WO2007103515A2 - Unstructured recombinant polymers and uses thereof - Google Patents
Unstructured recombinant polymers and uses thereof Download PDFInfo
- Publication number
- WO2007103515A2 WO2007103515A2 PCT/US2007/005952 US2007005952W WO2007103515A2 WO 2007103515 A2 WO2007103515 A2 WO 2007103515A2 US 2007005952 W US2007005952 W US 2007005952W WO 2007103515 A2 WO2007103515 A2 WO 2007103515A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- urp
- amino acids
- sequences
- binding
- Prior art date
Links
- 0 CCCCCCCCCCC(C(C)*)[C@](CCC)C1CC*CC1 Chemical compound CCCCCCCCCCC(C(C)*)[C@](CCC)C1CC*CC1 0.000 description 3
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1044—Preparation or screening of libraries displayed on scaffold proteins
Definitions
- polymer-modified proteins are in clinical trials. These polymers exert their effect by increasing the hydrodynamic radius (also called Stokes' radius) of the modified protein relative to the unmodified protein, which reduces the rate of clearance by kidney filtration (Yang, K., et al. (2003) Protein Eng, 16: 761-70).
- polymer attachment can reduce interaction of the modified protein with other proteins, cells, or surfaces.
- polymer attachment can reduce interactions between the modified protein and antibodies and other components of the immune system thus reducing the formation of a host immune response to the modified protein.
- protein modification by PEGylation i.e. by attaching linear or branched polymers of polyethylene glycol.
- Protein Pept Lett, 11: 353-60 are conjugated with the protein of interest via a chemical modification step after the unmodified protein has been purified.
- polymers can be attached to proteins.
- hydrophilic polymers that have flexible conformations and are well hydrated in aqueous solutions.
- a frequently used polymer is polyethylene glycol (PEG).
- PEG polyethylene glycol
- the attached polymers tend to have limited interactions with the protein they have been attached to and thus the polymer-modified protein retains its relevant functions.
- the chemical conjugation of polymers to proteins requires complex multi-step processes. Typically, the protein component needs to be produced and purified prior to the chemical conjugation step.
- the conjugation step can result in the formation of product mixtures that need to be separated leading to significant product loss.
- such mixtures can be used as the final pharmaceutical product.
- Some examples are currently marketed PEGylated Interferon-alpha products that are used as mixtures (Wang, B. L., et al. (1998) JSubmicrosc Cytol Pathol, 30: 503-9; Dhalluin, C, et al. (2005) Bioconjug Chem, 16: 504-17).
- -Such mixtures are difficult to manufacture and characterize and they contain isomers with reduced or no therapeutic activity. [0005] Methods have been described that allow the site-specific addition of polymers like PEG.
- Examples are the selective PEGylation at a unique glycosylation site of the target protein or the selective PEGylation of a non-natural amino acid that has been engineered into the target proteins.
- PEGylation of target proteins is the introduction of cysteine residues that allow selective conjugation. All these methods have significant limitations.
- the selective PEGylation of the N-terminus requires careful process control and side reactions are difficult to eliminate.
- the introduction of cysteines for PEGylation can interfere with protein production and/or purification.
- the specific introduction of non-natural amino acids requires specific host organisms for protein production.
- a further limitation of PEGylation is that
- PEG is typically manufactured as a mixture of polymers with similar but not uniform length. The same limitations are inherent in many other chemical polymers.
- the present invention provides an unstructured recombinant polymer (URP) comprising at least 40 contiguous amino acids, wherein said URP is substantially incapable of non-specific binding to a serum protein, and wherein (a) the sum of glycine (G), aspartate (D), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) residues contained in the URP, constitutes more than about 80% of the total amino acids of the URP; and/or (b) at least 50% of the amino acids are devoid of secondary structure as determined by Chou-Fasman algorithm.
- URP unstructured recombinant polymer
- the present invention provides an unstructured recombinant polymer (URP) comprising at least 40 contiguous amino acids, wherein said URP has an in vitro serum degradation half-life greater than about 24 hours, and wherein (a) the sum of glycine (G), aspartate (D), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) residues contained in the URP, constitutes more than about 80% of the total amino acids of the URP; and/or (b) at least 50% of the amino acids are devoid of secondary structure as determined by Chou-Fasman algorithm.
- the subject URP can comprises a non-natural amino acid sequence.
- the URP is selected for incorporation into a heterologous protein, and wherein upon incorporation the URP into a heterologous protein, said heterologous protein exhibits a longer serum secretion half-life and/or higher solubility as compared to the corresponding protein that is deficient in said URP.
- the half-life can be extended by two folds, three folds, five folds, ten folds or more.
- incorporation of the URP into a heterologous protein results in at least a 2-fold, 3-fold, 4-fold, 5-fold or more increase in apparent molecular weight of the protein as approximated by size exclusion chromatography.
- the URPs has a Tepitope score less than -3.5 (e.g., -4 or less, -5 or less).
- the URPs can contain predominantly hydrophilic residues.
- at least 50% of the amino acids of the URP are devoid of secondary structure as determined by Chou-Fasman algorithm.
- the glycine residues contained in the URP may constitute at least about 50% of the total amino acids of the URP.
- any one type of the amino acids alone selected from the group consisting of glycine (G), aspartate (D), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) contained in the URP constitutes more than about
- the URP comprises more than about 100, 150, 200 or more contiguous amino acids.
- the present invention also provides a protein comprising one or more of the subject URPs, wherein the subject URPs are heterologous with respect to the protein.
- the total length of URPs in aggregation can • exceed about 40, 50, 60, 100, 150, 200, or more amino acids.
- the protein can comprise one or more functional modules selected from the group consisting of effector module, binding module, N-terminal module, C-terminal module, and any combinations thereof.
- the subject protein comprises a plurality of binding modules, wherein the individual binding modules exhibit binding specificities to the same or different targets.
- the binding module may comprise a disulf ⁇ de-containing scaffold formed by intra-scaffold pairing of cysteines.
- the binding module may bind to a target molecule target is selected from the group consisting of cell surface protein, secreted protein, cytosolic protein, and nuclear protein.
- the target can be an ion channel and/or GPCR.
- the effector module can be a toxin.
- the subject URP-containing protein typically an extended serum secretion half-life by at least 2, 3, 4, 5, 10 or more folds as compared to a corresponding protein that is deficient in said URP.
- the present invention provides a non-naturally occurring protein comprising at least 3 repeating units of amino acid sequences, each of the repeating unit comprising at least 6 amino acids, wherein the majority of segments comprising about 6 to about 15 contiguous amino acids of the at least 3 repeating units are present in one or more native human proteins.
- the majority of the segments, or each segment comprising about 9 to about 15 contiguous amino acids within the repeating units are present in one or more native human proteins.
- the segments can comprise about 9 to about 15 amino acids.
- the three repeating units may share substantial sequence homology, e.g., share sequence identify of greater than about 50%, 60%, 70%, 80%, 90% or 100% when aligned.
- non-natural protein may also comprise one or more modules selected from the group consisting of binding modules, effector modules, multimerization modules, C-terminal modules, and N-terminal modules.
- the non- natural protein may comprise individual repeating unit having the subject unstructured recombinant polymer (URP).
- the present invention also provides recombinant polynucleotides comprising coding sequences that encode the subject URPs, URP-containing proteins, microproteins and toxins. Also provided in the present invention are vectors containing the subject polynucleotides, host cells harboring the vectors, genetic packages displaying the subject URPs, URP-containing proteins, toxins and any other proteinaceous entities disclosed herein. Further provided are selectable library of expression vectors of the present invention. ⁇ (0013] The present invention also provides method of producing a protein comprising an unstructured recombinant polymer (URP).
- URP unstructured recombinant polymer
- the method involves (i) providing a host cell comprising a recombinant polynucleotide encoding the protein, said protein comprising one or more URP, said URP comprising at least 40 contiguous amino acids, wherein said URP is substantially incapable of non-specific binding to a serum protein, and wherein (a) the sum of glycine (G), aspartate (D), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) residues contained in the URP, constitutes more than about 80% of the total amino acids of the URP; and/or (b) at least 50% of the amino acids are devoid of secondary structure as determined by Chou-Fasman algorithm; and (ii) culturing said host cell in a suitable culture medium under conditions to effect expression of said protein from said polynucleotide.
- Suitable host cells are eukaryotic (e.g., CHO cells) and prokaryotic cells.
- the present invention also provides a method of increasing serum secretion half-life of a protein, comprising: fusing said protein with one or more unstructured recombinant polymers (URPs), wherein the URP comprises at least about 40 contiguous amino acids, and wherein (a) the sum of glycine (G), aspartate (D), alanine (A) 7 serine (S), threonine (T), glutamate (E) and proline (P) residues contained in the URP, constitutes more than about 80% of the total amino acids of the URP; and/or (b) at least 50% of the amino acids are devoid of secondary structure as determined by Chou-Fasman algorithm; and wherein said URP is substantially incapable of non-specific binding to a serum protein.
- URPs unstructured recombinant polymers
- Also provided in the present invention is a method of detecting the presence or absence of a specific interaction between a target and an exogenous protein that is displayed on a genetic package, wherein said protein comprises one or more unstructured recombinant polymer (URP), the method comprising: (a) providing a genetic package displaying a protein that comprises one or more unstructured recombinant polymers (URPs); (b) contacting the genetic package with the target under conditions suitable to produce a stable protein-target complex; and (c) detecting the formation of the stable protein-target complex on the genetic package, thereby detecting the presence of a specific interaction.
- the method may further comprises obtaining a nucleotide sequence from the genetic package that encodes the exogenous protein.
- the presence or absence of a specific interaction is between the URP and a target comprising a serum protein. In some aspects, the presence or absence of a specific interaction is between the URP and a target comprising a serum protease.
- a genetic package displaying a microprotein, wherein said microprotein retains binding capability to its native target. In some aspects, the microprotein exhibits binding capability towards at least one family of ion channel selected from the group consisting of a sodium, a potassium, a calcium, an acetylcholine, and a chlorine channel.
- the microprotein is an ion-channel-binding microprotein, and is modified such that (a) the microprotein binds to a different family of channel as compared to the corresponding unmodified microprotein; (b) the microprotein binds to a different subfamily of the same channel family as compared to the corresponding unmodified microprotein; (c) the microprotein binds to a different species of the same subfamily of channel as compared to the corresponding unmodified microprotein; (d) the microprotein binds to a different site on the same channel as compared to the corresponding unmodified microprotein; and/or (e) the microprotein binds to the same site of the same channel but yield a different biological effect as compared to the corresponding unmodified microprotein.
- the microprotein is a toxin.
- the present invention also provides a library of genetic packages displaying the subject microproteins and/or toxins. Where desired, the genetic package displays a proteinaceous toxin that retains in part or in whole its toxicity spectrum.
- the toxin cna be derived from a single toxin protein, or derived from a family of toxins.
- the present invention also provides a library of genetic packages wherein the library displays a family of toxins, wherein the family retains in part or in whole its native toxicity spectrum.
- the present invention further provides a protein comprising a plurality of ion-channel binding domains, wherein individual domains are microprotein domains that have been modified such that (a) the microprotein domains bind to a different family of channel as compared to the corresponding unmodified microprotein domains; (b) the microprotein domains bind to a different subfamily of the same channel family as compared to the corresponding unmodified microprotein domains; (c) the microprotein domains bind to a different species of the same subfamily as compared to the corresponding unmodified microprotein domains; (d) the microprotein domains bind to a different site on the same channel as compared to the corresponding unmodified microprotein domains; (e) the microprotein domains bind to the same site of the same channel but yield a different biological effect as compared to the corresponding unmodified microprotein domains; and/or (f) the microprotein domains bind to the same site of the same channel and yield the same biological effect as compared to the corresponding corresponding
- [OOIS] Also embodied in the invention is a method of obtaining a microprotein with desired property, comprising: (a) providing a subject library; and (b) screening the selectable library to obtain at least one phage displaying a microprotein with the desired property.
- Polynucleotides, vectors, genetic packages, host cells for use in any one of the disclosed methods are also provided.
- FIG. 1 shows the modular components of an MURP. Binding modules, effector modules, and multimerization modules are depicted as circles. URP modules, N-terminal, and C-terminal modules are shown as rectangles. [0022] FTG. 2 shows examples of modular achitectures of MURPs. Binding modules (BM) in one MURP can have identical or differing target specificities.
- FIG. 3 shows that a repeat protein that is based on a human sequence can contain novel amino acid sequences, which can contain T cell epitopes. These novel sequences are formed at the junction between neighboring repeat units.
- FIG.4 illustrates the design of a URP sequence that is a repeat protein based on three human donor sequences Dl, D2, and D3. The repeating unit of this URP was chosen such that even 9-m ⁇ r sequences that span the junction between neighboring units can be found in at least one of the human donor sequences.
- FIG. 5 Example of a URP sequences that is a repeat protein based on the sequences of three human proteins. The lower portion of the figure illustrates that all 9-mer subsequences in the URP occur in at least one of the human donor proteins.
- FIG. 6 Example based URP sequence based on the human POU domain residues 146-182.
- FIG. 7 shows the advantage of separating modules with information rich sequences by inserting URP modules between such sequences.
- the left side of the figure shows that the direct fusion of modules A and B leads to novel sequences in the junction region. These junction sequences can be epitopes.
- the right half of the figure shows that the insertion of a URP module between module A and B prevents the formation of such junction sequences that contain partial sequences from modules A and B. Instead, the termini of modules A and B yield junction sequences that contain URP sequences and thus are predicted to have low immunogenicity.
- FIG. 8 shows drug delivery constructs that are based on URPs.
- the drug molecules depicted as hexagons are chemically conjugated to the MURP.
- FIG. 9 shows and MURP containing a protease-sensitive site.
- the URP module is designed such that it blocks the effector module from its function. Protease cleavage removes a portion of the URP module and results in increased activity of the effector function.
- FIG. 10 shows how an URP module can act as a linker between a binding module and an effector module.
- the binding module can bind to a target and as a consequence it increases the local concentration of the effector module in the proximity of the target.
- FIG. 11 Shows a process to construct genes encoding URP sequences from libraries of short URP modules.
- the URP module library can be inserted into a staffer vector that contains green fluorescent protein (GFP) as a reporter to facilitate the identification of URP sequences with high expression.
- GFP green fluorescent protein
- FIG. 12 shows MURPs that contain multiple binding modules for death receptors. Death receptors are triggered by trimerization and thus MURPs containing at least three binding elements for one death receptor particularly potent in inducing cell death. The lower portion of the figure illustrates that one can increase the specificity of the MURP for diseased tissue by adding one or more binding modules with specificity for tumor tissue.
- FIG. 13 shows a MURP that comprises four binding modules (rectangles) with specificity for a tumor antigen with an effector module like interleukin 2.
- FIG. 14 shows the flow chart for the construction of URP modules with 288 residues.
- the URP modules were constructed as fusion proteins with GFP. Libraries of URP modules with 36 amino acids were constructed first followed by iterative dimerization to yield URP modules with 288 amino acids (rPEG_H288 and rPEG_J288).
- FIG. 15 Amino acid and nucleotide sequence of a URP module with 288 amino acids (rPEG_J288).
- FIG. 16 Amino acid and nucleotide sequence of a URP module with 288 amino acids (rPEG_H288).
- FIG. 17 Amino acid sequence of a serine-rich sequence region of the human protein dentin sialophosphoprotein.
- FIG. 18 shows a depot derivative of a MURP.
- the protein contains two cysteine residues that can form a weak SS bridge.
- the protein can be manufactured with the SS bridge intact. It can be formulated and injected into patients in reduced form. After injection it will be oxidized in proximity to the injection site and as a result in can form a high molecular weight polymer with very limited diffusivity.
- the active MURP can slowly leach from the injection site by limited proteolysis or limited reduction of the cross linking SS bond.
- FIG. 19 shows a depot form of a MURP.
- the MURP has very limited diffusivity at the injection site and can be liberated from the injection site by limited proteolysis.
- FIG. 20 shows a depot form of a MURP that contains a histidine-rich sequence.
- the MURP can be formulated and injected in combination with insoluble beads that contain immobilized nickel.
- the MURP binds to the nickel beads at the injection site and is released slowly into the circulalio ⁇ .
- FIG. 21 shows MURPs that contain multimerization modules. The upper part of the figure shows an
- MURP that contains one dimerization sequence. As a result it forms a dimer which effectively doubles its molecular weight
- the center of the figure shows three MURP designs that comprise two multimerization sequences. Such MURPs can form multimers with very high effective molecular weight.
- FIG. 22 Shows a variety of MURPs that are designed to block or modulate ion channel function. Circles indicate binding modules with specificity for ion channels. These binding modules can be derived or identical to natural toxins with affinity for ion channel receptors. The figure illustrates that other binding domains can be added on either side of the ion channel-specific binding modules thus conferring the MURPs increased efficacy or specificity for a particular cell type.
- FIG. 23 shows several MURP designs for increased half-life. Increased effective molecular weight can be achieved by increasing chain length (A), chemical multimerization (B), adding multiple copies of binding modules into a molecule separated by non-binding sites (C), construction of chemical multimers similar to C (D, E), including multimerization sequences (F).
- FIG. 24 shows MURPs that can be formed by chemical conjugation of binding modules to a recombinant
- FIG. 25 shows the design of a library of 2SS binding modules. The sequences contain a constant ISS sequence in the center which is flanked by random sequences that contain cysteine residues in varying distance from the 1 SS core.
- FIG. 26 shows the design of a library of 2SS binding modules.
- the sequences contain a constant ISS sequence in the center which is flanked by random sequences that contain cysteine residues in varying distance from the ISS core.
- FIG.27 shows the design of a library of dimers of ISS binding modules. Initially, a collection of ISS binding modules is amplified by two PCR reactions. The resulting PCR products are combined and dimers are generated in a subsequent PCR step.
- FIG. 28 show the Western analysis of a fusion protein containing the 288 amino acid URP sequence rPEG_J288 after incubation of up to 3 days in 50% mouse serum.
- FIG. 29 shows results of a binding assay testing for pre-existing antibodies against a URP sequence of 288 amino acids.
- FIG. 30 shows the binding of MURPs containing one (Monomer), two (Dimer), four (Tetramer), or zero
- FIG. 31 show sthe amino acid sequence of an MURP with specificity for EpCAM.
- the sequence contains four binding modules with affinity for EpCAM (underlined).
- the sequence contains an N-terminal Flag sequence which contains the only two lysine residues of the entire sequence.
- FIG. 32 shows the design of ISS addition libraries. Random ISS modules can be added to the N- or C- terminus of a pre-selected binding module or simultaneously to both sides.
- FIG. 33 shows the alignment of three finger toxin-related sequences. The figure also shows a 3D structure that was solved by NMR.
- FIG. 34 shows the design of a three-finger toxin-based library. Residues designated X were randomized.
- FIG. 35 shows the alignment of plexin-related sequences.
- FIG. 36 shows the design of a plexin-based library. Residues designated X were randomized. The codon
- FIG. 37 Sequences of plexin-related binding modules with sepecificity for DR4, ErbB2, and HGFR.
- FIG. 38 shows a binding assay for microprotein-based binding domains with specificity for VEGF.
- FIG. 39 shows sequences of 2SS and 3SS binding modules that were isolated from buildup libraries with specificity for VEGF. The upper part of the protein shows PAGE gel analysis of the proteins purified by heat-lysis.
- FIG. 40 shows cloning steps to construct the URP sequence rPEG_J72.
- FIG. 41 shows the construction of a library of URP modules with 36 amino acids called rPEG_J36.
- the region encoding rPEG_J36 was assembled by ligating three shorter segments encoding rPEG_J12 and a stopper module.
- FIG. 42 shows the nucleotide sequence and translation of the stuffer vector pCW0051.
- the stuffer region is flanked by Bsal and Bbsl sites and contains multiple stop codons.
- FIG. 43 shows a PAGE gel of the purification of the URP rPEG_J288 fused to GFP.
- Lane 2 shows the cell lysate; lane 3: product purified by IMAC; lane 4: product purified by anti-Flag.
- FIG. 44 Amino acid sequence of fusion proteins between rPEG_J288 and human effector domains interferon alpha, G-CSF, and human growth hormone.
- FIG. 45 shows the Western analysis of expression of fusion proteins between rPEG_J28S and human growth hormone (lanes 1 and 2), interferon alpha (lanes 3 and 4), and GFP (lanes 5 and 6). Both soluble and insoluble material was analyzed for each protein.
- FIG. 46 shows the design of MURPs based on the toxin OSKl. The figure shows that URP sequences and/or binding modules can be added to either side of OSKl.
- FIG 47 depicts exemplary product formats comprising the subjet URPs.
- polypeptide polypeptide
- peptide amino acid sequence
- protein protein
- polymers of amino acids of any length may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.
- amino acid refers to either natural and/or unnatural or synthetic amino acids, including but not limited to glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics. Standard single or three letter codes are used to designate amino acids.
- a ⁇ epetitive sequence refers to an amino acid sequence that can be described as an oligomer of repeating peptide sequences, forming direct repeats, or inverted repeats or alternating repeats of multiple sequence motifs. These repeating oligomer sequences can be identical or homologous to each other, but there can also be multiple repeated motifs. Repetitive sequences are characterized by a very low information content. A repetitive sequence is not a required feature of a URP and in some cases a non-repetitive sequence will in fact be preferred.
- Amino acids can be characterized based on their hydrophobicity.
- a number of scales have been developed. An example is a scale developed by Levitt, M et al. (see Levitt, M (1976) J MoI Biol 104, 59, #3233, which is listed in Hopp, TP, et al. ( 1981 ) Proc Natl Acad Sci U S A 78, 3824, #3232).
- Examples of "hydrophilic amino acids” are arginine, lysine, threonine;, alanine, asparagine, and glutamine. Of particular interest are the hydrophilic amino acids aspartate, glutamate, and serine, and glycine.
- hydrophobic amino acids are tryptophan, tyrosine, phenylalanine, methionine, leucine, isoleucine, and valine.
- denatured conformation describes the state of a peptide in solution that is characterized by a large conformational freedom of the peptide backbone. Most peptides and proteins adopt a denatured conformation in the presence of high concentrations of denaturants or at elevated temperatures. Peptides in denatured conformation have characteristic CD spectra and they are generally characterized by a lack of long range interactions as determined by e.g., NMR. Denatured conformation and unfolded conformation will be used synonymously.
- URP sequences and "unstructured recombinant polymer” (URP) are used herein interchanageably.
- the terms refer to amino acid sequences that share commonality with denatured peptide sequences, e.g., exhibiting a typical behavior like denatured peptide sequences, under physioloigical conditions, as detailed herien.
- URP sequences lack a defined tertiary structure and they have • limited or no secondary structure as detected by, e.g., Chou-Fasman algorithm.
- cell surface proteins refers to the plasma membrane components of a cell.
- An integral membrane protein is a transmembrane protein that extends across the lipid bilayer of the plasma membrane of a cell.
- a typical integral membrane protein consists of at least one membrane spanning segment that generally comprises hydrophobic amino acid residues.
- Peripheral membrane proteins do not extend into the hydrophobic interior of the lipid bilayer and they are bound to the membrane surface via covalent or noncovalent interaction directly or indirectly with other membrane components.
- the terms “membrane”, “cytosolic”, “nuclear” and “secreted” as applied to cellular proteins specify the extracellular and/or subcellular location in which the cellular protein is mostly, predominantly, or preferentially localized.
- Cell surface receptors represent a subset of membrane proteins, capable of binding to their respective ligands. Cell surface receptors are molecules anchored on or inserted into the cell plasma membrane. They constitute a large family of proteins, glycoproteins, polysaccharides and lipids, which serve not only as structural constituents of the plasma membrane, but also as regulatory elements governing a variety of biological functions.
- module refers to a portion of a protein that is physically or functionally distinguished from other portions of the protein or peptide.
- a module can comprise one or more domains.
- a module or domain can be a single, stable three-dimensional structure, regardless of size.
- the tertiary structure of a typical domain is stable in solution and remains the same whether such a member is isolated or covalently fused to other domains.
- a domain generally has a particular tertiary structure formed by the spatial relationships of secondary structure elements, such as beta-sheets, alpha helices, and unstructured loops.
- disulfide bridges are generally the primary elements that determine tertiary structure.
- domains are modules that can confer a specific functional activity, such as avidity (multiple binding sites to the same target), multi-specificity (binding sites for different targets), halflife (using a domain, cyclic peptide or linear peptide) which binds to a serum protein like human serum albumin (HSA) or to IgG (hlgG 1,2,3 or 4) or to red blood cells.
- Functionally-defined domains have a distinct biological function(s).
- the ligand-binding domain of a receptor for example, is that domain that binds ligand.
- An antigen-binding domain refers to the part of an antigen-binding unit or an . antibody that binds to the antigen.
- Functionally-defined domains need not be encoded by contiguous amino acid sequences.
- Functionally-defined domains may contain one or more physically-defined domain.
- Receptors for example, are generally divided into the extracellular ligand-binding domain, a transmembrane domain, and an intracellular effector domain.
- a "membrane anchorage domain” refers to the portion of a protein that mediates membrane association.
- the membrane anchorage domain is composed of hydrophobic amino acid residues.
- the membrane anchorage domain may contain modified amino acids, e.g. amino acids that are attached to a fatty acid chain, which in turn anchors the protein to a membrane.
- Non-naturally occurring as applied to a protein means that the protein contains at least one amino acid that is different from the corresponding wildtype or native protein.
- Non-natural sequences can be determined by performing BLAST search using, e.g., the lowest smallest sum probability where the comparison window is the length of the sequence of interest (the queried) and when compared to the non- redundant ("nr") database of Genbank using BLAST 2.0.
- the BLAST 2.0 algorithm which is described in Altschul et al. (1990) J. MoI. Biol. 215:403-410, respectively.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- a "host cell” includes an individual cell or cell culture which can be or has been a recipient for the subject vectors. Host cells include progeny of a single host cell. The progeny may not necessarily be completely identical (in morphology or in genomic of total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected in vivo with a vector of this invention.
- isolated means separated from constituents, cellular and otherwise, in which the polynucleotide, peptide, polypeptide, protein, antibody, or fragments thereof, are normally associated with in nature. As is apparent to those of skill in the art, a non-naturally occurring the polynucleotide, peptide, polypeptide, protein, antibody, or fragments thereof, does not require “isolation” to distinguish it from its naturally occurring counterpart.
- a “concentrated”, “separated” or “diluted” polynucleotide, peptide, polypeptide, protein, antibody, or fragments thereof is distinguishable from its naturally occurring counterpart in that the concentration or number of molecules per volume is greater than “concentrated” or less than “separated” than that of its naturally occurring counterpart.
- Linked and “fused” or “fusion” are used interchangeably herein. These terms refer to the joining together of two more chemical elements or components, by whatever means including chemical conjugation or recombinant means.
- An “in-frame fusion” refers to the joining of two or more open reading frames (OFRs) to form a continuous longer OFR, in a manner that maintains the correct reading frame of the original OFRs.
- the resulting recombinant fusion protein is a single protein containing two ore more segments that correspond to polypeptides encoded by the original OFRs (which segments are not normally so joined in nature.)
- a "linear sequence” or a “sequence” is an order of amino acids in a polypeptide in an amino to carboxyl terminus direction in which residues that neighbor each other in the sequence are contiguous in the primary structure of the polypeptide.
- a "partial sequence” is a linear sequence of part of a polypeptide which is known to comprise additional residues in one or both directions.
- Heterologous means derived from a genotypically distinct entity from the rest of the entity to which it is being compared.
- a glycine rich sequence removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous glycine rich sequence.
- heterologous as applied to a polynucleotide, a polypeptide, means that the polynucleotide or polypeptide is derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared.
