WO2007103261A2 - Listeria-based epha2 immunogenic compositions - Google Patents
Listeria-based epha2 immunogenic compositions Download PDFInfo
- Publication number
- WO2007103261A2 WO2007103261A2 PCT/US2007/005512 US2007005512W WO2007103261A2 WO 2007103261 A2 WO2007103261 A2 WO 2007103261A2 US 2007005512 W US2007005512 W US 2007005512W WO 2007103261 A2 WO2007103261 A2 WO 2007103261A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- epha2
- listeria
- cancer
- antigenic peptide
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/10—Protein-tyrosine kinases (2.7.10)
- C12Y207/10001—Receptor protein-tyrosine kinase (2.7.10.1)
Definitions
- the present invention provides nucleic acid constructs comprising a nucleotide sequence encoding an EphA2 antigenic peptide and Listeria comprising such constructs.
- the present invention provides Listeria engineered to express a plurality of EphA2 antigenic peptides and immunogenic compositions comprising such Listeria.
- the invention encompasses, inter alia, the use of the immunogenic compositions for eliciting an immune response against an EphA2-expressing cell, as well as for the treatment, management and/or prevention of a hyperproliferative disorder and/or a disease involving aberrant angiogenesis.
- Listeria preferably Listeria monocytogenes
- Listeria monocytogenes is a Gram-positive facultative intracellular bacterium that is being developed for use in antigen-specific immunogenic compositions due to its ability to prime a potent CD4+/CD8+ T-cell mediated response via both MHC class I and class II antigen presentation pathways, and as such it has been tested recently as a vaccine vector in a human clinical trial among normal healthy volunteers.
- Listeria has been studied for many years as a model for stimulating both innate and adaptive T cell-dependent antibacterial immunity.
- the ability of Listeria to effectively stimulate cellular immunity is based on its intracellular lifecycle.
- the bacterium Upon infecting the host, the bacterium is rapidly taken up by phagocytes including macrophages and dendritic cells into a phagolysosomal compartment. The majority of the bacteria are subsequently degraded.
- MHC class II molecules Peptides resulting from proteolytic degradation of pathogens within phagosomes of infected APCs are loaded directly onto MHC class II molecules, and these MHC II-peptide complexes activate CD4+ "helper" T cells that stimulate the production of antibodies, and the processed antigens are expressed on the surface of the antigen presenting cell via the class II endosomal pathway.
- certain bacterial genes are activated including the cholesterol-dependent cytolysin, LLO, which can degrade the phagolysosome, releasing the bacterium into the cytosolic compartment of the host cell, where the surviving Listeria propagate. Efficient presentation of heterologous antigens via the MHC class I pathway requires de novo endogenous protein expression by Listeria.
- antigen presenting cells proteins synthesized and secreted by Listeria are sampled and degraded by the proteosome. The resulting peptides are shuttled into the endoplasmic reticulum by TAP proteins and loaded onto MHC class I molecules. The MHC I-peptide complex is delivered to the cell surface, which in combination with sufficient co-stimulation (signal 2) activates and stimulates cytotoxic T lymphocytes (CTLs) having the cognate T cell receptor to expand and subsequently recognize the MHC I-peptide complex.
- signal 2 sufficient co-stimulation
- CTLs cytotoxic T lymphocytes
- a neoplasm, or tumor is a neoplastic mass resulting from abnormal uncontrolled cell growth which can be benign or malignant. Benign tumors generally remain localized. Malignant tumors are collectively termed cancers.
- malignant generally means that the tumor can invade and destroy neighboring body structures and spread to distant sites to cause death (for review, see Robbins and Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68-122). Cancer can arise in many sites of the body and behaves differently depending upon its origin. Cancerous cells destroy the part of the body in which they originate and then spread to other part(s) of the body where they start new growth and cause more destruction. [006] More than 1.2 million Americans develop cancer each year. Cancer is the second leading cause of death in the United States and, if current trends continue, cancer is expected to be the leading cause of death by the year 2010. Lung and prostate cancer are the top cancer killers for men in the United States.
- Lung and breast cancer are the top cancer killers for women in the United States.
- One in two men in the United States will be diagnosed with cancer at some time during his lifetime.
- One in three women in the United States will be diagnosed with cancer at some time during her lifetime.
- a cure for cancer has yet to be found.
- Current treatment options, such as surgery, chemotherapy and radiation treatment, are often either ineffective or present serious side effects.
- Cancer is a disease of aberrant signal transduction. Aberrant cell signaling overrides anchorage-dependent constraints on cell growth and survival (Rhim et al, 1997, CHt. Rev. in Oncogenesis 8:305; Patarca, 1996, Crit. Rev. in Oncogenesis 7:343; Malik et al, 1996, Biochimica et Biophysica Acta 1287:73; Cance et al, 1995, Breast Cancer Res. Treat. 35:105).
- Tyrosine kinase activity is induced by extracellular matrix (ECM) anchorage and indeed, the expression or function of tyrosine kinases is usually increased in malignant cells (Rhim et al., 1997, Critical Reviews in Oncogenesis 8:305; Cance et al., 1995, Breast Cancer Res. Treat. 35:105; Hunter, 1997, Cell 88:333). Based on evidence that tyrosine kinase activity is necessary for malignant cell growth, tyrosine kinases have been targeted with new therapeutics (Levitzki et al., 1995, Science 267:1782; Kondapaka et al., 1996, MoI. & Cell. Endocrinol. 117:53; Fry et al., 1995, Curr. Opin. in
- tyrosine kinase activity is often vital for the function and survival of benign tissues (Levitzki et al., 1995, Science 267:1782). To minimize collateral toxicity, it is critical to first identify and then target tyrosine kinases that are selectively overexpressed in tumor cells.
- cancer therapy may involve surgery, chemotherapy, hormonal therapy and/or radiation treatment to eradicate neoplastic cells in a patient (see, e.g., Stockdale, 1998, "Principles of Cancer Patient Management," in Scientific American: Medicine, vol. 3, Rubenstein and Federman, eds., ch. 12, sect. IV).
- cancer therapy may also involve biological therapy or immunotherapy. All of these approaches can pose significant drawbacks for the patient.
- Surgery for example, may be contraindicated due to the health of the patient or may be unacceptable to the patient. Additionally, surgery may not completely remove the neoplastic tissue.
- Radiotherapy is only effective when the neoplastic tissue exhibits a higher sensitivity to radiation than normal tissue, and radiation therapy can also often elicit serious side effects.
- Hormonal therapy is rarely given as a single agent and, although it can be effective, is often used to prevent or delay recurrence of cancer after other treatments have removed the majority of the cancer cells.
- Biological therapies/immunotherapies are limited in number and each therapy is generally effective for only a very specific type of cancer.
- chemotherapeutic agents available for treatment of cancer.
- a significant majority of cancer chemotherapeutics act by inhibiting DNA synthesis, either directly, or indirectly by inhibiting the biosynthesis of the deoxyribonucleotide triphosphate precursors, to prevent DNA replication and concomitant cell division (see, e.g., Gilman et ah, 1990, Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 8th Ed. (Pergamom Press, New York)).
- agents which include alkylating agents, such as nitrosourea, antimetabolites, such as methotrexate and hydroxyurea, and other agents, such as etoposides, campathecins, bleomycin, doxorubicin, daunorubicin, etc., although not necessarily cell cycle specific, kill cells during S phase because of their effect on DNA replication.
- agents specifically colchicine and the vinca alkaloids, such as vinblastine and vincristine, interfere with microtubule assembly resulting in mitotic arrest.
- Chemotherapy protocols generally involve administration of a combination of chemotherapeutic agents to increase the efficacy of treatment.
- chemotherapeutic agents have many drawbacks (see, e.g., Stockdale, 1998, "Principles Of Cancer Patient Management” in Scientific American Medicine, vol. 3, Rubenstein and Federman, eds., ch. 12, sect. X). Almost all chemotherapeutic agents are toxic, and chemotherapy causes significant, and often dangerous, side effects, including severe nausea, bone marrow depression, immunosuppression, etc.
- Asthma is a disorder characterized by intermittent airway obstruction. In western countries, it affects 15% of the pediatric population and 7.5% of the adult population (Strachan et al., 1994, Arch. Dis. Child 70:174-178). Most asthma in children and young adults is initiated by IgE mediated allergy (atopy) to inhaled allergens such as house dust mite and cat dander allergens. However, not all asthmatics are atopic, and most atopic individuals do not have asthma. Thus, factors in addition to atopy are necessary to induce the disorder (Fraser et al, eds.
- Asthma is strongly familial, and is due to the interaction between genetic and environmental factors. The genetic factors are thought to be variants of normal genes ("polymorphisms") which alter their function to predispose to asthma. [0016] Asthma may be identified by recurrent wheeze and intermittent air flow limitation.
- An asthmatic tendency may be quantified by the measurement of bronchial hyper-responsiveness in which an individual's dose-response curve to a broncho-constrictor such as histamine or methacholine is constructed.
- the curve is commonly summarized by the dose which results in a 20% fall in air flow (PD20) or the slope of the curve between the initial air flow measurement and the last dose given (slope).
- PD20 20% fall in air flow
- IgE is produced by B-cells in response to allergen stimulation. These antibodies coat mast cells by binding to the high affinity receptor for IgE and initiate a series of cellular events leading to the destabilization of the cell membrane and release of inflammatory mediators. This results in mucosal inflammation, wheezing, coughing, sneezing and nasal blockage.
- Atopy can be diagnosed by (i) a positive skin prick test in response to a common allergen; (ii) detecting the presence of specific serum IgE for allergen; or (iii) by detecting elevation of total serum IgE.
- COPD chronic obstructive pulmonary disease
- chronic bronchitis and emphysema are most commonly caused by smoking; approximately 90% of patients with COPD are or were smokers. Although approximately 50% of smokers develop chronic bronchitis, only 15% of smokers develop disabling airflow obstruction. Certain animals, particularly horses, suffer from COPD as well.
- the airflow obstruction associated with COPD is progressive, may be accompanied by airway hyperactivity, and may be partially reversible. Non-specific airway hyper-responsiveness may also play a role in the development of COPD and may be predictive of an accelerated rate of decline in lung function.
- COPD is a significant cause of death and disability. It is currently the fourth leading cause of death in the United States and Europe. Treatment guidelines advocate early detection and implementation of smoking cessation programs to help reduce morbidity and mortality due to the disorder. However, early detection and diagnosis has been difficult for a number of reasons. COPD takes years to develop and acute episodes of bronchitis often are not recognized by the general practitioner as early signs of COPD. Many patients exhibit features of more than one disorder (e.g., chronic bronchitis or asthmatic bronchitis) making precise diagnosis a challenge, particularly early in the etiology of the disorder.
- chronic bronchitis or asthmatic bronchitis e.g., chronic bronchitis or asthmatic bronchitis
- Mucins are a family of glycoproteins secreted by the epithelial cells including those at the respiratory, gastrointestinal and female reproductive tracts. Mucins are responsible for the viscoelastic properties of mucus (Thornton et al., 1997, /. Biol. Chem. 272:9561-9566).
- MUC 1, MUC 2, MUC 3, MUC 4, MUC 5AC, MUC 5B, MUC 6, MUC 7 and MUC 8 (Bobek et al., 1993, J. Biol. Chem. 268:20563-9; Dusseyn et al., 1997, J. Biol. Chem.
- Mucociliary impairment caused by mucin hypersecretion leads to airway mucus plugging which promotes chronic infection, airflow obstruction and sometimes death.
- COPD a disorder characterized by slowly progressive and irreversible airflow limitation, is a major cause of death in developed countries.
- the respiratory degradation consists mainly of decreased luminal diameters due to airway wall thickening and increased mucus caused by goblet cell hyperplasia and hypersecretion.
- EGF Epidermal growth factor
- mucin production/secretion is known to upregulate epithelial cell proliferation, and mucin production/secretion (Takeyama et al., 1999, Proc. Natl. Acad. ScL USA 96:3081-6; Burgel et al., 2001, J. Immunol. 167:5948-54).
- EGF also causes mucin-secreting cells, such as goblet cells, to proliferate and increase mucin production in airway epithelia (Lee et al., 2000, Am. J. Physiol. Lung Cell. MoI Physiol. 278:185-92; Takeyama et al., 2001, Am. J. Respir. Crit. Care. Med.
- mucus hypersecretion has been treated in two ways: physical methods to increase clearance and mucolytic agents. Neither approach has yielded significant benefit to the patient or reduced mucus obstruction. Therefore, it would be desirable to have methods for reducing mucin production and treating the disorders associated with mucin hypersecretion.
- Vascular interventions including angioplasty, stenting, atherectomy and grafting are often complicated by undesirable effects. Exposure to a medical device which is implanted or inserted into the body of a patient can cause the body tissue to exhibit adverse physiological reactions. For instance, the insertion or implantation of certain catheters or stents can lead to the formation of emboli or clots in blood vessels. Other adverse reactions to vascular intervention include endothelial cell proliferation which can lead to hyperplasia, restenosis, i.e. the re-occlusion of the artery, occlusion of blood vessels, platelet aggregation, and calcification. Treatment of restenosis often involves a second angioplasty or bypass surgery.
- restenosis may be due to endothelial cell injury caused by the vascular intervention in treating a restenosis.
- Angioplasty involves insertion of a balloon catheter into an artery at the site of a partially obstructive atherosclerotic lesion. Inflation of the balloon is intended to rupture the intima and dilate the obstruction. About 20 to 30% of obstructions reocclude in just a few days or weeks (Eltchaninoff et al., 1998, J. Am Coll Cardiol 32: 980-984). Use of stents reduces the re-occlusion rate, however a significant percentage continues to result in restenosis.
- Restenosis is caused by an accumulation of extracellular matrix containing collagen and proteoglycans in association with smooth muscle cells which is found in both the atheroma and the arterial hyperplastic lesion after balloon injury or clinical angioplasty. Some of the delay in luminal narrowing with respect to smooth muscle cell proliferation may result from the continuing elaboration of matrix materials by neointimal smooth muscle cells. Various mediators may alter matrix synthesis by smooth muscle cells in vivo.
- Neointimal hyperplasia is the pathological process that underlies graft atherosclerosis, stenosis, and the majority of vascular graft occlusion. Neointimal hyperplasia is commonly seen after various forms of vascular injury and a major component of the vein graft's response to harvest and surgical implantation into high-pressure arterial circulation.
- EphA2 is a 130 kDa receptor tyrosine kinase that is expressed in adult epithelia, where it is found at low levels and is enriched within sites of cell-cell adhesion (Zantek et al, 1999, Cell Growth & Differentiation 10:629; Lindberg et al, 1990, Molecular & Cellular Biology 10:6316). This subcellular localization is important because EphA2 binds ligands (known as EphrinsAl to A5) that are anchored to the cell membrane (Eph Nomenclature Committee, 1997, Cell 90:403; Gale et ah, 1997, Cell & Tissue Research 290: 227).
- EphA2 autophosphorylation The primary consequence of ligand binding is EphA2 autophosphorylation (Lindberg et al., 1990, supra). However, unlike other receptor tyrosine kinases, EphA2 retains enzymatic activity in the absence of ligand binding or phosphotyrosine content (Zantek et al., 1999, supra). E ⁇ hA2 is upregulated on a large number hyperproliferating cells, including aggressive carcinoma cells.
- EphA2 is overexpressed and functionally altered in a large number of malignant carcinomas.
- EphA2 is an oncoprotein and is sufficient to confer metastatic potential to cancer cells.
- EphA2 is also associated with other hyperproliferating cells and is implicated in diseases caused by cell hyperproliferation.
- the present invention stems, in part, from the inventors' discovery that administration of Listeria that express an EphA2 antigenic peptide to a subject provides beneficial therapeutic and prophylactic benefits against hyperproliferative disorders involving EphA2 overexpressing cells. Without being bound by any mechanism or theory, it is believed that the therapeutic and prophylactic benefit is the result of an immune response elicited by administration of the EphA2 antigenic peptide-expressing Listeria.
- the present invention thus provides Listeria-based EphA2 immunogenic compositions and methods for their use.
- the immunogenic compositions are vaccines.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the present invention can elicit a cellular immune response, a humoral immune response, or both.
- the immune response is a cellular immune response, it can be a Tc, ThI or a Th2 immune response.
- the immune response is a Th2 cellular immune response.
- a Listeri ⁇ -based EphA2 immunogenic composition of the invention expresses one or more epitopes of EphA2 that is selectively exposed or increased on cancer cells relative to non-cancer cells (i.e., normal, healthy cells or cells that are not hyperproliferative).
- the cancer is of an epithelial cell origin.
- the cancer is a cancer of the skin, lung, colon, prostate, breast, ovary, esophageal, bladder, or pancreas or is a renal cell carcinoma or a melanoma.
- the cancer is of a T cell origin.
- the cancer is a leukemia or a lymphoma.
- the cancer is a glioma.
- the Listeri ⁇ -based EphA2 immunogenic compositions comprise Listeria as an EphA2 antigenic peptide expression vehicle.
- the Listeria- based EphA2 immunogenic compositions for use in a subject are attenuated.
- the attenuated Listeria bacteria may be, for example, deficient in DNA repair (e.g., mutant in a DNA repair gene), attenuated in their tissue tropism (e.g., inlB mutant), and/ or attenuated in their ability to spread from cell to cell ⁇ e.g., actA mutant).
- the attenuated Listeria bacteria comprise a mutation (e.g., a deletion, addition or substitution) in one or more internalins (e.g., inlA and/or inlB), and such mutation results in or contributes to the attenuation of the Listeria.
- the attenuated Listeria bacteria are attenuated in their tissue tropism (e.g., MB mutant) and in their ability to spread from cell to cell (e.g., actA mutant).
- the attenuated Listeria bacteria comprise a mutation (e.g., a deletion, addition or substitution) in internalin B and a mutation in actA, and such mutations result in or contribute to the attenuation of the Listeria.
- the Listeria-based EphA2 immunogenic compositions of the invention may have one or a plurality of EphA2 antigenic peptide-expressing Listeria.
- a immunogenic composition of the invention has 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more EphA2 antigenic peptide-expressing Listeria, or 2-5, 2-10, 2-20, 10-20, or 15-25 EphA2 antigenic peptide-expressing Listeria.
- the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprise the full-length EphA2 sequence.
- the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprises (or consists of) the extracellular (ECD or EX) and cytoplasmic (ICD or CO) domains of EphA2, joined together, and the peptide has a lysine to methionine substitution at position 646.
- the transmembrane domain is deleted.
- the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprises the extracellular domain of EphA2 or a fragment thereof.
- the EphA2 antigenic peptide of one or more EphA2 antigenic peptide-expressing Listeria comprises the cytoplasmic domain or a fragment thereof, and, in certain embodiments, the peptide has a lysine to methionine substitution at position 646.
- the Listeria-based EphA2 immunogenic compositions of the invention comprise Listeria bacteria engineered to express one, two, three or more EphA2 antigenic peptides.
- an EphA2 antigenic peptide-expressing Listeria expresses 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more EphA2 antigenic peptides, or 2-5, 2- 10, 2-20, 10-20, or 15-25 EphA2 antigenic peptides.
- any species, strain and/or type of Listeria can be engineered to express one, two, three or more EphA2 antigenic peptides.
- Non- limiting examples of species of Listeria bacteria include Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri.
- the Listeria is Listeria monocytogenes.
- the Listeria are attenuated. [0037]
- Listeria, preferably attenuated Listeria are engineered to express two EphA2 antigenic peptides from a single Listeria locus that is not required for growth and spread of the Listeria.
- Listeria preferably attenuated Listeria
- Listeria are engineered to express two EphA2 antigenic peptides from a single Listeria locus that is required for growth and spread of the Listeria ⁇ e.g., the actA locus).
- Listeria preferably attenuated Listeria
- Non-limiting examples of such Listeria locus include actA, intemalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl.
- Non- limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the locus is the actA locus or the inlB locus.
- Listeria may be engineered to express two EphA2 antigenic peptides from a single locus using a vector comprising a bicistronic expression cassette.
- the bicistronic expression cassette comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non- limiting examples of promoters); (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising an EphA2 immunodominant epitope.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Listeria preferably attenuated Listeria
- Listeria are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are not required for growth and spread of the Listeria.
- Listeria, preferably attenuated Listeria are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are required for growth and spread of the Listeria ⁇ e.g., the actA locus).
- Listeria preferably attenuated Listeria
- Listeria loci are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more loci are required for growth and spread of the Listeria and one or more loci are not required for growth and spread of the Listeria.
- Listeria, preferably attenuated Listeria are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more loci are virulence genes.
- Non-limiting examples of such Listeria loci include actA, intemalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, My, plcA, pcLB, and mpl.
- Listeria preferably attenuated Listeria, are engineered to express 2 or more EphA2 antigenic peptides from two Listeria loci.
- the loci are the actA locus and the inlB locus.
- Listeria may be engineered to express multiple EphA2 antigenic peptides from multiple loci using multiple vectors.
- these vectors may comprise monocistronic, bicistronic and/or polyc ⁇ stronic expression cassettes.
- attenuated Listeria are engineered to express two EphA2 antigenic peptides, wherein the first EphA2 antigenic peptide is expressed from the actA locus and the second EphA2 antigenic peptide is expressed from the inlB locus.
- Listeria are engineered to express two EphA2 antigenic peptides from two Listeria loci.
- the Listeria loci are required for growth and spread of the Listeria.
- attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the MB locus.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the MB locus, wherein the first EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA, and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPa signal peptide.
- EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA
- the first EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO:122), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO: 119).
- EphA2 preferably human EphA2
- the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPA signal peptide (SEQ ID NO:84 or S
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- Listeria may be engineered to express two EphA2 antigenic peptides from two loci using two vectors, each vector comprising a monocistronic expression cassette.
- each monocistronic construct comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters); (2) a Shine-Dalgarno sequence; and (3) a nucleotide sequence encoding an EphA2 antigenic peptide.
- the two monocistronic expression cassettes may or may not comprise the same EphA2 antigenic peptide.
- the expression cassettes comprise different EphA2 antigenic peptides.
- one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably human EphA2) or a fragment thereof and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably human EphA2) or a fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptides are fusion proteins comprising a signal peptide. Non-limiting examples of signal peptides are provided in Section 5.2.3.3.1 below.
- one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA, and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 or a fragment thereof with, in certain embodiments, a lysine to methionine substitution at position 646 and a BaPa signal peptide.
- the first EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NOrIlO), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ED NO: 122), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO:119).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- the two vectors are preferably integrated into the Listeria genome.
- Listeria, preferably attenuated Listeria are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus that is not required for growth and spread of the Listeria..
- Listeria preferably attenuated Listeria
- Listeria are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus that is required for growth and spread (e.g., the actA locus) of the Listeria.
- Listeria preferably attenuated Listeria
- Listeria loci include actA, intemalin (ml) A, MB, inlC, inlD, inlD, inlE, inlF, i ⁇ lG, inlH, My, plcA, pclB, and mpl.
- attenuated Listeria are engineered to express three or more EphA2 antigenic peptides from the actA or inlB locus.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Listeria may be engineered to express three or more EphA2 antigenic peptides from a single locus using a vector comprising a polycistronic expression cassette.
- the polycistronic expression cassette comprises the following elements: (1) a single prokaryotic promoter regulating the expression of all of the EphA2 antigenic peptides; (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide); (7) a Shine-Dalgarno sequence; and (8) a third nucleotide sequence encoding a third EphA2 antigenic peptide (which may or may not be different from the first and/or second EphA2 antigenic peptides).
- the EphA2 antigenic peptides comprise EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA.
- one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- the two vectors are preferably integrated into the Listeria genome.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of E ⁇ hA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA.
- EphA2 antigenic peptides are fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a first nucleotide sequence encoding a first EphA2 antigenic peptide and a second nucleotide sequence encoding a second EphA2 antigenic peptide.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO:122).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide.
- each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide.
- one or more of the nucleic acids is integrated into the Listeria chromosomal DNA.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the nucleic acids are integrated into the Listeria chromosomal DNA. Li a specific embodiment, the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA.
- the EphA2 antigenic peptide is a fusion protein comprising the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- the two vectors are preferably integrated into the Listeria genome.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 has been substituted for lysine, m yet another embodiment, the second EphA2 antigenic peptide is an immunodominant epitope of the EphA2 intracellular domain.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA.
- the first and/or second EphA2 antigenic peptides may be fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- Non-limiting examples of signal peptides are provide below in Section 5.2.3.3.1.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of actA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with a lysine to methionine substitution at amino acid residue 646.
- the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of actA and the extracellular domain of EphA2 (
- the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 110) and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO: 119) and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with a lysine to methionine substitution at amino acid residue 646.
- the first and/or second nucleic acids may be integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the MB locus.
- the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises E ⁇ hA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the E ⁇ hA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the E ⁇ hA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA of Listeria monocytogenes 10403S (SEQ ED NO: 122).
- the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- one or more of the nucleic acids is integrated into the Listeria chromosomal DNA.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, and the second nucleic acid comprises a second EphA2 antigenic peptide cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the nucleic acids are integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the fusion protein comprises an immunodominant epitope of EphA2.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ED NO: 122).
- the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic
- EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine.
- the second EphA2 antigenic peptide is an immunodominant epitope of EphA2 intracellular domain.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122).
- the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
- signal peptides are provided below in Section 5.2.3.3.1.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide expression cassette comprising a promoter and a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of actA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 antigenic peptide expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine.
- the first nucleic acid comprises a first nucleotide sequence en
- the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the inlB locus.
- the Listeria-based EphA2 immunogenic compositions are useful to produce antibodies which can be used in diagnostic immunoassays, passive immunotherapy and the generation of antiidiotypic antibodies.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are also useful for eliciting an immune response against an EphA2-expressing cell.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of disorders associated with aberrant expression (e.g., overexpression) of EphA2.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are useful for eliciting an immune response against EphA2 expressed on neovasculature.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of hyperproliferative (neoplastic and non-neoplastic).
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of disorders associated with aberrant angiogenesis.
- the present invention provides methods of eliciting an immune response against an EphA2-expressing cell, said method comprising administering to an individual a Listeri ⁇ -based EphA2 immunogenic composition in an amount effective to elicit an immune response against an EphA2-expressing cell.
- the present invention also provides Listeri ⁇ -based EphA2 immunogenic compositions useful for eliciting an immune response against an EphA2-ex ⁇ ressing cell and/or for treating, preventing or managing a hyperproliferative disorder of EphA2-expressing cells.
- the present invention provides a method of treating, preventing and/or managing a hyperproliferative disorder of EphA2-expressing cells, said method comprising administering to a subject a Listeria-based EphA2 immunogenic composition in an amount effective treat or prevent the hyperproliferative disorder (e.g., a neoplastic hyperproliferative disorder and a non-neoplastic hyperproliferative disorder).
- the hyperproliferative disorder e.g., a neoplastic hyperproliferative disorder and a non-neoplastic hyperproliferative disorder.
- the hyperproliferative disease is cancer.
- the cancer is of an epithelial cell origin and/or involves cells that overexpress EphA2 relative to non- cancer cells having the tissue type of said cancer cells.
- the cancer is a cancer of the skin, lung, colon, breast, ovary, esophageal, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma.
- the cancer is of a T cell origin.
- the cancer is a leukemia or a lymphoma.
- the hyperproliferative disorder is non-neoplastic.
- the non-neoplastic hyperproliferative disorder is an epithelial cell disorder.
- non-neoplastic hyperproliferative disorders are asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
- the hyperproliferative disease is an endothelial cell disorder.
- the methods of the invention are used to prevent, treat and/or manage EphA2-expressing tumor metastases, hi a preferred embodiment, the EphA2-expressing cells against which an immune response is sought ("target cells") overexpress EphA2 relative to a normal healthy cell of the same type as assessed by an assay described herein or known to one of skill in the art (e.g., an immunoassay such as an ELISA or a Western blot, a Northern blot or RT-PCR).
- an immunoassay such as an ELISA or a Western blot, a Northern blot or RT-PCR.
- less EphA2 on the target cells is bound to ligand compared to a normal, healthy cell of the same type, either as a result of decreased cell-cell contacts, altered subcellular localization, or increases in amount of EphA2 relative to ligand.
- approximately 10% or less, approximately 15% or less, approximately 20% or less, approximately 25% or less, approximately 30% or less, approximately 35% or less, approximately 40% or less, approximately 45% or less, approximately 50% or less, approximately 55% or less, approximately 60% or less, approximately 65% or less, approximately 70% or less, approximately 75% or less, approximately 80% or less, approximately 85% or less, approximately 90% or less, or approximately 95% or less of EphA2 on the target cells is bound to ligand ⁇ e.g., EphrinAl) compared to a normal, healthy cell of the same type as assessed by an assay known in the art (e.g., an immunoassay).
- 1-10 fold, 1-8 fold, 1-5 fold, 1-4 fold or 1-2 fold, or 1 fold, 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, or 10 fold less EphA2 on target cells is bound to ligand (e.g., EphrinAl) compared to a normal, healthy cell of the same type as assessed by an assay known in the art (e.g., an immunoassay).
- ligand e.g., EphrinAl
- the Listeria-based EphA2 immunogenic compositions of the invention are used to treat, prevent and/or manage a non-cancer disease or disorder associated with cell hyperproliferation, such as but not limited to asthma, chronic obstructive pulmonary disease, restenosis (smooth muscle and/or endothelial), psoriasis, etc.
- a non-cancer disease or disorder associated with cell hyperproliferation such as but not limited to asthma, chronic obstructive pulmonary disease, restenosis (smooth muscle and/or endothelial), psoriasis, etc.
- the hyperproliferative cells are epithelial.
- the hyperproliferative cells overexpress EphA2.
- EphA2 is not bound to ligand as assessed by an assay known in the art (e.g., an immunoassay), either as a result of decreased cell-cell contacts, altered subcellular localization, or increases in the amount of EphA2 relative to EphA2-ligand.
- an assay known in the art e.g., an immunoassay
- the present invention provides methods of treating, preventing and/or managing a disorder associated with or involving aberrant angiogenesis comprising administering to a subject in need thereof a Listeri ⁇ -based EphA2 immunogenic composition in an amount effective to treat, prevent and/or manage a disorder associated with or involving aberrant angiogenesis.
- diseases include, but are not limited to, macular degeneration, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, infantile hemangioma, verruca vulgaris, psoriasis, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis and coronary artery disease.
- the methods of the present invention encompass combination therapy with a Listeri ⁇ -based EphA2 immunogenic composition and one or more additional therapies, for example an additional anti-cancer therapy.
- the additional anti-cancer therapy is an agonistic E ⁇ hA2 antibody, i.e., antibody that binds to EphA2 and induces signaling and phosphorylation of EphA2.
- the additional anti-cancer therapy is an anti-idiotype of an anti-EphA2 antibody.
- the additional anti-cancer therapy is chemotherapy, biological therapy, immunotherapy, radiation therapy, hormonal therapy, or surgery.
- the Listeria-based immunogenic compositions of the invention are administered in combination with a therapy that increases EphA2 internalization.
- the agent is an EphA2 agonist, for example an antibody, peptide (see, e.g., Koolpe et ah, 2002, J. Biol. Chem. 277(49):46974-46979) or small molecule.
- the agent is an inhibitor of a phosphatase that modulates EphA2, e.g., low molecular weight tyrosine phosphatase (LMW-PTP).
- LMW-PTP low molecular weight tyrosine phosphatase
- the immunogenic compositions of the invention can be administered to a subject, for example, by mucosal, intranasal, parenteral, intramuscular, intravenous, oral or intraperitoneal routes.
- the immunogenic compositions of the invention are administered locally to the site of a disease, by, e.g., implantation or intratumoral injection.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 u CFU, 5 x 10 u CFU or 10 12 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 s CFU, 5 x 10 s CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 11 CFU, 5 x 10 11 CFU or 10 12 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 s CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 1 ' CFU, 5 x l ⁇ " CFU or 10 12 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 11 CFU, 5 x 10 n CFU or 10 12 CFU.
- the dosage is an absolute amount.
- the dosage is converted to an appropriate dosage for a human based on the specified dosages used in a mouse model.
- the present invention provides nucleic acids useful for the production of the EphA2-expressing Listeria used in the manufacture of an Listeria-based EphA2 immunogenic composition.
- the present invention provides a nucleic acid comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3,1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the signal sequence of BaPA.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides a nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the signal sequence of BaPA.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- kits comprising the immunogenic compositions of the invention.
- the term "Listeria-based EphA2 immunogenic composition” refers to a Listeria bacterium that has been engineered to express an EphA2 antigenic peptide, or a composition comprising such a bacterium.
- the Listeria-based EphA2 immunogenic compositions of the invention when administered in an effective amount, elicit an immune response against EphA2 on hyperproliferative cells.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention when administered in an effective amount, elicit an immune response against EphA2 on endothelial cells.
- the immunogenic composition is a vaccine.
- the term “Listeria” refers to a bacterium of the genus
- Listeria including any species therein.
- the term also refers to any strain or type of Listeria, including naturally occurring and modified Listeria.
- Species of Listeria bacteria include, but are not limited to, Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri.
- the Listeria is Listeria monocytogenes.
- the Listeria may be attenuated.
- the Listeria is a modified Listeria monocytogenes and has deletions in one, two or more virulence genes.
- the Listeria is a modified strain of the Listeria monocytogenes strain DP-L4056 that has been modified by deleting the coding sequence of the virulence genes actA and inlB.
- the Listeria is electrocompetent.
- EphA2 antigenic peptide and “EphA2 antigenic polypeptide” refer to: (i) an EphA2 polypeptide, preferably SEQ ID NO:2, or a fragment, analog or derivative thereof comprising one or more B cell epitopes or T cell epitopes of EphA2; and/or (ii) a fusion protein comprising an EphA2 polypeptide, preferably SEQ ID NO:2, or a fragment, analog or derivative thereof comprising one or more B cell epitopes or T cell epitopes of EphA2.
- the EphA2 polypeptide may be from any species.
- an EphA2 polypeptide refers to the mature, processed form of EphA2. In other embodiments, an EphA2 polypeptide refers to an immature form of EphA2. In certain embodiments of the invention, an EphA2 antigenic peptide is fused to a signal peptide. In a specific embodiment, the nucleotide sequence encoding EphA2 and/or the signal peptide may be codon optimized. See, for example, U.S. Application Publication No. US 2005/0249748.
- the nucleotide and/or amino acid sequences of EphA2 polypeptides can be found in the literature or public databases, or the nucleotide and/or amino acid sequences can be determined using cloning and sequencing techniques known to one of skill in the art.
- the nucleotide sequence of human EphA2 can be found in the GenBank database (see, e.g., Accession Nos. BC037166, M59371 and M36395).
- the amino acid sequence of human EphA2 can be found in the GenBank database (see, e.g. , Accession Nos. NP_004422, AAH37166 and AAA53375). Additional non-limiting examples of amino acid sequences of EphA2 are listed in Table 1, infra.
- the EphA2 antigenic peptides are not one or more of the following peptides: TLADFDPRV (SEQ ID NO:3); VLLLVLAGV (SEQ DD NO:4); VLAGVGFFI (SEQ ID NO:5); IMNDMPIYM (SEQ ID NO:6); SLLGLKDQV (SEQ ID NO:7); WLVPIGQCL (SEQ ID NO:8); LLWGCALAA (SEQ ID NO:9); GLTRTSVTV (SEQ ED NO: 10); NLYYAESDL (SEQ ID NO: 11); KLNVEERSV (SEQ BD NO: 12); IMGQFSHHN (SEQ ID NO: 13); YSVCNVMSG (SEQ ID NO: 14); MQNIMNDMP (SEQ DD NO: 15); EAGIMGQFSHHNIIR (SEQ LD NO: 16); PIYMYSVCNVMSG (SEQ ED NO: 17); DLMQ
- the EphA2 antigenic peptide is not any of SEQ ID NOS :3- 12, is not any of SEQ ID NOS:13-15, and/or is not any of SEQ ED NOS.16-18. In yet another specific embodiment, the EphA2 antigenic peptide is not any of SEQ ID NOS:3- 18.
- analog in the context of a proteinaceous agent
- a proteinaceous agent refers to a proteinaceous agent that possesses a similar or identical function as a second proteinaceous agent (e.g., an EphA2 polypeptide) but does not necessarily comprise a similar or identical amino acid sequence or structure of the second proteinaceous agent.
- a proteinaceous agent that has a similar amino acid sequence refers to a proteinaceous agent that satisfies at least one of the following: (a) a proteinaceous agent having an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least
- a proteinaceous agent with similar structure to a second proteinaceous agent refers to a proteinaceous agent that has a similar secondary, tertiary or quaternary structure of the second proteinaceous agent.
- the structure of a proteinaceous agent can be determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy.
- the proteinaceous agent has EphA2 activity.
- the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence).
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the determination of percent identity between two sequences can also be accomplished using a mathematical algorithm.
- a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. ScL U.S.A. 87: 2264-2268, modified as in Karlin and Altschul, 1993 , Proc. Natl. Acad. ScL U.S.A. 90: 5873-5877.
- Gapped BLAST can be utilized as described in Altschul et al, 1997, Nucleic Acids Res. 25: 3389-3402.
- PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.).
- the default parameters of the respective programs e.g., of XBLAST and NBLAST
- Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4: 11-17.
