WO2007106072A2 - Isolated complexes of endotoxin and modified md-2 - Google Patents
Isolated complexes of endotoxin and modified md-2 Download PDFInfo
- Publication number
- WO2007106072A2 WO2007106072A2 PCT/US2006/007188 US2006007188W WO2007106072A2 WO 2007106072 A2 WO2007106072 A2 WO 2007106072A2 US 2006007188 W US2006007188 W US 2006007188W WO 2007106072 A2 WO2007106072 A2 WO 2007106072A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- endotoxin
- complex
- tlr4
- los
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/285—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pasteurellaceae (F), e.g. Haemophilus influenza
Definitions
- the ability of an organism to withstand bacterial invasion depends upon sensitive and specific molecular systems.
- the molecules involved in these systems are designed to recognize specific bacterial products and trigger rapid responses to small numbers of invading bacteria.
- Innate recognition systems include highly conserved "pattern recognition" host molecules that detect and respond to highly conserved and structurally unique microbial molecules.
- pattern recognition host molecules that detect and respond to highly conserved and structurally unique microbial molecules.
- the best-studied example of such an innate system is the machinery engaged in recognition of endotoxins, which are unique surface glycolipids of Gram-negative bacteria.
- TLR4 Toll-like receptor 4
- Beutler et al., 2003; Means et al., 2000; and Ulevitch et al., 1999 An important feature of TLR4-dependent cell activation by endotoxin is its extraordinary sensitivity, permitting timely host responses to small numbers of invading Gram-negative bacteria, essential for efficient host defense (Beutler et al., 2003; Means et al., 2000; and Ulevitch et al, 1999).
- TLR4 contains a leucine-rich extracellular domain involved in ligand recognition, a transmembrane region, and an intracellular domain responsible for triggering signalling pathways that result in activation of genes of the innate immune defense system (Beutler et al., 2001; and Medzhitov et al., 1998). Maximal potency of TLR4-dependent cell activation by endotoxin requires four different extracellular and cell surface host proteins: lipopolysaccharide (LPS) binding protein (LBP), CD14, MD- 2 and TLR4 (Beutler et al., 2003; Miyake et al., 2003; and Ulevitch, 2000).
- LPS lipopolysaccharide
- LBP lipopolysaccharide
- CD14 CD14
- MD- 2 and TLR4 Beutler et al., 2003; Miyake et al., 2003; and Ulevitch, 2000.
- TLR4 requires MD-2 for CD14-dependent cellular response to low concentrations of endotoxin, but neither the precise nature of the ligand that binds to TLR4 nor the role of MD-2 has been folly defined.
- MD-2 either endogenously expressed or exogenously added, associates with TLR4 on the cell surface (Viriyakosol et al., 2001; Schramm et al., 2001; Visintin et al., 2001; Re et al., 2002; Akashi et al., 2003; Visintin et al., 2003; and Re et al., 2003) and its endogenous expression is needed for optimal surface expression of TLR4.
- TLR4 responsiveness to endotoxin is disrupted by point mutations of MD-2 (Schramm et al., 2001; Kawasaki et al., 2003; Ohnishi et al., 2001; and Mullen et al., 2003) (e. g., C95Y, Lysl28 and Lysl32) despite surface expression of TLR4/MD-2 complexes.
- complexes containing endotoxin species with potent pro-inflammatory activity induce TLR4-dependent cell activation at picomolar concentrations.
- Complexes containing under-acylated forms of endotoxin have little or no agonist activity and antagonize pro-inflammatory activity of TLR4 agonists.
- these complexes are water soluble and, in contrast to MD-2 alone, they are uniformly monomeric.
- Complexes with potent TLR4 agonist activity may be used to prime innate and adaptive host immune responses, whereas complexes that function as potent TLR4 antagonists may be used to dampen uncontrolled endotoxin- driven inflammation.
- the present inventors have produced and isolated complexes of endotoxin and MD-2.
- the present inventors have discovered that endotoxin:MD-2 complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin (for example, under-acylated forms of endotoxin) inhibit TLR4-dependent cell stimulation.
- the present inventors have also discovered that MD-2 can have inhibitory as well as stimulatory effects on TLR4- dependent cell activation by endotoxin.
- the present invention provides a purified complex including endotoxin bound to MD-2.
- these complexes when devoid of any other host or microbial molecules, are potent and water soluble and do not require additional lipid carrier molecules (e.g., serum albumin) for water solubility.
- the present invention also provides a method for making the complexes of the invention and a method of isolating complexes of the invention.
- the present invention provides a purified complex containing endotoxin bound to a modified MD-2.
- the modified MD-2 varies from wild-type MD-2 at amino acid 68, 69, 126, 127, 128, 129, 130, and/or 131.
- the reference numbering scheme is that used in Kawasaki et al., J hnmun 170:413-20 (2003).
- the variation may be an amino acid substitution, such as a conserved substitution.
- the wild-type amino acid may be substituted with an alanine.
- the present invention also provides methods of using the complexes of the invention, e.g., methods to increase or inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo.
- Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation.
- Methods using complexes with wild-type endotoxin are useful, e.g., to promote innate immune responses and as immunological adjuvants.
- Figure 1 depicts the expression and bioactivity of recombinant MD-2-His 6 .
- SDS/PAGE immunoblots were performed of control culture medium or medium from HiFive cells infected with recombinant baculovirus encoding wild-type (wt) or C95Y MD-2. MD-2 was detected using anti- (His) 4 antibody.
- HEK/TLR4 cells were incubated in HEPES-buffered HBSS + /0.1% albumin with 14 C-LOS agg (3 ng/ml) with or without LBP (30 ng/ml) and/or 60 ⁇ l of culture medium containing wt MD-2 ("MD-2") (open bars); LOS agg plus LBP and sCD14 (250 ng/ml) with or without wt (closed bars) or C95Y "MD-2” (striped bars), or 14 C-LOS :sCD14 (2 ng LOS/ml) with or without wt or C95Y "MD-2” (filled bars). After overnight incubation, extracellular IL-8 was assayed by ELISA.
- HEK/TLR4 cells were incubated with increasing amounts of wt ( ⁇ ) or C95Y (o)"MD-2" plus 14 C-LOS :sCD14 (2 ng/ml) and the cell activation was measured. Results shown are from one experiment (duplicate samples) representative of four independent experiments.
- Figure 2 shows that a bioactive complex (M r -25,000) containing MD-2 and 14 C-LOS is formed by incubation of 14 C- LOS:sCD14 with wt, but not C95Y, MD-2.
- dialyzed control insect cell medium (o) or medium containing wt ( ⁇ ) or C95Y (*) MD- 2 was incubated for 30 minutes, 37°C with 14 C-LOS :sCD14 (1:1 vol/vol) in HBSS+/10 niM HEPES and chromatographed on Sephacryl SlOO. Column fractions were analyzed for 14 C-LOS. Identical results were obtained in analytical (5 ng 14 C-LOS per ml + 200 ⁇ l culture medium) or more preparative runs (reagents concentrated 2Ox).
- Peak fractions of the purified complex (Figure 2B; 10 ng 14 C-LOS) were dialyzed against PBS and incubated with HisBind resin (0.125 ml) for one hour at 25 0 C and processed as described in the Methods for Example 1.
- Non-adsorbed and adsorbed material eluted with 200 mM imidazole was precipitated with trichloroacetic acid to concentrate sample for SDS-P AGE/immunoblot analysis.
- absorbed material was eluted with 2% SDS and counted by liquid scintillation spectroscopy.
- adsorption of 14 C-LOS :sCD14 was tested as a negative control. Overall recovery of 14 C-LOS was greater than 90%. Results shown are the mean or representative of two closely similar experiments.
- Figure 3 depicts delivery of 3 H-LOS :MD-2 but not 3 H-LOS agg or 3 H-LOS :sCD14 to HEK/TLR4.
- HEK ( ⁇ ) or HEK/TLR4 ( ⁇ ) cells were incubated with 3 H-LOS (0.75 ng/ml) in the form of LOS agg , LOS:sCD14, or LOS:MD-2. After overnight incubation at 37°C, cells were washed and lysed as described in the Methods for Example 1. The amount Of 3 H-LOS associated with the cells was measured by liquid scintillation spectroscopy. Results are from one experiment in duplicate, representative of three similar experiments.
- Figure 4 depicts the effects of added MD-2 on activation of HEK/TLR4 by 3 H- LOS:MD-2 and delivery of 3 H-LOS :MD-2 to HEK/TLR4.
- FIG 4A cells were incubated in HBSS+, 10 mM HEPES/0.1% albumin with 14 C-LOS:MD-2 (0.3 ng/ml) and increasing amounts of wt ( ⁇ ), C95Y (*) MD-2 or negative control medium ( ⁇ ) as well as with wt MD-2 but no 14 C-LOS :MD-2 (o). After overnight incubation, extracellular accumulation of IL-8 was measured.
- the concentrated and dialyzed conditioned media contained about 10 ng (wt or C95Y) MD-2 ⁇ l.
- Results are from one experiment in duplicate, which are representative of three similar experiments.
- purified 14 C-LOS :MD-2 (1 ng/ml) was pre-incubated with (•) or without (o) an amount of MD-2 that completely inhibited activation (40 ⁇ l of 20-fold concentrated and dialyzed conditioned media) for 30 minutes, 37°C in HBSS+/10 rnM HEPES before chromatography on Sephacryl S200. Column fractions were analyzed for l C-LOS by liquid scintillation spectroscopy.
- 3 H-LOS :MD-2 (0.75 ng/ml; about 3000 cpm) with or without excess MD-2 as indicated in Figure 4B was incubated with HEK/TLR4 cells overnight at 37°C as described in the Methods for Example 1. After supernatants were removed, cells were washed and then lysed as described in the Methods for Example 1. The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. No radioactivity was associated with parental cells.
- FIG. 5 depicts a possible mechanism of action of MD-2 in endotoxin-dependent activation of TLR4.
- TLR4 activation may involve either conformational changes in MD- 2 that follow the interaction of MD-2 with endotoxin and TLR4 (A) or transfer of endotoxin from MD-2 to TLR4 (B).
- Figure 6 depicts endotoxin responsiveness of well-differentiated primary cultures of human airway epithelia.
- FIG. 6B shows the polarity of epithelial responses to IL-l ⁇ and NTHi LOS. Reagents were applied to the apical, basolateral or both surfaces as indicted in the same concentrations as in Figure 6A. IL-l ⁇ induced HBD-2 expression from either surface, while NTHi LOS failed to induce responses from either side. Results represent replicate data from two different specimens, (four epithelialcondition) ; *P ⁇ 0.05.
- Figure 7 depicts results indicating the generation of a functional adenoviral vector expressing human MD-2.
- a replication incompetent adenoviral vector expressing MD-2 was used.
- HEK293 cells were transduced with a multiplicity of infection of 50 (MOI 50). Twenty-four hours later, the HEK293 cell culture supernatants were harvested and, in dilutions- as indicated, applied to HEK cells with or without TLR4 in the presence of LOS:sCD14 (2 ng LOS/ml). TLR4-dependent cell activation was manifested as extracellular accumulation of IL-8, monitored by ELISA.
- the x-axis indicates the concentration (dilution) of cell culture supernatant applied. Results demonstrate that the adenoviral vector directs production of MD-2 that is secreted and functional. TLR4- cells showed no significant response to LOS-sCD14 medium containing MD-2.
- Figure 8 depicts the effects of MD-2 on endotoxin responsiveness in human airway epithelia. Effect of transduction of well-differentiated, polarized human airway epithelia with Ad-MD-2 on cellular responsiveness to NTHi LOS as measured by HBD- 2 mRNA expression ( Figures 8A and 8C) and by NF- ⁇ B-luciferase activity ( Figure 8B). In the latter, cells were pretreated with an adenoviral vector expressing MD-2 48 hours before stimulation with LOS as described in the Materials of Example 2 below. Cells were treated with N.
- meningitidis LOS aggregates prepared as described in the Materials of Example 2 below
- LBP and sCD14 Figure 8 A and 8B
- L0S:sCD14 Figure 8C
- the fold increase in HBD-2 mRNA expression was quantified by real time PCR, and is indicated on the y-axis.
- Figure 8D shows the effect of soluble, recombinant MD-2 (rMD-2) on cellular responsiveness to LOS:sCD14.
- Well-differentiated human airway epithelia were treated with N. meningitidis LOS:sCD14 (5 ng LOS/ml), with or without the addition of cell culture supernatants containing rMD-2 as indicated on the x-axis. Twenty-four hours after endotoxin treatment, HBD-2 expression was quantified by real time PCR. Results shown represent findings from four different human airway specimens. *P ⁇ 0.05.
- Figure 9 shows the responsiveness of airway epithelia to purified LOS:MD-2 complex.
- Hatched bar represents results from cells pretreated with Ad-MD-2 twenty-four hours before application of LOS:MD-2 complex.
- Each bar represents means ⁇ SE for results from four different human epithelial specimens; *P ⁇ 0.05 compared with LOS:CD14 condition.
- Figure 1OA shows that MD-2 mRNA expression in human airway epithelia is induced by several stimuli.
- Agents used included heat-killed NTHi (strain 12), the NTHi outer membrane protein P6, TNF- ⁇ IFN- ⁇ , and phorbol myristate acetate (PMA). Concentrations used are indicated in the Materials for Example 2 below.
- MD-2 mRNA level form Mac is shown. The fold increase in MD-2 mRNA expression, relative to the level of MD-2 mRNA in control resting airway epithelia, was quantified using real time PCR. Shown are the results from three independent experiments on three different epithelial preparations. *P ⁇ 0.05.
- Figure 1OB shows the effect of pretreatment of airway epithelia with heat-killed NTHi on LOS responsiveness.
- Epithelia were exposed to NTHi for 24 hours as described in Figure 1OA above, and were then treated with apically applied LO S: CD 14 complex (hatched bar).
- Control cells were treated with LOS:CD14 alone (open bar) or NTHi alone (filled bar). Twenty-four hours later, HBD-2 expression was assayed using real-time PCR. Results shown are mean ⁇ SE for epithelia from five different specimens.
- Figures 1 IA-I ID shows proposed mechanisms by which expression of MD-2 in the airway can regulate the responsiveness of the airway epithelial cells to endotoxin.
- Endogenous and exogenous expression of MD-2 refers to airway epithelial cells.
- E( a gg ⁇ mem b > purified endotoxin (LPS or LOS) aggregates or gram-negative bacterial outer membrane to which LBP first binds.
- LPS or LOS purified endotoxin
- Figure 12 depicts sephacryl S200 chromatography of C-msbB LOS aggregates (1 ⁇ g) pre-incubated with 100 ng LBP and 24 ⁇ g sCD14 for 15 minutes at 37°C.
- the arrow indicates elution of wt LOS-sCD14 complex.
- Figure 13 depicts sephacryl S200 chromatography oi u C-msbB LOS-sCD14 (160 ng) pre-incubated with ⁇ 5 ⁇ g MD-2 for 15 minutes at 37°C.
- the arrow indicates elution of wt LOS-MD-2 complex.
- Figure 14 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA.
- HEK/TLR4 cells were incubated overnight at 37°C with increasing amounts of wt or mutant (msbB) LOS-MD-2, as indicated.
- Figure 15 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA.
- HEK/TLR4 cells were incubated overnight at 37°C with 0.1 ng/ml of wt LOS-MD-2 increasing amounts of mutant msbB LOS-MD-2, as indicated.
- Mutant MD-2 (K125A.F126A) forms LOS:MD-2 complex ( Figure 16A) that acts as weak agonist ( Figure 16B) and inhibits activation of HEK/TLR4 cells by wt LOS:MD-2 ( Figure 16C).
- FIG. 16A Sephacryl S200 chromatography of LOS:sCD14 after incubation with culture medium from cells transfected with expression vector alone (*) or expression vectors directing expression and secretion of wt (closed circles) or mutant (open circles) MD-2.
- Figure 16B Dose-dependent activation of HEK/TLR4 cells by purified wt (closed circles) and mutant (open circles) LOS:MD-2.
- Figure 16C Dose-dependent inhibition by mutant LOS:MD-2 of cell activation induced by wt LOS:MD-2 (0.1 ng LOS/ml).
- Figure 16B, Figure 16C Cell activation was monitored by extracellular accumulation of IL-8 and measured by ELISA. Results shown are representative of four closely similar and independent experiments.
- FIG. 17A shows dose-dependent activation of HEK/TLR4 cells by wt and mutant LOS:MD-2 complexes. Purified LOS:MD-2 complexes were incubated with HEK293/TLR4 cells in HBSS+, HEPES 5 0.1% human serum albumin for 16 h. Extracellular IL-8 recovered in harvested culture medium was measured by ELISA.
- Figure 17B shows inhibition of wt LOS:MD-2 activity by LOS:MD-2 (F126A).
- HEK293/TLR4 cells were incubated for 16 h with increasing amounts of LOS:MD-2 (F126A) ⁇ 20 pM wt LOS:MD-2 before assay of extracellular IL-8 by ELISA. Results shown are representative of 3 closely similar experiments.
- Figure 18 Molecular model of MD-2 molecule (taken from Gangloff & Gay, NJ, TRENDS Biochem Sci, 29:294 (2004), and effects of site-specific mutations of murine or human MD-2, taken in part from Kawasaki, K et ah, J Immunol 170:413 (2003).
- FIG. 19 Potent pro-inflammatory activity of nasally administered wt LOS:MD-2 in mice.
- Four hours after administration animals were sacrificed and sampled by broncho-alveolar lavage to monitor accumulation of total WBC and neutrophils (and cytokines; to be assayed). Results shown represent mean + SEM of values obtained.
- MD-2 interacts directly with endotoxin-CD14 complexes to generate endotoxin-MD-2 complexes that produce TLR4- dependent cell stimulation.
- This stimulation can be produced at concentrations consistent with the ability of the innate immune system to detect and respond to minute amounts of endotoxin.
- endotoxin bound to MD-2 rather than endotoxin itself, is a ligand for triggering TLR4 receptor activation.
- the present invention provides a purified complex including endotoxin bound to MD-2.
- the endotoxin may be a wild-type endotoxin.
- the endotoxin may be a wild-type endotoxin derived from any of a broad array of Gram-negative bacterial species. This includes many species of clinical importance such as Neisseria meningitidis, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Salmonella typhimurium, and Francisella tularensis.
- the complex may have a molecular weight of about 25,000.
- the complex may consist essentially of one molecule of endotoxin bound to one molecule of MD-2.
- the complex may be soluble in water.
- the complexes may be soluble in water to a greater extent than is an endotoxin molecule not bound to MD-2.
- the complex may bind to TLR4 and may produce TLR4-dependent activation of cells, e.g., at a concentration of about 1 nM or less of the complex the complex may produce a half maximal activation of cells, e.g., at a concentration of about 30 pM or less of the complex the complex may produce a half maximal activation of cells.
- the endotoxin may be hexa-acylated.
- the endotoxin may be an under-acylated endotoxin, e.g., a tetra-acylated or penta-acylated endotoxin. Examples of such under- acylated endotoxins are in PCT Publication No. WO 97/19688.
- the complex containing the under-acylated endotoxin may be capable of producing less TLR4-dependent activation of cells as compared to a complex including an endotoxin that is hexa- acylated.
- the complex containing the under-acylated endotoxin also may inhibit cell activation by more potent TLR4 agonists.
- the present invention also provides a composition including a complex of the invention, optionally including a pharmaceutically acceptable carrier.
- the composition can be used, e.g., to promote innate immune responses and as an immunological adjuvants.
- the present invention also provides methods to produce the complexes of the invention.
- This method includes contacting MD-2 with an endotoxin:CD14 complex to produce the endotoxin:MD-2 complex.
- the endotoxin can be modified by LPS-binding protein (LBP) prior to the formation of the endotoxin:MD-2 complex.
- LBP LPS-binding protein
- the present invention also provides a method for modulating TLR4-mediated cell activation by endotoxin, including administering to the cell MD-2.
- the MD-2 can be administered prior to exposure of the cell to endotoxin.
- the MD-2 can be administered while the cell is exposed to endotoxin.
- administration of a stoichiometric excess of MD-2 relative to TLR4 inhibits the endotoxin-mediated cell activation.
- the MD- 2 is administered to achieve a concentration of about 10-100 ng/ml.
- administration of MD-2 to cells e.g., cells having a constitutively low level of MD-2 expression, increases endotoxin-mediated cell activation. These cells may be, for example, airway epithelial cells or pulmonary macrophages.
- the present invention also provides methods for treating conditions associated with endotoxin-mediated cell activation.
- the conditions include sepsis, trauma, liver disease, inflammatory bowel disease, cystic fibrosis, asthma, complications in renal dialysis, autoimmune diseases, cancer chemotherapy sequelae, and intracellular gram- negative bacterial infections, e.g., infection caused by Francisella tularensis.
- the conditions can be treated by administration of a complex of the invention.
- Treatment includes both prophylactic treatments and therapeutic treatments.
- the association of endotoxin with MD-2 forms the complexes of the invention.
- the endotoxin molecules and the MD-2 molecules may be wild-type (wt) molecules, or they may be mutant molecules.
- the endotoxin molecules are wt endotoxin molecules, e.g., endotoxin derived from wt gram-negative bacteria. These wt endotoxin molecules may be hexa-acylated.
- the complexes formed with the wt endotoxin and MD-2 are capable of binding to TLR4 and are capable of producing TLR4-dependent cell activation.
- the endotoxin molecules are mutant endotoxin molecules.
- the mutant endotoxin molecules are endotoxin molecules that are capable of binding to MD-2 and these complexes to TLR4 without producing the same level of TLR4-dependent cell activation (i.e., the mutant endotoxin complexes produce less activation) as produced by TLR4 dependent cell activation by complexes containing wild-type endotoxin molecules.
- These mutant endotoxin molecules may be under-acylated (e.g., penta- acylated or tetra-acylated).
- under-acylated endotoxin molecules may be produced via enzymatic release of non-hydroxylated fatty acids from endotoxin, or they may be produced using bacteria having genes disrupted that encode an acyltransferase (e.g., MrB, msbB) needed for biosynthetic incorporation of non-hydroxylated fatty acids into endotoxin. Because the complexes are both potent and water soluble, they will be useful in the treatment of conditions associated with TLR4-dependent cell activation.
- an acyltransferase e.g., MrB, msbB
- the MD-2 molecule may also be a wild-type MD-2 or a mutant MD-2 molecule.
- the MD-2 may be a recombinant MD-2.
