguous sequence of at least nine residues of the formula:
Xi X2 X3 X4 X5 Xβ X7 Xe Xg Xi 0 Xi 1 X12 wherein:
Figure imgf000064_0001
X2 is Z or N or D or H or S or X
X3 is Z or P
X4 is R
X5 is K or R or E or Q or X
X6 is Y or F or W or X X7 is L or M or I or V or F or X
X8 is R
X9 is S
X-io is Z or V or I or L or M or X
X11 is Z or G or X Xi2 is Z or D or N or E or X in which
X = any amino acid or amino acid analogue,
Z = not present.
4. The YB-1 phosphorylation inhibitor of claim 3, wherein:
Figure imgf000064_0002
X2 is Z or N or D X3 is Z or P X4 is R X5 is K or R X6 is Y or F or W X7 is L or M or I
X8 is R X9 is S
Xio is Z or V or I Xii is Z or G
Figure imgf000065_0001
5. The YB-1 phosphorylation inhibitor of any one of claims 1 to 4, further comprising a protein transduction domain.
6. The YB-1 phosphorylation inhibitor of claim 5, wherein the protein transduction domain is an Antennapedia transduction domain.
7. The YB-1 phosphorylation inhibitor of claim 6, wherein the Antennapedia transduction domain has the sequence RQIKIWFQNRRMKWKK.
8. The YB-1 phosphorylation inhibitor of any one of claims 1 through 7, wherein the YB-1 selective Akt phosphorylation site has the sequence PRKYLRSVG.
9. The YB-1 phosphorylation inhibitor of claim 1 , consisting essentially of a peptide having the sequence RQIKIWFQNRRMKWKKPRKYLRSVG.
10. A composition comprising the YB-1 phosphorylation inhibitor of any one of claims 1 to 9 and a pharmaceutically acceptable carrier.
11. Use of the YB-1 phosphorylation inhibitor of any one of claims 1 to 9, to formulate a medicament.
12. Use of the YB-1 phosphorylation inhibitor of any one of claims 1 to 9, to formulate a medicament for treating a YB-1 mediated disease.
13. Use of the YB-1 phosphorylation inhibitor of any one of claims 1 to 9, for treating a YB-1 mediated disease.
14. The use of the YB-1 phosphorylation inhibitor according to claim 12 or
13, wherein the YB-1 mediated disease is selected from the group consisting of cancer, heart disease, kidney disease, diabetes, autoimmune disease, cerebral palsy and infection.
15. The use of the YB-1 phosphorylation inhibitor according to claim 12 or
13, wherein the YB-1 mediated disease is a cancer.
16. The use of the YB-1 phosphorylation inhibitor according to claim 15, wherein the cancer is selected from the group consisting of melanoma, adenocarcinoma, hepatoma, fibrosarcoma, colon, prostate and breast cancer.
17. The use of the YB-1 phosphorylation inhibitor according to claim 15, wherein the cancer is a breast cancer.
18. The use of the YB-1 phosphorylation inhibitor according to claim 17, wherein the breast cancer is a trastuzumab resistant breast cancer.
19. The use of the YB-1 phosphorylation inhibitor according to claim 15, wherein the cancer is a prostate cancer.
20. The use of the YB-1 phosphorylation inhibitor according to claim 19, wherein the prostate cancer is an androgen independent prostate cancer.
21. A method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the YB-1 phosphorylation inhibitor of any one of claims 1 to 9.
22. The method of claim 21 , wherein the subject is suffering from a YB-1 mediated disease.
23. The method of claim 21 , wherein the subject is suffering from a disease selected from the group consisting of cancer, heart disease, kidney disease, diabetes, autoimmune disease, cerebral palsy and infection.
24. The method of claim 23, wherein the disease is a cancer.
25. The method of claim 24, wherein the cancer is selected from the group consisting of melanoma, adenocarcinoma, hepatoma, fibrosarcoma, colon, prostate and breast cancer.
26. The method of claim 25, wherein the cancer is a breast cancer.
27. The method of claim 26, wherein the breast cancer is a trastuzumab resistant breast cancer.
28. The method of claim 25, wherein the cancer is a prostate cancer.
29. The method of claim 28, wherein the prostate cancer is an androgen- independent prostate cancer.
30. The method of any one of claims 21 to 29, wherein the subject is a human.
31. A method of inhibiting the phosphorylation of YB-1 comprising contacting a cell with the YB-1 phosphorylation inhibitor of any one of claims 1 to 9.
32. The method of claim 31 , wherein the cell is a human cancer cell.
33. The method of claim 32, wherein the cancer cell is a breast cancer cell.
34. The method of claim 33, wherein the breast cancer cell is a trastuzumab resistant breast cancer cell.
35. The method of claim 32, wherein the cancer cell is a prostate cancer cell.
36 The method of claim 35, wherein the prostate cancer is an androgen- independent prostate cancer cell.
37. A recombinant nucleic acid encoding the YB-1 phosphorylation inhibitor of any one of claims 1 to 9, wherein the YB-1 phosphorylation inhibitor consists of a polypeptide.
38. A cell permeable peptidic compound comprising an Akt phosphorylation recognition site comprising the peptide sequence PRKYLRSVG.
39. A cell permeable peptidic compound comprising an Akt phosphorylation recognition site comprising the peptide sequence:
Xi X2 X3 X4 X5 Xδ X7 Xe X9 X10 Xi 1 X12 wherein: X1 is Z or N or D or H or S or X
X2 is Z or N or D or H or S or X
X3 is Z or P
X4 is R X5 is K or R or E or Q or X
X6 is Y or F or W or X
X7 is L or M or I or V or F or X
X8 is R
X9 is S X-io is Z or V or I or L or M or X
Xii is Z or G or X
Xi2 is Z or D or N or E or X in which
X = any amino acid or amino acid analogue, Z = not present.
40. The compound of claim 39, wherein:
Figure imgf000069_0001
X2 is Z or N or D X3 is Z or P
X4 is R
X5 is K or R
X6 is Y or F or W
X7 is L or M or I X8 is R
X9 is S
Xio is Z or V or I
Figure imgf000069_0002
41. The compound of any one of claims 38 to 40, further comprising a protein transduction domain.
PCT/CA2007/000526 2006-03-29 2007-03-29 Therapeutic yb-1 phosphorylation decoys Ceased WO2007109908A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78671206P 2006-03-29 2006-03-29
US60/786,712 2006-03-29