- polynucleotides are used interchangeably. TheyTefer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
- polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
- modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- Recombinant as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
- gene or “gene fragment” are used interchangeably herein. They refer to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
- a gene or gene fragment may be genomic or cDNA, as long as the polynucleotide contains at least one open reading frame, which may cover the entire coding region or a segment thereof.
- a "fusion gene” is a gene composed of at least two heterologous polynucleotides that are linked together.
- a "vector” is a nucleic acid molecule, preferably self-replicating, which transfers an inserted nucleic acid molecule into and/or between host cells.
- the term includes vectors that function primarily for insertion of DNA or RNA into a cell, replication of vectors that function primarily for the replication of DNA or RNA, and expression vectors that function for transcription and/or translation of the DNA or RNA. Also included are vectors that provide more than one of the above functions.
- An “expression vector” is a polynucleotide which, when introduced into an appropriate host cell, can be transcribed and translated into a polypeptide(s).
- An "expression system” usually connotes a suitable host cell comprised of an expression vector that can function to yield a desired expression product.
- the "target” as used in the context of MURPs is a biochemical molecule or structure to which the Binding Module or the URP-linked Binding Module can bind and where the binding event results in a desired biological activity.
- the target can be a protein ligand or receptor that is inhibited, activated or otherwise acted upon by the t protein.
- targets are hormones, cytokines, antibodies or antibody fragments, cell surface receptors, kinases, growth factors and other biochemical structures with biological activity.
- a “functional module” can be any non-URP in a protein product.
- a functional module can be a binding module (BM), an effector module (EM), a multimerization module (MM), a C-terminal module (CM), or an N-terminal module (NM).
- BM binding module
- EM effector module
- MM multimerization module
- CM C-terminal module
- NM N-terminal module
- functional modules are characterized by a high information content of their amino acid sequence, i.e they contain many different amino acids and many of these amino acids are important for the function of a functional module.
- a functional module typically has secondary and tertiary structure, may be a folded protein domain and may contain 1,2,3,4,5 or more disulfide bonds.
- microproteins refers to a classification in the SCOP database. Microproteins are usually the smallest proteins with a fixed structure and typically but not exclusively have as few as 15 amino acids with two disulfides or up to 200 amino acids with more than ten disulfides. A microprotein may contain one or more microprotein domains. Some microprotein domains or domain families can have multiple more-or-less stable and multiple more or less similar structures which are conferred by different disulfide bonding patterns, so the term stable is used in a relative way to differentiate microproteins from peptides and non-microprotein domains. Most microprotein toxins are composed of a single domain, but the cell- surface receptor microproteins often have multiple domains.
- Microproteins can be so small because their folding is stabilized either by disulfide bonds and/or by ions such as Calcium, Magnesium, Manganese, Copper, Zinc, Iron or a variety of other multivalent ions, instead of being stabilized by the typical hydrophobic core.
- ions such as Calcium, Magnesium, Manganese, Copper, Zinc, Iron or a variety of other multivalent ions, instead of being stabilized by the typical hydrophobic core.
- scaffold refers to the minimal polypeptide 'framework' or 'sequence motif that is used as the conserved, common sequence in the construction of protein libraries.
- a scaffold is typically defined by the conserved residues that are observed in an alignment of a family of sequence-related proteins. Fixed residues may be required for folding or structure, especially if the functions of the aligned proteins are different.
- a full description of a microprotein scaffold may include the number, position or spacing and bonding pattern of the cysteines, as well as position and identity of any fixed residues in the loops, including binding sites for ions such as Calcium.
- the "fold" of a microprotein is largely defined by the linkage pattern of the disulfide bonds (i.e., 1-4, 2-6, 3-5). This pattern is a topological constant and is generally not amenable to conversion into another pattern without unlinking and relinking the disulfides such as by reduction and oxidation (redox agents). In general, natural proteins with related sequences adopt the same disulfide bonding patterns.
- CDP cysteine distance pattern
- non-cys residues as well as a metal- binding site, if present.
- folding of proteins is also influenced by the surrounding sequences (ie pro-peptides) and in some cases by chemical derivatization (ie gamma-carboxylation) of residues that allow the protein to bind divalent metal ions (ie Ca++) which assists their folding.
- divalent metal ions ie Ca++
- proteins with the same bonding pattern may still comprise multiple folds, based on differences in the length and composition of the loops that are large enough to give the protein a rather different structure.
- An example are the conotoxin, cyclotoxin and anato domain families, which have the same DBP but a very different CDP and are considered to be different folds.
- Determinants of a protein fold are any attributes that greatly alter structure relative to a different fold, such as the number and bonding pattern of the cysteines, the spacing of the cysteines, differences in the sequence motifs of the inter-cysteine loops (especially fixed loop residues which are likely to be needed for folding, or in the location or composition of the calcium (or other metal or co-factor) binding site.
- DBP disulfide bonding pattern
- Disulfide bonding patterns are topologically constant, meaning they can only be changed by unlinking one or more disulfides such as using redox conditions.
- the possible 2-, 3-, and 4-disulf ⁇ de bonding patterns are listed below in paragraphs 0048-0075.
- CDP cyste distance pattern
- C5C0C3C equals C5CC3C equals CxxxxxCCxxxC.
- Serum degradation resistance - Proteins can be eliminated by degradation in the blood, which typically involves proteases in the serum or plasma.
- the serum degradation resistance is measured by combining the protein with human (or mouse, rat, monkey, as appropriate) serum or plasma, typically for a range of days (ie 0.25, 0.5, 1, 2, 4, 8, 16 days) at 37C.
- the samples for these timepoints are then run on a western assay and the protein is detected with an antibody.
- the antibody can be to a tag in the protein. If the protein shows a single band on the western, where the protein's size is identical to that of the injected protein, then no degradation has occurred.
- the timepoint where 50% of the protein is degraded, as judged by western, is the serum degradation halflife of the protein.
- Serum protein binding While the MURP typically has a number of modules that bind to cell-surface targets and/or serum proteins, it is desirable that the URP substantially lack unintended activities.
- the URP should be designed to minimize avoid interaction with (binding to) serum proteins, including antibodies.
- Different URP designs can be screened for serum protein binding by ELISA, immobilizing the serum proteins and then adding the URP, incubating, washing and then detecting the amount of bound URP.
- One approach is to detect the URP using an antibody that recognizes a tag that has been added to the URP.
- a different approach is to immobilize the URP (such as via a fusion to GFP) and come in with human serum, incubating, washing, and then detecting the amount of human antibodies that remain bound to the URP using secondary antibodies like goat anti-human IgG.
- URPs we have designed our URPs to show very low levels of binding to serum proteins.
- binding to serum proteins or serum-exposed proteins is desired, for example because it can further extend the secretion halfllife.
- the MURP can be given binding modules that contain peptides that have been designed to bind to serum proteins or serum-exposed proteins such as HAS or IgG.
- URPs unstructured recombinant polymers
- the subject URPs are particularly useful for generating recombinant proteins of therapeutic and/or diagnostic value.
- the subject URPs exhibit one or more following features.
- the subject URPs comprise amino acid sequences that typically share commonality with denatured peptide sequences under physiological conditions. URP sequences typically behave like denatured peptide sequences under physiological conditions. URP sequences lack well defined secondary and tertiary structures under physiological conditions. A variety of methods have been established in the art to ascertain the second and tertiary structures of a given polypeptide.
- the secondary structure of a polypeptide can be determined by CD spectroscopy in the "far-UV" spectral region (190-250 run).
- Alpha-helix, beta-sheet, and random coil structures each give rise to a characteristic shape and magnitude of CD spectra.
- Secondary structure can also be ascertained via certain computer programs or algorithms such as the Chou-Fasman algorithm (Chou, P. Y., et al. (1974) Biochemistry, 13: 222-45).
- the algorithm can predict whether there exists some or no secondary structure at all.
- URP sequences will have spectra that resemble denatured sequences due to their low degree of secondary and tertiary structure.
- URP sequences can be designed to have predominantly denatured conformations under physiological conditions.
- URP sequences typically have a high degree of conformational flexibility under physiological conditions and they tend to have large hydrodynamic radii (Stokes' radius) compared to globularproteins of similar molecular weight.
- physiological conditions refer to a set of conditions including temperature, salt concentration, pH that mimic those conditions of a living subject.
- a host of physioloigcally relevant conditions for use in in vitro assays have been established.
- a physiological buffer contains a physiological concentration of salt and at adjusted to a neutral pH ranging from about 6.5 to about 7.8, and preferably from about 7.0 to about 7.5.
- a variety of physiological buffers is listed in Sambrook et al. (1989) supra and hence is not detailed herein.
- Physiologically relevant temperature ranges from about 25 0 C to about 38 0 C, and preferably from about 30 0 C to about 37 0 C.
- the subject URPs can be sequences with low immunogenicity. Low immunogenicity can be a direct result of the conformational flexibility of URP sequences. Many antibodies recognize so-called conformational epitopes in protein antigens. Conformational epitopes are formed by regions of the protein surface that are composed of multiple discontinuous amino acid sequences of the protein antigen. The precise folding of the protein brings these sequences into a well-defined special configuration that can be recognized by antibodies. Preferred URPs are designed to avoid formation of conformational epitopes. For example, of particular interest are URP sequences having a low tendency to adapt compactly folded conformations in aqueous solution.
- low immunogenicity caii be achieved by choosing sequences that resist antigen processing in antigen presenting cells, choosing sequences that do not bind MHC well and/or by choosing sequences that are derived from human sequences.
- the subject URPs can be sequences with a high degree of protease resistance.
- Protease resistance can also be a result of the conformational flexibility of URP sequences.
- Protease resistance can be designed by avoiding known protease recognition sites.
- protease resistant sequences can be selected by phage display or related techniques from random or semi-random sequence libraries.
- serum protease cleavage sites can be built into an URP.
- URP sequences with high stability e.g., long serum half-life, less prone to cleavage by proteases present in bodily fluid
- the subject URP can also be characterized by the effect in that wherein upon incorporation of it into a protein, the protein exhibits a longer serum half-life and/or higher solubility as compared to the corresponding protein that is deficient in the URP.
- Methods of ascertaining serum half-life are known in the art (see e.g., Alvarez, P., et al. (2004) J Biol Chem, 279: 3375-81).
- One can readily determine whether the resulting protein has a longer serum half-life as compared to the unmodified protein by praciting any methods available in the art or exemplified herein.
- the subject URP can be of any length necessary to effect (a) extension of serum half-life of a protein comprising the URP; (b) an increase in solubility of the resulting protein; (c) an increased resistance to protease; and/or (d) a reduced immunogenicity of the resulting protein that comprises the URP.
- the subject URP has about 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400 or more contiguous amino acids.
- the URP can be fragmented such that the resulting protein contains multiple URPs, or multiple fragments of URPs.
- Some or all of these individual URP sequences may be shorter that 40 amino acids as long as the combined length of all URP sequences in the resulting protein is at least 40 amino acids.
- the resulting protein has a combined length of URP sequences exceeding 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids.
- URPs may have an isoelectric point (pi) of 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5,
- URP sequences are rich in hydrophilic amino acids and contain a low percentage of hydrophobic or aromatic amino acids.
- Suitable hydrophilic residues include but are not limited to glycine, serine, aspartate, glutamate, lysine, arginine, and threonine.
- Hydrophobic residues that are less favored in construction of URPs include tryptophan, phenylalanine, tyrosine, leucine, isoleucine, valine, and methionine.
- URP sequences can be rich in glycine but URP sequences can also be rich in the amino acids glutamate, aspartate, serine, threonine, alanine or proline.
- the predominant amino acid may be G, E, D, S, T, A or P.
- the inclusion of proline residues tends to reduce sensitivity to proteolytic degradation.
- the inclusion of hydrophilic residues typically increases URPs' solubility in water and aqueous media under physiological conditions.
- URP sequences As a result of their amino acid composition, URP sequences have a low tendency to form aggregates in aqueous formulations and the fusion of URP sequences to other proteins or peptides tends to enhance their solubility and reduce their tendency to form aggregates, which is a separate mechanism to reduce immunogenicity.
- URP sequences can be designed to avoid certain amino acids that confer undesirable properties to the protein. For instance, one can design URP sequences to contain few or none of the following amino acids: cysteine (to avoid disulfide formation and oxidation), methionine (to avoid oxidation), asparagine and glutamine (to avoid desamidation).
- Glycine-rich URPs [00111]
- the subject URP comprises a glycine rich sequence (GRS).
- GRS glycine rich sequence
- glycine can be present predominantly such that it is the most prevalent residues present in the sequence of interest.
- URP sequences can be designed such that glycine resiudes constitute at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% of the total amino acids.
- URPs can also contain 100% glycines.
- the URPs contain at least 30% glycine and the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 20%. In still another exmaple, the URPs contain at least 40% glycine and the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 10%. In still yet another exmaple, the URPs contain at least about 50% glycine and the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 5%.
- the length of GRS can vary between about 5 amino acids and 200 amino acids or more.
- the length of a single, contiguous GRS can contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90,100,
- GRS may comprise glycine residues at both ends.
- GRS can also have a significant content of other amino acids, for example Ser, Thr, Ala, or Pro.
- GRS can contain a significant fraction of negatively charged amino acids including but not limited to Asp and GIu.
- GRS can contain a significant fraction of positively charged amino acids including but not limited to Arg or
- URPs can be designed to contain only a single type of amino acid (i.e., GIy or GIu), sometimes only a few types of amino acid, e.g., two to five types of amino acids (e.g., selected from G, E, D, S, T, A and P), in contrast to typical proteins and typical linkers which generally are composed of most of the twenty types of amino acids.
- URPs may contain negatively charged residues (Asp, GIu) in 30, 25, 20, 15, 12, 10, 9, 8, 1, 6, 5, 4, 3, 2, or 1 percent of the amino acids positions.
- the subject GRS-containing URP has about 30, 40, 50, 60, 70, 80, 90, 100, or more contiguous amino acids.
- the URP can be fragmented such that the resulting protein contains multiple URPs, or multiple fragments of URPs. Some or all of these individual URP sequences may be shorter that 40 amino acids as long as the combined length of all URP sequences in the resulting protein is at least 30 amino acids.
- the resulting protein has a combined length of URP sequences exceeding 40, 50, 60, 70, 80, 90, 100, or more amino acids.
- the GRS-containing URPs are of particular interest due to, in part, the increased conformational freedom of glycine-containing peptides.
- Denatured peptides in solution have a high degree of conformational freedom. Most of that conformational freedom is lost upon binding of said peptides to a target like a receptor, an antibody, or a protease. This loss of entropy needs to be offset by the energy of interaction between the peptide and its target.
- the degree of conformational freedom of a denatured peptide is dependent on its amino acid sequences. Peptides containing many amino acids with small side chains tend to have more conformational freedom than peptides that are composed of amino acids with larger side chains.
- Peptides containing the amino acid glycine have particularly large degrees of freedom. It has beeni estimated that glycine-containing peptide bonds have about 3.4 times more entropy in solution as compared to corresponding alanine-containing sequences (D'Aquino, J. A., et al. (1996) Proteins, 25: 143-56). This factor increases with the number of glycine residues in a sequence. As a result, such peptides tend to lose, more entropy upon binding to targets, which reduces their overall ability to interact with other proteins as well as their ability to adopt defined three-dimensional structures.
- GRS-containing URRs are sequences from human proteins or sequences that share substantial homology to the corresponidng glycine rich sequences in the reference human proteins.
- Table 2 Open reading frames encoding GRS with 300 or more glycine residues GRS Gene
- NP_787059 GAGGGGGGGGGGGGGSGGGGGGGGAGAGGAGAG 33
- NP_005850 GSGSGSGSGGGGGGGGGGGGSGGGGGG 25
- purine-rich element binding protein A purine-rich single-stranded DNA-binding protein alpha
- transcriptional activator protein PUR-alpha [Homo sapiens] GHPGSGSGSGGGGGGGGGGGGSGGGGGGAPGG
- regulatory factor Xl trans-acting regulatory factor 1
- enhancer factor C enhancer factor C
- MHC class II regulatory factor RFX Homo sapiens
- ZNP-99 transcription factor [Homo sapiens]
- RNA binding protein (autoantigenic, hnRNP-associated with lethal yellow) short isoform; RNA-binding protein (autoantigenic); RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)
- GDGGGAGGGGGGGGSGGGGGGSGGGGGGGGG signal recognition particle 68fcDa [Homo sapiens] GOGGGGGSGGGGGSGGGGSGGGRGAGG
- KIAA0265 protein [Homo sapiens] GOGAAGAGGGGSGAGGGSGGSGGRGTG
- Engrailed-2 Homo sapiens GAGGGRGGGAGGEGGASGAEGGGGAGG
- RNA binding protein (autoantigenic, hnRNP-associated with lethal yellow) long isoform; RNA-binding protein (autoantigenic); RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow) [Homo sapiens] GDGGGAGGGGGGGGSGGGGSGGGGGGGGG
- homeo box DI l homeo box 4F; Hox-4.6, mouse, homolog of; homeobox protein Hox-Dl 1 [Homo sapiens] GGGGGGSAGGGSSGGGPGGGGGGAGG
- frizzled 8 frizzled (Drosophila) homolog 8 [Homo sapiens] GGGGGPGGGGGGGPGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
- homeo box B3 homeo box 2G; homeobox protein Hox-B3 [Homo sapiens] GGGGGGGGGSGGSGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
- chromosome 2 open reading frame 29 [Homo sapiens] GGSGGGRGGASGPGSGSGGPGGPAG
- DKFZP564F0522 protein [Homo sapiens] GGHHGDRGGGRGGRGGRGGRGGRAG
- ras homolog gene family member U; Ryu GTPase; Wnt-1 responsive Cdc42 homolog; 2310026M05Rik; GTP- binding protein like 1 ; CDC42-like GTPase [Homo sapiens] GGRGGRGPGEPGGRGRAGGAEGRG scratch 2 protein; transcriptional repressor scratch 2; scratch (drosophila homolog) 2, zinc finger protein [Homo sapiens]
- nucleolar protein family A member 1 ; GARl protein [Homo sapiens] GGGRGGRGGGRGGGGRGGGRGGG;
- nucleolar protein family A member 1 ; GARl protein [Homo sapiens] GGGRGGRGGGRGGGGRGGGRGGG;
- RNA U3 small nucleolar interacting protein 1 [Homo sapiens] GRGRGGGGGGGGGGGGGRGGGG
- calpain small subunit 1; calcium-activated neutral proteinase; calpain, small polypeptide; calpain 4, small subunit (30K); calcium-dependent protease, small subunit [Homo sapiens] GAGGGGGGGGGGGGGGGGGGGG keratin 9 [Homo sapiens] GG ⁇ SGGGHSGGSGGGHSGGSGG
- forkhead box Dl forkhead-related activator 4; Forkhead, drosophila, homolog-like 8; forkhead (Drosophila)-like 8 [Homo sapiens] GAGAGGGGGGGGAGGGGSAGSG
- cadherin 22 precursor ortholog of rat PB-cadherin [Homo sapiens] GGDGGGSAGGGAGGGSGGGAG
- AT-binding transcription factor 1 AT motif-binding factor 1 [Homo sapiens] GGGGGGSGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
- sperm associated antigen 8 isoform 2 sperm membrane protein 1 [Homo sapiens] GSGSGPGPGSGPGSSPGHGSG
- RNA binding motif protein 27 [Homo sapiens] GPGPGPGPGPGPGPGPGPGPGPGPGPGPGPGPGPG
- ankyrin repeat and sterile alpha motif domain containing 1 ankyrin repeat and SAM domain containing 1 [Homo sapiens]
- sperm associated antigen 8 isoform 1 sperm membrane protein 1 [Homo sapiens] GSGSGPGPGSGPGSGPGHGSG
- methyl-CpG binding domain protein 2 testis-specific isoform [Homo sapiens] GRGRGRGRGRGRGRGRGRGRGRG
- cell death regulator aven; programmed cell death 12 [Homo sapiens] GGGGGGGGDGGGRRGRGRGRG
- nonsense transcripts 1 delta helicase; up-frameshift mutation 1 homolog (S. cerevisiae); nonsense mRNA reducing factor 1; yeast Upflp homolog [Homo sapiens] GGPGGPGGGGAGGPGGAGAG
- small conductance calcium-activated potassium channel protein 2 isoform a apamin-sensitive small-conductance Ca2+-activated potassium channel [Homo sapiens] GTGGGGSTGGGGGGGGSGHG
- SRY (sex determining region Y)-box 1 SRY-related HMG-box gene 1 [Homo sapiens]
- transcription factor 20 isoform 2; stromelysin-1 platelet-derived growth factor-responsive element binding protein; stromelysin 1 PDGF-responsive element-binding protein; SPRE-binding protein; nuclear factor SPBP [Homo sapiens]
- transcription factor 20 isoform 1; stromelysin- 1 platelet-derived growth factor-responsive element binding protein; stromelysin 1 PDGF-responsive element-binding protein; SPRE-binding protein; nuclear factor SPBP [Homo sapiens]
- Ras-interacting protein 1 [Homo sapiens]
- forkhead box Cl forkhead-related activator 3; Forkhead, drosophila, homolog-like 7; forkhead (Drosophila)-Iike 7; iridogoniodysgenesis type 1 [Homo sapiens] GSSGGGGGGAGAAGGAGGAG
- splicing factor ⁇ 54 arginine-rich 54 kDa nuclear protein [Homo sapiens] GPGPSGGPGGGGGGGGGGGGGG
- v-maf musculoaponeurotic fibrosarcoma oncogene homolog Avian musculoaponeurotic fibrosarcoma (MAF) protooncogene
- v-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog [Homo sapiens] GGGGGGGGGGGGGGAAGAGG
- sequences of non-glycine residues in these GRS can be selected to optimize the properties of URPs and hence the proteins that contain the desired URPs. For instance, one can optimize the sequences of URPs to enhance the selectivity of the resulting protein for a particular tissue, specific cell type or cell lineage. For example, one can incorporate protein sequences that are not ubiquitously expressed, but rather are differentially expressed in one or more of the body tissues including heart, liver, prostate, lung, kidney, bone marrow, blood, skin, bladder, brain, muscles, nerves, and selected tissues that are affected by diseases such as infectious diseases, autoimmune disease, renal, neronal, cardiac disorders and cancers.
- tissue-specific, cell-type specific, subcellular location specific sequences are known and available from numerous protein databases.
- Such selective URP sequences can be obtained by generating libraries of random or semi-random URP sequences, injecting them into animals or patients, and determining sequences with the desired tissue selectivity in tissue samples. Sequence determination can be performed by mass spectrometry. Using similar methods one can select URP sequences that facilitate oral, buccal, intestinal, nasal, thecal, peritoneal, pulmonary, rectal, or dermal uptake.
- URP sequences that contain regions that are relatively rich in the positively charged amino acids arginine or lysine which favor cellular uptake or transport through membranes.
- URP sequences can be designed to contain one or several protease-sensitive sequences. Such URP sequences can be cleaved once the product of the invention has reached its target location. This cleavage may trigger an increase in potency of the pharmaceutically active domain (pro-drug activation) or it may enhance binding of the cleavage product to a receptor.
- URP sequences can be designed to carry excess negative charges by introducing aspartic acid or glutamic acid residues.
- URP that contain great than 5%, greater than 6%, 7%, 8%, 9%, 10%, 15%, 30% or more glutamic acid and less than 2% lysine or arginine.
- Such URPs carry an excess negative charge and as a result they have a tendency to adopt open conformations due to electrostatic repulsion between individual negative charges of the peptide.
- Such an excess negative charge leads to an effective increase in their hydrodynamic radius and as a result it can lead to reduced kidney clearance of such molecules.
- one can modulate the effective net charge and hydrodynamic radius of a URP sequence by controlling the frequency and distribution of negatively charged amino acids in the URP sequences.
- Most tissues and surfaces in a human or animal carry excess negative charges.
- URPs may have a repetitive amino acid sequence of the format (Motif) x in which a sequence motif forms a direct repeat (ie ABCABCABCABC) or an inverted repeat (ABCCBAABCCBA) and the number of these repeats can be 2,3,4,5,6,7,8,9,10,12,14,16,18,20,22,24,26,28,30, 35,40, 50 or more.
- URPs or the repeats inside URPs often contain only 1,2,3,4,5 or 6 different types of amino acids.
- URPs typically consist of repeats of human amino acid sequences that are 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,22,24,26,28,30,32,34,36 or more amino acids long, but URPs may also consist of non-human amino acid sequences that are 20,22,24,26,28,30,32, 34 36, 38 40, 42, 44,
- URPs derived from human sequences can be derived from human sequences.
- the human genome contains many subsequences that are rich in one particular amino acid.
- amino acid sequences that are rich in a hydrophilic amino acid like serine, threonine, glutamate, aspartate, or glycine.
- subsequences that contain few hydrophobic amino acids.
- Such subsequences are predicted to be unstructured and highly soluable in aqeuous solution.
- Such human subsequences can be modified to further improve their utility.
- Figure 17 shows an exemplary human sequence that is rich in serine and that can be isolated as the subject URP.
- the exemplified dentin sialophosphoprotein contains a 670-amino acid subsequence in which 64% of the residues are serine and most other positions are hydrophilic amino acids such as aspartate, asparagines, and glutamate.
- the sequence is extremely repetitive and as a result it has a low information content.
- Examples of sequences that are related to dentin sialophosphoprotein are (SSD) n , (SSDSSN) n , (SSE) n , where n is between about 4 and 200.
- sequences from human proteins is particularly desirable in design of URPs with reduced immunogenicity in a human subject.
- a key step for eliciting an immune response to a foreign protein is the presentation of peptide fragments of said protein by MHC class II receptors. These MHCII-bound fragments can then be detected by T cell receptors, which triggers the proliferation of T helper cells and initiates an immune response.
- T cell epitopes from pharmaceutical proteins has been recognized as a means to reduce the risk of eliciting an immune reaction (Stickler, M., et al. (2003) J
- MHCII receptors typically interact with an epitope having e.g., a 9- amino acid long region of die displayed peptides.
- an epitope having e.g., a 9- amino acid long region of die displayed peptides.
- One can incorporate human sequences into the design of URP sequences by oligomerizing or concatenating human sequences mat have suitable amino acid compositions. These can be direct repeats or inverted repeats or mixtures of different repeats.
- Such oligomers have reduced risk of being immunogenic.
- the junction sequences between the monomer units can still contain T cell epitopes that can trigger an immune reaction, which is illustrated in figure 3.
- the URP sequence in figure 2 designed as an oligomer based on multiple human sequences such that each 9mer subsequences of the oligomer can be found in a human protein. In these designs, every 9-mer subsequence is a human sequence.
- An example of a URP sequence based on three human sequences is shown in figure 5.
- URP sequences based on a single human sequences such that all possible 9mer subsequences in the oligomeric URP sequences occur in the same human protein.
- An example is shown in figure 6 based on the POU domain that is rich in glycine and proline.
- the repeating monomer in the URP sequence is only a fragment of the human protein and its flanking sequences is identical to the repeating unit as illustrated in figure 6.
- Non-oligomeric URP sequences can be designed based on human proteins as well.
- the primary conditions are that all 9mer subsequences can be found in human sequences.
- the amino acid composition of the sequences preferably contains few hydrophobic residues.
- URP sequences that are designed based on human sequences and that contain a large fraction of glycine residues.
- Host of interest can be any animals, including vertebrates and invertebrates.
- Preferred hosts are mamals such as primates (e.g. chimpanzees and humans), cetaceans (e.g. whales and dolphins), chiropterans (e.g. bats), perrisodactyls (e.g. horses and rhinoceroses), rodents (e.g.
- the URPs typically contain multiple copies of the repeat sequences or units, wherein the majority of segments comprising about 6 to about 15 contiguous amino acids are present in one or more native human proteins.
- the majority of segments comprising between about 9 to about 15 contiguous amino acids are found in one or more native human proteins.