- TLR4-dependent cell activation refers to the cascade of events produced when TLR4 is activated, e.g., by endotoxin, to produce responses, e. g., pro-inflammatory responses.
- the art worker can measure TLR4-dependent cell activation, e.g., by assaying the level of IL-8 produced by the cells.
- the endotoxin and MD-2 proteins include variants or biologically active fragments of the proteins.
- a "variant" of the protein is a protein that is not completely identical to a native protein.
- a variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid.
- the amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or unproved qualities as compared to the native polypeptide.
- the substitution may be a conserved substitution.
- a "conserved substitution” is a substitution of an amino acid with another amino acid having a similar side chain.
- a conserved substitution would be a substitution with an ammo acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall polypeptide retains its spatial conformation but has altered biological activity.
- common conserved changes might be Asp to GIu, Asn or GIn; His to Lys or Arg or Phe; Asn to GIn, Asp or GIu and Ser to Cys, Thr or GIy.
- Alanine is commonly used to substitute for other amino acids in mutagenesis studies.
- the 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine having uncharged polar side chains; aspartate and glutamate having acidic side chains; and lysine, arginine, and histidine having basic side chains (Stryer (1981) ; Lehninger (1975)). It is known that variant polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity. For example, through substitution of alternative amino acids, small conformational changes may be conferred upon a polypeptide that results in increased bioactivity.
- the amino acid sequence of the variant endotoxin or MD-2 protein corresponds essentially to the native protein amino acid sequence.
- “corresponds essentially to” refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by native protein. Such a response may be at least 60% of the level generated by native protein, and may even be at least 80%, 85%, 90% or 95% of the level generated by native protein.
- variants of the native endotoxin will elicit a biological response (i.e., TLR4-dependent cell activation) substantially the same as the response generated by the native endotoxin.
- a variant of the invention may include amino acid residues not present in the corresponding native protein, or may include deletions relative to the corresponding native protein.
- a variant may also be a truncated fragment as compared to the corresponding native protein, i.e., only a portion of a full-length protein.
- Protein variants also include peptides having at least one D-amino acid.
- the endotoxin and/or MD-2 of the present invention may be expressed from isolated nucleic acid (DNA or RNA) sequences encoding the proteins.
- Amino acid changes from the native to the variant protein may be achieved by changing the codons of the corresponding nucleic acid sequence.
- Recombinant is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well- known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon, and still result in an identical amino acid sequence.
- the starting material (such as an MD-2 gene) used to make the complexes of the present invention may be substantially identical to wild-type genes, or may be variants of the wild-type gene. Further, the polypeptide encoded by the starting material may be substantially identical to that encoded by the wild-type gene, or may be a variant of the wild-type gene.
- the following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence, " (b) "comparison window,” (c)”sequence identity, " (d) "percentage of sequence identity, "and (e) “substantial identity.” (a) As used herein, "reference sequence” is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
- comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may include additions or deletions (i. e., gaps) compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences.
- the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30,40, 50,100, or longer.
- Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
- the CLUSTAL program is well described by Higgins et al. (1988); Higgins et al. (1989); Corpet et al. (1988); Huang et al. (1992); and Pearson et al. (1994).
- the ALIGN program is based on the algorithm of Myers and Miller, supra.
- the BLAST programs of Altschul et al. (1990); Altschul et al. (1997), are based on the algorithm of Karlin and Altschul
- HSPs high scoring sequence pairs
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
- M forward score for a pair of matching residues
- N penalty score for mismatching residues; always ⁇ 0.
- a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P (N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, less than about 0.01, or even less than about 0.001.
- Gapped BLAST in BLAST 2.0
- PSI- BLAST in BLAST 2.0
- the default parameters of the respective programs e.g., BLASTN for nucleotide sequences, BLASTX for proteins
- W wordlength
- E expectation
- W wordlength
- E expectation
- BLOSUM62 scoring matrix Alignment may also be performed manually by inspection.
- comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
- equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
- sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
- percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
- sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
- Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
- percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
- polynucleotide sequences means that a polynucleotide includes a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.
- nucleotide sequences are substantially identical if two molecules hybridize to each other under stringent conditions (see below).
- stringent conditions are selected to be about 5 0 C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- T m thermal melting point
- stringent conditions encompass temperatures in the range of about 1 0 C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
- One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
- substantially identical in the context of a peptide indicates that a peptide includes a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, or even 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
- Optimal alignment may be conducted using the homology alignment algorithm of Needleman and Wunsch (1970).
- a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
- sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e. g., total cellular) DNA or RNA.
- Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
- T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
- T m can be approximated from the equation of Meinkoth and Wahl (1984); T m 81.5°C + 16.6 (log M) +0.41 (% GC) -0.
- T n is reduced by about 1°C for each 1 % of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10 0 C.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 0 C lower than the thermal melting point (T m )
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C lower than the thermal melting point (T m )
- low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T m ).
- An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes.
- An example of stringent wash conditions is a 0.2X SSC wash at 65°C for 15 minutes (see Sambrook et al. (2001) for a description of SSC buffer).
- a high stringency wash is preceded by a low stringency wash to remove background probe signal.
- An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides is IX SSC at 45 0 C for 15 minutes.
- An example low stringency wash for a duplex of, e. g., more than 100 nucleotides is 4-6X SSC at 40 0 C for 15 minutes.
- stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8. 3, and the temperature is typically at least about 3O 0 C and at least about 60 0 C for long probes (e.g., >50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- destabilizing agents such as formamide.
- a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
- Very stringent conditions are selected to be equal to the Tm for a particular probe.
- An example of stringent conditions for hybridization of complementary nucleic acids that have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
- the complex can be generated with about physiologic (pM) concentrations of endotoxin and soluble MD-2.
- This complex activates cells in a TLR4-dependent fashion without the inclusion of other host or bacterial factors.
- pM physiologic
- the surprising and unexpected success in achieving formation of a bioactive endotoxin:MD-2 complex at such low concentrations of endotoxin and MD-2 reflects the importance of presenting endotoxin to MD-2 after endotoxin has been first modified by LBP and CD 14.
- the reaction pathway described herein in which endotoxin molecules in purified aggregates (or membranes) containing thousands to millions of endotoxin molecules/particle are extracted and transferred to first CD 14 and then MD-2 provides a unique physico-chemical mechanism to attain the potency that is needed for response.
- the ability to generate a homogeneous protein-endotoxin complex that, alone, triggers TLR4-dependent cell activation, interacts with host cells in an almost exclusively TLR4- dependent fashion and that can be metabolically labeled to sufficient specific radioactivity to monitor interactions at pM concentrations makes it possible for the first time to measure host cell-endotoxin interactions that are directly relevant to TLR4- dependent cell activation.
- endotoxin-responsive cells contain membrane-associated CD 14 and MD-2 (associated with TLR4) (Means et al., 2000; Miyake et al., 2003; Takeda et al., 2003).
- resting airway epithelial cells like HEK/TLR4 cells, express TLR4 without MD-2 and respond to endotoxin only if LBP, sCD14 and soluble MD-2 are added.
- Each of these proteins are likely to be present in biological fluids at the concentrations needed to drive endotoxin-dependent TLR4 activation, especially in view of the very low extracellular MD-2 concentrations demonstrated in this study to be sufficient.
- reaction pathway defined is relevant at the cell surface when TLR4/MD-2 complexes are endogenously present and also when only TLR4 is present at the cell surface and MD-2, which has been produced and secreted by neighboring cells, is present in the extracellular medium.
- FIG. 5 depicts mechanisms of action of MD-2 in endotoxin-dependent activation of TLR4.
- TLR4 activation may involve (A) conformational changes in MD-2 that follow the interaction of MD-2 with endotoxin and TLR4 and/or (B) transfer of endotoxin from MD-2 to TLR4.
- MD-2 may be able to discriminate between TLR4 agonists and antagonists. Agonists and antagonists may differ in their ability to form a complex with MD-2 or in the structural properties of the endotoxin: MD-2 complex that is formed. Perhaps, only endotoxins that are TLR4 agonists are transferred from CD 14 to MD-2 or, within the endotoxin:MD-2 complex, trigger changes in MD-2 conformation or protein-protein contacts between TLR4 and MD-2 needed for TLR4 activation.
- MD-2 may function in a manner analogous to that observed with Toll receptors in Drosophila where a modified protein, Spaetzle, is the ligand that initiates the cytoplasmic signaling pathway.
- the surfaces of the conducting airways and alveoli of the lung are a large interface between the host and the environment. Despite ongoing daily exposure to microbes and their components by inhalation, the intrapulmonary airways and airspaces normally maintain a sterile state without significant inflammation (Reynolds, 1997). This remarkable condition reflects the success of the concerted activities of the innate and adaptive immune systems.
- Inducible antimicrobial peptides including the cationic ⁇ -defensins, represent an important component of the innate immune system (Zasloff, 2002; Schutte et al., 2002; and Ganz, 2002).
- the expression of four ⁇ -defensins has been reported in pulmonary epithelia (McCray et al., 1997; Schroder et al., 1999; BaIs et al., 1998; Jia et al., 2001; Harder et al., 2001; and Garcia et al., 2001), and a recent genome-wide search uncovered evidence of a much larger family of ⁇ -defensin genes encoded in five chromosomal clusters (Schutte et al., 2002).
- TLR Toll-like receptor
- HBD-2 Human ⁇ -defensins-2
- HBD-2 is an inducible cationic antimicrobial peptide expressed at many muscosal surfaces, including the skin, cornea, gut, gingiva and airway epithelium (BaIs et al., 1998; Harder et al., 1997; Mathews et al., 1999; OTSfeil et al., 1999 ; Liu et al., 1998; and McNamara et al., 1999).
- HBD-2 mRNA is expressed at low levels in resting cells but is markedly induced by pro-inflammatory stimuli including IL-l ⁇ , TNF- ⁇ , and Pseudomonas aeruginosa (Singh et al., 1998; and Harder et al., 2000). Furthermore, the 5' flanking sequence of the HBD-2 gene contains several cis-acting elements that may mediate transcription in response to inflammatory stimuli, including NF- ⁇ B, IFN-gamma, AP-I, and NF-IL-6 response elements (Liu et al., 1998 ; Harder et al., 2000; and Tsutsumi-Ishii et al., 2003).
- Sensitive cellular response to many endotoxins requires the concerted action of at least four host extracellular and cellular proteins: LPS binding protein (LBP), CD 14, MD-2 and TLR-4.
- LBP LPS binding protein
- CD 14 CD 14
- MD-2 MD-2
- TLR-4 TLR-4
- inducible antimicrobial peptides such as human defensin- ⁇ (HBD-2) by epithelia is a component of the innate pulmonary defense.
- TLR4 In well-differentiated primary cultures of human airway epithelia, TLR4 but little or no MD-2 is expressed, and these cells are relatively unresponsive to added endotoxin, even in the presence of LBP and CD 14.
- hypo-responsiveness to endotoxin is a common characteristic of epithelial cells lining mucosal surfaces that are repeatedly exposed to Gram-negative bacteria or cell- free (sterile) forms of endotoxin.
- the molecular basis of endotoxin hypo-responsiveness is unknown.
- hypo-responsiveness likely represents the functional deficiency of one or more elements of pathway (s) leading to and resulting from TLR4 activation.
- TLR4 is a membrane protein containing repeats of a leucine rich motif in the extracellular portion of the protein and a cytoplasmic domain homologous to the intracellular domain of the human IL-I receptor (Medzhitov et al., 1997).
- the IL-I responsiveness of airway epithelia indicates that the overlapping intracellular signaling pathways for activated TLR and IL-I receptors (Hoffmann et al., 1999; Janeway et al., 2002; and Beutler et al., 2003) are present and functionally intact in human airway epithelia, including those important in NF- ⁇ B-regulated HBD-2 expression.
- TLR4 Even though airway epithelia express TLR4, the cells responded poorly to LOS:sCD14. Therefore it is likely that there is a defect in TLR4-dependent recognition and/or response to endotoxin.
- MD-2 also termed lymphocyte antigen 96 (LY96)
- LY96 lymphocyte antigen 96
- aeruginosa LPS was no greater ( ⁇ 3-fold) than what the present inventors found with added LOS in the absence of MD-2 complementation; i.e., very modest when contrasted to the induction of HBD-2 expression caused by IL-I (3 or by endotoxin in the presence of MD-2.
- mobilization of MD-2 in the airway could have at least two roles: (1) combining, when endogenously expressed, with endogenously expressed TLR4 to increase surface expression of TLR2 (MD-2), and (2) participating directly in endotoxin recognition by extracting endotoxin from monomeric endotoxin: CD 14 complexes either before or after interaction of MD-2 to the TLR4.
- TLR4 alone has no apparent ability to engage the endotoxin:(s) CD14 complex.
- results presented herein indicate that MD-2 plays a direct role in endotoxin recognition by TLR4. Endotoxin is transferred from an endotoxin: (s)CD 14 complex to MD-2 to form an endotoxin:MD-2 complex that appears to be the ligand for endotoxin- dependent TLR4 activation. TLR4 alone has no apparent ability to productively engage the endotoxin: (s)CD 14 complex. In addition, endogenous expression of MD-2 can increase surface expression of TLR4, as a TLR4/MD-2 complex, indicating a chaperone- like function for MD-2 as well.
- MD-2 expression is a key determinant of airway epithelial responses to endotoxin.
- low MD-2 expression in airway epithelia renders cells poorly responsive to endotoxin, whereas up-regulation of MD-2 alone can greatly enhance cellular responses to endotoxin.
- a variety of stimuli can induce MD-2 mRNA expression in airway epithelia, perhaps by more than one receptor-mediated pathway.
- MD-2 can be secreted by epithelia or mononuclear cells and the application of secreted MD-2 enhances TLR4 signaling in MD- 2 deficient cells.
- cytokines e.g., cytokines, bacterial products
- cytokine signals including TNF- ⁇ and interferon- (Abreu et al., 2001; and Visintin et al., 2001).
- Stimulated pulmonary macrophages might also secrete sufficient MD-2 to enhance TLR4 signaling in epithelia. In either case, production of MD-2 by epithelia or exogenous provision of MD-2 from neighboring cells would complement the airway cells for enhanced TLR.4 signaling in response to endotoxin.
- TLR4-dependent cell activation by endotoxin requires simultaneous interaction of MD-2 with endotoxin and TLR4 ( Figure 11)
- excessive production of MD-2 could blunt cellular responsiveness to endotoxin by promoting conversion of extracellular endotoxin: sCD 14 complex to endotoxin:MD-2 while presaturating TLR4 with MD-2, leaving no cellular targets (i.e., free TLR4) for the extracellular endotoxin:MD-2 complex.
- the regulation of MD-2 expression in the airways e.g., airway epithelia and/or pulmonary macrophages
- One advantage of such a hierarchy of responses is that it would help to minimize the frequency of epithelial-induced inflammatory signals from endotoxin.
- Ambient air contains bacteria and endotoxin (Mueller-Anneling et al., 2004) and the aerosolized concentrations of endotoxin can increase dramatically in some agricultural and industrial environments from ⁇ 10 EU/m 3 to >l,000 EU/m 3 (Douwes et al., 2003).
- the low expression of MD-2 in epithelia can serve to dampen endotoxin responsiveness to common environmental exposures and thereby avoid unwanted states of chronic inflammation in the face of frequent encounters with environmental endotoxin and other bacterial cell wall components.
- MD-2 expression can be important to enhance host defense responses to invading Gram-negative bacteria.
- enhanced expression of MD-2 could lead to exaggerated endotoxin responsiveness with pathologic consequences.
- Complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin inhibit TLR4- dependent cell stimulation.
- Methods of using the complexes e.g., methods to increase or inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo are provided.
- Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation.
- Methods using complexes with wild- type endotoxin are useful, e.g., to promote innate immune responses and to serve as an immunological adjuvant.
- Complexes of the invention, or MD-2 alone, including their salts can be administered to a patient.
- Administration in accordance with the present invention may be in a single dose, in multiple doses, and/or in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
- the administration may be essentially continuous over a preselected period of time or may be in a series of spaced doses.
- the amount administered will vary depending on various factors including, but not limited to, the condition to be treated and the weight, physical condition, health, and age of the patient. A clinician employing animal models or other test systems that are available in the art can determine such factors.
- the complexes are produced as described herein or otherwise obtained and purified as necessary or desired.
- One or more suitable unit dosage forms including the complex can be administered by a variety of routes including topical, oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
- routes including topical, oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
- the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods known to the pharmaceutical arts. Such methods include the step of mixing the complex with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
- pharmaceutically acceptable it is meant a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and not deleterious or unsuitably harmful to the recipient thereof.
- the therapeutic compounds may also be formulated for sustained release, for example, using microencapsulation (see WO 94/07529, and U. S. Patent No. 4,962, 091).
- the complex may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, and small volume infusion containers, or in multi- dose containers. Preservatives can be added to help maintain the shelve life of the dosage form.
- the complex and other ingredients may form suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the complex and other ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
- a suitable vehicle e.g., sterile, pyrogen-free water
- organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol,” polyglycols and polyethylene glycols, C 1 -C 4 alkyl esters of short-chain acids, ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "Miglyol,” isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.
- solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol,” polyglycols and polyethylene glycols, C 1 -C 4 alkyl esters of short-chain acids, ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "
- antioxidants such as antioxidants, surfactants, preservatives, film-forming, keratolytic or comedolytic agents, perfumes, flavorings and colorings.
- Antioxidants such as t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene and a-tocopherol and its derivatives can be added.
- the pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are available in the art.
- pharmaceutically acceptable carriers such as physiologically buffered saline solutions and water.
- physiologically acceptable buffered saline solutions such as phosphate buffered saline solutions at a pH of about 7.0-8. 0.
- the complex can also be administered via the respiratory tract.
- the present invention also provides aerosol pharmaceutical formulations and dosage forms for use in the methods of the invention, hi general, such dosage forms include an amount of complex effective to treat or prevent the clinical symptoms of a specific condition. Any attenuation, for example a statistically significant attenuation, of one or more symptoms of a condition that has been treated pursuant to the methods of the present invention is considered to be a treatment of such condition and is within the scope of the invention.
- the composition may take the form of a dry powder, for example, a powder mix of the complex and a suitable powder base such as lactose or starch.
- the powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator, insufflator, or a metered-dose inhaler (see, for example, the pressurized metered dose inhaler (MDI) and the dry powder inhaler disclosed in Newman (1984).
- Intranasal formulations may include vehicles that neither cause irritation to the nasal mucosa nor significantly disturb ciliary function.
- Diluents such as water, aqueous saline or other known substances can be employed with the subject invention.
- the nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and benzalkonium chloride.
- a surfactant may be present to enhance absorption of the subject proteins by the nasal mucosa.
- the complex may also be administered in an aqueous solution, for example, when administered in an aerosol or inhaled form.
- aerosol pharmaceutical formulations may include, for example, a physiologically acceptable buffered saline solution. Dry aerosol in the form of finely divided solid compound that is not dissolved or suspended in a liquid is also useful in the practice of the present invention.
- the complex can be conveniently delivered from a nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray.
- Pressurized packs may include a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Nebulizers include, but are not limited to, those described in U.S. Patent Nos.
- Aerosol delivery systems of the type disclosed herein are available from numerous commercial sources including Fisons Corporation (Bedford, Mass.), Schering Corp. (Kenilworth, NJ) and American Pharmoseal Co., (Valencia, CA).
- the therapeutic agent may also be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered-dose inhaler. Typical of atomizers are the Mistometer (Wintrop) and the Medihaler (Riker).
- the complex may also be delivered via an ultrasonic delivery system. In some embodiments of the invention, the complex may be delivered via an endotracheal tube. In some embodiments of the invention, the complex may be delivered via a face mask.
- the complex may also be used in combination with other therapeutic agents, for example, pain relievers, anti-inflammatory agents, antihistamines, and the like, whether for the conditions described or some other condition.
- other therapeutic agents for example, pain relievers, anti-inflammatory agents, antihistamines, and the like, whether for the conditions described or some other condition.
- the present invention further pertains to a packaged pharmaceutical composition such as a kit or other container.
- a packaged pharmaceutical composition such as a kit or other container.
- the kit or container holds a therapeutically effective amount of a pharmaceutical composition of the complex and instructions for using the pharmaceutical composition for treating a condition.
- TLR4-dependent delivery of endotoxin to human embryonic kidney (HEK) cells and cell activation at pM concentrations of endotoxin occurred with purified endotoxin:MD-2 complex, but not purified endotoxin aggregates LBP and/or sCD14.
- the presence of excess MD-2 inhibited delivery of endotoxin:MD-2 to HEK/TLR4 cells and cell activation.
- the inventors generated conditioned insect cell culture medium containing soluble, polyhistidine-tagged recombinant wild-type (wt) or C95Y mutant MD-2 according to the method of Viriyakosol et al. (2001).
- a human embryonic kidney cell line HEK293 that stably expresses TLR4 (HEK/TLR4), but lacks both CD 14 and MD-2 (Yang et al., 2000), was used to evaluate the effect of MD-2 on the ability of lipooligosaccharide (LOS) to interact with TLR4 and promote activation.
- HEK/TLR4 cells were not activated by 14 C-LOS aggregates with or without LBP and sCD14 or by the isolated 14 C-LOS:sCD14 complex ( Figure IA).
- This 14 C-LO S -containing complex is fully resolved from albumin and any residual 14 C-LOS:sCD14 or sCD14 released from LOS:sCD14 during formation of the complex judged by gel filtration chromatography and immunoassay for CD14 and LOS:sCD14.
- the isolated M r -25,000 complex activated HEK/TLR4 cells in a potent dose, and TLR4-dependent manner (Figure 2C); half- maximal activation occurred at approximately 150 pg of 14 C-LOS per ml (30 pM). Cell activation did not require addition of sCD14 or albumin.
- Table 1 also indicates that endotoxin must be presented in the form of a monomeric endotoxin-MD-2 complex to activate HEK/TLR4 cells. This could reflect a unique ability of MD-2 to deliver endotoxin to TLR4. To test this hypothesis, cell association of purified LOS agg , LOS-sCD14 or LOS-MD-2 complexes to parental and HEK/TLR4 cells were compared. Initial experiments with [ l C]-LOS did not reveal significant cell association of radiolabeled LOS under any condition. These negative results could simply reflect the limited amount of surface TLR4 available and needed to engage LOS-MD-2 for cell activation.