- ALIGN program version 2.0
- a PAM120 weight residue table a gap length penalty of 12, and a gap penalty of 4
- Additional algorithms for sequence analysis are known in the art and include ADVANCE and ADAM as described in Torellis and Robotti, 1994, Comput. Appl. Biosci. 10:3-5; and FASTA described in Pearson and Lipman,1988, Proc Natl Acad Sci USA 85:2444-8.
- ktup is a control option that sets the sensitivity and speed of the search.
- ktup 2 or 1 for protein sequences, or from 1 to 6 for DNA sequences. The default if ktup is not specified is 2 for proteins and 6 for DNA.
- FASTA parameters see, e.g., the parameters provided by the Institut Pasteur Biological software website (e.g., http://bioweb.pasteur.fr/docs/man/man/fasta.1.html#sect2).
- analog in the context of a non-proteinaceous analog refers to a second organic or inorganic molecule which possesses a similar or identical function as a first organic or inorganic molecule and is structurally similar to the first organic or inorganic molecule.
- the terms "attenuated” and “attenuation” refer to a modif ⁇ cation(s) so that the Listeria are less pathogenic.
- the end result of attenuation is that the risk of toxicity as well as other side effects is decreased when the Listeria are administered to a subject.
- Attenuation of the Listeria can be measured in terms of biological effects of the Listeria on a host.
- the pathogenicity of a Listeria strain can be assessed by measurement of the LD 50 in mice or other vertebrates.
- the LD 50 is the amount, or dosage, of Listeria injected into vertebrates necessary to cause death in 50% of the vertebrates.
- the LD 50 values can be compared for Listeria having a particular modification (e.g., a mutation) versus Listeria without the particular modification as a measure of the level of attenuation. For example, if the Listeria strain without a particular mutation has an LD50 of 10 3 bacteria and the Listeria strain having the particular mutation has an LD50 of 10 5 bacteria, the strain has been attenuated so that is LD 5 0 is increased 100- fold or by 2 log. Other methods for measuring attenuation are described in U.S.
- a proteinaceous agent e.g. , proteins, polypeptides, peptides, and antibodies
- derivatives refers to a proteinaceous agent that comprises an amino acid sequence which has been altered by the introduction of amino acid residue substitutions, deletions, and/or additions.
- derivative also refers to a proteinaceous agent which has been modified, i.e., by the covalent attachment of a type of molecule to the proteinaceous agent.
- a derivative of a proteinaceous agent may be produced, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or o ⁇ ier protein, etc.
- a derivative of a proteinaceous agent may also be produced by chemical modifications using techniques known to those of skill in the art, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of a proteinaceous agent may contain one or more non-classical amino acids. A derivative of a proteinaceous agent possesses an identical function(s) as the proteinaceous agent from which it was derived.
- the term "derivative" in the context of EphA2 proteinaceous agents refers to a proteinaceous agent that comprises an amino acid sequence of an EphA2 polypeptide or a fragment of an EphA2 polypeptide that has been altered by the introduction of amino acid residue substitutions, deletions or additions (Le., mutations) in a wild-type EphA2 sequence.
- the term “derivative” as used herein in the context of EphA2 proteinaceous agents also refers to an EphA2 polypeptide or a fragment of an EphA2 polypeptide which has been modified, Le, by the covalent attachment of any type of molecule to the polypeptide.
- an EphA2 polypeptide or a fragment of an EphA2 polypeptide may be modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc.
- a derivative of an EphA2 polypeptide or a fragment of an EphA2 polypeptide may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc.
- a derivative of an EphA2 polypeptide or a fragment of an EphA2 polypeptide may contain one or more non-classical amino acids.
- a polypeptide derivative possesses a similar or identical function as an EphA2 polypeptide or a fragment of an EphA2 polypeptide described herein.
- a derivative of EphA2 polypeptide or a fragment of an EphA2 polypeptide has an altered activity when compared to an unaltered polypeptide.
- a derivative of an EphA2 polypeptide or fragment thereof can differ in phosphorylation relative to an EphA2 polypeptide or fragment thereof as assessed by, e.g., an immunoassay such as an immunoprecipitation / Western blot assay.
- an immunoassay such as an immunoprecipitation / Western blot assay.
- a derivative of an organic molecule includes, but is not limited to, a molecule modified, e.g., by the addition or deletion of a hydroxyl, methyl, ethyl, carboxyl, nitryl, or amine group.
- An organic molecule may also, for example, be esterif ⁇ ed, alkylated and/or phosphorylated.
- EphrinAl polypeptide refers to: (i) EphrinAl, an analog, derivative or a fragment thereof; and/or (ii) a fusion protein comprising EphrinAl, an analog, derivative or a fragment thereof.
- the EphrinAl polypeptide may be from any species.
- EphrinAl polypeptide refers to the mature, processed form of EphrinAl. In other embodiments, the term “EphrinAl polypeptide” refers to an immature form of EphrinAl.
- the nucleotide and/or amino acid sequences of EphrinAl polypeptides can be found in the literature or public databases, or the nucleotide and/or amino acid sequences can be determined using cloning and sequencing techniques known to one of skill in the art.
- the nucleotide sequence of human EphrinAl can be found in the GenBank database (see, e.g., Accession No. BC032698).
- the amino acid sequence of human EphrinAl can be found in the GenBank database (see, e.g., Accession No. AAH32698). Additional non-limiting examples of amino acid sequences of EphrinAl are listed in Table 2, infra.
- a EphrinAl polypeptide is EphrinAl from any species.
- an EphrinAl polypeptide is human EphrinAl.
- the term "effective amount” refers to the amount of a therapy ⁇ e.g., a prophylactic or therapeutic agent) which is sufficient to reduce and/or ameliorate the severity and/or duration of a disorder (e.g., cancer, a non-neoplastic hyperproliferative cell disorder or a disorder associated with aberrant angiogenesis) or a symptom thereof, prevent the advancement of said disorder, cause regression of said disorder, prevent the recurrence, development, or onset of one or more symptoms associated with said disorder, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy ⁇ e.g. , prophylactic or therapeutic agent).
- a therapy e.g., a prophylactic or therapeutic agent
- B cell epitope refers to a fragment of an EphA2 polypeptide having antigenic or immunogenic activity in an animal, preferably in a mammal, and most preferably in a mouse or a human.
- An epitope having immunogenic activity is a fragment of an EphA2 polypeptide that elicits an antibody response in an animal.
- An epitope having antigenic activity is a fragment of an EphA2 polypeptide to which an antibody immunospecifically binds as determined by any method well known in the art, for example, by immunoassays.
- Antigenic epitopes need not necessarily be immunogenic.
- T cell epitope refers to at least a fragment of an
- EphA2 polypeptide preferably an EphA2 polypeptide of SEQ ED NO:2, that is recognized by a T cell receptor.
- T cell epitope encompasses helper T cell (Th) epitopes and cytotoxic T cell (Tc) epitopes.
- helper T cell epitopes encompasses ThI and Th2 epitopes.
- fragment refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least contiguous 80 amino acid residues, at least contiguous 90 amino acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of peptide or polypeptide.
- a fragment of a peptide or polypeptide is 5-150 contiguous amino acid residues, 5-125 contiguous amino acid residues, 5-100 contiguous amino acid residues, 5-75 contiguous amino acid residues, 5- 50 contiguous amino acid residues, 5-25 contiguous amino acid residues, 10-150 contiguous amino acid residues, 10-125 contiguous amino acid residues, 10-100 contiguous amino acid residues, 10-75 contiguous amino acid residues, 10-50 contiguous amino acid residues, 10-25 contiguous amino acid residues, 8-25 contiguous amino acid residues, 9-25 contiguous amino acid residues, 11-25 contiguous amino acid residues, 12- 25 contiguous amino acid residues, 13-25 contiguous amino acid residues, 50-200 contiguous amino acid residues, 50-150 contiguous amino acid residues, 25-100 contiguous amino acid residues, 25-150 contiguous amino acid residues, 100-200 contiguous amino acid residues, 100-150 contiguous amino acid residues, 100-150 con
- fragment in the context of EphA2 polypeptides include an EphA2 antigenic peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 6 contiguous amino acid residues, at least 7 contiguous amino acid residues, at least 8 contiguous amino acid residues, at least 9 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 11 contiguous amino acid residues, at least 12 contiguous amino acid residues, at least 13 contiguous amino acid residues, at least 14 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 45 contiguous amino acid residues, at least 50 con
- fusion protein refers to a polypeptide or protein that comprises the amino acid sequence of a first polypeptide or protein or fragment, analog or derivative thereof, and the amino acid sequence of a heterologous polypeptide or protein.
- a fusion protein comprises a prophylactic or therapeutic agent fused to a heterologous protein, polypeptide or peptide.
- the heterologous protein, polypeptide or peptide may or may not be a different type of prophylactic or therapeutic agent.
- two different proteins, polypeptides, or peptides with immunomodulatory activity may be fused together to form a fusion protein.
- fusion proteins retain or have improved activity relative to the activity of the original polypeptide or protein prior to being fused to a heterologous protein, polypeptide, or peptide.
- heterologous in the context of a nucleic acid sequence ⁇ e.g., a gene) or an amino acid sequence (e.g., a peptide, polypeptide or protein) refers a nucleic acid sequence or an amino acid sequence that is not found in nature to be associated with a second nucleic acid sequence or a second amino acid sequence (e.g., a nucleic acid sequence or an amino acid sequence derived from a different species).
- the terms "hyperproliferative cell disorder" refers a nucleic acid sequence or an amino acid sequence that is not found in nature to be associated with a second nucleic acid sequence or a second amino acid sequence (e.g., a nucleic acid sequence or an amino acid sequence derived from a different species).
- hyperproliferative cell disease refers to a disorder in which cellular hyperproliferation or any form of excessive cell accumulation causes or contributes to the pathological state or symptoms of the disorder.
- the hyperproliferative cell disorder is characterized by hyperproliferating epithelial cells.
- the hyperproliferative cell disorder is characterized by hyperproliferating endothelial cells.
- the hyperproliferative cell disorder is characterized by hyperproliferating fibroblasts.
- the hyperproliferative cell disorder is not neoplastic.
- non-neoplastic hyperproliferative cell disorders are asthma, chronic pulmonary obstructive disease, fibrosis (e.g., lung, liver, and kidney fibrosis), bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
- the hyperproliferative cell disorder is characterized by hyperproliferating cells that express (preferably, overexpress) EphA2.
- the term “immunospecifically binds to EphA2" and analogous terms refer to agents (e.g., peptides, polypeptides, proteins, fusion proteins, and antibodies or fragments thereof) that specifically bind to EphA2 or one or more fragments thereof and do not specifically bind to or has lower binding affinity for other receptors or fragments thereof.
- EphrinAl immunospecifically binds to EphrinAl
- analogous terms e.g., “react specifically with EphrinAl” or “binds specifically to EphrinAl”
- agents e.g., peptides, polypeptides, proteins, fusion proteins, and antibodies or fragments thereof
- EphrinAl or one or more fragments thereof do not specifically bind to or has lower binding affinity for other ligands or fragments thereof.
- An agent e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof
- an agent may bind to other peptides, polypeptides, or proteins with lower affinity as determined by, e.g., immunoassays or other assays known in the art to detect binding affinity.
- An agent e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof
- that immunospecifically bind to EphA2 or EphrinAl may be cross-reactive with related antigens.
- antibodies or fragments thereof that immunospecifically bind to EphA2 or EphrinAl can be identified, for example, by immunoassays or other techniques known to those of skill in the art.
- An agent e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof
- RIAs radioimmunoassays
- ELISAs enzyme-linked immunosorbent assays
- an antibody that immunospecifically binds to EphA2 or EphrinAl does not bind or cross- react with other antigens.
- an antibody that binds to EphA2 or EphrinAl that is a fusion protein specifically binds to the portion of the fusion protein that is EphA2 or EphrinAl, or a fragment thereof.
- antibody refers to molecules that contain an antigen binding site, e.g., immunoglobulins.
- Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGi, IgG 2 , IgG 3 , IgG 4 , IgAi and IgA2) or subclass.
- Antibodies of the invention include, but are not limited to, synthetic antibodies, monoclonal antibodies, recombinantly produced antibodies, multispecific antibodies (including bi-specific antibodies), human antibodies, humanized antibodies, chimeric antibodies, intrabodies, single-chain Fvs (scFv) (e.g., including monospecific and bi-specific, etc.), Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. .
- scFv single-chain Fvs
- sdFv single-chain Fvs
- sdFv disulfide-linked Fvs
- anti-Id anti-idiotypic antibodies
- the term "isolated" in the context of an organic or inorganic molecule refers to an organic or inorganic molecule substantially free of a different organic or inorganic molecule (also referred to as "contaminating organic or inorganic molecule").
- an organic or inorganic molecule is 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% free of a second, different organic or inorganic molecule.
- an organic and/or inorganic molecule is isolated.
- the amount of a contaminating organic or inorganic molecule can be determined by methods known to one of skill in the art, e.g. , high performance liquid chromatography (HPLC), differential scanning calorimetry, etc.
- a proteinaceous agent which is substantially free of cellular material or contaminating proteins from the cell or tissue source from which it is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- substantially free of cellular material includes preparations of a proteinaceous agent in which the proteinaceous agent is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- a proteinaceous agent that is substantially free of cellular material includes preparations of a proteinaceous agent having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein, polypeptide, peptide, or antibody (also referred to as a "contaminating protein").
- the proteinaceous agent is recombinantly produced, it is also preferably substantially free of culture medium, Le. , culture medium represents less than about 20%, 10%, or 5% of the volume of the proteinaceous agent preparation.
- the proteinaceous agent is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, Le., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the proteinaceous agent.
- nucleic acid molecules refers to a nucleic acid molecule which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
- an "isolated" nucleic acid molecule such as a cDNA molecule, is preferably substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- nucleic acid molecules described herein are isolated.
- an "isolated" nucleic acid molecule is a nucleic acid molecule that is recombinantly expressed in a heterologous cell.
- an "isolated” nucleic acid molecule is a nucleic acid molecule that is substantially free of heterologous nucleic acid sequences.
- the term "in combination" in the context of the use of therapies refers to the use of more than one therapies (e.g., prophylactic and/or therapeutic agents).
- the use of the term “in combination” does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a hyperproliferative cell disorder, especially cancer.
- a first therapy e.g., prophylactic and/or therapeutic agent
- can be administered prior to e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before
- a second therapy e.g., prophylactic and/or therapeutic agent
- the therapies are administered to a subject in a sequence and within a time interval such that the agent of the invention can act together with the other agent to provide an increased benefit than if they were administered otherwise.
- Any additional therapy e.g., prophylactic and/or therapeutic agent
- can be administered in any order with the other additional therapy e.g., prophylactic and/or therapeutic agent.
- the phrase "low tolerance" in the context of the use of a therapy(ies) refers to a state in which the patient suffers from side effects from therapy so that the patient does not benefit from and/or will not continue therapy because the adverse effects and/or the harm from the side effects outweighs the benefit of the therapy.
- the terms “manage,” “managing” and “management” in the context of administering a therapy(ies) refer to the beneficial effects that a subject derives from administration of a therapy (e.g., prophylactic and/or therapeutic agent), which does not result in a cure of the disease.
- a subject is administered one or more therapies (e.g., prophylactic and/or therapeutic agents) to "manage” a disease so as to prevent the progression or worsening of the disease.
- Neoplastic refers to a disease involving cells that have the potential to metastasize to distal sites and exhibit phenotypic traits that differ from those of non-neoplastic cells, for example, formation of colonies in a three- dimensional substrate such as soft agar or the formation of tubular networks or weblike matrices in a three-dimensional basement membrane or extracellular matrix preparation, such as MATRIGELTM.
- Non-neoplastic cells do not form colonies in soft agar and form distinct sphere-like structures in three-dimensional basement membrane or extracellular matrix preparations.
- Neoplastic cells acquire a characteristic set of functional capabilities during their development, albeit through various mechanisms.
- non-neoplastic means that the condition, disease, or disorder does not involve cancer cells.
- non-responsive/refractory in the context of the use of a therapy(ies) is used to describe patients treated with one or more currently available therapies (e.g., cancer therapies) such as chemotherapy, radiation therapy, surgery, hormonal therapy and/or biological therapy/immunotherapy, particularly a standard therapeutic regimen for the particular cancer, wherein the therapy is not clinically adequate to treat the patients such that these patients need additional effective therapy, e.g., remain unsusceptible to therapy.
- therapies e.g., cancer therapies
- chemotherapy e.g., radiation therapy, surgery, hormonal therapy and/or biological therapy/immunotherapy, particularly a standard therapeutic regimen for the particular cancer, wherein the therapy is not clinically adequate to treat the patients such that these patients need additional effective therapy, e.g., remain unsusceptible to therapy.
- additional effective therapy e.g., remain unsusceptible to therapy.
- non-responsive/refractory means that at least some significant portion of the cancer cells are not killed or their cell division arrested.
- a cancer is “non-responsive/refractory” where the number of cancer cells has not been significantly reduced, or has increased during the treatment.
- the term "overexpress" in the context of EphA2 overexpression means that the gene encoding EphA2 is expressed at a level above that which is expressed by a normal human cell as assessed by an assay described herein or known to one of skill in the art (e.g. , an immunoassay such as an ELISA or Western blot, a Northern blot, or RT-PCR). Overexpression can also result from protein stabilization.
- EphA2 is overexpressed if there is a 10% to 15%, 15% to 25%, 25% to 50%, 25% to 75%, 25% to 100%, or 50% to 100% increase in EphA2 expression by a cell relative to a normal cell of the same type as measured by an immunoassay (e.g., an ELISA).
- E ⁇ hA2 is overexpressed if there is a 1.5 to 3 fold, 2 to 4 fold, 2 to 5 fold, or 2 to 10 fold increase in EphA2 expression by a cell relative to a normal cell of the same type as measured by an immunoassay (e.g., an ELISA).
- the term "potentiate” in the context of the use of a therapy(ies) refers to an improvement in the efficacy of a therapy at its common or approved dose.
- the terms “prevent,” “preventing” and “prevention” in the context of the administration of a therapy(ies) refer to the prevention of the onset, development, recurrence, or spread of a disease in a subject resulting from the administration of a therapy (e.g., prophylactic or therapeutic agent), or a combination of therapies.
- the term “prophylactic agent” refers to any agent that can be used in the prevention of the onset, development, recurrence or spread of a disorder (e.g., a disorder associated with EphA2 overexpression, a disorder associated with aberrant angiogenesis and/or a hyperproliferative cell disease, particularly cancer).
- a disorder e.g., a disorder associated with EphA2 overexpression, a disorder associated with aberrant angiogenesis and/or a hyperproliferative cell disease, particularly cancer.
- the term “prophylactic agent” refers to a Listeria-based EphA2 immunogenic composition of the invention.
- prophylactic agent refers to a therapy other than a Listeri ⁇ -hased EphA2 immunogenic composition, e.g., a cancer chemotherapeutic, radiation therapy, hormonal therapy, biological therapy (e.g., immunotherapy), hi other embodiments, more than one prophylactic agent may be administered in combination.
- a prophylacticaliy effective amount refers to that amount of a therapy (e.g., a prophylactic agent) sufficient to result in the prevention of the onset, development, recurrence or spread of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease, preferably, cancer).
- a therapy e.g., a prophylactic agent
- a disorder e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease, preferably, cancer.
- a prophylacticaliy effective amount may refer to the amount of therapy (e.g., a prophylactic agent) sufficient to prevent the onset, recurrence or spread of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease, particularly cancer) in a subject including, but not limited to, subjects predisposed to a hyperproliferative cell disease, for example, those genetically predisposed to cancer or previously exposed to carcinogens.
- a prophylacticaliy effective amount may also refer to the amount of a therapy (e.g., prophylactic agent) that provides a prophylactic benefit in the prevention of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease).
- a prophylacticaliy effective amount with respect to a therapy means that amount of a therapy (e.g., prophylactic agent) alone, or in combination with other therapies (e.g., agents), that provides a prophylactic benefit in the prevention of a disorder (e.g., a disorder associated with aberrant angiogenesis and/or a hyperproliferative cell disease).
- a therapy e.g., prophylactic agent
- other therapies e.g., agents
- the term can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of or synergizes with another therapy (e.g., a prophylactic agent).
- a prophylactic or therapeutic agent includes dosing schedules and dosing regimens.
- side effects encompasses unwanted and adverse effects of a prophylactic or therapeutic agent. Adverse effects are always unwanted, but unwanted effects are not necessarily adverse. An adverse effect from a therapy (e.g., a prophylactic or therapeutic agent) might be harmful or uncomfortable or risky.
- Side effects from chemotherapy include, but are not limited to, gastrointestinal toxicity such as, but not limited to, early and late-forming diarrhea and flatulence, nausea, vomiting, anorexia, leukopenia, anemia, neutropenia, asthenia, abdominal cramping, fever, pain, loss of body weight, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, xerostomia, and kidney failure, as well as constipation, nerve and muscle effects, temporary or permanent damage to kidneys and bladder, flu-like symptoms, fluid retention, and temporary or permanent infertility.
- Side effects from radiation therapy include but are not limited to fatigue, dry mouth, and loss of appetite.
- a subject is preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), most preferably a human.
- the subject is a non-human animal.
- the subject is a farm animal (e.g. , a horse, a pig, a lamb or a cow) or a pet (e.g., a dog, a cat, a rabbit or a bird).
- the subject is an animal other than a laboratory animal or animal model (e.g., a mouse, a rat, a guinea pig or a monkey).
- the subject is a human.
- the human subject is a newborn (one month or less in age), an infant (one year or less in age), a toddler (1-3 years old), a child (1-12 years old), a teenager (12-18 years old), an adult (18 years or older), or a senior citizen (65 years old or older).
- the human subject is not immunocompromised or immunosuppressed.
- the subject is a human with a mean absolute lymphocyte count of approximately 500 cells/mm 3 , approximately 600 cells/mm 3 , approximately 650 cells/mm 3 , approximately 700 cells/mm 3 , approximately 750 cells/mm 3 , approximately 800 cells/mm 3 , approximately 850 cells/mm 3 , approximately 900 cells/mm 3 , approximately 950 cells/mm 3 , approximately 1000 cells/mm 3 , approximately 1050 cells/mm 3 , approximately 1100 cells/mm 3 , or approximately 1150 cells/mm 3 or approximately 1200 cells/mm 3 .
- the terms “treat,” “treating” and “treatment” in the context of the administration of a therapy(ies) refer to the eradication, reduction or amelioration of a disorder or a symptom thereof, particularly, the eradication, removal, modification, or control of primary, regional, or metastatic cancer tissue that results from the administration of one or more therapies (e.g., therapeutic agents).
- the terms also refer to the reduction or amelioration in the progression, severity and/or duration of a disorder or a symptom thereof. In certain embodiments, such terms refer to the minimizing or delaying the spread of cancer resulting from the administration of one or more therapies ⁇ e.g., therapeutic agents) to a subject with such a disease.
- the term "therapeutic agent” refers to any agent that can be used in the treatment, and/or management of a disease (e.g., a disorder associated with overexpression of EphA2 and/or hyperproliferative cell disorder, particularly, cancer).
- a disease e.g., a disorder associated with overexpression of EphA2 and/or hyperproliferative cell disorder, particularly, cancer.
- the term “therapeutic agent” refers to a Listeria-based EphA2 immunogenic composition of the invention.
- the term “therapeutic agent” refers to a therapy other than a Listeria-based EphA2 immunogenic composition such as, e.g., a cancer chemotherapeutic, radiation therapy, hormonal therapy, and/or biological therapy/immunotherapy.
- more than one therapy e.g. , a therapeutic agent
- a "therapeutically effective amount” refers to that amount of a therapy (e.g., a therapeutic agent) sufficient to treat or manage a disorder (e.g., a disorder associated with EphA2 overexpression, a disorder associated with aberrant angiogenesis and/or hyperproliferative cell disease) and, preferably, the amount sufficient to destroy, modify, control or remove primary, regional or metastatic cancer tissue.
- a therapeutically effective amount may refer to the amount of a therapy (e.g., a therapeutic agent) sufficient to delay or minimize the onset of a disorder (e.g., hyperproliferative cell disease), e.g., delay or minimize the spread of cancer.
- a therapeutically effective amount may also refer to the amount of a therapy (e.g., a therapeutic agent) that provides a therapeutic benefit in the treatment or management of a disorder (e.g., cancer).
- a therapeutically effective amount with respect to a therapy means that amount of a therapy (e.g., therapeutic agent) alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of a disorder (e.g., a hyperproliferative cell disease such as cancer).
- the term can encompass an amount that improves overall therapy, reduces or avoids unwanted effects, or enhances the therapeutic efficacy of or synergies with another therapy (e.g. , a therapeutic agent).
- the term "therapy” refers to any protocol, method and/or agent that can be used in the prevention, treatment and/or management of a disorder (e.g. , a hyperproliferative cell disorder, a disorder associated with aberrant angiogenesis and/or a non-neoplastic hyperproliferative cell disorder) or. a symptom thereof.
- a disorder e.g. , a hyperproliferative cell disorder, a disorder associated with aberrant angiogenesis and/or a non-neoplastic hyperproliferative cell disorder
- the terms "therapies” and “therapy” refer to a biological therapy, supportive therapy, and/or other therapies useful in treatment, management, prevention, and/or amelioration of a disorder (e.g., a hyperproliferative cell disorder and/or a non-neoplastic hyperproliferative cell disorder) or one or more symptoms thereof known to one of skill in the art such as medical personnel (e.g., a medical doctor or a nurse).
- a disorder e.g., a hyperproliferative cell disorder and/or a non-neoplastic hyperproliferative cell disorder
- a disorder e.g., a hyperproliferative cell disorder and/or a non-neoplastic hyperproliferative cell disorder
- a disorder e.g., a hyperproliferative cell disorder and/or a non-neoplastic hyperproliferative cell disorder
- symptoms thereof known to one of skill in the art such as medical personnel (e.g., a medical doctor or a nurse).
- the term "synergistic" in the context of the use of a therapy(ies) refers to a combination of therapies (e.g., prophylactic or therapeutic agents) which is more effective than the additive effects of any two or more single therapies (e.g., one or more prophylactic or therapeutic agents).
- a synergistic effect of a combination of therapies permits the use of lower dosages of one or more of therapies (e.g. , one or more prophylactic or therapeutic agents) and/or less frequent administration of said therapies to a subject with a disorder (e.g., a hyperproliferative epithelial and/or endothelial cell disorder).
- therapies e.g., prophylactic or therapeutic agents
- a synergistic effect can result in improved efficacy of therapies (e.g., prophylactic or therapeutic agents) in the prevention or treatment of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disorder).
- T cell malignancies and “T cell malignancy” refer to any T cell lymphoproliferative disorder, including thymic and post-thymic malignancies.
- T cell malignancies include tumors of T cell origin.
- T cell malignancies refer to tumors of lymphoid progenitor cell, thymocyte, T cell, NK-cell, or antigen presenting cell origin.
- T cell malignancies include, but are not limited to, leukemias, including acute lymphoblastic leukemias, thymomas, acute lymphoblastic leukemias, and lymphomas, including Hodgkin's and non-Hodgkin's disease, with the proviso that T cell malignancies are not cutaneous T cell malignancies, in particular cutaneous-cell lymphomas.
- T cell malignancies are systemic, non-cutaneous T cell malignancies.
- SEQ ID NO:28 Codon Optimized LLOss-PEST-FLAG-EX2JE ⁇ hA2-myc-CodonO ⁇ (Codon Optimized L. monocytogenes LLO signal peptide + PEST-Codon optimized -FLAG-EX-2 EphA2-Myc) Nucleotide Sequence (including hly promoter) [00135] SEQ ID NO.-29
- PhoD-FLAG-EX2_EphA2-myc-CodonOp (Codon optimized B. subtil ⁇ s phoD Tat signal peptide-FLAG-EX-2 EphA2-
- PhoD-FLAG-EX2_EphA2-myc-CodonOp (Codon optimized B. subtilis phoD Tat signal peptide-FLAG-EX-2 EphA2-
- BaPa signal peptide + human EphA2 intracellular domain (ICD) intracellular domain of EphA2 is fused to the BaPA signal peptide downstream of My promoter and inserted into the inlB locus Nucleotide sequence [00153] SEQ ID NO:93
- Figure 1 Listeria intracellular life cycle, antigen presenting cell activation, and antigen presentation.
- Figure 2. Western blot analysis of secreted protein from recombinant
- Figure 6 Western blot analysis of pooled populations CT26 murine colon carcinoma cells expressing high levels of human EphA2 protein.
- Figure 7. Flow Cytometry of B 16F10 cells expressing huEphA2.
- Figure 8 Western blot analysis of lysate from 293 cells 48 hr. following transfection with pCDNA4 plasmid DNA encoding full-length native EphA2 sequence.
- Figures 9A-9B In the CT26 tumor model, therapeutic immunization with positive control Listeria expressing AH1-A5.
- Figures 10A-10B Preventative immunization with Listeria expressing
- ECD of hEphA2 suppresses CT26-hEphA2 tumor growth (Figure 10A) and increases survival (Figure 10B).
- L4029EphA2-exFlag Listeria control (DP-L4029), or Listeria positive control containing the AHl protein (DP-L4029-AH1) (5xlO 5 cells in 100 ⁇ l volume) either subcutaneously or intravenously.
- Figure HA demonstrates tumor volume of mice inoculated with CT26 cells expressing the ECD of huEphA2, vehicle (HBSS), Listeria (DP-L4029) or Listeria positive (DP-L4029-AH1) controls.
- Figure HB demonstrates mean tumor volume of mice inoculated with CT26 cells expressing the ECD of huEphA2 (DP-L4029-EphA2 exFlag) compared to the Listeria (DP-L4029) control.
- Figure HC illustrates results of the prevention study in the s.c. model, measuring percent survival of the mice post CT26 tumor cell inoculation.
- Figure HD illustrates the results of the prevention study in the lung metastases model, measuring percent survival of the mice post tumor cell inoculation.
- Figure 12. Preventative immunization with Listeria expressing ECD of hEphA2 increases survival following RenCa-hEphA2 tumor challenge.
- Figures 13A-13C illustrate results of a typical therapeutic study of animals inoculated with CT26 murine colon carcinoma cells transfected with human EphA2 (DP-L4029-EphA2 exFlag), Listeria control (DP-L4029- control) or vehicle (HBSS).
- tumor volume was measured at several intervals post inoculation.
- Figure 13B illustrates the mean tumor volume of mice inoculated with CT26 cells containing either Listeria control or the ECD of huEphA2.
- Figure 13C represents the results of a therapeutic study using the lung metastases model- measuring percent survival of mice post inoculation with CT26 cells with either HBSS or Listeria control, or Listeria expressing the ECD of huEphA2.
- Figures 14A-F Figure 14A. Therapeutic immunization in Balb/C mice with Listeria expressing ICD of hEphA2 suppresses established CT26-hEphA2 tumor growth.
- Figure 14B Immunization of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors with recombinant Listeria encoding EphA2 CO domain confers long-term survival.
- Figure 14C Long-term survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors immunized with recombinant Listeria encoding OVA.AH1 or OVA.AH1-A5.
- Figure 14D Figure 14D.
- Figures 18A-B Therapeutic vaccination with Listeria expressing human
- FIG. 18A depicts images of tumor sections stained with biotinylated rat anti-mouse CD45/B200.
- Figure 18B is a bar graph normalizing the image data to tumor volume.
- Figures 19 A-C General EphA2 Expression Strategy.
- Figure 19A represents a monocistronic, single locus approach, where a construct contains a fusion of huEphA2 ECD and ICD nucleic acid sequences which is expressed from a single promoter.
- Figure 19B represents a monocistronic, two loci approach, where two separate constructs containing huEphA2 ECD or ICD, respectively, are expressed from two promoters.
- Figure 19C represents a bicistronic, single locus approach, where a construct contains huEphA2 ECD and ICD nucleic acid sequences on separate cistrons, but is expressed from a single promoter.
- Figures 20A-E Nucleotide sequences of representative dual monocistronic expression cassettes.
- Figure 2OA Extracellular domain of EphA2 is fused to first lOOaa of actA and inserted into actA locus. Flanking sequence necessary for homologous recombination into the actA locus is shown in plain text. Sequence coding for the first 100 amino acids of actA is in bold text. The EphA2 extracellular domain is cloned into engineered BamHI and Sad sites (underlined) and indicated in italics text.
- Figure 2OB Intracellular domain of EphA2 is fused to the BaPA signal peptide downstream of hly promoter and inserted into the inlB locus.
- Flanking sequence necessary for homologous recombination into the inlB locus is shown in plain text.
- the hly promoter and BdPA signal peptide is downstream of an engineered Kpnl site (underlined) and the BaPA signal peptide is Indicated by bold text.
- the EphA2 intracellular domain is shown in italics text and is cloned into engineered BamHI and Sad sites (underlined).
- Figure 2OC Intracellular domain of EphA2 is fused to first lOOaa of actA and inserted into actA locus.
- the EphA2 Extracellular domain is cloned into engineered BamHI and Sad sites.
- Figure 2OD Extracellular domain of EphA2 is fused to BaPa signal peptide downstream of hly promoter and inserted into inlB locus. The ephA2 extracellular domain is cloned into engineered BamHI and Sad sites.
- Figure 2OE Intracellular domain of EphA2 is fused to BaPa signal peptide and inserted into actA locus. The EphA2 extracellular domain is cloned into engineered BamHI and Sad sites.
- Figure 21 Western Blot Analysis of Secreted EphA2 from Listeria
- Monocistronic Listeria strains Western blot analysis of secreted protein from recombinant Listeria encoding either EphA2 ICD or ECD fused to ActA(Nl-lOO) from a monocistronic, two loci approach.
- Figures 24A-24B Preventative Model: Comparison of Monocistronic Dual Loci Strains. Preventative immunization with Listeria expressing hEphA2 ECD and ICD from separate loci suppresses CT26-hEphA2 tumor growth ( Figure 24A). Tumor volume measurements were taken from individual mice on day 21 ( Figure 24B).
- FIG. 35 A schematic diagram depicting the process of selecting recombinant Lm strains that have undergone homologous recombination for integration of the EphA2 expression cassette.
- An allelic exchange vector containing the EphA2 expression cassette is electroporated into an Lm strain.
- the permissive temperature of 30 0 C the vector is maintained episomally in the presence of chloramphenicol (Cm).
- Cm chloramphenicol
- 41°C non-permissive temperature
- homologous recombination directed by the flanking sequences of the target locus takes place in the presence of Cm.
- the remaining vector sequences are removed by a second homologous recombination event during several passages in the absence of Cm.
- Figure 36 A schematic diagram depicting the cloning process of the pKSVactAN100ExEphA2 allelic exchange vector.
- Figure 37 A schematic diagram depicting the cloning process of the pKSVmlB-BaPAEphA2Co allelic exchange vector.
- Figures 38A-B A schematic diagram depicting the cloning process of the pKSVactAN100-MurineEphA2ExFLAG and pKSV-inlBMurineE ⁇ hA2CO allelic exchange vectors.
- Figure 39 Secretion of human EphA2 ICD from Dual Monocistronic
- Figures 41 A-C shows the nucleotide and amino acid sequences of the entire murine EphA2 ECD expression cassette comprising of the actA promoter (partial) and 5' UTR (plain text), ActA-NlOO (bold text), ECD (underlined text), and FLAG epitope (italicized text).
- Figures 42A-B shows the nucleotide and amino acid sequences of the entire murine EphA2 ICD expression cassette comprising of the hly promoter (partial) and 5' UTR (plain text), BaPA signal peptide (bold text), and ICD (underlined text).
- Figures 43A-B and 44A-B show a schematic of the cassettes, and their nucleotide sequences which were introduced into a single Listeria strain (Le., CERS 382.20) by sequential chromosome integration into the respective loci to give rise to ActA(N100)ExmonoComono ⁇ i.e., MEDI-543).
- Figures 43A shows the nucleotide sequences of the actA promoter (SEQ ID NO:85), 5'UTR (plain text) including the Shine- Dalgarno sequence (bold text), sequence coding for the first 100 amino acids of ActA (shaded text) (SEQ ID NO:110), and sequence coding for the EphA2 extracellular domain (underlined text).
- FIG 43B The corresponding encoded amino acid sequences are indicated in one letter amino acid code in Figure 43B.
- Listeria monocytogenes recognize the "GTG" three- letter codon for valine corresponding to the GUG translation initiation site of the ActA N- terminus and insert a methionine in the first position instead of valine.
- Figure 44 shows the nucleotide sequences of the hly promoter (SEQ ID NO: 111), Shine-Dalgarno sequence (underlined text), sequence coding for the BaPA signal peptide (bold text), and sequence coding for the human EphA2 intracellular domain (italicized text).
- Figure 45 shows the nucleotide sequences of the expression cassette comprising the hly promoter (SEQ ED NO: 111) including the 5'UTR and Shine-Dalgarno sequence, BaPA signal peptide, and human EphA2 ECD domain. The corresponding amino acid sequence encoded by the expression cassette is shown.
- the present invention is based, in part, on the inventors' discovery that a
- Listeria-based immunogenic composition comprising Listeria engineered to express two EphA2 antigenic peptides can confer beneficial therapeutic and prophylactic benefits against hyperproliferative diseases involving EphA2-expressing cells.
- the present invention provides methods and compositions that provide for the prevention, treatment, inhibition, and management of disorders associated with overexpression of EphA2, disorders associated with aberrant angiogenesis and/or hyperproliferative cell disorders.