- majority of the segments refers to more than about 50%, preferably 60%, preferably 70%, preferably 80%, preferably 90%, preferably 100%.
- each of the possible segments between about 6 to 15 amino acids, preferably between about 9 to 15 amino acids within the repeating units are present in one or more native human proteins.
- the URPs can comprise multiple repeating units or sequences, for example having 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeating units.
- URP sequences can be designed to be substantially free of epitopes recorgnized by human T cells. For instance, one can synthesize a series of semi-random sequences with amino acid compositions that favor denatured, unstructured conformations and evaluate these sequences for the presence of human T cell epitopes and whether they are human sequences. Assays for human T cell epitopes have been described (Stickler, M., et al. (2003) J Immunol Methods, 281: 95-108). Of particular interest are peptide sequences that can be oligomerized without generating T cell epitopes or non-human sequences.
- T-cell epitopes This can be achieved by testing direct repeats of these sequences for the presence of T-cell epitopes and for the occurrence of 6 to 15-mer and in particular 9-mer subsequences that are not human.
- An alternative is to evaluate multiple peptide sequences that can be assembled into repeating units as described in the previous section for the assembly of human sequences.
- Another alternative is to design URP sequences that result in low scores using epitope prediction algorithms like TEPITOPE (Stumiolo, T., et al. (1999) Nat Biotechnol, 17: 555- 61).
- Another approach to avoiding T-cell epitopes is to avoid amino acids that can serve as anchor residues. during peptide display on MHG, such as M, I, L, V, F.
- Hydrophobic amino acids and positively charged amino acids can frequently serve as such anchor residues and minimizing their frequency in a URP sequences reduces the chance of generating T-cell epitopes and thus eliciting an immune reaction.
- the selected URPs generally contain subsequences that are found in at least one human protein, and have a lower content of hydrophobic amino acids.
- URP sequences can be designed to optimize protein production. This can be achieved by avoiding or minimizing repetitiveness of the encoding DNA. URP sequences such as poly-glycine may have very desirable pharmaceutical properties but their manufacturing can be difficult due to the high GC-content of DNA sequences encoding for GRS and due to the presence of repeating DNA sequences that can lead to recombination.
- URP sequences can be designed to be highly repetitive at the amino acid level. As a result the URP sequences have very low information content and the risk of eliciting an immune reaction can be reduced.
- URPs containing repeating amino acids are: poly-glycine, poly-glutamic acid, poly-aspartic acid, poly-serine, poly-threonine, (GX) n where G is glycine and X is serine, aspartic acid, glutamic acid, threonine, or proline and n is at least 20, (GGX) n where X is serine, aspartic acid, glutamic acid, threonine, or proline and n is at least 13, (GGGX) n where X is serine, aspartic acid, glutamic acid, threonine, or proline and n is at least 10, (GGGGX) n where X is serine, aspartic acid, glutamic acid, threonine, or proline and n
- the number of these repeats can be any number between 10 and 100.
- Products of the invention may contain URP sequences that are semi-random sequences. Examples are semi-random sequences containing at least 30, 40, 50, 60 or 70% glycine in which the glycines are well dispersed and in which the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 70, 60, 50, 40, 30, 20, or 10% when combined.
- a preferred semi-random URP sequence contains at least 40% glycine and the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 10%.
- a more preferred random URP sequence contains at least 50% glycine and the total concentration of tryptophan, phenylalanine, tyrosine, valine, leucine, and isoleucine is less then 5%.
- URP sequences can be designed by combining the sequences of two or more shorter URP sequences or fragments of URP sequences. Such a combination allows one to better modulate the pharmaceutical properties of the product containing the URP sequences and it allows one to reduce,. the repetitiveness of the DNA sequences encoding the URP sequences, which can improve expression and reduce recombination of the URP encoding sequences.
- URP sequences can be designed and selected to possess several of the following desired properties: a) high genetic stability of the coding sequences in the production host, b) high level of expression, c) low (predicted/calculated) immunogenicity, d) high stability in presence of serum proteases and/or other tissue proteases, e) large hydrodynamic radius under physiological conditions.
- a) high genetic stability of the coding sequences in the production host b) high level of expression, c) low (predicted/calculated) immunogenicity, d) high stability in presence of serum proteases and/or other tissue proteases, e) large hydrodynamic radius under physiological conditions.
- URP sequences that meet multiple criteria is to construct a library of candidate sequences and to identify from the library the suitable subsequences.
- Libraries can comprise random and/or semi-random sequences.
- codon libraries which is a library of DNA molecules that contains multiple codons for the identical amino acid residue. Codon randomization can be applied to selected amino acid positions of a certain type or to most or all positions.
- True codon libraries encode only a single amino acid sequence, but they can easily be combined with amino acid libraries, which is a population of DNA molecules encoding a mixture of (related or unrelated) amino acids at the same residue position. Codon libraries allow the identification of genes that have relatively low repetitiveness at the DNA level but that encode highly repetitive amino acid sequences.
- codon libraries that encode limited amino acid diversity. Such libraries allow introduction of a limited number of amino acids in some positions of the sequence while other positions allow for codon variation but all codons encode the same amino acid.
- One can synthesize partially random oligonucleotides by incorporating mixtures of nucleotides at the same position during oligonucleotide synthesis. Such partially random oligonucleotides can be fused by overlap PCR or ligation-based approaches, hi particular, one can multimerize semi-random oligonucleotides that encode glycine-rich sequences. These oligonucleotides can differ in length and sequences and codon usage.
- URP sequences with desirable properties can be identified from libraries using a variety of methods. Sequences that have a high degree of genetic stability can be enriched by cultivating the library in a production host. Sequences that are unstable will accumulate mutations, which can be identified by DNA sequencing.
- Variants of URP sequences that can be expressed at high level can be identified by screening or selection using multiple protocols known to someone skilled in the art. For instance one can cultivate multiple isolates from a library and compare expression levels. Expression levels can be measured by gel analysis, analytical chromatography, or various ELIS A-based methods. The determination of expression levels of individual sequence variants can be facilitated by fusing the library of candidate URP sequences to sequence tags like myc-tag, His-tag, HA-tag. Another approach is to fuse the library to an enzyme or other reporter protein like green fluorescent protein. Of particular interest is the fusion of the library to a selectable marker like beta-lactamase or kanamycin-acyl transferase. One can use antibiotic selection to enrich for variants with high level of expression and good genetic stability.
- Variants with good protease resistance can he identified by screening for intact sequences after incubation with proteases.
- An effective way to identify protease-resistant URP sequences is bacterial phage display or related display methods. Multiple systems have been described where sequences that undergo rapid proteolysis can be enriched by phage display. These methods can be easily adopted to enrich for protease resistant sequences. For example, one can clone a library of candidate URP sequences between an affinity tag and the pill protein of
- the library can then be exposed to proteases or protease-containing biological samples like blood or lysosomal preparations.
- Phage that contain protease-resistant sequences can be captured after protease treatment by binding to the affinity tag. Sequences that resist degradation by lysosomal preparations are of particular interest because lysosomal degradation is a key step during antigen presentation in dendritic and other antigen presenting cells.
- Phage display can be utilized to identify candidate URP sequences that do not bind to a particular immune serum in order to identify URP sequences with low immunogenicity.
- the resulting serum can then be used for phage panning to remove or identify sequences that are recognized by antibodies in the resulting immune serum.
- Other methods like bacterial display, yeast display, ribosomal display can be utilized to identify variants of URP sequences with desirable properties.
- Another approach is the identification of URP sequences of interest by mass spectrometry. For instance, one can incubate a library of candidate URP sequences with a protease or biological sample of interest and identify sequences that resist degradation by mass spectrometry. In a similar approach one can identify URP sequences that facilitate oral uptake. One can feed a mixture of candidate URP sequences to animals or humans and identify variants with the highest transfer or uptake efficiency across some tissue barrier (ie dermal, etc) by mass spectrometry.
- URP sequences that favor other uptake mechanisms like pulmonary, intranasal, rectal, transdermal delivery.
- URP sequences can be designed by combining URP sequences or fragments of URP sequences that were designed by any of the methods described above.
- codon optimization with the goal of improving expression of the enhanced proteins and to improve the genetic stability of the encoding gene in the production hosts. Codon optimization is of particular importance for URP sequences that are rich in glycine or that have very repetitive amino acid sequences.
- Codon optimization can be performed using computer programs (Gustafsson, C, et al. (2004) Trends Biotechnol, 22: 346-53), some of which minimize ribosomal pausing (Coda Genomics Inc.).
- URP sequences one can consider a number of properties. One can minimize the repetitiveness in the encoding DNA sequences. In addition, one can avoid or minimize the use of codons that are rarely used by the production host (ie the AGG and AGA arginine codons and one Leucine codon in E. coli) DNA sequences that have a high level of glycine tend to have a high GC content that can lead to instability or low expression levels.
- URP encoding genes can be made in one or more steps, either fully synthetically or by synthesis combined with enzymatic processes, such as restriction enzyme-mediated cloning, PCR and overlap extension.
- URP modules can be constructed such that the URP module-encoding gene has low repetitiveness while the encoded amino acid sequence has a high degree of repetitiveness. The approach is illustrated in figure 11. As a first step, one constructs a library of relatively short URP sequences. This can be a pure codon library such that each library member has the same amino acid sequence but many different coding sequences are possible.
- the library can construct the library as fusion to a reporter protein.
- reporter genes are green fluorescent protein, luciferace, alkaline phosphatase, beta-galactosidase.
- the initial library of short URP sequences can allow some variation in amino acid sequence. For instance one can randomize some codons such that a number of hydrophilic amino acids can occur in said position.
- URP sequences one can also generate longer multimers. This allows one to faster increase the length of URP modules.
- URP sequences contain particular amino acids at high fraction. Such sequences can be difficult to produce by recombinant techniques as their coding genes can contain repetitive sequences that are subject to recombination. Furthermore, genes that contain particular codons at very high frequencies can limit expression as the respective loaded tRNAs in the production host become limiting.
- An example is the recombinant production of GRS. Glycine residues are encoded by 4 triplets, GGG, GGC, GGA 5 and GGT. As a result, genes encoding GRS tend to have high GC-content and tend to be particularly repetitive. An additional challenge can result from codon bias of the production host. In the case of E.
- codon optimization of the gene encoding URP sequences can be very desirable.
- One can optimize codon usage by employing computer programs that consider codon bias of the production host (Gustafsson, C, et al. (2004) Trends Biotechnol, 22: 346-53).
- codon libraries where all members of the library encode the same amino acid sequence but where codon usage is varied. Such libraries can be screened for highly expressing and genetically stable members which are particularly suitable for the large-scale production of
- MURPs Multivalent Unstructured Recombinant Proteins
- the subject URPs are particularly useful as modules for design of proteins of therapeutic value. Accordingly, the present invention provides proteins comprising one or more subject URPs. Such proteins are termed herein Multivalent Unstructured Recombinant Proteins (MURPs).
- MURPs Multivalent Unstructured Recombinant Proteins
- one or more URP sequences can be fused to the N-terminus or C-terminus of a protein or inserted in the middle of the protein, e.g., into loops of a protein or in between modules of the protein of interest, to give the resulting modified protein improved properties relative to the unmodified protein.
- the combined length of URP sequences that are attached to a protein can be 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids.
- the subject MURPs exhibit one or more improved properties as detailed below.
- Adding a URP sequences to a pharmaceutically active protein can improve many properties of that protein.
- adding a long URP sequence can significantly increase the serum half-life of the protein.
- Such URPs typically contain amino acid sequences of at least about 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids.
- the URPs can be fragmented such that the resulting protein contains multiple URPs, or multiple fragments of URPs. Some or all of these individual URP sequences may be shorter that 40 amino acids as long as the combined length of all URP sequences in the resulting protein is at least 30 amino acids. Preferably, the resulting protein has a combined length of URP sequences exceeding 40, 50, 60, 70, 80, 90, 100, 150, 200 or more amino acids.
- the fused URPS can increase the hydrodynamic radius of a protein and thus reduces its clearance from the blood by the kidney. The increase in the hydrodynamic radius of the resulting fusion protein relative to the unmodified protein can be detected by ultracentrifugation, size exclusion chromatography, or light scattering.
- hydrophilic polymers have a tendency to accumulate selectively in tumor tissue which is caused by the enhanced permeability and retention (EPR) effect.
- EPR enhanced permeability and retention
- the underlying cause of the EPR effect is the leaky nature of tumor vasculature (McDonald, D. M., et al. (2002) Cancer Res, 62: 5381-5) and the lack of lymphatic drainage in tumor tissues. Therefore, the selectivity of pharmaceutically active proteins for tumor tissues can be enhanced by adding hydrophilic polymers.
- the therapeutic index of a given pharmaceutically active protein can be increased via incorporating the subject URPS. Protection from degradation and reduced immunogenicity:
- URP sequences can significantly improve the protease resistance of a protein.
- URP sequences themselves can be designed to be protease resistant and by attaching them to a protein one can shield that protein from the access of degrading enzymes.
- URP sequences can be added to pharmaceutically active proteins with the goal of reducing undesirable interactions of the protein with other receptors or surfaces. To achieve this, it can be beneficial to add the URP sequences to the pharmaceutically active protein in proximity to the site of the protein that makes such undesirable contacts.
- one can add URP sequences to pharmaceutically active proteins with the goal of reducing their interactions with any component of the immune system to prevent an immune response against the product of the invention.
- URP sequences can reduce interaction with pre-existing antibodies or B-cell receptors. Furthermore, the addition of URP sequences can reduce the uptake and processing of the product of the invention by antigen presenting cells. Adding one or more URP sequence to a protein is a preferred way of reducing its immunogenicity as it will suppress an immune response in many species allowing one to predict the expected immunogenicity of a product in patients based on animal data. Such species independent testing of immunogenicity is not possible for approaches that are based on the identification and removal of human T cell epitopes or sequences comparison with human sequences.
- URP sequences can be introduced into proteins in order to interrupt T cell epitopes. This is particularly useful for proteins that combine multiple separate functional modules.
- the formation of T cell epitopes requires that peptide fragments of a protein antigen bind to MHC. MHC molecules interact with a short segment of amino acids typically 9 contiguous residues of the presented peptides.
- the direct fusion of different binding modules in a protein molecule can lead to T cell epitopes that span two neighboring domains.
- URP sequences between functional modules can also interfere with proteolytic processing in antigen presenting cells, which will lead to an additional reduction of immunogenicity.
- Another approach to reduce the risk of immunogenicity is to disrupt T cell epitopes within functional modules of a product.
- one approach is to have some of the intercysteine loops (those that are not involved in target binding) be glycine-rich.
- microproteins whose structure is due to a small number of cysteines, one could in fact replace most or all of the residues that are not involved in target binding with glycine, serine, glutamate, threonine, thus reducing the potential for immunogenicity while not affecting the affinity for the target.
- this can be carried out by performing a 'glycine-scan' of all residues, in which each residue is replaced by a glycine, then selecting the clones which retain target binding using pahge display or screening, and then combining all of the glycine substitutions that are permitted.
- functional modules have a much higher probability to contain T cell epitopes than URP modules.
- Functional modules of a protein can have limited solubility.
- binding modules tend to carry hydrophobic residues on their surface, which can limit their solubility and can lead to aggregation.
- URP modules By spacing or flanking such functional modules with URP modules one can improve the overall solubility of the resulting product. This is in particular true for URP modules that carry a significant percentage of hydrophilic or charged residues.
- URP sequences can be designed to carry an excess of negative or positive charges. As a result they confer an electrostatic field to any fusion partner which can be utilized to shift the pH profile of an enzyme or a binding interaction.
- the electrostatic field of a charged URP sequence can increase the homogeneity of pKa values of surface charges of a protein product, which leads to sharpened pH profiles of ligand interactions and to sharpened separations by isoelectric focusing or chromatofocusing. Improved purification properties due to sharper product pKa: [00144] Each amino acid in solution by itself has a single, fixed pKa, which is the pH at which its functional groups are half protonated. In a typical protein you have many types of residues and due to proximity and protein breathing effects, they also change each other's effective pKa in variable ways.
- URP modules can form a single, homogeneously ionizated type of molecule and can yield a single mass in mass spectrometry.
- MURPs can be expressed as a fusion with an URP having a single type of charge (GIu) distributed at constant spacing through the URP module.
- GIu type of charge
- the increase in the homogeneity of the charge of the protein population has favorable processing properties, such as in ion exchange, isoelectric focusing, massspec, etc. compared to traditional PEGylation.
- URP sequences can significantly simplify the formulation and or the delivery of the resulting products.
- URP sequences can be designed to be very hydrophilic and as a result they improve the solubility of (for example) human proteins, which often contain hydrophobic patches that they use to bind to other human proteins.
- the formulation of such human proteins, like antibodies, can be quite challenging and often limits their concentration and delivery options.
- URPs can reduce product precipitation and aggregation and it allows one to use simpler formulations containing fewer ingredients, that are typically needed to stabilize a product in solution.
- URP sequences-containing products allows to formulate these products at higher concentration and as a result one can reduce the injection volume for injectable products, which may enable home injection, which is limited to a very low injected volume. Addition of a URP sequence can also simplify the storage of the resulting formulated products.
- URP sequences can be added to pharmaceutically active proteins to facilitate their oral, pulmonary, rectal, or intranasal uptake. URP sequences can facilitate various modes of delivery because they allow higher product concentrations and improved product stability. Additional improvements can be achieved by designing URP sequences that facilitate membrane penetration. Improved production: [00150] Adding URP sequences can have significant benefits for the production of the resulting product.
- URP -containing products are much easier to prepare as compared to polymer-modified proteins. Chemical polymer-modification requires extra modification and purification steps after the active protein has been purified. In contrast, URP sequences can be manufactured using recombinant DNA methods together with the pharmaceutically active protein.
- the products of the invention are also significantly easier to characterize compared to polymer-modified products.
- URP sequences can also facilitate the purification of a product.
- URP sequences can include subsequences that can be captured by affinity chromatography.
- An example are sequences rich in histidine, which can be captured on resins with immobilized metals like nickel.
- URP sequences can also be designed to have an excess of negatively or positively charged amino acids. As a result they can significantly impact the net charge of a product, which can facilitate product purification by ion-exchange chromatography or preparative electrophoresis.
- the subject MURPs can contain a variety of modules, including but not limited to binding modules, effector modules, multimerization modules, C-terminal modules, and N-terminal modules.
- Figure 1 depicts an exemplary MURP having multiple mudules.
- MURPs can also have relatively simple architectures that are illustrated in Fig. 2.
- MURPs can also contain fragmentation sites. These can be protease-sensitive sequences or chemically sensitive sequences that can be preferentially cleaved when the MURPs reach their target site.
- Binding Module (BM) refers to a peptide or protein sequence that can bind specifically to one or several targets, which may be one or more therapeutic targets or accessory targets, such as for cell-, tissue- or organ targeting.
- BMs can be linear or cyclic peptides, cysteine-constrained peptides, microproteins, scaffold proteins (e.g., f ⁇ bronectin, ankyrins, crystalline, streptavidin, antibody fragments, domain antibodies), peptidic hormones, growth factors, cytokines, or any type of protein domain, human or non-human, natural or non-natural, and they may be based on a natural scaffold or not based on a natural scaffold, or based on combinations or they may be fragments of any of the above.
- these BMs can be engineered by adding, removing or replacing one or multiple amino acids in order to enhance their binding properties, their stability, or other properties.
- Binding modules can be obtained from natural proteins, by design or by genetic package display, including phage display, cellular display, ribosomal display or other display methods. Binding modules may bind to the same copy of the same target, which results in avidity, or they may bind to different copies of the same target (which can result in avidity if these copies are somehow connected or linked, such as by a cell membrane), or they may bind to two unrelated targets (which yields avidity if these targets are somehow linked, such as by a membrane). Binding modules can be identified by screening or otherwise analyzing random libraries of peptides or proteins.
- Particularly desirable binding modules are those that upon incorporation into a MURP, the MURP yield a desirable Tepitope score.
- the Tepitope score of a protein is the log of the Kd (dissociation constant, affinity, off-rate) of the binding of that protein to multiple of the most common human MHC alleles, as disclosed in Sturniolo, T. et al. (1999) Nature Biotechnology 17:555). The score ranges over at least 15 logs, from about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, -1, -2, -3, -4, -5 (1Oe 10 Kd) to about -5.
- binding modules comprising disuf ⁇ de bonds formed by pairing two cysteine residues.
- the binding modules comprise polypeptides having high cysteine content or high disulfide density (HDD).
- Binding modules of the HDD family typically have 5-50% (5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45 or 50%) cysteine residues and each domain typically contains at least two disulfides and optionally a co-factor such as calcium or another ion.
- the presence of HDD scaffold allows these modules to be small but still adopt a relatively rigid structure.
- Rigidity is important to obtain high binding affinities, resistance to proteases and heat, including the proteases involved in antigen processing, and thus contributes to the low or non-immunogenicity of these modules.
- the disulfide framework folds the modules without the need for a large number of hydrophobic side chain interactions in the interior of most modules.
- the small size is also advantageous for fast tissue penetration and for alternative delivery such as oral, nasal, intestinal, pulmonary, blood-brain-barrier, etc.
- the cysteine-containing binding modules can adopt a wide range of disulfide bonding patterns (DBPs). For example, two-disulfide modules can have three different disulfide bonding patterns (DBPs), three- disulfide modules can have 15 different DBPs and four-disulfide modules have up to 105 different DBPs.
- DBPs disulfide bonding patterns
- the modules used in MURPs are natural or non-naturally occurring cysteine (C)-contaming scaffold exhibiting a binding specificity towards a target molecule
- the non-naturally occurring cysteine (C)-containing scaffold comprise intra-scaffold cysteines according to a pattern selected from the group of permutations represented by the formula Error! Objects cannot be created from editing field codes.
- n equals to the predicted number of disulfide bonds formed by the cysteine residues
- Error! Objects cannot be created from editing field codes represents the product of (2i-l), where i is a positive integer ranging from 1 up to n.
- the natural or non- naturally occurring cysteine (C)-containing module comprises a polypeptide having two disulfide bonds formed by pairing cysteines contained in the polypeptide according to a pattern selected from the group consisting of C 1"2 ' 3 ⁇ *, C 1"3 ' 2A , and C 1"4 ' 2"3 , wherein the two numerical numbers linked by a hyphen indicate which two cysteines counting from N-terminus of the polypeptide are paired to form a disulfide bond.
- the natural or non-naturally occurring cysteine (C)-containing module comprises a polypeptide having three disulfide bonds formed by pairing intra-scaffold cysteines according to a pattern selected from the group consisting of C 1'2 ' 3 ⁇ 5'6 , c 1"2 - 3"5 - 4 ⁇ , c 1"2 - 3"6 ' 4 - 5 , c 1 ' 3 ' 2 ⁇ 5 - 6 , cr 3 - 2 - 5 - 4 " 6 , C 1"3 ' « > 4 ⁇ , C " 4,_-3.5-6 5 cl -4,2-6,3- 5> c >-5, 2-3. « C ,-,, M, « C I - S .
- the natural or non-naturally occurring cysteine (C)- containing module comprises a polypeptide having at least four disulfide bonds formed by pairing cysteines contained in the polypeptide according to a pattern selected from the group of permutations defined by the formula above.
- the natural or non-naturally occurring cysteine (C)-containing module comprises a polypeptide having at least five, six, or more disulfide bonds formed by pairing intra- protein cysteines according to a pattern selected from the group of permutations represented by the formula above.
- Any of the cysteine-containing proteins or scaffolds disclosed in the co-pending applications [serial nos. 11/528,927 and 11/528,950 which are incorporated herein by reference in their entiety] are candidate binding modules.
- Binding modules can also be selected from libraries of cysteine-constrained cyclic peptides with 4, 5, 6, 7, 8, 9, 10, 11 and 12 randomized or partially randomized amino acids between the disulfide-bonded cystines (e.g., in a build-up manner), and in some cases additional randomized amino acids on the outside of the cystine pair can be constructed using a variety of methods.
- Library memders with specificity for a target of interest can be identified using various methods including phage display, ribosomal display, yeast display and other methods known in the art.
- Such cyclic peptides can be utilized as binding modules in MlIRPs.
- buildup approaches that lead to binding modules containing more than one disulfide bond.
- One particular buildup approach is illustrated in Fig. 25. It is based on the addition of a single cysteine plus multiple randomized residues on the N-te ⁇ ninal side of the previously selected cyclic peptide, as well as on the C-terminal side.
- Such buildup libraries can contain between 1 and 12 random positions on the N-terminal as well as on the C-terminal side of a cyclic peptide.
- the distance between the cysteine residues in the newly added random flanks and the cysteine residues in the cyclic peptide can be varied between 1 and 12 residues.
- Such buildup approaches can be performed with clone-specific primers so that it leaves no fixed sequence between the library areas as shown in Fig. 25, or it can be performed with primers that use (and thus leave) a fixed sequence on both sides of the previously selected peptide and therefore these same primers can be used for any previously selected clone as illustrated in Fig. 26.
- the method illustrated in Fig. 26 can be applied to a collection of cyclic peptides with specificity for a target of interest. Both buildup approaches were shown to work for anti-VEGF affinity maturation by build-up. This approach can be repeated to generate binding modules with six or more cysteine residues.
- FIG. 27 Another buildup of a one-disulfide into a 2-disulfide sequence is illustrated in Fig. 27. It involves the dimerization of a previously selected pool of 1 -disulfide peptides with itself so that the preselected peptide pool ends up in the N-terminal as well as in the C-terminal position. This approach favors the build up of 2-disulfide sequences that recognize two separate epitopes on a target.
- Another buildup approach involves the addition of a (partially) randomized sequence of 6-15 residues containing two cysteines that are spaced 4,5,6,7,8,9,or 10 amino acids apart, with optionally additional randomized positions outside the linked cysteines.
- This 2-cysteine random sequence is added on the N- terminal side of the previously selected peptide, or on the C-terminal side.
- This approach favors a 1-23-4 DBP, although other DBPs may be formed.
- This approach can be repeated to generate binding modules with six or more cysteine residues.
- Binding modules can be constructed based on natural protein scaffolds. Such scaffolds can be identified by data base searching. Libraries that are based on natural scaffolds can be subjected to phage display panning followed by screening to identify sequences that specifically bind to a target of interest.
- a wide selection of natural scaffolds is available for constructing the binding modules.
- the choice of a particular scaffold will depend on the intended target.
- Non-limiting examples of natural scaffolds include snake-toxin-like proteins such as snake venom toxins and extracellular domain of human cell surface receptors.
- Non-limiting examples of snake venom toxins are Erabutoxin B, gamma-Cardiotoxin, Faciculin, Muscarininc toxin, Erabutoxin A, Neurotoxin I, Cardiotoxin V4II (Toxin III), Cardiotoxin V, alpha- Cobratoxin, long Neurotoxin 1, FS2 toxin, Bungarotoxin, Bucandin, Cardiotoxin CTXI, Cardiotoxin CTX IIB, Cardiotoxin II, Cardiotoxin III, Cardiotoxin IV, Cobrotoxin 2, alpha-toxins, Neurotoxin II (cobrotoxin B), Toxin B (long neurotoxin), Candotoxin, Bucain.
- (human) cell surface receptors include CD59, Type II activin receptor, BMP receptor Ia ectodomain, TGF- beta type II receptor extracellular domain.
- Other natural scaffolds include but are not limited to A- domains, EGF, Ca-EGF, TNF-R, Notch, DSL, Trefoil, PD, TSPl, TSP2, TSP3, Anato, Integrin Beta, Thyroglobulin, Defensin 1, Defensin 2, Cyclotide, SHKT, Disintegrins, Myotoxins, Gamma-Thioneins, Conotoxin, Mu-Conotoxin, Omega-Atracotoxins, Delta-Atracotoxins, as well as additional families disclosed in co-pending applications serial nos.