- LBP and sCD14 were provided by Xoma (US) LLC. (Berkeley, CA). Both parental HEK293 and cells stably transfected with TLR4 (HEK/TLR4) were provided by Dr. Jesse Chow, Eisai Research Institute, (Andover, MA). Chromatography matrices and electrophoresis supplies were purchased from Amersham Biosciences (Piscataway, NJ). Human serum albumin was obtained as an endotoxin-free, 25% stock solution (Baxter Healthcare Corp., Glendale, CA). [ 14 C]-LOS or [ 3 H]-LOS was isolated from an acetate auxotroph of Neisseria meningitidis Serogroup B after metabolic labeling and isolated as previously described (28).
- [ 14 C or 3 H]-LOS agg (apparent M r > 20 million) and [ 14 C or 3 H]-LOS-CD14 (M r ⁇ 60,000) were purified as previously described (Thomas et al. 2002).
- [ 3 H]-LPS from E. coli LCD25 was purchased from List Biologicals (Campbell, CA) as processed as described previously (Iovine et al, 2002).
- MD-2 cDNA was isolated, linearized, and inserted, using Ncol and Xhol- sensitive restriction sites, into the baculovirus transfection vector pBACl 1 (Novagen) that provides a six residue polyhistidine tag at the carboxyl terminal end of MD-2 and 5' flanking signal sequence (gp64) to promote secretion of the expressed protein.
- DNA encoding each desired product was sequenced in both directions to confirm fidelity of the product. Production and amplification of recombinant viruses were undertaken in collaboration with the Diabetes and Endocrinology Research Center at the Veterans' Administration Medical Center, Iowa City, IA.
- Sf9 cells were transfected with linear baculovirus DNA and the pBACl 1 vector using Bacfectin, according to a procedure described by Clontech.
- HiFive cells For production of recombinant protein, HiFive cells (Invitrogen) were incubated in serum-free medium and inoculated at an appropriate virus titer. Supernatants were collected and dialyzed either against HEPES-buffered (10 mM, pH 7.4) Hanks' balanced salts solution with divalent cations (HBSS + ), pH 7.4 or 50 mM phosphate, 150 mM NaCl, pH 7.4 (PBS). To absorb the expressed polyhistidine tagged protein, nickel charged agarose resin (HisBind, Novagen, Madison, WI) was incubated batchwise with culture medium pre-dialyzed against PBS containing 5 mM imidazole.
- an anti-polyhistidine antibody (Tetra-His antibody, Qiagen, Valencia, CA) was used. Samples were electrophoresed using an Amersham Biosciences PhastGel System (10-15% gradient acrylamide gel) and transferred to nitrocellulose by semi-dry transfer. The nitrocellulose was washed with Tris-buffered saline (TBS), pH 7.5, containing 0.05% Tween-20 and 0.2% TritonX-100 (TBSTT), blocked to reduce nonspecific background with 3% BSA in TBSTT for 1 hr at 25°C, and incubated with the anti-His 4 antibody in TBSTT overnight.
- TBS Tris-buffered saline
- TBSTT TritonX-100
- the blot was incubated with donkey anti-mouse IgG conjugated to horseradish peroxidase (BioRad) for 1 hr at 25°C in TBS containing 3% goat serum and washed with TBSTT exhaustively. Blots were developed using the Pierce SuperSignal substrate system.
- HEK cells +/- TLR4 have been extensively characterized and were cultured as has been described (Yang et ah, 2000).
- cells were grown to confluency in 48 well plates. Cell monolayers were washed with warm PBS 2x and incubated overnight at 37°C, 5% CO 2 , and 95% humidity in HBSS + , 0.1% HSA with the supplements indicated in the legends to Figures 1-3 and Table 1.
- Activation of HEK cells was assessed by measuring accumulation of extracellular IL-8 by ELISA as previously described (Denning et ah, 1998).
- Samples for chromatography contained from 2 ng to 200 ng [ 14 C]- LOS a gg , [ 14 C]-LOS-sCD14 or [ 14 C]-LOS-MD-2 in 1 ml of column buffer +/- 0.1% HSA. Aliquots of the collected fractions were analyzed by liquid scintillation spectroscopy using a Beckman LS liquid scintillation counter to detect [ 14 C]-LOS. Recoveries of [ 14 C]-LOS were > 70% +/- albumin. All solutions used were pyrogen- free and sterile-filtered.
- HEK or HEK/TLR4 cells were grown to confluency in 6 well plates, washed twice with warm PBS, and [ 3 H]-LOS aggregates or [ 3 H]-LOS-protein complexes +/- indicated supplements were incubated overnight at 37°C, 5% CO 2 , and 95% humidity in DMEM, 0.1% HSA with the supplements indicated in the legends to Figures 3 and 4. After the incubation, supernatants (extracellular media) were collected, cells were washed twice with cold PBS, and cells were lysed and solubilized using RNeasy lysis buffer (Qiagen). The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. Total recovery of radioactivity was >90%.
- results presented herein demonstrate that in well-differentiated primary cultures of human airway epithelia TLR4, but little or no MD-2, is expressed. These cells are relatively unresponsive to added endotoxin even in the presence of LBP and CD 14. However, the responsiveness of these cells to endotoxin is markedly amplified by either the endogenous expression or the exogenous addition of MD-2, indicating that the constitutively low levels of MD-2 expression in these cells at "rest” is important in maintaining their hypo-responsiveness to endotoxin. Changes in MD-2 expression in the airway epithelium and/or neighboring cells can.be achieved by exposure of these cells to specific bacterial and host products and can thereby regulate airway responsiveness to endotoxin.
- Nontypeable Haemophilus influenza is a common commensal, and sometimes a pathogen, of the respiratory tract (Lerman et ah, 1979; Smith et al, 1989; Bandi et al, 2001).
- LOS endotoxin
- TLR4 Toll-like receptors
- the deficiency of MD-2 in airway epithelia was circumvented by using an adenoviral vector containing the human MD-2 cDNA.
- the vector was first used to transduce parental HEK293 cells.
- Conditioned medium recovered from the transduced cells were then assayed for the presence of active MD-2 by measuring activation of HEK293 cells ⁇ TLR4 by added LOS-sCD14 (the bioactive product of LBP/sCD14 treatment of LOS; (Giardina et al, 2001; Gioannini et ah, 2002; and Gioannini et ah, 2003)).
- conditioned medium from Ad-MD-2 transduced cells produced a dose-dependent augmentation of IL-8 release by HEK/TLR4 cells but not the parental (TLR4 " ) cells, consistent with the functional expression of MD-2 by the vector.
- Extracellular complementation with recombinant MD-2 protein enhances endotoxin signaling in human airway epithelia
- HEK/TLR4 + cells have been used to show that endogenous (co-) expression of MD-2 or addition of secreted MD-2 to TLRA + MD-T cells confers increased endotoxin responsiveness.
- the primary cultures of human airway epithelia provide a more natural setting to test the effect of exogenous addition of recombinant MD-2 (rMD-2) on cellular responsiveness to endotoxin (i.e., LOS-sCD14).
- rMD-2 recombinant MD-2
- LOS-sCD14 endotoxin
- addition of conditioned insect cell culture medium containing rMD-2 increased the response of the human airway epithelial cultures to LOS-sCD14 by > 100-fold. Control conditioned medium, by contrast, had no effect.
- MD-2 expression is the principal limiting factor for responsiveness of human airway epithelia to endotoxin.
- the need for MD-2 could reflect its role either in TLR-4 trafficking, posttranslational modifications and surface expression, and/or in endotoxin recognition and delivery to TLR-4.
- the inventors examined the responsiveness of airway epithelia to purified LOS: MD-2 complex.
- Figure 9 show that the apical application of 2 ng/ml (400 pM) of LOS: MD-2 produced significant activation of resting epithelia, but not of cells induced by adenoviral transduction, to express MD-2 along with TLR-4.
- the levels of MD-2 mRNA attained under these conditions were similar to that induced by phorbol myristate acetate but still significantly less than MD-2 mRNA levels in human alveolar macrophages. These findings demonstrate that, in response to specific stimuli, levels of MD-2 transcript can be up-regulated in human airway epithelia.
- Figure 10 depicts results indicating that MD-2 mRNA expression in human airway epithelia is inducible in response to several stimuli. Fold increase in MD-2 mRNA expression was quantified using real time PCR. Figure 10 represents the results from three independent experiments on three different epithelial preparations. * indicates p ⁇ 0.05.
- Phorbol myristate acetate (PMA), human recombinant IL-I ⁇ , TNF- ⁇ and INF- ⁇ were obtained from Sigma (St Louis, MO). Soluble CD14 (sCD14) and LPS binding protein (LBP) were provided by Xoma (US) LLC (Berkeley, CA). Lipooligosaccharide (LOS) from non-typeable Haemophilus influenzae was isolated by a mini-phenol-water extraction procedure, as previously described (Inzana et al, 1997).
- LOS was also isolated from Neisseria meningitidis and used as purified aggregates (LOS agg) and as monomeric L0S-sCD14 complexes as previously described (Giardina et al, 2001; and Gioannini et al., 2002).
- P6 from non-typeable Haemophilus influenzae was a generous gift from Dr. Timothy F. Murphy, SUNY, Buffalo.
- NTHi strain 12 (Frick et al, 2000) was a kind gift of Dr. D wight Look.
- BALF Bronchoalveolar lavage fluid
- NF- ⁇ B-Luc plasmid (Clontech Laboratories Inc., Palo Alto,CA) was used as a template to generate a recombinant adenovirus vector (Ad-NF- ⁇ B-Luc).
- Ad-NF- ⁇ B-Luc a recombinant adenovirus vector
- the fragment was inserted into a promoterless adenoviral shuttle plasmid (pAd5mcspA) and Ad-NF- ⁇ B-Luc virus was generated by homologous recombination as previously described and stored in 10 mM Tris with 20% glycerol at -80 0 C (Anderson et al., 2000).
- the particle titer of adenoviral stock was determined by A260 reading.
- the functional titer of the adenoviral stock was determined by plaque titering on 293 cells and expression assays for the encoded protein.
- the primers consisted of forward- 5'- CTTGTCGACATTTGTAAAGCTTTGGAGATATTGAA-S' (SEQ IDNO:1) and reverse- 5'-ATTGAATTCTAATTTGAATTAGGTTGGTGTAGGA-S' (SEQ ID NO:2) (Shimazu et al., 1999).
- the reaction was performed at 95 °C for 5 min, followed by 35 cycles at 94 °C for lmin, 60 °C for 1 min and 72 °C for 1 min.
- the chain reaction was elongated at 72 °C for 10 min.
- the fidelity of the PCR product was confirmed by DNA sequencing.
- the MD-2 cDNA was digested by Sail at the 5' end and EcoRI at the 3' end and then inserted into an adenoviral shuttle plasmid (pAd5cmcpA), containing the CMV promoter and Ad-MD2 virus was generated by homologous recombination.
- the titering and storage of the Ad-MD2 virus were identical to those described above for Ad-NF - ⁇ B-Luc.
- An adenoviral vector expressing the human TLR-4 cDNA was also used in these studies. The methods for the construction of this vector were published previously (Arbour et al, 2000).
- RT-PCR RT-PCR was used to detect expression of TLR4, CD14 and MD-2 mRNA in human airway epithelia and alveolar macrophages. 1 ⁇ g of total RNA from each sample was reverse transcribed using random hexamer primers with Superscript (GibcoBRL). First strand cDNA was amplified by PCR.
- the primer set for TLR4 consisted of forward- 5'-TGAGCAGTCGTGCTGGTATC-S' (SEQ ID NO:3); reverse- 5'- CAGGGCTTTTCTGAGTCGTC-3' (SEQ ID NO:4) and amplified a product of 166 bp.
- the primer set for CD14 consisted of forward- 5'-CTGCAACTTCTCCGAACCTC-S' (SEQ ID NO:5) and reverse- 5'-CCAGTAGCTGAGCAGGAACC-S' (SEQ ID NO:6) and produced a cDNA fragment of 215 bp.
- the primer set for MD-2 included forwards' -TGTAA AGCTTTGGAGAT ATTGAA- 3' (SEQ ID NO:7) and reverse- 5'- TTTGAATTAGGTTGGTGTAGGA-3' (SEQ ID NO:8) and amplified a product of 508 bp.
- GAPDH was amplified in each reaction using the following primers- forward- 5'-GTCAGTGGTGGACCTGACC-S' (SEQ ID NO:9); reverse- 5'-AGGGGTCTACATGGCAACTG-S' (SEQ ID NO:10).
- Each reaction contained approximately 1.25 pM of the primers, 3 mM Mg ⁇ + .
- PCR products were electrophoresed on a 2% agarose gel and visualized using ethidium bromide.
- Real-time quantitative PCR for detecting HBD-2 and MD-2 Real-time PCR was employed to detect human ⁇ -defensin-2 and MD-2 and to quantify changes in expression.
- Real-time quantitative PCR was performed using a sequence detector (ABI PRISM 7700, Applied Biosystems, Foster City, CA) and Taqman technology (Roche Molecular Diagnostic Systems) following the manufacturer's protocols (Bustin, 2000). The primers and probes were designed using the Primer Express program (Applied Biosystems).
- the primers were- forward 5'-CAACAATATCATTCTCCTTCAAGGG -3' (SEQ ID NO:11), reverse 5'- GCATTTCTTCTGGGCTCCC-3' (SEQ ID NO:12), and probe 5'- AAAATTTTCTAAGGGAAAATACAAATGTGTTGTTGAAGC-S' (SEQ ID NO: 13).
- the forward primer was- 5'-CCTGTTACCTGCCTTAAGAGTGGA-S' (SEQ ID NO:14), the reverse primer- 5'- ACC AC AGGTGCC AATTTGTTTA-3' (SEQ ID NO: 15), and the probe was- 5'-
- CCATATGTCATCCAGTCTTTTGCCCTAGAAGG -3' (SEQ ID NO: 16). Both probes contain a fluorescent reporter (6-Carboxyfluorescein [FAM]) at the 5' end and a fluorescent quencher (6-Carboxytetramethylrhodamine [TAMRA]) at the 3' end.
- FAM fluorescent reporter
- TAMRA fluorescent quencher
- human GAPDH real-time quantitative PCR was conducted in every reaction.
- the primers and probes were purchased from Roche Molecular Diagnostic Systems. The PCR fragments were amplified for 40 cycles (15 sec at 95 0 C and 1 min at 60 0 C).
- LOS ⁇ specific endotoxin-binding proteins as indicated in the individual figure legends were applied in 50 ⁇ l to the apical or basolateral side of the cells as noted.
- Control groups received PBS (negative control) or IL- l ⁇ (100 ng/ml, applied apically and basolaterally as positive control).
- the cells were disrupted in the IX lysis buffer provided with the luciferase assay kit (Promega) to measure luciferase activity.
- some samples were prepared to isolate total RNA.
- HEK cells +/- TLR4 were obtained from Dr. Jesse Chow (Eisai Research Institute, Andover, MA) and were cultured as described (Yang et ah, 2000; and Gioannini et al, 2003).
- cells were grown to confluency in 48 well plates. Epithelia were washed with warm PBS 2X and incubated overnight at 37°C, 5% CO 2 , and 95% humidity in Hanks' balanced salts solution, 0.1% human serum albumin with the supplements indicated in the legends to Figure 8.
- Activation of HEK cells was assessed by measuring accumulation of extracellular IL-8 by ELISA as previously described (Denning et al, 1998).
- Recombinant MD-2 protein (rMD-2) was produced in baculovirus for application to airway epithelia.
- the human MD-2 cDNA was first sub-cloned into pGEM-T easy vector for transformation of E. coli JMl 09 and amplification.
- the DNA was then isolated, linearized, and inserted into pBACl 1 (using Ncol and Xhol-sensitive restriction sites) for transfection into insect cells.
- a vector encoding a six-histidine (“poly-HIS”) extension of the C-terminus was used.
- the DNA encoding MD-2 was sequenced in both directions to confirm the fidelity of the product. Sf9 cells were used for production and multiplication of virus containing pBACl 1 plasmids.
- High Five (Invitrogen) cells were inoculated with recombinant virus in serum-free medium, incubated 24-48 hr and culture medium then collected for analysis.
- the presence of recombinant MD-2-(HIS)6 was determined by SDS-PAGE and immuno-blots of the culture medium, using an anti-His4 mAb (Qiagen).
- the culture medium was dialyzed against sterile Hanks' balanced salts solution buffered with 10 mM HEPES, pH 7.4 and supplemented with 0.1% human serum albumin before use in bioassays.
- Endotoxin species with potent pro-inflammatory activity are typically hexa- acylated. That is, the lipid A region contains 6 covalently linked fatty acids, including 4 mol/mol of 3 -OH fatty acids linked directly to the di-N-acetylglucosamine backbone of lipid A and 2 mol/mol non-hydroxylated fatty acids (NFA) that are linked to two of the four 3-OH fatty acids via an ester bond with the 3-OH group.
- NFA non-hydroxylated fatty acids
- Under-acylated endotoxin reacts normally with LBP, CD 14 and MD-2 to produce an endotoxin-MD-2 complex that engages TLR4 without producing the changes in TLR4 needed for receptor and cell activation.
- the presence of an excess of under-acylated endotoxin-MD-2 complex e.g., tetra- or penta-acylated endotoxin
- NMB Neisseria meningitidis serogroup B
- the activities of the endotoxin:MD-2 complexes differ markedly between the complex containing wt (hexa-acylated) LOS and that containing the mutant msbB (penta-acylated) LOS, with the complex containing the mutant LOS causing less cell activation.
- addition of increasing amounts of the mutant msbB LOS:MD-2 complex significantly reduced cell activation by the wt LOS:MD-2 complex.
- Limited cell activation seen at higher doses of the msbB LOS:MD-2 complex closely resembles levels of cell activation produced by addition of these amounts of the msbB L0S:MD-2 complex alone (compare Figs. 14 and 15) indicating that the mutant endotoxin: MD-2 complexes can efficiently compete with the wt endotoxin: MD-2 complex for interaction with cellular TLR4, and thus blunt endotoxin-induced cell activation.
- the present inventors identified and characterized an MD-2 mutant that forms a monomeric complex with endotoxin (E) that acts as a TLR4 antagonist.
- E endotoxin
- Potent TLR4- dependent cell activation by E depends on transfer of E from LBP to CD 14 to MD-2.
- MD-2 has the, dual function of binding to the extracellular domain of TLR4 and to E.
- site-directed mutagenesis structural requirements of MD-2 for TLR4 binding and cellular E responsiveness have been determined but not, directly, those for E binding.
- the mutant complex inhibited cell activation by wt E:MD-2, consistent with binding of E:MD-2 K125A F126A to TLR4 without efficient receptor activation.
- MD-2 K125A F126A alone had much less inhibitory effect, reflecting greater stability of E:MD-2 than free MD-2.
- Our findings show that a structural requirement of MD-2, distinct from E and TLR4 binding, is needed for activation of TLR4 by E:MD-2.
- This MD-2 mutant provides a useful tool for unraveling the mechanism of TLR4 activation by E and dampening TLR4 activation by E.
- the inventors have also constructed the single site-specific mutants F 126 A and K125A mutants to determine whether K125 and/or F126 are functionally important. Each of these mutants reacted normally with E:sCD14 to form a monomeric E:MD-2 complex (data not shown).
- E:MD-2 (K125A) was at least as active as E:MD-2 (wt) in activation of HEK/TLR4 cells, as judged by induced synthesis and secretion of IL-8 (data not shown).
- E:MD-2 (F 126A) produced virtually no activation of HEK/TLR4 (Fig. 17A).
- MD-2 complex The inventors used two different procedures for preparative production and purification of endotoxin:MD-2 complex.
- the first procedure used recombinant MD-2 expressed in insect cells, where culture conditions are somewhat more favorable for retention of secreted MD-2 in functional form before exposure to monomeric endotoxin: sCD 14 complex.
- the second procedure used, more analytical procedures, MD-2 expressed from mammalian cells. In the mammalian cells, formation and recovery of monomeric endotoxhr.MD-2 complex is greatly enhanced by addition of endotoxin: sCD 14 complex to culture medium to react with MD-2 as it is being secreted.
- the harvested insect cell culture medium containing secreted soluble MD-2-His 6 was incubated with preformed monomeric E:sCD14 for 30 min at 37 0 C.
- Albumin >0.3% (wt/vol) was added to maintain the solubility of E as it is being transferred from CD 14 to MD-2.
- This incubation can be carried out in small ( ⁇ 1 ml) to very large volumes (at least 1 Liter), producing in the latter case up to 1 mg monomeric E:MD-2 complex.
- the complex is purified from the culture medium by gel sieving chromatography and, if necessary, metal chelation (e.g., HisLink) chromatography after concentration of the culture medium containing the monomeric E:MD-2 complex by ultrafiltration.
- cultured mammalian cells e.g., HEK293T cells
- an expression plasmid e.g., pEFBOS
- 3 H-LOS:sCD14 5-10 ng LOS/ml
- albumin 0.03% albumin
- E/MD-2 complex take advantage of the much more favorable physico-chemical properties of the complex as compared to that of either endotoxin or MD-2 alone.
- the expression and secretion of MD-2 in insect cells is advantageous because culturing is done at lower temperature (e.g., 27°C) than that used for mammalian cell cultures (37°C). Consequently, the secreted MD-2 suffers less temperature-dependent loss of activity.
- This problem has been bypassed by spiking monomeric endotoxin: sCD 14 into the culture medium at the time of peak MD-2 secretion, taking advantage of the very fast transfer of E from sCD14 to MD-2 and the much greater stability of E:MD-2 in comparison to MD-2 alone.
- the inventors have recovered the E:MD-2 complex from the culture medium after 24 to 48 h at 37°C and it still has full bioactivity.
- Agonist versus antagonist properties of endotoxin variants e.g., differing in degree of acylation
- the present inventors have also performed in vivo testing showing potent proinflammatory activity of nasally instilled E:MD-2.
- the inventors performed experiments in mice to assess the ability of nasally administered purified wt E:MD-2 complex as compared to the same E added as purified endotoxin aggregates to induce airway inflammation.
- the monomeric E:MD-2 complex was at least ten times more potent than the E aggregates (without MD-2), as judged by induction of airway accumulation of neutrophils. This supports the observation that E:MD-2 complex has special properties not associated with E or MD-2 alone.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Communicable Diseases (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Applicants have produced and isolated water soluble complexes of endotoxin and modified MD-2.