- a particular aspect of the invention relates to methods and compositions containing compounds that, when administered to a subject with a hyperproliferative cell disorder involving EphA2-expressing cells, either elicit or mediate an immune response against EphA2, resulting in a growth inhibition of the EphA2- expressing cells involved in the hyperproliferative cell disorder.
- the present invention further relates to methods and compositions for the treatment, inhibition, or management of metastases of cancers of epithelial cell origin, especially human cancers of the breast, ovarian, esophageal, lung, skin, prostate, bladder, and pancreas, and renal cell carcinomas and melanomas.
- the invention further relates to methods and compositions for the prevention, treatment, inhibition, or management of cancers of T cell origin, especially leukemias and lymphomas.
- the compositions and methods of the invention include other types of active ingredients in combination with the Listeria-based EphA2 immunogenic compositions of the invention.
- compositions of the invention are used to treat, prevent or manage other non-neoplastic hyperproliferative cell disorders, for example, but not limited to asthma, psoriasis, restenosis, COPD, etc.
- the present invention also relates to methods for the treatment, inhibition, and management of cancer and other hyperproliferative cell disorders that have become partially or completely refractory to current or standard therapy ⁇ e.g., a cancer therapy, such as chemotherapy, radiation therapy, hormonal therapy, and biological/immunotherapy).
- a cancer therapy such as chemotherapy, radiation therapy, hormonal therapy, and biological/immunotherapy.
- the present invention provides Listeria bacteria engineered to express one, two, three or more EphA2 antigenic peptides.
- any species, strain and/or type of Listeria can be engineered to express one, two, three or more EphA2 antigenic peptides.
- Non-limiting examples of species of Listeria bacteria include Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri.
- the Listeria is Listeria monocytogenes.
- Listeria preferably attenuated Listeria
- the Listeria locus is not required for growth and spread of the Listeria.
- the Listeria locus is required for growth and spread of the Listeria ⁇ e.g., the actA gene).
- the Listeria locus is a virulence gene.
- Non-limiting examples of such Listeria loci include actA, internalin (int) A, inlB, inlC, MD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl.
- Attenuated Listeria are engineered to express two EphA2 antigenic peptides from the actA or irilB locus.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Listeria may be engineered to express two EphA2 antigenic peptides from a single locus using a vector comprising a bicistronic expression cassette.
- the bicistronic expression cassette comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non- limiting examples of promoters); (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Listeria preferably attenuated Listeria
- Listeria are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are not required for growth and spread of the Listeria.
- Listeria, preferably attenuated Listeria are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are required for growth and spread of the Listeria.
- Listeria preferably attenuated Listeria
- Listeria loci are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more of the loci are not required for growth and spread and one or more of the loci are required for growth and spread of the Listeria.
- Listeria preferably attenuated Listeria
- Listeria loci include actA, internalin (int) A, inlB, inlC, inlD, inlD, inlE, inlF, inlG, inlH, My, plcA, pclB, and mpl.
- Listeria may be engineered to express multiple EphA2 antigenic peptides from multiple loci using multiple vectors.
- these vectors may comprise monocistronic, bicistronic and/or polycistronic expression cassettes.
- Listeria preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from two Listeria loci.
- the Listeria loci are not required for proliferation of the Listeria.
- the loci are virulence genes.
- attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the inlB locus.
- Attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the intlB locus, wherein the first EphA2 antigen peptide comprises the extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPa signal peptide.
- EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125,
- Listeria may be engineered to express two EphA2 antigenic peptides from a two locus using two vectors, each vector comprising a monocistronic expression cassette.
- each monocistronic construct comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters); (2) a Shine-Dalgamo sequence; and (3) a nucleotide sequence encoding an EphA2 antigenic peptide.
- the two monocistronic expression cassettes may or may not comprise the same EphA2 antigenic peptide, hi a specific embodiment, the expression cassettes comprise different EphA2 antigenic peptides.
- one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 or a fragment thereof.
- the EphA2 antigenic peptides are fusion proteins comprising a signal peptide. Non-limiting examples of signal peptides are provided in Section 5.2.3.3.1 below.
- one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S), and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 with, in certain embodiments, a lysine to methionine substitution at position 646 or a fragment thereof and a BaPa signal peptide.
- Listeria preferably attenuated Listeria
- the Listeria locus is required for growth and spread of the Listeria (e.g., the act A locus).
- the Listeria locus is a virulence gene.
- Non-limiting examples of such Listeria loci include actA, internalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl.
- Attenuated Listeria are engineered to express two EphA2 antigenic peptides from die actA and/or inlB locus.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- Listeria may be engineered to express three or more EphA2 antigenic peptides from a single locus using a vector comprising a polycistronic expression cassette.
- the polycistronic expression cassette comprises the following elements: (1) a single prokaryotic promoter regulating the expression of all of the EphA2 antigenic peptides; (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide); (7) a Shine-Dalgarno sequence; and (8) a third nucleotide sequence encoding a third EphA2 antigenic peptide (which may or may not be different from the first and/or second EphA2 antigenic peptides).
- the EphA2 antigenic peptides comprise EphA2 or a derivative, analog or fragment thereof, hi other embodiments, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the act A or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides), hi another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- ActA preferably ActA of Listeria monocytogenes L0403S.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a first nucleotide sequence encoding a first EphA2 antigenic peptide and a second nucleotide sequence encoding a second EphA2 antigenic peptide.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides)
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide.
- each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide.
- one or more of the nucleic acids is integrated into the Listeria chromosomal DNA.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the nucleic acids are integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. Li a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- ActA preferably ActA of Listeria monocytogenes L0403S.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 has been substituted for lysine.
- the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intra
- the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- ActA preferably ActA of Listeria monocytogenes L0403S.
- Non-limiting examples of signal peptides are provide below in Section 5.2.3.3.1.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide is a fusion protein comprising the first 100 amino acid residues of ActA (preferably ActA of Listeria monocytogenes L0403S) and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine.
- ActA preferably ActA of Listeria monocytogenes L0403S
- EphA2 preferably, human EphA2
- the second nucleic acid comprises a second
- the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the act A locus and the second nucleic acid is integrated into the inlB locus.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the octA or MB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide.
- the expression cassette can be part of a vector, such as described below.
- the nucleic acid is integrated into the Listeria chromosomal DNA.
- the nucleic acid is integrated into the actA or inlB locus.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide.
- one or more of the nucleic acids is integrated into the Listeria chromosomal DNA.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, and die second nucleic acid comprises a second EphA2 antigenic peptide cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide).
- the nucleic acids are integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second is integrated into die inlB locus.
- the EphA2 antigenic peptide comprises E ⁇ hA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence.
- Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic
- EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof
- the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine.
- the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S).
- ActA preferably ActA of Listeria monocytogenes L0403S.
- Non-limiting examples of signal peptides are provided below in Section 5.2.3.3.1.
- the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide expression cassette comprising a promoter and a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of ActA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment ti ⁇ ereof, and the second nucleic acid comprises a second EphA2 antigenic peptide expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine.
- the first nucleic acid comprises a first nucle
- the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA.
- the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the inlB locus.
- the bacteria are preferably attenuated in their virulence for causing disease.
- the end result is to reduce the risk of toxic shock or other side effects due to administration of the Listeria to the patient.
- Such attenuated Listeria can occur naturally or be produced recombinantly or by exposure to mutagens (e.g., mutagenic chemicals and radiation).
- the Listeria are attenuated by subjecting the bacteria to psoralen treatment.
- the attenuated Listeria can be isolated by a number of techniques.
- the Listeria can be attenuated by the deletion or disruption of DNA sequences which encode for virulence factors which insure survival of the Listeria in the host cell, especially macrophages and neutrophils, by, for example, homologous recombination techniques and chemical or transposon mutagenesis.
- virulence genes include, but are not limited to, My,plcA,plcB, mpl, actA, inlA, and MB. See also Autret et al., 2001, Infection and Immunity 69:2054-2065. [00227] In one embodiment, the attenuated Listeria are deficient in DNA repair
- Attenuated Listeria and methods for producing such attenuated strains are described in greater detail in U.S. Patent Application Publication Nos. 2004/0013690, 2004/0228877, 2004/0197343 and International Publication Nos. WO 2004/110481 and WO 2005/071088, each of which are herein incorporated by reference in its entirety.
- the capacity of the attenuated Listeria for cell-to-cell spread is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or at least about 90%, relative to Listeria without the attenuating mutation (e.g., the wild type bacterium). In some embodiments, the capacity of the attenuated Listeria for cell-to-cell spread is reduced by at least about 25% relative to Listeria without the attenuating mutation. In some embodiments, the capacity of the attenuated Listeria attenuated for cell-to-cell spread is reduced by at least about 50% relative to Listeria without the attenuating mutation.
- the concentration of Gentamicin in the media dramatically affects plaque size, and is a measure of the ability of a selected Listeria strain to effect cell-to-cell spread (Glomski, I J., M.M. Gedde, A.W. Tsang, J.A. Swanson, and D.A. Portnoy. 2002. /. Cell Biol 156:1029-1038).
- the plaque size of Listeria strains having a phenotype of defective cell- to-cell spread is reduced by at least 50% as compared to wild-type Listeria, when overlayed with media containing Gentamicin at a concentration of 50 ⁇ g/ml.
- the plaque size between Listeria strains having a phenotype of defective cell-to-cell spread and wild-type Listeria is similar, when infected monolayers are overlayed with media + agarose containing only 5 ⁇ g/ml gentamicin.
- the relative ability of a selected strain to effect cell-to-cell spread in an infected cell monolayer relative to wild- type Listeria can be determined by varying the concentration of gentamicin in the media containing agarose.
- visualization and measurement of plaque diameter can be facilitated by the addition of media containing Neutral Red (GIBCO BRL; 1:250 dilution in DME + agarose media) to the overlay at 48 h. post infection.
- the plaque assay can be performed in monolayers derived from other primary cells or continuous cells.
- HepG2 cells, a hepatocyte-derived cell line, or primary human hepatocytes can be used to evaluate the ability of selected Listeria mutants to effect cell- to-cell spread, as compared to wild-type Listeria.
- Listeria comprising mutations or other modifications that attenuate the Listeria for cell-to-cell spread produce "pinpoint" plaques at high concentrations of gentamicin (about 50 ⁇ g/ml).
- the Listeria is attenuated for entry into non- phagocytic cells (relative or a non-mutant or wildtype bacterium).
- the Listeria is defective with respect to one or more internalins (or equivalents).
- internalins include inlA, inlB, inlC, inlD, inlE, inlF, inlG and inlH.
- the Listeria is defective with respect to internalin A.
- the Listeria is defective with respect to internalin B.
- the Listeria comprises a mutation in inlA.
- the Listeria comprises a mutation in MB.
- the Listeria comprises a mutation in both actA and inlB.
- the Listeria is deleted in functional ActA and internalinB.
- the Listeria is an AactAAinlB double deletion mutant.
- the Listeria is defective with respect to both ActA and internalin B.
- such mutants may be generated by deleting the coding sequence of ActA and internalin B only, while retaining the flanking regions (including the transcriptional cis elements) intact and unmodified. Techniques known to those of skill in the art may be used to generate such mutants.
- the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or at least about 90%, relative to a bacterium without the attenuating mutation (e.g., the wild type bacterium). In some embodiments, the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 25% relative to Listeria without the attenuating mutation. In some embodiments, the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 50% relative to Listeria without the attenuating mutation.
- the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 75% relative to Listeria without the attenuating mutation.
- the attenuated Listeria strain are not attenuated for entry into more than one type of non-phagocytic cell.
- the attenuated strain may be attenuated for entry into hepatocytes, but not attenuated for entry into epithelial cells.
- the attenuated strain may be attenuated for entry into epithelial cells, but not hepatocytes.
- Attenuation for entry into a non- phagocytic cell of particular modified Listeria is a result of mutating a designated gene, for example a deletion mutation, encoding an invasin protein which interacts with a particular cellular receptor, and as a result facilitates infection of a nonphagocytic cell.
- Listeria AinlB mutant strains are attenuated for entry into non-phagocytic cells expressing the hepatocyte growth factor receptor (c-met), including hepatocyte cell lines (e.g., HepG2), and primary human hepatocytes.
- c-met hepatocyte growth factor receptor
- the Listeria are still capable of uptake by phagocytic cells, such as at least dendritic cells and/or macrophages.
- the ability of the attenuated Listeria to enter phagocytic cells is not diminished by the modification made to the strain, such as the mutation of an invasin (i.e., approximately 95% or more of the measured ability of the strain to be taken up by phagocytic cells is maintained post- modification).
- the ability of the attenuated Listeria to enter phagocytic cells is diminished by no more than about 10%, no more than about 25%, no more than about 50%, or no more than about 75%.
- the amount of attenuation in the ability of the Listeria to enter non-phagocytic cells ranges from a two-fold reduction to much greater levels of attenuation relative to a wild-type Listeria strain. In some embodiments, the attenuation in the ability of the Listeria to enter non-phagocytic cells is at least about 0.3 log, about 1 log, about 2 log, about 3 log, about 4 log, about 5 log, or at least about 6 log.
- the attenuation is in the range of about 0.3 to >8 log, about 2 to >8 log, about 4 to >8 log, about 6 to >8 log, about 0.3-8 log, also about 0.3- 7 log, also about 0.3-6 log, also about 0.3-5 log, also about 0.3-4 log, also about 0.3-3 log, also about 0.3-2 log, also about 0.3-1 log. In some embodiments, the attenuation is in the range of about 1 to >8 log, 1-7 log, 1-6 log, also about 2-6 log, also about 2-5 log, also about 3-5 log.
- the Listeria may be engineered such that it is attenuated in more than one manner, e.g. f a mutation affecting tissue tropism (e.g., inlB mutant) and a mutation affecting the ability to spread from cell to cell (e.g., actA mutant).
- the Listeria comprise a mutation (e.g., a deletion, addition or substitution) in internalin B and a mutation in actA.
- the Listeria is a mutant strain of Listeria monocytogenes that is actA ' (e.g., DP-L4029 (the DP-L3078 strain described in Skoble et al., J. of Cell Biology, 150:527-537 (2000), incorporated by reference herein in its entirety, which has been cured of its prophage as described in (Lauer et al., /. Bacteriol. 184:4177 (2002); U.S. Patent Publication No.
- actA ' e.g., DP-L4029 (the DP-L3078 strain described in Skoble et al., J. of Cell Biology, 150:527-537 (2000), incorporated by reference herein in its entirety, which has been cured of its prophage as described in (Lauer et al., /. Bacteriol. 184:4177 (2002); U.S. Patent Publication No.
- actA ' MB ' e.g., ⁇ P-L4029inlB, deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard., Manassas, Virginia 20110-2209, United States of America, on October 3, 2003, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and designated with accession number PTA-5562
- actA " uvrAB ' e.g., DP-L4029wvrAB, deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard., Manassas, Virginia 20110-
- the attenuated Listeria bacterium (e.g., a Listeria monocytogenes bacterium) is an ⁇ actA ⁇ inlB double deletion mutant.
- EphA2 antigenic peptides are preferably expressed in Listeria using a heterologous gene expression cassette (sometimes referred to herein as an "expression cassette” or an "EphA2 antigenic peptide expression cassette").
- An EphA2 antigenic peptide monocistronic gene expression cassette is typically comprised of the following ordered elements: (1) a promoter; (2) a Shine-Dalgarno sequence; and (3) an EphA2 antigenic peptide.
- the E ⁇ hA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising a signal peptide and EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125 or 1 to 150 of actA and EphA2 or a derivative, analog or fragment thereof.
- An EphA2 antigenic peptide bicistronic gene expression cassette is typically comprised of the following elements: (1) a promoter; (2) a Shine-Dalgarno sequence; (3) a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine- Dalgarno sequence; and (6) a second EphA antigic peptide.
- the expression cassette may also contain a transcription termination sequence, in constructs for stable integration within the bacterial chromosome. While not required, inclusion of a transcription termination sequence as the final ordered element in a heterologous gene expression cassette may prevent polar effects on the regulation of expression of adjacent genes, due to read-through transcription.
- the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising a signal peptide and EphA2 or a derivative, analog or fragment thereof.
- the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125 or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S) and EphA2 or a derivative, analog or fragment thereof.
- ActA preferably ActA of Listeria monocytogenes L0403S
- EphA2 or a derivative, analog or fragment thereof preferably ActA of Listeria monocytogenes L0403S
- Non-limiting examples of vectors are provided hereinbelow.
- the expression vectors introduced into the Listeria are preferably designed such that the Listeria-p ⁇ oduced EphA2 peptides and, optionally, a second tumor antigen, are secreted by the Listeria.
- Exemplary secretion signals that can be used with Listeria are ActA, BaPa, BsPhoD, p60, SecA, tat, and usp45, as described in Section 5.2.3.3.1, infra.
- the secretion signal is ActA or BaPa.
- one or more of the nucleotide sequences within the expression cassette and/or expression vector are codon-optimized (relative to the native coding sequence). It is desirable to utilize codons favored by Listeria for optimal translation efficiency of a selected heterologous protein.
- a polynucleotide in the recombinant nucleic acid molecules (and/or in the expression cassette and/or expression vector) described herein that encodes a signal peptide is codon- optimized for expression in Listeria.
- a polynucleotide encoding a polypeptide other than a signal peptide such as an antigen (e.g., EphA2 or a derivative, analog or fragment thereof) or other therapeutic protein, is codon-optimized for expression in Listeria.
- an antigen e.g., EphA2 or a derivative, analog or fragment thereof
- both a polynucleotide encoding a signal peptide and a polynucleotide encoding another polypeptide fused to the signal peptide are codon- optimized for expression in Listeria. See, e.g., U.S. Application Publication No. US 2005/0249748, which is incorporated by reference herein in its entirety, for techniques for codon optimization for expression in Listeria.
- a polynucleotide encoding a secreted protein (or fragment thereof) used as a scaffold or a polynucleotide encoding an autolysin (or fragment or variant thereof) is codon-optimized.
- a polynucleotide comprising a coding sequence is "codon-optimized " if at least one codon of the native coding sequence of the polynucleotide has been replaced with a codon that is more frequently used by the organism in which the coding sequence is to be expressed (the "target organism") than the original codon of the native coding sequence.
- the preferred codon usage for bacterial expression can be determined as described in Nakamura et aL, 2000, Nucl. Acids Res. 28:292.
- codon-optimized expression of EphA2 antigenic peptides, from Listeria monocytogenes is desired.
- the coding sequence is optimized for expression in Lm by modifying the coding sequence with BLUE HERON (Blue Heron Biotechnology, Bothell, WA) using a proprietary algorithm to match codon utilization in Lm and to reduce secondary structure in nascent transcripts that impede translational efficiency.
- plasmid construct backbones are available which are suitable for use in the assembly of an EphA2 antigenic expression cassette.
- a particular plasmid construct backbone is selected based on whether expression of the EphA2 antigenic expression cassette from the bacterial chromosome or from an extra-chromosomal episome is desired.
- incorporation of an EphA2 antigenic expression cassette into the bacterial chromosome of Listeria monocytogenes ⁇ Listeria is accomplished with an integration vector that contains an expression cassette for a listeriophage integrase that catalyzes sequence-specific integration of the vector into the Listeria chromosome.
- the integration vectors known as pPLl and pPL2 program stable single-copy integration of a heterologous protein (e.g., EphA2-antigenic peptide) expression cassette within an innocuous region of the bacterial genome, and have been described in the literature (Lauer etal., 2002, J. Bacteriol. 184:4177-4178; U.S. Patent Application Publication No. 20030203472).
- the integration vectors are stable as plasmids in E. coli and are introduced via conjugation into the desired Listeria background.
- Each vector lacks a Lwf ⁇ n ⁇ -specific origin of replication and encodes a phage integrase, such that the vectors are stable only upon integration into a chromosomal phage attachment site.
- the process of generating a recombinant Listeria strain expressing a desired protein(s) takes approximately one week.
- the pPLl and pPL2 integration vectors are based, respectively, on the U153 and PSA listeriophages.
- the pPLl vector integrates within the open reading frame of the comK gene, while pPL2 integrates within the tRNAArg gene in such a manner that the native sequence of the gene is restored upon successful integration, thus keeping its native expressed function intact.
- the pPLl and pPL2 integration vectors contain a multiple cloning site sequence in order to facilitate construction of plasmids containing the heterologous protein ⁇ e.g., EphA2-antigenic peptide) expression cassette.
- incorporation of the EphA2- antigenic peptide expression cassette into the Listeria chromosome can be accomplished through alleleic exchange methods, known to those skilled in the art.
- compositions in which it is desired to not incorporate a gene encoding an antibiotic resistance protein as part of the construct containing the heterologous gene expression cassette methods of allelic exchange are desirable.
- the pKSV7 vector (Camilli et al., 1993, MoL
- Microbiol. 8:143-157 contains a temperature-sensitive Listeria Gram-positive replication origin which is exploited to select for recombinant clones at the non-permissive temperature that represent the pKS V7 plasmid recombined into the Listeria chromosome.
- the pE194ts origin of replication and chloramphenicol (Cm) acetyltransferase gene (cat) of pKSV7 allow temperature-dependent selection of choramphenicol-resistant (Cm 1 ) Listeria.
- Cm chloramphenicol
- Cat chloramphenicol-resistant
- plasmid integrants When combined with homologous sequence sufficient to direct recombination with the Listeria chromosome, plasmid integrants can be selected in Cm at non-permissive temperatures for plasmid replication.
- the pKSV7 allelic exchange plasmid vector contains a multiple cloning site sequence in order to facilitate construction of plasmids containing the heterologous protein (e.g., EphA2-antigenic peptide) expression cassette.
- the heterologous EphA2-antigenic peptide expression cassette construct is optimally flanked by approximately 1 kb of chromosomal DNA sequence that corresponds to the precise location of desired integration.
- the pKSV7-expression cassette plasmid may be introduced into a desired bacterial strain by electroporation, according to standard methods for electroporation of Gram positive bacteria.
- an EphA2-antigenic peptide from a stable plasmid episome. Maintenance of the plasmid episome through passaging for multiple generations requires the co-expression of a protein that confers a selective advantage for the plasmid-containing bacterium.
- the protein co-expressed from the plasmid in combination with an EphA2-antigenic peptide may be an antibiotic resistance protein, for example chloramphenicol, or may be a bacterial protein (that is expressed from the chromosome in wild-type bacteria), that can also confer a selective advantage.
- Non-limiting examples of bacterial proteins include enzymes required for purine or amino acid biosynthesis (selection under defined media lacking relevant amino acids or other necessary precursor macromolecules), or a transcription factor required for the expression of genes that confer a selective advantage in vitro or in vivo (Gunn et al., 2001, J. Imrnuol. 167:6471-6479).
- pAM401 is a suitable plasmid for episomal expression of a selected heterologous protein (e.g., EphA2-antigenic peptide) in diverse Gram-positive bacterial genera (Wirth et al., 1986, J. Bacte ⁇ ol 165:831-836).
- the present invention generally employs expression cassettes to facilitate cloning into a suitable vector.
- An E ⁇ hA2 antigenic peptide monocistronic gene expression cassette is typically comprised of the following ordered elements: (1) a promoter; (2) a Shine-Dalgarno sequence; and (3) an EphA2 antigenic peptide.
- An EphA2 antigenic peptide bicistronic gene expression cassette is typically comprised of the following elements: (1) a promoter; (2) a Shine-Dalgarno sequence; (3) a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second EphA antigenic peptide.
- the expression cassette may also contain a transcription termination sequence, in constructs for stable integration within the bacterial chromosome. The components of the expression cassette are discussed in more detailed below.
- the promoters in the expression cassettes described herein are prokaryotic promoters.
- the prokaryotic promoters can be Listeria promoters.
- Preferred promoters include, but are not limited to, sequences derived from the hly gene which encodes LLO, the p60 (iap) gene, and the actA gene which encodes a surface protein necessary for actin assembly.
- Other promoter sequences of interest include the plcA gene which encodes PI-PLC, the mpl gene, which encodes a metalloprotease, and the inlA gene which encodes intemalin, a Listeria membrane protein.
- the heterologous regulatory elements such as promoters derived from phage and promoters derived from other bacterial species may also be employed.
- the Listeria promoter is an hly promoter.
- the promoters are prfA-dependent promoters (e.g., eta actA promoter).
- the promoters are constitutive promoters (e.g., ap60 promoter).
- the expression cassette comprising a recombinant nucleic acid molecule described herein comprises an hly, actA, o ⁇ p60 promoter operably linked to the polynucleotides of the recombinant nucleic acid molecule.
- the expression cassettes (or recombinant nucleic acid molecules described herein) comprise a promoter (e.g., an actA promoter) as well as untranslated sequences (5' and/or 3' untranslated sequences) that appear to enhance RNA expression and/or stability.
- the expression cassettes (or recombinant nucleic acid molecules described herein) comprise an act A promoter and 5' untranslated sequences of act A.
- the expression cassette of the invention comprises the native actA promoter and 5' untranslated region (UTR). PrfA-dependent transcription from the actA promoter results in synthesis of a 150 nucleotide 5' UTR RNA prior to the ActA protein GUG translation initiation site. Listeria monocytogenes mutants deleted of the actA promoter 5' UTR express low levels of ActA, resulting in a phenotype characterized by absence of intracellular actin recruitment, inability to spread from cell-to- cell, and attenuated, as compared to the wild-type parent bacterium (Wong et. al., Defective Cellular Microbiology 6:155-166).
- the expression cassette of the invention comprises the native actA promoter and the entire 5' UTR approximately 150 nucleotide long.
- the promoters driving the expression of the EphA2 antigenic peptides may be either constitutive, in which the peptides are continually expressed; inducible, in which the peptides are expressed only upon the presence of an inducer molecule(s); or cell-type specific embodiment, in which the peptides or enzymes are expressed only in certain cell types.
- Shine-Dalgarno Sequence At the 3' end of the promoter is a poly-purine Shine-Dalgarno sequence, the element required for engagement of the 30S ribosomal subunit (via 16S rRNA) to the heterologous gene RNA transcript and initiation of translation.
- the Shine-Dalgarno sequence (SEQ ID NO: 112) has typically the following consensus sequence in the 3'end of a promoter (or 5' UTR) (SEQ ID NO:66): 5'-NAGGAGGU-N5-10-AUG (start codon)- 3'.
- the Listeria My gene that encodes listerolysin O has the following Shine-Dalgarno sequence (SEQ ID NO: 113) in the 3'end of the promoter (or 5' UTR) (SEQ ID NO:67): 5'-AAGGAGAGTGAAACCCATG-S' (Shine-Dalgarno sequence is underlined, and the translation start codon is bolded).
- the Listeria actA gene has the following Shine- Dalgarno sequence (SEQ ID NO: 114) in the 3'end of the promoter (or 5' UTR) (SEQ ID NO: 109): 5'-CGAGGAGGGAGT AT AAGTG-3 ' (Shine-Dalgarno sequence is underlined, and the translation start codon is bolded). 5.2.3.3. EphA2 Antigenic Peptides
- the present invention relates to the use of Listeria that have been engineered to express one, two, three or more EphA2 antigenic peptides. Without being bound by any mechanism, such Listeria are capable of eliciting an immune response to EphA2 upon administration to a subject with a disease involving aberrant expression (e.g., overexpression) of EphA2, resulting in a cellular or humoral immune response against endogenous EphA2.
- Listeria are capable of eliciting an immune response to EphA2 upon administration to a subject with a disease involving aberrant expression (e.g., overexpression) of EphA2, resulting in a cellular or humoral immune response against endogenous EphA2.
- EphA2 antigenic peptide (sometimes referred to as an
- EphA2 antigenic polypeptide for use in the methods and compositions of the present invention can be any EphA2 antigenic peptide that is capable of eliciting an immune response against EphA2-expressing cells involved in a hyperproliferative disorder or a disorder involving aberrant angiogenesis.
- an EphA2 antigenic peptide can be an EphA2 polypeptide, preferably an EphA2 polypeptide of SEQ ID NO:2, or a fragment or derivative of an EphA2 polypeptide that (1) displays antigenicity of EphA2 (ability to bind or compete with EphA2 for binding to an anti-EphA2 antibody, (2) displays immunogenicity of EphA2 (ability to generate antibody which binds to EphA2), and/or (3) contains one or more T cell epitopes of EphA2.
- the EphA2 antigenic peptide is a sequence provided below or a fragment or derivative thereof: [00260] Genbank Accession No. NP_004422 Human
- the EphA2 antigenic peptide comprises (or consists of) full length EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) full length human EphA2 (SEQ ID NO:2). In other embodiments, the EphA2 antigenic peptide comprises (or consists of) a fragment of EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) fragment of human EphA2 (SEQ ID NO:2).
- the EphA2 antigenic peptide comprises (or consists of) the intracellular domain (ICD) of EphA2.
- the EphA2 antigenic peptide comprises (or consists of) residues 558 to 976 of SEQ ID NO:2.
- the intracellular domain may comprise (or consist of) a lysine to methionine substitution at amino acid residue 646.
- the EphA2 antigenic peptide comprise (or consist of) a fragment of the EphA2 intracellular domain (ICD).
- the EphA2 antigenic peptide is an immunodominant epitope of EphA2, preferably in the intracellular domain.
- the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2.
- the antigenic peptide consists of 8 to 15 amino acids or 12 to 14 amino acids of this epitope. In other embodiments, the antigenic peptide consists of 8 or 9 amino acids of this epitope.
- the EphA2 antigenic peptide comprises (or consists of) the extracellular domain (ECD) of EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) residues 22 to 554 of SEQ ID NO:2.
- the EphA2 antigenic peptide comprises (or consists of) a fragment of the EphA2 extracellular domain (ECD). In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) a fragment of the EphA2 extracellular domain. [00267] In yet other embodiments, the EphA2 antigenic peptide comprises (or consists of) more than one domain of the full length human EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) the extracellular domain and the intracellular cytoplasmic domain, joined together. In accordance with this embodiment, the transmembrane domain of EphA2 is deleted. [00268] In certain embodiments of the invention, the tyrosine kinase activity of
- EphA2 is ablated.
- EphA2 may contain deletions, additions or substitutions of amino acid residues that result in the elimination of tyrosine kinase activity.
- a lysine to methionine substitution at position 646 is present.
- the EphA2 antigenic peptide comprises (or consists of) the extracellular and cytoplasmic domains of EphA2, joined together, and the peptide has a lysine to methionine substitution as position 646.
- the transmembrane domain is deleted.
- the peptide corresponds to or comprises an EphA2 epitope that is exposed in a cancer cell but occluded in a non-cancer cell.
- the EphA2 antigenic peptides preferentially include epitopes on EphA2 that are selectively exposed or increased on cancer cells but not non-cancer cells ("exposed EphA2 epitope peptides").
- the present invention preferably encompasses the use of a plurality of
- EphA2 antigenic peptides e.g., 2, 3, 4, 5, 6, or more EphA2 antigenic peptides, in the compositions and methods of the present invention.
- the plurality of EphA2 antigenic peptides are on separate cistrons.
- the full-length E ⁇ hA2 or fragments of EphA2 that are useful in the methods and compositions present invention may contain deletions, additions or substitutions of amino acid residues within the amino acid sequence encoded by an EphA2 gene. Preferably mutations result in a silent change, thus producing a functionally equivalent EphA2 gene product.
- functionally equivalent it is meant that the mutated E ⁇ hA2 gene product has the same function as the wild-type EphA2 gene product, e.g., contains one or more epitopes of EphA2.
- An EphA2 antigenic peptide sequence preferably comprises (or consists of ) an amino acid sequence that exhibits at least about 65% sequence similarity to human EphA2, more preferably exhibits at least 70% sequence similarity to human EphA2, yet more preferably exhibits at least about 75% sequence similarity human EphA2.
- the EphA2 polypeptide sequence preferably comprises (or consists of) an amino acid sequence that exhibits at least 85% sequence similarity to human EphA2, yet more preferably exhibits at least 90% sequence similarity to human EphA2, and most preferably exhibits at least about 95% sequence similarity to human EphA2.
- the present invention encompasses EphA2 antigenic peptides comprising
- EphA2 or a fragment thereof that are encoded by nucleotide sequences that have at least 65% homology to human E ⁇ hA2 or a fragment thereof, more preferably has at least 70% homology to human EphA2 or a fragment thereof, yet more preferably has at least about 75% homology to human EphA2 or a fragment thereof.
- the present invention encompasses EphA2 antigenic peptides comprising EphA2 or a fragment thereof that are encoded by nucleotide sequences that have at least 85% homology to human EphA2 or a fragment thereof, preferably at least 90% homology to human EphA2 or a fragment thereof, and more preferably at least about 95% homology to human EphA2 or a fragment thereof.
- the EphA2 antigenic peptide is encoded by nucleotide sequences that have been codon-optimized for expression in bacteria. In another embodiment, the EphA2 antigenic peptide is encoded by nucleotide sequences that have been codon-optimized for expression in Listeria.
- the EphA2 antigenic peptides comprise ( or consist of) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a nucleotide sequence that encodes human EphA2 or a fragment thereof, such as the intracellular domain or extracellular domain, under stringent conditions.
- nucleotide sequences hybridize over the full length EphA2 or a corresponding fragment (e.g., EphA2 extracellular domain or EphA2 intracellular domain) depending on the nucleotide sequence that encodes an EphA2 antigenic peptide.
- nucleotide sequences hybridize over the full length human EphA2 or a corresponding fragment (e.g., human EphA2 extracellular domain or human EphA2 intracellular domain) depending on the nucleotide sequence that encodes the human EphA2 antigenic peptide.
- EphA2 antigenic peptides that comprise (or consist of) at least 10, 20, 30, 40, 50, 75, 100, or 200 amino acids of an EphA2 polypeptide, preferably of SEQ ID NO:2 are used in the present invention.
- EphA2 antigenic peptides that comprise (or consist of) at least 10, 20, 30, 40, 50, 75, 100, or 200 contiguous amino acids of an EphA2 polypeptide, preferably of SEQ ID NO:2 are used in the present invention.
- an EphA2 antigenic peptide comprises (or consists of) all or a fragment of the extracellular domain of an EphA2 polypeptide of SEQ ID NO:2.
- an EphA2 antigenic peptide comprises (or consists of) all or a fragment, derivative or analog of the intracellular domain of an EphA2 polypeptide of SEQ ID NO:2.
- the extracellular or intracellular domains may be codon-optimized and the intracellular domain may have an amino acid substitution at position 646 that ablates kinase activity.
- an EphA2 antigenic peptide is a fusion protein.
- the present invention encompasses EphA2 antigenic peptides that are fusion proteins comprising all or a fragment, derivative or analog of EphA2 operatively associated, linked and/or conjugated to a heterologous component, e.g., a heterologous peptide, such as a signal peptide.
- a heterologous component can include, but are not limited to sequences which facilitate isolation and purification of the fusion protein.
- Heterologous components can also include sequences which confer stability to EphA2 antigenic peptides.
- a fusion protein comprises a signal peptide sequence and an EphA2 antigenic peptide.
- the heterologous component is the native Listeria
- the heterologous component is amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA, wherein amino acid residue 1 is the N-terminal amino acid residue of ActA.
- the heterologous component is the first 15, the first 20, the first 25, the first 30, the first 35, the first 40, the first 45, the First 50, the first 55, the first 60, the first 65, the first 70, the first 75, the first 80, the first 85, the first 90, the first 95, the first 100, the first 110, the first 125, the first 150, or the first 175 amino acid residues of ActA.
- the heterologous component is the NH 2 terminal 1-100 amino acids of actA.
- the amino acid sequence of ActA or a fragment thereof is fused to the NH2 terminus of EphA2, or a derivative, analog or fragment thereof.
- the actA protein sequences may help expression and secretion of E ⁇ hA2 or a derivative, analog or fragment thereof.
- the present invention encompasses the use of fusion proteins comprising EphA2 or a derivative, analog or fragment thereof (e.g.
- a polypeptide of SEQ ID NO:2 or a fragment thereof and a heterologous polypeptide (Le., a polypeptide or fragment thereof, preferably a fragment of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 contiguous amino acids of the polypeptide).
- the fusion can be direct, but may occur through linker sequences.
- the heterologous polypeptide may be fused to the N-terminus or C-terminus of the EphA2 antigenic peptide. Alternatively, the heterologous polypeptide may be flanked by EphA2 polypeptide sequences.
- a fusion protein can comprise EphA2 or a derivative, analog or fragment thereof fused to a heterologous signal sequence at its N-terminus.
- Various signal sequences are commercially available.
- prokaryotic heterologous signal sequences useful in the methods of the invention include, but are not limited to, the phoA secretory signal (Sambrook et al., eds., 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) and the protein A secretory signal (Pharmacia Biotech, Piscataway, NJ).
- EphA2 or a derivative, analog or fragment thereof can be fused to tag sequences, e.g., a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, CA), among others, many of which are commercially available for use in the methods of the invention.
- a hexa-histidine peptide such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, CA), among others, many of which are commercially available for use in the methods of the invention.
- a hexa-histidine provides for convenient purification of the fusion protein.
- peptide tags are the hemagglutinin "HA” tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, 1984, Cell, 37:767) and the “flag” tag (Knappik et at, 1994, Biotechniques, 17(4):754-761). These tags are especially useful for purification of recombinantly produced EphA2 antigenic peptides.
- An affinity label can be fused at its amino terminal to the carboxyl terminal of EphA2 or a derivative, analog or fragment thereof for use in the methods of the invention.