- Display methods where a library of variants is expressed on the surface of a phage, protein, or cell. These methods have in common, that that DNA or RNA coding for each variant in the library is physically linked to the ligand. This enables one to detect or retrieve the ligand of interest and then determine its peptide sequence by sequencing the attached DNA or RNA. Display methods allow one skilled in the art to enrich library members with desirable binding properties from large libraries of random variants. Frequently, variants with desirable binding properties can be identified from enriched libraries by screening individual isolates from an enriched library for desirable properties. Examples of display methods are fusion to lac repressor (Cull, M., et al. (1992) Proc.
- Phage typically carry 3-5 copies of this protein and thus phage in such a library will in most cases carry between 3-5 copies of a library member.
- This approach is referred to as multivalent display.
- An alternative is phagemid display where the library is encoded on a phagemid. Phage particles can be formed by infection of ceils carrying a phagemid with a helper phage. (Lowman, H. B., et al. (1991) Biochemistry, 30: 10832-10838). This process typically leads to monovalent display. In some cases, monovalent display is preferred to obtain high affinity binders. In other cases multivalent display is preferred (O'Connell, D., et al. (2002) J MoI Biol, 321: 49-56).
- a variety of methods have been described to enrich sequences with desirable characteristics by phage display.
- One can immobilize a target of interest by binding to immunotubes, microtiter plates, magnetic beads, or other surfaces.
- a phage library is contacted with the immobilized target, phage that lack a binding ligand are washed away, and phage carrying a target specific ligand can be eluted by a variety of conditions. Elution can be performed by low pH, high pH, urea or other conditions that tend to break protein-protein contacts.
- Bound phage can also be eluted by adding E. coli cells such diat eluting phage can directly infect the added E. coli host.
- protease which can degrade the phage-bound ligand or the immobilized target.
- Proteases can also be utilized as tools to enrich protease resistant phage-bound ligands. For instance, one can incubate a library of phage-bound ligands with one or more (human or mouse) proteases prior to panning on the target of interest. This process degrades and removes protease-labile ligands from the library (Kristensen, P., et al. (1998) Fold Des, 3: 321-8). Phage display libraries of ligands can also be enriched for binding to complex biological samples.
- Examples are the panning on immobilized cell membrane fractions (Tur, M. K., et al. (2003) IntJ MoI Med, 11: 523-7), or entire cells (Rasmussen, U. B., et al. (2002) Cancer Gene Ther, 9: 606-12; Kelly, K. A., et al. (2003) Neoplasia, 5: 437-44).
- Phage panning can also be performed in live patients or animals.
- Random mixtures of nucleotides can be utilized to synthesize oligonucleotides that contain one or multiple random positions. This process allows one to control the number of random positions as well as the degree of randomization. In addition, one can obtain random or semi-random DNA sequences by partial digestion of DNA from biological samples. Random oligonucleotides can be used to construct libraries of plasmids or phage that are randomized in pre-defined locations.
- Kunkel mutagenesis uses templates containing randomly incorporated uracil bases which can be obtained from E. coli strains like CJ236.
- the uracil-containing template strand is preferentially degraded upon transformation into E. coli while the in vitro synthesized mutagenized strand is retained.
- most transformed cells carry the mutagenized version of the phagemid or phage.
- a valuable approach to increase diversity in a library is to combine multiple sub-libraries. These sub-libraries can be generated by any of the methods described above and they can be based on the same or on different scaffolds.
- a useful method to generate large phage libraries of short peptides has been recently described (Scholle, M.
- This method is related to the Ku ⁇ kel approach but it does not require the generation of single stranded template DNA that contains random uracil bases. Instead, the method starts with a template phage that carries one or more mutations close to the area to be mutagenized and said mutation renders the phage non-infective.
- the method uses a mutagenic oligonucleotide that carries randomized codons in some positions and that correct the phage- inactivating mutation in the template. As a result, only mutagenized phage particles are infective after transformation and very few parent phage are contained in such libraries. This method can be further modified in several ways.
- This approach now yields libraries of more than 1Oe 10 transformants (up to lOel 1) with a single transformation, so that a single library with a diversity of 10el2 is expected from 10 transformations.
- Another variation of the Scholle method is to design the mutagenic oligonucleotide such that an amber stop codon in the template is converted into an ochre stop codon, and an ochre into an amber in the next cycle of mutagenesis.
- the template phage and the mutagenized library members must be cultured in different suppressor strains of E. coli, alternating an ochre suppressor with amber suppressor strains. This allows one to perform successive rounds of mutagenesis of a phage by alternating between these two types of stop codons and two suppressor strains.
- the megaprimer is a long ssDNA that was generated from the library inserts of the selected pool of phage from the previous round of panning.
- the goal is to capture the full diversity of library inserts from the previous pool, which was mutagenized in one or more areas, and transfer it to a new library in such a way that an additional area can be mutagenized.
- the megaprimer process can be repeated for multiple cycles using the same template which contains a stop-codon in the gene of interest.
- the megaprimer is a ssDNA (optionally generated by PCR) which contains 1) 5' and 3' overlap areas of at least 15 bases for complementarity to the ssDNA template, and 2) one or more previously selected library areas (1,2,3,4 or more) which were copied (optionally by PCR) from the pool of previously selected clones, and 3) a newly mutagenized library area that is to be selected in the next round of panning.
- the megaprimer is optionally prepared by 1) synthesizing one or more oligonucleotides encoding the newly synthesized library area and 2) by fusing this, optionally using overlap PCR, to a DNA fragment (optionally obtained by PCR) which contains any other library areas which were previously optimized.
- Run-off or single stranded PCR of the combined (overlap) PCR product is used to generate the single stranded megaprimer that contains all of the previously optimized areas as well as the new library for an additional area that is to be optimized in the next panning experiment.
- This approach is expected to allow affinity maturation of proteins using multiple rapid cycles of library creation generating lOel 1 to 10el2 diversity per cycle, each followed by panning.
- a variety of methods can be applied to introduce sequence diversity into (previously selected or naive) libraries of microproteins or to mutate individual microprotein clones with the goal of enhancing their binding or other properties like manufacturing, stability or immunogenicity.
- all the methods that can be used to generate libraries can also be used to introduce diversity into enriched (previously selected) libraries of microproteins.
- DNA shuffling (Stemmer, W. P. C. (1994) Nature, 370: 389-391), which generates recombinants of individual sequences in an enriched library.
- Shuffling can be performed using a variety modified PCR conditions and templates may be partially degraded to enhance recombination.
- An alternative is the recombination at pre-defined positions using restriction enzyme-based cloning.
- methods utilizing type IIS restriction enzymes that cleave DNA outside of their sequence recognition site (Collins, J., et al. (2001) J Biotechnol, 74: 317-38.
- Restriction enzymes that generate non-palindromic overhangs can be utilized to cleave plasmids or other DNA encoding variant mixtures in multiple locations and complete plasmids can be reassembled by ligation (Berger, S. L., et al. (1993) Anal Biochem, 214: 571-9).
- Another method to introduce diversity is PCR-mutagenesis where DNA sequences encoding library members are subjected to
- PCR under mutagenic conditions have been described that lead to mutations at relatively high mutation frequencies (Leung, D., et al. (1989) Technique, 1: 11-15).
- a polymerase with reduced fidelity can be employed (Vanhercke, T., et al. (2005) Anal Biochem, 339: 9-14).
- a method of particular interest is based on mutator strains (Irving, R. A., et al. (1996) Immunotechnology, 2: 127-43; Coia, G., et al. (1997) Gene, 201: 203-9). These are strains that carry defects in one or more DNA repair genes. Plasmids or phage or other DNA in these strains accumulate mutations during normal replication.
- the libraries can be further treated to reduce artifacts.
- Known artifacts of phage panning include 1) no- spec ⁇ ic binding based on hydrophobicity, and 2) multivalent binding to the target, either due to a) the pentavalency of the pill phage protein, or b) due to the formation of disulfides between different microproteins, resulting in multimers, or c) due to high density coating of the target on a solid support and
- Examples of context dependence are all of the constant sequences, including pill protein, linkers, peptide tags, biorin-streptavidin, Fc and other fusion proteins that contribute to the interaction.
- the typical approach for avoiding context-dependence involves switching the context as frequently as practical in order to avoid buildup. This may involve alternating between different display systems (ie Ml 3 versus T7, or M13 versus Yeast), alternating the tags and linkers that are used, alternating the (solid) support used for immobilization (ie immobilization chemistry) and alternating the target proteins itself (different vendors, different fusion versions).
- Library treatments can also be used to select for proteins with preferred qualities.
- One option is the treatment of libraries with proteases in order to remove unstable variants from the library.
- the proteases used are typically those that would be encountered in the application.
- For pulmonary delivery one would use lung proteases, for example obtained by a pulmonary lavage.
- mixtures of single purified proteases An extensive list of proteases is shown in [Appendix E]. The phage themselves are exceptionally resistant to most proteases and other harsh treatments.
- One approach is to apply a genetic selection for protein expression level, folding and solubility as described by A. C. Fisher et al. (2006) Genetic selection for protein solubility enabled by die folding quality control feature of the twin-arginine translocation pathway. Protein Science (online). After panning of display libraries (optional), one would like to avoid screening thousands of clones at the protein level for target binding, expression level and folding.
- An alternative is to clone the whole pool of selected inserts into a betalactamase fusion vector, which, when plated on betalactam, the authors demonstrated to be selective for well-expressed, fully disulfide bonded and soluble proteins.
- Filter lift is another methodology that can be with bacterial colonies grown at high density on large agar plates(10e2-10e5). Small amounts of some proteins are secreted into the media and end up bound to the filter membrane (nitrocellulose or nylon). The filters are then blocked in non-fat milk, 1% Casein hydrolysate or a 1% BSA solution and incubated with the target protein that has been labeled with a fluorescent dye or an indicator enzyme (directly or indirectly via antibodies or via biotin-streptavidin).
- the location of the colony is determined by overlaying the filter on the back of the plate and all of the positive colonies are selected and used for additional characterization.
- the advantage of filter lifts is that it can be made to be affinity-selective by reading the signal after washing for different periods of time. The signal of high affinity clones 'fades' slowly, whereas the signal of low affinity clones fades rapidly.
- affinity characterization typically requires a 3-point assay with a well-based assay and may provide better clone-to- clone comparability than well-based assays. Gridding of colonies into an array is useful since it minimizes differences due to colony size or location.
- the subject MURPs can contain N-terminal modules (NM), which are particularly useful e.g., in facilitating production of the MURPs.
- the NM can be a single methionine residue when the products is expressed in the E. coli cytoplasm.
- a typical product format is an URP fused to a therapeutic protein, which is expressed in the bacterial cytoplasm so that the N-terminus is formyl-methionine.
- the formyl- methionine can either be permanent or temporary, if it is removed by biological or chemical processing.
- the NM can also be a peptide sequence that has been engineered for proteolytic processing, which can be used to remove tags or to remove fusion proteins.
- the N-terminal module can be engineered to facilitate the purification of the MURP by including an affinity tag such as the Flag-, Myc-, HA- orHis-tag.
- the N- terminal module can also include an affinity tag that can be used for the detection of the MURP.
- An NM can be engineered or selected for high-level expression of the MURP. It can also be engineered or selected to enhance the protease resistance of the resulting MURP.
- MURPs can be produced with an N-terminal module that facilitates expression and/or purification. This N-terminal module can be cleaved off during the production process with a protease, such that the final product does not contain an N-terminal module.
- the N-terminal module can also contain a processing site that can be cleaved by a specific protease like factor Xa, thrombin, or enterokinase, Tomato Etch Virus (TEV) protease. Processing sites can also be designed to be cleavable by chemical hydrolysis. An example is the amino acid sequence asp- pro that can be cleaved under acidic conditions.
- An N-terminal module can also be designed to facilitate the purification of a MURP.
- N-terminal modules can be designed to contain multiple his residues which allow product capture by immobilized metal chromatography.
- N-terminal modules can contain peptide sequences that can be specifically captured or detected by antibodies. Examples are FLAG, HA, c-myc.
- MURPs can contain a C-terminal module, which are particularly useful e.g., in facilitating production of the MURPs.
- C-terminal module can comprise a cleavage site to effect proteolytic processing to remove sequences that are fused and hence increasing protein expression or facilitating purification.
- the C-terminal module can also contain a processing site that can be cleaved by a specific protease like factor Xa, thrombin, TEV protease or enterokinase. Processing sites can also be designed to be cleavable by chemical hydrolysis.
- An example is the amino acid sequence asp-pro that can be cleaved under acidic conditions.
- the C-terminal module can be an affinity tag aimed at facilitating the purification of the MURP.
- C-terminal modules can be designed to contain multiple his residues which allow product capture by immobilized metal chromatography.
- C-terminal modules can contain peptide sequences that can be specifically captured or detected by antibodies.
- Non-limiting examples of the tags include FLAG-, HA-, c-myc, or His-tag.
- C-terminal module can also be engineered or selected to enhance the protease resistance of the resulting MURP.
- the N-termimis of the protein can be linked to its own C-terminus.
- linking these two modules can be carreid out by creating an amino acid-like natural linkage (peptide bond) or by using an exogenous linking entity.
- peptide bond amino acid-like natural linkage
- exogenous linking entity e.g., cyclo ⁇ des, a family of small proteins in which this occurs naturally. Adopting a structural format like cyclotides is exepcted to provide additional stability against exo-proteases. Such intramolecular linkage typically works better at lower protein concentrations.
- MURPs can comprise one or multiple effector modules (EMs), or none at all. Effector modules typically do not provide the targeting, but they provide an activity required for therapeutic effect, like cell-killing.
- EMs can be pharmaceuticaly active small molecules (ie toxic drugs), peptides or proteins. Non-limiting examples are cytokines, antibodies enzymes, growth factors, hormones, receptors, receptor agonists or antagonists, whether whole or a fragment or domain thereof.
- Effector modules can also comprise peptide sequences that carry chemically linked small molecule drugs, whether synthetic or natural.
- these effector molecules can be linked to the effector module via chemical linkers, which may or may not be cleaved under selected conditions leading to a release of the toxic activity.
- EMs can also include radioisotopes and their chelates, as well as various labels for PET and MRI.
- Effector modules can also be toxic to a cell or a tissue.
- MURPs that contain toxic effector modules and binding modules with specificity for a diseased tissue or disease cell type. Such MURPs can specifically accumulate in a diseased tissue or in diseased cells and the can exert their toxic action preferentially in the diseased cells or tissues.
- exemplary effector modules are exemplary effector modules.
- Enzymes - Effector modules can be enzymes. Of particular interest are enzymes that degrade metabolites that are critical for cellular growth like carbohydrates or amino acids or lipids or co-factors. Other examples for effector modules with enzymatic activity are RNase, DNase, and phosphatase, asparaginase, histidinase, arginase, betalactamase. Effector modules with enzymatic activity can be toxic when delivered to a tissue or cell. Of particular interest are MURPs that combine effector modules that are toxic and binding modules that bind specifically to a diseased tissue. Enzymes that convert an inactive prodrug into an active drug at the tumor site are also potential effector modules.
- the subject MURP can contain an effector that is a drug.
- sequences can be designed for the organ-selective delivery of drug molecules.
- An example is illustrated in figure 8.
- An URP sequence can be fused to a protein that preferentially binds to diseased tissue.
- the same URP sequence can contain one or more amino acid residues that can be modified for the attachment of drug molecules.
- Such a conjugate can bind to diseased tissue with high specificity and the attached drug molecules can result in local action while minimizing systemic drug exposure.
- the MURP can be designed to facilitate the release of drug molecules at the target size by introducing protease-sensitive sites that can be cleaved by native proteases at the site of desired action.
- URP sequences for the design of drug delivery constructs.
- Many drug molecules that can be conjugated to targeting domains have significant hydrophobicity and the resulting conjugates tend to aggregate.
- hydrophilic URP sequences to such constructs one can improve the solubility of the resulting delivery constructs and as a consequence reduce the aggregation tendency.
- the use of URP sequences allows one to optimize the distance between the drug conjugation sites to facilitate complete conjugation.
- chemotherapeutic agents such as thiotepa and cyclosphosphamide (CYTOXANTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembicbin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as car
- 5-oxo-L-norleucine 5-oxo-L-norleucine, doxorubicin, epirubicin, esorubicin, idarubic ⁇ i, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytar
- paclitaxel (TAXOLTM, Bristol-Myers Squibb Oncology, Princeton, N.J.) and docetaxel (TAXOTERETM, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; camptothecin-11 (CPT-11); topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoic acid; esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives
- chemotherapeutic cell conditioners are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY 117018, onapristone, and toremifene (Fareston); and anti-androgens such as fhitamide, nilutamide, bicalutamide, leuprolide, goserelin, doxorubicin, daunomycin, duocarmycin, vincristin, and vinblastin.
- Other drugs that can be used as the effector modules include those that are useful for treating inflammatory conditions, cardiac diseases, infectious diseases, respiratory diseases, autoimmune diseases, neronal and muscular disorders, metabolic disorders, and cancers.
- Additional drugs that can be used as the effectors in MURPs include agents for pain and inflammation such as histamine and histamine antagonists, bradykinin and bradykinin antagonists, 5-hydroxytryptamine
- lipid substances that are generated by biotransformation of the products of the selective hydrolysis of membrane phospholipids, eicosanoids, prostaglandins, thromboxanes, leukotrienes, aspirin, nonsteroidal anti-inflammatory agents, analgesic-antipyretic agents, agents that inhibit the synthesis of prostaglandins and thromboxanes, selective inhibitors of the inducible cyclooxygenase, selective inhibitors of the inducible cyclooxygenase-2, autacoids, paracrine hormones, somatostatin, gastrin, cytokines that mediate interactions involved in humoral and cellular immune responses, lipid-derived autacoids, eicosanoids, /3-adrenergic agonists, ipratropium, glucocorticoids, methylxanthines, sodium channel blockers, opioid receptor agonists, calcium channel blockers, membrane stabilizers and leukotriene inhibitors.
- Radionuclides - MURPs can be designed for the tissue-targeted delivery of radionuclides as well as for imagin with radionuclides. URPs are ideal for imaging because the halflife can be optimized by changing the length of the URP.
- MURPs can be designed such that they only contain a single or a small defined number of amino groups that can be modified with chelating agents (such as DOTA) for radio isotopes such as technetium, indium, yttrium, (EXPAND). Alternative methods of conjugation are through reserved cysteine side chains.
- chelating agents such as DOTA
- radio isotopes such as technetium, indium, yttrium, (EXPAND).
- EXPAND chelating agents
- Alternative methods of conjugation are through reserved cysteine side chains.
- Such radionuclide-carrying MURPs can be employed for the treatment of tumors or other diseased tissues, as well as for imaging.
- Many pharmaceutically active proteins or protein domains can used as effector models in MURPs.
- cytokines examples are the following proteins as well as fragments of these proteins: cytokines, growth factors, enzymes, -receptors, microproteins, hormones, erythopoetin, adenosine deiminase, asparaginase, arginase, interferon, growth hormone, growth hormone releasing hormone, G-CSF, GM-CSM, insulin, hirudin, TNF- receptor, uricase, rasburicase, axokine, RNAse, DNAse, phosphatase, pseudomonas exotoxin, ricin, gelonin, desmoteplase, laronidase, thrombin, blood clotting enzyme, VEGF, protropin, somatropin, alteplase, interleukin, factor HV, factor VIII, factor X, factor IX, dornase, glucocerebrosidase, follitropiiL glucagon,
- Protease-activated MURPs To enhance the therapeutic index of an effector module, one can insert protease-labile sequences into URP sequences that are sensitive to proteases that are preferentially found in serum or in the target tissue to be treated by the MURP. This approach is illustrated in figure 9. Some designs allows one to construct proteins that are selectively activated when reaching a target tissue. Of particular interest are MURPs that are activated at a disease site. To facilitate such target-specific activation one can attach URP sequences in close proximity to the active site or receptor binding site of the effector module such that the resulting fusion protein has limited biological activity. Of particular interest is the activation of an effector module at a tumor site.
- PSA prostate specific antigen
- doxorubicin a serine protease
- Prodrugs consisting of a PSA-labile peptide conjugated to the cancer drug doxorubicin have shown selective activation in prostate tissue [DeFeo-Jones, D., et al. (2000) Nat Med, 6: 1248].
- proteins with cytostatic or cytotoxic activity like TNFalpha, and many cytokines and interleukins.
- Another application is the selective activation of proteins at the site of inflammation or at site of virus or bacterial infection.
- Methods of production - MURPs containing URP sequences can be produced using molecular biology approaches that are well know in the art.
- a variety of cloning vectors are available for various expression systems like mammalian cells, yeast, and microbes.
- expression hosts are E. coli, S. cerevisiae, P. pastoris, and Chinese hamster ovary cells.
- hosts that have been optimized to widen their codon usage are a host that has been modified to enhance expression of GRS. That can be done by providing DNA that encodes glycine-specific tRNAs.
- the DNA encoding the enhanced protein can be operationally linked to a promoter sequences.
- the DNA encoding the enhanced protein as well as the operationally linked promoter can be part of a plasmid vector, viral vector or it can be inserted into the chromosome of the host.
- the MURPs can adopt a variety of formats.
- the MURPs can contain URPs that are fused to pharmaceutically active proteins to produce slow-release products. Such products can be injected or implanted locally for instance into or under the skin of a patient. Due to its large hydrodynamic radius the URP sequences-containing product is slowly released from the injection or implantation site which leads to a reduction of the frequency of injection or implantation.
- the URP sequences can be designed to contain regions that bind to cell surfaces or tissue in order to prolong the local retention of the drug at the injection site.
- URP-containing products that can be formulated as soluble compounds but form aggregates or precipitates upon injection. This aggregation or precipitation can be triggered by a change in pH between the formulated product and the pH at the injection site.
- URP-containing products that precipitate or form aggregates as a result of a change in redox conditions.
- URP-containing product that is stabilized in solution by addition of non-active solutes, but that precipitates or aggregates upon injection as a result of diffusion of the solubilizing solutes.
- Another approach is to design URP-containing products that contain one or multiple Lysine or Cysteine residues in their URP sequence and that can be cross-linked prior to injection.
- the MURP is monomeric (here meaning not-crosslinked) when manufactured and formulated and when injected, but after subcutaneous injection the protein starts to crosslink with itself or with native human proteins, forming a polymer under the skin from which active drug molecules are freed only very gradually.
- release can be by disulfide bond reduction or disulfide shuffling as illustrated in Fig. 18, or it can be mediated by proteolysis as shown in Fig. 19, releasing active fragments into the circulation. It is important that these active fragments are large enough to have a long halflife, because the longer their secretion halflife, the lower the dose of the released protein can be, allowing the use of a lower dose of product to be injected or a longer time between injections.
- a protein drug would be manufactured with a cyclic peptide in it (one or more). This cyclic peptide may or may not be involved in binding to the target. This protein is manufactured with the cyclic peptide formed, ie in oxidized form, to simplify purification. However, the product is then reduced and formulated to keep the protein in reduced form.
- the cyclic peptide reduces at a low concentration of reducing agent, such as .0.25, 0.5, 1.0, 2.0, 4.0 or 8.0 mM Dithiothreitol or Betamercaptoethanol or cysteine or equivalent reducing agent, so that the cyclic peptide can be reduced without reducing other disulfide containing protein modules in the product.
- reducing agent such as .0.25, 0.5, 1.0, 2.0, 4.0 or 8.0 mM Dithiothreitol or Betamercaptoethanol or cysteine or equivalent reducing agent.
- FDA approved reducing agents is preferred, such as cysteine or glutathione.
- the low molecular weight reducing agent diffuses away rapidly or is neutralized by human proteins, exposing the drug to an oxidizing environment while it is still at a high molar concentration, which causes crosslinking of cysteines located on different protein chains, which leads to polymerization of the drug at the injection site.
- disulfide reduction and oxidation will cause disulfide reshuffling, which will lead to cyclic peptide reformation and monomerization and resolubilization of the drug.
- the release of the drug from the polymer can also occur via proteolysis which could be targeted and controlled or increased by building in cleavage sites for serum proteases.
- the crosslinking ot the proteins could also be performed with a chemical protein-protein crosslinking agent, such as the ones listed in [table x]. Ideally, this is an already FDA-approved agent, such as those used for vaccine conjugation or conjugation of chemicals to proteins.
- disulfides instead of using disulfides, one can also stabilize proteins against proteolytic degradation using a wide variety of crosslinking agents. Most of the agents below are sold by Pierce Chemicals under that same name and instructions for their use are available online (www.piercenet.com). The agents that result in the ' same chain-to-chain distance as obtained with disulfides are the most likely to be useful for this application.
- the short-linker agents such as DFDNB are the most promising.
- the interchain distance can be readily determined from the structures of the chemicals as shown in www.piercenet.com.
- Homobifunctional crosslinking agents have two identical reactive groups and are often used in a onestep chemical crosslinking procedure.
- Examples are BS3 (a non-cleavable water-soluble DSS analog), BSOCOES (base-reversible), DMA (Dimethyl adipimidate-2HCl), DMP (Dimethyl pimelimidate-2HCl), DMS (Dimethyl suberimidate-2HCl), DSG (5-carbon analog of DSS), DSP (Lomant's reagent), DSS (non- cleavable), DST (cleavable by oxidizing agents), DTBP (Dimethyl 3,3 '-dithiobispropionimidate-2HCl), DTSSP, EGS, Sulfo-EGS, THPP, TSAT, DFDNB (l,5-Difiuoro-2,4-dinitrobenzene) is especially useful for crosslinking between small spacial distances (Kornblatt, J.
- Sulfhydryl-reactive homobifunctional crosslinking agents are homobifunctional protein crosslinkers that react with sulfhydryls are often based on maleimides, which react with -SH groups at pH 6.5-7.5, forming stable thioether linkages.
- BM[PEO]3 is an 8-atom polyether spacer that reduces potential for conjugate precipitation in sulfydryl-to-sulfhydryl cross-linking applications.
- BM[PEO]4 is similar but with an 11- atom spacer.
- BMB is a non-cleavable crosslinker with a four-carbon spacer.
- BMDB makes a linkage that can be cleaved with periodate.
- BMH is a widely used hom ⁇ bifunctional sulfhydryl-reactive crosslinker.
- BMOE has an especially short linker.
- DPDPB and DTME are cleavable crosslinkers.
- HVBS does not have the hydrolysis potential of meleimides.
- TMEA is another option.
- Hetero-bifunctional crosslinking agents have two different reactive groups. Examples are NHS-esters and amines/hydrazines via EDC activation,
- Amine-Sulfhydryl reactive bifunctional crosslinkers are AMAS, APDP, BMPS, EMCA, EMCS, GMBS, KMUA, LC-SMCC, LC- SPDP, MBS, SBAP, SIA (extra short), SLAB, SMCC, SMPB, SMPH 5 SMPT, SPDP, Sulfo-EMCS, Sulfo- GMBS, Sulfo-KMUS, Sulfo-LC-SMPT, Sulfo-LC-SPDP, Sulfo-MBS, Sulfo-SIAB, Sulfo-SMCC, Sulfo- SMPB.
- Amino-group reactive heterobifunctional crosslinking agents are ANB-NOS, MSA, NHS-ASA,
- SADP SAED, SAND, SANPAH, SASD, SFAD, Sulfo-HSAB, Sulfo-NHS-LC-ASA, Sulfo-SADP, Sulfo- SANPAH, TFCS.
- a different slow release format has the drug labeled with a His6 tag, which is mixed and co-injected with Nickel-Nitrilotriacetic acid-conjugated beads (Ni-NTA beads), a GMO version of the ones that are available from Qiagen.
- the drug would slowly teach off the beads, providing depot and slow release as illustrated in Fig. 20.
- the beads are optional and can be replaced by a crosslinked, polymeric Nickel- nitrilotriacetic acid that leads to assembly of an even larger polymer.