Description
ISOLATED COMPLEXES OF ENDOTOXIN AND MODIFIED MD-2
Statement Regarding Federally Sponsored Research
Work related to this application was supported by grants from the National Institutes of Health (AI059372 and AI044642). The government may have certain rights in the invention.
Background of the Invention
The ability of an organism to withstand bacterial invasion depends upon sensitive and specific molecular systems. The molecules involved in these systems are designed to recognize specific bacterial products and trigger rapid responses to small numbers of invading bacteria.
Innate recognition systems include highly conserved "pattern recognition" host molecules that detect and respond to highly conserved and structurally unique microbial molecules. The best-studied example of such an innate system is the machinery engaged in recognition of endotoxins, which are unique surface glycolipids of Gram-negative bacteria.
Potent pro-inflammatory cellular responses to endotoxin are mediated through activation of a member of the Toll-like receptor family of proteins, Toll-like receptor 4 (TLR4; Beutler et al., 2003; Means et al., 2000; and Ulevitch et al., 1999). An important feature of TLR4-dependent cell activation by endotoxin is its extraordinary sensitivity, permitting timely host responses to small numbers of invading Gram-negative bacteria, essential for efficient host defense (Beutler et al., 2003; Means et al., 2000; and Ulevitch et al, 1999).
TLR4 contains a leucine-rich extracellular domain involved in ligand recognition, a transmembrane region, and an intracellular domain responsible for triggering signalling pathways that result in activation of genes of the innate immune defense system (Beutler et al., 2001; and Medzhitov et al., 1998). Maximal potency of TLR4-dependent cell activation by endotoxin requires four different extracellular and cell surface host proteins: lipopolysaccharide (LPS) binding protein (LBP), CD14, MD- 2 and TLR4 (Beutler et al., 2003; Miyake et al., 2003; and Ulevitch, 2000).
TLR4 requires MD-2 for CD14-dependent cellular response to low concentrations of endotoxin, but neither the precise nature of the ligand that binds to
TLR4 nor the role of MD-2 has been folly defined. MD-2, either endogenously expressed or exogenously added, associates with TLR4 on the cell surface (Viriyakosol et al., 2001; Schramm et al., 2001; Visintin et al., 2001; Re et al., 2002; Akashi et al., 2003; Visintin et al., 2003; and Re et al., 2003) and its endogenous expression is needed for optimal surface expression of TLR4. TLR4 responsiveness to endotoxin is disrupted by point mutations of MD-2 (Schramm et al., 2001; Kawasaki et al., 2003; Ohnishi et al., 2001; and Mullen et al., 2003) (e. g., C95Y, Lysl28 and Lysl32) despite surface expression of TLR4/MD-2 complexes.
Summary of the Invention
The activation of inflammatory reactions mobilizes protective host defenses. However, excessive responses, or dysfunctional regulation of these responses, can lead to severe, even life-threatening pathology. Thus, optimal physiological functioning of inflammatory responses requires careful positive and negative regulation. Accordingly, agents and methods that affect such regulation, for example by affecting TLR4- mediated cell activation, would have great clinical benefit and are needed.
The present inventors have discovered that complexes containing endotoxin species with potent pro-inflammatory activity induce TLR4-dependent cell activation at picomolar concentrations. Complexes containing under-acylated forms of endotoxin have little or no agonist activity and antagonize pro-inflammatory activity of TLR4 agonists. In contrast to endotoxin alone, these complexes are water soluble and, in contrast to MD-2 alone, they are uniformly monomeric. Complexes with potent TLR4 agonist activity may be used to prime innate and adaptive host immune responses, whereas complexes that function as potent TLR4 antagonists may be used to dampen uncontrolled endotoxin- driven inflammation.
The present inventors have produced and isolated complexes of endotoxin and MD-2. The present inventors have discovered that endotoxin:MD-2 complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin (for example, under-acylated forms of endotoxin) inhibit TLR4-dependent cell stimulation. The present inventors have also discovered that MD-2 can have inhibitory as well as stimulatory effects on TLR4- dependent cell activation by endotoxin.
Accordingly, the present invention provides a purified complex including endotoxin bound to MD-2. Surprisingly, these complexes, when devoid of any other
host or microbial molecules, are potent and water soluble and do not require additional lipid carrier molecules (e.g., serum albumin) for water solubility. The present invention also provides a method for making the complexes of the invention and a method of isolating complexes of the invention.
The present invention provides a purified complex containing endotoxin bound to a modified MD-2. The modified MD-2 varies from wild-type MD-2 at amino acid 68, 69, 126, 127, 128, 129, 130, and/or 131. The reference numbering scheme is that used in Kawasaki et al., J hnmun 170:413-20 (2003). The variation may be an amino acid substitution, such as a conserved substitution. For example, the wild-type amino acid may be substituted with an alanine.
The present invention also provides methods of using the complexes of the invention, e.g., methods to increase or inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo. Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation. Methods using complexes with wild-type endotoxin are useful, e.g., to promote innate immune responses and as immunological adjuvants.
Brief Description of the Figures
Figure 1 depicts the expression and bioactivity of recombinant MD-2-His6. SDS/PAGE immunoblots were performed of control culture medium or medium from HiFive cells infected with recombinant baculovirus encoding wild-type (wt) or C95Y MD-2. MD-2 was detected using anti- (His)4 antibody. In Figure IA, HEK/TLR4 cells were incubated in HEPES-buffered HBSS+/0.1% albumin with 14C-LOSagg (3 ng/ml) with or without LBP (30 ng/ml) and/or 60 μl of culture medium containing wt MD-2 ("MD-2") (open bars); LOSagg plus LBP and sCD14 (250 ng/ml) with or without wt (closed bars) or C95Y "MD-2" (striped bars), or 14C-LOS :sCD14 (2 ng LOS/ml) with or without wt or C95Y "MD-2" (filled bars). After overnight incubation, extracellular IL-8 was assayed by ELISA. In Figure IB, HEK/TLR4 cells were incubated with increasing amounts of wt (■) or C95Y (o)"MD-2" plus 14C-LOS :sCD14 (2 ng/ml) and the cell activation was measured. Results shown are from one experiment (duplicate samples) representative of four independent experiments. Figure 2 shows that a bioactive complex (Mr -25,000) containing MD-2 and 14C-LOS is formed by incubation of 14C- LOS:sCD14 with wt, but not C95Y, MD-2. In Figure 2A, dialyzed control insect cell medium (o) or medium containing wt (♦) or C95Y (*) MD- 2 was incubated for 30
minutes, 37°C with 14C-LOS :sCD14 (1:1 vol/vol) in HBSS+/10 niM HEPES and chromatographed on Sephacryl SlOO. Column fractions were analyzed for 14C-LOS. Identical results were obtained in analytical (5 ng 14C-LOS per ml + 200 μl culture medium) or more preparative runs (reagents concentrated 2Ox). In Figure 2B5 peak fractions (M1- -25,000) from treatment of 14C-LOS :sCD14 with wt "MD-2" (Figure 2A) were re-chromatographed on SlOO in HBSS+/10 mM HEPES without HSA; recovery of 14C-LOS was >80%. In Figure 2C, HEK (□) or HEK/TLR4 (■) were incubated overnight with the indicated amounts of LOS added as purified Mr -25,000 (LOSrMD- 2) complex. Cell activation was measured by IL-8 accumulation. Results shown correspond to one experiment, in duplicate, representative of three similar experiments. Figure 2D depicts adsorption and elution of bioactive Mr -25,000 complex to HisBind resin. Peak fractions of the purified complex (Figure 2B; 10 ng 14C-LOS) were dialyzed against PBS and incubated with HisBind resin (0.125 ml) for one hour at 250C and processed as described in the Methods for Example 1. Non-adsorbed and adsorbed material eluted with 200 mM imidazole was precipitated with trichloroacetic acid to concentrate sample for SDS-P AGE/immunoblot analysis. Alternatively, absorbed material was eluted with 2% SDS and counted by liquid scintillation spectroscopy. In Figure 2D, adsorption of 14C-LOS :sCD14 was tested as a negative control. Overall recovery of 14C-LOS was greater than 90%. Results shown are the mean or representative of two closely similar experiments.
Figure 3 depicts delivery of 3H-LOS :MD-2 but not 3H-LOSagg or 3H-LOS :sCD14 to HEK/TLR4. HEK (□) or HEK/TLR4 (■) cells were incubated with 3H-LOS (0.75 ng/ml) in the form of LOSagg, LOS:sCD14, or LOS:MD-2. After overnight incubation at 37°C, cells were washed and lysed as described in the Methods for Example 1. The amount Of3H-LOS associated with the cells was measured by liquid scintillation spectroscopy. Results are from one experiment in duplicate, representative of three similar experiments.
Figure 4 depicts the effects of added MD-2 on activation of HEK/TLR4 by 3H- LOS:MD-2 and delivery of 3H-LOS :MD-2 to HEK/TLR4. In Figure 4A, cells were incubated in HBSS+, 10 mM HEPES/0.1% albumin with 14C-LOS:MD-2 (0.3 ng/ml) and increasing amounts of wt (■), C95Y (*) MD-2 or negative control medium (□) as well as with wt MD-2 but no 14C-LOS :MD-2 (o). After overnight incubation, extracellular accumulation of IL-8 was measured. The concentrated and dialyzed conditioned media contained about 10 ng (wt or C95Y) MD-2μl. Results are from one
experiment in duplicate, which are representative of three similar experiments. In Figure 4B, purified 14C-LOS :MD-2 (1 ng/ml) was pre-incubated with (•) or without (o) an amount of MD-2 that completely inhibited activation (40 μl of 20-fold concentrated and dialyzed conditioned media) for 30 minutes, 37°C in HBSS+/10 rnM HEPES before chromatography on Sephacryl S200. Column fractions were analyzed for l C-LOS by liquid scintillation spectroscopy. In Figure 4C, 3H-LOS :MD-2 (0.75 ng/ml; about 3000 cpm) with or without excess MD-2 as indicated in Figure 4B was incubated with HEK/TLR4 cells overnight at 37°C as described in the Methods for Example 1. After supernatants were removed, cells were washed and then lysed as described in the Methods for Example 1. The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. No radioactivity was associated with parental cells.
Figure 5 depicts a possible mechanism of action of MD-2 in endotoxin- dependent activation of TLR4. TLR4 activation may involve either conformational changes in MD- 2 that follow the interaction of MD-2 with endotoxin and TLR4 (A) or transfer of endotoxin from MD-2 to TLR4 (B).
Figure 6 depicts endotoxin responsiveness of well-differentiated primary cultures of human airway epithelia. Figure 6A shows that polarized epithelia were treated by apical application of NTHi LOS (100 ng/ml), soluble CD14 (sCD14; 250 ng/ml) and LPS binding protein (LBP; 100 ng/ml) or of IL-lβ (100 ng/ml) in a 50 μl volume. Twenty- four hours later, epithelia were harvested and analyzed for human β- defensin-2 (HBD-2) mRNA expression by real time PCR. Results shown represent 2 epithelia/trial, n = 3 different donors; *P < 0.05. Matched, untreated epithelia served as controls (CTL). Figure 6B shows the polarity of epithelial responses to IL-lβ and NTHi LOS. Reagents were applied to the apical, basolateral or both surfaces as indicted in the same concentrations as in Figure 6A. IL-lβ induced HBD-2 expression from either surface, while NTHi LOS failed to induce responses from either side. Results represent replicate data from two different specimens, (four epithelialcondition) ; *P < 0.05.
Figure 7 depicts results indicating the generation of a functional adenoviral vector expressing human MD-2. A replication incompetent adenoviral vector expressing MD-2 was used. To show that MD-2 protein produced by the vector is functional, HEK293 cells were transduced with a multiplicity of infection of 50 (MOI 50). Twenty-four hours later, the HEK293 cell culture supernatants were harvested and,
in dilutions- as indicated, applied to HEK cells with or without TLR4 in the presence of LOS:sCD14 (2 ng LOS/ml). TLR4-dependent cell activation was manifested as extracellular accumulation of IL-8, monitored by ELISA. The x-axis indicates the concentration (dilution) of cell culture supernatant applied. Results demonstrate that the adenoviral vector directs production of MD-2 that is secreted and functional. TLR4- cells showed no significant response to LOS-sCD14 medium containing MD-2.
Figure 8 depicts the effects of MD-2 on endotoxin responsiveness in human airway epithelia. Effect of transduction of well-differentiated, polarized human airway epithelia with Ad-MD-2 on cellular responsiveness to NTHi LOS as measured by HBD- 2 mRNA expression (Figures 8A and 8C) and by NF-κB-luciferase activity (Figure 8B). In the latter, cells were pretreated with an adenoviral vector expressing MD-2 48 hours before stimulation with LOS as described in the Materials of Example 2 below. Cells were treated with N. meningitidis LOS aggregates (prepared as described in the Materials of Example 2 below) plus LBP and sCD14 (Figure 8 A and 8B) or with purified L0S:sCD14 (Figure 8C). The fold increase in HBD-2 mRNA expression was quantified by real time PCR, and is indicated on the y-axis. Results were normalized to the control level of HBD-2 expression in untreated cells set at 1. Results shown are means ± SE of three different human specimens; *P < 0.05. NF-κB-luciferase activity was measured 24 hours following endotoxin treatment (n = 5 epithelia/condition, *P < 0.05). In Figure 8C, results represent means ± SE for four different human specimens ; *P < 0.05. Figure 8D shows the effect of soluble, recombinant MD-2 (rMD-2) on cellular responsiveness to LOS:sCD14. Well-differentiated human airway epithelia were treated with N. meningitidis LOS:sCD14 (5 ng LOS/ml), with or without the addition of cell culture supernatants containing rMD-2 as indicated on the x-axis. Twenty-four hours after endotoxin treatment, HBD-2 expression was quantified by real time PCR. Results shown represent findings from four different human airway specimens. *P < 0.05.
Figure 9 shows the responsiveness of airway epithelia to purified LOS:MD-2 complex. Well-differentiated airway epithelia, before and after adenoviral transduction to express MD-2, were treated with apically applied LOS:CD14 aggregates (open bar) or LOS:MD-2 aggregates (filled bar) and assayed for HBD-2 expression 24 hours later as described in the Materials for Example 2. Hatched bar represents results from cells pretreated with Ad-MD-2 twenty-four hours before application of LOS:MD-2 complex.
Each bar represents means ± SE for results from four different human epithelial specimens; *P < 0.05 compared with LOS:CD14 condition.
Figure 1OA shows that MD-2 mRNA expression in human airway epithelia is induced by several stimuli. Agents used included heat-killed NTHi (strain 12), the NTHi outer membrane protein P6, TNF-α IFN-γ, and phorbol myristate acetate (PMA). Concentrations used are indicated in the Materials for Example 2 below. For comparison, MD-2 mRNA level form Mac is shown. The fold increase in MD-2 mRNA expression, relative to the level of MD-2 mRNA in control resting airway epithelia, was quantified using real time PCR. Shown are the results from three independent experiments on three different epithelial preparations. *P < 0.05. Figure 1OB shows the effect of pretreatment of airway epithelia with heat-killed NTHi on LOS responsiveness. Epithelia were exposed to NTHi for 24 hours as described in Figure 1OA above, and were then treated with apically applied LO S: CD 14 complex (hatched bar). Control cells were treated with LOS:CD14 alone (open bar) or NTHi alone (filled bar). Twenty-four hours later, HBD-2 expression was assayed using real-time PCR. Results shown are mean ± SE for epithelia from five different specimens.
Figures 1 IA-I ID shows proposed mechanisms by which expression of MD-2 in the airway can regulate the responsiveness of the airway epithelial cells to endotoxin. Endogenous and exogenous expression of MD-2 refers to airway epithelial cells. E(aggχmemb> purified endotoxin (LPS or LOS) aggregates or gram-negative bacterial outer membrane to which LBP first binds. Complexes of endotoxin (E) with sCD14 and soluble MD-2 (sMD-2) are, by contrast, monomeric.
Figure 12 depicts sephacryl S200 chromatography of C-msbB LOS aggregates (1 μg) pre-incubated with 100 ng LBP and 24 μg sCD14 for 15 minutes at 37°C. The arrow indicates elution of wt LOS-sCD14 complex.
Figure 13 depicts sephacryl S200 chromatography oiuC-msbB LOS-sCD14 (160 ng) pre-incubated with ~5 μg MD-2 for 15 minutes at 37°C. The arrow indicates elution of wt LOS-MD-2 complex.
Figure 14 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA. HEK/TLR4 cells were incubated overnight at 37°C with increasing amounts of wt or mutant (msbB) LOS-MD-2, as indicated.
Figure 15 depicts cell activation as measured by accumulation of extracellular IL-8, monitored by ELISA. HEK/TLR4 cells were incubated overnight at 37°C with 0.1 ng/ml of wt LOS-MD-2 increasing amounts of mutant msbB LOS-MD-2, as indicated.
Figure 16. Mutant MD-2 (K125A.F126A) forms LOS:MD-2 complex (Figure 16A) that acts as weak agonist (Figure 16B) and inhibits activation of HEK/TLR4 cells by wt LOS:MD-2 (Figure 16C). (Figure 16A) Sephacryl S200 chromatography of LOS:sCD14 after incubation with culture medium from cells transfected with expression vector alone (*) or expression vectors directing expression and secretion of wt (closed circles) or mutant (open circles) MD-2. (Figure 16B) Dose-dependent activation of HEK/TLR4 cells by purified wt (closed circles) and mutant (open circles) LOS:MD-2. (Figure 16C) Dose-dependent inhibition by mutant LOS:MD-2 of cell activation induced by wt LOS:MD-2 (0.1 ng LOS/ml). (Figure 16B, Figure 16C) Cell activation was monitored by extracellular accumulation of IL-8 and measured by ELISA. Results shown are representative of four closely similar and independent experiments.
Figure 17. Monomeric complex of wt LOS with F126A MD-2 mutant is a potent TLR4 antagonist. Figure 17A shows dose-dependent activation of HEK/TLR4 cells by wt and mutant LOS:MD-2 complexes. Purified LOS:MD-2 complexes were incubated with HEK293/TLR4 cells in HBSS+, HEPES5 0.1% human serum albumin for 16 h. Extracellular IL-8 recovered in harvested culture medium was measured by ELISA. Figure 17B shows inhibition of wt LOS:MD-2 activity by LOS:MD-2 (F126A). HEK293/TLR4 cells were incubated for 16 h with increasing amounts of LOS:MD-2 (F126A) ± 20 pM wt LOS:MD-2 before assay of extracellular IL-8 by ELISA. Results shown are representative of 3 closely similar experiments.
Figure 18. Molecular model of MD-2 molecule (taken from Gangloff & Gay, NJ, TRENDS Biochem Sci, 29:294 (2004), and effects of site-specific mutations of murine or human MD-2, taken in part from Kawasaki, K et ah, J Immunol 170:413 (2003).
Figure 19. Potent pro-inflammatory activity of nasally administered wt LOS:MD-2 in mice. Mice (6/experimental group) were treated by nasal administration of 50 μl of PBS, purified LOS aggregates (30 or 300 EU = 3 or 30 ng LOS) or purified LOS:MD-2 (30 or 300 EU = 3 or 30 ng LOS in LOS:MD-2), as indicated. Four hours after administration, animals were sacrificed and sampled by broncho-alveolar lavage to monitor accumulation of total WBC and neutrophils (and cytokines; to be assayed). Results shown represent mean + SEM of values obtained.
Detailed Description of the Invention
The present inventors have discovered that MD-2 interacts directly with endotoxin-CD14 complexes to generate endotoxin-MD-2 complexes that produce TLR4- dependent cell stimulation. This stimulation can be produced at concentrations consistent with the ability of the innate immune system to detect and respond to minute amounts of endotoxin. Thus, endotoxin bound to MD-2, rather than endotoxin itself, is a ligand for triggering TLR4 receptor activation.
Accordingly, the present invention provides a purified complex including endotoxin bound to MD-2. The endotoxin may be a wild-type endotoxin. The endotoxin may be a wild-type endotoxin derived from any of a broad array of Gram-negative bacterial species. This includes many species of clinical importance such as Neisseria meningitidis, Escherichia coli, Pseudomonas aeruginosa, Haemophilus influenzae, Salmonella typhimurium, and Francisella tularensis.
The complex may have a molecular weight of about 25,000. The complex may consist essentially of one molecule of endotoxin bound to one molecule of MD-2. The complex may be soluble in water. The complexes may be soluble in water to a greater extent than is an endotoxin molecule not bound to MD-2. The complex may bind to TLR4 and may produce TLR4-dependent activation of cells, e.g., at a concentration of about 1 nM or less of the complex the complex may produce a half maximal activation of cells, e.g., at a concentration of about 30 pM or less of the complex the complex may produce a half maximal activation of cells.
The endotoxin may be hexa-acylated. The endotoxin may be an under-acylated endotoxin, e.g., a tetra-acylated or penta-acylated endotoxin. Examples of such under- acylated endotoxins are in PCT Publication No. WO 97/19688. The complex containing the under-acylated endotoxin may be capable of producing less TLR4-dependent activation of cells as compared to a complex including an endotoxin that is hexa- acylated.
The complex containing the under-acylated endotoxin also may inhibit cell activation by more potent TLR4 agonists. The present invention also provides a composition including a complex of the invention, optionally including a pharmaceutically acceptable carrier. The composition can be used, e.g., to promote innate immune responses and as an immunological adjuvants.
The present invention also provides methods to produce the complexes of the invention. This method includes contacting MD-2 with an endotoxin:CD14 complex to
produce the endotoxin:MD-2 complex. The endotoxin can be modified by LPS-binding protein (LBP) prior to the formation of the endotoxin:MD-2 complex.
The present invention also provides a method for modulating TLR4-mediated cell activation by endotoxin, including administering to the cell MD-2. The MD-2 can be administered prior to exposure of the cell to endotoxin. The MD-2 can be administered while the cell is exposed to endotoxin. In some embodiments of the invention, administration of a stoichiometric excess of MD-2 relative to TLR4 inhibits the endotoxin-mediated cell activation. In some embodiments of the invention, the MD- 2 is administered to achieve a concentration of about 10-100 ng/ml. In some embodiments of the invention, administration of MD-2 to cells, e.g., cells having a constitutively low level of MD-2 expression, increases endotoxin-mediated cell activation. These cells may be, for example, airway epithelial cells or pulmonary macrophages.