- the precise site at which the fusion is made in the carboxyl terminal is not critical. The optimal site can be determined by routine experimentation.
- An affinity label can also be fused at its carboxyl terminal to the amino terminal of EphA2 or a derivative, analog or fragment thereof for use in the methods and compositions of the invention.
- a variety of affinity labels known in the art may be used, such as, but not limited to, the immunoglobulin constant regions (see also Petty, 1996, Metal-chelate affinity chromatography, in Current Protocols in Molecular Biology, Vol. 2, Ed.
- affinity labels may afford the EphA2 antigenic peptide novel structural properties, such as the ability to form multimers. These affinity labels are usually derived from proteins that normally exist as homopolymers. Affinity labels such as the extracellular domains of CD8 (Shiue et al, 1988, /. Exp. Med. 168: 1993-2005), or CD28 (Lee et al, 1990, J. Immunol. 145:344-352), or fragments of the immunoglobulin molecule containing sites for interchain disulfide bonds, could lead to the formation of multimers.
- affinity labels As will be appreciated by those skilled in the art, many methods can be used to obtain the coding region of the above-mentioned affinity labels, including but not limited to, DNA cloning, DNA amplification, and synthetic methods. Some of the affinity labels and reagents for their detection and isolation are available commercially. [00286] Various leader sequences known in the art can be used for the efficient secretion of the EphA2 antigenic peptide from bacterial cells such as Listeria (von Heijne, 1985, J. MoL Biol. 184:99-105).
- leader sequences for targeting EphA2 antigenic peptide expression in bacterial cells include, but are not limited to, the leader sequences of the E.coli proteins OmpA (Hobom et al, 1995, Dev. Biol Stand. 84:255-262), Pho A (Oka et al, 1985, Proc. Natl Acad. Sci 82:7212-16), OmpT (Johnson et al, 1996, Protein
- the fusion partner comprises a non-EphA2 polypeptide corresponding to an antigen associated with the cell type against which a therapeutic or prophylactic immune is desired.
- the non-EphA2 polypeptide can comprise an epitope of a tumor-associated antigen, such as, but not limited to, MAGE- 1, MAGE-2, MAGE-3, gplOO, TRP-2, tyrosinase, MART-I, ⁇ -HCG, CEA, Ras, ⁇ - catenin, g ⁇ 43, GAGE-I, GAGE -2, N-acetylglucosaminyltransferase-V, pl5, ⁇ -catenin, BAGE-I, PSA, MUM-I, CDK4, HER-2/neu, Human papillomavirus-E6, Human papillomavirus-E7, and MUC-I, 2, 3.
- a tumor-associated antigen such as, but not limited to, MAGE- 1, MAGE-2, MAGE-3, gplOO, TRP-2, tyrosinase, MART-I, ⁇ -HCG, CEA, Ras, ⁇ - cat
- EphA2 or a derivative, analog or fragment thereof is functionally coupled to an internalization signal peptide, also referred to as a "protein transduction domain," that would allow its uptake into the cell nucleus.
- the internalization signal is that of Antennapedia (reviewed by Prochiantz, 1996, Curr. Opin. Neurobiol. 6:629-634, Hox A5 (Chatelin et al., 1996, Mech. Dev.
- HIV TAT protein Vives et al., 1997, J. Biol. Chem. 272:16010-16017
- VP22 Phelan et ah, 1998, Nat. Biotechnol 16:440-443.
- Any fusion protein may be readily purified by utilizing an antibody specific or selective for the fusion protein being expressed.
- the terms “signal peptide,” “signal sequence,” and “secretion signal” are used interchangeably herein.
- the signal peptide helps facilitate transportation of a polypeptide fused to the signal peptide across the cell membrane of a cell (e.g., a bacterial cell) so that the polypeptide is secreted from the cell.
- the signal peptide is a "secretory signal peptide” or “secretory sequence”.
- the signal peptide is positioned at the N-terrninal end of the polypeptide to be secreted.
- the sequence encoding the signal peptide in the recombinant nucleic acid or expression cassette is positioned within the recombinant nucleic acid or expression cassette such that the encoded signal peptide will effect secretion of the polypeptide to which it is fused from the desired Listeria.
- the nucleotide sequence encoding the signal peptide is positioned in frame (either directly or separated by intervening polynucleotides) at the 5' end of the polynucleotide that encodes the polypeptide to be secreted (e.g., a polypeptide comprising an antigen).
- the signal peptides that are part of the fusion proteins and/or protein chimeras encoded by the recombinant nucleic acid, expression cassettes and/or expression vectors are heterologous to at least one other polypeptide sequence in the fusion protein and/or protein chimera.
- the signal peptide encoded by the recombinant nucleic acid, expression cassette and/or expression vector is heterologous (Le., foreign) to the Listeria into which the recombinant nucleic acid, expression cassette and/or expression vector is to be incorporated or has been incorporated.
- the signal peptide is native to the Listeria in which the recombinant nucleic acid molecule, expression cassette and/or expression vector is to be incorporated.
- the nucleotide sequence encoding the signal peptide is codon-optimized for expression in Listeria (such as Listeria monocytogenes).
- the nucleotide sequence that is codon-optimized for a particular bacterium is foreign to the Listeria.
- the nucleotide sequence that is codon- optimized for the particular Listeria is native to that Listeria.
- a large variety of signal peptides are known in the art.
- a variety of algorithms and software programs, such as the "SignalP" algorithms, which can be used to predict signal peptide sequences are available in the art.
- the signal peptide is prokaryotic. In some alternative embodiments, the signal peptide is eukaryotic. The use of eukaryotic signal peptides for expression of proteins in Escherichia coli for example, is described in Humphreys et al., Protein Expression and Purification, 20:252-264 (2000).
- the signal peptide is a bacterial signal peptide. In some embodiments, the signal peptide is a non-Listeria signal peptide. In some embodiments, the signal peptide is a Listeria signal peptide. In some embodiments the signal peptide is derived from gram-positive bacterium. In some embodiments, the signal peptide is derived from an intracellular bacterium.
- the signal peptide (e.g., a non-secAl bacterial signal peptide) used in a recombinant nucleic acid molecule, expression cassette, or expression vector is derived from Listeria. In some embodiments, this signal peptide is derived from Listeria monocytogenes. In some embodiments, the signal peptide is a signal peptide from Listeria monocytogenes. In some embodiments, the signal peptide is not derived from Listeria, but is instead derived from a bacterium other than a bacterium belonging to the genus Listeria. In some embodiments, the bacterial signal peptide is derived from a Bacillus bacterium.
- Bacteria utilize diverse pathways for protein secretion, including sec Al and
- Tat Twin-Arg Translocation
- signal peptides that can be used include, but are not limited to B. anthracis protective antigen ("BaPa”), Bs phoD, p60, LI usp45 (van Asseldonk et al., 1993, MoI Gen Genet. 240:428 ⁇ 34).
- BaPa B. anthracis protective antigen
- Bs phoD Bs phoD
- p60 LI usp45
- van Asseldonk et al., 1993, MoI Gen Genet. 240:428 ⁇ 34 van Asseldonk et al., 1993, MoI Gen Genet. 240:428 ⁇ 34
- these signal peptides may provide better secretion and/or expression in the constructs disclosed herein.
- the Listeria protein p60 is a peptidoglucan autolysin that is secreted by the secA2 pathway. See, e.g., U.S. Patent Application Publication No. US 2005/0249748, which is incorporated herein
- Nucleotide sequence encoding signal peptides corresponding to either of these protein secretion pathways can be fused genetically in-frame to a desired heterologous protein coding sequence.
- the signal peptides optimally contain a cleavage site recognized by a peptidase at their carboxyl terminus for release of the authentic desired protein into the extra-cellular environment (Sharkov and Cai. 2002, J. Biol. Chem. 277:5796-5803; Nielsen et.
- Signal peptide cleavage sites can be predicted using programs such as SignalP 3.0 (Bendtsen et al, 2004, /. MoI. Biol. 340:783-795).
- the signal peptides can be derived not only from diverse secretion pathways, but also from diverse bacterial genera. Signal peptides have a common structural organization, having a charged N-terminus (N-domain), a hydrophobic core region (H-domain) and a more polar C-terminal region (C-domain), however, they do not show sequence conservation.
- the C- domain of the signal peptide carries a type I signal peptidase (SPase I) cleavage site, having the consensus sequence A-X-A, at positions —1 and —3 relative to the cleavage site.
- SPase I type I signal peptidase
- Proteins secreted via the sec pathway have signal peptides that average 28 residues.
- Signal peptides related to proteins secreted by the Tat pathway have a tripartite organization similar to Sec signal peptides, but are characterized by having an RR-motif (R-R-X-#-#, where # is a hydrophobic residue), located at the N-domain / H-domain boundary.
- Bacterial Tat signal peptides average 14 amino acids longer than sec signal peptides.
- the Bacillus subtilis secretome may contain as many as 69 putative proteins that utilize the Tat secretion pathway, 14 of which contain a SPase I cleavage site (Jongbloed et al, 2002, J. Biol. Chem. 277:44068-44078; Thalsma et al, 2000, Microbiol. MoI. Biol. Rev. 64:515-547). Shown in Table 4 below are non-limiting examples of signal peptides that can be used in fusion compositions with a selected heterologous gene, resulting in secretion from the bacterium of the encoded protein.
- Tat signal peptides corresponding to these proteins are fused genetically in-frame to a desired sequence encoding an EphA2 antigenic peptide, to facilitate secretion of the functionally linked Tat signal peptide-EphA2 protein chimera via the Tat pathway.
- Tat signal sequences from other bacteria can also be used as signal peptides, including, but not restricted to, phoD from B. subtilis. See Jongbloed et al, 2002, J. Biol. Chem. 277:44068-44078; Jongbloed et al, 2000, J. Biol. Chem.
- proteins from Bacillus subtilis and Listeria that are predicted to utilize Tat pathway secretion.
- Other proteins identified that have been predicted to be secreted by the Tat pathway include the following: >gi
- subtilis YwbN protein (Listeria innocua); >gi
- Organisms utilize codon bias to regulate expression of particular endogenous genes.
- signal peptides utilized for secretion of selected EphA2 antigenic peptides may not contain codons that utilize preferred codons, resulting in non- optimal levels of protein synthesis.
- the signal peptide sequence fused in frame with a nucleotide sequence encoding EphA2 or a derivative, analog or fragment thereof is codon-optimized for codon usage in a selected Listeria.
- a nucleotide sequence of a selected signal peptide is codon optimized for expression in Listeria monocytogenes, according to Table 4, supra.
- the present invention encompasses nucleotide sequences encoding peptides described in section 5.2.3.3.
- the nucleotide sequences are those in SEQ ID NOS:90, 92, 94, 96 or 98.
- the present invention also encompasses nucleotide sequences that are homologous to nucleotide sequences encoding peptides described in Section 5.2.3.3.
- the present invention also encompasses nucleotide sequences encoding
- EphA2 antigenic peptides that hybridize under high stringency, intermediate or lower stringency hybridization conditions, e.g., as defined infra, to nucleotide sequences that encode an EphA2 or a fragment thereof. It is understood that the nucleotide sequences hybridize over the full length EphA2 or a corresponding fragment (e.g., EphA2 extracellular domain or EphA2 intracellular domain) depending on the nucleotide sequence that encodes an EphA2 antigenic peptide.
- the nucleotide sequences hybridize over the full length human EphA2 or a corresponding fragment (e.g., human EphA2 extracellular domain or human EphA2 intracellular domain) depending on the nucleotide sequence that encodes the human EphA2 antigenic peptide.
- a corresponding fragment e.g., human EphA2 extracellular domain or human EphA2 intracellular domain
- procedures using such conditions of low stringency for regions of hybridization of over 90 nucleotides are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. ScL USA 78:6789-6792).
- Filters containing DNA are pretreated for 6 hours at 40 0 C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 ⁇ g/ml denatured salmon sperm DNA.
- Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ⁇ g/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X 10 6 cpm 32 P-labeled probe is used.
- Filters are incubated in hybridization mixture for 18-20 h at 40 0 C, and then washed for 1.5 h at 55°C in a solution containing 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60 0 C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re- exposed to film. Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).
- PCR polymerase chain reaction
- the present invention encompasses nucleotide sequences with 100%, 99.5%, 99%, 98.5%, 98%, 97.5%, 97%, 96.5%, 96%, 95.5%, 95%, 94%, 93%, 92%, 91% 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10% identity to nucleotide sequences encoding EphA2 (preferably, human EphA2, SEQ DD NO:1) or derivatives, analogs or fragments thereof (e.g., EphA2 intracellular domain or EphA2 extracellular domain).
- EphA2 preferably, human EphA2, SEQ DD NO:1
- derivatives analogs or fragments thereof (e.g., EphA2 intracellular domain or EphA2 extracellular domain).
- a transcription termination sequence can be inserted into the heterologous protein expression cassette, downstream from the C-terminus of the translational stop codon related to the heterologous protein.
- Appropriate sequence elements known to those who are skilled in the art that promote either rho-dependent or rho-independent transcription termination can be placed in the heterologous protein expression cassette.
- the bicistronic or polycistronic expression cassettes comprise an intergenic sequence (e.g., from a native bacterial bicistronic or polycistronic gene) positioned between the coding sequences of the two peptides.
- the intergenic sequence comprises a sequence which promotes ribosomal entry and initiation of translation.
- the intergenic sequence is the Listeria monocytogenes actA-plcB intergenic sequence.
- the intergenic sequence is positioned between a polynucleotide sequence encoding a first polypeptide (or a first fusion protein comprising a first polypeptide and a signal peptide) and a polynucleotide sequence encoding a second polypeptide (or a second fusion protein comprising a second polypeptide and signal peptide).
- the sequence of a Listeria monocytogenes intergenic region from a selected polycistronic message can be used to construct polycistronic expression cassettes for expression of a selected heterologous protein from recombinant Listeria species.
- a selected heterologous protein from recombinant Listeria species For example, several of the prfA-dependent virulence factors from Listeria monocytogenes are expressed from polycistronic message.
- the Listeria monocytogenes ActA and PIcB proteins are expressed as a bicistronic message.
- the DNA sequence corresponding to the Listeria monocytogenes actA-plcB intergenic sequence (5 '-3') is shown below:
- intergenic or synthetic sequences can be used to construct polycistronic expression cassettes for use in Listeria or other bacteria. Construction of intergenic regions which lead to substantial secondary RNA structure should be prevented, to avoid unwanted transcription termination by a rho-independent mechanism.
- signal peptides must be functionally linked to each coding region. In some embodiments, these signal peptides differ from each other.
- a nucleic acid encoding the peptide may be assembled from chemically synthesized oligonucleotides ⁇ e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the peptide, annealing and ligating those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
- recombinant nucleic acid molecules can be prepared by synthesizing long oligonucleotides on a DNA synthesizer which overlap with each other and then performing extension reaction and/or PCR to generate the desired quantity of double-stranded DNA. See, e.g., sections 6.2.5, 6.10.2, and 6.10.5.1 which describe the preparation of EphA2 expression cassettes.
- the double-stranded DNA can be cut with restriction enzymes and inserted into the desired expression or cloning vectors. See, e.g., sections 6.2.3-6.2.5, 6.10.1, 6.10.2 and 6.10.5.1 which describe the cloning of EphA2 expression cassettes into the appropriate vectors. Sequencing may be performed to verify that the correct sequence has been obtained. Also by way of non-limiting example, alternatively, one or more portions of the recombinant nucleic acid molecules may be obtained from plasmids containing the portions.
- PCR of the relevant portions of the plasmid and/or restriction enzyme excision of the relevant portions of the plasmid can be performed, followed by ligation and/or PCR to combine the relevant polynucleotides to generate the desired recombinant nucleic acid molecules.
- Such techniques are standard to the art. Standard cloning techniques may also be used to insert the recombinant nucleic acid sequence into a plasmid and replicate the recombinant nucleic acid within a host cell, such as bacteria. The recombinant nucleic acid can then be isolated from the host cell.
- a polynucleotide encoding an EphA2 antigenic peptide may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular peptide is not available, but the sequence of the EphA2 antigenic peptide is known, a nucleic acid encoding the peptide may be chemically synthesized or obtained from a suitable source (e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing EphA2) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a. cDNA clone from a cDNA library that encodes the peptide. Amplified nucleic acids
- nucleic acid that is useful hi the present methods may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
- EphA2 antigenic peptides having a different amino acid sequence from the amino acid sequence depicted in SEQ ID NO:2, for example to create amino acid substitutions, deletions, and/or insertions.
- Polynucleotides encoding fusion proteins can be produced by standard recombinant DNA techniques.
- a nucleic acid molecule encoding a fusion protein can be synthesized by conventional techniques including automated DNA synthesizers.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence ⁇ see, e.g., Current Protocols in Molecular Biology, Ausubel et aL, eds., John Wiley & Sons, 1992).
- the nucleotide sequence coding for a fusion protein can be inserted into an appropriate expression vector, Le., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
- the expression of a fusion protein may be regulated by a constitutive, inducible or tissue-specific or -selective promoter. It will be understood by the skilled artisan that fusion proteins, which can facilitate solubility and/or expression, and can increase the in vivo half-life of the EphA2 antigenic peptide and thus are useful in the methods of the invention.
- the EphA2 antigenic peptides or peptide fragments thereof, or fusion proteins can be used in any assay that detects or measures EphA2 antigenic peptides or in the calibration and standardization of such assay.
- the methods of invention encompass the use of EphA2 antigenic peptides or peptide fragments thereof, which may be produced by recombinant DNA technology using techniques well known in the art.
- methods for preparing the EphA2 antigenic peptides of the invention by expressing nucleic acid sequences encoding EphA2 antigenic antigenic peptides are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing, e.g., EphA2 antigenic peptide coding sequences (including but not limited to nucleic acids encoding all or an antigenic portion of a polypeptide of SEQ ID NO:2) and appropriate transcriptional and translational control signals.
- RNA capable of encoding EphA2 antigenic peptide sequences may be chemically synthesized using, for example, synthesizers ⁇ see, e.g., the techniques described in Oligonucleotide Synthesis, 1984, Gait, MJ. ed., IRL Press, Oxford).
- the invention also provides a method of using any of the expression cassettes described herein to produce a recombinant Listeria bacterium.
- the method of using an expression cassette described herein to make a recombinant Listeria bacterium comprises introducing the expression cassette into a Listeria.
- the expression cassette is integrated into the genome of the Listeria bacterium.
- the expression cassette is integrated into a chromosome of the Listeria bacterium by homologous recombination.
- the expression cassette is on a plasmid which is incorporated within the Listeria bacterium.
- incorporation of the expression cassette into the Listeria bacterium occurs by conjugation.
- the introduction of the expression cassette into the Listeria bacterium can be effected by any of the standard techniques known in the art. For instance, incorporation of the expression cassette into the Listeria bacterium can occur by conjugation, transduction (transfection), or transformation.
- the EphA2 antigenic peptide expression cassette plasmids can be introduced optimally into a desired Listeria species, strain or type by electroporation, according to standard methods for electroporation of Gram positive bacteria. See, e.g., section 6.10.
- bacteria electroporated with the EphA2 antigenic peptide expression cassette plasmid are selected by plating on BHI agar media containing chloramphenicol (10 ⁇ g/ml) or plating on VPP (Vegetable Peptone Phosphate, Oxoid Ltd.)/Stp (streptomycin)/Cm agar media, and incubated at the permissive temperature of 30 0 C.
- VPP Veetable Peptone Phosphate, Oxoid Ltd.
- Stp streptomycin
- plasmid excision and curing is achieved by passaging several individual colonies for multiple generations at the permissive temperature of 30 0 C in BHI media or VPP media not containing chloramphenicol.
- Verification of integration of the EphA2 antigenic peptide expression cassette into the Listeria chromosome can be accomplished by PCR, utilizing a primer pair that amplifies a region defined from within the EphA2 antigenic peptide expression cassette to the Listeria! chromosome targeting sequence not contained in the plasmid vector construct.
- the plasmid can then be introduced into E.
- the present invention provides Listeria-based EphA2 immunogenic compositions comprising Listeria bacteria engineered to express an EphA2 antigenic peptide. Any assay known in the art for determining whether a peptide is a T cell epitope or a B cell epitope may be employed in testing EphA2 peptides for suitability in the present methods and compositions. [00330] For example, for determining whether a peptide is a T cell epitope,
- EphA2 antigenic peptides can be determined by screening synthetic peptides corresponding to portions of EphA2. Candidate antigenic peptides can be identified on the basis of their sequence or predicted structure. A number of algorithms are available for this purpose.
- EphA2 peptides that display Immunogenicity of EphA2
- the ability of EphA2 peptides to elicit EphA2-specific antibody responses in mammals can be examined, for example, by immunizing animals ⁇ e.g., mice, guinea pigs or rabbits) with individual EphA2 peptides emulsified in Freund's adjuvant.
- immunizing animals ⁇ e.g., mice, guinea pigs or rabbits
- EphA2 peptides emulsified in Freund's adjuvant.
- IgG antibody responses are tested by peptide-specific ELISAs and imrnunoblotting against EphA2.
- EphA2 peptides which produce antisera that react specifically with the
- EphA2 peptides and also recognized full length EphA2 protein in immunoblots are said to display the antigenicity of EphA2. 5.5.2. CD4 + T-CELL PROLIFERATION ASSAY
- such assays include in vitro cell culture assays in which, peripheral blood mononuclear cells ("PBMCs") are obtained from fresh blood of a patient with a disease involving overexpression of EphA2, and purified by centrifugation using FICOLL-PLAQUE PLUS (Pharmacia, Upsalla, Sweden) essentially as described by Kruse and Sebald, 1992, EMBO J. 11:3237-3244.
- the peripheral blood mononuclear cells are incubated for 7-10 days with candidate EphA2 antigenic peptides.
- Antigen presenting cells may optionally be added to the culture 24 to 48 hours prior to the assay, in order to process and present the antigen.
- RPMI 1640 media GibcoBRL, Gaithersburg, MD
- 5 x 10 4 activated T cells/well are in RPMI 1640 media containing 10% fetal bovine serum, 10 mM HEPES, ph 7.5, 2 mM L-glutamine, 100 units/ml penicillin G, and 100 ⁇ g/ml streptomycin sulphate in 96 well plates for 72 hrs at 37 0 C, pulsed with 1 ⁇ Ci 3 H-thymidine (DuPont NEN, Boston, MA)/well for 6 hrs, harvested, and radioactivity measured in a TOPCOUNT scintillation counter (Packard Instrument CoL, Meriden, CT).
- Measurement of antigen-specific, intracellular cytokine responses of T cells can be performed essentially as described by Waldrop et ah, 1997, /. Clin. Invest. 99:1739-1750; Openshaw etal, 1995, /. Exp. Med. 182:1357-1367; or Estcourt et al, 1997, Clin. Immunol. Immunopathol 83:60-67.
- Purified PBMCs from patients with a disease involving EphA2-overexpressing cells are placed in 12x75 millimeter polystyrene tissue culture tubes (Becton Dickinson, Lincoln Park, NJ.) at a concentration of IxIO 6 cells per tube.
- a solution comprising 0.5 milliliters of HL-I serum free medium, 100 units per milliliter of penicillin, 100 units per milliliter streptomycin, 2 millimolar L glutamine (Gibco BRL), varying amounts of individual EphA2 antigenic candidate peptides, and 1 unit of anti-CD28 mAb (Becton-Dickinson, Lincoln Park, NJ.) is added to each tube.
- Anti-CD3 mAb is added to a duplicate set of normal PBMC cultures as positive control. Culture tubes are incubated for 1 hour. Brefeldin A is added to individual tubes at a concentration of 1 microgram per milliliter, and the tubes are incubated for an additional 17 hours.
- PBMCs stimulated as described above are harvested by washing the cells twice with a solution comprising Dulbecco's phosphate-buffered saline (dPBS) and 10 units of Brefeldin A. These washed cells are fixed by incubation for 10 minutes in a solution comprising 0.5 milliliters of 4% paraformaldehyde and dPBS. The cells are washed with a solution comprising dPBS and 2% fetal calf serum (FCS). The cells are then either used immediately for intracellular cytokine and surface marker staining or are frozen for no more than three days in freezing medium, as described (Waldrop et al., 1997, /. Clin. Invest. 99:1739-1750).
- FCS fetal calf serum
- the cell preparations were rapidly thawed in a 37°C water bath and washed once with dPBS.
- Cells either fresh or frozen, are resuspended in 0.5 milliliters of permeabilizing solution (Becton Dickinson Irnmunocytometry systems, San Jose, Calif.) and incubated for 10 minutes at room temperature with protection from light.
- Permeabilized cells are washed twice with dPBS and incubated with directly conjugated mAbs for 20 minutes at room temperature with protection from light.
- Optimal concentrations of antibodies are predetermined according to standard methods. After staining, the cells were washed, refixed by incubation in a solution comprising dPBS 1% paraformaldehyde, and stored away from light at 4°C for flow cytometry analysis.
- the ELISPOT assay measures Thl-cytokine specific induction in murine splenocytes following Listeria vaccination. ELISPOT assays are performed to determine the frequency of T lymphocytes in response to endogenous antigenic peptide stimulation, and are as described in Geginat et al., 2001, /. Immunol. 166:1877-1884. Balb/c mice (3 per group) are vaccinated with L. monocytogenes expressing candidate EphA2 antigenic peptides or HBSS as control. Whole mouse spleens are harvested and pooled five days after vaccination. Single cell suspensions of murine splenocytes are plated in the presence of various antigens overnight in a 37°C incubator.
- Assays are performed in nitrocellulose-backed 96-well microtiter plates coated with rat anti-mouse IFN- ⁇ mAb.
- a 1 x 10 "5 M peptide solution is prepared for the testing of the candidate E ⁇ hA2 antigenic peptide.
- prediluted peptide (1 x 10 "s M) is directly added to Ab-coated ELISPOT plates and mixed with 4 x 10 s splenocytes from nonimmune animals as APC to yield a final volume of 100 ⁇ l.
- 1 x 10 5 CD4 + or CD8 + cells purified from L. monocytogenes-imm ⁇ ne mice are added per well in a volume of 50 ⁇ l and plates are incubated overnight at 37 0 C.
- the ELISPOT-based ex vivo MHC restriction analysis is performed after loading of cell lines expressing specific MHC class I molecules with 1 x 10 "6 M peptide for 2 h at 37°C.
- ELISPOT plate 1 x 10 5 peptide-loaded APC are mixed with 4 x 10 5 or 4 x 10 4 responder splenocytes in a final volume of 150 ⁇ l.
- ELISPOT plates are developed with biotin-labeled rat anti-mouse IFN- ⁇ mAb, HRP streptavidin conjugate, and aminoethylcarbazole dye of spots per splenocytes seeded. The specificity and sensitivity of the ELISPOT assay is controlled with IFN- ⁇ secreting CD8 T cell lines specific for a control antigen.
- the present invention provides methods for treating, preventing, and/or managing a disorder associated with aberrant (e.g., overexpression) of EphA2, comprising administering to a subject in need thereof one or more L/,stera.-based EphA2 immunogenic compositions of the invention.
- the present invention also provides for treating, preventing, and/or managing hyperproliferative cell disorders, preferably cancer, comprising administering to a subject in need thereof one or more Listeria-based EphA2 immunogenic compositions of the invention.
- the immunogenic compositions of the invention can be a pharmaceutical composition or a vaccine composition.
- the present invention encompasses methods for eliciting an immune response against an EphA2-expressing cell associated with a hyperproliferative cell disorder, comprising administering to a subject one or more Listeria-based EphA2 compositions of the invention in an amount effective for eliciting an immune response against the EphA2-ex ⁇ ressing cell- [00345]
- the present invention also encompasses methods for eliciting an immune response against an EphA2-expressing cell associated with a hyperproliferative cell disorder, comprising administering to a subject a Listeria-based EphA2 composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for eliciting an immune response against the EphA2-expressing cell.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the Listeri ⁇ -based EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono.
- the disorder to be treated, prevented, or managed is a pre-cancerous condition associated with cells that overexpress EphA2.
- the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
- the present invention provides methods for treating, preventing, and/or managing a disorder associated with aberrant (e.g., overexpression) of EphA2, comprising administering to a subject in need thereof one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention and one or more other therapies.
- the present invention also provides methods for treating, preventing, and/or managing a hyperproliferative cell disorders, preferably cancer, comprising administering to a subject in need thereof one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention and one or more other therapies.
- other therapies include, but are not limited to, those listed below in Section 5.6.3, infra.
- a Listeria-based EphA2 immunogenic composition of the invention is administered in combination with one or more other therapies ⁇ e.g., prophylactic or therapeutic agents) useful in the treatment, prevention and/or management of disorders associated with EphA2 overexpression and/or hyperproliferative cell disorders, such as cancer.
- one or more Listeri ⁇ -based EphA2 immunogenic compositions are administered to a subject, preferably a human, concurrently with one or more other therapies (e.g., therapeutic agents) useful for the treatment and/or management of cancer.
- each therapy e.g., prophylactic or therapeutic agent
- each therapy may be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, they should be administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect.
- Each therapy e.g.
- the Listeria- based EphA2 immunogenic compositions of the invention are administered before, concurrently or after surgery. Preferably, the surgery completely removes localized tumors or reduces the size of large tumors. Surgery can also be done as a preventive measure or to relieve pain.
- the therapies are administered less than 1 hour apart, at about 1 hour apart, at about 1 hour to about 2 hours apart, at about 2 hours to about 3 hours apart, at about 3 hours to about 4 hours apart, at about 4 hours to about 5 hours apart, at about 5 hours to about 6 hours apart, at about 6 hours to about 7 hours apart, at about 7 hours to about 8 hours apart, at about 8 hours to about 9 hours apart, at about 9 hours to about 10 hours apart, at about 10 hours to about 11 hours apart, at about 11 hours to about 12 hours apart, no more than 24 hours apart or no more than 48 hours apart.
- two or more therapies are administered within the same patient visit.
- the dosage amounts and frequencies of administration provided herein are encompassed by the terms therapeutically effective and prophylactically effective.
- the dosage and frequency further will typically vary according to factors specific for each patient depending on the specific therapeutic or prophylactic agents administered, the severity and type of cancer, the route of administration, as well as age, body weight, response, and the past medical history of the patient. Suitable regimens can be selected by one skilled in the art by considering such factors and by following, for example, dosages reported in the literature and recommended in the Physician's Desk Reference (56 th ed., 2002, 57 th ed., 2003 and 58 th ed., 2004). 5.6.1.1. Patient Population
- the invention provides methods for treating, preventing, and/or managing a disorder associated with EphA2 overexpression and/or hyperproliferative cell disease, particularly cancer, comprising administrating to a subject in need thereof one or more Listeria-based EphA2 immunogenic compositions of the invention in an effective amount or an amount effective to elicit an immune response against EphA2-expressing cells associated with the hyperproliferative disorder.
- the Listeri ⁇ - based E ⁇ hA2 composition is engineered to express two or more EphA2 antigenic peptides.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette.
- the two or more EphA2 antigenic peptides are each encoded by separate monocistronic expression cassette.
- the two or more EphA2 antigenic peptides include EphA2 ICD and EphA2 ECD.
- the Listeri ⁇ -based EphA2 composition comprises ActA(N 100) Exmono Comono.
- an effective amount of a Listeri ⁇ - based EphA2 immunogenic composition of the invention is administered in combination with an effective amount of one or more other therapies (e.g., therapeutic or prophylactic agents) to a subject to treat, prevent, and/or manage a disorder associated with EphA2 overexpression and/or hyperproliferative cell disease, particularly cancer.
- therapies e.g., therapeutic or prophylactic agents
- the subject is preferably a mammal such as non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) and a primate (e.g., monkey, such as a cynomolgous monkey and a human).
- non-primate e.g., cows, pigs, horses, cats, dogs, rats, etc.
- a primate e.g., monkey, such as a cynomolgous monkey and a human.
- the subject is a human.
- the hyperproliferative disorder prevented, treated and/or managed in accordance with the methods of the invention is cancer.
- cancers that can be treated, prevented and/or managed in accordance with the methods encompassed by the invention include, but are not limited to, cancers that overexpress EphA2.
- the cancer is of an epithelial origin. Examples of such cancers are cancer of the lung, colon, prostate, breast, and skin. Other cancers include cancer of the bladder and pancreas and renal cell carcinoma and melanoma.
- the cancer is a solid tumor.
- the cancer is of a T cell origin. Examples of such cancers are leukemias and lymphomas.
- compositions of the invention comprise the administration of one or more Listeria-based EphA2 immunogenic compositions of the invention to subjects/patients suffering from or expected to suffer from cancer, e.g., have a genetic predisposition for a particular type of cancer, have been exposed to a carcinogen, or are in remission from a particular cancer.
- cancer refers to primary or metastatic cancers. Such patients may or may not have been previously treated for cancer.
- the methods and compositions of the invention may be used as any line of cancer therapy, e.g., a first line, second line or third line of cancer therapy. Included in the invention is also the treatment of patients undergoing other cancer therapies and the methods and compositions of the invention can be used before any adverse effects or intolerance of these other cancer therapies occurs.
- the invention also encompasses methods for administering one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention to treat or ameliorate symptoms in refractory patients.
- that a cancer is refractory to a therapy means that at least some significant portion of the cancer cells are not killed or their cell division arrested.
- the determination of whether the cancer cells are refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of treatment on cancer cells, using the art-accepted meanings of "refractory" in such a context.
- a cancer is refractory where the number of cancer cells has not been significantly reduced, or has increased.
- the invention also encompasses methods for administering one or more Listeri ⁇ -based EphA2 immunogenic compositions to prevent the onset or recurrence of cancer in patients predisposed to having cancer.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are administered to reverse resistance or reduced sensitivity of cancer cells to certain hormonal, radiation and chemotherapeutic agents thereby resensitizing the cancer cells to one or more of these agents, which can then be administered (or continue to be administered) to treat or manage cancer, including to prevent metastasis.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are administered to patients with increased levels of the cytokine IL-6, which has been associated with the development of cancer cell resistance to different treatment regimens, such as chemotherapy and hormonal therapy.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention are administered to patients suffering from breast cancer that have a decreased responsiveness or are refractory to tamoxifen treatment.
- the Listeria-based EphA2 immunogenic compositions of the invention are administered to patients with increased levels of the cytokine IL-6, which has been associated with the development of cancer cell resistance to different treatment regimens, such as chemotherapy and hormonal therapy.
- the invention provides methods for treating or managing a patients' cancer comprising administering to the patient one or more Listeri ⁇ - based EphA2 immunogenic compositions of the invention in combination with any other therapy or to patients who have proven refractory to other therapies but are no longer on these therapies.
- the patients being treated by the methods of the invention are patients already being treated with chemotherapy, radiation therapy, hormonal therapy, or biological therapy/immunotherapy. Among these patients are refractory patients and those with cancer despite treatment with existing cancer therapies.
- the patients have been treated and have no disease activity and one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention are administered to prevent the recurrence of cancer.
- the existing therapy is chemotherapy.
- the existing therapy includes administration of chemotherapies including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, cisplatin, carboplatin, mitomycin, dacarbazine, procarbizine, etoposides, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, asparaginase, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, etc.
- chemotherapies including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine
- the invention also encompasses methods for treating or managing patients undergoing or having undergone radiation therapy.
- patients being treated or previously treated with chemotherapy, hormonal therapy and/or biological therapy/immunotherapy.
- patients who have undergone surgery for the treatment of cancer.
- the invention encompasses methods for treating patients undergoing or having undergone hormonal therapy and/or biological therapy/immunotherapy. Among these are patients being treated or having been treated with chemotherapy and/or radiation therapy. Also among these patients are those who have undergone surgery for the treatment of cancer.
- the invention also provides methods of treatment or management of cancer as an alternative to chemotherapy, radiation therapy, hormonal therapy, and/or biological therapy/immunotherapy where the therapy has proven or may prove too toxic, i.e., results in unacceptable or unbearable side effects, for the subject being treated.
- the subject being treated with the methods of the invention may, optionally, be treated with other cancer therapies such as surgery, chemotherapy, radiation therapy, hormonal therapy or biological therapy, depending on which therapy was found to be unacceptable or unbearable.
- the invention provides administration of one or more
- Listeria-based EphA2 immunogenic compositions of the invention without any other cancer therapies for the treatment of cancer, but who have proved refractory to such treatments.
- patients refractory to other cancer therapies are administered one or more EphA2 immunogenic compositions in the absence of cancer therapies.
- patients with a pre-cancerous condition associated with cells that overexpress EphA2 can be administered immunogenic compositions of the invention to treat the disorder and decrease the likelihood that it will progress to malignant cancer.
- the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
- the hyperproliferative disorder prevented, treated and/or managed in accordance with the methods of the invention is a non-neoplastic hyperproliferative disorder, in particular, a non-neoplastic disorder associated with EphA2 overexpression.
- non-limiting examples of such disorders include asthma, chromic obstructive pulmonary disorder (COPD), fibrosis ⁇ e.g., lung, kidney, heart and liver fibrosis), restenosis (smooth muscle and/or endothelial), psoriasis, etc.
- COPD chromic obstructive pulmonary disorder
- fibrosis ⁇ e.g., lung, kidney, heart and liver fibrosis
- restenosis smooth muscle and/or endothelial
- psoriasis etc.