- URP sequences can contain sequences that are known to form multimers- like alpha2D [Hill, R., et al.
- Multimerization modules are amino acid sequences that facilitate dimer or multimer formation of
- Multimerization modules may bind to themselves to form dimers or multimers. Alternatively, multimerization modules can bind to other modules of the MURP. These can be leucine zippers or small peptides like Hydra head activator derivatives (SKVILF-like) which forms anriparallel homopolymers, or peptides like RARARA and DADADA, which form high affinity antiparallel heteropolymers. Using one. two or more copies of these peptides one can force the formation of protein dimers, linear multimers or branched multimers.
- SKVILF-like Hydra head activator derivatives
- the affinity of the association can be tailored by changing the type, length and composition of the peptides. Some applications require peptides that form homodimers as illustrated in Fig. 21. Other applications require heterodimers. In some cases, once associated, the peptides can be locked into place by forming disulfide bonds between the two protein chains, typically on either side of the peptides. Multimerization modules are useful for linking two MURP molecules together (head to tail, head to head, or tail to tail) as illustrated in Fig. 21. The multimerization modules can be located on either the N- or C-terminus in order to form dimers. If the multimerization modules are present at both termini, long, linear multimers will be formed.
- branched polymeric networks can be formed.
- the concepts of multimerization and chemical conjugation can be combined leading to useful for halflife extension and depot formation, leading to slow release of active drug from the depot or injection site as illustrated in Fig. 23.
- the subject MURPs can incorporate a genetic or universal URP.
- One approach is to express a URP containing a long URP module, which provides halflife and contains multiple (typically 4-10) lysines ( or other sites) that allows site-specific conjugation of peptides (ie linear, cyclic, 2SS, 3 SS, etc) that bind to a specific target.
- the URP module is generic and can be conjugated with any target-specific peptide.
- the linkage of the target-specific peptide to the URP is a directed linkage, so that residues on the URP can only react with a residue on the target-specific peptide and exhaustive coupling can only produce a single species, which is a URP that is linked to a peptide at every lysine, for example.
- This complex behaves like a high-avidity multimer in it's binding properties but is simple to manufacture.
- Fig. 24 The subject MURPs can also incorporate URPs to effect delivery across tissue barriers.
- URPs can be engineered to enhance delivery across the dermal, oral, buccal, intestinal, nasal, blood-brain, pulmonary, thecal, peritoneal, rectal, vaginal or many other tissue barriers.
- URP sequences can improve protease resistance of pharmaceutically active proteins and thus facilitate their uptake. It has been shown that protein uptake in the digestive system can be improved by adding molecular carriers. The main role of these carriers is an improvement of membrane permeability [Stoll, B. R., et al. (2000) J Control Release, 64: 217-28]. Thus one can include sequences into URP sequences that improve membrane permeability. Many sequences that improve membrane permeability are know and examples are sequences rich in arginine [Takenobu, T., et al. (2002) MoI Cancer Ther, 1: 1043-9].
- URP sequences that improve cellular or oral uptake of proteins by combining two functions, a reduction in proteolytic degradation of the protein of interest as well as an increase in membrane permeability of the fusion product.
- a sequence to the URP sequence that is sensitive to a protease that is preferentially located at in the target tissue for the drug of interest but is stable to proteases in the digestive tract.
- Examples of such URP sequences are sequences that contain long regions of GRS as well as sequences that are rich in basic amino acids in particular arginine and facilitate membrane transfer.
- URP can be utilized in a similar way to improve protein uptake via intranasal, intrapulmonary, or other routes of delivery.
- DR4/DR5 agonist - DR4 and DR5 are death receptors that are expressed on many tumor cells. These receptors can be triggered by trimerization which leads to cell death and tumor regression. Binding domains with specificity for DR4 or DR5 can be obtained by phage panning or other display methods: These DR4 or DR5-s ⁇ ecific binding domains can be multimerized using URP modules as linkers as illustrated in figure 12. Of particular interest are MURPs that contain three or more binding modules with specificity for DR4 or DR5 or both. As illustrated in Figure 12, MURPs can contain additional binding modules with sepecificity for tumor antigens that are overexpressed in tumor tissues.
- MURPs that specifically accumulate in tumor tissue and trigger cell death.
- MURPs can contain modules that bind either DR4 or DR5. Of particular interest are MURPs that contain binding modules that bind bodi DR4 and DR5.
- Tumor-targeted Interleukin 2- Interleukin 2 (IL2) is a cytokine that can enhance the immune response to tumor tissue.
- systemic IL2 therapy is characterized by significant side effects.
- MURPs can be constructed that combine binding domains with specificity for tumor antigens and IL2 as effector module as illustrated in Figure 13. Such MURP can selectively accumulate in tumor tissue and thus elicit a tumor- selective immune response while minimizing the systemic side effects of cytokine therapy.
- MURPs can target a variety of tumor antigens like EpCAM, Her2, CEA, EGFR, Thomsen Friedenreich antigen. Of particular utility are MURPs that bind to tumor antigens that show slow internalization. Similar MURPs can be designed using other cytokines or tumor necrosis factor-alfa as effector modules.
- Tumor-selective asparaginase - Asparaginase is used to treat patients with acute leukemia. Both asparaginase from E. coli and asparaginase from Erwinia are used for treatment. Both enzymes can lead to immunogenicity and hypersensitive reactions. Oncaspar is PEGylated version of asparaginase that has reduced immunogenicity.
- URP sequences to termini and/or to internal loops allows the direct recombinant manufacture of an asparaginase variant that is homogeneous and has low immunogenicity.
- URP sequences and attachment sites can be compared to determine the optimum position for URP sequence attachment.
- enzymes can degrade amino acids have reported antitumor activity. Examples are arginase, methioninase, phenylalanine ammonia lyase, and tryptophanase.
- VEGF vascular endothelial growth factor
- VEGF-Rl vascular endothelial growth factor
- VEGF-R2 vascular endothelial growth factor
- VEGF-R3 Her-1, Her-2, Her-3, EGF-I, EGF-2, EGF-3, Alpha3, cMet
- ICOS CD40L, LFA-I, c-Met, ICOS, LFA-I, IL-6, B7.1, B7.2, OX40, IL-Ib,.
- BDNF BDNF, bNGF, bECGF, BMP2,3,4,5,6,7,8; CRP, Cadherin6,8,l 1; Cathepsin A,B,C,D,E,L,S,V,X; CDl la/LFA-1, LFA-3 , GP2b3a, GH receptor, RSV F protein, IL-23 (p40, pl9), IL-12, CD80, CD86, CD28, CTLA-4, ⁇ 4 ⁇ l, ct4 ⁇ 7, TNF/Lymphotoxin, IgE, CD3, CD20, IL-6 , IL-6R, BLYS/BAFF, IL-2R, HER2, EGFR, CD33, CD52, Digoxin, Rho (D), Varicella, Hepatitis, CMV, Tetanus, Vaccinia, Antivenom, Botulinum, Trail-Rl, Trail-R2, cMet, TNF-R family, such as LA NGF-R, CD
- Lymphotoxin a/b receptor WsM, TL1A/TNFSF15, BAFF, BAFF-R/TNFRSF13C, TRAIL R2/TNFRSF10B, TRAIL R2/TNFRSF10B, Fas/TNFRSF6 CD27/TNFRSF7, DR3/TNFRSF25, HVEM/TNFRSF14, TROY/TNFRSF19, CD40 Ligand/TNFSF5, BCMA/TNFRSF17, CD30/TNFRSF8, LIGHT/TNFSF14, 4-1BB/TNFRSF9, CD40/TNFRSF5, GITR/TNFRSF18, Osteoprotegerin/TNFRSFl lB, RANK/TNFRSFll A, TRAIL R3/TNFRSF10C, TRAIL/TNFSFIO, TRANCE/RANK L/TNFSF11, 4-1BB
- TNF ⁇ alpha/TNFSFl A, EDAR, XEDAR, TNF RI/TNFRSFIA are human target proteins that are commercially available in purified form. Examples are: 4EBP1, 14-3-3 zeta, 53BP1, 2B4/SLAMF4, CCL21/6Ckine, 4-1BB/TNFRSF9, 8D6A, 4-1BB Ligand/TNFSF9, 8-oxo-dG, 4-Amino-l,8-naphthalimide, A2B5, Aminopeptidase LRAP/ERAP2, A33, Aminopeptidase N/ANPEP, Aag,Aminopeptidase P2/XPNPEP2, ABCG2, Aminopeptidase P 1/XPNPEP 1 ,
- ACE Aminopeptidase PILS/ARTS1, ACE-2, Amnionless, Actin, Amphiregulin, beta- Actin, AMPK alpha 1/2, Activin A, AMPK alpha 1, Activin AB, AMPK alpha 2, Activin B, AMPK beta 1, Activin C, AMPK beta 2, Activin RIA/ALK-2, Androgen R/NR3C4, Activin RIB/ALK-4, Angiogenic Activin RIIA, Angiopoietin-1, Activin RIIB, Angiopoietin-2, ADAM8, Angiopoietin-3, ADAM9, Angiopoietin-4, ADAM 10, Angiopoietin-like 1 , ADAM 12, Angiopoietin-like 2, ADAM 15, Angiopoietin-like 3,
- TACE/ADAM17 Angiopoietin-like 4, ADAM19, Angiopoietin-like 7/CDT6, ADAM33, Angiostatin, ADAMTS4, Annexin Al/Annexin I, ADAMTS5, Annexin A7, ADAMTSl, Annexin AlO, ADAMTSL- 1/Punctin, Annexin V, Adiponectin/Acrp30, ANP, AEBSF, AP Site, Aggrecan, APAF-I, Agrin, APC, AgRP, APE, AGTR-2, APJ, AIF, APLP-I, Akt, APLP-2, Aktl, Apolipoprotein AI, Akt2, Apolipoprotein B, Akt3, APP, Serum Albumin, APRIL/TNFSF13, ALCAM, ARC, ALK-I, Artemin, ALK-7,
- BMI-I BACE-I, BMP-1/PCP, BACE-2, BMP-2, Bad, BMP-3, BAFF/TNFSF13B, BMP-3b/GDF-10, BAFF R/TNFRSF13C, BMP-4, Bag-1, BMP-5 , BAK, BMP-6, BAMBI/NMA, BMP-7, BARDl, BMP-8, Bax, BMP-9, BCAM, BMP-10, Bcl-10, BMP-15/GDF-9B, BcI- 2, BMPR-IA/ALK-3, Bcl-2 related protein Al, BMPR-IB/ALK-6, Bcl-w, BMPR-II, Bcl-x, BNIP3L, BcI- xL, BOC, BCMA/TNFRSF17, BOK, BDNF, BPDE, Benzamide, Brachyury, Common beta Chain, B-Raf, beta
- Cathepsin C/DPPI Contactin-1, Cathepsin D, Contactin-2/TAGl, Cathepsin E, Contactin-4, Cathepsin F, Contactin-5, Cathepsin H, Corin, Cathepsin L, Cornulin, Cathepsin O, CORS26/ClqTNF,3, Cathepsin S, Rat Cortical Stem Cells, Cathepsin V, Cortisol, Cathepsin X/Z/P, COUP-TF I/NR2F1, CBP, COUP-TF II/NR2F2, CCI, COX-I, CCK-A R, COX-2, CCL28, CRACC/SLAMF7, CCRl, C-Reactive Protein, CCR2, Creatine Kinase, Muscle/CKMM, CCR3, Creatinine, CCR4, CREB, CCR5, CREG, CCR6,
- CD30 Ligand/TNFSF ⁇ CXCR6, CD31/PECAM-1, Cyclophilin A, CD34, Cyr61/CCN1, CD36/SR-B3, Cystatin A, CD38, Cystatin B, CD40/TNFRSF5, Cystatin C, CD40 Ligand/TNFSF5, Cystatin D, CD43, Cystatin E/M, CD44, Cystatin F, CD45, Cystatin H, CD46, Cystatin H2, CD47, Cystatin S, CD48/SLAMF2, Cystatin SA, CD55/DAF, Cystatin SN, CD58/LFA-3, Cytochrome c, CD59, Apocytochrome c, CD68, Holocytochrome c, CD72, Cytokeratin 8, CD74, Cytokeratin 14, CD83,
- Cytokeratin 19 CD84/SLAMF5, Cytonin, D6, DISPl, DAN, Dkk-1, DANCE, Dkk-2, DARPP-32, Dkk-3, DAX1/NR0B1, Dkk-4, DCC, DLEC, DCIR/CLEC4A, DLLI, DCAR, DLJL4, DcR3/TNFRSF6B, d- Luciferin, DC-SIGN, DNA Ligase IV 1 DC-SIGNR/CD299, DNA Polymerase beta, DcTRAIL R1/TNFRSF23, DNAM-I, DcTRAIL R2/TNFRSF22, DNA-PKcs, DDRl, DNER, DDR2, Dopa Decarboxylase/DDC, DEC-205, DPCR-I, Decapentaplegic, DPP6, Decorin, DPPA4, Dectin-l/CLECyA,
- EpCAM/TROP-1 EpCAM/TROP-1, ER alpha/NR3Al, EPCR, ER beta/NR3A2, Eph, Exonuclease III, EphAl, Exostosin- like 2/EXTL2, EphA2, Exostosin-like 3/EXTL3, EphA3, FABPl, FGF-BP, FABP2, FGF Rl -4, FABP3, FGF Rl, FABP4, FGF R2, FABP5, FGF R3, FABP7, FGF R4, FABP9, FGF R5, Complement Factor B, .
- Fgr 7 FADD FHR5, FAM3A, Fibronectin, FAM3B, Ficolin-2, FAM3C, Ficolin-3, FAM3D, FITC, Fibroblast Activation Protein alpha/FAP, FKBP38, Fas/TNFRSF6, Flap, Fas Ligand/TNFSF6, FLIP,
- IL-10 cIAP (pan), IL-10 R alpha, cIAP-l/HIAP-2, IL-10 R beta, cIAP-2/HIAP-l, IL-11, IBSP/Sialoprotein II, IL-11 R alpha, ICAM-1/CD54, IL-12, ICAM-2/CD102, IL-12/IL-23 p40, ICAM-3/CD50, IL-12 R beta 1, ICAM-5, IL-12 R beta 2, ICAT, IL-13, ICOS, IL-13 R alpha 1, Iduronate 2-Sulfatase/IDS, IL-13 R alpha 2, IFN 5 IL-15, EFN-alpha, j.L-15 R alpha, DFN-alpha 1, IL-16, IFN-alpha 2, IL-17, IFN-alpha 4b, IL-17 R, IFN-alpha A > IL-17 RC, IFN-alpha B2, IL-17 RD,
- NKp46/NCRl Nestin, NKp80/KLRFl, NETO2, NKX2.5, Netrin-1, NMDA R, NRl Subunit, Netrin-2, NMDA R, NR2A Subunit, Netrin-4, NMDA R, NR2B Subunit, Netrin-Gla, NMDA R, NR2C Subunit, Netrin-G2a, N-Me-6,7-diOH-TIQ, Neuregulin-1/NRGl, Nodal, Neuregulin-3/NRG3, Noggin, Neuritin, Nogo Receptor, NeuroDl, Nogo-A, Neurofascin, NOMO, Neurogenin-1, Nope, Neurogenin-2, Norrin, Neurogenin-3, eNOS, Neurolysin, iNOS, Neurophysin II, nNOS, Neuropilin-1,
- Notch-1 Neuropilin-2, Notch-2, Neuropoietin, Notch-3, Neurotrirnin, Notch-4, Neurturin, NOV/CCN3, NFAMl, NRAGE, NF-H, NrCAM, NFkBl, NRL, NFkB2, NT-3, NF-L, NT-4, NF-M, NTB- A/SLAMF6, NG2/MCSP, NTHl, NGF R/TNFRSF16, Nucleostemin, beta-NGF, Nurr-1/NR4A2, NGFI-B alpha/NR4Al, OAS2, Orexin B, OBCAM, OSCAR, OCAM, OSF-2/Periostin, OCIL/CLEC2d, Oncostatin M/OSM, OCILRP2/CLEC2i, OSM R beta, Oct-3/4, Osteoactivin/GPNMB, OGGl, Osteoadherin, OHg 1,
- Osteoprotegerin/TNFRSFl IB Oligodendrocyte Marker Ol, Otx2, Oligodendrocyte Marker O4, OV-6, OMgp, OX40/TNFRSF4, Opticin, OX40 Ligand/TNFSF4, Orexin A, RACKl, Ret, Radl, REV-ERB alpha/NRlDl, Radl 7, REV-ERB beta/NRlD2, Rad51, Rex-1, Rae-1, RGM-A, Rae-1 alpha, RGM-B, Rae- 1 beta, RGM-C, Rae-1 delta, Rheb, Rae-1 epsilon, Ribosomal Protein S6, Rae-1 gamma, RIPl, Raf-1, ROBOl, RAGE, ROBO2, RalA/RalB, ROBO3, RaIA, ROBO4, RaIB, ROR/NR1F1-3 (pan),
- RANK/TNFRSFl IA ROR alpha/NRIFl, CCL5/RANTES, ROR gamma/NRlF3, Rapl A/B, RTK-like O ⁇ han Receptor 1/RORl, RAR alpha/NRlBl, RTK-like Orphan Receptor 2/ROR2, RAR beta/NRlB2, RP105, RAR gamma/NRlB3, RPA2, Ras, RSK (pan) , RBP4, RSK1/RSK2, RECK, RSKl, Reg 2/PAP, RSK2, Reg I, RSK3, Reg IL RSK4, Reg III, R-Spondin 1, Reg HIa, R-Spondin 2, Reg IV, R-Spondin 3, Relaxin-1, RUNX1/CBFA2, Relaxin-2, RUNX2/CBFA1, Relaxin-3, RUNX3/CBFA3, RELM alpha, RXR alpha/NR2Bl, RELM beta, RXR beta/NR2B2, RELT/TNFR
- Se ⁇ in F2 Stanniocalcin 1, Se ⁇ in Gl/Cl Inhibitor, Stanniocalcin 2, Se ⁇ in 12, STATl, Serum Amyloid Al, STAT2, SF-1/NR5A1, STAT3, SGK, STAT4, SHBG, STAT5a/b, SHIP, STAT5a, SHP/NR0B2, STAT5b, SHP-I, STAT6, SHP-2, VE-Statin, SIGIRR, Stella/Dppa3, Siglec-2/CD22, STRO-I, Siglec- 3/CD33, Substance P, Siglec-5, Sulfamidase/SGSH, Siglec-6, Sulfatase Modifying Factor 1/SUMFl, Siglec-7, Sulfatase Modifying Factor 2/SUMF2, Siglec-9, SUMOl, Siglec-10, SUMO2/3/4, Siglec-11,
- RI/TNFRSFIA TC21/R-Ras2, TNF RILTNFRSFIB, TCAM-I, TOR, TCCR/WSX-1, TP-I, TC-PTP, TP63/TP73L, TDG, TR, CCJL25/TECK, TR alpha/NRlAl, Tenascin C, TR beta 1/NR1A2, Tenascin R, TR2/NR2C1, TER-119, TR4/NR2C2, TERT, TRA-1-85, Testican 1/SPOCKl, TRADD, Testican 2/SPOCK2,TRAF-l, Testican 3/SPOCK3, TRAF-2, TFPI, TRAF-3, TFPI-2, TRAF-4, TGF-alpha, TRAF- 6, TGF-beta, TRAIL/TNFSFl 0, TGF-beta 1 , TRAIL R1/TNFRSF10A , LAP (TGF-beta 1), TRAIL
- TGF-beta Latent TGF-beta 1, TRAIL R3/TNFRSF10C, TGF-beta 1.2, TRAIL R4/TNFRSF10D, TGF-beta 2, TRANCE/TNFSFl 1, TGF-beta 3, TfR (Transferrin R), TGF-beta 5, Apo-Transferrin, Latent TGF-beta bpl, Holo-Transferrin, Latent TGF-beta bp2, Trappin-2/Elafin, Latent TGF-beta bp4, TREM-I, TGF-beta RI/ALK-5, TREM-2, TGF-beta RII, TREM-3, TGF-beta RIIb, TREMLl/TLT-1 , TGF-beta Ri ⁇ , TRF-I , Thermolysin, TRF-2, Thioredoxin-1, TRH-degrading Ecto ⁇ nzyrn
- TRIM5 Thioredoxin-80, Tripeptidyl-Peptidase I, Thioredoxin-like 5/TRP14 , TrkA, THOPl, TrkB, Thrombomodulin/CD141, TrkC, Thrombopoietin, TROP-2, Thrombopoietin R, Troponin I Peptide 3,Thrombospondin-l,Troponin T, Thrombospondin-2, TROY/TNFRSF19, Thrombospondin-4, Trypsin 1, Thymopoietin, Trypsin 2/PRSS2, Thymus Chemokine-1 , Trypsin 3/PRSS3, Tie-l, Tryptase-5/Prss32, Tie-2, Tryptase alpha/TPSl, TIM-1/KIM-l/HAVCR, Tryptase beta-l/MCPT-7, TIM-2,
- TIM-3 Tryptase epsilon/BSSP-4, TIM-4, Tryptase gamma- 1 /TPSGl, TIM-5, Tryptophan Hydroxylase, TIM-6, TSC22, TIMP-I, TSG, TIMP-2, TSG-6, TIMP-3, TSK, TIMP-4, TSLP, TL1A/TNFSF15, TSLP R, TLRl, TSP50, TLR2, beta-III Tubulin, TLR3, TWEAK/TNFSF12, TLR4, TWEAK R/TNFRSF 12, TLR5, Tyk2, TLR6, Phospho-Tyrosine, TLR9, Tyrosine Hydroxylase, TLX/NR2E1, Tyrosine Phosphatase Substrate I, Ubiquitin, UNC5H3, Ugi, UNC5H4, UGRPl, UNG,
- Non-limiting examples include 5- hydroxytryptamine 3 receptor B subunit, 5-hydroxytryptamine 3 receptor precursor, 5-hydroxytryptamine receptor 3 subunit C, AAD 14 protein, Acetylcholine receptor protein, alpha subunit precursor, Acetylcholine receptor protein, beta subunit precursor, Acetylcholine receptor protein/ delta subunit precursor, Acetylcholine receptor protein, epsilon subunit precursor, Acetylcholine receptor protein, gamma subunit precursor, Acid sensing ion channel 3 splice variant b, Acid sensing ion channel 3 splice variant c, Acid sensing ion channel 4, ADP-ribose pyrophosphatase, mitochondrial precursor, AlphalA- voltage-dependent calcium channel, Amiloride-sensitive cation channel 1, neuronal, Amiloride-sensitive cation channel 2, neuronal Amiloride-sensitive cation channel 4, isoform 2, Amiloride-sensitive sodium channel,
- FXYD domain-containing ion transport regulator 3 precursor FXYD domain-containing ion transport regulator 5 precursor, FXYD domain-containing ion transport regulator 6 precursor, FXYD domain-containing ion transport regulator 7, FXYD domain-containing ion transport regulator 8 precursor, G protein-activated inward rectifier potassium channel 1, G protein-activated inward rectifier potassium channel 2, G protein-activated inward rectifier potassium channel 3, G protein-activated inward rectifier potassium channel 4, Gamma-aminobutyric-acid receptor alpha-1 subunit precursor, Gamma-aminobutyric- acid receptor alpha-2 subunit precursor, Gamma-aminobutyric-acid receptor alpha-3 subunit precursor, Gamma-aminobutyric-acid receptor alpha-4 subunit precursor, Gamma-aminobutyric-acid receptor al ⁇ ha-5 subunit precursor, Gamma-aminobutyric-acid receptor alpha-6 sub ⁇ nit precursor, Gamma-ami
- Glutamate receptor B Glutamate receptor delta-1 subunit precursor, Glutamate receptor, ionotropic kainate 1 precursor, Glutamate receptor, ionotropic kainate 2 precursor, Glutamate receptor, ionotropic kainate 3 precursor, Glutamate receptor, ionotropic kainate 4 precursor, Glutamate receptor, ionotropic kainate 5 precursor, Glutamate [NMDA] receptor subunit 3A precursor, Glutamate [NMDA] receptor subunit 3B precursor, Glutamate [NMDA] receptor subunit epsilon 1 precursor, Glutamate [NMDA] receptor subunit epsilon 2 precursor, Glutamate [NMDA] receptor subunit epsilon 4 precursor, Glutamate [NMDA] receptor subunit zeta 1 precursor, Glycine receptor alpha- 1 chain precursor, Glycine receptor alpha-2 chain precursor, Glycine receptor alpha-3 chain precursor, Glycine receptor beta chain precursor, H/ACA ribonucleoprotein complex subunit 1, High affinity immunoglob
- MGC15619 Inositol 1,4,5-trisphos ⁇ hate receptor type 1, Inositol 1 ,4,5-trisphosphate receptor type 2, Inositol 1 ,4,5-trisphosphate receptor type 3, Intermediate conductance calcium-activated potassium channel protein 4, Inward rectifier potassium channel 13, Inward rectifier potassium channel 16, Inward rectifier potassium channel 4, Inward rectifying K(+) channel negative regulator Kir2.2v, Kainate receptor subunit KA2a, KCNH5 protein, KCTD 17 protein, KCTD2 protein, Keratinocytes associated transmembrane protein 1, Kv channel-interacting protein 4, Melastatin 1, Membrane protein MLCl, MGC 15619 protein, Mucolipin-1, Mucolipin-2, Mucolipin-3, Multidrug resistance-associated protein 4, N-methyl-D-aspartate receptor 2C subunit precursor, NADPH oxidase homolog 1, Navl.5, Neuronal acetylcholine receptor protein, alpha- 10 subunit precursor, Neuronal acet
- Potassium channel tetramerisation domain containing 3 Potassium channel tetramerisation domain containing protein 12, Potassium channel tetramerisation domain containing protein 14, Potassium channel tetramerisation domain containing protein 2, Potassium channel tetramerisation domain containing protein 4, Potassium channel tetramerisation domain containing protein 5, Potassium channel tetramerization domain containing 10, Potassium channel tetramerization domain containing protein 13, Potassium channel tetramerization domain-containing 1, Potassium voltage-gated channel subfamily A member 1, Potassium voltage-gated channel subfamily A member 2, Potassium voltage-gated channel subfamily A member 4, Potassium voltage-gated channel subfamily A member 5, Potassium voltage-gated channel subfamily A member 6, Potassium voltage-gated channel subfamily B member 1, Potassium voltage-gated channel subfamily B member 2, Potassium voltage-gated channel subfamily C member 1 , Potassium voltage-gated channel subfamily C member 3, Potassium
- Voltage-dependent T-type calcium channel alpha- 1 G subunit Voltage-dependent T-type calcium channel alpha-lH subunit, Voltage-dependent T-type calcium channel alpha-ll subunit, Voltage-gated L-type calcium channel alpha- 1 subunit, Voltage-gated potassium channel beta-1 subunit, Voltage-gated potassium channel beta-2 subunit, Voltage-gated potassium channel beta-3 subunit, Voltage-gated potassium channel KCNA7.
- Exemplary GPCRs include but are not limited to Class A Rhodopsin like receptors such as Muse.