Publications (1)

Publication Number Publication Date
WO2007109908A1 true WO2007109908A1 (en) 2007-10-04

Family

ID=38540770

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2007/000526 Ceased WO2007109908A1 (en) 2006-03-29 2007-03-29 Therapeutic yb-1 phosphorylation decoys

Country Status (1)

Country Link
WO (1) WO2007109908A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160310607A1 (en) * 2013-10-28 2016-10-27 Cupid Peptide Company Limited Cell transport
CN109200287A (en) * 2017-08-03 2019-01-15 吉林众泰生物技术有限公司 Directly or indirectly application of the substance of regulation YB-1 phosphorylation in terms of the drug of preparation treatment inflammatory factor associated diseases
WO2019024875A1 (en) * 2017-08-03 2019-02-07 吉林众泰生物技术有限公司 Use of substance directly or indirectly regulating yb-1 phosphorylation in preparation of drug for treating disease caused by inflammatory factors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005117992A2 (en) * 2004-05-30 2005-12-15 Cemines, Inc. Controlled delivery of therapeutic compounds

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005117992A2 (en) * 2004-05-30 2005-12-15 Cemines, Inc. Controlled delivery of therapeutic compounds

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SUTHERLAND B.W. ET AL.: "Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells", ONCOGENE, vol. 24, no. 26, 16 June 2005 (2005-06-16), pages 4281 - 4292 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160310607A1 (en) * 2013-10-28 2016-10-27 Cupid Peptide Company Limited Cell transport
US9913914B2 (en) * 2013-10-28 2018-03-13 Cupid Peptide Company Limited Cell transport
CN109200287A (en) * 2017-08-03 2019-01-15 吉林众泰生物技术有限公司 Directly or indirectly application of the substance of regulation YB-1 phosphorylation in terms of the drug of preparation treatment inflammatory factor associated diseases
WO2019024518A1 (en) * 2017-08-03 2019-02-07 吉林众泰生物技术有限公司 Drug for treating monocyte chemoattractant protein-1 (mcp-1) involved disease by adjusting phosphorylation of yb-1
WO2019024875A1 (en) * 2017-08-03 2019-02-07 吉林众泰生物技术有限公司 Use of substance directly or indirectly regulating yb-1 phosphorylation in preparation of drug for treating disease caused by inflammatory factors

Similar Documents

Publication Publication Date Title
US10105420B2 (en) Methods, compositions and screens for therapeutics for the treatment of synovial sarcoma
JP6550333B2 (en) Peptide-induced protein knockdown
AU2009305550B2 (en) MUC-1 cytoplasmic domain peptides as inhibitors of cancer
US10188699B2 (en) CAPCNA peptide therapeutics for cancer
CN104837859A (en) Cell-penetrating peptides, conjugates comprising the peptides, and compositions comprising the conjugates
EP3066113A2 (en) Peptide inhibitors of tead/yap-taz interaction
RS62047B1 (en) Immunosuppressive agents and their use in therapy
CN104271590A (en) Peptide agents for cancer therapy
US20180312539A1 (en) Methods for preparing high throughput peptidomimetics, orally bioavailable drugs and compositions containing same
EP2970418A2 (en) Stabilized ezh2 peptides
EP2413968B1 (en) Semaphorin 3c (sema3c) inhibitor therapeutics, methods, and uses
US11442057B2 (en) Method for screening anticancer agent inhibiting binding of AIMP2-DX2 and HSP70
JP2013535954A (en) Peptides, structures and uses thereof
US12378301B2 (en) B1SP fusion protein therapeutics, methods, and uses
US9683025B2 (en) Methods and compositions for treating cancer and inflammatory diseases
US20150212086A1 (en) Diagnosis and Treatment of Brain Tumor
TW201534725A (en) A peptide having inhibition of HSP expression and the composition comprising the same
Hilan Novel Peptide Nanoparticles Designed for Tumour Cell Entry Via Glucose Regulated Protein 78 Dependent Targeting
US20140005119A1 (en) COMPOSITIONS AND METHODS FOR INHIBITING THE ACTIVITY OF P110a MUTANT PROTEINS
TW202502371A (en) Combination therapy with braf inhibitors for the treatment of cancer
EP3426679A1 (en) Inhibitors of the interaction bcl-2 l10 / ip3 receptors
EP2578227B1 (en) Cancer therapy method
CN113195704A (en) Peptide therapeutics for treating cancer and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07719458

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07719458

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 12301582

Country of ref document: US