- These methods include methods analogous to those described above for treating, preventing and managing cancer, for example, by administering the EphA2 immunogenic compositions of the invention, combination therapy (see, e.g., Section 5.6.3, infra, for examples of other therapies to administer in combination with the EphA2 immunogenic compositions to a subject to treat, prevent or manage a hyperproliferative disorder other than cancer), administration to patients refractory to particular treatments, etc. 5.6.1.2. Cancers
- Cancers and related disorders that can be treated, prevented, or managed by methods and compositions of the present invention include, but are not limited to, cancers of an epithelial cell origin and/or an endothelial origin and cancers and related disorders that are characterized by overexpression of EphA2.
- cancers include the following: leukemias, such as but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias, such as, myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia leukemias and myelodysplastic syndrome; chronic leukemias, such as but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as but not limited to Hodgkin's disease, non-Hodgkin's disease; multiple myelomas such as but not limited to smoldering multiple myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma; Waldenstrom
- cancers include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma and papillary adenocarcinomas (for a review of such disorders, see Fishman et al., 1985, Medicine, 2d Ed., J-B. Lippincott Co., Philadelphia and Murphy eial., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A., Inc., United States of America).
- carcinoma including that of the bladder, breast, colon, kidney, liver, lung, ovary, pancreas, stomach, cervix, thyroid and skin; including squamous cell carcinoma; hematopoietic tumors of lymphoid lineage, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T cell lymphoma, Burkitt's lymphoma; hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias and promyelocytic leukemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyoscarcoma; other tumors, including melanoma, seminoma, tetratocarcinoma, neuro
- cancers caused by aberrations in apoptosis would also be treated by the methods and compositions of the invention.
- Such cancers may include but not be limited to follicular lymphomas, carcinomas with p53 mutations, hormone dependent tumors of the breast, prostate and ovary, and precancerous lesions such as familial adenomatous polyposis, and myelodysplastic syndromes.
- malignancy or dysproliferative changes (such as metaplasias and dysplasias), or hyperproliferative disorders, are treated or prevented in the skin, lung, colon, breast, prostate, bladder, kidney, pancreas, ovary, or uterus.
- sarcoma, melanoma, or leukemia is treated or prevented.
- the cancer is malignant and overexpresses EphA2.
- the disorder to be treated is a pre-cancerous condition associated with cells that overexpress EphA2.
- the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
- the mediods and compositions of the invention are used for the treatment and/or prevention of breast, ovarian, esophageal, colon, ovarian, lung, and prostate cancers and melanoma and are provided below by example rather than by limitation.
- the methods and compositions of the invention are used for the treatment and/or prevention of cancers of T cell origin, including, but not limited to, leukemias and lymphomas.
- kits for treating breast cancer are administered an effective amount of one or more Liste ⁇ -based EphA2 immunogenic compositions of the invention.
- the Listeria-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for breast cancer therapy including but not limited to: doxorubicin, epirubicin, the combination of doxorubicin and cyclophosphamide (AC), the combination of cyclophosphamide, doxorubicin and 5-fluorouracil (CAF), the combination of cyclophosphamide, epirubicin and 5-fluorouracil (CEF), her-2 antibodies, e.g.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention can be administered with taxanes plus standard doxorubicin and cyclophosphamide for adjuvant treatment of node-positive, localized breast cancer.
- patients with pre-cancerous fibroadenoma of the breast or fibrocystic disease are administered a Listeri ⁇ -based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant breast cancer.
- patients refractory to treatment are administered a Listeri ⁇ -based EphA2 immunogenic composition of the invention to treat the cancer and/or render the patient non-refractory or responsive.
- patients with colon cancer are administered an effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for colon cancer therapy including but not limited to: AVASTINTM (bevacizumab), the combination of 5-FU and leucovorin, the combination of 5-FU and levamisole, irinotecan (CPT-Il) or the combination of irinotecan, 5-FU and leucovorin (IFL).
- patients with prostate cancer are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention.
- the Listeri ⁇ -based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for prostate cancer therapy including but not limited to: external- beam radiation therapy, interstitial implantation of radioisotopes (Le., I , palladium, iridium), leuprolide or other LHRH agonists, non-steroidal antiandrogens (flutamide, nilutamide, bicalutamide), steroidal antiandrogens (cyproterone acetate), the combination of leuprolide and flutamide, estrogens such as DES, chlorotrianisene, ethinyl estradiol, conjugated estrogens U.S.
- DES-diphosphate radioisotopes, such as strontium-89, the combination of external-beam radiation therapy and strontium-89, second-line hormonal therapies such as aminoglutethimide, hydrocortisone, flutamide withdrawal, progesterone, and ketoconazole, low-dose prednisone, or other chemotherapy regimens reported to produce subjective improvement in symptoms and reduction in PSA level including docetaxel, paclitaxel, estramustine/docetaxel, estramustine/etoposide, estramustine/vinblastine, and estramustine/paclitaxel.
- second-line hormonal therapies such as aminoglutethimide, hydrocortisone, flutamide withdrawal, progesterone, and ketoconazole, low-dose prednisone, or other chemotherapy regimens reported to produce subjective improvement in symptoms and reduction in PSA level including docetaxel, paclitaxel, estramustine/docetaxel, estramustine/etoposide, estram
- patients with pre-cancerous high-grade prostatic intraepithelial neoplasia are administered a Listeri ⁇ -based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant prostate cancer.
- patients with melanoma are administered an effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention.
- the Zisf ⁇ rz ' iz-based E ⁇ hA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for melanoma cancer therapy including but not limited to: dacarbazine (DTIC), nitrosoureas such as carmustine (BCNU) and lomustine (CCNU), agents with modest single agent activity including vinca alkaloids, platinum compounds, and taxanes, the Dartmouth regimen (cisplatin, BCNU, and DTIC), interferon alpha (IFN- ⁇ ), and interleukin-2 (IL-2).
- DTIC dacarbazine
- BCNU carmustine
- CCNU lomustine
- agents with modest single agent activity including vinca alkaloids, platinum compounds, and taxanes
- the Dartmouth regimen cisplatin, BCNU, and DTIC
- an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention can be administered in combination with isolated hyperthermic limb perfusion (ELP) with melphalan (L-PAM), with or without tumor necrosis factor-alpha (TNF- ⁇ ) to patients with multiple brain metastases, bone metastases, and spinal cord compression to achieve symptom relief and some shrinkage of the tumor with radiation therapy.
- ELP hyperthermic limb perfusion
- L-PAM melphalan
- TNF- ⁇ tumor necrosis factor-alpha
- patients with pre-cancerous compound nevi are administered a Listeri ⁇ -based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant melanoma.
- patients with ovarian cancer are administered an effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention.
- the L/srer/ ⁇ -based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for ovarian cancer therapy including but not limited to: intraperitoneal radiation therapy, such as P 32 therapy, total abdominal and pelvic radiation therapy, cisplatin, the combination of paclitaxel (Taxol) or docetaxel (Taxotere) and cisplatin or carboplatin, the combination of cyclophosphamide and cisplatin, the combination of cyclophosphamide and carboplatin, the combination of 5-FU and leucovorin, etoposide, liposomal doxorubicin, gemcitabine or topotecan.
- intraperitoneal radiation therapy such as P 32 therapy, total abdominal and pelvic radiation therapy
- cisplatin the combination
- an effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention is administered in combination with the administration Taxol for patients with platinum-refractory disease.
- the treatment of patients with refractory ovarian cancer including administration of: ifosfamide in patients with disease that is platinum-refractory, hexamethylmelamine (HMM) as salvage chemotherapy after failure of cisplatin-based combination regimens, and tamoxifen in patients with detectable levels of cytoplasmic estrogen receptor on their tumors.
- HMM hexamethylmelamine
- patients with small lung cell cancer are administered an effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention.
- the Lwrer/ ⁇ -based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for lung cancer therapy including but not limited to: thoracic radiation therapy, cisplatin, vincristine, doxorubicin, and etoposide, alone or in combination, the combination of cyclophosphamide, doxorubicin, vincristine/etoposide, and cisplatin (CAV/EP), local palliation with endobronchial laser therapy, endobronchial stents, and/or brachytherapy.
- CAV/EP cisplatin
- patients with non-small lung cell cancer are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with an effective amount of one or more other agents useful for lung cancer therapy including but not limited to: palliative radiation therapy, the combination of cisplatin, vinblastine and mitomycin, the combination of cisplatin and vinorelbine, paclitaxel, docetaxel or gemcitabine, the combination of carboplatin and paclitaxel, interstitial radiation therapy for endobronchial lesions or stereotactic radiosurgery.
- patients with T cell malignancies are administered an effective amount of one or more Listeri ⁇ - based EphA2 immunogenic compositions of the invention.
- the Lisieri ⁇ -based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for the prevention, treatment or amelioration of cancer, particularly T cell malignancies or one or more symptoms thereof, said combination therapies comprising administering to a subject in need thereof a prophylactically or therapeutically effective amount of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention and a prophylactically or therapeutically effective amount of one or more cancer therapies, including chemotherapies, hormonal therapies, biological therapies, immunotherapies, or radiation therapies.
- patients with T cell malignancies are administered an effective amount of one or more Li steri ⁇ -based EphA2 immunogenic compositions of the invention in combination with one or more cancer chemotherapeutic agents, such as but not limited to: doxorubicin, epirubicin, cyclophosphamide, 5- fluorouracil, taxanes such as docetaxel and paclitaxel, leucovorin, levamisole, irinotecan, estramustine, etoposide, vinblastine, dacarbazine, nitrosoureas such as carmustine and lomustine, vinca alkaloids, platinum compounds, cisplatin, mitomycin, vinorelbine, gemcitabine, carboplatin, hexamethylmelamine and/or topotecan.
- cancer chemotherapeutic agents such as but not limited to: doxorubicin, epirubicin, cyclophosphamide, 5- fluorouracil, taxanes such as
- Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to radiation therapy, biological therapies, hormonal therapies and/or surgery.
- patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with one or more types of radiation therapy, such as external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, indium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy.
- radiation therapy such as external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, indium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy.
- Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to chemotherapies, biological therapies/immunotherapies, hormonal therapies and/or surgery.
- patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with one or more biological therapies/immunotherapies or hormonal therapies, such as tamoxifen, leuprolide or other LHRH agonists, non-steroidal antiandrogens (flutamide, nilutamide, bicalutamide), steroidal antiandrogens (cyproterone acetate), estrogens (DES, chlorotrianisene, ethinyl estradiol, conjugated estrogens U.S.P., DES-diphosphate), aminoglutethimide, hydrocortisone, flutamide withdrawal, progesterone, ketoconazole, prednisone, interferon- ⁇
- Biological therapies also included are cytokines such as but not limited to TNF ligand family members such as TRAIL anti-cancer agonists that induce apoptosis, TRAIL antibodies that bind to TRAIL receptors 1 and 2 otherwise known as DR4 and DR5 (Death Domain Containing Receptors 4 and 5), as well as DR4 and DR5.
- TRAIL and TRAIL antibodies, ligands and receptors are known in the art and described in U.S. Patent Nos. 6,342,363, 6,284,236, 6,072,047 and 5,763,223.
- Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to radiation therapy, chemotherapies, and/or surgery.
- patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with standard and experimental therapies of T cell malignancies.
- Standard and experimental therapies of T cell malignancies that can be used in the methods and compositions of the invention include, but are not limited to, antibody therapy (e.g., Campath®, anti-Tac, HuM291 (humanized murine IgG2 monoclonal antibody against CD3), antibody drug conjugates (e.g., Mylotarg), radiolabeled monoclonal antibodies (e.g., Bexxar, Zevalin, Lym-1)), cytokine therapy, aggressive combination chemotherapy with or without cytotoxic agents, purine analogs, hematopoietic stem cell transplantation, and T cell mediated therapy (e.g., CD8+ T cells with anti-leukemic activity against target antigens including but not limited to leukemia specific proteins (e.g., bcr/abl
- EphA2 is as a marker of angiogenic blood vessels and plays a critical role in angiogenesis or neovascularization (see, e.g. , Ogawa et al. , 2000, Oncogene. 19(52):6043-52; Hess et al, 2001, Cancer Res. 61(8):3250-5).
- Angiogenesis is characterized by the invasion, migration and proliferation of smooth muscle and endothelial cells. The growth of new blood vessels, or angiogenesis, contributes to pathological conditions such as diabetic retinopathy (Adonis et al, 1994, Amer. J.
- the Listeria-based EphA2 immunogenic compositions of the invention may therefore be administered to a subject in need thereof to prevent, manage, treat and/or ameliorate a disorder associated with aberrant angiogenesis or one or more symptoms thereof.
- the present invention encompasses methods for treating, preventing and/or managing disorders associated with aberrant angiogenesis comprising administering to a subject a Iis?er/ ⁇ -based EphA2 immunogenic composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for treating or preventing the disorder.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette.
- the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette.
- the Listeri ⁇ -hased EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono.
- disorders that are associated with or characterized by aberrant angiogenesis and may be prevented, treated, and/or managed with the Listeria-based EphA2 immunogenic compositions of the invention include, but are not limited to, neoplastic diseases (non-limiting examples are metastases of tumors and leukemia); diseases of ocular neovascularization (non-limiting examples are age-related macular degeneration, diabetic retinopathy, and retinopathy of prematurity, vascular restenosis); skin diseases (non-limiting examples are infantile hemangiomas, verruca vulgaris, psoriasis, basal cell and squamous cell carcinomas, cutaneous melanoma, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa); arthritis (non-limiting examples are rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psori
- the disorders that are associated with or characterized by aberrant angiogenesis and that may be prevented, treated and/or managed with the Listeri ⁇ -based EphA2 immunogenic compositions of the invention include chronic articular rheumatism, psoriasis, diabetic retinopathy, neovascular glaucoma, macular degeneration, capillary proliferation in atherosclerotic plaques as well as cancers in which EphA2 is expressed in the vasculature.
- cancer disorders can include, for example, solid tumors, tumor metastasis, angiofibromas, retrolental, fibroplasia, hemangiomas, Kaposi's sarcoma.
- the Listeri ⁇ -based EphA2 immunogenic compositions are employed in combination therapy regimens involving other therapies.
- therapies include analgesics, angiogenesis inhibitors, anticancer therapies and anti-inflammatory agents, in particular analgesics and angiogenesis inhibitors.
- the present invention encompasses methods for treating, managing, and/or preventing a disorder associated with aberrant angiogenesis or a symptom thereof, in a subject comprising administering one or more Listeri ⁇ -based EphA2 immunogenic compositions.
- the methods of the invention comprise the administration of one or more Listeria-based EphA2 immunogenic compositions to patients suffering from or expected to suffer from (e.g., patients with a genetic predisposition for or patients that have previously suffered from) a disorder associated with aberrant angiogenesis.
- the present invention also encompasses methods for treating, managing, and/or preventing a disorder associated with aberrant angiogenesis or a symptom thereof, in a subject, comprising administering to a subject a Listeri ⁇ -based EphA2 immunogenic composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for treating, managing, and/or preventing the disorder.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette.
- the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette.
- the Listeri ⁇ - based EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono.
- a Listeri ⁇ -based EphA2 immunogenic composition may be used as any line of therapy, including, but not limited to, a first, second, third and fourth line of therapy.
- a Listeri ⁇ -based EphA2 immunogenic composition can be used before any adverse effects or intolerance of the Listeri ⁇ -based EphA2 immunogenic composition therapies occurs.
- the invention encompasses methods for administering one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention to prevent the onset or recurrence of a disorder associated with aberrant angiogenesis.
- the invention also provides methods of treatment or management of a disorder associated with aberrant angiogenesis as alternatives to current therapies.
- the current therapy has proven or may prove too toxic (Le., results in unacceptable or unbearable side effects) for the patient.
- the patient has proven refractory to a current therapy, hi such embodiments, the invention provides for the administration of one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention without any other therapies for treating or managing the disorder associated with aberrant angiogenesis.
- one or more Listeri ⁇ -based EphA2 immunogenic compositions of the invention can be administered to a patient in need thereof instead of another therapy to treat or manage a disorder associated with aberrant angiogenesis.
- the present invention also encompasses methods for administering one or more Listeria-based E ⁇ hA2 immunogenic compositions of the invention to treat or ameliorate symptoms of a disorder associated with aberrant angiogenesis in patients that are or have become refractory to non-Listeri ⁇ -based EphA2 immunogenic composition therapies.
- the determination of whether the symptoms are refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a therapy on affected cells in the disorder associated with aberrant angiogenesis, or in patients that are or have become refractory to non-Listeri ⁇ -based EphA2 immunogenic composition therapies.
- therapy by administration of one or more Listeri ⁇ - based EphA2 immunogenic compositions is combined with the administration of one or more therapies such as, but not limited to, chemotherapies, radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies.
- therapies such as, but not limited to, chemotherapies, radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies.
- Prophylactic/therapeutic agents include, but are not limited to, proteinaceous molecules, including, but not limited to, peptides, polypeptides, proteins, including post-translationally modified proteins, peptides etc.; or small molecules (less than 1000 daltons), inorganic or organic compounds; or nucleic acid molecules including, but not limited to, double-stranded or single-stranded DNA, or double-stranded or single-stranded RNA, as well as triple helix nucleic acid molecules.
- Prophylactic/therapeutic agents can be derived from any known organism (including, but not limited to, animals, plants, bacteria, fungi, and protista, or viruses) or from a library of synthetic molecules.
- the Listeri ⁇ -based EphA2 composition is engineered to express two or more EphA2 antigenic peptides.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette.
- the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette.
- the Listeri ⁇ -based E ⁇ hA2 immunogenic composition administered to a subject in need thereof comprises ACtA(NlOO) Exmono Comono.
- the methods of the invention encompass administration of a Listeri ⁇ -based EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents, including antibodies, that are inhibitors of kinases such as, but not limited to, ABL, ACK, AFK, AKT (e.g., AKT-I, AKT-2, and AKT-3), ALK, AMP-PK, ATM, Auroral, Aurora2, bARKl, bArk2, BLK, BMX, BTK, CAK, CaM kinase, CDC2, CDK, CK, COT, CTD, DNA-PK, EGF-R, ErbB-1, ErbB-2, ErbB-3, ErbB-4, ERK (e.g., ERKl, ERK2, ERK3, ERK4, ERK5, ERK6, ERK7), ERT-PK, FAK, FGR (e.g., FGFl
- FGR e.g.,
- a Listeria-b&sed EphA2 immunogenic composition of the invention is administered in combination with the administration of one or more prophylactic/therapeutic agents that are inhibitors of Eph receptor kinases (e.g., EphA2, EphA4).
- an EphA2 immunogenic composition of the invention is administered in combination with the administration of one or more prophylactic/therapeutic agents that are inhibitors of EphA2.
- the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of an E ⁇ hA2 immunodominant epitope.
- the EphA2 immunodominant epitope comprises (or consists of) amino residues 917 to 935.
- the antigenic peptide consists of 8 to 15 amino acids or 12 to 14 amino acids of this epitope.
- the methods of the invention encompass administration of a Listeri ⁇ -based EphA2 immunogenic composition of the invention in combination with the administration of one or more therapeutic antibodies.
- therapeutic antibodies that can be used in methods of the invention include but are not limited to AVASTIN® which is an anti-VEGF antibody; antibodies that immunospecifically bind to EphA2 induce signal transduction (i.e., EphA2 agonistic antibodies); antibodies that immunospecifically bind to EphrinAl; HERCEPTIN® (Trastuzumab) (Genentech, CA) which is a humanized anti-HER2 monoclonal antibody for the treatment of patients with metastatic breast cancer; REOPRO® (abciximab) (Centocor) which is an anti-glycoprotein Ilb/IIIa receptor on the platelets for the prevention of clot formation; ZENAP AX® (daclizumab) (Roche Pharmaceuticals, Switzerland) which is an immunosuppressive, humanized anti
- Campath 1H/LDP-03 which is a humanized anti CD52 IgGl antibody (Leukosite); Smart M195 which is a humanized anti-CD33 IgG antibody (Protein Design Lab/Kanebo); RITUXANTM which is a chimeric anti-CD20 IgGl antibody (H)EC Pharm/Genentech, Roche/Zettyaku); LYMPHOCIDETM which is a humanized anti-CD22 IgG antibody (Immunomedics); LYMPHOCIDETM Y-90 (Immunomedics); Lymphoscan (Tc-99m- labeled; radioimaging; Immunomedics); Nuvion (against CD3; Protein Design Labs); CM3 is a humanized anti-ICAM3 antibody (ICOS Pharm); IDEC-114 is a primatized anti- CD80 antibody (IDEC Pharm/Mitsubishi); ZEVALINTM is a radiolabeled murine anti- CD20 antibody (IDE
- the methods of the invention encompass administration of a Listeria-hasc ⁇ EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents that are angiogenesis inhibitors such as, but not limited to: Angiostatin (plasminogen fragment); antiangiogenic antithrombin III; Angiozyme; ABT-627; Bay 12-9566; Benefin; Bevacizumab (AVASTINTM); BMS-275291; cartilage-derived inhibitor (CDI); CAI; CD59 complement fragment; CEP-7055; Col 3; Combretastatin A-4; Endostatin (collagen XVIII fragment); fibronectin fragment; Gro-beta; Halofuginone; Heparinases; Heparin hexasaccharide fragment; HMV833; Human chorionic gonadotropin (hCG); IM-862; Interferon alpha/beta/gamma; Interferon inducible protein
- angiogenesis inhibitors such as
- the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents that are anti-cancer agents such as, but not limited to: acivicin, aclarubicin, acodazole hydrochloride, acronine, adozelesin, aldesleukin, altretamine, ambomycin, ametantrone acetate, aminoglutethimide, amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azacitidine, azetepa, azotomycin, batimastat, benzodepa, bicalutamide, bisantrene hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, bropirimine, busulfan, cactinomycin
- prophylactic/therapeutic agents
- anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxyvitamin D3, 5-ethynyluracil, abiraterone, aclarubicin, acylfulvene, adecypenol, adozelesin, aldesleukin, ALL-TK antagonists, altretamine, ambamustine, amidox, amifostine, aminolevulinic acid, amrubicin, amsacrine, anagrelide, anastrozole, andrographolide, angiogenesis inhibitors, antagonist D, antagonist G, antarelix, anti-dorsalizing morphogenetic protein- 1, antiandrogens, antiestrogens, antineoplaston, aphidicolin glycinate, apoptosis gene modulators, apoptosis regulators, apurinic acid, ara-CDP-DL-PTBA, arginine deaminase, asula
- the present invention also comprises the administration of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with the administration of one or more therapies such as, but not limited to anti-cancer agents such as those disclosed in Table 5 below, preferably for the treatment of breast, ovary, melanoma, prostate, colon and lung cancers as described above.
- therapies such as, but not limited to anti-cancer agents such as those disclosed in Table 5 below, preferably for the treatment of breast, ovary, melanoma, prostate, colon and lung cancers as described above.
- the invention also encompasses administration of the Listeria-based
- EphA2 immunogenic compositions of the invention in combination with radiation therapy comprising the use of x-rays, gamma rays and other sources of radiation to destroy the cancer cells.
- the radiation treatment is administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source.
- the radiation treatment is administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass.
- the methods of the invention encompass administration of a Listeri ⁇ -based EphA2 immunogenic composition of the invention in combination with the administration of one or more anti- inflammatory agents.
- anti-inflammatory agents include non-steroidal antiinflammatory drugs (NS ADDs), steroidal anti-inflammatory drugs, anticholinergics (e.g., atropine sulfate, atropine methylnitrate, and ipratropium bromide (ATRO VENTTM)), beta2-agonists (e.g., abuterol (VENTOLINTM and PROVENTILTM), bitolterol (TORNALATETM), levalbuterol (XOPONEXTM), metaproterenol (ALUPENTTM), pirbuterol (MAXAIRTM), terbutlaine (BRETHAIRETM and BRETHINETM), albuterol (PROVENTILTM, REPETABSTM, and VOLMAXTM), forraoterol (FORADEL AEROLIZERTM), and salmeterol (SEREVENTTM
- NORDs non-steroidal antiinflammatory drugs
- anticholinergics e.g., atropine sulfate, atropine methylnitrate
- NSAIDs include, but are not limited to, aspirin, ibuprofen, celecoxib (CELEBREXTM), diclofenac (VOLTARENTM), etodolac (LODINETM), fenoprofen (NALFONTM), indomethacin (INDOCESfTM), ketoralac (TORADOLTM), oxaprozin (DAYPROTM), nabumentone (RELAFENTM), sulindac (CLINORBLTM), tolmentin (TOLECTINTM), rofecoxib (VIOXXTM), naproxen (ALEVETM,
- NAPROSYN 1 "), ketoprofen (ACTRONTM) and nabumetone (RELAFENTM).
- NSAEDs function by inhibiting a cyclooxgenase enzyme (e.g., COX-I and/or COX-2).
- steroidal anti-inflammatory drugs include, but are not limited to, glucocorticoids, dexamethasone (DECADRONTM), corticosteroids ⁇ e.g., methylprednisolone (MEDROLTM)), cortisone, hydrocortisone, prednisone (PREDNISONETM and DELTASONETM), prednisolone (PRELONETM and PEDIAPREDTM), triamcinolone, azulfidine, and inhibitors of eicosanoids (e.g., prostaglandins, thromboxanes, and leukotrienes ⁇ see Table 6, infra, for non-limiting examples of leukotriene and typical dosages of such agents)).
- DECADRONTM dexamethasone
- MEDROLTM corticosteroids ⁇ e.g., methylprednisolone (MEDROLTM)
- cortisone hydrocortisone
- prednisone PREDNI
- the anti-inflammatory agent is an agent useful in the prevention, management, treatment, and/or amelioration of asthma or one or more symptoms thereof.
- agents include adrenergic stimulants ⁇ e.g., catecholamines ⁇ e.g., epinephrine, isoproterenol, and isoetharine), resorcinols ⁇ e.g., metaproterenol, terbutaline, and fenoterol), and saligenins ⁇ e.g., salbutamol)), adrenocorticoids, blucocorticoids, corticosteroids (e.g., beclomethadonse, budesonide, flunisolide, fluticasone, triamcinolone, methylprednisolone, prednisolone, and prednisone), other steroids, beta2-agonists (e.g., albuterol, bitolterol), other steroids, beta2-agonists (e.g.
- C3 receptor antagonists including antibodies
- immunosuppressant agents e.g., methotrexate and gold salts
- mast cell modulators e.g., cromolyn sodium (INT ALTM) and nedocromil sodium (PELADETM)
- mucolytic agents e.g., acetylcysteine
- the anti-inflammatory agent is a leukotriene inhibitor (e.g., montelukast (SINGULAIRTM), zafirlukast (ACCOLATETM), pranlukast (ONONTM), or zileuton (ZYFLOTM) (see Table 6)).
- a leukotriene inhibitor e.g., montelukast (SINGULAIRTM), zafirlukast (ACCOLATETM), pranlukast (ONONTM), or zileuton (ZYFLOTM) (see Table 6).
- the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of one or more immunomodulatory agents.
- An example of an immunomodulatory agent is cyclophosphamide.
- Cancer therapies as well as therapies for hyperproliferative cell disorders other than cancer and their dosages, routes of administration and recommended usage are known in the art and have been described in such literature as the Physician's Desk Reference (56th ed., 2002, 57th ed., 2003, and 58th ed., 2004).
- compositions of the invention include bulk drug compositions useful in the manufacture of non-pharmaceutical compositions (e.g., impure or non-sterile compositions) and pharmaceutical compositions (Le., compositions that are suitable for administration to a subject or patient) which can be used in the preparation of unit dosage forms.
- Such compositions comprise a prophylactically or therapeutically effective amount of a prophylactic and/or therapeutic agent disclosed herein or a combination of those agents and a pharmaceutically acceptable carrier.
- compositions of the invention comprise a prophylactically or therapeutically effective amount of one or more Listeria engineered to express one, two, three or more EphA2 antigenic peptides.
- the pharmaceutical compositions are immunogenic compositions.
- the Listeria-based EphA2 immunogenic compositions of the invention may comprise one, two or more EphA2 antigenic peptide-expressing Listeria and a pharmaceutically acceptable carrier.
- the Listeria-based EphA2 immunogenic composition of the invention comprises the species Listeria monocytogenes.
- the Listeria strain is attenuated.
- the immunogenic composition is a vaccine.
- the Listeria-based EphA2 immunogenic compositions of the invention comprise the Listeria monocytogenes strain ActA(N100)ExmonoComono (Le., MEDI-543).
- a composition of the invention comprises a Listeria-based EphA2 immunogenic composition and an additional prophylactic or therapeutic, e.g., anti-cancer, agent.
- the composition may further comprise a pharmaceutically acceptable carrier.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- carrier refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete) or, more preferably, MF59C.1 adjuvant available from Chiron, Emeryville, CA), excipient, or vehicle with which the therapeutic is administered.
- adjuvant e.g., Freund's adjuvant (complete and incomplete) or, more preferably, MF59C.1 adjuvant available from Chiron, Emeryville, CA
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
- Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
- Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
- the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
- compositions of the invention are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
- the composition is provided as a frozen liquid.
- the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
- an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
- compositions of the invention can be formulated as neutral or salt forms.
- Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, hist ⁇ dine, procaine, etc.
- Various delivery systems are known and can be used to administer a
- Listeria-based EphA2 immunogenic composition of the invention or the combination of a Listeria-based EphA2 immunogenic composition of the invention and a prophylactic agent or therapeutic agent useful for preventing or treating cancer, e.g., encapsulation in liposomes, microparticles, microcapsules, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, /. Biol. Chem. 262:4429-4432), etc.
- a prophylactic agent or therapeutic agent useful for preventing or treating cancer, e.g., encapsulation in liposomes, microparticles, microcapsules, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, /. Biol. Chem. 262:4429-4432), etc.
- Methods of administering a Listeri ⁇ - based EphA2 immunogenic composition or the combination of a Zi-s/emz-based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal, inhaled, and oral routes).
- parenteral administration e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous
- epidural e.g., epidural
- mucosal e.g., intranasal, inhaled, and oral routes.
- a Listeri ⁇ -based EphA2 immunogenic composition of the invention or the combination of a Listeri ⁇ -based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent are administered intramuscularly, intravenously, or subcutaneously.
- the Listeri ⁇ -based EphA2 immunogenic composition of the invention or the combination of a Listeri ⁇ -based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
- the Listeri ⁇ - based EphA2 immunogenic composition of the invention may be desirable to administer the Listeri ⁇ - based EphA2 immunogenic composition of the invention or the combination of a Listeri ⁇ - based EphA2 immunogenic composition of the invention and other prophylactic or therapeutic agents of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
- the Listeri ⁇ -based E ⁇ hA2 immunogenic composition of the invention or the combination of a Listeri ⁇ -based EphA2 immunogenic composition of die invention and prophylactic or therapeutic agent can be delivered in a controlled release or sustained release system.
- a pump may be used to achieve controlled or sustained release (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald etal., 1980, Surgery 88:507; Saudek et ah, 1989, N. Engl. J. Med. 321:574).
- polymeric materials can be used to achieve controlled or sustained release of the EphA2 antigenic peptide-expressing Listeria of the invention (see e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, FL (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. ScL Rev. Macromol. Chem. 23:61; see also Levy etaL, 1985, Science 228:190; During et al., 1989, Ann. Neurol 25:351; Howard et al, 1989, J. Neurosurg. 7 1:105); U.S. Patent Nos. 5,679,377; 5,916,597; 5,912,015; 5,989,463; 5,128,326;
- polymers used in sustained release formulations include, but are not limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), poly( vinyl alcohol), polyacrylamide, poly(ethylene glycol), polylactides (PLA), polyflactide-co-glycolides) (PLGA), and polyorthoesters.
- the polymer used in a sustained release formulation is inert, free of leachable impurities, stable on storage, sterile, and biodegradable.
- a controlled or sustained release system can be placed in proximity of the prophylactic or therapeutic target, thus requiring only a fraction of the systemic dose ⁇ see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
- Immunogenic compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
- the EphA2 antigenic peptide-expressing Listeria of the invention and their physiologically acceptable salts and solvates be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, parenteral or mucosal (such as buccal, vaginal, rectal, sublingual) administration.
- parenteral or mucosal such as buccal, vaginal, rectal, sublingual
- local or systemic parenteral administration is used.
- the Lister / ⁇ -based EphA2 immunogenic composition may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
- binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
- fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
- lubricants e.g., magnesium stearate, talc or silica
- Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
- the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
- compositions for oral administration may be suitably formulated to give controlled release of the active compound.
- compositions for buccal administration may take the form of tablets or lozenges formulated in conventional manner.
- the prophylactic or therapeutic agents for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the Listeria-based EphA2 immunogenic composition may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- the immunogenic compositions of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
- the prophylactic or therapeutic agents may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
- the prophylactic or therapeutic agents may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- suitable polymeric or hydrophobic materials for example as an emulsion in an acceptable oil
- ion exchange resins for example, as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- the invention also provides that a Listeria-based EphA2 immunogenic composition of the invention is packaged in a hermetically sealed container such as an ampoule or sachette indicating die quantity.
- the immunogenic composition is supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water or saline to the appropriate concentration for administration to a subject.
- the formulation and administration of various chemotherapeutic, biological/immunotherapeutic and hormonal therapeutic agents for use in combination with the immunogenic composition of the invention are known in the art and often described in the Physician's Desk Reference, (56 th ed. 2002).
- the agents can be formulated and supplied as provided in Table 5.
- radiation therapy agents such as radioactive isotopes can be given orally as liquids in capsules or as a drink. Radioactive isotopes can also be formulated for intravenous injections. The skilled oncologist can determine the preferred formulation and route of administration.
- the EphA2 antigenic peptide-expressing Listeria of the invention are formulated at 1 mg/ml, 5 mg/ml, 10 mg/ml, and 25 mg/ml for intravenous injections and at 5 mg/ml, 10 mg/ml, and 80 mg/ml for repeated subcutaneous administration and intramuscular injection.
- the EphA2 antigenic peptide-expressing Listeria of the invention are formulated at amounts ranging between approximately IxIO 2 CFU/ml to approximately IxIO 12 CFU/ml, for example at IxIO 2 CFU/ml, 5xlO 2 CFU/ml, IxIO 3 CFU/ml, 5xlO 3 CFU/ml, IxIO 4 CFU/ml, 5xlO 4 CFU/ml, IxIO 5 CFU/ml, 5xlO 5 CFU/ml, IxIO 6 CFU/ml, 5xlO 6 CFU/ml, IxIO 7 CFU/ml, 5xlO 7 CFU/ml, IxIO 8 CFU/ml, 5xlO 8 CFU/ml, IxIO 9 CFU/ml, 5xlO 9 CFU/ml, IxIO 10 CFU/ml, 5xlO 10 CFU/ml, lxlO 11 CFU/ml
- compositions may, if desired, be presented in a pack or dispenser device that may contain one or more unit dosage forms containing the active ingredient.
- the pack may for example comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the amount of the composition of the invention which will be effective in the treatment, prevention or management of cancer can be determined by standard research techniques.
- the dosage of the Listeria-based EphA2 immunogenic composition of the invention which will be effective in the treatment, prevention or management of cancer can be determined by administering the composition to an animal model such as, e.g., the animal models disclosed herein or known to those skilled in the art.
- in vitro assays may optionally be employed to help identify optimal dosage ranges.
- Selection of the preferred effective dose can be determined (e.g. , via clinical trials) by a skilled artisan based upon the consideration of several factors which will be known to one of ordinary skill in the art. Such factors include the disease to be treated or prevented, the symptoms involved, the patient's body mass, the patient's immune status and other factors known by the skilled artisan to reflect the accuracy of administered pharmaceutical compositions.
- the dosage is based on the amount colony forming units (c.f.u.).
- the dosage ranges are from about 1.0 c.f.u./kg to about 1 x 10 10 ci.u ⁇ g; from about 1.0 c.f.uJkg to about 1 x 10 8 c.f.uAg; from about 1 x 10 2 c.f.u./kg to about 1 x 10 8 c.f.u./kg; and from about 1 x 10 4 c.f.uAg to about 1 x 10 8 c.f.u./kg.
- a single dose of the composition or vaccine comprises from about 1 x 10 3 CFU/kg to about 1 x 10 8 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises from about 1 x 10 4 CFU/kg to about 1 x 10 7 CFU/kg. In some embodiments, a single dose of the composition comprises at least about 1 CFU/kg. In some embodiments, a single dose of the composition comprises at least about 10 CFU/kg. In another embodiment, a single dose of the composition or vaccine comprises at least about 1 x 10 2 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises at least about 1 x 10 3 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises from at least about 1 x 10 4 CFU/kg.
- the proper (Le., effective dosage amount for one host, such as a human) can be extrapolated from the LD50 data for another host, such as a mouse, using methods known to those in the art.
- the dosage ranges are 0.001-fold to 10,000-fold of the murine LD 50 , 0.01-fold to 1,000-fold of the murine LD 50 , 0.1 -fold to 500-fold of the murine LD 50 , 0.5-fold to 250-fold of the murine LD50, 1-fold to 100-fold of the murine LD5 0 , and 5-fold to 50-fold of the murine LD5 0 .
- the dosage ranges are 0.00.1 -fold, 0.01-fold, 0.1- fold, 0.5-fold, 1-fold, 5-fold, 10-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1,000-fold,
- mice 5,000-fold or 10,000-fold of the murine LD 50 .