- acetylcholine Vertebrate type 1 Muse, acetylcholine Vertebrate type 2, Muse, acetylcholine Vertebrate type 3, Muse, acetylcholine Vertebrate type 4; Adrenoceptors (Alpha Adrenoceptors type 1, Alpha Adrenoceptors type 2, Beta Adrenoceptors type 1, Beta Adrenoceptors type 2, Beta Adrenoceptors type 3, Dopamine Vertebrate type 1, Dopamine Vertebrate type 2, Dopamine Vertebrate type 3, Dopamine Vertebrate type 4, Histamine type 1, Histamine type 2, Histamine type 3, Histamine type 4, Serotonin type 1, Serotonin type 2, Serotonin type 3, Serotonin type 4, Serotonin type 5, Serotonin type 6, Serotonin type
- Serotonin type 8 other Serotonin types, Trace amine, Angiotensin type 1, Angiotensin type 2, Bombesin, Bradykinin, C5a anaphylatoxin, Fmet-leu-phe, APJ like, Interleukin-8 type A, Interleukin-8 type B, Interleukin-8 type others, C-C Chemokine type 1 through type 11 and other types, C-X-C Chemokine (types 2 through 6 and others), C-X3-C Chemokine, Cholecystokinin CCK, CCK type A, CCK type B, CCK others, Endothelin, Melanocortin (Melanocyte stimulating hormone, Adrenocorticotropic hormone, Melanocortin hormone), Duffy antigen, Prolactin-releasing peptide (GPRlO), Neuropeptide Y (type 1 through 7), Neuropeptide Y, Neuropeptide Y other, Neurotensin, Opioid (type D,
- FF J QRFP Chemokine receptor-like, Neuromedin U like (Neuromedin U, PRXamide), hormone protein (Follicle stimulating hormone, Lutropin-choriogonadotropic hormone, Thyrotropin, Gonadotropin type I, Gonadotropin type II), (Rhod)opsin, Rhodopsin Vertebrate (types 1-5), Rhodopsin Vertebrate type 5, Rhodopsin Arthropod, Rhodopsin Arthropod type 1, Rhodopsin Arthropod type 2, Rhodopsin Arthropod type 3, Rhodopsin Mollusc, Rhodopsin, Olfactory (Olfactory II fam 1 through 13), Prostaglandin
- Prostaglandin E2 subtype EPl Prostaglandin E2/D2 subtype EP2, prostaglandin E2 subtype EP3, Prostaglandin E2 subtype EP4, Prostaglandin F2-alpha, Prostacyclin, Thromboxane, Adenosine type 1 through 3, Purinoceptors, Purinoceptor P2RY1-4,6,11 GPR91, Purinoceptor P2RY5,8,9,10 GPR35,92,174, Purinoceptor P2RY12-14 GPR87 (UDP-Glucose), Cannabinoid, Platelet activating factor , Gonadotropin- releasing hormone, Gonadotropin-releasing hormone type I, Gonadotropin-releasing hormone type II,
- Vasoactive intestinal polypeptide Latrophilin, Larrophilin type 1, Latrophilin type 2, Latrophilin type 3, ETL receptors, Brain-specific angiogenesis inhibitor (BAI), Methuselah-like proteins (MTH), Cadherin EGF LAG (CELSR), Very large G-protein coupled receptor, Class C Metabotropic glutamate / pheroraone, Metabotropic glutamate group I through III, Calcium-sensing like, Extracellular calcium- sensing, Pheromone, calcium-sensing like other, Putative pheromone receptors, GABA-B, GABA-B subtype 1, GABA-B subtype 2, GABA-B like, Orphan GPRC5, Orphan GPCR6, Bride of sevenless proteins (BOSS), Taste receptors (TlR), Class D Fungal pheromone, Fungal pheromone A-Factor like
- the subject MURPs can be designed to target any cellular proteins including but not limited to cell surface protein, secreted protein, cytosolic protein, and nuclear protein.
- a target of particular interest is an ion channel.
- Ion channels constitute a superfamily of proteins, including the family of potassium channels (K-channels), the family of sodium channels (Na-channels), the family of calcium channels (Ca-channels), the family of Chlorine channels (Cl-channels) and the family of acetylcholine channels.
- K-channels potassium channels
- Na-channels sodium channels
- Ca-channels calcium channels
- Cl-channels Chlorine channels
- acetylcholine channels acetylcholine channels.
- K-channel family contains subfamilies of voltage-gated K-channels called KvI .x and Kv3.x.
- Kv 1.x contains the channels KvI.1, Kvl.2 and Kvl.3, which correspond to the products of single genes and are thus called 'species'.
- the classification applies to the Na-, Ca-, Cl- and other families of channels as well.
- Ion channels can also be classified according to the mechanisms by which the channels are operated.
- the main types of ion channel proteins are characterized by the method employed to open or close the channel protein to either permit or prevent specific ions from permeating the channel protein and crossing a lipid bilayer cellular membrane.
- One important type of channel protein is the voltage-gated channel protein, which is opened or closed (gated) in response to changes in electrical potential across the cell membrane.
- the voltage-gated sodium channel 1.6 (Navl .6) is of particular interest as a therapeutic target.
- Another type of ion channel protein is the mechanically gated channel, for which a mechanical stress on the protein opens or closes the channel.
- Still another type is called a ligand-gated channel, which opens or closes depending on whether a particular ligand is bound to the protein.
- the ligand can be either an extracellular moiety, such as a neurotransmitter, or an intracellular moiety, such as an ion or nucleotide.
- Ion channels generally permit passive flow of ions down an electrochemical gradient , whereas ion pumps use ATP to transport against a gradient. Coupled transporters, both antiporters and symporters, allow movement of one ion species against its gradient, powered by the downhill movement of another ion species.
- One of the most common types of channel proteins found in the membrane of almost all animal cells, permits the specific permeation of potassium ions across a cell membrane. In particular, potassium ions permeate rapidly across cell membranes through K + channel proteins (up to 10 '8 ions per second).
- K + channel proteins up to 10 '8 ions per second.
- potassium channel proteins have the ability to distinguish among potassium ions, and other small alkali metal ions, such as Li + or Na + with great fidelity. In particular, potassium ions are at least ten thousand times more permanent than sodium ions. Potassium channel proteins typically comprise four
- HVA High-voltage- activated
- dihydropyridines, diphenyl-alkylamines and piperidines bind to the a x subunit of the L-type calcium channel and block a proportion of HVA calcium currents in neuronal tissue, which are termed L-type calcium currents.
- L-type calcium currents are sensitive to omega conopeptides, but are relatively insensitive to dihydropyridine compounds, such as nimodipine and nifedipine.
- P/Q-type channels are insensitive to dihydropyridines, but are sensitive to the funnel web spider toxin Aga IIIA.
- R-type calcium channels like L-, N-, P- and Q-type channels, arc activated by large membrane depolarizations, and are thus classified as high voltage-activated (HVA) channels.
- R-type channels are generally insensitive to dihydropyridines and omega conopeptides, but, like P/Q, L and N channels, are sensitive to the runnel web spider toxin AgaTVA. Immunocytochemical staining studies indicate that these channels are located throughout the brain, particularly in deep midline structures (caudate-putamen, thalamus, hypothalamus, amygdala, cerebellum) and in the nuclei of the ventral midbrain and brainstem.
- Neuronal voltage-sensitive calcium channels typically consists of a central ⁇ t . subunit, an a 2 / ⁇ subunit, a ⁇ subunit and a 95 kD subunit.
- Additional non-limiting examples include Kir (an inwardly rectified potassium channel), Kv (a voltage- gated potassium channel), Nav (a voltage-gated sodium channel), Cav (a voltage-gated calcium channel), CNG (cyclic nucleotide-gated channel), HCN ( hyperpolarization-activated channel), TRP (a transient receptor potential channel), ClC (a chloride channel), CFTR (a cystic fibrosis transmembrane conductance regulator, a chloride channel), IP3R (a inositol trisphosphate receptor), RYR (a ryanodine receptor).
- Other channel types are 2-pore channels, glutamate-receptors (AMPA, NMDA, KA), M2, Connexins and Cys- loop receptors.
- a common layout for ion channel proteins, such as Kvl.2, Kv3.1, Shaker, TRPCl and TRPC5 is to have ⁇ six membrane-spanning segments, arranged as follows: N-terminus— Sl- El— S2— XI— S3— E2— S4— X2— S5— E3— S6— C-terminus
- Sl-6 are membrane-spanning sequences
- El-3 are extracellular surface loops
- Xl-2 are intracellular surface loops.
- the E3 loop is generally the longest of the three extracellular loops and is hydrophilic so it is a good target for drugs and MLTRPs to bind.
- the pore-forming part of most channels is a multimeric (e.g. tetrameric or rarely pentameric) complex of membrane-spanning alpha-helices.
- the ion channels are valuable targets for drug design because they are involved in a broad range of physiological processes.
- ion channel proteins many of which have been implicated in genetic diseases.
- abbrebrant expression or function of ion channels has been shown to cause a wide arrange of diseases including cardiac, neuronal, muscular, respiratory metabolic diseases.
- This section focuses on ion channels, but the same concepts and approaches are equally applicable to all membrane proteins, including 7TMs, ITMs, G-proteins and G-Protein Coupled receptors (GPCRs), etc.
- Some of the ion channels are GPGRs.
- Ion channels typically form large macromolecular complexes that include tightly bound accessory , protein subunits and combinatorial use of such subunits contributes to the diversity of ion channels.
- accessory proteins can also be the binding targets of the subject MURPs, microproteins and toxins.
- the subject MURPs can be designed to bind any of the channels known in (he art and to those specifically exemplified herein.
- MURPs exhibiting a desired ion channel binding capability can be selected by any recombinant and biochemical (e.g. expression and display) techniques known in the art.
- MURPs can be displayed by a genetic package including but not limited to phages and spores, and be subjected to panning against intact cell membranes, or preferably intact cells such as whole mammalian cells.
- the present invention provides microproteins, and particularly microproteins exhibiting binding capability towards at least one family of ion channels.
- the present invention also provides a genetic package displaying such microproteins.
- Non-limiting ion-channel examples to which ' the subject microproteins bind are sodium, potassium, calcium, acetylcholine, and chlorine channels.
- Native targets are generally natural molecules or fragments, derivatives thereof that the microprotein is known to bind, typically including those known binding targets that have been reported in the literature.
- the subject invention also provides a genetic package displaying an ion-channel-binding microprotein which has been modified.
- the modified microprotein may (a) binds to a different family of channel as compared to the corresponding unmodified microprotein; (b) binds to a different subfamily of the same channel family as compared to the corresponding unmodified microprotein; (c) binds to a different species of the same subfamily of channel as compared to the corresponding unmodified microprotein; (d) the microprotein binds to a different site on the same channel as compared to the corresponding unmodified microprotein; and/or (e) binds to the same site of the same channel but yield a different biological effect as compared to the corresponding unmodified microprotein.
- Figure 22 and 46 show how microprotein domains or toxins that each bind at different sites of the same ion channel can be combined into a single protein.
- the two binding sites that these two microproteins bind to can be on two channels from different families, two channels from the same family but a different subfamily, two channels from the same subfamily but a different species (gene product), or two different binding sites on the same channel (species) or they can (simultaneously or not) bind the same binding site on the same channel (species) since the channels are multimeric.
- the binding modules and domains that bind to sites on the channels can be microprotein domains (natural or non-natural, 2- to 8-disulfide containing), one-disulfide peptides, or linear peptides. These modules can be selected independently and combined, or one can be selected from a library to bind in the presence of one fixed, active binding module. In the latter case, the display library would display multiple modules of which one would contain a library of variants. A typical goal is to select a dimer from this library that has a higher affinity than the active monomer that was the starting point. [00232] In another embodiment, the present invention provides a protein comprising a plurality of ion-channel binding domains, wherein individual domains are microprotein domains that have been modified such that .
- the microprotein domains bind to a different family of channel as compared to the corresponding unmodified microprotein domains; (b) the microprotein domains bind to a different subfamily of the same channel family as compared to the corresponding unmodified microprotein domains; (c) the microprotein domains bind to a different species of the same subfamily as compared to the corresponding unmodified microprotein domains; (d) the microprotein domains bind to a different site on the same channel as compared to the corresponding unmodified microprotein domains; (e) the microprotein domains bind to the same site of the same channel but yield a different biological effect as compared to the corresponding unmodified microprotein domains; and/or (f) the microprotein domains bind to the same site of the same channel and yield the same biological effect as compared to the corresponding unmodified microprotein domains.
- the microprotein domains may comprise natural or non-natural sequences.
- the individual domains can be linked together via a heterologous linker.
- the individual microprotein domains can bind to the same or different channel family, same or different channel subfamily, same.or different species of the same subfamily, same or different site on the same channel.
- the subject microproteins can be a toxin.
- the toxin retains in part or in whole its toxicity spectrum.
- venomous animals such as snakes, encounter a range of prey and intruder species and the venom toxins differ in activity for the different receptors of the different species.
- the venom consists of a large number of related and unrelated toxins, with each toxin having a "spectrum of activity", which can be defined as all of the receptors from all of the species on which that toxin has measurable activity. All of the targets in the 'spectrum of activity' are considered “native targets" and this includes any human targets that the toxin is active against.
- the native target(s) of a microprotein or toxin include all of the targets that the toxin is reported to inhibit in the literature. The higher the affinity or activity on a target, the more likely that target is the natural, native target, but it is not uncommon for toxins to act on multiple targets within the same species.
- Native target(s) can be human or non-human receptors that the toxin is active against.
- toxin For the toxin to retain the ability to bind to cells after fusion to the display vector, it may be desirable to test both the N-terrninus and C-terminus for fusion and to test a variety of fusion sites (i.e., 0,1,2,3,4,5,6 amino acids before the first cysteine or after the last cysteine of the toxin domain, if the toxin domain is a cystein- containing domain) using a synthetic DNA library approach, preferably encoding a library of glycine-rich linkers, which form the smallest amino acid chain, are uncharged and are most likely to be compatible with binding of the toxin to the target.
- a synthetic DNA library approach preferably encoding a library of glycine-rich linkers, which form the smallest amino acid chain, are uncharged and are most likely to be compatible with binding of the toxin to the target.
- the library should contain a lysine or a argini ⁇ e to mimic the positively charged amino group (or fusions to the N-terminus of the toxin) and a glutamate or an aspartate to mimic the negatively charged carboxyl group (for fusions to the C-terminus of the toxin).
- the inhibitors) that are used to block the target during negative selection can be small molecules, peptides or proteins, and natural or non-natural.
- the choice of the mixture of inhibitors is a valuable tool to control the specificity of the ion channel inhibitors that are being designed. Because there are over three hundreds ion channels in total, with partially overlapping specificities and sequence similarities, and multiple modulatory sites per channel, each having a different effect, the specificity requirement can be complex.
- the two toxins can bind the same channel at the same site and have the same physiologic effect, or the two toxins can bind the same channel at the same site and have a different physiologic effect, or the two toxins can bind to the same channel at a different site, or the two toxins can bind to different channels that belong to the same subfamily (i.e. Kvl.3 and Kvl.2; meaning product of a different gene or 'species'), or the two toxins can bind to different channels that belong to the same family (i.e.
- Ion channels typically have many transmembrane segments (24 for sodium channels) and thus offer a number of different, non-competing and non-overlapping binding sites for modulators to alter the activity of the channel in different ways.
- One approach is to create binders for one site on the same ion channel from existing binders for a different site, even if these sites are unrelated.
- the existing toxin can be used as a targeting agent for a library of l-,2-,3-,or 4-disulfide proteins that is separated from the targeting toxin by a flexible linker of 5,6,7,8,9,10,12,14,16,18,20,25,30,35,40 or 50 amino acids. It is useful if the affinity of the targeting agent is not too high, so that the affinity of the new library can have a significant contribution to the overall affinity.
- Another approach is to create new modulators for channels from existing modulators for other channels that are related in sequence or in structure.
- the conotoxin family contains sequence-related and structure-related modulators for Ca-, K, Na-channels and nicotinic acetylcholine receptors. It appears feasible to convert a K-channel modulator into a Na- channel modulator using a library of conotoxin-derivatives, or vice versa. For example, Kappa-conotoxins inhibit K-channels, Mu-conotoxins and Delta-conotoxins inhibit Na-channels, Omega-conotoxins inhibit Ca-channels and Alpha-conotoxins inhibit acetylcholine receptors.
- the individual modules can be panned and selected separately, in isolation of each other, or they can be designed in each other's presence, such that the new domain is added to a display system as a library that also contain a fixed, active copy that serves as a targeting element for the library and only clones that are significantly better than the fixed, active monomer are selected and characterized.
- Figs. 46 and 47 show some of the monomelic derivatives that can be made from native (natural) toxins, and some of the multimers that can be made to bind at multiple different binding sites of the target.
- the linkers are shown as glycine-rich rPEG, but the linkers could be any sequence and could also be optimized using molecular libraries followed by panning.
- Such libraries can be based on existing toxins with known activity for that site, or they can be or naive 1-, 2-, 3-, 4-disulf ⁇ de libraries based on unrelated microprotein scaffolds.
- These additional contact elements can be added on one or both sides of the active domains, and can be directly adjacent to the existing modulatory domain or they can be separated from it by flexible linkers.
- the initial multimer or the final, improved multimer can be a homomultimer or a heteromul timer, based on sequence similarity of the domains or based on target specificity of the domains of the multimer.
- the monomers that comprise the multimer may bind to the same target sites but have the same or different sequences.
- 10-100 different native toxins that are known to bind to each family of channels, and with 2,3,4,5 or 6 domains per clone display libraries with a huge combinatorial diversity can be created even if one only uses native toxin sequences.
- Low level synthetic mutagenesis based on amino acid similarity or on phylogenetic substitution rates within the family can be used to create high quality libraries of mutants, of which a very high fraction is expected to retain function, with a high probability of enhanced function in ⁇ some of the properties of interest.
- the binding capability of the subject MURPs, microproteins, or toxins to a given ion channel can be measured in terms of Hill Coefficient. Hill Coefficient indicates the stoichiometry of the binding interaction. A Hill coefficient of 2 indicates that 2 inhibitors bind to each channel.
- the biological activity or effect of an ion channel and the ability of the subject MURPs, microproteins or toxins to regulate an ion channel activity can be assessed using a variety of in vitro and in vivo assays. For instance, methods are available in the art for measuring voltage, measuring current, measuring membrane potential, measuring ion flux, e.g., potassium or rubidium, measuring ion concentration, measuring gating, measuring second messengers and transcription levels, and using e.g., voltage-sensitive dyes, radioactive tracers, and patch-clamp electrophysiology. In particular such assays can be used to test for microproteins and toxins that can inhibit or activate an ion channel of interest.
- potential channel inhibitors or activators can be tested in comparison to a suitable control to examine the extent of modulation.
- Control samples can also be samples untreated with the candidate activators or inhibitors. Inhibition is present when a given ion channel activity value relative to the control is about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or even less.
- IC50 is a commonly used unit (the concentration of inhibitor that reduces the ion channel's activity by 50%) for determining the inhibitory effect. Similar for IC90.
- Activation of channels is achieved when the select a given ion channel activity value relative to the control is increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, or more.
- Changes in ion flux may be assessed by determining changes in polarization (i.e., electrical potential) of the cell or membrane expressing the channel of interest. For instance, one method is to determine changes in cellular polarization is by measuring changes in current (thereby measuring changes in polarization) with voltage-clamp and patch-clamp techniques, e.g., the "cell-attached” mode, the "inside-out” mode, and the "whole cell” mode (see, e.g., Ackerman et al., New Engl. J. Med. 336: 1575-1595 (1997)). Whole cell currents are conveniently determined using the standard methodology (see, e.g., Hamil et al., Pilugers. Archiv.
- the effects of the candidate MURPs, microproteins, or toxins upon the function of a channel of interest can be measured by changes in the electrical currents or ionic flux or by the consequences of changes in currents and flux.
- the downstream effect of the candidate proteins on ion flux can be varied. Accordingly, any suitable physiological change can be used to assess the influence of a candidate protein on the test channels.
- the effects of candidate protein can be measured by a toxin binding assay.
- transmitter release e.g., dopamine
- hormone release e.g., insulin
- transcriptional changes to both known and uncharacterized genetic markers e.g., northern blots
- cell volume changes e.g., in red blood cells
- immunoresponses e.g., T cell activation
- changes in cell metabolism such as cell growth or pH changes
- changes in intracellular second messengers such as Ca2 + .
- Gating Frequency is influenced by voltage (in voltage gated channels, which are opened or closed by changes in membrane voltage) and ligand-binding.
- the transition rate between open and closed states is typically ⁇ 1 Omicroseconds but can be increased or decreased by other molecules.
- the flux rate (current) through the pore when it is open is on the order of 10e7 ions per second for ion channels and much less for coupled exchangers.
- some voltage-gated channels enter an inactivated, non-conducting state in which they are refractory to depolarization.
- NP_009060 GGGSGGGSGSGGGG 486-499 zinc finger protein
- Figure 6 illustrates that oligomers of peptide B with sequence GGGGGPGGGGP can be utilized as GRS. All 9mer subsequences that are contained in peptides with the sequence (GGGGGPGGGGP) n are also contained in the sequence of the POU domain. Thus, such oligomeric sequences do not contain T cell epitopes. 5
- Glycine rich sequences can be designed based on the subsequence GAGGEGGGGEGGGPGG that is part of the ribosornal protein S6 kinase (accession number BAD92170). For instance, oligomers of peptide C with the sequence GGGGE will form sequences where most 9mer subsequences will be contained in the sequence of ribosornal protein S6 kinase. Thus, oligomeric GRS of the general structure (GGGGE) n bear a 0 very low risk of containing T cell epitopes.
- a codon optimized gene encoding a URP sequence with 288 amino acids and the sequence (GSGGEG) 48 .
- a staffer vector pCW0051 as JO illustrated in Fig. 40.
- the sequence of the expression cassette in pCW0051 is shown in Fig. 42.
- the sniffer vector was based on a pET vector and includes a T7 promoter.
- the vector encodes a Flag sequence followed by a staffer sequence that is flanked by Bsal, Bbsl, and Kpnl sites. The Bsal and Bbsl sites were inserted such that they generate compatible overhangs after digestion as illustrated in Fig. 42.
- the staffer sequence was followed by a His ⁇ tag and the gene of green fluorescent protein (GFP).
- the staffer sequence S5 contains stop codons and thus E. coli cells carrying the staffer plasmid pCW0051 formed non-fluorescent colonies.
- the staffer vector pCW0051 was digested with Bsal and Kpnl.
- a codon library encoding URP sequences of 36 amino acid length was constructed as shown in Fig. 41.
- the URP sequence was designated rPEG_J36 and had the amino acid sequence (GSGGEG) ⁇ .
- the insert was obtained by annealing synthetic oligonucleotide pairs encoding the amino acid sequence GSGGEGGSGGEG as well as a pair of 1-0 oligonucleotides that encode an adaptor to the Kpnl site.
- the following oligonucleotides were used: pr_LCW0057for: AGGTAGTGGWGGWGARGGWGGWTCYGGWGGAGAAGG, pr_LCW0057rev: [00254] ACCTCCTTCTCCWCCRGAWCCWCCYTCWCCWCCACT, pr_3KpnIstopperFor:
- Fig. 14 The process of screening and iterative multimerization of rPEG_J36 sequences is illustrated in Fig. 14.
- Fig. 14 We screened 288 isolates from library LCW0057 for high level of fluorescence. 48 isolates with strong fluorescence were analyzed by PCR to verify the length of the rPEG_J segment and 16 clones were identified that had the expected length of rPEG_J36. This process resulted in a collection of 16 isolates of rPEG_J36, which show high expression and which differ in their codon usage. The isolates were pooled and dimerized using a process outlined in Fig.40.
- a plasmid mixture was digested with Bsal/Ncol and a fragment comprising the rPEG_J36 sequence and a part of GFP was isolated.
- the same plasmid mixture was also digested with Bbsl/Ncol and the vector fragment comprising rPEG_J36, most of the plasmid vector, and the remainder of the GFP gene was isolated. Both fragments were mixed, ligated, and transformed into BL21 and isolates were screened for fluorescence. This process of dimerization was repeated two more rounds as outlined in Fig. 14. During each round, we doubled the length of the rPEG_J gene and ultimately obtained a collection of genes that encode rPEG_J288.
- rPEG_J288 The amino acid and nucleotide sequence of rPEG_J288 is shown in Fig. 15. It can be seen that the rPEG_J288 module contains segments of rPEG_J36 that differ in their nucleotide sequence despite of having identical amino acid sequence. Thus we minimized internal homology in the gene and as a result we reduced the risk of spontaneous recombination.
- rPEG_H288 A library of genes encoding a 288 amino acid URP termed rPEG_H288 was constructed using the same procedure that was used to construct rPEG_J288.
- rPEG_H288 has the amino acid sequence (GSGGEGGSGGSG)24- The flow chart of the construction process in shown in Fig. 14. The complete amino acid sequence as well as the nucleotide sequence of one isolate of rPEG_H288 as given in Fig. 16.
- a fusion protein containing the an N-terminal Flag tag and the URP sequence rPEG_J288 fused to the N- terminus of green fluorescent protein was incubated in 50% mouse serum at 37 C for 3 days. Samples were withdrawn at various time points and analyzed by SDS PAGE followed by detection using Western analysis. An antibody against the N-terminal flag tag was used for Western detection. Results are shown in Fig. 28, which indicate that a URP sequence of 288 amino acids can be completely stable in serum for at least three days.
- the synthetic gene was fused with a gene encoding rPEG_J288.
- a His6 tag was placed at the N-terminus to facilitate detection and purification of the fusion protein.
- the amino acid sequence of the fusion protein is given in Fig. 44.
- Example: Construction of rPEG J288-G-CSF fusion [00260] A gene encoding human G-CSF was designed using codon optimization for E. coli expression. The synthetic gene was fused with a gene encoding rPEG_J288. A His6 tag was placed at the N-terminus to facilitate detection and purification of the fusion protein. The amino acid sequence of the fusion protein is given in Fig. 44.
- a gene encoding human growth hormone was designed using codon optimization for E. coli expression.
- the synthetic gene was fused with a gene encoding rPEG_J288.
- a His6 tag was placed at the N-terminus to facilitate detection and purification of the fusion protein.
- the amino acid sequence of the fusion protein is given in Fig. 44.
- the fusion proteins between rPEG_J288 and two human proteins, interferon-alpha and human growth hormone were cloned into a T7 expression vector and transformed into E. coli BL21.
- the cells were grown at 37 C to an optical density of 0.5 OD. Subsequently, the cells were cultured at 18 C for 30 min. Then 0.5 mM IPTG was added and the cultures were incubated in a shaking incubator at 18C overnight. Cells were harvested by centrifugation and soluble protein was released using BugBuster (Novagen).
- Fig. 45 shows the Western analysis of the two fusion proteins as well as rPEG_J288-GFP as control. All fusion proteins were expressed and the majority of the protein was in the soluble fraction. This is evidence of the high solubility of rPEG_J288 because most attempts at expression of the interferon-alpha and human growth hormone in the cytosol of E. coli, that have been reported in the literature, resulted in the formation of insoluble inclusion bodies.
- Fig. 45 shows that the majority of fusion proteins are expressed as full length proteins, i.e. no fragments that would suggest incomplete synthesis or partial protein degradation were detected.
- VEGF binding affinity of fusion proteins containing between zero and four VEGF-binding units were compared in Fig. 30.
- a fusion protein containing only rPEG_A36 fused to GFP shows no affinity for VEGF.
- Adding increasing numbers of VEGF binding modules increases affinity of the resulting fusion proteins.
- NNS NNS TGTNNS NNS The libraries were panned agai ⁇ s a series of therapeutically relevant targets using the following protocol: Wells on immunosorbent ELISA plates were coated with 5 ⁇ g/ml of the target antigen in PBS overnight at 4°C. Coated plates were washed with PBS, and non-specific sites were blocked with Blocking Buffer (PBS containing either 0.5% BSA or 0.5% Ovalbumin) for 2h at room temperature.
- Blocking Buffer PBS containing either 0.5% BSA or 0.5% Ovalbumin
- PBST PBS containing 0.05% Tween 20
- phage particles at l-5xl0 12 /ml in Binding Buffer (Blocking Buffer containing 0.05% Tween 20) were added to the wells and incubated with shaking for 2h at room temperature.