The present invention also provides methods for treating conditions associated with endotoxin-mediated cell activation. The conditions include sepsis, trauma, liver disease, inflammatory bowel disease, cystic fibrosis, asthma, complications in renal dialysis, autoimmune diseases, cancer chemotherapy sequelae, and intracellular gram- negative bacterial infections, e.g., infection caused by Francisella tularensis. The conditions can be treated by administration of a complex of the invention., Treatment, as used herein, includes both prophylactic treatments and therapeutic treatments.
Endotoxin and MD-2
The association of endotoxin with MD-2 forms the complexes of the invention. The endotoxin molecules and the MD-2 molecules may be wild-type (wt) molecules, or they may be mutant molecules. In some embodiments of the invention, the endotoxin molecules are wt endotoxin molecules, e.g., endotoxin derived from wt gram-negative bacteria. These wt endotoxin molecules may be hexa-acylated. The complexes formed with the wt endotoxin and MD-2 are capable of binding to TLR4 and are capable of producing TLR4-dependent cell activation.
In some embodiments of the invention, the endotoxin molecules are mutant endotoxin molecules. In some embodiments of the invention, the mutant endotoxin molecules are endotoxin molecules that are capable of binding to MD-2 and these complexes to TLR4 without producing the same level of TLR4-dependent cell activation (i.e., the mutant endotoxin complexes produce less activation) as produced by TLR4 dependent cell activation by complexes containing wild-type endotoxin
molecules. These mutant endotoxin molecules may be under-acylated (e.g., penta- acylated or tetra-acylated). These under-acylated endotoxin molecules may be produced via enzymatic release of non-hydroxylated fatty acids from endotoxin, or they may be produced using bacteria having genes disrupted that encode an acyltransferase (e.g., MrB, msbB) needed for biosynthetic incorporation of non-hydroxylated fatty acids into endotoxin. Because the complexes are both potent and water soluble, they will be useful in the treatment of conditions associated with TLR4-dependent cell activation.
The MD-2 molecule may also be a wild-type MD-2 or a mutant MD-2 molecule. The MD-2 may be a recombinant MD-2.
TLR4-dependent cell activation refers to the cascade of events produced when TLR4 is activated, e.g., by endotoxin, to produce responses, e. g., pro-inflammatory responses. The art worker can measure TLR4-dependent cell activation, e.g., by assaying the level of IL-8 produced by the cells.
As used herein, the endotoxin and MD-2 proteins include variants or biologically active fragments of the proteins. A "variant" of the protein is a protein that is not completely identical to a native protein. A variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid. The amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or unproved qualities as compared to the native polypeptide. The substitution may be a conserved substitution. A "conserved substitution" is a substitution of an amino acid with another amino acid having a similar side chain. A conserved substitution would be a substitution with an ammo acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall polypeptide retains its spatial conformation but has altered biological activity. For example, common conserved changes might be Asp to GIu, Asn or GIn; His to Lys or Arg or Phe; Asn to GIn, Asp or GIu and Ser to Cys, Thr or GIy. Alanine is commonly used to substitute for other amino acids in mutagenesis studies. The 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine having uncharged polar side chains; aspartate and glutamate having acidic side chains; and lysine, arginine, and histidine having basic side chains (Stryer (1981) ; Lehninger (1975)).
It is known that variant polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity. For example, through substitution of alternative amino acids, small conformational changes may be conferred upon a polypeptide that results in increased bioactivity.
One can use the hydropathic index of amino acids in conferring interactive biological function on a polypeptide, wherein it is found that certain amino acids may be substituted for other amino acids having similar hydropathic indices and still retain a similar biological activity.
The amino acid sequence of the variant endotoxin or MD-2 protein corresponds essentially to the native protein amino acid sequence. As used herein "corresponds essentially to" refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by native protein. Such a response may be at least 60% of the level generated by native protein, and may even be at least 80%, 85%, 90% or 95% of the level generated by native protein. For example, variants of the native endotoxin will elicit a biological response (i.e., TLR4-dependent cell activation) substantially the same as the response generated by the native endotoxin.
A variant of the invention may include amino acid residues not present in the corresponding native protein, or may include deletions relative to the corresponding native protein. A variant may also be a truncated fragment as compared to the corresponding native protein, i.e., only a portion of a full-length protein. Protein variants also include peptides having at least one D-amino acid.
The endotoxin and/or MD-2 of the present invention may be expressed from isolated nucleic acid (DNA or RNA) sequences encoding the proteins. Amino acid changes from the native to the variant protein may be achieved by changing the codons of the corresponding nucleic acid sequence. Recombinant is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well- known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon, and still result in an identical amino acid sequence.
The starting material (such as an MD-2 gene) used to make the complexes of the present invention may be substantially identical to wild-type genes, or may be variants of the wild-type gene. Further, the polypeptide encoded by the starting material may be substantially identical to that encoded by the wild-type gene, or may be a variant of the
wild-type gene. The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence, " (b) "comparison window," (c)"sequence identity, " (d) "percentage of sequence identity, "and (e) "substantial identity." (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
(b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may include additions or deletions (i. e., gaps) compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30,40, 50,100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Preferred, non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988); the local homology algorithm of Smith et al. (1981) ; the homology alignment algorithm of Needleman and Wunsch (1970); the search-for-similarity-method of Pearson and Lipman (1988); the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993).
Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins et al. (1988); Higgins et al. (1989); Corpet et al. (1988); Huang et al. (1992); and Pearson et al. (1994). The ALIGN program is based on the algorithm of Myers and Miller, supra.
The BLAST programs of Altschul et al. (1990); Altschul et al. (1997), are based on the algorithm of Karlin and Altschul supra.
Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, less than about 0.01, or even less than about 0.001.
To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997). Alternatively, PSI- BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al., supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. Alignment may also be performed manually by inspection.
For purposes of the present invention, comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
(c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which
does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
(e)(i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide includes a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 70%, at least 80%, 90%, or even at least 95%.
Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions (see below). Generally, stringent conditions are selected to be about 50C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 10C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
(e)(ii) The term "substantial identity" in the context of a peptide indicates that a peptide includes a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, or even 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window. Optimal alignment may be
conducted using the homology alignment algorithm of Needleman and Wunsch (1970). An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
As noted above, another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e. g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984); Tm 81.5°C + 16.6 (log M) +0.41 (% GC) -0. 61 (% form) - 500/L ; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA5 % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tn, is reduced by about 1°C for each 1 % of mismatching;
thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 100C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 40C lower than the thermal melting point (Tm) ; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45°C (aqueous solution) or 320C (formamide solution), the SSC concentration can be increased so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC wash at 65°C for 15 minutes (see Sambrook et al. (2001) for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 450C for 15 minutes. An example low stringency wash for a duplex of, e. g., more than 100 nucleotides, is 4-6X SSC at 400C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8. 3, and the temperature is typically at least about 3O0C and at least about 600C for long probes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are
substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids that have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, IM NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (2OX SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
Complexes of endotoxin with MD-2
Disclosed herein is the formation and isolation of a novel, bioactive, monomeric endotoxin:MD-2 complex. The complex can be generated with about physiologic (pM) concentrations of endotoxin and soluble MD-2. This complex, at pg/ml concentrations, activates cells in a TLR4-dependent fashion without the inclusion of other host or bacterial factors. The surprising and unexpected success in achieving formation of a bioactive endotoxin:MD-2 complex at such low concentrations of endotoxin and MD-2 reflects the importance of presenting endotoxin to MD-2 after endotoxin has been first modified by LBP and CD 14.
As interactions of CD 14 with endotoxin are greatly enhanced by prior interaction of endotoxin with LBP (Gioannini et al, 2002; Iovine et al, 2002; Hailman et al, 1994; Yu et al., 1996; Tapping et al., 1997 ; Thomas et al., 2002; and Giardina et al., 2001), these findings indicate that MD-2 endotoxin interactions leading to the generation of the bioactive endotoxin:MD-2 complex are greatly enhanced by presentation of endotoxin as a monomeric complex with CD 14. This may reflect, for example, a greater reactivity of MD-2 for disaggregated vs. aggregated forms of endotoxin, or the need for an additional protein-protein interaction between CD 14 and MD-2. Whatever the precise molecular basis of the high affinity and reactivity of endotoxin: CD 14 complexes with MD-2, these surprising findings indicate a direct role of MD-2 in endotoxin recognition and delivery of endotoxin to host cells containing TLR4, not requiring prior association of MD-2 with TLR4, as has been previously presumed (Viriyakosol et al., 2001; Visinin et al., 2001; Visintin et al., 2003; and Mullen et al., 2003). These findings also indicate
that the key role of LBP and CD 14 in enhancing cell responses to endotoxin is to transform aggregates of endotoxin to monomeric endotoxin: CD 14 complexes that are preferentially reactive with MD-2. Conversely, the remarkably potent activity of the purified endotoxin: MD-2 complex toward HEK/TLR4 cells indicates that CD 14 is not needed as part of a more complex hetero-oligomeric receptor, as was previously suggested (Miyake, 2003; Kawasaki et al., 2003; Muroi et al, 2002; Latz et al, 2002; and da Silva Correia et al., 2001).
The reaction pathway described herein in which endotoxin molecules in purified aggregates (or membranes) containing thousands to millions of endotoxin molecules/particle are extracted and transferred to first CD 14 and then MD-2 provides a unique physico-chemical mechanism to attain the potency that is needed for response. The ability to generate a homogeneous protein-endotoxin complex that, alone, triggers TLR4-dependent cell activation, interacts with host cells in an almost exclusively TLR4- dependent fashion and that can be metabolically labeled to sufficient specific radioactivity to monitor interactions at pM concentrations makes it possible for the first time to measure host cell-endotoxin interactions that are directly relevant to TLR4- dependent cell activation.
Many endotoxin-responsive cells contain membrane-associated CD 14 and MD-2 (associated with TLR4) (Means et al., 2000; Miyake et al., 2003; Takeda et al., 2003). However, as described herein, resting airway epithelial cells, like HEK/TLR4 cells, express TLR4 without MD-2 and respond to endotoxin only if LBP, sCD14 and soluble MD-2 are added. Each of these proteins are likely to be present in biological fluids at the concentrations needed to drive endotoxin-dependent TLR4 activation, especially in view of the very low extracellular MD-2 concentrations demonstrated in this study to be sufficient. Thus, the reaction pathway defined is relevant at the cell surface when TLR4/MD-2 complexes are endogenously present and also when only TLR4 is present at the cell surface and MD-2, which has been produced and secreted by neighboring cells, is present in the extracellular medium.
The findings presented herein thus indicate that MD-2 can engage both endotoxin and TLR4, and that simultaneous interaction of MD-2 with endotoxin and within TLR4 is important for TLR4-dependent cell activation by endotoxin. It is thus predicted that binding sites within MD-2 for TLR4 and endotoxin are topologically as well as structurally distinct, permitting engagement of endotoxin:MD-2 complexes with TLR4, as well as interaction and transfer of endotoxin from endotoxin: CD 14 complexes
to MD-2 already associated with TLR4 (Figure 5). The complete lack of reactivity of the C95Y MD-2 mutant with endotoxin: sCD 14 explains the complete absence of activity in this mutant protein (Figure 2B) despite a partial retention of reactivity with TLR4.
In contrast to 14C-LOS:sCD14, the "stability/solubility" of LOS:MD-2 in aqueous buffer and its bioactivity does not require albumin. That albumin is no longer required once the endotoxin:MD-2 complex is formed indicates that a hydrophobic site in MD-2, possibly a deep hydrophobic site, accommodates and shields the hydrophobic lipid A region of the bound endotoxin, making subsequent transfer to TLR4 less likely. Thus, binding of endotoxin to MD-2 may induce conformational changes in MD-2 that lead to TLR4 activation (Figure 5).
Figure 5 depicts mechanisms of action of MD-2 in endotoxin-dependent activation of TLR4. TLR4 activation may involve (A) conformational changes in MD-2 that follow the interaction of MD-2 with endotoxin and TLR4 and/or (B) transfer of endotoxin from MD-2 to TLR4.
MD-2 may be able to discriminate between TLR4 agonists and antagonists. Agonists and antagonists may differ in their ability to form a complex with MD-2 or in the structural properties of the endotoxin: MD-2 complex that is formed. Perhaps, only endotoxins that are TLR4 agonists are transferred from CD 14 to MD-2 or, within the endotoxin:MD-2 complex, trigger changes in MD-2 conformation or protein-protein contacts between TLR4 and MD-2 needed for TLR4 activation. Therefore, rather than transferring the buried endotoxin molecule to TLR4, MD-2 may function in a manner analogous to that observed with Toll receptors in Drosophila where a modified protein, Spaetzle, is the ligand that initiates the cytoplasmic signaling pathway.
Endotoxin Responsiveness of Human Airway Epithelia
The surfaces of the conducting airways and alveoli of the lung are a large interface between the host and the environment. Despite ongoing daily exposure to microbes and their components by inhalation, the intrapulmonary airways and airspaces normally maintain a sterile state without significant inflammation (Reynolds, 1997). This remarkable condition reflects the success of the concerted activities of the innate and adaptive immune systems.
Inducible antimicrobial peptides, including the cationic β-defensins, represent an important component of the innate immune system (Zasloff, 2002; Schutte et al., 2002; and Ganz, 2002). In humans, the expression of four β-defensins has been reported in pulmonary epithelia (McCray et al., 1997; Schroder et al., 1999; BaIs et al., 1998; Jia et
al., 2001; Harder et al., 2001; and Garcia et al., 2001), and a recent genome-wide search uncovered evidence of a much larger family of β-defensin genes encoded in five chromosomal clusters (Schutte et al., 2002). Recent data from several groups suggest that the regulation of inducible β-defensins expression in epithelia may parallel many aspects of antimicrobial peptide expression in Drosophila, including sensing of the extracellular environment by the Toll-like receptor (TLR) family of pattern recognition receptors and intracellular signaling through NF-κB and other pathways.
Human β-defensins-2 (HBD-2) is an inducible cationic antimicrobial peptide expressed at many muscosal surfaces, including the skin, cornea, gut, gingiva and airway epithelium (BaIs et al., 1998; Harder et al., 1997; Mathews et al., 1999; OTSfeil et al., 1999 ; Liu et al., 1998; and McNamara et al., 1999). In the airways, HBD-2 mRNA is expressed at low levels in resting cells but is markedly induced by pro-inflammatory stimuli including IL-lβ, TNF-α, and Pseudomonas aeruginosa (Singh et al., 1998; and Harder et al., 2000). Furthermore, the 5' flanking sequence of the HBD-2 gene contains several cis-acting elements that may mediate transcription in response to inflammatory stimuli, including NF-κB, IFN-gamma, AP-I, and NF-IL-6 response elements (Liu et al., 1998 ; Harder et al., 2000; and Tsutsumi-Ishii et al., 2003).
Sensitive cellular response to many endotoxins requires the concerted action of at least four host extracellular and cellular proteins: LPS binding protein (LBP), CD 14, MD-2 and TLR-4. The expression of inducible antimicrobial peptides such as human defensin- β (HBD-2) by epithelia is a component of the innate pulmonary defense. In well-differentiated primary cultures of human airway epithelia, TLR4 but little or no MD-2 is expressed, and these cells are relatively unresponsive to added endotoxin, even in the presence of LBP and CD 14. However, the responsiveness of these cells to endotoxin is markedly amplified by either the endogenous expression or the exogenous addition of MD-2, indicating that the constitutively low levels of MD-2 expression in these cells at "rest" are important in maintaining their hyporesponsiveness to endotoxin. Changes in MD-2 expression in the airway epithelium and/or neighboring cells can be achieved by exposure of these cells to specific bacterial and host products and may thereby regulate airway responsiveness to endotoxin.
Under resting conditions, human airway epithelia are hyporesponsive to endotoxin stimulation. The present inventors tested LOS from two different gram- negative bacterial species and several different presentations to LOS, including LOS:sCD14, which is active at picogram/milliliters toward highly endotoxin-responsive
cells such as monocytes, macrophages, and endothelial cells. The inventors focused on responses of airway epithelia to LOS, rather than LPS, because most gram-negative bacteria that colonize the upper airway produce LOS or LPS without O-antigen. Although airway epithelial cells are relatively unresponsive to endotoxin, these cells are not generally hyporesponsive to all stimuli, as shown by their robust responses to proinflammatory cytokines including IL- lβ.
Hypo-responsiveness to endotoxin is a common characteristic of epithelial cells lining mucosal surfaces that are repeatedly exposed to Gram-negative bacteria or cell- free (sterile) forms of endotoxin. The molecular basis of endotoxin hypo-responsiveness is unknown. As sensitive responses to endotoxin generally depend on TLR4-dependent signaling (Shimazu et al., 1999), hypo-responsiveness likely represents the functional deficiency of one or more elements of pathway (s) leading to and resulting from TLR4 activation. TLR4 is a membrane protein containing repeats of a leucine rich motif in the extracellular portion of the protein and a cytoplasmic domain homologous to the intracellular domain of the human IL-I receptor (Medzhitov et al., 1997). The IL-I responsiveness of airway epithelia indicates that the overlapping intracellular signaling pathways for activated TLR and IL-I receptors (Hoffmann et al., 1999; Janeway et al., 2002; and Beutler et al., 2003) are present and functionally intact in human airway epithelia, including those important in NF-κB-regulated HBD-2 expression. Even though airway epithelia express TLR4, the cells responded poorly to LOS:sCD14. Therefore it is likely that there is a defect in TLR4-dependent recognition and/or response to endotoxin.
MD-2, also termed lymphocyte antigen 96 (LY96), was first identified by Shimazu and colleagues as a molecule that conferred TLR4-dependent responses to minute amounts of endotoxin (Shimazu et al., 1999; and Yang et al., 2000). Cells that are TLR4+/MD-2' are virtually unresponsive to endotoxin (Shimazu et al., 1999; and Nagai et al., 2002). As described herein, human airway epithelia exhibit endotoxin responses consistent with a TLR4+/MD-2' phenotype. The complementation of this deficiency of MD-2 via endogenous expression or extracellular addition was sufficient to convert human airway epithelia from endotoxin hypo-responsive to highly endotoxin responsive without changing basal NF-KB-regulated HBD-2 expression of these cells or that stimulated by treatment with an unrelated agonist (e.g., IL-I β). These data indicate that the hypo-responsiveness of "resting" airway epithelia is due specifically to the absence of MD-2 expression.
It was previously observed that TLRs 1-6 and CD 14 were expressed in differentiated human airway epithelia. Although it was reported that P. aeruginosa LPS activated CD14-dependent NF -KB signaling, the increase in HBD-2 mRNA that was observed in response to P. aeruginosa LPS was no greater (~3-fold) than what the present inventors found with added LOS in the absence of MD-2 complementation; i.e., very modest when contrasted to the induction of HBD-2 expression caused by IL-I (3 or by endotoxin in the presence of MD-2.
Similar to the finding in airway epithelia, cell lines derived from intestinal epithelia respond robustly to IL-I (3 stimulation but not to purified, protein-free LPS with NF-κB signaling. However, published data on intestinal epithelia indicate both diminished TLR4 expression as well as absent MD-2. Accordingly, complementation of both TLR4 and MD-2 in intestinal epithelia is needed for significant activation of NF- KB and IL-8 reporter genes in response to endotoxin. These data suggest that airway and intestinal epithelia, both derivatives of the endodermal foregut, have evolved pattern recognition receptor profiles that minimize stimulation by endotoxin that is frequently encountered at these mucosal surfaces. Whether or not the apparent differences in the molecular basis of endotoxin hyporesponsiveness observed in the studies vs. the present findings reflect differences between airway and intestinal epithelial cells or differences between well-differentiated primary cultures and cell lines requires further study. The ability of the airway to mobilize protective TLR4-dependent responses without the need for MD-2 in response to specific products of gram-positive bacterial airway pathogens (e.g., pneumococci) is consistent with the apparently greater retention of TLR4 expression by airway vs. intestinal epithelia.
On the basis of current understanding of MD-2 actions, mobilization of MD-2 in the airway could have at least two roles: (1) combining, when endogenously expressed, with endogenously expressed TLR4 to increase surface expression of TLR2 (MD-2), and (2) participating directly in endotoxin recognition by extracting endotoxin from monomeric endotoxin: CD 14 complexes either before or after interaction of MD-2 to the TLR4. TLR4 alone has no apparent ability to engage the endotoxin:(s) CD14 complex. The ability of soluble, extracellular MD-2 plus endotoxin: sCD 14 and preformed endotoxin:MD-2 complex to activate resting human airway epithelia implies that sufficient TLR4 is produced by these cells to respond sensitively to endotoxin when endotoxin is presented as a complex with MD-2. No mechanism for TLR-independent interaction of endotoxin: MD-2 complex has been described. Therefore, the inventors
believe that the ability of pico-molar amounts of LOS : MD-2 to activate resting human airway epithelia suggests that there is sufficient apical surface expression of TLR4 (even without endogenous MD-2 to interact directly with extracellular endotoxin:MD-2 and produce potent cell activation. This could be biologically important because it would permit TLR4 from one cell to engage MD-2 or endotoxin: MD-2 derived from MD-2 secreted by a neighboring cell. This potency of endotoxin: MD-2-TLR4 interactions may explain how small amounts of surface TLR4 may be sufficient for robust cell activation yet insufficient for recognition by fluorescent or neutralizing antibodies.
Results presented herein indicate that MD-2 plays a direct role in endotoxin recognition by TLR4. Endotoxin is transferred from an endotoxin: (s)CD 14 complex to MD-2 to form an endotoxin:MD-2 complex that appears to be the ligand for endotoxin- dependent TLR4 activation. TLR4 alone has no apparent ability to productively engage the endotoxin: (s)CD 14 complex. In addition, endogenous expression of MD-2 can increase surface expression of TLR4, as a TLR4/MD-2 complex, indicating a chaperone- like function for MD-2 as well. The ability of exogenously added MD-2 to increase cellular responsiveness to LOS:sCD14 and the ability of purified LOS-MD-2 to directly activate "resting" airway epithelia indicates some apical surface expression of TLR4 even without endogenous expression of MD-2. This would be biologically important because it would permit TLR4 from one cell to engage MD-2 or endotoxin:MD-2 derived from MD-2 secreted by a neighboring cell.