- Dosages found to be effective mice include 1 x 10 3 , 5 x 10 3 , 5 x 10 4 , 1 x 10 5 , 5 x 10 5 , 5 x 10 6 , 1 x 10 7 , and 5 x 10 7 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 n CFU, 5 x 10" CFU or 1O 32 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 1 ' CFU, 5 x 10 11 CFU or 10 12 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 11 CFU, 5 x 10 u CFU or 10 12 CFU.
- the composition can be administered at about 10 3 CFU, 5 x 10 3 CFU, 10 4 CFU, 5 x 10 4 CFU, 10 5 CFU, 5 x 10 5 CFU, 10 6 CFU, 5 x 10 6 CFU, 10 7 CFU, 5 x 10 7 CFU, 10 8 CFU, 5 x 10 8 CFU, 10 9 CFU, 5 x 10 9 CFU, 10 10 CFU, 5 x 10 10 CFU, 10 11 CFU, 5 x 10 u CFU or 10 12 CFU.
- the dosage is an absolute amount.
- the dosage is converted to an appropriate dosage for a human based on the specified dosages used in a mouse model.
- a single dose of the immunogenic composition comprises from about 10 2 to about 10 12 of the bacterial organisms. In another embodiment, a single dose comprises from about 10 5 to about 10 H of the bacterial organisms. In another embodiment, a single dose comprises from about 10 6 to about l ⁇ " of the bacterial organisms. Ih still another embodiment, a single dose of the pharmaceutical composition or vaccine comprises from about 10 7 to about 10 10 of the bacterial organisms. In still another embodiment, a single dose of the pharmaceutical composition or vaccine comprises from about 10 7 to about 10 9 of the bacterial organisms. [00435] For other cancer therapeutic agents administered to a patient, the typical doses of various cancer therapeutics known in the art are provided in Table 5.
- certain preferred embodiments will encompass the administration of lower dosages in combination treatment regimens than dosages recommended for the administration of single agents.
- the invention provides for any method of administrating lower doses of known prophylactic or therapeutic agents than previously thought to be effective for the prevention, treatment, management or amelioration of cancer.
- lower doses of known anti-cancer therapies are administered in combination with lower doses of Listeria- based EphA2 immunogenic compositions of the invention.
- the Listeria immunogenic compositions of the invention can be used to produce antibodies which can be used in diagnostic immunoassays, passive immunotherapy, and generation of antiidiotypic antibodies.
- an attenuated Listeria bacterium comprising one or more EphA2 antigenic peptides can be administered to a subject (e.g., a human) to generate antibodies which can then be isolated and used in diagnostic assays, passive immunotherapy and generation of antiidiotypic antibodies.
- the generated antibodies may be isolated by standard techniques known in the art (e.g., immunoaffinity chromatography, centrifugation, precipitation, etc.) and used in diagnostic immunoassays, passive immunotherapy and generation of antiidiotypic antibodies.
- the isolated antibodies before being used in passive immunotherapy may be modified, e.g., the antibodies may be chimerized or humanized. See, e.g., U.S. Patent Nos. 4,444,887 and 4,716,111; and International Publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety, for reviews on the generation of chimeric and humanized antibodies.
- the antibodies isolated from subjects administered an Listeria immunogenic composition of the invention may also be used to monitor efficacy of a therapy(ies) and/or disease progression.
- Any immunoassay system known in the art may be used for diagnosis of disease, monitoring the efficacy of a therapy(ies) and/or assessing or monitoring disease progression including but not limited to competitive and noncompetitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assays), "sandwich” immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, proteinA immunoassays and Immunoelectrophoresis assays, to name but a few.
- the antibodies generated by the Listeria bacteria of the invention can also be used in the production of antiidiotypic antibody.
- the antiidiotypic antibody can then in turn be used for immunization, in order to produce a subpopulation of antibodies that bind the initial antigen, i.e., EphA2 (Jerne, 1974, Ann. Immunol. (Paris) 125c:373; Jerne et al., 1982, EMBO J. 1:234).
- Listeria cells generated to express one or more EphA2 antigenic peptides can be screened for the correct EphA2 inserts by PCR and secretion confirmed by Western blot of TCA-precipitated culture supernatants.
- Bacteria are removed from cultures by centrifugation and 3 mL TCA are added to culture supernatants. Precipitations are performed overnight at 4°C, and protein precipitates are collected by centrifugation. Pellets are washed 5 times with acetone and then air-dried.
- Pellets are resuspended in TE containing phenol red and neutralized with NH4OH. Proteins are electrophoresed on NuPAGE 7% Tris-acetate gel (Invitrogen Corp.) and are transferred to nitrocellulose. The correct EphA2 fragment can be detected with an antibody that immunospecifically binds to the EphA2 fragment. See also section 6.10 (Example 10).
- Toxicity and efficacy of the prophylactic and/or therapeutic protocols of the instant invention can be determined by standard pharmaceutical procedures in experimental animals, e.g. , for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED50.
- Prophylactic and/or therapeutic agents that exhibit large therapeutic indices are preferred. While prophylactic and/or therapeutic agents that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- Biological activity can be measured in ELISPOT and ICS assays as described in Sections 5.5.3 and 5.54. Other suitable assays are shown below.
- the level of cytokine secretion by the spleen cells of mice can be assessed for control and vaccinated C57B1/6 mice. Spleen cells are stimulated for 24 hours with SL8 or LLOigo. Stimulation with irrelevant peptide HSV-gB2 (Invitrogen) is used as a control. The supernatants of the stimulated cells are collected and the levels of T helper- 1 and T helper 2 cytokines are determined using an ELISA assay (eBiosciences, CO) or a Cytometric Bead Array Kit (Pharmingen).
- Listeria cells can be further evaluated by assessing their cytotoxic activity, either in vitro or directly in C57B1/6 mouse in vivo.
- the CD8+ T cells recognize and lyse their respective target cells in an antigen-specific manner.
- In vitro cytotoxicity is determined using a chromium release assay.
- Spleen cells of nave and Listeria-OVA (internal) vaccinated mice are stimulated at a 10:1 ratio with either irradiated EG7.OVA cells (EL-4 tumor cell line transfected to express OVA, ATCC, Manassas, Va.) or with 100 nM SL8, in order to expand the OVA specific T cells in the spleen cell population.
- the cytotoxic activity of the effector cells is determined in a standard 4-hour 51Cr-release assay using EG7.OVA or SL8 pulsed EL-4 cells (ATCC, Manassas, Va.) as target cells and EL-4 cells alone as negative control.
- the YAC-I cell line (ATCC, Manassas, Va.) is used as targets to determine NK cell activity, in order to distinguish the activity due to T cells from that due to NK cells.
- the percentage of specific cytotoxicity is calculated as 100 % (experimental release-spontaneous release)/(maximal release-spontaneous release).
- Spontaneous release is determined by incubation of target cells without effector cells. Maximal release is determined by lysing cells with 0.1% Triton X-100. Experiments are considered valid for analysis if spontaneous release is ⁇ 20% of maximal release.
- spleen cells from naive C57B1/6 mice are split into two equivalent aliquots. Each group is pulsed with a specific peptide, either target or control, at 0.5 ⁇ g/ml for 90 minutes at 37°C. Cells are then washed 3 times in medium, and twice in PBS+0.1% BSA. Cells are resuspended at 1 x 10 7 per ml in warm PBS+0.1% BSA (10 ml or less) for labeling with carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes, Eugene, OR).
- CFSE carboxyfluorescein diacetate succinimidyl ester
- a 5 mM stock of CFSE is added and the sample mixed by vortexing.
- a ten-fold dilution of the CFSE stock is added and the sample mixed by vortexing.
- the cells are incubated at 37°C for 10 minutes. Staining is stopped by addition of a large volume (>40 ml) of ice-cold PBS. The cells are washed twice at room temperature with PBS, then resuspended and counted.
- Each cell suspension is diluted to 50 x 10 6 per ml, and 100 ⁇ L of each population is mixed and injected via the tail vein of either nave or vaccinated mice.
- the spleens are harvested and a total of 5 x 10 6 cells are analyzed by flow cytometry.
- the high (target) and low (control) fluorescent peaks are enumerated, and the ratio of the two is used to establish the percentage of target cell lysis.
- the in vivo cytotoxicity assay permits the assessment of lytic activity of antigen-specific T cells without the need of in vitro re- stimulation. Furthermore, this assays assesses the T cell function in their native environment.
- the data obtained from the animal studies can be used in formulating a range of dosage of the prophylactic and/or therapeutic agents for use in humans.
- the dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i-e-, the concentration of the immunogenic composition or test compound that achieves a half- maximal inhibition of symptoms) as determined in animal studies. Such information can be used to more accurately determine useful doses in humans.
- the anti-cancer activity of the therapies used in accordance with the present invention also can be determined by using various experimental animal models for the study of cancer, such as an immunocompetent mouse model, e.g., Balb/c or C57 ⁇ B1/6, or transgenic mice where a mouse EphA2 is replaced with the human EphA2, mouse models to which murine tumor cell lines engineered to express human EphA2 are administered, animal models described in Section 6 infra, or any animal model (including hamsters, rabbits, etc.) known in the art and described in Relevance of Tumor Models for Anticancer Drug Development (1999, eds.
- mouse corneal angiogensis assays may be performed (see, e.g., Cheng et al., MoI. Cancer Res., 2002, 1:2-11 and Kenyon et al., 1996, Invest. Ophthalmol. Vis. ScL 37:1625-1632).
- hydron pellents containing sucralfate with either vehicle alone (PBS or IgG) or an angiogenic factor (e.g., bFGF, VEGF) are surgically implanted into corneal micropockets created 1 mm to the lateral corneal limbus of a mouse (e.g., C57/BL6; The Jackson
- corneas are photographed at an incipient angle of 35-50° from the polar axis in the meridian containing the pellet, using a Zeiss split lamp.
- VA fraction of the total corneal image that is vascularized
- RVD vascularized region
- TVD total corneal image
- the degree of angiogenesis observed in the eyes of animals administered the Listeria-based EphA2 immunogenic compositions can be compared to the degree of angiogenesis observed in the eyes of animals administered with a placebo.
- compositions of the invention for use in therapy can be tested in other suitable animal model systems prior to testing in humans, including but not limited to in rats, mice, chicken, cows, monkeys, rabbits, hamsters, etc., for example, the animal models described above. The compounds can then be used in the appropriate clinical trials.
- any assays known to those skilled in the art can be used to evaluate the prophylactic and/or therapeutic utility of the combinatorial therapies disclosed herein for treatment or prevention of cancer.
- the invention provides a pack or kit comprising one or more containers filled with a Listeria-based EphA2 immunogenic composition of the invention or a component of a Listeri ⁇ -based EphA2 immunogenic composition of the invention.
- the Listeri ⁇ -based EphA2 composition is engineered to express two or more EphA2 antigenic peptides.
- the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette.
- the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette.
- the EphA2- expressing Listeria incorporated in the kits is ActA(N100) Exmono Comono.
- one or more other prophylactic or therapeutic agents useful for the treatment of a cancer or other hyperproliferative disorder can also be included in the pack or kit.
- Optionally associated with such containers can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
- kits that can be used in the above methods.
- a kit comprises one or more a Listeria-based EphA2 immunogenic compositions of the invention.
- a kit further comprises one or more other prophylactic or therapeutic agents useful for the treatment of cancer or another hyperproliferative disorder, in one or more containers.
- the prophylactic or therapeutic agent is a biological or hormonal therapeutic.
- EphA2 The receptor tyrosine kinase EphA2 is selectively over-expressed in a variety of malignant cell types and tumors. Additionally, recent studies have identified patient-derived T lymphocytes that recognize EphA2. As such, EphA2 provides a much- needed target for active immunotherapy.
- Listeria monocytogenes Listeria
- Listeria infects critical antigen presenting cells and thereby provides efficacy as a cancer therapy based its ability to induce potent and robust CD4+ and CD8+ T cell responses against encoded antigens.
- Attenuated Listeria mutant strains which retain the antigen delivery potency of wild-type bacteria, yet are nearly 10,000-fold less pathogenic in mice, were employed.
- Listeria actA " strains were engineered to express the extracellular (ECD) or intracellular (ICD) domain of human EphA2 (actA-hEphA2-ECD or actA-hEphA2-ICD). Expression and secretion of hEphA2-EX and -CO from Listeria was confirmed by Western blot analysis.
- ActA(N100)ExmonoCom ⁇ no was engineered to express both the ECD domain of human EphA2 as well as the ICD domain of human EphA2 with a single mutation at residue 646 (lysine to methionine) that ablates kinase activity, by sequential homologous recombination into the actA and inlB loci, respectively, with the ICD inserted first.
- fusion protein comprising the first 100 amino acids of ActA (ACtA(Nl 00)) and the ECD of human EphA2 and the ICD domain of human EphA2 with the K646M mutation from the Listeria strains (i.e., ActA(N100)ExmonoComono) of the invention were confirmed by Western blot analysis.
- Protective immunization with ActA(N100)ExmonoComono significantly inhibited the subcutaneous growth of CT26 cells that express full-length hEphA2 in mice.
- mice vaccinated with the parental actA strain developed tumors that were comparable to vehicle-treated control mice.
- ACtA(Nl 00)ExmonoComono was evaluated using the experimental CT26-hEphA2 lung tumor model.
- Balb/c mice were immunized with ACtA(Nl 00)ExmonoComono, AH1-A5/OVA (Listeria expressing AHl- A5 and ovalbumin), FL-InIB (Listeria expressing full length EphA2), or a control strain.
- Immunization with ActA(N100)ExmonoComono significantly reduced tumor volume in mice relative to the other Listeria strains tested. Together, these data demonstrate that Lister/ ⁇ -mediated vaccination targeting the EphA2 tumor antigen can provide both preventative and therapeutic efficacy against a variety of malignancies.
- Listeria strains were derived from 10403S (Bishop et ah, J. Immunol. 139:2005 (1987)), which is a streptomycin-resistant variant of the wild-type strain 10403.
- Listeria strains with in-frame deletions of the indicated genes were generated by SOE- PCR and allelic exchange with established methods (Camilli et al., MoI. Microbiol. 8:143 (1993)).
- the mutant strain LLO L461T (DP-L4017) was described in Glomski, et al., J. Cell. Biol. 156: 1029 (2002), incorporated by reference herein.
- DP- L4029 is the DP-L3078 strain described in Skoble et al., J. of Cell Biology, 150: 527-537 (2000), incorporated by reference herein in its entirety, which has been cured of its prophage. (Prophage curing is described in (Lauer et al., J. Bacteriol. 184:4177 (2002)); U.S. Patent Publication No. 2003/0203472.) [00458] In some vaccines, mutant strains of Listeria that are deficient with respect to internalin B (Genbank accession number AL591975 (Listeria monocytogenes strain
- EGD complete genome, segment 3/12; inlB gene region: nts. 97008-98963), incorporated by reference herein in its entirety, and/or the sequence listed as Genbank accession number NC_003210 (Listeria monocytogenes strain EGD, complete genome, inlB gene region: nts.457008-458963), incorporated by reference herein in its entirety) are used.
- Genbank accession number NC_003210 Listeria monocytogenes strain EGD, complete genome, inlB gene region: nts.457008-458963), incorporated by reference herein in its entirety
- One particular actA ' inlB ' strain (DP-L4029m/5) was deposited with the American Type Culture Collection (ATCC) on October 3, 2003, and designated with accession number PTA-5562).
- the strain CERS 382.20 is an attenuated strain of DP-L4056 deleted of the coding sequence of actA and inlB, wherein the flanking regions, including the cis elements remain.
- DP-L4056 is a prophage-free derivative of strain 10403S. The process used to isolate strain DP-L4056 from strain 10403S has been described in detail (Lauer etal., J. Bacteriol. 184:4177 (2002)). The streptomycine resistance is conserved in CERS 382.20.
- Selected heterologous antigen expression cassette molecular constructs were inserted into pPL2 (Lauer et. al. J. Bacteriol. 2002), or pAM401 (Wirth et. al., J. Bacteriol. 165:831-836), modified to contain the multiple cloning sequence of pPL2 (Aat II small fragment blunted by T4 polymerase, 171 bps), inserted between Klenow blunted Xba I and Nru /recognition sites, within the tetracycline resistance gene (pAM401-MCS).
- the hly promoter and (selected) signal peptide sequence (Le., Listeria monocytogene expression optimized BaPA signal peptide) was inserted between the unique Kpn I and Bam HI sites in the pPL2 or pAM401-MCS plasmid vectors.
- the pAM- BaPA plasmid was constructed by inserting a Kpnl-BamHI DNA fragment containing the hly promoter and Listeria monocytogene expression optimized BaPA signal peptide into the Kpnl-BamHI sites of p AM-MCS.
- EphA2 genes (sometimes modified to contain N-terminal and C-terminal epitope tags; see description below) were cloned subsequently into these constructs between unique Bam HI and Sac I sites.
- E ⁇ hA2 cDNA containing conservative codon modifications were also cloned into the constructs between unique BamHI and Sad sites.
- EphA2 cDNA sequences were modified by BLUE HERON (Blue Heron Biotechnology, Bothell, WA) using a proprietary algorithm to match codon utilization in Listeria and to reduce secondary structure in nascent transcripts that impede translational efficiency.
- Plasmid sequences were excised from merodiploid strains when cultured under non-selective conditions that favor a second recombination event.
- the resulting Cm- sensitive (Cm s ) strains were screened for the E ⁇ hA2 inserts by PCR and secretion confirmed by Western blot of TCA-precipitated culture supernatants.
- Recombinant Listeria transformed with various pAM401-MCS based heterologous protein expression cassette constructs were utilized to measure heterologous protein expression and secretion, as described below.
- the pPL2 based heterologous protein expression cassette constructs were incorporated into the tRNAArg gene in the genome of selected Listeria strains, according to the methods as described previously (Lauer et al., 2002, J. Bacteriol. 184:4177-4186). Briefly, the pPL2 heterologous protein expression cassette constructs plasmid was first introduced into the E. coli host strain SMlO (Simon et ah, 1983, Bio/Technology 1:784- 791) by electroporation or by chemical means. Subsequently, the pPL2-based plasmid was transferred from transformed SMlO to the selected Listeria strains by conjugation.
- Heterologous protein expression cassettes contained the prfA-dependent hly promoter, which drives the transcription of the gene encoding Listeriolysin O (LLO), and is activated within the microenvironment of the infected cell.
- Nucleotides 205586- 206000 (414 bps) were amplified by PCR from Listeria monocytogenes, strain DP-L4056, using the primer pair shown below.
- the region amplified includes the hly promoter and also the first 28 amino acids of LLO, comprising the secAl signal peptide (ibid) and PEST domain.
- the expected sequence of this region for Listeria monocytogenes, strain EGD can be found in GenBank (Accession number: gill6802048
- Listeria monocytogenes strain DP-L4056 contained eight nucleotide base changes flanking the prfA box in the hly promoter, as compared to the EGD strain.
- the hly promoter alignment for the Listeria monocytogenes DP-L4056 and EGD strains is shown in the Figure below (SEQ ID NOs: 68 and 69, respectively). Listeria hly DP-L4056 and EGD Alignment
- EphA2 The external (EX2) and cytoplasmic (CO) domains of EphA2 which flank the EphA2 transmembrane helix were cloned separately for insertion into various pPL2- signal peptide expression constructs. Genes corresponding to the native mammalian sequence or codon-optimized for expression in Listeria monocytogenes of EphA2 EX2 and CO domains were used. The optimal codons in Listeria (see table, ibid) for each of the 20 amino acids were utilized for codon-optimized EphA2 EX2 and EphA2 CO.
- SEQ ID NOS: 23, 21 and 22 represent the primary amino acid sequences, together with the native and codon-optimized nucleotide sequences, respectively, for the
- SEQ ID NOS: 34, 32 and 33 represent the primary amino acid sequences, together with the native and codon-optimized nucleotide sequences, respectively, for the
- FLAG Stratagene, La Jolla, CA
- myc epitope tags were inserted, respectively, in-frame at the amino and carboxy termini of synthesized EphA2
- EX2 and CO genes for detection of expressed and secreted EphA2 by Western blot analysis using antibodies specific for the FLAG or proteins.
- the expressed protein had the following ordered elements: NHb-Signal Peptide-FLAG-EphA2-myc-CO 2 .
- FLAG [00478] 5'-GATTATAAAGATGATGATGATAAA (SEQ ID NO ⁇ I)
- the pellet was then resuspended in 300-600 ⁇ l volume of TE, pH 8.0 containing 15 ⁇ g/ml phenol red. Sample dissolution was facilitated by vortexing. Sample pH was adjusted by NH4OH addition if necessary until color was pink. AU samples were prepared for electrophoresis by addition of 100 ⁇ l of 4X SDS loading buffer and incubating for 10 min. at 90 0 C. The samples were then centrifuged from 5 min at 14,000 rpm in. a micro-centrifuge, and the supernatants collected and stored at -2O 0 C.
- Antibodies were used under the following dilutions in PBST buffer (0.1% Tween 20 in PBS): (1) Rabbit anti-Myc polyclonal antibody (ICL laboratories, Newberg, Oregon) at 1:10,000; (2) murine anti-FLAG monoclonal antibody (Stratagene, ibid) at 1:2,000; and, (3) Rabbit anti-E ⁇ hA2 (carboxy terminus-specific) polyclonal antibody (sc- 924, Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Specific binding of antibody to protein targets was evaluated by secondary incubation with goat anti-rabbit or anti-mouse antibody conjugated with horseradish peroxidase and detection with the ECL chemilumenescence assay kit (Amersham), and exposure to film.
- PBST buffer 0.1% Tween 20 in PBS
- Expression cassette construct LLOss-PEST-CO-EphA2 (SEQ ID NO:35) [00485] The native sequence of the EphA2 CO domain was genetically fused to the native secAl LLO sequence, and the heterologous antigen expression cassette under control of the Listeria hly promoter was inserted into the pPL2 plasmid between the Kpn I and Sac /sites as described (ibid). The pPL2-EphA2 plasmid constructs were introduced by conjugation into the Listeria strains DP-L4029 (actA) and DP-L4017 (L461T LLO) as described (ibid).
- Figure 2 shows the results of a Western blot analysis of TCA- precipitated bacterial culture fluids of 4029-EphA2 CO and 4017-EphA2 CO. This analysis demonstrated that recombinant Listeria engineered to contain a heterologous protein expression cassette comprised of native sequences corresponding to the secAl and EphA2 CO fusion protein secreted multiple EphA2-specific fragments that were lower than the 52 kDa expected molecular weight, demonstrating the need for modification of the expression cassette.
- FIG. 3 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria actA encoding either the native or codon-optimized secAl LLO signal peptide fused with the codon-optimized EphA2 EX2 domain.
- CodonOp PhoD-(CodonOp) FLAG- EphA2_CO-myc SEQ ID NO:41
- the native secAl LLO signal peptide sequence or the secAl LLO signal peptide sequence codon-optimized for expression in Listeria, or, alternatively, the Tat signal peptide of the phoD gene from Bacillus subtilis codon-optimized for expression in Listeria was fused genetically with the E ⁇ hA2 CO domain sequence codon-optimized for expression in Listeria, and the heterologous antigen expression cassette under control of the Listeria My promoter was inserted into the pAM40i-MCS plasmid between the Kpn I and Sac I sites as described (ibid).
- FIG. 4 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria actA encoding either the native or codon-optimized sec Al LLO signal peptide, or codon-optimized Bacillus subtilis phoD Tat signal peptide fused with the codon-optimized EphA2 CO domain.
- This analysis demonstrated once again that the combination of utilizing sequence for both signal peptide and heterologous protein optimized for the preferred codon usage in Listeria monocytogenes resulted in expression of the expected full-length EphA2 CO domain protein.
- the pPL2 integrational vector (Lauer et al., J. Bacterial. 184:4177 (2002); U.S. Patent Publication No. 2003/0203472) was used to derive OVA and AH1-A5/OVA recombinant Listeria strains containing a single copy integrated into an innocuous site of the Listeria genome.
- OVA-expressing Listeria DP-L4056
- An antigen expression cassette consisting of hemolysin-deleted LLO fused with truncated OVA and contained in the pPL2 integration vector (pPL2/LLO-OVA) is first prepared.
- the Listeria-OVA vaccine strain is derived by introducing pPL2/LLO- OVA into the phage-cured L. monocytogenes strain DP-L4056 at the PSA (Phage from ScottA) attachment site tRNA Ms -attBB' .
- PCR is used to amplify the hemoly sin-deleted LLO using the following template and primers: Source: DP-L4056 genomic DNA
- PCR is also used to amplify the truncated OVA using the following template and primers:
- One protocol for completing the construction process involves first cutting the LLO amplicon with Kpnl and BamHI and inserting the Kpril/BamHI vector into the pPL2 vector (pPL2-LLO).
- the OVA amplicon is then cut with Xhol and Notl and inserted into the pPL2-LLO which has been cut with Xhol/Notl (Note: The pPL2 vector does not contain any Xhol sites; pDP-3616 contains one Xhol site, that is exploited in the OVA reverse primer design.)
- the construct pPL2/LLO-OVA is verified by restriction analysis (Kpnl-LLO-XhoI-OVA-Notl) and sequencing.
- the plasmid pPL2/LLO-OVA is introduced into E. coli by transformation, followed by introduction and integration into Listeria (DP-L4056) by conjugation, exactly as described by Lauer et al. (or into another desired strain of Listeria).
- A5 insert AHl epitope insert (Clal-Pstl compatible ends):
- the oligonucletide pair for a given epitope are mixed together at an equimolar ratio, heated at 95 0 C for 5 min. The oligonucleotide mixture is then allowed to slowly cool. The annealed oligonucleotide pairs are then ligated at a 200 to 1 molar ratio with pPL2-LLO/OVA plasmid prepared by digestion with the relevant restriction enzymes. The identity of the new construct can be verified by restriction analysis and/or sequencing. [00499] The plasmid can then be introduced into E.
- a mouse immunotherapy model was created for testing the Listeria-based vaccines of the invention.
- Three murine tumor cell lines the CT26 murine colon carcinoma cell line, the Bl 6F10 murine melanoma cell line, and the RenCa murine renal cell carcinoma cell line were created to express high levels of the huEphA2 protein.
- FACS cell sorting assays were performed to identify CT26, B16F10, and RenCa tumor cells expressing high levels of huEphA2, which were pooled and analyzed by Western blot analysis. Clones were further pooled by FACS cell sorting to generate subclones expressing the highest levels of huEphA2.
- Figure 5 illustrates a representative experiment, showing that the EphA2-3 clone expressed the highest levels of human EphA2 protein.
- Human EphA2 was introduced into B16F10 murine melanoma cells by a retroviral transduction method to create clones expressing high levels of the protein.
- RenCa cells were transfected with constructs containing huEphA2 using standard transfection techniques and commercially available LipofectamineTM according to the manufacturer's instructions.
- the vaccines of the present invention can be assessed using a variety of in vitro and in vivo methods.
- Some assays involve the analysis of antigen-specific T cells from the spleens of mice that have been vaccinated. For example C57B1/6 or Balb/c are vaccinated by intravenous injection of 0.1 LD50 of a Listeria strain expressing OVA (or other appropriate antigen).
- the spleen cells of the mice are harvested (typically 3 mice per group) by placing the spleens into ice cooled RPMI 1640 medium and preparing a single cell suspension from this.
- lymph nodes of the mice could be similarly harvested, prepared as a single cell suspension and substituted for the spleen cells in the assays described below.
- spleen cells are assessed for intraveneous or intraperitoneal administration of the vaccine while spleen cells and cells from lymph nodes are assessed for intramuscular, subcutaneous or intradermal administration of the vaccine.
- the quantitative frequency of antigen-specific T cells generated upon immunization in a mouse model is assessed using an ELISPOT assay.
- the antigen-specific T cells evaluated are OVA specific CD8+ or LLO specific CD8+ or CD4+ T cells.
- This OVA antigen model assesses the immune response to a heterologous tumor antigen inserted into the vaccine and could be substituted with any antigen of interest.
- the LLO antigen is specific to Listeria.
- the specific T cells are assessed by detection of cytokine release (e.g. IFN- ⁇ ) upon recognition of the specific antigen.
- PVDF-based 96 well plates (BD Biosciences, San Jose, CA) are coated overnight at 4°C with an anti-murine IFN- ⁇ monoclonal antibody (mAb R4; 5 ⁇ g/ml). The plates are washed and blocked for 2 hours at room temperature with 200 ⁇ L of complete RPMI. Spleen cells from vaccinated mice (or non vaccinated control mice) are added at 2 x 10 5 cells per well and incubated for 20 to 22 hours at 37°C in the presence of various concentrations of peptides ranging from 0.01 to 10 ⁇ M.
- mAb R4 anti-murine IFN- ⁇ monoclonal antibody
- the peptides used for OVA and LLO are either SL8, an MHC class I epitope for OVA, LLO 1 9 0 (NEKYAQAYPNVS, Invitrogen) an MHC class II epitope for listeriolysin O (Listeria antigen), LLO 2 96 (VAYGRQVYL), an MHC class I epitope for listeriolysin O, or LLO 91 (GYKDGNEYI), an MHC class I epitope for listeriolysin O.
- LLOigo and LLO296 are used in a C57BI/6 model, while LLO9 1 is used in a Balb/c model.
- the plates are incubated with secondary biotinylated antibodies specific for IFN- ⁇ (XMG 1.2) diluted in PBS to 0.5 ⁇ g/ml. After incubation at room temperature for 2 hours, the plates are washed and incubated for 1 hour at 37 0 C with a 1 nm gold goat anti-biotin conjugate (GAB-I; 1:200 dilution; Ted Pella, Redding, CA) diluted in PBS containing 1 % BSA. After thorough washing, the plates are incubated at room temperature for 2 to 10 minutes with substrate (Silver Enhancing Kit; 30 ml/well; Ted Pella) for spot development. The plates are then rinsed with distilled water to stop the substrate reaction.
- substrate Tin Enhancing Kit
- cytokine response is expressed as the number of IFN- ⁇ spot- forming cells (SFCs) per 2 x 10 5 spleen cells for either the OVA specific T cells or the Listeria specific T cells.
- ICS is performed and the cells evaluated by flow cytometry analysis.
- Spleen cells from vaccinated and control groups of mice are incubated with SL8 (stimulates OVA specific CD8+ cells) or LLOi 90 (stimulates LLO specific CD4+ cells) for 5 hours in the presence of Brefeldin A (Pharmingen).
- the Brefeldin A inhibits secretion of the cytokines produced upon stimulation of the T cells.
- Spleen cells incubated with an irrelevant MHC class I peptide are used as controls.
- PMA phorbol-12-myristate- 13 -acetate, Sigma
- ionomycin Sigma 2 ⁇ g/ml stimulated spleen cells are used as a positive control for IFN- ⁇ and TNF- ⁇ intracellular cytokine staining.
- cytoplasmic cytokine expression cells are stained with FITC-anti-CD4 mAb (RM 4-5) and PerCP-anti-CD8 rnAb (53-6.7), fixed and permeabilized with Cytofix/CytoPerm solution (Pharmingen), and stained with PE-conjugated anti-TNF- ⁇ mAb (MP6-XT22) and APC-conjugated anti- IFN- ⁇ mAb (XMG 1.2) for 30 minutes on ice.
- FITC-anti-CD4 mAb RM 4-5
- PerCP-anti-CD8 rnAb 53-6.7
- Cytofix/CytoPerm solution Pharmingen
- PE-conjugated anti-TNF- ⁇ mAb MP6-XT22
- APC-conjugated anti- IFN- ⁇ mAb XMG 1.2
- the percentage of cells expressing intracellular DFN- ⁇ and/or TNF- ⁇ was determined by flow cytometry (FACScalibur, Becton Dickinson, Mountain View, CA) and data analyzed using CELLQuest software (Becton Dickinson Immunocytometry System). As the fluorescent labels on the various antibodies can all be distinguished by the FACScalibur, the appropriate cells are identified by gating for those CD8+ and CD4+ that are stained with either or both of the anti-EFN- ⁇ or anti-TNF- ⁇ .
- the level of cytokine secretion by the spleen cells of mice can also be assessed for control and vaccinated C57B1/6 mice.
- Spleen cells are stimulated for 24 hours with SL8 or LLO190.
- Stimulation with irrelevant peptide HSV-gB 2 (Invitrogen, SSIEFARL) is used as a control.
- the supernatants of the stimulated cells are collected and the levels of T helper- 1 and T helper 2 cytokines are determined using an ELISA assay (eBiosciences, CO) or a Cytometric Bead Array Kit (Pharmingen).
- the OVA specific CD8+ T cells can be further evaluated by assessing their cytotoxic activity, either in vitro or directly in C57B1/6 mouse in vivo.
- the CD8+ T cells recognize and lyse their respective target cells in an antigen-specific manner.
- In vitro cytotoxicity is determined using a chromium release assay.
- Spleen cells of naive and Listeria-OYA (internal) vaccinated mice are stimulated at a 10:1 ratio with either irradiated EG7.OVA cells (EL-4 tumor cell line transfected to express OVA, ATCC, Manassas, VA) or with 100 nM SL8, in order to expand the OVA specific T cells in the spleen cell population.
- the cytotoxic activity of the effector cells is determined in a standard 4-hour 5l Cr-release assay using EG7.OVA or SL8 pulsed EL-4 cells (ATCC, Manassas, VA) as target cells and EL-4 cells alone as negative control.
- the YAC-I cell line (ATCC, Manassas, VA) is used as targets to determine NK cell activity, in order to distinguish the activity due to T cells from that due to NK cells.
- the percentage of specific cytotoxicity is calculated as 100 x (experimental release - spontaneous release) / (maximal release - spontaneous release).
- Spontaneous release is determined by incubation of target cells without effector cells. Maximal release is determined by lysing cells with 0.1% Triton X-100. Experiments are considered valid for analysis if spontaneous release is ⁇ 20% of maximal release.
- spleen cells from naive C57B1/6 mice are split into two equivalent aliquots. Each group is pulsed with a specific peptide, either target (SLS) or control (HSV-gB 2 ), at 0.5 ⁇ g/ml for 90 minutes at 37 0 C. Cells are then washed 3 times in medium, and twice in PBS + 0.1% BSA.
- SLS target
- HVS HSV-gB 2
- Cells are resuspended at 1 x 10 7 per ml in warm PBS + 0.1% BSA (10 ml or less) for labeling with carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes, Eugene, OR).
- CFSE carboxyfluorescein diacetate succinimidyl ester
- To the target cell suspension 1.25 ⁇ L of a 5mM stock of CFSE is added and the sample mixed by vortexing.
- a tenfold dilution of the CFSE stock is added and the sample mixed by vortexing.
- the cells are incubated at 37 0 C for 10 minutes. Staining is stopped by addition of a large volume
- the in vivo cytotoxicity assay permits the assessment of lytic activity of antigen-specific T cells without the need of in vitro re-stimulation. Furthermore, this assays assesses the T cell function in their native environment.
- Efficacy studies were performed in mice inoculated with CT26 tumor cells expressing the extracellular domain (ED) of human EphA2 in order to characterize the anti-tumor effect of huEphA2. Endpoints measured were tumor volume and percent survival of the mice after tumor inoculation.
- the routes of inoculation were subcutaneous (s.c.) and intravenous (Lv.).
- HBSS and Listeria were administered as controls.
- Figure 1OA demonstrates the anti-tumor efficacy of Listeria expressing the
- Figure 1OB demonstrates the anti-tumor efficacy of Listeria expressing the
- Groups Eight groups often mice per group. Groups 1-4 were inoculated s.c. and groups 5-8 were inoculated i.v. with CT26 colon carcinoma cells transfected with human EphA2, as shown in Table 10 below:
- Figures 1 IA-I ID illustrate results of the preventive experiments.
- Figure HB also depicts results of the preventive experiments, showing again that the tumor volume of mice inoculated with CT26-huEphA2 cells following vaccination with Listeria expressing the ECD of huEphA2 (DP-L4029-EphA2 exFlag) was significantly reduced when compared to the Listeria (DP- L4029) control starting at day 21 and continuing until day 32 post inoculation.
- Figure HC illustrates the results of the prevention study in the s.c. model, measuring the percent survival of mice vaccinated with the indicated Listeria strains or vehicle control post CT26-huEphA2 tumor cell inoculation.
- Figure 1 ID illustrates the results of the prevention study in the lung metastases model, measuring the percent survival of mice vaccinated with the indicated Listeria strains or vehicle control post CT26-huEphA2 tumor cell inoculation. Compared to all control groups, the DP-L4029-EphA2 exFlag group had the most significant survival rate. [00529] The foregoing data demonstrate that preventative immunization with
- Figure 12 presents the data from preventive studies performed utilizing a pool of RenCa cells (American Type Culture Collection, Manassas, VA) expressing huEphA2 generated and screened by the methods described above. Groups often Balb/c mice per group were inoculated subcutaneously with RenCa renal cell carcinoma cells expressing human EphA2 ("RenCa-hEphA2 cells")- The mice were immunized with 0.1 LD50 Listeria control or Listeria expressing the ICD of hEphA2 in a 200ml bolus. The immunizations were performed 18 and 4 days prior to RenCa-hEphA2 cell tumor challenge. Tumor volume measurements were obtained twice weekly for the course of the study to determine an anti-tumor effect of the vaccinations.