- Bound phage particles were eluted from the wells by incubation with 10OmM HCl for lOmin at room temperature, transferred to sterile tubes, and neutralized with IM TRIS base.
- log phase E log phase E.
- CoIi SS320 growing in Super Broth supplemented with 5 ⁇ g/ml Tetracycline were added to the neutralized phage eluate, and the culture was incubated with shaking for 30min at 37°C.
- Infected cultures were men transferred to larger tubes containing Super Broth with 5/ig/ml Tetracycline and the cultures were incubated with shaking overnight at 37°C. The overnight cultures were cleared of E. CoIi by centrifugation, and phage were precipitated from the supernatant following the addition of a solution of 20% PEG and 2.5MNaCl to a final PEG concentration of 4%.
- Precipitated phage were harvested by centrifugation, and the phage pellet was resuspended in ImI PBS, cleared of residual E. CoIi by centrifugation, and tranfered to a fresh tube. Phage concentrations were estimated spectrophotometrically and phage was utilized for the next round of selection. Individual clones were screened for target binding affinity after 3 or 4 rounds of phage panning. Individual plaques from phage clones selected during the panning were picked into Super Broth containing
- ELISA plates were prepared by coating antigen and control proteins (BSA, Ovalbumin, IgG) at 3 ⁇ g/ml in PBS overnight at 4°C. The plates were washed with PBS, and blocked with Blocking Buffer (PBS containing 0.5% BSA) for 2h at room temperature. Overnight cultures were cleared of E. coli by centrifugation and the supernatant was diluted 1 : 10 in Binding Buffer (Blocking Buffer containing 0.05% Tween 20) and transferred to the ELISA plates after washing with PBST (PBS containing 0.05% Tween 20). The plates were incubated with shaking for 2h at room temperature.
- BSA Blocking Buffer
- PBST PBS containing 0.05% Tween 20
- EpCaml EpCAM specific peptide ligands
- EpCair ⁇ ligands contain the conserved CXXXXC cysteine spacing.
- the majority of anti- EpCam sequences do not contain a lysine residue, which allows for conjugation to free amine groups outside of the binding sequences.
- anti-EpCam peptide ligands can be genetically fused to URP sequences (of any length) and multimerized using iterative dimerization.
- the resulting anti-EpCAM MTJRPs can be used to specifically target EpCAM with increased affinity over monomer sequences.
- An example of a tetramer EpCAM-URP amino acid sequence is shown in Fig. 31. This sequence contains only two lysine residues that are located in the N-terminai Flag-tag. The side chains of these lysine residues are particularly suitable for drug conjugation.
- Binding modules can be affinity matured, or lengthened, by the addition of URP-like linkers and random sequence to the N-termimis, C-terminus, or both N- and C-terminus of the binding sequence.
- Fig. 32 shows the addition of naive cysteine-constrained sequences to an anti-EpCAM binding module.
- Libraries of random sequence additions can be generated using a single-stranded or double-stranded DNA cloning approaches. Once generated, libraries can be affinity selected against the initial target protein or a second protein. For example, an addition library that contains an anti-EpCAM binding module can be used to select sequences that contain 2 or more binding sites to the target protein.
- oligonucleotides were designed to construct a library based on the VEGF-binding ISS peptide FTCTNHWCPS.
- the oligonucleotides incorporate variations in cysteine distance patterns of the flanking sequences while the VEGF-binding peptide sequence was kept fixed.
- LMS70-1 CAGGCAGCGGGCCCGTCTGGCCCGTGYTTTACTTGTACGAATCATTGGTGTCCT [00270]
- LMS70-2 CAGGCAGCGGGCCCGTCTGGCCCGTGYNNKTTTACTTGTACGAATCATTGGTGTCCT [00271]
- LMS70-3 CAGGCAGCGGGCCCGTCTGGCCCGTGYNNKTTTACTTGTACGAATCATTGGTGTCCT [00271]
- LMS70-1R ACCGGAACCACCAGACTGGCCRCACGAAGGACACCAATGATTCGTACAA
- LMS70-2R ACCGGAACCACCAGACTGGCCRCAMNNCGAAGGACACCAATGATTCGTACAA
- LMS70-3R ACCGGAACCACCAGACTGGCCRCAMNNCGAAGGACACCAATGATTCGTACAA
- PCR assembly [00282] 10.0 ⁇ l Template Oligo (5 ⁇ M), 10.0 ⁇ l 1OX Buffer, 2.0 dNTPs (lOmM), 1.0 ⁇ l cDNA Polymerase
- PCR amplification [00283] Primers, 10.0 ⁇ l Assembled mixture, 10.0 ⁇ l 1OX buffer, 2.0 dNTPs (1OmM), 10.0 ⁇ l LIBPTF (5 ⁇ M), 10.0 ⁇ l LIBPTR (5 ⁇ M), 1.0 ⁇ cDNA polymerase (Clonetech), 57 ⁇ l DS H 2 O. PCR program: 95°C 1 min,
- the assembled product was digested with Sfil and BstXI and ligated into the phagemid vector pMP003. Ligation was performed over night at 16 0 C in a MJ PCR machine. Ligation then was purified by EtOH precipitation. Transformation into fresh competent ER2738 cells by Electroporation.
- VEGF 121 antigen 0.25 ⁇ g of VEGF 121 antigen in 25 ⁇ l of PBS. Cover the plate with a plate sealer. Coating can be performed overnight at 4°C or for 1 h at 37°C.
- step 3 Continue from step 3) for the next round or store the phage preparation at 4°C.
- Sodium azide may be 10 added to 0.02 % (w/v) for long-term storage. Only freshly prepared phage should be used for each round.
- Second round panning [00301] Second round, coat 2 wells per library to be screened. Coat the well of a Costar 96-well ELISA plate with
- VEGFi 2 0.25 ⁇ g of VEGFi 2 ] antigen in 25 ⁇ l of PBS. Cover the plate with a plate sealer. Coating can be performed overnight at 4°C or for 1 h at 37°C. 15 [00302] Also block 2 uncoated wells for each library to be used as negative control for the enrichment ratio calculation.
- Third round panning [00304] Third round, coat 1 well per library to be screened. Coat the well of a Costar 96-well ELISA plate with 0.25 ⁇ g of VEGF 12I antigen in 25 ⁇ l of PBS. Cover the plate with a plate sealer. Coating can be performed 0 overnight at 4°C or for 1 h at 37°C.
- Example: Screening by Phage Elisa for VEGF positive clones 10 [00317] 1) Add 0.5 ml SB containing 50 ⁇ g/ml carbenic ⁇ lin to 96 deep well plate. Pick one colony and inoculate wells. [00318] 2) Shake the plate containing the bacterial cultures at 300 rpm o/n at 37oC. [00319] 3) Prepare 4 ng/ ⁇ l target protein solution in PBS. Add 25 ⁇ l (100 ng) of protein to each well and incubate overnight at 4oC.
- binding buffer (blocking buffer +0.5% Tween 20). Aliquot 135 ⁇ l binding buffer per well in low protein-binding 96 well plate.
- the resulting plexin libraries were designated LMP031 (N terminal library) and LMP032 (C terminal library) and each was represented by a complexity of approximately 5 x 10 8 independent transformants.
- LMP031 N terminal library
- LMP032 C terminal library
- approximately 24 Carb-resistant clones from each unselected library were analyzed by PCR. Clones that gave a correct size fragment (375 bp) were further analyzed by DNA sequencing. Correct full-length plexin sequences were obtained for 50% and 67% of clones derived from LMP031 and LMP032 libraries, respectively.
- Dr4, ErbB2, and HGFR immobilized on 96-well ELISA plates Four rounds of panning were carried out using 1000 ng of protein target in the first round, 500 ng in the second round, 250 ng in the third round, and
- Fig. 37 For further analysis, an assortment of selected target-specific binders are first subcloned into protein expression vector pVSOOl, then produced as soluble microproteins, and finally purified by heat lysis. The purified target-specific microproteins are analysed by protein ELISA to confirm the target recognition, by SDS-PAGE to confirm monomer formation, and by surface plasmon resonance to measure their affinities to target. The best clones are used in the next round of library generation to further improve their properties.
- Three 3FT scaffolds were used as a template for 3FT library generation (fingers 1 and 2 configuration).
- the structure of a 3FT scaffold and a multiple sequence alignment of related sequences is shown in Fig. 33.
- a library was designed such that two surface loops of the toxin are randomized as illustrated in Fig. 34.
- the library of partially randomized 3FT scaffold was generated by overlapping four library-encoding oligos at the annealing regions and using pull-thru PCR followed by restriction cloning (Sfil/BstXI) into phagemid vector pMP003.
- the resulting 3FT library was designated LMP041.
- the aim here is to use the peptides that have been identified to be specific for target of interest in order to generate 3SSplus target-specific binders.
- This strategy is illustrated by using VEGF-specific peptide transfer into fingertip 1 of 3FT scaffold and by modifying the AA residues of finger 2, which are in close proximity from target specific sequence to generate high affinity VEGF binders.
- Phage displayed libraries of 10e8 to 1Oe]O of 3 finger toxin (3FT) scaffolds with VEGF specific sequence of fingertip 1 and partially randomized descending part of finger 2 was created by standard methods as described in example above except 2 random finger 1 forward primers were replaced by Fl -VEGF-specific forward primer encoding the following sequence: P S G P S C H T T N H W P I S A V T C P P.
- the focused (VEGF-specific) 3FT scaffold library with partially randomized finger 2 was generated by overlapping four library-encoding oligos at the annealing regions and using pull-thru PCR followed by restriction cloning (Sfil/BstXI) into phagemid vector pMP003.
- the resulting 3FT library was designated
- the plasma half-life of MURPs can be measured after i.v. or i.p. injection of the MURP into catheterized rats essentially as described by [Pepinsky, R. B., et al. (2001) J Pharmacol Exp Ther, 297: 1059-66]. Blood samples can be withdrawn at various time points (5 min, 15 min, 30 min, Ih, 3h, 5 h, Id, 2d, 3d) and the plasma concentration of the MURP can be measured using ELISA. Pharmacokinetic parameters can be calculated using WinNonlin version 2.0 (Scientific Consulting Inc., Apex, NC). To analyze the effect of the URP module one can compare on plasma half-life of a protein containing the URP module with the plasma half-life of the same protein lacking the URP module. Example: Solubility testing of an MURP
- Solubility of MURPs can be determined by concentrating purified samples of MURPs in physiological buffers like phosphate buffered saline to various concentrations in the range of 0.01 mg/ml to 10 mg/ml.
- Samples can be incubated for up to several weaks. Samples where the concentration exceeds the solubility of the MURP show precipitation as indicated by turbidity, which can be measured in an absorbance reader. On can remove precipitated material by centrifugation or filtration and measure the concentration of remaining protein in the supernatant using a protein assay like the Bradford assay of by measuring the absorbance at 280 nm. Solubility studies can be accelerated by freezing the samples at -20C and subsequent thawing. This process frequently leads to the precipitation of poorly soluble proteins.
- Serum binding activity of MURPs [00340] One can coat MURPs of interest into microliter plates and control proteins in other wells of the plate.
- serum samples of interest can be added to the wells for 1 hour. Subsequently, the wells can be washed with a plate washer. Bound serum proteins can be detected by adding antibodies against serum proteins that have been conjugated with enzymes like horse radish peroxidase or alkaline phosphatase for detection. Another way to detec serum binding to MURPs to add the MURP of interest to serum for about 1 hour to allow binding. Subsequently, one can immunoprecipitate the MURP using an antibody against an epitope in the MURP sequence. The precipitated samples can be analyzed by PAGE and optionally by Western to detect any proteins that co-precipitated with the MURP. One can identify the serum proteins that show co-precipitation by mass spectrometry.
Abstract
Description
Claims
Priority Applications (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2008558403A JP2009543541A (en) | 2006-03-06 | 2007-03-06 | Non-structural recombinant polymers and uses thereof |
CA2644712A CA2644712C (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
SI200731247T SI1996220T2 (en) | 2005-09-27 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
EP11172812.7A EP2402754B2 (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
ES07752636T ES2417153T3 (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
FIEP07752636.6T FI1996220T4 (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
CN2007800158992A CN101616685B (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
EP07752636.6A EP1996220B2 (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
AU2007223855A AU2007223855B2 (en) | 2006-03-06 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
DK07752636.6T DK1996220T4 (en) | 2006-03-06 | 2007-03-06 | UNSTRUCTURED RECOMBINANT POLYMERS AND THEIR USES |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US74341006P | 2006-03-06 | 2006-03-06 | |
US60/743,410 | 2006-03-06 | ||
US74362206P | 2006-03-21 | 2006-03-21 | |
US60/743,622 | 2006-03-21 | ||
US11/528,927 US20070191272A1 (en) | 2005-09-27 | 2006-09-27 | Proteinaceous pharmaceuticals and uses thereof |
US11/528,927 | 2006-09-27 | ||
US11/528,950 | 2006-09-27 | ||
US11/528,950 US20070212703A1 (en) | 2005-09-27 | 2006-09-27 | Proteinaceous pharmaceuticals and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2007103515A2 true WO2007103515A2 (en) | 2007-09-13 |
WO2007103515A3 WO2007103515A3 (en) | 2008-04-03 |
Family
ID=38475542
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2007/005857 WO2007103455A2 (en) | 2006-03-06 | 2007-03-06 | Genetic packages and uses thereof |
PCT/US2007/005952 WO2007103515A2 (en) | 2005-09-27 | 2007-03-06 | Unstructured recombinant polymers and uses thereof |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2007/005857 WO2007103455A2 (en) | 2006-03-06 | 2007-03-06 | Genetic packages and uses thereof |
Country Status (6)
Country | Link |
---|---|
EP (3) | EP1996220B2 (en) |
AU (2) | AU2007223888A1 (en) |
CA (1) | CA2644712C (en) |
DK (1) | DK2402754T4 (en) |
SI (1) | SI2402754T2 (en) |
WO (2) | WO2007103455A2 (en) |
Cited By (66)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1996220A2 (en) | 2006-03-06 | 2008-12-03 | Amunix, Inc. | Unstructured recombinant polymers and uses thereof |
EP2185701A2 (en) * | 2007-08-15 | 2010-05-19 | Amunix, Inc. | Compositions and methods for modifying properties of biologically active polypeptides |
WO2011000095A1 (en) * | 2009-07-02 | 2011-01-06 | Angiochem Inc. | Multimeric peptide conjugates and uses thereof |
WO2011135067A1 (en) | 2010-04-30 | 2011-11-03 | Molecular Partners Ag | Modified binding proteins inhibiting the vegf-a receptor interaction |
WO2011144756A1 (en) | 2010-05-21 | 2011-11-24 | Xl-Protein Gmbh | Biosynthetic proline/alanine random coil polypeptides and their uses |
EP2393828A1 (en) * | 2009-02-03 | 2011-12-14 | Amunix Operating Inc. | Extended recombinant polypeptides and compositions comprising same |
WO2011157819A2 (en) | 2010-06-18 | 2011-12-22 | Xiberscience Gmbh | Peptides as active agents to stabilize biological barriers |
EP2440228A1 (en) * | 2009-06-08 | 2012-04-18 | Amunix Operating Inc. | Glucose-regulating polypeptides and methods of making and using same |
EP2440241A1 (en) * | 2009-06-08 | 2012-04-18 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
US8178495B2 (en) | 2008-06-27 | 2012-05-15 | Duke University | Therapeutic agents comprising a GLP-1 receptor agonist and elastin-like peptide |
WO2012069654A1 (en) | 2010-11-26 | 2012-05-31 | Molecular Partners Ag | Designed repeat proteins binding to serum albumin |
EP2470670A1 (en) * | 2009-08-24 | 2012-07-04 | Amunix Operating Inc. | Coagulation factor vii compositions and methods of making and using same |
US8334257B2 (en) | 2005-12-20 | 2012-12-18 | Duke University | Methods and compositions for delivering active agents with enhanced pharmacological properties |
JP2013511263A (en) * | 2009-11-19 | 2013-04-04 | 浙江大学 | Non-natural collagen-like protein and its application |
US8563521B2 (en) | 2007-06-21 | 2013-10-22 | Technische Universitat Munchen | Biological active proteins having increased in vivo and/or in vitro stability |
WO2013169614A1 (en) | 2012-05-07 | 2013-11-14 | Allergan, Inc. | Method of treating amd in patients refractory to anti-vegf therapy |
WO2014001442A1 (en) | 2012-06-28 | 2014-01-03 | Molecular Partners Ag | Designed ankyrin repeat proteins binding to platelet-derived growth factor |
US8729018B2 (en) | 2005-12-20 | 2014-05-20 | Duke University | Therapeutic agents comprising elastic peptides |
EP2738180A1 (en) | 2012-11-30 | 2014-06-04 | Molecular Partners AG | Binding proteins comprising at least two binding domains against HER2. |
US8921314B2 (en) | 2008-10-15 | 2014-12-30 | Angiochem, Inc. | Conjugates of GLP-1 agonists and uses thereof |
WO2015022326A1 (en) | 2013-08-12 | 2015-02-19 | Xiber Science Gmbh | Peptides as active agents for treating primary graft dysfunction |
WO2015069668A1 (en) | 2013-11-05 | 2015-05-14 | Allergan, Inc. | Method of treating conditions of the eye with an anti-vegf darpin |
US9050318B2 (en) | 2009-12-06 | 2015-06-09 | Biogen Idec Hemophilia Inc. | Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof |
US9173891B2 (en) | 2009-04-20 | 2015-11-03 | Angiochem, Inc. | Treatment of ovarian cancer using an anticancer agent conjugated to an angiopep-2 analog |
WO2015195531A2 (en) | 2014-06-18 | 2015-12-23 | Albert Einstein College Of Medicine, Inc. | Syntac polypeptides and uses thereof |
US9221867B2 (en) | 2003-01-06 | 2015-12-29 | Angiochem Inc. | Method for transporting a compound across the blood-brain barrier |
US9233145B2 (en) | 2010-07-09 | 2016-01-12 | Biogen Hemophila Inc. | Factor IX polypeptides and methods of use thereof |
US9365634B2 (en) | 2007-05-29 | 2016-06-14 | Angiochem Inc. | Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues |
US9458211B1 (en) | 2015-04-02 | 2016-10-04 | Molecular Partners Ag | Recombinant proteins that simultaneously bind HGF, VEGF-A and serum albumin, comprising ankyrin repeat domains |
US9486507B2 (en) | 2011-06-10 | 2016-11-08 | Biogen Ma Inc. | Pro-coagulant compounds and methods of use thereof |
WO2017201210A1 (en) | 2016-05-18 | 2017-11-23 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
WO2017201131A1 (en) | 2016-05-18 | 2017-11-23 | Albert Einstein College Of Medicine, Inc. | Variant pd-l1 polypeptides, t-cell modulatory multimeric polypeptides, and methods of use thereof |
US9849188B2 (en) | 2009-06-08 | 2017-12-26 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
KR101813727B1 (en) * | 2009-06-08 | 2018-01-02 | 아뮤닉스 오퍼레이팅 인코포레이티드 | Growth hormone polypeptides and methods of making and using same |
US9914754B2 (en) | 2008-12-05 | 2018-03-13 | Angiochem Inc. | Conjugates of neurotensin or neurotensin analogs and uses thereof |
US9938331B2 (en) | 2005-09-27 | 2018-04-10 | Amunix Operating Inc. | Biologically active proteins having increased in vivo and/or in vitro stability |
US9976166B2 (en) | 2010-04-02 | 2018-05-22 | Amunix Operating Inc. | Binding fusion proteins, binding fusion protein-drug conjugates, XTEN-drug conjugates and methods of making and using same |
US10010622B2 (en) | 2011-07-08 | 2018-07-03 | Bioverativ Therapeutics Inc. | Factor VIII chimeric and hybrid polypeptides, and methods of use thereof |
WO2018129474A1 (en) | 2017-01-09 | 2018-07-12 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
US10023628B2 (en) | 2012-07-06 | 2018-07-17 | Bioverativ Therapeutics Inc. | Cell line expressing single chain factor VIII polypeptides and uses thereof |
US10138291B2 (en) | 2012-07-11 | 2018-11-27 | Bioverativ Therapeutics Inc. | Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof |
US10172953B2 (en) | 2012-02-27 | 2019-01-08 | Amunix Operating Inc. | XTEN conjugate compositions and methods of making same |
WO2019051127A1 (en) | 2017-09-07 | 2019-03-14 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptide with conjugation sites and methods of use thereof |
US10258700B2 (en) | 2005-12-20 | 2019-04-16 | Duke University | Methods and compositions for delivering active agents with enhanced pharmacological properties |
WO2019139896A1 (en) | 2018-01-09 | 2019-07-18 | Cue Biopharma, Inc. | Multimeric t-cell modulatory polypeptides and methods of use thereof |
US10370430B2 (en) | 2012-02-15 | 2019-08-06 | Bioverativ Therapeutics Inc. | Recombinant factor VIII proteins |
US10421798B2 (en) | 2012-02-15 | 2019-09-24 | Bioverativ Therapeutics Inc. | Factor VIII compositions and methods of making and using same |
WO2019201855A1 (en) * | 2018-04-16 | 2019-10-24 | Swedish Orphan Biovitrum Ab (Publ) | Lysosomal fusion protein |
US10548953B2 (en) | 2013-08-14 | 2020-02-04 | Bioverativ Therapeutics Inc. | Factor VIII-XTEN fusions and uses thereof |
US10584147B2 (en) | 2013-11-08 | 2020-03-10 | Biovertiv Therapeutics Inc. | Procoagulant fusion compound |
US10588949B2 (en) | 2013-03-15 | 2020-03-17 | Bioverativ Therapeutics Inc. | Factor IX polypeptide formulations |
US10656167B2 (en) | 2011-07-25 | 2020-05-19 | Bioverativ Therapeutics Inc. | Assays to monitor bleeding disorders |
US10745680B2 (en) | 2015-08-03 | 2020-08-18 | Bioverativ Therapeutics Inc. | Factor IX fusion proteins and methods of making and using same |
WO2020181062A1 (en) | 2019-03-06 | 2020-09-10 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
US10980892B2 (en) | 2015-06-15 | 2021-04-20 | Angiochem Inc. | Methods for the treatment of leptomeningeal carcinomatosis |
US11192936B2 (en) | 2014-01-10 | 2021-12-07 | Bioverativ Therapeutics Inc. | Factor VIII chimeric proteins and uses thereof |
US11208452B2 (en) | 2015-06-02 | 2021-12-28 | Novo Nordisk A/S | Insulins with polar recombinant extensions |
US11225650B2 (en) | 2012-09-25 | 2022-01-18 | Bioverativ Therapeutics Inc. | Methods of using FIX polypeptides |
WO2022032187A1 (en) | 2020-08-07 | 2022-02-10 | Bristol-Myers Squibb Company | Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis |
US11292825B2 (en) | 2015-10-01 | 2022-04-05 | Novo Nordisk A/S | Protein conjugates |
WO2022115597A1 (en) | 2020-11-25 | 2022-06-02 | Bristol-Myers Squibb Company | Methods of treating liver diseases |
WO2022123459A1 (en) | 2020-12-11 | 2022-06-16 | Friedrich Miescher Institute For Biomedical Research | Hdac6 binding proteins and their anti-viral use |
US11370827B2 (en) * | 2012-01-12 | 2022-06-28 | Bioverativ Therapeutics Inc. | Chimeric factor VIII polypeptides and uses thereof |
US11471537B2 (en) | 2017-04-05 | 2022-10-18 | Novo Nordisk A/S | Oligomer extended insulin-Fc conjugates |
US11529394B2 (en) | 2020-09-30 | 2022-12-20 | Beijing Ql Biopharmaceutical Co., Ltd. | Polypeptide conjugates and methods of uses |
US11713358B2 (en) | 2015-08-28 | 2023-08-01 | Amunix Pharmaceuticals, Inc. | Chimeric polypeptide assembly and methods of making and using the same |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7846445B2 (en) | 2005-09-27 | 2010-12-07 | Amunix Operating, Inc. | Methods for production of unstructured recombinant polymers and uses thereof |
AU2014206217B2 (en) * | 2009-02-03 | 2015-09-17 | Amunix Pharmaceuticals, Inc. | Extended recombinant polypeptides and compositions comprising same |
US8703717B2 (en) | 2009-02-03 | 2014-04-22 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
US8680050B2 (en) | 2009-02-03 | 2014-03-25 | Amunix Operating Inc. | Growth hormone polypeptides fused to extended recombinant polypeptides and methods of making and using same |
AU2015218510B2 (en) * | 2009-02-03 | 2016-11-10 | Amunix Pharmaceuticals, Inc. | Extended recombinant polypeptides and compositions comprising same |
WO2011123813A2 (en) * | 2010-04-02 | 2011-10-06 | Amunix Operating Inc. | Binding fusion proteins, binding fusion protein-drug conjugates, xten-drug conjugates and methods of making and using same |
KR102238317B1 (en) | 2012-05-17 | 2021-04-12 | 익스텐드 바이오사이언시즈, 인크. | Carriers for improved drug delivery |
US9789197B2 (en) | 2014-10-22 | 2017-10-17 | Extend Biosciences, Inc. | RNAi vitamin D conjugates |
EP3220961B1 (en) | 2014-10-22 | 2023-07-05 | Extend Biosciences, Inc. | Therapeutic vitamin d conjugates |
WO2016065052A1 (en) | 2014-10-22 | 2016-04-28 | Extend Biosciences, Inc. | Insulin vitamin d conjugates |
CN115083016A (en) * | 2022-06-09 | 2022-09-20 | 广州紫为云科技有限公司 | Monocular camera-based small-target-oriented hand space interaction method and device |
Family Cites Families (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DD257197A1 (en) † | 1987-01-28 | 1988-06-08 | Univ Dresden Tech | METHOD FOR THE PRODUCTION OF IMMOBILIZED INSULIN PRAEPARATIONS STABILIZED IN ITS BIOLOGICAL ACTIVITY AND MODIFIED IN ITS PHARMACOLOGICAL PROPERTIES |
FR2647677B1 (en) * | 1989-05-31 | 1991-09-27 | Roussel Uclaf | NOVEL MICRO-PROTEINS, PROCESS FOR THE PREPARATION AND APPLICATION AS MEDICAMENTS OF SUCH NEW MICRO-PROTEINS |
CA2094512A1 (en) † | 1990-12-13 | 1992-06-14 | Teresa M. Kubiak | Fusion polypeptides |
US5833911A (en) † | 1995-05-31 | 1998-11-10 | Johnson & Johnson Medical, Inc. | Method for forming a glove using a folded glove form |
WO1998022577A1 (en) † | 1996-11-15 | 1998-05-28 | Maria Grazia Masucci | Fusion proteins having increased half-lives |
US20050260605A1 (en) * | 1998-02-11 | 2005-11-24 | Maxygen, Inc. | Targeting of genetic vaccine vectors |