Thus, these results indicate that the regulation of MD-2 expression is a key determinant of airway epithelial responses to endotoxin. Under resting conditions, low MD-2 expression in airway epithelia renders cells poorly responsive to endotoxin, whereas up-regulation of MD-2 alone can greatly enhance cellular responses to endotoxin. A variety of stimuli can induce MD-2 mRNA expression in airway epithelia, perhaps by more than one receptor-mediated pathway. MD-2 can be secreted by epithelia or mononuclear cells and the application of secreted MD-2 enhances TLR4 signaling in MD- 2 deficient cells. There may be stimuli (e.g., cytokines, bacterial products) that induce MD-2 expression in airway epithelia to levels sufficient to enhance endotoxin responsiveness. In intestinal epithelia, expression of MD-2 is regulated by cytokine signals including TNF-α and interferon- (Abreu et al., 2001; and Visintin et al., 2001). Stimulated pulmonary macrophages might also secrete sufficient MD-2 to enhance TLR4 signaling in epithelia. In either case, production of MD-2 by epithelia or exogenous provision of MD-2 from neighboring cells would complement
the airway cells for enhanced TLR.4 signaling in response to endotoxin. However, because TLR4-dependent cell activation by endotoxin requires simultaneous interaction of MD-2 with endotoxin and TLR4 (Figure 11), excessive production of MD-2 could blunt cellular responsiveness to endotoxin by promoting conversion of extracellular endotoxin: sCD 14 complex to endotoxin:MD-2 while presaturating TLR4 with MD-2, leaving no cellular targets (i.e., free TLR4) for the extracellular endotoxin:MD-2 complex. Thus, the regulation of MD-2 expression in the airways (e.g., airway epithelia and/or pulmonary macrophages) may permit both up-and down-regulation of endotoxin responsiveness in the airway.
One advantage of such a hierarchy of responses is that it would help to minimize the frequency of epithelial-induced inflammatory signals from endotoxin. Ambient air contains bacteria and endotoxin (Mueller-Anneling et al., 2004) and the aerosolized concentrations of endotoxin can increase dramatically in some agricultural and industrial environments from <10 EU/m3 to >l,000 EU/m3 (Douwes et al., 2003). Under normal conditions, the low expression of MD-2 in epithelia can serve to dampen endotoxin responsiveness to common environmental exposures and thereby avoid unwanted states of chronic inflammation in the face of frequent encounters with environmental endotoxin and other bacterial cell wall components. Conversely, up- regulation of MD-2 expression can be important to enhance host defense responses to invading Gram-negative bacteria. However, in certain disease states, such as cystic fibrosis or asthma, enhanced expression of MD-2 could lead to exaggerated endotoxin responsiveness with pathologic consequences.
Formulations and Administration
Complexes containing wild-type endotoxin produce TLR4-dependent cell stimulation, while complexes containing mutant forms of endotoxin inhibit TLR4- dependent cell stimulation. Methods of using the complexes, e.g., methods to increase or inhibit TLR4-dependent activation of cells by endotoxin in vitro or in vivo are provided. Methods using complexes with mutant endotoxin are useful, e.g., to decrease undesirable endotoxin-mediated inflammation. Methods using complexes with wild- type endotoxin are useful, e.g., to promote innate immune responses and to serve as an immunological adjuvant.
Complexes of the invention, or MD-2 alone, including their salts, can be administered to a patient. Administration in accordance with the present invention may be in a single dose, in multiple doses, and/or in a continuous or intermittent manner,
depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The administration may be essentially continuous over a preselected period of time or may be in a series of spaced doses. The amount administered will vary depending on various factors including, but not limited to, the condition to be treated and the weight, physical condition, health, and age of the patient. A clinician employing animal models or other test systems that are available in the art can determine such factors.
To prepare the complexes, the complexes are produced as described herein or otherwise obtained and purified as necessary or desired.
One or more suitable unit dosage forms including the complex can be administered by a variety of routes including topical, oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
The formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods known to the pharmaceutical arts. Such methods include the step of mixing the complex with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system. By "pharmaceutically acceptable" it is meant a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and not deleterious or unsuitably harmful to the recipient thereof. The therapeutic compounds may also be formulated for sustained release, for example, using microencapsulation (see WO 94/07529, and U. S. Patent No. 4,962, 091).
The complex may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, and small volume infusion containers, or in multi- dose containers. Preservatives can be added to help maintain the shelve life of the dosage form. The complex and other ingredients may form suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the complex and other ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
These formulations can contain pharmaceutically acceptable carriers and vehicles that are available in the art. It is possible, for example, to prepare solutions using one or more organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol," polyglycols and polyethylene glycols, C1-C4 alkyl esters of short-chain acids, ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "Miglyol," isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.
It is possible to add other ingredients such as antioxidants, surfactants, preservatives, film-forming, keratolytic or comedolytic agents, perfumes, flavorings and colorings. Antioxidants such as t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene and a-tocopherol and its derivatives can be added.
The pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are available in the art. Examples of such substances include normal saline solutions such as physiologically buffered saline solutions and water. Specific non-limiting examples of the carriers and/or diluents that are useful in the pharmaceutical formulations of the present invention include water and physiologically acceptable buffered saline solutions such as phosphate buffered saline solutions at a pH of about 7.0-8. 0.
The complex can also be administered via the respiratory tract. Thus, the present invention also provides aerosol pharmaceutical formulations and dosage forms for use in the methods of the invention, hi general, such dosage forms include an amount of complex effective to treat or prevent the clinical symptoms of a specific condition. Any attenuation, for example a statistically significant attenuation, of one or more symptoms of a condition that has been treated pursuant to the methods of the present invention is considered to be a treatment of such condition and is within the scope of the invention.
For admim'stration by inhalation, the composition may take the form of a dry powder, for example, a powder mix of the complex and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator, insufflator, or a metered-dose inhaler (see, for example, the pressurized metered dose inhaler (MDI) and the dry powder inhaler disclosed in Newman (1984).
Intranasal formulations may include vehicles that neither cause irritation to the nasal mucosa nor significantly disturb ciliary function. Diluents such as water, aqueous saline or other known substances can be employed with the subject invention. The nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and benzalkonium chloride. A surfactant may be present to enhance absorption of the subject proteins by the nasal mucosa.
The complex may also be administered in an aqueous solution, for example, when administered in an aerosol or inhaled form. Thus, other aerosol pharmaceutical formulations may include, for example, a physiologically acceptable buffered saline solution. Dry aerosol in the form of finely divided solid compound that is not dissolved or suspended in a liquid is also useful in the practice of the present invention.
For administration to the respiratory tract, for example, the upper (nasal) or lower respiratory tract, by inhalation, the complex can be conveniently delivered from a nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray. Pressurized packs may include a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Nebulizers include, but are not limited to, those described in U.S. Patent Nos. 4,624,251; 3,703,173; 3,561,444; and 4,635,627. Aerosol delivery systems of the type disclosed herein are available from numerous commercial sources including Fisons Corporation (Bedford, Mass.), Schering Corp. (Kenilworth, NJ) and American Pharmoseal Co., (Valencia, CA). For intra-nasal administration, the therapeutic agent may also be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered-dose inhaler. Typical of atomizers are the Mistometer (Wintrop) and the Medihaler (Riker). The complex may also be delivered via an ultrasonic delivery system. In some embodiments of the invention, the complex may be delivered via an endotracheal tube. In some embodiments of the invention, the complex may be delivered via a face mask.
Furthermore, the complex may also be used in combination with other therapeutic agents, for example, pain relievers, anti-inflammatory agents, antihistamines, and the like, whether for the conditions described or some other condition.
The present invention further pertains to a packaged pharmaceutical composition such as a kit or other container. The kit or container holds a therapeutically effective
amount of a pharmaceutical composition of the complex and instructions for using the pharmaceutical composition for treating a condition.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1: Isolation of an Endotoxin-MD-2 Complex
Reported herein is the purification of a stable, monomeric, bioactive endotoxin- MD-2 complex generated by treatment of endotoxin: sCD 14 with recombinant MD-2. Efficient generation of this complex occurred with pM amounts of endotoxin and ng/ml amounts of MD-2 and, under these conditions, required the presentation of endotoxin to MD-2 as a monomeric endotoxin:CD14 complex. Higher concentrations of the monomeric endotoxin:MD-2 complex can be generated by co-incubation of higher concentrations of soluble MD-2 and monomeric endotoxin: CD 14 complex. TLR4- dependent delivery of endotoxin to human embryonic kidney (HEK) cells and cell activation at pM concentrations of endotoxin occurred with purified endotoxin:MD-2 complex, but not purified endotoxin aggregates LBP and/or sCD14. The presence of excess MD-2 inhibited delivery of endotoxin:MD-2 to HEK/TLR4 cells and cell activation. These findings demonstrate that TLR4-dependent activation of host cells by pM concentrations of endotoxin occurs by sequential interaction and transfer of endotoxin to LBP, CD 14 and MD-2 and simultaneous engagement of endotoxin and TLR4 by MD-2.
Recombinant MD-2 secreted by infected insect cells
To further define the mechanism by which 4C-LOS :sCD14 promotes cell activation and the role of MD-2, the inventors generated conditioned insect cell culture medium containing soluble, polyhistidine-tagged recombinant wild-type (wt) or C95Y mutant MD-2 according to the method of Viriyakosol et al. (2001). A human embryonic kidney cell line (HEK293) that stably expresses TLR4 (HEK/TLR4), but lacks both CD 14 and MD-2 (Yang et al., 2000), was used to evaluate the effect of MD-2 on the ability of lipooligosaccharide (LOS) to interact with TLR4 and promote activation.
Conditioned medium from insect cells inoculated with baculovirus encoding either wild-type (wt) or mutant C95Y MD-2, but not conditioned control medium, contained a polyhistidine-tagged protein that migrated with a size appropriate to that reported for MD-2 (Mr -20,000; (Shimazu et al., 1999)). In the absence of added
conditioned medium, HEK/TLR4 cells were not activated by 14C-LOS aggregates with or without LBP and sCD14 or by the isolated 14C-LOS:sCD14 complex (Figure IA). However, addition of dialyzed conditioned medium from cells expressing wt MD-2 with 14C-LOSagg + LBP and sCD14 or with purified 14C-LOS :sCD14 alone resulted in robust activation of HEK/TLR4 (Figure IA). Little or no activation of these cells occurred when wt MD-2 was added with LOSagg with or without LBP, but without sCD14. Parental HEK cells (TLR4-) were not activated by endotoxin under any of the conditions tested. Thus, activation of HEK293 cells by LOS required the concerted action of LBP, sCD14 (to produce LOS:sCD14), MD-2, and TLR4. The effects of the conditioned medium containing wt MD-2 were not seen with control conditioned medium or medium containing C95Y MD-2 (Figure IA) even when added at 100-fold greater amounts (Figure IB). Maximum cell activation was produced with as little as 30 ng wt MD-2 per ml added.
Formation and function of a novel endotoxin-MD-2 complex There is a close correlation between the bioactivity of endotoxin and changes in the physical state of endotoxin induced by reversible protein associations. Because incubation of wt MD-2 with 14C-LOS :sCD14 is necessary for activation of HEK/TLR4 cells (Figures IA and IB), the result of incubation of wt MD-2 with 14C-LOS:sCD14 at concentrations of wt MD-2 and LOS comparable to that used in the bioassays (Figure 1) was examined by gel filtration. Treatment of 14C-LOS :sCD14 with wt MD-2 efficiently generated a new 14C-LOS-containing complex that eluted as Mr -25,000 on Sephacryl SlOO (Figure 2A). In contrast, treatment of 14C-LOS :sCD14 with the non-functional C95Y MD-2 produced no change in the chromatographic behavior of 14C-LOS :sCD14 (Figure 2A). Re-chromatography of the peak fraction (s) from preparative generation of this new 14C-LOS-containing complex (Figure 2B) yielded a single, symmetrical peak (recovery > 90% with or without albumin, Figure 2B). This 14C-LO S -containing complex is fully resolved from albumin and any residual 14C-LOS:sCD14 or sCD14 released from LOS:sCD14 during formation of the complex judged by gel filtration chromatography and immunoassay for CD14 and LOS:sCD14. The isolated Mr -25,000 complex activated HEK/TLR4 cells in a potent dose, and TLR4-dependent manner (Figure 2C); half- maximal activation occurred at approximately 150 pg of 14C-LOS per ml (30 pM). Cell activation did not require addition of sCD14 or albumin. The apparent size of this active complex, as judged by gel-sieving chromatography, was consistent with a monomeric complex of LOS:MD-2. To
determine if the 14C-LOS in this active complex was linked to MD-2, the ability of nickel charged agarose resin (HisBind) to co-capture polyhistidine-tagged MD-2 and 14C-LOS was examined. Both MD-2 and 14C-LOS adsorbed to the HisBind resin and were eluted with 200 mM imidazole (Figure 2D). The low adsorption of 14C- LOS:sCD14 confirmed that the binding to the HisBind resin of 14C-LOS in the bioactive Mr -25,000 complex was specific and reflected its association with MD-2. Thus, treatment of 14C-LOS :sCD14 with soluble MD-2 generated an apparently monomeric 14C-LOS :MD-2 complex that activated HEK/TLR4 cells in a potent (pg/ml) dose- dependent and TLR4-dependent manner that was independent of CD 14. Also generated was a 3H-LPS :MD-2 complex from 3H-LPS purified from E. coli LCD25 (Munford et al., 1992) with chromatographic and functional properties virtually identical to 14C- LOS:MD-2.
Efficient formation of bioactive endotoxin-MD-2 complex requires monomeric endotoxin-CD14 complex
The demonstration that 14C-LOS :sCD14 could activate HEK/TLR4 cells by first transferring 14C-LOS :sCD14 to MD-2 indicated that it was this step that was facilitated by presentation of endotoxin as a monomeric complex with CD 14. Various presentations of 14C-LOS :sCD14 (i.e., 14C-LOSagg with or without LBP, with or without sCD14) were compared for their ability to react with MD-2 to form the LOS:MD-2 complex (assessed by gel filtration chromatography) and subsequently activate HEK/TLR4 cells. Only 14C-LOS :sCD14 (either purified or generated during incubation of 14C-LOSagg with LBP and sCD14) was able to react with MD-2 to produce 14C- L0S:MD-2 and activate HEK/TLR4 cells (Table 1). These findings directly demonstrate the role of CD14 (i.e., endotoxin- CD14) in the delivery of endotoxin to MD-2 and demonstrate CD14 is not part of the complex that directly activates TLR4.
Table 1. Ability of various forms of [14C]-LOS +/- proteins to form LOS- MD-2 and to activate HEK/TLR4.
Purified [14C]-LOSagg or [14C]-LOS-sCD14 (3 ng LOS/ml) +/- indicated proteins (30 ng/ml LBP, 250 ng/ml sCD14, 60 μl culture medium) were incubated at 37°C for 30 min. After this incubation, samples were analyzed by gel filtration chromatography to monitor formation of [14C]-LOS-MD-2 and by incubation with HEK/TLR4 cells to measure cell activation.
Molecular requirements for MD-2 dependent delivery of endotoxin
Table 1 also indicates that endotoxin must be presented in the form of a monomeric endotoxin-MD-2 complex to activate HEK/TLR4 cells. This could reflect a unique ability of MD-2 to deliver endotoxin to TLR4. To test this hypothesis, cell association of purified LOSagg, LOS-sCD14 or LOS-MD-2 complexes to parental and HEK/TLR4 cells were compared. Initial experiments with [l C]-LOS did not reveal significant cell association of radiolabeled LOS under any condition. These negative results could simply reflect the limited amount of surface TLR4 available and needed to engage LOS-MD-2 for cell activation. To address this, LOS was isolated after metabolic labelling with [3H] -acetate to achieve nearly 10-fold higher specific radioactivity (-4000 cpm/ng) and generated [3H]-LOSagg and protein: [3H]-LOS complexes. Using the [ H]-LOS, specific TLR4-dependent cell association of [ H]- LOS-MD-2 only, with virtually no TLR4-independent cell association of LOS-MD-2, was readily detected (Figure 3). In addition, no cell association of either [3H]-LOSagg or [3H]-LOS-sCD14 to HEK cells ± TLR4 was detected (Figure 3).
These findings indicate a bifunctional role for MD-2, coupling endotoxin recognition to TLR4 activation. If simultaneous engagement of endotoxin and TLR4 by MD-2 is required for TLR4-dependent cell activation by endotoxin, the presence of a stoichiometric excess of MD-2 relative to TLR4 should inhibit cell activation by endotoxin. To test this hypothesis, the effect of adding varied amounts of conditioned insect cell culture medium containing wt, C95Y, or no MD-2 was examined. Addition of medium containing wt MD-2, but not control medium, produced a dose-dependent inhibition of the activation of HEK/TLR4 by 4C-LOS:MD-2 (Figure 4A). Medium
containing C95Y MD-2 had an intermediate inhibitory effect consistent with the (partial) retention of TLR4 binding by this mutant MD-2 species. Inhibitory effects of added MD-2 had no direct effect on LOS:MD-2 (Figure 4B, no change in chromatographic behavior), but blocked TLR4-dependent cell association of 3H- LOS:MD-2 (Figure 4C). This finding is consistent with a need for simultaneous engagement of endotoxin and TLR4 by individual molecules of MD-2 for TLR4- dependent cell activation. Thus, depending on levels of expression, MD-2, line LBP, can have inhibitory as well as stimulatory effects on TLR4-dependent cell activation by endotoxin.
Materials and Methods
LBP and sCD14 were provided by Xoma (US) LLC. (Berkeley, CA). Both parental HEK293 and cells stably transfected with TLR4 (HEK/TLR4) were provided by Dr. Jesse Chow, Eisai Research Institute, (Andover, MA). Chromatography matrices and electrophoresis supplies were purchased from Amersham Biosciences (Piscataway, NJ). Human serum albumin was obtained as an endotoxin-free, 25% stock solution (Baxter Healthcare Corp., Glendale, CA). [14C]-LOS or [3H]-LOS was isolated from an acetate auxotroph of Neisseria meningitidis Serogroup B after metabolic labeling and isolated as previously described (28). [14C or 3H]-LOSagg (apparent Mr > 20 million) and [14C or 3H]-LOS-CD14 (Mr ~ 60,000) were purified as previously described (Thomas et al. 2002). [3H]-LPS from E. coli LCD25 was purchased from List Biologicals (Campbell, CA) as processed as described previously (Iovine et al, 2002).
Preparation of recombinant MD-2
MD-2 cDNA was isolated, linearized, and inserted, using Ncol and Xhol- sensitive restriction sites, into the baculovirus transfection vector pBACl 1 (Novagen) that provides a six residue polyhistidine tag at the carboxyl terminal end of MD-2 and 5' flanking signal sequence (gp64) to promote secretion of the expressed protein. DNA encoding each desired product was sequenced in both directions to confirm fidelity of the product. Production and amplification of recombinant viruses were undertaken in collaboration with the Diabetes and Endocrinology Research Center at the Veterans' Administration Medical Center, Iowa City, IA. Sf9 cells were transfected with linear baculovirus DNA and the pBACl 1 vector using Bacfectin, according to a procedure described by Clontech. For production of recombinant protein, HiFive cells (Invitrogen) were incubated in serum-free medium and inoculated at an appropriate virus titer.
Supernatants were collected and dialyzed either against HEPES-buffered (10 mM, pH 7.4) Hanks' balanced salts solution with divalent cations (HBSS+), pH 7.4 or 50 mM phosphate, 150 mM NaCl, pH 7.4 (PBS). To absorb the expressed polyhistidine tagged protein, nickel charged agarose resin (HisBind, Novagen, Madison, WI) was incubated batchwise with culture medium pre-dialyzed against PBS containing 5 mM imidazole. After extensive washing with this same buffer, adsorbed material was eluted with 200 mM imidazole. Flow-through and eluate fractions were analyzed by immunoblot as described below. The presence of [l C-LOS] was evaluated by liquid scintillation spectroscopy.
Immunoblotting
To detect polyhistidine labeled wt and C95 Y MD-2, an anti-polyhistidine antibody (Tetra-His antibody, Qiagen, Valencia, CA) was used. Samples were electrophoresed using an Amersham Biosciences PhastGel System (10-15% gradient acrylamide gel) and transferred to nitrocellulose by semi-dry transfer. The nitrocellulose was washed with Tris-buffered saline (TBS), pH 7.5, containing 0.05% Tween-20 and 0.2% TritonX-100 (TBSTT), blocked to reduce nonspecific background with 3% BSA in TBSTT for 1 hr at 25°C, and incubated with the anti-His4 antibody in TBSTT overnight. After washing with TBSTT, the blot was incubated with donkey anti-mouse IgG conjugated to horseradish peroxidase (BioRad) for 1 hr at 25°C in TBS containing 3% goat serum and washed with TBSTT exhaustively. Blots were developed using the Pierce SuperSignal substrate system.
HEK cell activation assay
HEK cells +/- TLR4 have been extensively characterized and were cultured as has been described (Yang et ah, 2000). For cell activation assays, cells were grown to confluency in 48 well plates. Cell monolayers were washed with warm PBS 2x and incubated overnight at 37°C, 5% CO2, and 95% humidity in HBSS+, 0.1% HSA with the supplements indicated in the legends to Figures 1-3 and Table 1. Activation of HEK cells was assessed by measuring accumulation of extracellular IL-8 by ELISA as previously described (Denning et ah, 1998).
Chromatography
Columns of Sephacryl HR S200 (1.6 cm x 30 cm) or SlOO (1.0 cm x 60 cm) were pre-equilibrated in 10 mM HEPES, HBSS+ +/- 0.1% HSA. Aliquots containing [14C] -LOSagg +/- LBP, +/- sCD14, +/- dialyzed conditioned insect cell medium or [14C]- LOS-sCD14 +/- dialyzed conditioned insect cell medium or [14C]-LOS-MD-2 were
incubated at 37°C, 30 min before gel filtration chromatography. Fractions (ImI) were collected (flow rate: 0.5 ml/min) at room temperature using an Amersham Biosciences AKTA FPLC. Samples for chromatography contained from 2 ng to 200 ng [14C]- LOSagg , [14C]-LOS-sCD14 or [14C]-LOS-MD-2 in 1 ml of column buffer +/- 0.1% HSA. Aliquots of the collected fractions were analyzed by liquid scintillation spectroscopy using a Beckman LS liquid scintillation counter to detect [14C]-LOS. Recoveries of [14C]-LOS were > 70% +/- albumin. All solutions used were pyrogen- free and sterile-filtered. After chromatography, selected fractions to be used in bioassays were pooled and passed through sterile syringe filters (0.22μm) with greater than 90% recovery of radiolabeled material in the sterile filtrate. Fractions were stored under sterile conditions at 40C for more than 3 months with no detectable changes in chromatographic or functional properties. Columns were calibrated with BioRad gel filtration standards that included thyroglobulin (V0), γ-globulin, ovalbumin, myoglobin, and vitamin B 12 (V;) and human serum albumin. Experiments utilizing [3H]-LOS and [3H]-LPS were carried out by the same procedure.