- RenCa cells American Type Culture Collection, Manassas, VA
- RenCa-hEphA2 cells human EphA2
- Figure 12 demonstrates the anti-tumor efficacy of Listeria expressing the
- CT26-huEphA2 huEphA2
- a representative therapeutic study was performed as follows: [00534] Groups: Six groups of ten mice per group. Groups 1-3 were inoculated s.c. and groups 4-6 were inoculated i.v. with CT26 murine colon carcinoma cells, as shown in Table 12 below: TABLE 12
- Tumor volume was measured bi-weekly (s.c inoculation only) and animal weights assessed on a weekly basis. Any animals possessing tumors greater than 2000 mm 3 or demonstrating signs of morbidity (hunched posture, impaired breathing, decreases mobility, greater than 20% weight loss, etc.) were humanely euthanized.
- the schedule is summarized in Table 13 below.
- Figures 13A-13C illustrate the results of a typical therapeutic study.
- FIG 13 A tumor volume was measured at several intervals post inoculation with CT26- huEphA2.
- the mice vaccinated with Listeria expressing the ECD of huEphA2 had a significantly lower tumor volume after day 14 and continued onto day 28.
- Figure 13B depicts the mean tumor volume of mice inoculated with CT26-huEphA2 tumor cells followed by vaccination with either Listeria control or Listeria expressing the ECD of huEphA2 ("Listeria-ECD-huEphA2").
- Listeria-ECD-huEphA2 Listeria-ECD-huEphA2
- the mice vaccinated with Listeria-ECD-huEphA2 had a reduced mean tumor volume.
- Figure 13C represents the results of the therapeutic study using the lung metastases model, measuring percent survival of the indicated groups of mice post inoculation with CT26-huEphA2 tumor cells. Animals vaccinated with Listeria expressing the ECD of huEphA2 (depicted by triangles) showed a higher percent survival rate compared to controls. [00537] In another study, groups of ten Balb/c mice per group were inoculated s.c. or ⁇ .v. with CT26 colon carcinoma cells transfected with human EphA2 ("CT26- huEphA2").
- mice were immunized with 0.1 LD 50 act A Listeria control or Listeria expressing the ICD of huEphA2 in a 200 ⁇ l bolus.
- the immunizations were performed 6 and 14 days post s.c. CT26-huEphA2 tumor inoculation.
- the immunizations were performed 3 and 14 days post i.v. CT26-huEphA2 tumor inoculation.
- Anti-tumor efficacy was determined from twice weekly tumor measurements and survival.
- Figure 14B demonstrates the survival time of immunized animals. This data is summarized in Table 15 below: TABLE 15
- Figure 14D shows percent survival data comparing vaccination with the indicated Listeria strains in mice challenged with CT26.24 (huEphA2+) tumor cells.
- the EphA2 CO domain is strongly immunogenic, and a significant long term increase in survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors was observed when immunized with recombinant Listeria encoding codon-optimized or native EphA2 CO domain sequence ( Figure 14D).
- EphA2 EX2 domain is poorly immunogenic, and increased survival of
- EX2 domain sequences was supported by statistically significant therapeutic anti-tumor efficacy, as shown in the table below:
- mice were randomized and vaccinated IV with various recombinant Listeria strains encoding EphA2. In some cases (noted in figures) mice were vaccinated with 100 ⁇ g of pCDNA4 plasmid or pCDNA4-EphA2 plasmid in the tibialis anterior muscle. As a positive control, mice were vaccinated IV with recombinant Listeria strains encoding O VA. AHI or OVA.AH1-A5 protein chimeras. Mice were vaccinated on days 3 and 14 following tumor cell implantation. Mice injected with Hanks Balanced Salt Solution (HBSS) buffer or unmodified Listeria served as negative controls. All experimental cohorts contained 5 mice. For survival studies mice were sacrificed when they started to show any signs of stress or labored breathing.
- HBSS Hanks Balanced Salt Solution
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention provides nucleic acid constructs comprising a nucleotide sequence encoding an EphA2 antigenic peptide and Listeria comprising such constructs. In particular, the present invention provides Listeria engineered to express a plurality of EphA2 antigenic peptides and immunogenic compositions comprising such Listeria. The invention encompasses, inter alia, the use of the immunogenic compositions for eliciting an immune response against an EphA2-expressing cell, as well as for the treatment, management and/or prevention of a hyperproliferative disorder and/or a disease involving aberrant angiogenesis.
Description
LfSTFXfA -BASED EohA2 IMMUNOGENIC COMPOSITIONS
[001] This application claims priority benefit under 35 U.S.C. § 119(e) to U.S.
Provisional Application No. 60/778,426, filed March 1, 2006, which is herein incorporated by reference in its entirety.
1. FIELD OF THE INVENTION
[002] The present invention provides nucleic acid constructs comprising a nucleotide sequence encoding an EphA2 antigenic peptide and Listeria comprising such constructs. In particular, the present invention provides Listeria engineered to express a plurality of EphA2 antigenic peptides and immunogenic compositions comprising such Listeria. The invention encompasses, inter alia, the use of the immunogenic compositions for eliciting an immune response against an EphA2-expressing cell, as well as for the treatment, management and/or prevention of a hyperproliferative disorder and/or a disease involving aberrant angiogenesis.
2. BACKGROUND OF THE INVENTION 2.1. Listeria
[003] Listeria, preferably Listeria monocytogenes, is a Gram-positive facultative intracellular bacterium that is being developed for use in antigen-specific immunogenic compositions due to its ability to prime a potent CD4+/CD8+ T-cell mediated response via both MHC class I and class II antigen presentation pathways, and as such it has been tested recently as a vaccine vector in a human clinical trial among normal healthy volunteers.
[004] Listeria has been studied for many years as a model for stimulating both innate and adaptive T cell-dependent antibacterial immunity. The ability of Listeria to effectively stimulate cellular immunity is based on its intracellular lifecycle. Upon infecting the host, the bacterium is rapidly taken up by phagocytes including macrophages and dendritic cells into a phagolysosomal compartment. The majority of the bacteria are subsequently degraded. Peptides resulting from proteolytic degradation of pathogens within phagosomes of infected APCs are loaded directly onto MHC class II molecules, and these MHC II-peptide complexes activate CD4+ "helper" T cells that stimulate the production of antibodies, and the processed antigens are expressed on the surface of the antigen presenting cell via the class II endosomal pathway. Within the acidic compartment, certain bacterial genes are activated including the cholesterol-dependent
cytolysin, LLO, which can degrade the phagolysosome, releasing the bacterium into the cytosolic compartment of the host cell, where the surviving Listeria propagate. Efficient presentation of heterologous antigens via the MHC class I pathway requires de novo endogenous protein expression by Listeria. Within antigen presenting cells (APC), proteins synthesized and secreted by Listeria are sampled and degraded by the proteosome. The resulting peptides are shuttled into the endoplasmic reticulum by TAP proteins and loaded onto MHC class I molecules. The MHC I-peptide complex is delivered to the cell surface, which in combination with sufficient co-stimulation (signal 2) activates and stimulates cytotoxic T lymphocytes (CTLs) having the cognate T cell receptor to expand and subsequently recognize the MHC I-peptide complex.
2.2. Hvperproliferative Diseases
2.2.1. Cancer
[005] A neoplasm, or tumor, is a neoplastic mass resulting from abnormal uncontrolled cell growth which can be benign or malignant. Benign tumors generally remain localized. Malignant tumors are collectively termed cancers. The term
"malignant" generally means that the tumor can invade and destroy neighboring body structures and spread to distant sites to cause death (for review, see Robbins and Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68-122). Cancer can arise in many sites of the body and behaves differently depending upon its origin. Cancerous cells destroy the part of the body in which they originate and then spread to other part(s) of the body where they start new growth and cause more destruction. [006] More than 1.2 million Americans develop cancer each year. Cancer is the second leading cause of death in the United States and, if current trends continue, cancer is expected to be the leading cause of death by the year 2010. Lung and prostate cancer are the top cancer killers for men in the United States. Lung and breast cancer are the top cancer killers for women in the United States. One in two men in the United States will be diagnosed with cancer at some time during his lifetime. One in three women in the United States will be diagnosed with cancer at some time during her lifetime. [007] A cure for cancer has yet to be found. Current treatment options, such as surgery, chemotherapy and radiation treatment, are often either ineffective or present serious side effects.
2.2.2. Metastasis
[008] The most life-threatening forms of cancer often arise when a population of tumor cells gains the ability to colonize distant and foreign sites in the body. These metastatic cells survive by overriding restrictions that normally constrain cell colonization into dissimilar tissues. For example, typical mammary epithelial cells will generally not grow or survive if transplanted to the lung, yet lung metastases are a major cause of breast cancer morbidity and mortality. Recent evidence suggests that dissemination of metastatic cells through the body can occur long before clinical presentation of the primary tumor. These micrometastatic cells may remain dormant for many months or years following the detection and removal of the primary tumor. Thus, a better understanding of the mechanisms that allow for the growth and survival of metastatic cells in a foreign microenvironment is critical for the improvement of therapeutics designed to fight metastatic cancer and diagnostics for the early detection and localization of metastases.
2.2.3. Cancer Cell Signaling [009] Cancer is a disease of aberrant signal transduction. Aberrant cell signaling overrides anchorage-dependent constraints on cell growth and survival (Rhim et al, 1997, CHt. Rev. in Oncogenesis 8:305; Patarca, 1996, Crit. Rev. in Oncogenesis 7:343; Malik et al, 1996, Biochimica et Biophysica Acta 1287:73; Cance et al, 1995, Breast Cancer Res. Treat. 35:105). Tyrosine kinase activity is induced by extracellular matrix (ECM) anchorage and indeed, the expression or function of tyrosine kinases is usually increased in malignant cells (Rhim et al., 1997, Critical Reviews in Oncogenesis 8:305; Cance et al., 1995, Breast Cancer Res. Treat. 35:105; Hunter, 1997, Cell 88:333). Based on evidence that tyrosine kinase activity is necessary for malignant cell growth, tyrosine kinases have been targeted with new therapeutics (Levitzki et al., 1995, Science 267:1782; Kondapaka et al., 1996, MoI. & Cell. Endocrinol. 117:53; Fry et al., 1995, Curr. Opin. in
BioTechnology 6:662). Unfortunately, obstacles associated with specific targeting to tumor cells often limit the application of these drugs. In particular, tyrosine kinase activity is often vital for the function and survival of benign tissues (Levitzki et al., 1995, Science 267:1782). To minimize collateral toxicity, it is critical to first identify and then target tyrosine kinases that are selectively overexpressed in tumor cells.
2.2.4. Cancer Therapy
[0010] Barriers to the development of anti-metastasis agents have been the assay systems that are used to design and evaluate these drugs. Most conventional cancer
therapies target rapidly growing cells. However, cancer cells do not necessarily grow more rapidly but instead survive and grow under conditions that are non-permissive to normal cells (Lawrence and Steeg, 1996, World J. Urol. 14:124-130). These fundamental differences between the behavior of normal and malignant cells provide opportunities for therapeutic targeting. The paradigm that micrometastatic tumors have already disseminated throughout the body emphasizes the need to evaluate potential chemotherapeutic drugs in the context of a foreign and three-dimensional microenvironment. Many standard cancer drug assays measure tumor cell growth or survival under typical cell culture conditions (i.e., monolayer growth). However, cell behavior in two-dimensional assays often does not reliably predict tumor cell behavior in vivo.
[0011] Currently, cancer therapy may involve surgery, chemotherapy, hormonal therapy and/or radiation treatment to eradicate neoplastic cells in a patient (see, e.g., Stockdale, 1998, "Principles of Cancer Patient Management," in Scientific American: Medicine, vol. 3, Rubenstein and Federman, eds., ch. 12, sect. IV). Recently, cancer therapy may also involve biological therapy or immunotherapy. All of these approaches can pose significant drawbacks for the patient. Surgery, for example, may be contraindicated due to the health of the patient or may be unacceptable to the patient. Additionally, surgery may not completely remove the neoplastic tissue. Radiation therapy is only effective when the neoplastic tissue exhibits a higher sensitivity to radiation than normal tissue, and radiation therapy can also often elicit serious side effects. Hormonal therapy is rarely given as a single agent and, although it can be effective, is often used to prevent or delay recurrence of cancer after other treatments have removed the majority of the cancer cells. Biological therapies/immunotherapies are limited in number and each therapy is generally effective for only a very specific type of cancer.
[0012] With respect to chemotherapy, there are a variety of chemotherapeutic agents available for treatment of cancer. A significant majority of cancer chemotherapeutics act by inhibiting DNA synthesis, either directly, or indirectly by inhibiting the biosynthesis of the deoxyribonucleotide triphosphate precursors, to prevent DNA replication and concomitant cell division (see, e.g., Gilman et ah, 1990, Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 8th Ed. (Pergamom Press, New York)). These agents, which include alkylating agents, such as nitrosourea, antimetabolites, such as methotrexate and hydroxyurea, and other agents, such as etoposides, campathecins, bleomycin, doxorubicin, daunorubicin, etc., although not necessarily cell
cycle specific, kill cells during S phase because of their effect on DNA replication. Other agents, specifically colchicine and the vinca alkaloids, such as vinblastine and vincristine, interfere with microtubule assembly resulting in mitotic arrest. Chemotherapy protocols generally involve administration of a combination of chemotherapeutic agents to increase the efficacy of treatment.
[0013] Despite the availability of a variety of chemotherapeutic agents, chemotherapy has many drawbacks (see, e.g., Stockdale, 1998, "Principles Of Cancer Patient Management" in Scientific American Medicine, vol. 3, Rubenstein and Federman, eds., ch. 12, sect. X). Almost all chemotherapeutic agents are toxic, and chemotherapy causes significant, and often dangerous, side effects, including severe nausea, bone marrow depression, immunosuppression, etc. Additionally, even with administration of combinations of chemotherapeutic agents, many tumor cells are resistant or develop resistance to the chemotherapeutic agents, hi fact, those cells resistant to the particular chemotherapeutic agents used in the treatment protocol often prove to be resistant to other drugs, even to those agents that act by mechanisms different from the mechanisms of action of the drugs used in the specific treatment; this phenomenon is termed pleiotropic drug or multidrug resistance. Thus, because of drug resistance, many cancers prove refractory to standard chemotherapeutic treatment protocols. [0014] There is a significant need for alternative cancer treatments, particularly for treatment of cancer that has proved refractory to standard cancer treatments, such as surgery, radiation therapy, chemotherapy, and hormonal therapy. Further, it is uncommon for cancer to be treated by only one method. Thus, there is a need for development of new therapeutic agents for the treatment of cancer and new, more effective, therapy combinations for the treatment of cancer.
2.2.5. Other Hyperproliferative Disorders
2.2.5.1. Asthma
[0015] Asthma is a disorder characterized by intermittent airway obstruction. In western countries, it affects 15% of the pediatric population and 7.5% of the adult population (Strachan et al., 1994, Arch. Dis. Child 70:174-178). Most asthma in children and young adults is initiated by IgE mediated allergy (atopy) to inhaled allergens such as house dust mite and cat dander allergens. However, not all asthmatics are atopic, and most atopic individuals do not have asthma. Thus, factors in addition to atopy are necessary to induce the disorder (Fraser et al, eds. ,1994, Synopsis of Diseases of the
Chest: 635-53 (WB Saunders Company, Philadelphia); Djukanovic et al., 1990, Am. Rev. Respir. Dis. 142:434-457). Asthma is strongly familial, and is due to the interaction between genetic and environmental factors. The genetic factors are thought to be variants of normal genes ("polymorphisms") which alter their function to predispose to asthma. [0016] Asthma may be identified by recurrent wheeze and intermittent air flow limitation. An asthmatic tendency may be quantified by the measurement of bronchial hyper-responsiveness in which an individual's dose-response curve to a broncho-constrictor such as histamine or methacholine is constructed. The curve is commonly summarized by the dose which results in a 20% fall in air flow (PD20) or the slope of the curve between the initial air flow measurement and the last dose given (slope). [0017] In the atopic response, IgE is produced by B-cells in response to allergen stimulation. These antibodies coat mast cells by binding to the high affinity receptor for IgE and initiate a series of cellular events leading to the destabilization of the cell membrane and release of inflammatory mediators. This results in mucosal inflammation, wheezing, coughing, sneezing and nasal blockage.
[0018] Atopy can be diagnosed by (i) a positive skin prick test in response to a common allergen; (ii) detecting the presence of specific serum IgE for allergen; or (iii) by detecting elevation of total serum IgE.
2.2.5.2. COPD [0019] Chronic obstructive pulmonary disease (COPD) is an umbrella term frequently used to describe two conditions of fixed airways disorders, chronic bronchitis and emphysema. Chronic bronchitis and emphysema are most commonly caused by smoking; approximately 90% of patients with COPD are or were smokers. Although approximately 50% of smokers develop chronic bronchitis, only 15% of smokers develop disabling airflow obstruction. Certain animals, particularly horses, suffer from COPD as well.
[0020] The airflow obstruction associated with COPD is progressive, may be accompanied by airway hyperactivity, and may be partially reversible. Non-specific airway hyper-responsiveness may also play a role in the development of COPD and may be predictive of an accelerated rate of decline in lung function.
[0021] COPD is a significant cause of death and disability. It is currently the fourth leading cause of death in the United States and Europe. Treatment guidelines advocate early detection and implementation of smoking cessation programs to help
reduce morbidity and mortality due to the disorder. However, early detection and diagnosis has been difficult for a number of reasons. COPD takes years to develop and acute episodes of bronchitis often are not recognized by the general practitioner as early signs of COPD. Many patients exhibit features of more than one disorder (e.g., chronic bronchitis or asthmatic bronchitis) making precise diagnosis a challenge, particularly early in the etiology of the disorder. Also, many patients do not seek medical help until they are experiencing more severe symptoms associated with reduced lung function, such as dyspnea, persistent cough, and sputum production. As a consequence, the vast majority of patients are not diagnosed or treated until they are in a more advanced stage of the disorder.
2.2.5.3. Mucin
[0022] Mucins are a family of glycoproteins secreted by the epithelial cells including those at the respiratory, gastrointestinal and female reproductive tracts. Mucins are responsible for the viscoelastic properties of mucus (Thornton et al., 1997, /. Biol. Chem. 272:9561-9566). Nine mucin genes are known to be expressed in man: MUC 1, MUC 2, MUC 3, MUC 4, MUC 5AC, MUC 5B, MUC 6, MUC 7 and MUC 8 (Bobek et al., 1993, J. Biol. Chem. 268:20563-9; Dusseyn et al., 1997, J. Biol. Chem. 272:3168-78; Gendler et al., 1991, Am. Rev.Resp. Dis. 144:S42-S47; Gum etal., 1989, /. Biol. Chem. 264:6480-6487; Gum et al., 1990, Biochem. Biophys. Res. Comm. 171:407-415; Lesuffleur et al., 1995, J. Biol. Chem. 270:13665-13673; Meerzaman et al., 1994, J. Biol. Chem. 269:12932-12939; Porchet etal, 1991, Biochem. Biophys. Res. Comm. 175:414-422; Shankar et al., 1994, Biochem. J. 300:295-298; Toribara et al., 1997, J. Biol. Chem. 272: 16398-403). Many airway disorders such chronic bronchitis, chronic obstructive pulmonary disease, bronchietactis, asthma, cystic fibrosis and bacterial infections are characterized by mucin overproduction (Prescott et al., Eur. Respir. J.,
1995, 8:1333-1338; Kim etal., Eur. Respir. J., 1997, 10:1438; Steiger et al., 1995, Am. J. Respir. Cell MoI. Biol., 12:307-314). Mucociliary impairment caused by mucin hypersecretion leads to airway mucus plugging which promotes chronic infection, airflow obstruction and sometimes death. For example, COPD, a disorder characterized by slowly progressive and irreversible airflow limitation, is a major cause of death in developed countries. The respiratory degradation consists mainly of decreased luminal diameters due to airway wall thickening and increased mucus caused by goblet cell hyperplasia and hypersecretion. Epidermal growth factor (EGF) is known to upregulate epithelial cell
proliferation, and mucin production/secretion (Takeyama et al., 1999, Proc. Natl. Acad. ScL USA 96:3081-6; Burgel et al., 2001, J. Immunol. 167:5948-54). EGF also causes mucin-secreting cells, such as goblet cells, to proliferate and increase mucin production in airway epithelia (Lee et al., 2000, Am. J. Physiol. Lung Cell. MoI Physiol. 278:185-92; Takeyama et al., 2001, Am. J. Respir. Crit. Care. Med. 163:511-6; Burgel et al., 2000, /. Allergy CHn. Immunol. 106:705-12). Historically, mucus hypersecretion has been treated in two ways: physical methods to increase clearance and mucolytic agents. Neither approach has yielded significant benefit to the patient or reduced mucus obstruction. Therefore, it would be desirable to have methods for reducing mucin production and treating the disorders associated with mucin hypersecretion.
2.2.5.4. Restenosis
[0023] Vascular interventions, including angioplasty, stenting, atherectomy and grafting are often complicated by undesirable effects. Exposure to a medical device which is implanted or inserted into the body of a patient can cause the body tissue to exhibit adverse physiological reactions. For instance, the insertion or implantation of certain catheters or stents can lead to the formation of emboli or clots in blood vessels. Other adverse reactions to vascular intervention include endothelial cell proliferation which can lead to hyperplasia, restenosis, i.e. the re-occlusion of the artery, occlusion of blood vessels, platelet aggregation, and calcification. Treatment of restenosis often involves a second angioplasty or bypass surgery. In particular, restenosis may be due to endothelial cell injury caused by the vascular intervention in treating a restenosis. [0024] Angioplasty involves insertion of a balloon catheter into an artery at the site of a partially obstructive atherosclerotic lesion. Inflation of the balloon is intended to rupture the intima and dilate the obstruction. About 20 to 30% of obstructions reocclude in just a few days or weeks (Eltchaninoff et al., 1998, J. Am Coll Cardiol 32: 980-984). Use of stents reduces the re-occlusion rate, however a significant percentage continues to result in restenosis. The rate of restenosis after angioplasty is dependent upon a number of factors including the length of the plaque. Stenosis rates vary from 10% to 35% depending the risk factors present. Further, repeat angiography one year later reveals an apparently normal lumen in only about 30% of vessels having undergone the procedure. [0025] Restenosis is caused by an accumulation of extracellular matrix containing collagen and proteoglycans in association with smooth muscle cells which is found in both the atheroma and the arterial hyperplastic lesion after balloon injury or clinical
angioplasty. Some of the delay in luminal narrowing with respect to smooth muscle cell proliferation may result from the continuing elaboration of matrix materials by neointimal smooth muscle cells. Various mediators may alter matrix synthesis by smooth muscle cells in vivo.
2.2.5.5. Neointimal Hyperplasia
[0026] Neointimal hyperplasia is the pathological process that underlies graft atherosclerosis, stenosis, and the majority of vascular graft occlusion. Neointimal hyperplasia is commonly seen after various forms of vascular injury and a major component of the vein graft's response to harvest and surgical implantation into high-pressure arterial circulation.
[0027] Smooth muscle cells in the middle layer (i.e. media layer) of the vessel wall become activated, divide, proliferate and migrate into the inner layer (Le. intima layer). The resulting abnormal neointimal cells express pro-inflammatory molecules, including cytokines, chemokines and adhesion molecules that further trigger a cascade of events that lead to occlusive neointimal disease and eventually graft failure.
[0028] The proliferation of smooth muscle cells is a critical event in the neointimal hyperplastic response. Using a variety of approaches, studies have clearly demonstrated that blockade of smooth muscle cell proliferation resulted in preservation of normal vessel phenotype and function, causing the reduction of neointimal hyperplasia and graft failure. [0029] Existing treatments for the indications discussed above is inadequate; thus, there exists a need for improved treatments for the above indications.
2.3. EphA2
[0030] EphA2 is a 130 kDa receptor tyrosine kinase that is expressed in adult epithelia, where it is found at low levels and is enriched within sites of cell-cell adhesion (Zantek et al, 1999, Cell Growth & Differentiation 10:629; Lindberg et al, 1990, Molecular & Cellular Biology 10:6316). This subcellular localization is important because EphA2 binds ligands (known as EphrinsAl to A5) that are anchored to the cell membrane (Eph Nomenclature Committee, 1997, Cell 90:403; Gale et ah, 1997, Cell & Tissue Research 290: 227). The primary consequence of ligand binding is EphA2 autophosphorylation (Lindberg et al., 1990, supra). However, unlike other receptor tyrosine kinases, EphA2 retains enzymatic activity in the absence of ligand binding or
phosphotyrosine content (Zantek et al., 1999, supra). EρhA2 is upregulated on a large number hyperproliferating cells, including aggressive carcinoma cells.
3. SUMMARY OF THE INVENTION
[0031] EphA2 is overexpressed and functionally altered in a large number of malignant carcinomas. EphA2 is an oncoprotein and is sufficient to confer metastatic potential to cancer cells. EphA2 is also associated with other hyperproliferating cells and is implicated in diseases caused by cell hyperproliferation. The present invention stems, in part, from the inventors' discovery that administration of Listeria that express an EphA2 antigenic peptide to a subject provides beneficial therapeutic and prophylactic benefits against hyperproliferative disorders involving EphA2 overexpressing cells. Without being bound by any mechanism or theory, it is believed that the therapeutic and prophylactic benefit is the result of an immune response elicited by administration of the EphA2 antigenic peptide-expressing Listeria. [0032] The present invention thus provides Listeria-based EphA2 immunogenic compositions and methods for their use. hi certain embodiments, the immunogenic compositions are vaccines. The Listeriα-based EphA2 immunogenic compositions of the present invention can elicit a cellular immune response, a humoral immune response, or both. Where the immune response is a cellular immune response, it can be a Tc, ThI or a Th2 immune response. In a specific embodiment, the immune response is a Th2 cellular immune response.
[0033] In a preferred embodiment, a Listeriα-based EphA2 immunogenic composition of the invention expresses one or more epitopes of EphA2 that is selectively exposed or increased on cancer cells relative to non-cancer cells (i.e., normal, healthy cells or cells that are not hyperproliferative). In one embodiment, the cancer is of an epithelial cell origin. In other embodiments, the cancer is a cancer of the skin, lung, colon, prostate, breast, ovary, esophageal, bladder, or pancreas or is a renal cell carcinoma or a melanoma. In another embodiment, the cancer is of a T cell origin. In yet other embodiments, the cancer is a leukemia or a lymphoma. In a specific embodiment, the cancer is a glioma. [0034] The Listeriα-based EphA2 immunogenic compositions comprise Listeria as an EphA2 antigenic peptide expression vehicle. In a preferred embodiment, the Listeria- based EphA2 immunogenic compositions for use in a subject are attenuated. The attenuated Listeria bacteria may be, for example, deficient in DNA repair (e.g., mutant in a DNA repair gene), attenuated in their tissue tropism (e.g., inlB mutant), and/ or attenuated
in their ability to spread from cell to cell {e.g., actA mutant). In a specific embodiment, the attenuated Listeria bacteria comprise a mutation (e.g., a deletion, addition or substitution) in one or more internalins (e.g., inlA and/or inlB), and such mutation results in or contributes to the attenuation of the Listeria. In another embodiment, the attenuated Listeria bacteria are attenuated in their tissue tropism (e.g., MB mutant) and in their ability to spread from cell to cell (e.g., actA mutant). In a preferred embodiment, the attenuated Listeria bacteria comprise a mutation (e.g., a deletion, addition or substitution) in internalin B and a mutation in actA, and such mutations result in or contribute to the attenuation of the Listeria. [0035] The Listeria-based EphA2 immunogenic compositions of the invention may have one or a plurality of EphA2 antigenic peptide-expressing Listeria. In a specific embodiment, a immunogenic composition of the invention has 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more EphA2 antigenic peptide-expressing Listeria, or 2-5, 2-10, 2-20, 10-20, or 15-25 EphA2 antigenic peptide-expressing Listeria. In certain embodiments, the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprise the full-length EphA2 sequence. In some embodiments, the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprises (or consists of) the extracellular (ECD or EX) and cytoplasmic (ICD or CO) domains of EphA2, joined together, and the peptide has a lysine to methionine substitution at position 646. In accordance with this embodiment, the transmembrane domain is deleted. In some embodiments, the EphA2 antigenic peptide of one or more of the EphA2 antigenic peptide-expressing Listeria comprises the extracellular domain of EphA2 or a fragment thereof. In some embodiments, the EphA2 antigenic peptide of one or more EphA2 antigenic peptide-expressing Listeria comprises the cytoplasmic domain or a fragment thereof, and, in certain embodiments, the peptide has a lysine to methionine substitution at position 646.
[0036] The Listeria-based EphA2 immunogenic compositions of the invention comprise Listeria bacteria engineered to express one, two, three or more EphA2 antigenic peptides. In a specific embodiment, an EphA2 antigenic peptide-expressing Listeria expresses 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more EphA2 antigenic peptides, or 2-5, 2- 10, 2-20, 10-20, or 15-25 EphA2 antigenic peptides. In accordance with the invention, any species, strain and/or type of Listeria can be engineered to express one, two, three or more EphA2 antigenic peptides. Non- limiting examples of species of Listeria bacteria include Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes,
Listeria seeligeri and Listeria welshimeri. In a preferred embodiment, the Listeria is Listeria monocytogenes. In another preferred embodiment, the Listeria are attenuated. [0037] In one aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from a single Listeria locus that is not required for growth and spread of the Listeria. In another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from a single Listeria locus that is required for growth and spread of the Listeria {e.g., the actA locus). In a specific embodiment, Listeria, preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from a single Listeria locus that is a virulence gene. Non-limiting examples of such Listeria locus include actA, intemalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl. Non- limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. In a preferred embodiment, the locus is the actA locus or the inlB locus. [0038] In accordance with the invention, Listeria may be engineered to express two EphA2 antigenic peptides from a single locus using a vector comprising a bicistronic expression cassette. In a specific embodiment, the bicistronic expression cassette comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non- limiting examples of promoters); (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising an EphA2 immunodominant epitope. In more specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to
75, 1 to 100, 1 to 125, or 1 to 150 of actA. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[0039] In one aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are not required for growth and spread of the Listeria. In another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are required for growth and spread of the Listeria {e.g., the actA locus). In a further aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more loci are required for growth and spread of the Listeria and one or more loci are not required for growth and spread of the Listeria. [0040] In one embodiment, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more loci are virulence genes. Non-limiting examples of such Listeria loci include actA, intemalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, My, plcA, pcLB, and mpl. m a specific embodiment, Listeria, preferably attenuated Listeria, are engineered to express 2 or more EphA2 antigenic peptides from two Listeria loci. In a preferred embodiment, the loci are the actA locus and the inlB locus. In accordance with the invention, Listeria may be engineered to express multiple EphA2 antigenic peptides from multiple loci using multiple vectors. In a specific embodiment, these vectors may comprise monocistronic, bicistronic and/or polycϊstronic expression cassettes. In a preferred embodiment, attenuated Listeria are engineered to express two EphA2 antigenic peptides, wherein the first EphA2 antigenic peptide is expressed from the actA locus and the second EphA2 antigenic peptide is expressed from the inlB locus.
[0041] In a specific embodiment of the invention, Listeria, preferably attenuated
Listeria, are engineered to express two EphA2 antigenic peptides from two Listeria loci. In a specific embodiment, the Listeria loci are required for growth and spread of the Listeria. In a specific embodiment, attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the MB locus. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. In a preferred embodiment, attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the MB locus, wherein the first EphA2 antigenic peptide comprises the
extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA, and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPa signal peptide. In a specific embodiment, the first EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO:122), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO: 119). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. [0042] In accordance with the invention, Listeria may be engineered to express two EphA2 antigenic peptides from two loci using two vectors, each vector comprising a monocistronic expression cassette. In a specific embodiment, each monocistronic construct comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters); (2) a Shine-Dalgarno sequence; and (3) a nucleotide sequence encoding an EphA2 antigenic peptide. The two monocistronic expression cassettes may or may not comprise the same EphA2 antigenic peptide. In a specific embodiment, the expression cassettes comprise different EphA2 antigenic peptides. In a specific embodiment, one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably human EphA2) or a fragment thereof and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably human EphA2) or a fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptides are fusion proteins comprising a signal peptide. Non-limiting examples of signal peptides are provided in Section 5.2.3.3.1 below. In a preferred embodiment, one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA, and the other expression cassette
comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 or a fragment thereof with, in certain embodiments, a lysine to methionine substitution at position 646 and a BaPa signal peptide. In a specific embodiment, the first EphA2 antigenic peptide comprises the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NOrIlO), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ED NO: 122), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO:119). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. The two vectors are preferably integrated into the Listeria genome. [0043] In one aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus that is not required for growth and spread of the Listeria.. In another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus that is required for growth and spread (e.g., the actA locus) of the Listeria. In a specific embodiment, Listeria, preferably attenuated Listeria, are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus that is a virulence gene. Non-limiting examples of such
Listeria loci include actA, intemalin (ml) A, MB, inlC, inlD, inlD, inlE, inlF, iήlG, inlH, My, plcA, pclB, and mpl. In a specific embodiment, attenuated Listeria are engineered to express three or more EphA2 antigenic peptides from the actA or inlB locus. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0044] In accordance with the invention, Listeria may be engineered to express three or more EphA2 antigenic peptides from a single locus using a vector comprising a polycistronic expression cassette. In a specific embodiment, the polycistronic expression cassette comprises the following elements: (1) a single prokaryotic promoter regulating the expression of all of the EphA2 antigenic peptides; (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide); (7) a Shine-Dalgarno sequence; and (8) a third nucleotide sequence encoding a third EphA2 antigenic peptide (which may or may not be different from the
first and/or second EphA2 antigenic peptides). In certain embodiments, the EphA2 antigenic peptides comprise EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA. In a specific embodiment, one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. The two vectors are preferably integrated into the Listeria genome. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0045] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EρhA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a
specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA. In a specific embodiment, one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0046] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a first nucleotide sequence encoding a first EphA2 antigenic peptide and a second nucleotide sequence encoding a second EphA2 antigenic peptide. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or
1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO:122). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[0047] The present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, one or more of the nucleic acids is integrated into the Listeria chromosomal DNA. In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the nucleic acids are integrated into the Listeria chromosomal DNA. Li a specific embodiment, the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. hi a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising the extracellular domain of EphA2 (preferably human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria monocytogenes recognize the GUG
codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. The two vectors are preferably integrated into the Listeria genome. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0048] In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof. In another embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 has been substituted for lysine, m yet another embodiment, the second EphA2 antigenic peptide is an immunodominant epitope of the EphA2 intracellular domain. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In accordance with these embodiments, the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA. In a specific embodiment, the first and/or second EphA2 antigenic peptides may be fusion proteins comprising EphA2 (preferably human EphA2) or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100 (SEQ ID NO: 110), 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria monocytogenes recognize the GUG codon corresponding to the translation initiation site at residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of signal peptides are provide below in Section 5.2.3.3.1.
[0049] In a preferred embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide that is a
fusion protein comprising the first 100 amino acid residues of actA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with a lysine to methionine substitution at amino acid residue 646. In a specific embodiment, the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 110) and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPA signal peptide (SEQ ID NO:84 or SEQ ID NO: 119) and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with a lysine to methionine substitution at amino acid residue 646. In accordance with these embodiments, the first and/or second nucleic acids may be integrated into the Listeria chromosomal DNA. In a preferred embodiment, the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the MB locus. In a further embodiment, the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine.
[0050] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EρhA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific
embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EρhA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non- limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0051] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EρhA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein
comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA of Listeria monocytogenes 10403S (SEQ ED NO: 122). In a further embodiment, the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[0052] The present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, one or more of the nucleic acids is integrated into the Listeria chromosomal DNA. In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, and the second nucleic acid comprises a second EphA2 antigenic peptide cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the nucleic acids are integrated into the Listeria chromosomal DNA. In a specific embodiment, the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In one embodiment, the fusion protein comprises an immunodominant epitope of EphA2. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof
and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ED NO: 122). In a further embodiment, the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0053] In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof. In another embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first
EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine. In a specific embodiment, the second EphA2 antigenic peptide is an immunodominant epitope of EphA2 intracellular domain. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In accordance with these embodiments, the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In a specific embodiment, the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA of Listeria monocytogenes 10403S (SEQ ID NO: 122). In a further embodiment, the Listeria recognize the GUG codon corresponding to the translation initiation site at amino acid residue 1 of ActA and encode a methionine at residue 1 instead of valine. Non-limiting examples of signal peptides are provided below in Section 5.2.3.3.1.
[0054] In a preferred embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide expression cassette comprising a promoter and a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of actA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 antigenic peptide expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine. In accordance with this embodiment, the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA. In a preferred embodiment, the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the inlB locus. [0055] The Listeria-based EphA2 immunogenic compositions are useful to produce antibodies which can be used in diagnostic immunoassays, passive immunotherapy and the generation of antiidiotypic antibodies. The Listeriα-based EphA2 immunogenic compositions of the invention are also useful for eliciting an immune response against an EphA2-expressing cell. The Listeriα-based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of disorders associated with aberrant expression (e.g., overexpression) of EphA2. The Listeriα-based EphA2 immunogenic compositions of the invention are useful for eliciting an immune response against EphA2 expressed on neovasculature. [0056] The Listeriα-based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of hyperproliferative (neoplastic and non-neoplastic). The Listeriα-based EphA2 immunogenic compositions of the invention are useful for the prevention, treatment and management of disorders associated with aberrant angiogenesis. [0057] The present invention provides methods of eliciting an immune response against an EphA2-expressing cell, said method comprising administering to an individual a Listeriα-based EphA2 immunogenic composition in an amount effective to elicit an immune response against an EphA2-expressing cell. The present invention also provides Listeriα-based EphA2 immunogenic compositions useful for eliciting an immune response
against an EphA2-exρressing cell and/or for treating, preventing or managing a hyperproliferative disorder of EphA2-expressing cells.