WO1999041383A1 (en) * | 1998-02-11 | 1999-08-19 | Maxygen, Inc. | Antigen library immunization |
US20050287153A1 (en) * | 2002-06-28 | 2005-12-29 | Genentech, Inc. | Serum albumin binding peptides for tumor targeting |
US20030049689A1 (en) * | 2000-12-14 | 2003-03-13 | Cynthia Edwards | Multifunctional polypeptides |
US20020169125A1 (en) * | 2001-03-21 | 2002-11-14 | Cell Therapeutics, Inc. | Recombinant production of polyanionic polymers and uses thereof |
CN103172747A (en) * | 2005-01-25 | 2013-06-26 | 细胞治疗学公司 | Conjugates of biologically active proteins having a modified in vivo half-life |
EP1996220B2 (en) | 2006-03-06 | 2023-08-16 | Amunix Operating Inc. | Unstructured recombinant polymers and uses thereof |
ES2779992T3 (en) † | 2005-12-20 | 2020-08-21 | Univ Duke | Methods and compositions for delivering active agents with enhanced pharmacological properties |
WO2008049711A1 (en) † | 2006-10-27 | 2008-05-02 | Novo Nordisk A/S | Peptide extended insulins |
-
2007
- 2007-03-06 EP EP07752636.6A patent/EP1996220B2/en active Active
- 2007-03-06 AU AU2007223888A patent/AU2007223888A1/en not_active Abandoned
- 2007-03-06 CA CA2644712A patent/CA2644712C/en active Active
- 2007-03-06 WO PCT/US2007/005857 patent/WO2007103455A2/en active Application Filing
- 2007-03-06 SI SI200731588T patent/SI2402754T2/en unknown
- 2007-03-06 WO PCT/US2007/005952 patent/WO2007103515A2/en active Application Filing
- 2007-03-06 AU AU2007223855A patent/AU2007223855B2/en active Active
- 2007-03-06 DK DK11172812.7T patent/DK2402754T4/en active
- 2007-03-06 EP EP20140189047 patent/EP2863222A1/en not_active Ceased
- 2007-03-06 EP EP07752549A patent/EP1996937A4/en not_active Withdrawn
Non-Patent Citations (2)
Title |
---|
None |
See also references of EP1996220A4 |
Cited By (159)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9221867B2 (en) | 2003-01-06 | 2015-12-29 | Angiochem Inc. | Method for transporting a compound across the blood-brain barrier |
US9938331B2 (en) | 2005-09-27 | 2018-04-10 | Amunix Operating Inc. | Biologically active proteins having increased in vivo and/or in vitro stability |
US10258700B2 (en) | 2005-12-20 | 2019-04-16 | Duke University | Methods and compositions for delivering active agents with enhanced pharmacological properties |
US9458218B2 (en) | 2005-12-20 | 2016-10-04 | Duke University | Therapeutic agents comprising fusions of insulin and elastic peptides |
US8729018B2 (en) | 2005-12-20 | 2014-05-20 | Duke University | Therapeutic agents comprising elastic peptides |
US8841255B2 (en) | 2005-12-20 | 2014-09-23 | Duke University | Therapeutic agents comprising fusions of vasoactive intestinal peptide and elastic peptides |
US8334257B2 (en) | 2005-12-20 | 2012-12-18 | Duke University | Methods and compositions for delivering active agents with enhanced pharmacological properties |
US9328154B2 (en) | 2005-12-20 | 2016-05-03 | Duke University | Therapeutic agents comprising fusions of growth hormone and elastic peptides |
EP1996220A2 (en) | 2006-03-06 | 2008-12-03 | Amunix, Inc. | Unstructured recombinant polymers and uses thereof |
US9365634B2 (en) | 2007-05-29 | 2016-06-14 | Angiochem Inc. | Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues |
US8563521B2 (en) | 2007-06-21 | 2013-10-22 | Technische Universitat Munchen | Biological active proteins having increased in vivo and/or in vitro stability |
US9260494B2 (en) | 2007-06-21 | 2016-02-16 | Technische Universität München | Biological active proteins having increased in vivo and/or in vitro stability |
EP2185701A4 (en) * | 2007-08-15 | 2011-03-02 | Amunix Operating Inc | Compositions and methods for modifying properties of biologically active polypeptides |
EP2185701A2 (en) * | 2007-08-15 | 2010-05-19 | Amunix, Inc. | Compositions and methods for modifying properties of biologically active polypeptides |
US8933197B2 (en) | 2007-08-15 | 2015-01-13 | Amunix Operating Inc. | Compositions comprising modified biologically active polypeptides |
US8178495B2 (en) | 2008-06-27 | 2012-05-15 | Duke University | Therapeutic agents comprising a GLP-1 receptor agonist and elastin-like peptide |
US11103558B2 (en) | 2008-06-27 | 2021-08-31 | Duke University | Therapeutic agents comprising a BMP-9 peptide and eleastin-like peptides |
US9127047B2 (en) | 2008-06-27 | 2015-09-08 | Duke University | Therapeutic agents comprising insulin and elastin-like peptides |
US9200083B2 (en) | 2008-06-27 | 2015-12-01 | Duke University | Methods of treating diabetes using therapeutic agents comprising a GLP-1 receptor agonist and elastin-like peptides |
US9821036B2 (en) | 2008-06-27 | 2017-11-21 | Duke University | Therapeutic agents comprising a GLP-2 peptide and elastin-like peptides |
US10596230B2 (en) | 2008-06-27 | 2020-03-24 | Duke University | Methods of increasing nutrient absorption in the intestine using therapeutic agents comprising GLP-2 and elastin-like peptides |
US8921314B2 (en) | 2008-10-15 | 2014-12-30 | Angiochem, Inc. | Conjugates of GLP-1 agonists and uses thereof |
US9914754B2 (en) | 2008-12-05 | 2018-03-13 | Angiochem Inc. | Conjugates of neurotensin or neurotensin analogs and uses thereof |
CN108530543B (en) * | 2009-02-03 | 2023-06-23 | 阿穆尼克斯制药公司 | Extended recombinant polypeptides and compositions comprising the same |
CN102348715A (en) * | 2009-02-03 | 2012-02-08 | 阿穆尼克斯运营公司 | Extended recombinant polypeptides and compositions comprising same |
EP3178835A1 (en) * | 2009-02-03 | 2017-06-14 | Amunix Operating Inc. | Extended recombinant polypeptides and compositions comprising same |
KR101544245B1 (en) | 2009-02-03 | 2015-08-12 | 아뮤닉스 오퍼레이팅 인코포레이티드 | Extended recombinant polypeptides and compositions comprising same |
JP2016106135A (en) * | 2009-02-03 | 2016-06-16 | アムニクス オペレーティング インコーポレイテッド | Extended recombinant polypeptides and compositions comprising the same |
JP2021059595A (en) * | 2009-02-03 | 2021-04-15 | アムニクス ファーマシューティカルズ, インコーポレイテッド | Extended recombinant polypeptides and compositions comprising the same |
EP2393828A4 (en) * | 2009-02-03 | 2013-06-26 | Amunix Operating Inc | Extended recombinant polypeptides and compositions comprising same |
JP2015034165A (en) * | 2009-02-03 | 2015-02-19 | アムニクス オペレーティング インコーポレイテッド | Extended recombinant polypeptides and compositions comprising the same |
US10961287B2 (en) | 2009-02-03 | 2021-03-30 | Amunix Pharmaceuticals, Inc | Extended recombinant polypeptides and compositions comprising same |
CN102348715B (en) * | 2009-02-03 | 2017-12-08 | 阿穆尼克斯运营公司 | Extension recombinant polypeptide and the composition for including the extension recombinant polypeptide |
EP3581579A1 (en) * | 2009-02-03 | 2019-12-18 | Amunix Pharmaceuticals, Inc. | Extended recombinant polypeptides and compositions comprising same |
JP2017031218A (en) * | 2009-02-03 | 2017-02-09 | アムニクス オペレーティング インコーポレイテッド | Extended recombinant polypeptides and compositions comprising the same |
JP2012516854A (en) * | 2009-02-03 | 2012-07-26 | アムニクス オペレーティング インコーポレイテッド | Extended recombinant polypeptide and composition comprising extended recombinant polypeptide |
CN108530543A (en) * | 2009-02-03 | 2018-09-14 | 阿穆尼克斯运营公司 | Extend recombinant polypeptide and includes the composition of the extension recombinant polypeptide |
EP2393828A1 (en) * | 2009-02-03 | 2011-12-14 | Amunix Operating Inc. | Extended recombinant polypeptides and compositions comprising same |
US9926351B2 (en) | 2009-02-03 | 2018-03-27 | Amunix Operating Inc. | Extended recombinant polypeptides and compositions comprising same |
JP2018076378A (en) * | 2009-02-03 | 2018-05-17 | アムニクス オペレーティング インコーポレイテッド | Extended recombinant polypeptides and compositions comprising the same |
US9173891B2 (en) | 2009-04-20 | 2015-11-03 | Angiochem, Inc. | Treatment of ovarian cancer using an anticancer agent conjugated to an angiopep-2 analog |
KR101813727B1 (en) * | 2009-06-08 | 2018-01-02 | 아뮤닉스 오퍼레이팅 인코포레이티드 | Growth hormone polypeptides and methods of making and using same |
JP2016185171A (en) * | 2009-06-08 | 2016-10-27 | アムニクス オペレーティング インコーポレイテッド | Growth hormone polypeptides and methods of making and using the same |
CN103140236B (en) * | 2009-06-08 | 2017-04-19 | 阿穆尼克斯运营公司 | Growth hormone polypeptides and methods of making and using same |
EP2440228A4 (en) * | 2009-06-08 | 2013-06-26 | Amunix Operating Inc | Glucose-regulating polypeptides and methods of making and using same |
EP2440241A4 (en) * | 2009-06-08 | 2013-06-12 | Amunix Operating Inc | Growth hormone polypeptides and methods of making and using same |
JP2015124222A (en) * | 2009-06-08 | 2015-07-06 | アムニクス オペレーティング インコーポレイテッド | Growth hormone polypeptide and methods of making and using the same |
CN103140236A (en) * | 2009-06-08 | 2013-06-05 | 阿穆尼克斯运营公司 | Growth hormone polypeptides and methods of making and using same |
AU2010258892B2 (en) * | 2009-06-08 | 2015-08-13 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
US10000543B2 (en) | 2009-06-08 | 2018-06-19 | Amunix Operating Inc. | Glucose-regulating polypeptides and methods of making and using same |
JP2012529297A (en) * | 2009-06-08 | 2012-11-22 | アムニクス オペレーティング インコーポレイテッド | Glucose-regulating polypeptide and methods for making and using the same |
JP2012529296A (en) * | 2009-06-08 | 2012-11-22 | アムニクス オペレーティング インコーポレイテッド | Growth hormone polypeptides and methods of making and using the same |
JP2017217014A (en) * | 2009-06-08 | 2017-12-14 | アムニクス オペレーティング インコーポレイテッド | Growth hormone polypeptides and methods of making and using the same |
US9849188B2 (en) | 2009-06-08 | 2017-12-26 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
EP3278813A1 (en) * | 2009-06-08 | 2018-02-07 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
EP2440241A1 (en) * | 2009-06-08 | 2012-04-18 | Amunix Operating Inc. | Growth hormone polypeptides and methods of making and using same |
EP2440228A1 (en) * | 2009-06-08 | 2012-04-18 | Amunix Operating Inc. | Glucose-regulating polypeptides and methods of making and using same |
JP2012531467A (en) * | 2009-07-02 | 2012-12-10 | アンジオケム インコーポレーテッド | Multimeric peptide conjugates and uses thereof |
US9161988B2 (en) | 2009-07-02 | 2015-10-20 | Angiochem Inc. | Multimeric peptide conjugates and uses thereof |
WO2011000095A1 (en) * | 2009-07-02 | 2011-01-06 | Angiochem Inc. | Multimeric peptide conjugates and uses thereof |
CN102596993A (en) * | 2009-07-02 | 2012-07-18 | 安吉奥开米公司 | Multimeric peptide conjugates and uses thereof |
US9062299B2 (en) | 2009-08-24 | 2015-06-23 | Amunix Operating Inc. | Coagulation factor IX compositions and methods of making and using same |
US9376672B2 (en) | 2009-08-24 | 2016-06-28 | Amunix Operating Inc. | Coagulation factor IX compositions and methods of making and using same |
EP2470559A1 (en) * | 2009-08-24 | 2012-07-04 | Amunix Operating Inc. | Coagulation factor ix compositions and methods of making and using same |
US9758776B2 (en) | 2009-08-24 | 2017-09-12 | Amunix Operating Inc. | Coagulation factor IX compositions and methods of making and using same |
EP2470670A1 (en) * | 2009-08-24 | 2012-07-04 | Amunix Operating Inc. | Coagulation factor vii compositions and methods of making and using same |
CN102741422A (en) * | 2009-08-24 | 2012-10-17 | 阿穆尼克斯运营公司 | Coagulation factor ix compositions and methods of making and using same |
CN102741275A (en) * | 2009-08-24 | 2012-10-17 | 阿穆尼克斯运营公司 | Coagulation factor ix compositions and methods of making and using same |
JP2013502458A (en) * | 2009-08-24 | 2013-01-24 | アムニクス オペレーティング インコーポレイテッド | Coagulation factor VII composition and methods of making and using the same |
JP2013502459A (en) * | 2009-08-24 | 2013-01-24 | アムニクス オペレーティング インコーポレイテッド | Coagulation factor IX composition and methods of making and using the same |
EP2470559A4 (en) * | 2009-08-24 | 2013-07-31 | Amunix Operating Inc | Coagulation factor ix compositions and methods of making and using same |
EP3222287A1 (en) * | 2009-08-24 | 2017-09-27 | Amunix Operating Inc. | Coagulation factor ix compositions and methods of making and using same |
EP2470670A4 (en) * | 2009-08-24 | 2013-07-10 | Amunix Operating Inc | Coagulation factor vii compositions and methods of making and using same |
JP2013511263A (en) * | 2009-11-19 | 2013-04-04 | 浙江大学 | Non-natural collagen-like protein and its application |
US9050318B2 (en) | 2009-12-06 | 2015-06-09 | Biogen Idec Hemophilia Inc. | Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof |
EP3326643A1 (en) | 2009-12-06 | 2018-05-30 | Bioverativ Therapeutics Inc. | Factor viii-fc chimeric and hybrid polypeptides, and methods of use thereof |
EP3906937A1 (en) | 2009-12-06 | 2021-11-10 | Bioverativ Therapeutics Inc. | Factor viii-fc chimeric and hybrid polypeptides, and methods of use thereof |
US11266720B2 (en) | 2009-12-06 | 2022-03-08 | Bioverativ Therapeutics Inc. | Factor VIII-FC chimeric and hybrid polypeptides, and methods of use thereof |
US9241978B2 (en) | 2009-12-06 | 2016-01-26 | Biogen Hemophilia Inc. | Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof |
US9976166B2 (en) | 2010-04-02 | 2018-05-22 | Amunix Operating Inc. | Binding fusion proteins, binding fusion protein-drug conjugates, XTEN-drug conjugates and methods of making and using same |
US10870874B2 (en) | 2010-04-02 | 2020-12-22 | Amunix Pharmaceuticals, Inc. | Binding fusion proteins, binding fusion protein-drug conjugates, XTEN-drug conjugates and methods of making and using same |
EP3593821A1 (en) | 2010-04-30 | 2020-01-15 | Molecular Partners AG | Modified binding proteins inhibiting the vegf-a receptor interaction |
WO2011135067A1 (en) | 2010-04-30 | 2011-11-03 | Molecular Partners Ag | Modified binding proteins inhibiting the vegf-a receptor interaction |
US10081657B2 (en) | 2010-05-21 | 2018-09-25 | Technische Universitat Munchen | Biosynthetic proline/alanine random coil polypeptides and their uses |
EP3473261A1 (en) | 2010-05-21 | 2019-04-24 | XL-protein GmbH | Biosynthetic proline/alanine random coil polypeptides and their uses |
US9221882B2 (en) | 2010-05-21 | 2015-12-29 | Technische Universitat Munchen | Biosynthetic proline/alanine random coil polypeptides and their uses |
WO2011144756A1 (en) | 2010-05-21 | 2011-11-24 | Xl-Protein Gmbh | Biosynthetic proline/alanine random coil polypeptides and their uses |
US10844094B2 (en) | 2010-05-21 | 2020-11-24 | Technische Universität München | Biosynthetic proline/alanine random coil polypeptides and their uses |
US9012403B2 (en) | 2010-06-18 | 2015-04-21 | Xiberscience Gmbh | Peptides as active agents to stabilize biological barriers |
WO2011157819A2 (en) | 2010-06-18 | 2011-12-22 | Xiberscience Gmbh | Peptides as active agents to stabilize biological barriers |
US10548954B2 (en) | 2010-07-09 | 2020-02-04 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US9670475B2 (en) | 2010-07-09 | 2017-06-06 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
EP3552619A1 (en) | 2010-07-09 | 2019-10-16 | Bioverativ Therapeutics Inc. | Factor ix polypeptides and methods of use thereof |
US10561714B2 (en) | 2010-07-09 | 2020-02-18 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US10568943B2 (en) | 2010-07-09 | 2020-02-25 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US9233145B2 (en) | 2010-07-09 | 2016-01-12 | Biogen Hemophila Inc. | Factor IX polypeptides and methods of use thereof |
US9629903B2 (en) | 2010-07-09 | 2017-04-25 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US9675676B2 (en) | 2010-07-09 | 2017-06-13 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US10898554B1 (en) | 2010-07-09 | 2021-01-26 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US9623091B2 (en) | 2010-07-09 | 2017-04-18 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
US9867873B2 (en) | 2010-07-09 | 2018-01-16 | Bioverativ Therapeutics Inc. | Factor IX polypeptides and methods of use thereof |
EP3514169A1 (en) | 2010-11-26 | 2019-07-24 | Molecular Partners AG | Designed repeat proteins binding to serum albumin |
WO2012069654A1 (en) | 2010-11-26 | 2012-05-31 | Molecular Partners Ag | Designed repeat proteins binding to serum albumin |
US9486507B2 (en) | 2011-06-10 | 2016-11-08 | Biogen Ma Inc. | Pro-coagulant compounds and methods of use thereof |
EP3527218A1 (en) | 2011-06-10 | 2019-08-21 | Bioverativ Therapeutics Inc. | Pro-coagulant compounds and methods of use thereof |
US10010622B2 (en) | 2011-07-08 | 2018-07-03 | Bioverativ Therapeutics Inc. | Factor VIII chimeric and hybrid polypeptides, and methods of use thereof |
US10881742B2 (en) | 2011-07-08 | 2021-01-05 | Bioverativ Therapeutics Inc. | Factor VIII chimeric and hybrid polypeptides, and methods of use thereof |
EP3513804A1 (en) | 2011-07-08 | 2019-07-24 | Bioverativ Therapeutics Inc. | Factor viii chimeric and hybrid polypeptides, and methods of use thereof |
EP4169525A1 (en) | 2011-07-08 | 2023-04-26 | Bioverativ Therapeutics Inc. | Factor viii chimeric and hybrid polypeptides, and methods of use thereof |
US10656167B2 (en) | 2011-07-25 | 2020-05-19 | Bioverativ Therapeutics Inc. | Assays to monitor bleeding disorders |
US11747351B2 (en) | 2011-07-25 | 2023-09-05 | Bioverativ Therapeutics Inc. | Assays to monitor bleeding disorders |
US11370827B2 (en) * | 2012-01-12 | 2022-06-28 | Bioverativ Therapeutics Inc. | Chimeric factor VIII polypeptides and uses thereof |
US11685771B2 (en) | 2012-02-15 | 2023-06-27 | Bioverativ Therapeutics Inc. | Recombinant factor VIII proteins |
US10370430B2 (en) | 2012-02-15 | 2019-08-06 | Bioverativ Therapeutics Inc. | Recombinant factor VIII proteins |
US10421798B2 (en) | 2012-02-15 | 2019-09-24 | Bioverativ Therapeutics Inc. | Factor VIII compositions and methods of making and using same |
US10172953B2 (en) | 2012-02-27 | 2019-01-08 | Amunix Operating Inc. | XTEN conjugate compositions and methods of making same |
US10953073B2 (en) | 2012-02-27 | 2021-03-23 | Amunix Pharmaceuticals, Inc. | XTEN conjugate compositions and methods of making same |
EP3646880A1 (en) | 2012-05-07 | 2020-05-06 | Allergan, Inc. | Method of treating amd in patients refractory to anti-vegf therapy |
WO2013169614A1 (en) | 2012-05-07 | 2013-11-14 | Allergan, Inc. | Method of treating amd in patients refractory to anti-vegf therapy |
US10568934B2 (en) | 2012-05-07 | 2020-02-25 | Allergan, Inc. | Method of treating AMD in patients refractory to anti-VEGF therapy |
WO2014001442A1 (en) | 2012-06-28 | 2014-01-03 | Molecular Partners Ag | Designed ankyrin repeat proteins binding to platelet-derived growth factor |
US10023628B2 (en) | 2012-07-06 | 2018-07-17 | Bioverativ Therapeutics Inc. | Cell line expressing single chain factor VIII polypeptides and uses thereof |
EP3404105A1 (en) | 2012-07-06 | 2018-11-21 | Bioverativ Therapeutics Inc. | Cell line expressing single chain factor viii polypeptides and uses thereof |
US11091534B2 (en) | 2012-07-11 | 2021-08-17 | Bioverativ Therapeutics Inc. | Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof |
US10138291B2 (en) | 2012-07-11 | 2018-11-27 | Bioverativ Therapeutics Inc. | Factor VIII complex with XTEN and von Willebrand Factor protein, and uses thereof |
US11225650B2 (en) | 2012-09-25 | 2022-01-18 | Bioverativ Therapeutics Inc. | Methods of using FIX polypeptides |
EP2738180A1 (en) | 2012-11-30 | 2014-06-04 | Molecular Partners AG | Binding proteins comprising at least two binding domains against HER2. |
US11642398B2 (en) | 2013-03-15 | 2023-05-09 | Bioverativ Therapeutics Inc. | Factor IX polypeptide formulations |
US10588949B2 (en) | 2013-03-15 | 2020-03-17 | Bioverativ Therapeutics Inc. | Factor IX polypeptide formulations |
WO2015022326A1 (en) | 2013-08-12 | 2015-02-19 | Xiber Science Gmbh | Peptides as active agents for treating primary graft dysfunction |
US10548953B2 (en) | 2013-08-14 | 2020-02-04 | Bioverativ Therapeutics Inc. | Factor VIII-XTEN fusions and uses thereof |
EP3628324A1 (en) | 2013-11-05 | 2020-04-01 | Allergan, Inc. | Method of treating conditions of the eye with an anti-vegf darpin |
WO2015069668A1 (en) | 2013-11-05 | 2015-05-14 | Allergan, Inc. | Method of treating conditions of the eye with an anti-vegf darpin |
US10584147B2 (en) | 2013-11-08 | 2020-03-10 | Biovertiv Therapeutics Inc. | Procoagulant fusion compound |
US11192936B2 (en) | 2014-01-10 | 2021-12-07 | Bioverativ Therapeutics Inc. | Factor VIII chimeric proteins and uses thereof |
EP3480213A1 (en) | 2014-06-18 | 2019-05-08 | Albert Einstein College of Medicine, Inc. | Syntac polypeptides and uses thereof |
WO2015195531A2 (en) | 2014-06-18 | 2015-12-23 | Albert Einstein College Of Medicine, Inc. | Syntac polypeptides and uses thereof |
EP3483179A1 (en) | 2014-06-18 | 2019-05-15 | Albert Einstein College of Medicine, Inc. | Syntac polypeptides and uses thereof |
WO2016156596A1 (en) | 2015-04-02 | 2016-10-06 | Molecular Partners Ag | Designed ankyrin repeat domains with binding specificity for serum albumin |
US11332501B2 (en) | 2015-04-02 | 2022-05-17 | Molecular Partners Ag | Recombinant binding proteins and their use |
US10155791B2 (en) | 2015-04-02 | 2018-12-18 | Molecular Partners Ag | Recombinant binding proteins and their use |
US9458211B1 (en) | 2015-04-02 | 2016-10-04 | Molecular Partners Ag | Recombinant proteins that simultaneously bind HGF, VEGF-A and serum albumin, comprising ankyrin repeat domains |
US11208452B2 (en) | 2015-06-02 | 2021-12-28 | Novo Nordisk A/S | Insulins with polar recombinant extensions |
US10980892B2 (en) | 2015-06-15 | 2021-04-20 | Angiochem Inc. | Methods for the treatment of leptomeningeal carcinomatosis |
US10745680B2 (en) | 2015-08-03 | 2020-08-18 | Bioverativ Therapeutics Inc. | Factor IX fusion proteins and methods of making and using same |
US11713358B2 (en) | 2015-08-28 | 2023-08-01 | Amunix Pharmaceuticals, Inc. | Chimeric polypeptide assembly and methods of making and using the same |
US11292825B2 (en) | 2015-10-01 | 2022-04-05 | Novo Nordisk A/S | Protein conjugates |
WO2017201131A1 (en) | 2016-05-18 | 2017-11-23 | Albert Einstein College Of Medicine, Inc. | Variant pd-l1 polypeptides, t-cell modulatory multimeric polypeptides, and methods of use thereof |
WO2017201210A1 (en) | 2016-05-18 | 2017-11-23 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
WO2018129474A1 (en) | 2017-01-09 | 2018-07-12 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
US11471537B2 (en) | 2017-04-05 | 2022-10-18 | Novo Nordisk A/S | Oligomer extended insulin-Fc conjugates |
WO2019051127A1 (en) | 2017-09-07 | 2019-03-14 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptide with conjugation sites and methods of use thereof |
WO2019139896A1 (en) | 2018-01-09 | 2019-07-18 | Cue Biopharma, Inc. | Multimeric t-cell modulatory polypeptides and methods of use thereof |
WO2019201855A1 (en) * | 2018-04-16 | 2019-10-24 | Swedish Orphan Biovitrum Ab (Publ) | Lysosomal fusion protein |
WO2020181062A1 (en) | 2019-03-06 | 2020-09-10 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
WO2022032187A1 (en) | 2020-08-07 | 2022-02-10 | Bristol-Myers Squibb Company | Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis |
US11529394B2 (en) | 2020-09-30 | 2022-12-20 | Beijing Ql Biopharmaceutical Co., Ltd. | Polypeptide conjugates and methods of uses |
WO2022115597A1 (en) | 2020-11-25 | 2022-06-02 | Bristol-Myers Squibb Company | Methods of treating liver diseases |
WO2022123459A1 (en) | 2020-12-11 | 2022-06-16 | Friedrich Miescher Institute For Biomedical Research | Hdac6 binding proteins and their anti-viral use |
Also Published As
Publication number | Publication date |
---|---|
SI2402754T2 (en) | 2023-09-29 |
WO2007103455A2 (en) | 2007-09-13 |
AU2007223855A1 (en) | 2007-09-13 |
SI2402754T1 (en) | 2015-02-27 |
EP2863222A1 (en) | 2015-04-22 |
EP1996220B2 (en) | 2023-08-16 |
CA2644712C (en) | 2016-09-13 |
AU2007223888A1 (en) | 2007-09-13 |
EP1996220A2 (en) | 2008-12-03 |
EP1996937A4 (en) | 2009-04-08 |
CA2644712A1 (en) | 2007-09-13 |
EP1996220B1 (en) | 2013-05-08 |
WO2007103515A3 (en) | 2008-04-03 |
DK2402754T3 (en) | 2015-01-12 |
EP1996220A4 (en) | 2009-04-29 |
WO2007103455A3 (en) | 2007-11-29 |
AU2007223855B2 (en) | 2013-05-16 |
EP1996937A2 (en) | 2008-12-03 |
DK2402754T4 (en) | 2023-08-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9938331B2 (en) | Biologically active proteins having increased in vivo and/or in vitro stability | |
EP1996220B1 (en) | Unstructured recombinant polymers and uses thereof | |
US7846445B2 (en) | Methods for production of unstructured recombinant polymers and uses thereof | |
US20090099031A1 (en) | Genetic package and uses thereof | |
EP2402754B9 (en) | Unstructured recombinant polymers and uses thereof | |
US20200283505A1 (en) | Fast-off rate serum albumin binding fibronectin type iii domains | |
KR20160135762A (en) | Serum albumin-binding fibronectin type iii domains | |
JP2010536341A (en) | Compositions and methods for altering properties of biologically active polypeptides | |
CA2644548A1 (en) | Genetic packages and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780015899.2 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2644712 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008558403 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 7905/DELNP/2008 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007223855 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007752636 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2007223855 Country of ref document: AU Date of ref document: 20070306 Kind code of ref document: A |