Cell association of various forms of endotoxin
HEK or HEK/TLR4 cells were grown to confluency in 6 well plates, washed twice with warm PBS, and [3H]-LOS aggregates or [3H]-LOS-protein complexes +/- indicated supplements were incubated overnight at 37°C, 5% CO2, and 95% humidity in DMEM, 0.1% HSA with the supplements indicated in the legends to Figures 3 and 4. After the incubation, supernatants (extracellular media) were collected, cells were washed twice with cold PBS, and cells were lysed and solubilized using RNeasy lysis buffer (Qiagen). The amount of radioactivity associated with the cells was determined by liquid scintillation spectroscopy. Total recovery of radioactivity was >90%.
Example 2 - MD-2 Expression in Human Airway Epithelia
The results presented herein demonstrate that in well-differentiated primary cultures of human airway epithelia TLR4, but little or no MD-2, is expressed. These cells are relatively unresponsive to added endotoxin even in the presence of LBP and CD 14. However, the responsiveness of these cells to endotoxin is markedly amplified by either the endogenous expression or the exogenous addition of MD-2, indicating that the constitutively low levels of MD-2 expression in these cells at "rest" is important in maintaining their hypo-responsiveness to endotoxin. Changes in MD-2 expression in the airway epithelium and/or neighboring cells can.be achieved by exposure of these
cells to specific bacterial and host products and can thereby regulate airway responsiveness to endotoxin.
Human airway epithelia are hyporesponsive to applied endotoxin Nontypeable Haemophilus influenza (NTHi) is a common commensal, and sometimes a pathogen, of the respiratory tract (Lerman et ah, 1979; Smith et al, 1989; Bandi et al, 2001). The experiments described herein explored whether endotoxin (LOS) from NTHi increased HBD-2 expression after application to the apical surface of human airway epithelia. As shown in Figures 6A and 6B, following the apical application of LOS in the presence of sCD14 and LBP, there was little or no change in the HBD-2 mRNA abundance. In contrast, IL- lβ stimulated a large increase in HBD-2 expression (>10,000-fold).
It was possible that the striking lack of responsiveness of airway epithelia to endotoxin alone reflected a polar distribution of receptors for endotoxin on the basolateral surface of airway epithelia. To address this possibility, NTHi LOS was applied to either the apical or basolateral surface of airway epithelia and HBD-2 expression quantified by real-time PCR. As shown in Figure 6B, neither the apical or basolateral application of LOS in the presence of sCD14 and LBP caused significant induction of HBD-2 mRNA expression. In contrast, IL-β application to either or both sides of the epithelium again induced robust HBD-2 expression. These results indicate that human airway epithelia are relatively hypo-responsive to endotoxin.
MD-2 expression in human airway epithelia enhances endotoxin responsiveness Pattern recognition receptors from the family of Toll-like receptors (TLRs) play a central role in the recognition of bacterial products, including endotoxin from Gram- negative bacteria (Medzhitov et al, 2000). TLR4 is a key receptor for recognition and signaling in response to endotoxin (Medzhitov et al, 1997) and optimal responses require presentation of the bacterial product in the presence of LBP, CD 14, and MD-2 (Shimazu et al, 1999; Gioannini et al, 2003; and Abreu et al, 2001). Human airway epithelia were screened for the expression of TLR4, CD 14 and MD-2 mRNAs using RT-PCR. Alveolar macrophages served as a positive control. Figure 7 demonstrates that airway epithelia express the mRNAs for TLR4 and CD14. However, while macrophages demonstrated an MD-2 signal, no significant MD-2 transcripts were detected in airway epithelia following 35 cycles of PCR.
The apparent absence of MD-2 expression in primary cultures of human airway epithelia suggests that the failure of endotoxin to induce HBD-2 expression in these cells reflects a lack of available MD-2 and a resultant inability to form an optimal complex for TLR4-dependent signaling. To address this hypothesis, the deficiency of MD-2 in airway epithelia was circumvented by using an adenoviral vector containing the human MD-2 cDNA. To demonstrate that the Ad-MD-2 construct directed expression of functional MD-2 protein, the vector was first used to transduce parental HEK293 cells. Conditioned medium recovered from the transduced cells were then assayed for the presence of active MD-2 by measuring activation of HEK293 cells ± TLR4 by added LOS-sCD14 (the bioactive product of LBP/sCD14 treatment of LOS; (Giardina et al, 2001; Gioannini et ah, 2002; and Gioannini et ah, 2003)). As shown in Figure 8, conditioned medium from Ad-MD-2 transduced cells produced a dose- dependent augmentation of IL-8 release by HEK/TLR4 cells but not the parental (TLR4") cells, consistent with the functional expression of MD-2 by the vector.
Transduction of the human airway epithelial cells with Ad-MD-2, but not with the control Ad- vector, markedly increased the cellular levels of MD-2 mRNA. It is important to note that the Ad-MD-2 complemented epithelia exhibited markedly enhanced endotoxin responsiveness following apical application of either purified LOS + LBP and sCD14 (Figure 8A) or purified LOS: sCD14 (Figure 8C).
LOS-induced increases in HBD-2 mRNA were paralleled by increased secretion of HBD-2 peptide and increased NF-KB luciferase activity in MD-2 complemented cells (Figure 9B). In contrast, basolateral application of LOS to Ad-MD-2 complemented epithelia failed to elicit significant NF-KlB signaling or induction of HBD-2 expression (n = 2). These results indicate that the expression of MD-2 in airway epithelia confers endotoxin (LOS) responsiveness. Conversely, in the absence of MD-2, surface epithelia are relatively unresponsive to apical or basolateral endotoxin stimulation.
Extracellular complementation with recombinant MD-2 protein enhances endotoxin signaling in human airway epithelia
Genetically manipulated cells such as the HEK/TLR4+ cells have been used to show that endogenous (co-) expression of MD-2 or addition of secreted MD-2 to TLRA+MD-T cells confers increased endotoxin responsiveness. The primary cultures of human airway epithelia provide a more natural setting to test the effect of exogenous addition of recombinant MD-2 (rMD-2) on cellular responsiveness to endotoxin (i.e., LOS-sCD14). As shown in Figure 9D, addition of conditioned insect cell culture
medium containing rMD-2 increased the response of the human airway epithelial cultures to LOS-sCD14 by > 100-fold. Control conditioned medium, by contrast, had no effect.
The findings presented above indicate that MD-2 expression is the principal limiting factor for responsiveness of human airway epithelia to endotoxin. The need for MD-2 could reflect its role either in TLR-4 trafficking, posttranslational modifications and surface expression, and/or in endotoxin recognition and delivery to TLR-4. To test the latter possibility more directly, the inventors examined the responsiveness of airway epithelia to purified LOS: MD-2 complex. Figure 9 show that the apical application of 2 ng/ml (400 pM) of LOS: MD-2 produced significant activation of resting epithelia, but not of cells induced by adenoviral transduction, to express MD-2 along with TLR-4. This contrasts with effects of LOS: sCD14 that potently activated cells transduced with Ad- MD-2, but no resting cells (Figure 8C). Because cell activation by LOS: MD-2 requires expression by cells of TLR-4 without MD-2, these findings confirm that the well- differentiated primary cultures of airway epithelia express and produce TLR-4 without MD-2.
Expression of MD-2 in airway epithelia is regulated by pro-inflammatory stimuli
The demonstration that expression (or addition) of MD-2 could markedly increase the responsiveness of the airway epithelia to endotoxin prompted a search for more natural conditions in which endogenous MD-2 expression might be up-regulated. The effects of specific host or bacterial products on cellular MD-2 levels were examined. As shown in Figure 10, real-time PCR demonstrated marked increases in steady state MD-2 mRNA levels following exposure of the apical surface of the cultured airway epithelium to heat killed NTHi, the NTHi outer membrane protein P6 or the combination of TNF-α and interferon gamma. The levels of MD-2 mRNA attained under these conditions were similar to that induced by phorbol myristate acetate but still significantly less than MD-2 mRNA levels in human alveolar macrophages. These findings demonstrate that, in response to specific stimuli, levels of MD-2 transcript can be up-regulated in human airway epithelia.
Figure 10 depicts results indicating that MD-2 mRNA expression in human airway epithelia is inducible in response to several stimuli. Fold increase in MD-2 mRNA expression was quantified using real time PCR. Figure 10 represents the results
from three independent experiments on three different epithelial preparations. * indicates p < 0.05.
Materials and Methods
Reagents
Phorbol myristate acetate (PMA), human recombinant IL-I β, TNF-α and INF-γ were obtained from Sigma (St Louis, MO). Soluble CD14 (sCD14) and LPS binding protein (LBP) were provided by Xoma (US) LLC (Berkeley, CA). Lipooligosaccharide (LOS) from non-typeable Haemophilus influenzae was isolated by a mini-phenol-water extraction procedure, as previously described (Inzana et al, 1997). LOS was also isolated from Neisseria meningitidis and used as purified aggregates (LOS agg) and as monomeric L0S-sCD14 complexes as previously described (Giardina et al, 2001; and Gioannini et al., 2002). P6 from non-typeable Haemophilus influenzae was a generous gift from Dr. Timothy F. Murphy, SUNY, Buffalo. NTHi strain 12 (Frick et al, 2000) was a kind gift of Dr. D wight Look.
Cell culture
Primary cultures of human airway epithelia were prepared from trachea and bronchi by enzymatic dispersion using established methods (Karp et at, 2002). Briefly, epithelial cells were dissociated and seeded onto collagen-coated, semi-permeable membranes with a 0.4 μm pore size (Millicell-HA; surface area 0.6 cm ; Millipore Corp., Bedford, MA). Human airway epithelial cultures were maintained in Ultroser G (USG) media at 37°C, 5% CO2. Millicell inserts were placed into 24-well plastic cell culture plates (Costar, Cambridge, MA). Twenty-four hours after seeding, the mucosal medium was removed and the cells were allowed to grow at the air-liquid interface as reported previously (Karp et al., 2002). Only unpassaged, well-differentiated cultures (>2 weeks old) were used in these studies. The presence of tight junctions was confirmed by transepithelial resistance measurements using a volt-ohm meter (World Precision Instruments, Sarasota, FL; resistance >500 Ω«cm2). For each experimental protocol, the interventions were performed on the indicated number of primary culture specimens form different donors. For each individual experiment, a matched, unstimulated sample from the same specimens served as the control.
Isolation of macrophages from bronchoalveolar lavage fluid
Bronchoalveolar lavage fluid (BALF) was obtained from normal volunteers as previously reported (McCray et al., 1997). BALF was filtered through two layers of
gauze and spun down at 3500 rpm at 4°C for 5 minutes. The cell pellets were resuspended in 10 ml sterile saline and quantified using a Coulter counter.
Adenoviral vector constructs
A commercially available NF-κB-Luc plasmid (Clontech Laboratories Inc., Palo Alto,CA) was used as a template to generate a recombinant adenovirus vector (Ad-NF- κB-Luc). The fragment containing the firefly luciferase gene driven by four tandem copies of the NF -KB consensus sequence fused to a TATA-like promoter from Herpes simplex virus thymidine kinase gene was released by Kpnl and Xbal double digestion. The fragment was inserted into a promoterless adenoviral shuttle plasmid (pAd5mcspA) and Ad-NF-κB-Luc virus was generated by homologous recombination as previously described and stored in 10 mM Tris with 20% glycerol at -80 0C (Anderson et al., 2000). The particle titer of adenoviral stock was determined by A260 reading. The functional titer of the adenoviral stock was determined by plaque titering on 293 cells and expression assays for the encoded protein.
An adenoviral vector expressing human MD-2 was generated. Total RNA was isolated from human alveolar macrophages using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH). RNA was reverse transcribed to generate cDNA using superscript II reverse transcriptase (Life Technologies, Rockville, MD) following the manufacturer's protocol. PCR was employed to amplify a cDNA including the ORF of human MD-2 (Genbank ABOl 8549). The primers consisted of forward- 5'- CTTGTCGACATTTGTAAAGCTTTGGAGATATTGAA-S' (SEQ IDNO:1) and reverse- 5'-ATTGAATTCTAATTTGAATTAGGTTGGTGTAGGA-S' (SEQ ID NO:2) (Shimazu et al., 1999). The reaction was performed at 95 °C for 5 min, followed by 35 cycles at 94 °C for lmin, 60 °C for 1 min and 72 °C for 1 min. The chain reaction was elongated at 72 °C for 10 min. The fidelity of the PCR product was confirmed by DNA sequencing. The MD-2 cDNA was digested by Sail at the 5' end and EcoRI at the 3' end and then inserted into an adenoviral shuttle plasmid (pAd5cmcpA), containing the CMV promoter and Ad-MD2 virus was generated by homologous recombination. The titering and storage of the Ad-MD2 virus were identical to those described above for Ad-NF -κB-Luc. An adenoviral vector expressing the human TLR-4 cDNA was also used in these studies. The methods for the construction of this vector were published previously (Arbour et al, 2000).
Messenger RNA Analysis
Semiquantitative RT-PCR
RT-PCR was used to detect expression of TLR4, CD14 and MD-2 mRNA in human airway epithelia and alveolar macrophages. 1 μg of total RNA from each sample was reverse transcribed using random hexamer primers with Superscript (GibcoBRL). First strand cDNA was amplified by PCR. The primer set for TLR4 consisted of forward- 5'-TGAGCAGTCGTGCTGGTATC-S' (SEQ ID NO:3); reverse- 5'- CAGGGCTTTTCTGAGTCGTC-3' (SEQ ID NO:4) and amplified a product of 166 bp. The primer set for CD14 consisted of forward- 5'-CTGCAACTTCTCCGAACCTC-S' (SEQ ID NO:5) and reverse- 5'-CCAGTAGCTGAGCAGGAACC-S' (SEQ ID NO:6) and produced a cDNA fragment of 215 bp. The primer set for MD-2 included forwards' -TGTAA AGCTTTGGAGAT ATTGAA- 3' (SEQ ID NO:7) and reverse- 5'- TTTGAATTAGGTTGGTGTAGGA-3' (SEQ ID NO:8) and amplified a product of 508 bp. As a control for amplification, GAPDH was amplified in each reaction using the following primers- forward- 5'-GTCAGTGGTGGACCTGACC-S' (SEQ ID NO:9); reverse- 5'-AGGGGTCTACATGGCAACTG-S' (SEQ ID NO:10). Each reaction contained approximately 1.25 pM of the primers, 3 mM Mg^+. After an initial denaturing step (95 °C for 3 min), 35 cycles of denaturing (94 0C for 30 sec), annealing (60 °C for 30 sec), and extension (72 0C for 30 sec), followed by 5 min at 72 0C for elongation were conducted. PCR products were electrophoresed on a 2% agarose gel and visualized using ethidium bromide.
Real-time quantitative PCR for detecting HBD-2 and MD-2 Real-time PCR was employed to detect human β-defensin-2 and MD-2 and to quantify changes in expression. Real-time quantitative PCR was performed using a sequence detector (ABI PRISM 7700, Applied Biosystems, Foster City, CA) and Taqman technology (Roche Molecular Diagnostic Systems) following the manufacturer's protocols (Bustin, 2000). The primers and probes were designed using the Primer Express program (Applied Biosystems). For MD-2, the primers were- forward 5'-CAACAATATCATTCTCCTTCAAGGG -3' (SEQ ID NO:11), reverse 5'- GCATTTCTTCTGGGCTCCC-3' (SEQ ID NO:12), and probe 5'- AAAATTTTCTAAGGGAAAATACAAATGTGTTGTTGAAGC-S' (SEQ ID NO: 13). For HBD-2, the forward primer was- 5'-CCTGTTACCTGCCTTAAGAGTGGA-S' (SEQ ID NO:14), the reverse primer- 5'- ACC AC AGGTGCC AATTTGTTTA-3' (SEQ ID NO: 15), and the probe was- 5'-
CCATATGTCATCCAGTCTTTTGCCCTAGAAGG -3' (SEQ ID NO: 16). Both probes contain a fluorescent reporter (6-Carboxyfluorescein [FAM]) at the 5' end and a
fluorescent quencher (6-Carboxytetramethylrhodamine [TAMRA]) at the 3' end. As an internal control for normalization, human GAPDH real-time quantitative PCR was conducted in every reaction. The primers and probes were purchased from Roche Molecular Diagnostic Systems. The PCR fragments were amplified for 40 cycles (15 sec at 95 0C and 1 min at 60 0C).
Transduction of human airway epithelia with adenoviral expression vectors
Primary cultures of well-differentiated human airway epithelia were prepared as described herein. In vector transduction experiments, the cells were transduced with either Ad-NF-κB-Luc alone or with both Ad-NF-κB-Luc and Ad-MD-2 two days before performing experimental interventions. The vectors were formulated in 5 niM EGTA and applied to the apical surface (50 MOI) of the cells for 2 hours in a 100 μl volume as described previously to access receptors (Wang et ah, 2000). The vector solution was removed, and the cells were transferred to another multiwell culture dish with fresh culture medium. On the experimental day, LOS ± specific endotoxin-binding proteins as indicated in the individual figure legends were applied in 50 μl to the apical or basolateral side of the cells as noted. Control groups received PBS (negative control) or IL- lβ (100 ng/ml, applied apically and basolaterally as positive control). 18-24 hours later, the cells were disrupted in the IX lysis buffer provided with the luciferase assay kit (Promega) to measure luciferase activity. In addition, some samples were prepared to isolate total RNA.
HEK cell activation assay
HEK cells +/- TLR4 were obtained from Dr. Jesse Chow (Eisai Research Institute, Andover, MA) and were cultured as described (Yang et ah, 2000; and Gioannini et al, 2003). For cell activation assays, cells were grown to confluency in 48 well plates. Epithelia were washed with warm PBS 2X and incubated overnight at 37°C, 5% CO2, and 95% humidity in Hanks' balanced salts solution, 0.1% human serum albumin with the supplements indicated in the legends to Figure 8. Activation of HEK cells was assessed by measuring accumulation of extracellular IL-8 by ELISA as previously described (Denning et al, 1998).
Production of recombinant MD-2 protein
Recombinant MD-2 protein (rMD-2) was produced in baculovirus for application to airway epithelia. The human MD-2 cDNA was first sub-cloned into pGEM-T easy vector for transformation of E. coli JMl 09 and amplification. The DNA was then isolated, linearized, and inserted into pBACl 1 (using Ncol and Xhol-sensitive
restriction sites) for transfection into insect cells. A vector encoding a six-histidine ("poly-HIS") extension of the C-terminus was used. The DNA encoding MD-2 was sequenced in both directions to confirm the fidelity of the product. Sf9 cells were used for production and multiplication of virus containing pBACl 1 plasmids. To maximize recombinant protein production, High Five (Invitrogen) cells were inoculated with recombinant virus in serum-free medium, incubated 24-48 hr and culture medium then collected for analysis. The presence of recombinant MD-2-(HIS)6 was determined by SDS-PAGE and immuno-blots of the culture medium, using an anti-His4 mAb (Qiagen). The culture medium was dialyzed against sterile Hanks' balanced salts solution buffered with 10 mM HEPES, pH 7.4 and supplemented with 0.1% human serum albumin before use in bioassays.
Stimulation of airway epithelia with pro-inflammatory products Several agents were applied to human airway epithelia to investigate the regulation of MD-2 expression. PMA, TNF-α, and INF-γ were applied to the apical and basolateral surfaces at 100 ng/ml. Bacterial products including the NTHi membrane protein P6 (5 μg/ml) and heat killed NTHi (Strain 12, -100 bacteria per epithelial cell, Frick et al, 2000) were applied to the apical surface. Following an 18 - 24 hr stimulation, the cells were lysed and total RNA was extracted. Real-time PCR was conducted as described herein.
The present studies indicate that, under resting conditions, human airway . epithelia are hypo-responsive to endotoxin stimulation. This observation was confirmed using LOS from two different Gram-negative bacterial species and several different presentations of LOS, including LOS-sCD14 that is active at pg/ml concentrations toward highly endotoxin responsive cells such as monocytes, macrophages and endothelial cells (Giardina et al, 2001; Gioannini et al, 2002; and Iovine et al, 2002). However, airway epithelial cells are not generally hypo-responsive to all stimuli as shown by their robust responses to pro-inflammatory cytokines including IL- lβ.
Example 3 - Activities of Endotoxin: MD-2 Complexes
Endotoxin species with potent pro-inflammatory activity are typically hexa- acylated. That is, the lipid A region contains 6 covalently linked fatty acids, including 4 mol/mol of 3 -OH fatty acids linked directly to the di-N-acetylglucosamine backbone of lipid A and 2 mol/mol non-hydroxylated fatty acids (NFA) that are linked to two of the four 3-OH fatty acids via an ester bond with the 3-OH group. The presence of the NFA
is important for potent bioactivity of endotoxin. Either enzymatic release of the 2 NFA or disruption of the genes (htrB, msbB) encoding the two acyltransferases needed for their biosynthetic incorporation yields a tetra-acylated endotoxin derivative that lacks pro-inflammatory agonist activity and, instead, antagonizes wild-type endotoxin activity. Removal of just one of the two NFA (i.e. msbB mutant; penta-acylated endotoxin species) also typically exhibits markedly reduced agonist and partial antagonist activity toward human endotoxin-responsive cells.
Under-acylated endotoxin reacts normally with LBP, CD 14 and MD-2 to produce an endotoxin-MD-2 complex that engages TLR4 without producing the changes in TLR4 needed for receptor and cell activation. The presence of an excess of under-acylated endotoxin-MD-2 complex (e.g., tetra- or penta-acylated endotoxin) competitively inhibits the activity of a wt endotoxin-MD-2 complex.
An msbB mutant of Neisseria meningitidis serogroup B (NMB) was used to examine the effects of changes in acylation on TLR4 engagement and activation (see WO 97/19688). The parent strain was used for isolation of wild-type (wt; hexa- acylated) endotoxin (lipo-oligosaccharide; LOS). As described hereinabove in the previous Examples, metabolic labeling of the bacteria with 3H- or 14C-acetate was used to radiolabel the fatty acids of LOS during bacterial growth and de novo synthesis. Using the same methods described hereinabove in the previous Examples, production of predominantly hexa-acylated LOS by the wt strain (mol ratios of C12:0, 3-OH-12:0 and 3-OH-14:0 = 1.0/1.0/1.0) and of predominantly penta-acylated LOS by the msbB mutant strain (mol ratios = 0.5/1.0/0.9) and reaction of each LOS species with LBP, sCD14 and MD-2 to form an endotoxin-MD-2 complex (see Figs. 11 and 12 for formation and isolation of msbB LOS-sCD14 and msbB LOS-MD-2 complexes) was verified. The bioactivity of the wt and mutant endotoxin-MD-2 complexes was tested against HEK/TLR4 cells.
As shown in Figure 14, the activities of the endotoxin:MD-2 complexes differ markedly between the complex containing wt (hexa-acylated) LOS and that containing the mutant msbB (penta-acylated) LOS, with the complex containing the mutant LOS causing less cell activation. Moreover, addition of increasing amounts of the mutant msbB LOS:MD-2 complex significantly reduced cell activation by the wt LOS:MD-2 complex. Limited cell activation seen at higher doses of the msbB LOS:MD-2 complex closely resembles levels of cell activation produced by addition of these amounts of the msbB L0S:MD-2 complex alone (compare Figs. 14 and 15) indicating that the mutant
endotoxin: MD-2 complexes can efficiently compete with the wt endotoxin: MD-2 complex for interaction with cellular TLR4, and thus blunt endotoxin-induced cell activation.
Example 4 - Characterization of MD-2 Mutants
The present inventors identified and characterized an MD-2 mutant that forms a monomeric complex with endotoxin (E) that acts as a TLR4 antagonist. Potent TLR4- dependent cell activation by E depends on transfer of E from LBP to CD 14 to MD-2. MD-2 has the, dual function of binding to the extracellular domain of TLR4 and to E. By site-directed mutagenesis, structural requirements of MD-2 for TLR4 binding and cellular E responsiveness have been determined but not, directly, those for E binding. Using 3H-E:sCD14 and gel filtration chromatography, the inventors have tested wild- type (wt) and 22 MD-2 mutants (K122A, K128A, K132A, F121 A.K122A, K125A.F126A, Y131A.K132A, K128A.K130A, K55A.K58A, R68A.R69A, R90A.R91A, F121A.K122A.Y131A.K132A, D99A, N26A, N114A, Y102A.S103A, C25A, C37A, C51A, C95A, C105A, C133A, C148A) secreted by transiently transfected HEK293T cells for their ability to react with 3H-E:sCD14 (Mr~60,000) to form monomeric 3H-E:MD-2 (Mr~30,000). Seven MD-2 mutants, including K55A.K58A, R68A.R69A, K128A.K130A, K125A.F126A, K122A and C133A (but not the other six single Cys to Ala mutants) retained wt or near wt ability to produce E:MD-2. The numbering scheme for the mutants is based on Kawasaki et al., J. Immunol. 170:413 (2003). The MD-2 mutant K125A.F126A also formed E:MD-2, bound TLR4, but the mutant complex induced only ~10% as much activation (IL-8) of HEK/TLR4 cells as did wt E:MD-2 (Figure 16). In 10Ox molar excess, the mutant complex inhibited cell activation by wt E:MD-2, consistent with binding of E:MD-2K125A F126A to TLR4 without efficient receptor activation. MD-2K125A F126A alone (not complexed to E) had much less inhibitory effect, reflecting greater stability of E:MD-2 than free MD-2. Our findings show that a structural requirement of MD-2, distinct from E and TLR4 binding, is needed for activation of TLR4 by E:MD-2. This MD-2 mutant provides a useful tool for unraveling the mechanism of TLR4 activation by E and dampening TLR4 activation by E.
The inventors have also constructed the single site-specific mutants F 126 A and K125A mutants to determine whether K125 and/or F126 are functionally important. Each of these mutants reacted normally with E:sCD14 to form a monomeric E:MD-2
complex (data not shown). E:MD-2 (K125A) was at least as active as E:MD-2 (wt) in activation of HEK/TLR4 cells, as judged by induced synthesis and secretion of IL-8 (data not shown). In contrast, E:MD-2 (F 126A) produced virtually no activation of HEK/TLR4 (Fig. 17A). Moreover, addition of the E:MD-2 (F126A), in molar excess, produced a dose-dependent inhibition of cell activation by the wt complex (Fig. 17B), consistent with binding of the mutant E:MD-2 complex to TLR4, but without inducing efficient activation of TLR4. The ability of a mutant of MD-2 to confer potent TLR4 antagonist properties on an endotoxin species that is normally a potent TLR4 agonist shows that it is the properties of the E:MD-2 complex, and not that of endotoxin per se, that defines TLR4 agonist and antagonist properties. The ability to convert potent TLR4 agonists to antagonists by discrete modifications of endotoxin and/or MD-2 made it possible to test the ability of nasally administered endotoxin:MD-2 complexes (Example 6 below), depending on endotoxin or MD-2 structure, to stimulate or blunt TLR4- dependent airway inflammation.
Comparison of the inventors' findings to those previously published suggests that several other single site mutations of residues neighboring F 126 have similar properties to the F 126 A mutant. That is (as noted in Figure 18), substitution of P 127, K128, G129, H130 or Y131 with Ala in mouse MD-2 yielded an MD-2 variant that still formed a heterodimer with TLR4 on the cell surface but showed a marked defect in cellular responsiveness to endotoxin. The asterisks on the model denote other sites where mutation of wild-type residues with alanine gave a phenotype similar to that of F 126 A. Thus, of all the residues in MD-2 modified by site-specific alanine mutagenesis, less than a dozen mutants had a phenotype similar to that of F 126, suggesting specific but not unique roles of each of these residues in MD-2.
Example 5 - Preparation and Purification of Endotoxin:Md-2 Complex
The inventors used two different procedures for preparative production and purification of endotoxin:MD-2 complex. The first procedure used recombinant MD-2 expressed in insect cells, where culture conditions are somewhat more favorable for retention of secreted MD-2 in functional form before exposure to monomeric endotoxin: sCD 14 complex. The second procedure used, more analytical procedures, MD-2 expressed from mammalian cells. In the mammalian cells, formation and recovery of monomeric endotoxhr.MD-2 complex is greatly enhanced by addition of
endotoxin: sCD 14 complex to culture medium to react with MD-2 as it is being secreted.
In the first procedure, the harvested insect cell culture medium containing secreted soluble MD-2-His6 was incubated with preformed monomeric E:sCD14 for 30 min at 37 0C. Albumin (>0.3% (wt/vol) was added to maintain the solubility of E as it is being transferred from CD 14 to MD-2. This incubation can be carried out in small (<1 ml) to very large volumes (at least 1 Liter), producing in the latter case up to 1 mg monomeric E:MD-2 complex. The complex is purified from the culture medium by gel sieving chromatography and, if necessary, metal chelation (e.g., HisLink) chromatography after concentration of the culture medium containing the monomeric E:MD-2 complex by ultrafiltration.
In the second procedure, cultured mammalian cells (e.g., HEK293T cells) were transiently transfected with an expression plasmid (e.g., pEFBOS) containing cDNA encoding MD-2, the medium washed after 16-24 h and fresh serum-free medium, supplemented with 3H-LOS:sCD14 (5-10 ng LOS/ml) and 0.03% albumin. The medium was harvested after 24-48 h, concentrated by ultrafiltration and 3H-LOS :MD-2 purified as described above.
The present methods of making E/MD-2 complex take advantage of the much more favorable physico-chemical properties of the complex as compared to that of either endotoxin or MD-2 alone. The expression and secretion of MD-2 in insect cells is advantageous because culturing is done at lower temperature (e.g., 27°C) than that used for mammalian cell cultures (37°C). Consequently, the secreted MD-2 suffers less temperature-dependent loss of activity. This problem has been bypassed by spiking monomeric endotoxin: sCD 14 into the culture medium at the time of peak MD-2 secretion, taking advantage of the very fast transfer of E from sCD14 to MD-2 and the much greater stability of E:MD-2 in comparison to MD-2 alone. The inventors have recovered the E:MD-2 complex from the culture medium after 24 to 48 h at 37°C and it still has full bioactivity. Agonist versus antagonist properties of endotoxin variants (e.g., differing in degree of acylation) are mirrored by the properties of the respective E:MD-2 complexes.
Example 6 -In Vivo Testing of E:MD-2 Complex
The present inventors have also performed in vivo testing showing potent proinflammatory activity of nasally instilled E:MD-2. The inventors performed
experiments in mice to assess the ability of nasally administered purified wt E:MD-2 complex as compared to the same E added as purified endotoxin aggregates to induce airway inflammation. As shown in Fig. 19, the monomeric E:MD-2 complex was at least ten times more potent than the E aggregates (without MD-2), as judged by induction of airway accumulation of neutrophils. This supports the observation that E:MD-2 complex has special properties not associated with E or MD-2 alone. The potency of the instilled E:human MD-2 complex was consistent with prior in vitro observations indicating that potent endotoxin-induced TLR4 activation or inactivation (antagonism) is possible with combinations of murine TLR4 with either murine or human MD-2. These findings also confirm that, as predicted by the properties of primary cultures of these cells, conducting airway epithelia express on their luminal surface TLR4 without MD-2, rendering these cells directly responsive to instilled wt E:MD-2. This experiment also demonstrated that E:MD-2 could effectively be administered by airway instillation.
While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
AU publications, patents and patent applications cited herein are herein incorporated by reference.
Documents Cited
WO 94/07529
WO 97/19688
U.S. Patent No. 4,962,091
U.S. Patent No. 4,624,251
U.S. Patent No. 3,703,173
U.S. Patent No. 3,561,444
U.S. Patent No. 4,635,627
Abreu et al., 2001. J Immunol 167; 1609.
Abreu et al., 2002. J Biol Chem 277; 20431.
Akashi et al., J Immunol 164,3471-5. (2000).
Akashi et al., 2003. J Exp Med 198,1035-42.
Altschul et al., JMB5 215: 403 (1990).
Altschul et al., Nucl. Acids Res. , 25: 3389 (1997).
Anderson et al., 2000. Gene Ther 7; 1034.
Anderson, Curr Opin Immunol 12,13-9. (2000).
Arbour et al., 2000. Nat Genet 25; 187.
BaIs et al., 1998. J Clin Invest 102; 874.
Bandi et al., '2001. Am J Respir Crit Care Med 164; 2114.
Becker et al., 2000. J Biol Chem 275; 29731.
Beutler et al., Crit Care Med 29, S2-7. (2001).
Beutler et al., 2003. Nat Rev Immunol 3,169.
Bustin, 2000. J MoI Endocrinol 25; 169.
Corpet et al., Nucl. Acids Res. , 16: 10881 (1988). da Silva et al., J Biol Chem 26,26 (2001).
Denning et al., Infect Immun 66,5777-84. (1998).
Douwes et al., 2003. Biological agents-recognition. In Modern Industrial Hygiene, Vol.
2. J. L. Perkins, ed. ACGIH, Cincinnati.
Prick et al., 2000. J Immunol 164; 4185.
Ganz, 2002. J Clin Invest 109; 693.
Garcia et al., 2001. FASEB J. 15; 1819.
Giardina et al., J Biol Chem 276,5883-91. (2001).
Gioarmini et al., 2002. J Biol Chem 277; 47818.
Gioaήnini et al., 2004. Proc Natl Acad Sci U S A. 101 (12): 4186-91.
Gioarmini et al., Journal of Endotoxin Research. In press (2003).
Gottar et al., 2002. Nature 24; 24.
Hailman et al., 1994. J Exp Med 179,269-77.
Harder et al., 1997. Nature 387 ; 861.
Harder et al., 2000. Am J Respir Cell MoI Biol 22; 714.
Harder et al., 2001. J Biol Chem 276; 5707.
Higgins et al., Gene, 73: 237 (1988) Higgins et al., CABIOS5 5 : 151 (1989).
Hoffmann et al., 1999. Science 284; 1313.
Huang et al., CABIOS, 8: 155 (1992).
Inzana et al., 1997. Infect Immun 65; 4675. lovine et al., J Biol Chem 277,7970- 8. (2002).
Janeway et al., 2002. Annu Rev Immunol 20; 197.
Jia et al., 2001. Gene 263; 211.
Jia et al., 2004. Am J Physiol Lung Cell MoI Physio. 287 (2): L428-37.
Jiang et al., J hnmunol 165,3541-4. (2000).
Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87 : 2264 (1990).
Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90: 5873 (1993).
Karp et al,, 2002. Methods MoI Biol 188; 115.
Kawasaki et al., J Endotoxin Res 7,232-6 (2001).
Kawasaki et al., J Immuns 170,413-20 (2003).
Lamping et al., J ClinLivest 101,2065-71 (1998).
Latz et al., 2002. J Biol Chem. 277, 47834.
Lemaitre et al., 1996. Cell 86,973.
Lehninger, A. Biochemistry (2d ed. , 1975), p. 73-75.
Lerman et al., 1979. Pediatrics 64; 287.
Liu et al., 1998. Gene 222 ; 237.
Malley et al., 2003. Proc Natl Acad Sci U S A 100; 1966.
Mathews et al., 1999. Infect Immun 67; 2740.
McCray et al., 1997. Am J Respir Cell MoI Biol 16; 343.
McCray et al., 1997. Hum. Gene Ther. 8; 1087.
McNamara et al., 1999. Exp Eye Res 69; 483.
Means et al., Cytokine Growth Factor Rev 11, 219-32. (2000).
Medzhitov et al., 1997. Nature 388; 394.
Medzhitov et al., Curr Opin Immunol 10,12-5. (1998).
Medzhitov et al., 2000. Immunol Rev 173; 89.
Meinkoth and Wahl, Anal. Biochem. , 138: 267 (1984).
Miyake, Int Immunopharmacor3, 119-28 (2003).
Mueller-Anneling et al., 2004. Environ Health Perspect. 112 (5): 5 83-8.
Mullen et al., 2003. Proc Natl Acad Sci U S A 100, 3919-24.
Munford et al., 1992. J Immunol Methods 148,115-20.
Muroi et al., 2002. J Biol Chem 277,42372-9.
Muroi et al., Infect Immun 70,3546-50 (2002).
Myers and Miller, CABIOS, 4: 11 (1988).
Nagai et al., Nat Immunol 3,667-72 (2002).
Needleman and Wunsch, JMB, 48 : 443 (1970).
Newman, S. P. in Aerosols and the Lung, Clarke, S. W. and Davia, D. eds. , pp. 197-224, Butterworths, London, England, 1984 Ohnishi et al, J Immunol 167, 3354-9. (2001).
O1NdI et al., 1999. J Immunol 163; 6718.
Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85: 2444 (1988).
Pearson et al., Meth. MoI. Biol. , 24: 307 (1994).
Re et al., J Biol Chem 277,23427-32 (2002).
Re et al., Journal of Immunology, 171,5272-5276 (2003).
Reynolds, 1997. Integrated host defense against infections. In The Lung. R. G. Crystal, J.
B. West, E. R. Weibel, and P. J. Barnes, eds. Raven Press, Ltd. , New York, NY, p. 2353.
Sambrook et al., Molecular Cloning : A Laboratory Manual, 3rd Ed. , Cold Spring Harbor Laboratory Press, (2001).
Schroder et al., 1999. Int J Biochem Cell Biol 31 ; 645.
Schramm et al., J Exp Med 194,79-88. (2001).
Schutt, Int J Biochem Cell Biol 31,545-9 (1999).
Schutte et al., 2002. Annu Rev Physiol 64; 709.
Schutte et al., 2002. Proc Natl Acad Sci 99; 2129.
Shimazu et al., J Exp Med 189, 1777-82. (1999).
Singh et al., 1998. Proc Natl Acad Sci USA 95; 14961.
Smith et al., 1989. Acta Paediatr Scand Suppl 363; 31.
Smith et al., Adv. Appl. Math. , 2: 482 (1981).
Stryer, L. Biochemistry (2d ed. ) W. H. Freeman and Co. San Francisco (1981), p. 14-15.
Takeda et al., 2003. Cell Microbiol 5,143-53.
Tapping et al., 1997. J Biol Chem 272,23157-64.
Tauszig et al., 2000. Proc Natl Acad Sci U S A 97; 10520.
Thomas et al., 2002. FEBS Lett 531,184-8.
Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes, part I chapter 2"Overview of principles of hybridization and the strategy of nucleic acid probe assays "Elsevier, New York (1993).
Tsutsumi-Ishii et al., 2003. J Immunol 170; 4226.
Ulevitch, Immunol Res 21,49-54. (2000).
Ulevitch et al., 1999. Curr Opin Immunol 11,19-22. Viriyakosol et al.. J Biol Chem 276, 38044-38051. (2001). Visintin et al., Proc Natl Acad Sci U S A 98, 12156-61 (2001). Visintin et al., 2003. "Lysines 128 and 132 Enable LPS Binding to MD-2, Leading to Toll-like Receptor 4 Aggregation and Signal Transduction. , J Biol Chem. Wang et al., 2000. Am J Respir Cell MoI Biol 22; 129. Wang et al., 2002. J Immunol 168 ; 810. Weiss, Biochemical Society Transactions (2003). Yang et al., J Biol Chem 275,20861-6. (2000). Yu et al., 1996. J Biol Chem 271,4100-5. Zasloff, 2002. Nature 415; 389.
Claims
1. A purified complex comprising endotoxin bound to a modified MD-2, wherein the modified MD-2 comprises a variation from wild-type MD-2 at amino acid 68, 69, 126, 127, 128, 129, 130, and/or 131.
2. The complex of claim 1 , wherein the variation is an amino acid substitution.
3. The complex of claim 2, wherein the substitution is a conserved substitution.
4. The complex of claim 2, wherein the substitution is an alanine.
5. The complex of claim 1, wherein the endotoxin is a wild-type endotoxin.
6. The complex of claim 1, wherein the endotoxin is a gram-negative bacterial endotoxin.
7. The complex of claim 1 , wherein one molecule of endotoxin is bound to one molecule of MD-2.
8. The complex of claim 1, wherein the complex is soluble in water.
9. The complex of claim 1, wherein the complex binds to TLR4.
10. The complex of claim 1 , wherein the complex produces TLR4-dependent activation of cells.
11. The complex of claim 10, wherein the complex produces a half maximal TLR4-dependent activation of cells at a concentration of less than 1 nM of the complex.
12. The complex of claim 10, wherein the complex produces a half maximal TLR4-dependent activation of cells at a concentration of about 30 pM or less of the complex.
13. The complex of claim 1, wherein the endotoxin is hexa-acylated.
14. The complex of claim 1, wherein the endotoxin is an under-acylated endotoxin.
15. The complex of claim 14, wherein the endotoxin is a tetra-acylated endotoxin.
16. The complex of claim 14, wherein the endotoxin is a penta-acylated endotoxin.
17. The complex of claim 1, wherein the complex produces less TLR4- dependent activation of cells as compared to a complex comprising an endotoxin that is hexa-acylated.
18. A composition comprising the complex of claim 1.
19. The composition of claim 18, further comprising a pharmaceutically acceptable carrier.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2006/007188 WO2007106072A2 (en) | 2006-03-01 | 2006-03-01 | Isolated complexes of endotoxin and modified md-2 |
| US12/201,736 US8088396B2 (en) | 2006-03-01 | 2008-08-29 | Isolated complexes of endotoxin and modified MD-2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2006/007188 WO2007106072A2 (en) | 2006-03-01 | 2006-03-01 | Isolated complexes of endotoxin and modified md-2 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007106072A2 true WO2007106072A2 (en) | 2007-09-20 |
| WO2007106072A3 WO2007106072A3 (en) | 2008-10-09 |
Family
ID=38509913
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/007188 Ceased WO2007106072A2 (en) | 2006-03-01 | 2006-03-01 | Isolated complexes of endotoxin and modified md-2 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2007106072A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8137682B2 (en) | 2006-09-20 | 2012-03-20 | University Of Iowa Research Foundation | Isolated complexes of covalently cross-linked endotoxin and modified MD-2 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7164008B2 (en) * | 2003-11-17 | 2007-01-16 | University Of Iowa Research Foundation | Isolated complexes of endotoxin and MD-2 |
-
2006
- 2006-03-01 WO PCT/US2006/007188 patent/WO2007106072A2/en not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8137682B2 (en) | 2006-09-20 | 2012-03-20 | University Of Iowa Research Foundation | Isolated complexes of covalently cross-linked endotoxin and modified MD-2 |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007106072A3 (en) | 2008-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rustici et al. | Molecular mapping and detoxification of the lipid A binding site by synthetic peptides | |
| JP3797490B2 (en) | Isolated FrpB nucleic acid molecules and vaccines | |
| AU2009217425B2 (en) | Vaccine | |
| US8088396B2 (en) | Isolated complexes of endotoxin and modified MD-2 | |
| US7164008B2 (en) | Isolated complexes of endotoxin and MD-2 | |
| US8137682B2 (en) | Isolated complexes of covalently cross-linked endotoxin and modified MD-2 | |
| US12048740B2 (en) | Transcutaneous dosage formulation | |
| WO2007106072A2 (en) | Isolated complexes of endotoxin and modified md-2 | |
| US20140286977A1 (en) | Protein F - A Novel Haemophilus Influenzae Adhesin with Laminin and Vitronectin binding Properties | |
| PL194800B1 (en) | Neisseria meningitidis LbpB protein coding polynucleotides, protein fragment or a protein featuring specific sameness with the Neisseria meningitidis LbpB protein, a host cell containing such polynucleotide and method for its production, methods for the p | |
| US20060257961A1 (en) | Sialic acid permease system | |
| JP2005532789A (en) | P4 protein variant of non-typeable Haemophilus influenzae with reduced enzymatic activity | |
| JP2003506044A (en) | BASB118 polypeptides and polynucleotides from Moraxella catarrhalis | |
| JP2003506027A (en) | Moraxella catarrhalis BASB114 antigen and uses thereof | |
| JP2003506043A (en) | New compound | |
| JP2003506045A (en) | BASB119 polypeptides and polynucleotides from Moraxella catarrhalis | |
| Faggioni et al. | Molecular and detoxification of lipid A binding site by synthetic peptides | |
| WO2000050599A1 (en) | Haemophilus antigen | |
| JP2003503058A (en) | BASB111 polypeptides and polynucleotides from Moraxella catarrhalis | |
| JP2003511013A (en) | BASB132 polypeptides and polynucleotides from Moraxella catarrhalis | |
| JPH10313882A (en) | Lic a |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 06849725 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 06849725 Country of ref document: EP Kind code of ref document: A2 |