[0058] The present invention provides a method of treating, preventing and/or managing a hyperproliferative disorder of EphA2-expressing cells, said method comprising administering to a subject a Listeria-based EphA2 immunogenic composition in an amount effective treat or prevent the hyperproliferative disorder (e.g., a neoplastic hyperproliferative disorder and a non-neoplastic hyperproliferative disorder). In certain embodiments, the hyperproliferative disease is cancer. In certain embodiments, the cancer is of an epithelial cell origin and/or involves cells that overexpress EphA2 relative to non- cancer cells having the tissue type of said cancer cells. In specific embodiments, the cancer is a cancer of the skin, lung, colon, breast, ovary, esophageal, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma. In yet other embodiments, the cancer is of a T cell origin. In specific embodiments, the cancer is a leukemia or a lymphoma. In yet other embodiments, the hyperproliferative disorder is non-neoplastic. In specific embodiments, the non-neoplastic hyperproliferative disorder is an epithelial cell disorder. Exemplary non-neoplastic hyperproliferative disorders are asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis. In certain embodiments, the hyperproliferative disease is an endothelial cell disorder. [0059] In a preferred embodiment, the methods of the invention are used to prevent, treat and/or manage EphA2-expressing tumor metastases, hi a preferred embodiment, the EphA2-expressing cells against which an immune response is sought ("target cells") overexpress EphA2 relative to a normal healthy cell of the same type as assessed by an assay described herein or known to one of skill in the art (e.g., an immunoassay such as an ELISA or a Western blot, a Northern blot or RT-PCR). In a preferred embodiment, less EphA2 on the target cells is bound to ligand compared to a normal, healthy cell of the same type, either as a result of decreased cell-cell contacts, altered subcellular localization, or increases in amount of EphA2 relative to ligand. In another embodiment, approximately 10% or less, approximately 15% or less, approximately 20% or less, approximately 25% or less, approximately 30% or less, approximately 35% or less, approximately 40% or less, approximately 45% or less, approximately 50% or less, approximately 55% or less, approximately 60% or less, approximately 65% or less, approximately 70% or less, approximately 75% or less, approximately 80% or less, approximately 85% or less, approximately 90% or less, or
approximately 95% or less of EphA2 on the target cells is bound to ligand {e.g., EphrinAl) compared to a normal, healthy cell of the same type as assessed by an assay known in the art (e.g., an immunoassay). In another embodiment, 1-10 fold, 1-8 fold, 1-5 fold, 1-4 fold or 1-2 fold, or 1 fold, 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, or 10 fold less EphA2 on target cells is bound to ligand (e.g., EphrinAl) compared to a normal, healthy cell of the same type as assessed by an assay known in the art (e.g., an immunoassay). [0060] In other embodiments, the Listeria-based EphA2 immunogenic compositions of the invention are used to treat, prevent and/or manage a non-cancer disease or disorder associated with cell hyperproliferation, such as but not limited to asthma, chronic obstructive pulmonary disease, restenosis (smooth muscle and/or endothelial), psoriasis, etc. In preferred embodiments, the hyperproliferative cells are epithelial. In preferred embodiments, the hyperproliferative cells overexpress EphA2. In another preferred embodiment, some (e.g., 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 75% or less, 85% or less) EphA2 is not bound to ligand as assessed by an assay known in the art (e.g., an immunoassay), either as a result of decreased cell-cell contacts, altered subcellular localization, or increases in the amount of EphA2 relative to EphA2-ligand. [0061] The present invention provides methods of treating, preventing and/or managing a disorder associated with or involving aberrant angiogenesis comprising administering to a subject in need thereof a Listeriα-based EphA2 immunogenic composition in an amount effective to treat, prevent and/or manage a disorder associated with or involving aberrant angiogenesis. Examples of such diseases include, but are not limited to, macular degeneration, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, infantile hemangioma, verruca vulgaris, psoriasis, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis and coronary artery disease. [0062] The methods of the present invention encompass combination therapy with a Listeriα-based EphA2 immunogenic composition and one or more additional therapies, for example an additional anti-cancer therapy. In certain embodiments, the additional anti-cancer therapy is an agonistic EρhA2 antibody, i.e., antibody that binds to EphA2 and induces signaling and phosphorylation of EphA2. In other embodiments, the additional
anti-cancer therapy is an anti-idiotype of an anti-EphA2 antibody. In yet other embodiments, the additional anti-cancer therapy is chemotherapy, biological therapy, immunotherapy, radiation therapy, hormonal therapy, or surgery.
[0063] In certain aspects of the present invention, the Listeria-based immunogenic compositions of the invention are administered in combination with a therapy that increases EphA2 internalization. In specific embodiments, the agent is an EphA2 agonist, for example an antibody, peptide (see, e.g., Koolpe et ah, 2002, J. Biol. Chem. 277(49):46974-46979) or small molecule. In other specific embodiments, the agent is an inhibitor of a phosphatase that modulates EphA2, e.g., low molecular weight tyrosine phosphatase (LMW-PTP).
[0064] The immunogenic compositions of the invention can be administered to a subject, for example, by mucosal, intranasal, parenteral, intramuscular, intravenous, oral or intraperitoneal routes. In a specific embodiment, the immunogenic compositions of the invention are administered locally to the site of a disease, by, e.g., implantation or intratumoral injection. For example, for intravenous administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 10u CFU, 5 x 10u CFU or 1012 CFU. For intramuscular administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 10s CFU, 5 x 10s CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 1011 CFU, 5 x 1011 CFU or 1012 CFU. For subcutaneous administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 10s CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 101 ' CFU, 5 x lθ" CFU or 1012 CFU. For intradermal administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 1011 CFU, 5 x 10n CFU or 1012 CFU. In certain embodiments, the dosage is an absolute amount. In other embodiments, the dosage is converted to an appropriate dosage for a human based on the specified dosages used in a mouse model. [0065] The present invention provides nucleic acids useful for the production of the EphA2-expressing Listeria used in the manufacture of an Listeria-based EphA2 immunogenic composition. In particular, the present invention provides a nucleic acid
comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3,1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the signal sequence of BaPA. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [0066] The present invention provides a nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or
fragment thereof and the signal sequence of BaPA. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[0067] The present invention also provides kits comprising the immunogenic compositions of the invention.
3.1. DEFINITIONS
[0068] As used herein, the term "Listeria-based EphA2 immunogenic composition" refers to a Listeria bacterium that has been engineered to express an EphA2 antigenic peptide, or a composition comprising such a bacterium. In one embodiment, the Listeria-based EphA2 immunogenic compositions of the invention, when administered in an effective amount, elicit an immune response against EphA2 on hyperproliferative cells. In another embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention, when administered in an effective amount, elicit an immune response against EphA2 on endothelial cells. In certain embodiments, the immunogenic composition is a vaccine. [0069] As used herein, the term "Listeria" refers to a bacterium of the genus
Listeria, including any species therein. The term also refers to any strain or type of Listeria, including naturally occurring and modified Listeria. Species of Listeria bacteria include, but are not limited to, Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri. In a preferred embodiment, the Listeria is Listeria monocytogenes. The Listeria may be attenuated. In a specific embodiment, the Listeria is a modified Listeria monocytogenes and has deletions in one, two or more virulence genes. In a preferred embodiment, the Listeria is a modified strain of the Listeria monocytogenes strain DP-L4056 that has been modified by deleting the coding sequence of the virulence genes actA and inlB. In a specific embodiment, the Listeria is electrocompetent.
[0070] As used herein, the terms "EphA2 antigenic peptide" and "EphA2 antigenic polypeptide" refer to: (i) an EphA2 polypeptide, preferably SEQ ID NO:2, or a fragment, analog or derivative thereof comprising one or more B cell epitopes or T cell epitopes of EphA2; and/or (ii) a fusion protein comprising an EphA2 polypeptide, preferably SEQ ID NO:2, or a fragment, analog or derivative thereof comprising one or more B cell epitopes or T cell epitopes of EphA2. The EphA2 polypeptide may be from any species. In certain embodiments, an EphA2 polypeptide refers to the mature, processed form of EphA2. In other embodiments, an EphA2 polypeptide refers to an immature form of EphA2. In
certain embodiments of the invention, an EphA2 antigenic peptide is fused to a signal peptide. In a specific embodiment, the nucleotide sequence encoding EphA2 and/or the signal peptide may be codon optimized. See, for example, U.S. Application Publication No. US 2005/0249748. [0071] The nucleotide and/or amino acid sequences of EphA2 polypeptides can be found in the literature or public databases, or the nucleotide and/or amino acid sequences can be determined using cloning and sequencing techniques known to one of skill in the art. For example, the nucleotide sequence of human EphA2 can be found in the GenBank database (see, e.g., Accession Nos. BC037166, M59371 and M36395). The amino acid sequence of human EphA2 can be found in the GenBank database (see, e.g. , Accession Nos. NP_004422, AAH37166 and AAA53375). Additional non-limiting examples of amino acid sequences of EphA2 are listed in Table 1, infra.
[0072] Table 1
[0073] In certain embodiments, the EphA2 antigenic peptides are not one or more of the following peptides: TLADFDPRV (SEQ ID NO:3); VLLLVLAGV (SEQ DD NO:4); VLAGVGFFI (SEQ ID NO:5); IMNDMPIYM (SEQ ID NO:6); SLLGLKDQV (SEQ ID NO:7); WLVPIGQCL (SEQ ID NO:8); LLWGCALAA (SEQ ID NO:9); GLTRTSVTV (SEQ ED NO: 10); NLYYAESDL (SEQ ID NO: 11); KLNVEERSV (SEQ BD NO: 12); IMGQFSHHN (SEQ ID NO: 13); YSVCNVMSG (SEQ ID NO: 14); MQNIMNDMP (SEQ DD NO: 15); EAGIMGQFSHHNIIR (SEQ LD NO: 16); PIYMYSVCNVMSG (SEQ ED NO: 17); DLMQNIMNDMPIYMYS (SEQ ID NO: 18). In certain specific embodiments, the EphA2 antigenic peptide is not any of SEQ ID NOS :3- 12, is not any of SEQ ID NOS:13-15, and/or is not any of SEQ ED NOS.16-18. In yet another specific embodiment, the EphA2 antigenic peptide is not any of SEQ ID NOS:3- 18.
[0074] As used herein, the term "analog" in the context of a proteinaceous agent
(e.g., a peptide, polypeptide, protein or antibody) refers to a proteinaceous agent that possesses a similar or identical function as a second proteinaceous agent (e.g., an EphA2
polypeptide) but does not necessarily comprise a similar or identical amino acid sequence or structure of the second proteinaceous agent. A proteinaceous agent that has a similar amino acid sequence refers to a proteinaceous agent that satisfies at least one of the following: (a) a proteinaceous agent having an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least
65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequence of a second proteinaceous agent; (b) a proteinaceous agent encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding a second proteinaceous agent of at least 20 amino acid residues, at least 30 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, at least 125 amino acid residues, or at least 150 amino acid residues; and (c) a proteinaceous agent encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the nucleotide sequence encoding a second proteinaceous agent. A proteinaceous agent with similar structure to a second proteinaceous agent refers to a proteinaceous agent that has a similar secondary, tertiary or quaternary structure of the second proteinaceous agent. The structure of a proteinaceous agent can be determined by methods known to those skilled in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy. Preferably, the proteinaceous agent has EphA2 activity. [0075] To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions/total number of positions x 100%). In one embodiment, the two sequences are the same length.
[0076] The determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. ScL U.S.A. 87: 2264-2268, modified as in Karlin and Altschul, 1993 , Proc. Natl. Acad. ScL U.S.A. 90: 5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et ah, 1990, J. MoI. Biol. 215: 403. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score- 50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al, 1997, Nucleic Acids Res. 25: 3389-3402. Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-B last programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., the NCBI website). Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4: 11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis are known in the art and include ADVANCE and ADAM as described in Torellis and Robotti, 1994, Comput. Appl. Biosci. 10:3-5; and FASTA described in Pearson and Lipman,1988, Proc Natl Acad Sci USA 85:2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the search. If ktup = 2, similar regions in the two sequences being compared are found by looking at pairs of aligned residues; if ktup = 1, single aligned amino acids are examined, ktup can be set to 2 or 1 for protein sequences, or from 1 to 6 for DNA sequences. The default if ktup is not specified is 2 for proteins and 6 for DNA. For a further description of FASTA parameters, see, e.g., the parameters provided by the Institut Pasteur Biological software website (e.g., http://bioweb.pasteur.fr/docs/man/man/fasta.1.html#sect2).
[0077] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.
[0078] As used herein, the term "analog" in the context of a non-proteinaceous analog refers to a second organic or inorganic molecule which possesses a similar or identical function as a first organic or inorganic molecule and is structurally similar to the first organic or inorganic molecule.
[0079] As used herein, the terms "attenuated" and "attenuation" refer to a modifϊcation(s) so that the Listeria are less pathogenic. The end result of attenuation is that the risk of toxicity as well as other side effects is decreased when the Listeria are administered to a subject. Attenuation of the Listeria can be measured in terms of biological effects of the Listeria on a host. The pathogenicity of a Listeria strain can be assessed by measurement of the LD50 in mice or other vertebrates. The LD50 is the amount, or dosage, of Listeria injected into vertebrates necessary to cause death in 50% of the vertebrates. The LD50 values can be compared for Listeria having a particular modification (e.g., a mutation) versus Listeria without the particular modification as a measure of the level of attenuation. For example, if the Listeria strain without a particular mutation has an LD50 of 103 bacteria and the Listeria strain having the particular mutation has an LD50 of 105 bacteria, the strain has been attenuated so that is LD50 is increased 100- fold or by 2 log. Other methods for measuring attenuation are described in U.S.
Publication No. 2004/0228877 and International Publication No. WO 2005/071088, each of which are incorporated herein by reference in their entirety (see, e.g., paragraphs [0279] to [0281] of International Publication No. 2005/071088). [0080] As used herein, the term "derivative" in the context of a proteinaceous agent (e.g. , proteins, polypeptides, peptides, and antibodies) refers to a proteinaceous agent that comprises an amino acid sequence which has been altered by the introduction of amino acid residue substitutions, deletions, and/or additions. The term "derivative" as used herein also refers to a proteinaceous agent which has been modified, i.e., by the covalent attachment of a type of molecule to the proteinaceous agent. For example, but not by way of limitation, a derivative of a proteinaceous agent may be produced, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or oύier protein, etc. A derivative of a proteinaceous agent may also be produced by chemical modifications using techniques known to those of skill in the art, including, but
not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of a proteinaceous agent may contain one or more non-classical amino acids. A derivative of a proteinaceous agent possesses an identical function(s) as the proteinaceous agent from which it was derived. [0081] As used herein, the term "derivative" in the context of EphA2 proteinaceous agents refers to a proteinaceous agent that comprises an amino acid sequence of an EphA2 polypeptide or a fragment of an EphA2 polypeptide that has been altered by the introduction of amino acid residue substitutions, deletions or additions (Le., mutations) in a wild-type EphA2 sequence. The term "derivative" as used herein in the context of EphA2 proteinaceous agents also refers to an EphA2 polypeptide or a fragment of an EphA2 polypeptide which has been modified, Le, by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, an EphA2 polypeptide or a fragment of an EphA2 polypeptide may be modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. A derivative of an EphA2 polypeptide or a fragment of an EphA2 polypeptide may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of an EphA2 polypeptide or a fragment of an EphA2 polypeptide may contain one or more non-classical amino acids. In one embodiment, a polypeptide derivative possesses a similar or identical function as an EphA2 polypeptide or a fragment of an EphA2 polypeptide described herein. In another embodiment, a derivative of EphA2 polypeptide or a fragment of an EphA2 polypeptide has an altered activity when compared to an unaltered polypeptide. For example, a derivative of an EphA2 polypeptide or fragment thereof can differ in phosphorylation relative to an EphA2 polypeptide or fragment thereof as assessed by, e.g., an immunoassay such as an immunoprecipitation / Western blot assay. [0082] As used herein, the term "derivative" in the context of a non-proteinaceous agent refers to a second organic or inorganic molecule that is formed based upon the structure of a first organic or inorganic molecule. A derivative of an organic molecule includes, but is not limited to, a molecule modified, e.g., by the addition or deletion of a hydroxyl, methyl, ethyl, carboxyl, nitryl, or amine group. An organic molecule may also, for example, be esterifϊed, alkylated and/or phosphorylated.
[0083] As used herein, the term "EphrinAl polypeptide" refers to: (i) EphrinAl, an analog, derivative or a fragment thereof; and/or (ii) a fusion protein comprising EphrinAl, an analog, derivative or a fragment thereof. The EphrinAl polypeptide may be from any species. In certain embodiments, the term "EphrinAl polypeptide" refers to the mature, processed form of EphrinAl. In other embodiments, the term "EphrinAl polypeptide" refers to an immature form of EphrinAl.
[0084] The nucleotide and/or amino acid sequences of EphrinAl polypeptides can be found in the literature or public databases, or the nucleotide and/or amino acid sequences can be determined using cloning and sequencing techniques known to one of skill in the art. For example, the nucleotide sequence of human EphrinAl can be found in the GenBank database (see, e.g., Accession No. BC032698). The amino acid sequence of human EphrinAl can be found in the GenBank database (see, e.g., Accession No. AAH32698). Additional non-limiting examples of amino acid sequences of EphrinAl are listed in Table 2, infra.
Table 2
[0085] In a specific embodiment, a EphrinAl polypeptide is EphrinAl from any species. In a preferred embodiment, an EphrinAl polypeptide is human EphrinAl. [0086] As used herein, the terms "about" or "approximately" unless otherwise indicated, refer to a value that is no more than 10% above or below the value being modified by the term.
[0087] As used herein, the term "effective amount" refers to the amount of a therapy {e.g., a prophylactic or therapeutic agent) which is sufficient to reduce and/or ameliorate the severity and/or duration of a disorder (e.g., cancer, a non-neoplastic hyperproliferative cell disorder or a disorder associated with aberrant angiogenesis) or a symptom thereof, prevent the advancement of said disorder, cause regression of said disorder, prevent the recurrence, development, or onset of one or more symptoms associated with said disorder, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy {e.g. , prophylactic or therapeutic agent).
[0088] As used herein, the term "B cell epitope" refers to a fragment of an EphA2 polypeptide having antigenic or immunogenic activity in an animal, preferably in a
mammal, and most preferably in a mouse or a human. An epitope having immunogenic activity is a fragment of an EphA2 polypeptide that elicits an antibody response in an animal. An epitope having antigenic activity is a fragment of an EphA2 polypeptide to which an antibody immunospecifically binds as determined by any method well known in the art, for example, by immunoassays. Antigenic epitopes need not necessarily be immunogenic.
[0089] As used herein, the term "T cell epitope" refers to at least a fragment of an
EphA2 polypeptide, preferably an EphA2 polypeptide of SEQ ED NO:2, that is recognized by a T cell receptor. The term "T cell epitope" encompasses helper T cell (Th) epitopes and cytotoxic T cell (Tc) epitopes. The term "helper T cell epitopes" encompasses ThI and Th2 epitopes.
[0090] As used herein, the term "fragment" refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least contiguous 80 amino acid residues, at least contiguous 90 amino acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of peptide or polypeptide. In certain embodiments, a fragment of a peptide or polypeptide is 5-150 contiguous amino acid residues, 5-125 contiguous amino acid residues, 5-100 contiguous amino acid residues, 5-75 contiguous amino acid residues, 5- 50 contiguous amino acid residues, 5-25 contiguous amino acid residues, 10-150 contiguous amino acid residues, 10-125 contiguous amino acid residues, 10-100 contiguous amino acid residues, 10-75 contiguous amino acid residues, 10-50 contiguous amino acid residues, 10-25 contiguous amino acid residues, 8-25 contiguous amino acid residues, 9-25 contiguous amino acid residues, 11-25 contiguous amino acid residues, 12- 25 contiguous amino acid residues, 13-25 contiguous amino acid residues, 50-200 contiguous amino acid residues, 50-150 contiguous amino acid residues, 25-100 contiguous amino acid residues, 25-150 contiguous amino acid residues, 100-200 contiguous amino acid residues, 100-150 contiguous amino acid residues, or 150-200 contiguous amino acid residues. Generally, a fragment will not be the full-length protein.
[0091] As used herein, the term "fragment" in the context of EphA2 polypeptides include an EphA2 antigenic peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 6 contiguous amino acid residues, at least 7 contiguous amino acid residues, at least 8 contiguous amino acid residues, at least 9 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 11 contiguous amino acid residues, at least 12 contiguous amino acid residues, at least 13 contiguous amino acid residues, at least 14 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 45 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 110 contiguous amino acid residues, at least 120 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 140 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 160 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 180 contiguous amino acid residues, at least 190 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of an EphA2 polypeptide. [0092] As used herein, the term "fusion protein" refers to a polypeptide or protein that comprises the amino acid sequence of a first polypeptide or protein or fragment, analog or derivative thereof, and the amino acid sequence of a heterologous polypeptide or protein. In one embodiment, a fusion protein comprises a prophylactic or therapeutic agent fused to a heterologous protein, polypeptide or peptide. In accordance with this embodiment, the heterologous protein, polypeptide or peptide may or may not be a different type of prophylactic or therapeutic agent. For example, two different proteins, polypeptides, or peptides with immunomodulatory activity may be fused together to form a fusion protein. In a preferred embodiment, fusion proteins retain or have improved activity relative to the activity of the original polypeptide or protein prior to being fused to a heterologous protein, polypeptide, or peptide.
[0093] As used herein, the term "heterologous," in the context of a nucleic acid sequence {e.g., a gene) or an amino acid sequence (e.g., a peptide, polypeptide or protein) refers a nucleic acid sequence or an amino acid sequence that is not found in nature to be
associated with a second nucleic acid sequence or a second amino acid sequence (e.g., a nucleic acid sequence or an amino acid sequence derived from a different species). [0094] As used herein, the terms "hyperproliferative cell disorder,"
"hyperproliferative cell disease," "hyperproliferative disorder," and "hyperproliferative disease" and analogous terms refer to a disorder in which cellular hyperproliferation or any form of excessive cell accumulation causes or contributes to the pathological state or symptoms of the disorder. In some embodiments, the hyperproliferative cell disorder is characterized by hyperproliferating epithelial cells. In other embodiments, the hyperproliferative cell disorder is characterized by hyperproliferating endothelial cells. In other embodiments, the hyperproliferative cell disorder is characterized by hyperproliferating fibroblasts. In certain embodiments, the hyperproliferative cell disorder is not neoplastic. Exemplary non-neoplastic hyperproliferative cell disorders are asthma, chronic pulmonary obstructive disease, fibrosis (e.g., lung, liver, and kidney fibrosis), bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis. In a preferred embodiment, the hyperproliferative cell disorder is characterized by hyperproliferating cells that express (preferably, overexpress) EphA2.
[0095] As used herein, the term "immunospecifically binds to EphA2" and analogous terms (e.g., "react specifically with EphA2" or "binds specifically to EphA2") refer to agents (e.g., peptides, polypeptides, proteins, fusion proteins, and antibodies or fragments thereof) that specifically bind to EphA2 or one or more fragments thereof and do not specifically bind to or has lower binding affinity for other receptors or fragments thereof. The terms "immunospecifically binds to EphrinAl" and analogous terms (e.g., "react specifically with EphrinAl" or "binds specifically to EphrinAl") refer to agents (e.g., peptides, polypeptides, proteins, fusion proteins, and antibodies or fragments thereof) that specifically bind to EphrinAl or one or more fragments thereof and do not specifically bind to or has lower binding affinity for other ligands or fragments thereof. An agent (e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof) that immunospecifically binds to EphA2 or EphrinAl, or fragments thereof, may bind to other peptides, polypeptides, or proteins with lower affinity as determined by, e.g., immunoassays or other assays known in the art to detect binding affinity. An agent (e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof) that immunospecifically bind to EphA2 or EphrinAl may be cross-reactive with related antigens. Preferably, antibodies or fragments thereof that immunospecifically bind to EphA2 or EphrinAl can be identified, for example, by
immunoassays or other techniques known to those of skill in the art. An agent (e.g., a peptide, a polypeptide, a protein, a fusion protein, and an antibody or a fragment thereof) binds specifically to EphA2 or EphrinAl when it binds to EphA2 or EphrinAl with higher affinity than to any cross-reactive antigen as determined using experimental techniques, such as radioimmunoassays (RIAs) and enzyme-linked immunosorbent assays (ELISAs).
See, e.g., Paul, ed., 1989, Fundamental Immunology, 2nα< ed., Raven Press, New York at pages 332-336 for a discussion regarding antibody specificity. In a preferred embodiment, an antibody that immunospecifically binds to EphA2 or EphrinAl does not bind or cross- react with other antigens. In another embodiment, an antibody that binds to EphA2 or EphrinAl that is a fusion protein specifically binds to the portion of the fusion protein that is EphA2 or EphrinAl, or a fragment thereof.
[0096] As used herein, the terms "antibody" and "antibodies" refer to molecules that contain an antigen binding site, e.g., immunoglobulins. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGi, IgG2, IgG3, IgG4, IgAi and IgA2) or subclass. Antibodies of the invention include, but are not limited to, synthetic antibodies, monoclonal antibodies, recombinantly produced antibodies, multispecific antibodies (including bi-specific antibodies), human antibodies, humanized antibodies, chimeric antibodies, intrabodies, single-chain Fvs (scFv) (e.g., including monospecific and bi-specific, etc.), Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. .
[0097] As used herein, the term "isolated" in the context of an organic or inorganic molecule (whether it be a small or large molecule), other than a proteinaceous agent or a nucleic acid, refers to an organic or inorganic molecule substantially free of a different organic or inorganic molecule (also referred to as "contaminating organic or inorganic molecule"). Preferably, an organic or inorganic molecule is 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% free of a second, different organic or inorganic molecule. In a preferred embodiment, an organic and/or inorganic molecule is isolated. The amount of a contaminating organic or inorganic molecule can be determined by methods known to one of skill in the art, e.g. , high performance liquid chromatography (HPLC), differential scanning calorimetry, etc.
[0098] As used herein, the term "isolated" in the context of a proteinaceous agent
(e.g., a peptide, polypeptide, fusion protein, or antibody) refers to a proteinaceous agent
which is substantially free of cellular material or contaminating proteins from the cell or tissue source from which it is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a proteinaceous agent in which the proteinaceous agent is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a proteinaceous agent that is substantially free of cellular material includes preparations of a proteinaceous agent having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein, polypeptide, peptide, or antibody (also referred to as a "contaminating protein"). When the proteinaceous agent is recombinantly produced, it is also preferably substantially free of culture medium, Le. , culture medium represents less than about 20%, 10%, or 5% of the volume of the proteinaceous agent preparation. When the proteinaceous agent is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, Le., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the proteinaceous agent. Accordingly, such preparations of a proteinaceous agent have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the proteinaceous agent of interest. In a specific embodiment, proteinaceous agents disclosed herein are isolated. [0099] As used herein, the term "isolated" in the context of nucleic acid molecules refers to a nucleic acid molecule which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, is preferably substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, nucleic acid molecules described herein are isolated. In certain embodiments, an "isolated" nucleic acid molecule is a nucleic acid molecule that is recombinantly expressed in a heterologous cell. In other embodiments, an "isolated" nucleic acid molecule is a nucleic acid molecule that is substantially free of heterologous nucleic acid sequences. [00100] As used herein, the term "disease" and "disorder" are used interchangeably to refer to a condition.
[00101] As used herein, the term "in combination" in the context of the use of therapies refers to the use of more than one therapies (e.g., prophylactic and/or therapeutic agents). The use of the term "in combination" does not restrict the order in which
therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a hyperproliferative cell disorder, especially cancer. A first therapy (e.g., prophylactic and/or therapeutic agent) can be administered prior to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., prophylactic and/or therapeutic agent) to a subject which had, has, or is susceptible to a hyperproliferative cell disorder, especially cancer. The therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject in a sequence and within a time interval such that the agent of the invention can act together with the other agent to provide an increased benefit than if they were administered otherwise. Any additional therapy (e.g., prophylactic and/or therapeutic agent) can be administered in any order with the other additional therapy (e.g., prophylactic and/or therapeutic agent).
[00102] As used herein, the phrase "low tolerance" in the context of the use of a therapy(ies) refers to a state in which the patient suffers from side effects from therapy so that the patient does not benefit from and/or will not continue therapy because the adverse effects and/or the harm from the side effects outweighs the benefit of the therapy.
[00103] As used herein, the terms "manage," "managing" and "management" in the context of administering a therapy(ies) refer to the beneficial effects that a subject derives from administration of a therapy (e.g., prophylactic and/or therapeutic agent), which does not result in a cure of the disease. In certain embodiments, a subject is administered one or more therapies (e.g., prophylactic and/or therapeutic agents) to "manage" a disease so as to prevent the progression or worsening of the disease.
[00104] As used herein, the term "neoplastic" refers to a disease involving cells that have the potential to metastasize to distal sites and exhibit phenotypic traits that differ from those of non-neoplastic cells, for example, formation of colonies in a three- dimensional substrate such as soft agar or the formation of tubular networks or weblike matrices in a three-dimensional basement membrane or extracellular matrix preparation, such as MATRIGEL™. Non-neoplastic cells do not form colonies in soft agar and form distinct sphere-like structures in three-dimensional basement membrane or extracellular matrix preparations. Neoplastic cells acquire a characteristic set of functional capabilities
during their development, albeit through various mechanisms. Such capabilities include evading apoptosis, self-sufficiency in growth signals, insensitivity to anti-growth signals, tissue invasion/metastasis, limitless replicative potential, and sustained angiogenesis. Thus, "non-neoplastic" means that the condition, disease, or disorder does not involve cancer cells.
[00105] As used herein, the phrase "non-responsive/refractory" in the context of the use of a therapy(ies) is used to describe patients treated with one or more currently available therapies (e.g., cancer therapies) such as chemotherapy, radiation therapy, surgery, hormonal therapy and/or biological therapy/immunotherapy, particularly a standard therapeutic regimen for the particular cancer, wherein the therapy is not clinically adequate to treat the patients such that these patients need additional effective therapy, e.g., remain unsusceptible to therapy. The phrase can also describe patients who respond to therapy yet suffer from side effects, relapse, develop resistance, etc. In various embodiments, "non-responsive/refractory" means that at least some significant portion of the cancer cells are not killed or their cell division arrested. The determination of whether the cancer cells are "non-responsive/refractory" can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of treatment on cancer cells, using the art-accepted meanings of "refractory" in such a context. In various embodiments, a cancer is "non-responsive/refractory" where the number of cancer cells has not been significantly reduced, or has increased during the treatment.
[00106] As used herein, the term "overexpress" in the context of EphA2 overexpression means that the gene encoding EphA2 is expressed at a level above that which is expressed by a normal human cell as assessed by an assay described herein or known to one of skill in the art (e.g. , an immunoassay such as an ELISA or Western blot, a Northern blot, or RT-PCR). Overexpression can also result from protein stabilization. In certain embodiments, EphA2 is overexpressed if there is a 10% to 15%, 15% to 25%, 25% to 50%, 25% to 75%, 25% to 100%, or 50% to 100% increase in EphA2 expression by a cell relative to a normal cell of the same type as measured by an immunoassay (e.g., an ELISA). In other embodiments, EρhA2 is overexpressed if there is a 1.5 to 3 fold, 2 to 4 fold, 2 to 5 fold, or 2 to 10 fold increase in EphA2 expression by a cell relative to a normal cell of the same type as measured by an immunoassay (e.g., an ELISA). [00107] As used herein, the term "potentiate" in the context of the use of a therapy(ies) refers to an improvement in the efficacy of a therapy at its common or approved dose.
[00108] As used herein, the terms "prevent," " preventing" and "prevention" in the context of the administration of a therapy(ies) refer to the prevention of the onset, development, recurrence, or spread of a disease in a subject resulting from the administration of a therapy (e.g., prophylactic or therapeutic agent), or a combination of therapies.
[00109] As used herein, the term "prophylactic agent" refers to any agent that can be used in the prevention of the onset, development, recurrence or spread of a disorder (e.g., a disorder associated with EphA2 overexpression, a disorder associated with aberrant angiogenesis and/or a hyperproliferative cell disease, particularly cancer). In certain embodiments, the term "prophylactic agent" refers to a Listeria-based EphA2 immunogenic composition of the invention. In certain other embodiments, the term "prophylactic agent" refers to a therapy other than a Listeriα-hased EphA2 immunogenic composition, e.g., a cancer chemotherapeutic, radiation therapy, hormonal therapy, biological therapy (e.g., immunotherapy), hi other embodiments, more than one prophylactic agent may be administered in combination.
[00110] As used herein, a "prophylacticaliy effective amount" refers to that amount of a therapy (e.g., a prophylactic agent) sufficient to result in the prevention of the onset, development, recurrence or spread of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease, preferably, cancer). A prophylacticaliy effective amount may refer to the amount of therapy (e.g., a prophylactic agent) sufficient to prevent the onset, recurrence or spread of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease, particularly cancer) in a subject including, but not limited to, subjects predisposed to a hyperproliferative cell disease, for example, those genetically predisposed to cancer or previously exposed to carcinogens. A prophylacticaliy effective amount may also refer to the amount of a therapy (e.g., prophylactic agent) that provides a prophylactic benefit in the prevention of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disease). Further, a prophylacticaliy effective amount with respect to a therapy (e.g., prophylactic agent) means that amount of a therapy (e.g., prophylactic agent) alone, or in combination with other therapies (e.g., agents), that provides a prophylactic benefit in the prevention of a disorder (e.g., a disorder associated with aberrant angiogenesis and/or a hyperproliferative cell disease). Used in connection with an amount of a Listeriα-based EphA2 immunogenic composition of the invention, the term can encompass an amount
that improves overall prophylaxis or enhances the prophylactic efficacy of or synergizes with another therapy (e.g., a prophylactic agent).
[00111] As used herein, a "protocol" includes dosing schedules and dosing regimens. [00112] As used herein, the phrase "side effects" encompasses unwanted and adverse effects of a prophylactic or therapeutic agent. Adverse effects are always unwanted, but unwanted effects are not necessarily adverse. An adverse effect from a therapy (e.g., a prophylactic or therapeutic agent) might be harmful or uncomfortable or risky. Side effects from chemotherapy include, but are not limited to, gastrointestinal toxicity such as, but not limited to, early and late-forming diarrhea and flatulence, nausea, vomiting, anorexia, leukopenia, anemia, neutropenia, asthenia, abdominal cramping, fever, pain, loss of body weight, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, xerostomia, and kidney failure, as well as constipation, nerve and muscle effects, temporary or permanent damage to kidneys and bladder, flu-like symptoms, fluid retention, and temporary or permanent infertility. Side effects from radiation therapy include but are not limited to fatigue, dry mouth, and loss of appetite. Side effects from biological therapies/immunotherapies include but are not limited to rashes or swellings at the site of administration, flu-like symptoms such as fever, chills and fatigue, digestive tract problems and allergic reactions. Side effects from hormonal therapies include but are not limited to nausea, fertility problems, depression, loss of appetite, eye problems, headache, and weight fluctuation. Additional undesired effects typically experienced by patients are numerous and known in the art. Many are described in the Physicians' Desk Reference (56th ed., 2002, 57th ed., 2003 and 58th ed., 2004). [00113] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, a subject is preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), most preferably a human. In a specific embodiment, the subject is a non-human animal. In another embodiment, the subject is a farm animal (e.g. , a horse, a pig, a lamb or a cow) or a pet (e.g., a dog, a cat, a rabbit or a bird). In another embodiment, the subject is an animal other than a laboratory animal or animal model (e.g., a mouse, a rat, a guinea pig or a monkey).
[00114] In a preferred embodiment, the subject is a human. In a specific embodiment, the human subject is a newborn (one month or less in age), an infant (one year or less in age), a toddler (1-3 years old), a child (1-12 years old), a teenager (12-18
years old), an adult (18 years or older), or a senior citizen (65 years old or older). In another embodiment, the human subject is not immunocompromised or immunosuppressed. In another embodiment, the subject is a human with a mean absolute lymphocyte count of approximately 500 cells/mm3, approximately 600 cells/mm3, approximately 650 cells/mm3, approximately 700 cells/mm3, approximately 750 cells/mm3, approximately 800 cells/mm3, approximately 850 cells/mm3, approximately 900 cells/mm3, approximately 950 cells/mm3, approximately 1000 cells/mm3, approximately 1050 cells/mm3, approximately 1100 cells/mm3, or approximately 1150 cells/mm3 or approximately 1200 cells/mm3. [00115] As used herein, the terms "treat," "treating" and "treatment" in the context of the administration of a therapy(ies) refer to the eradication, reduction or amelioration of a disorder or a symptom thereof, particularly, the eradication, removal, modification, or control of primary, regional, or metastatic cancer tissue that results from the administration of one or more therapies (e.g., therapeutic agents). The terms also refer to the reduction or amelioration in the progression, severity and/or duration of a disorder or a symptom thereof. In certain embodiments, such terms refer to the minimizing or delaying the spread of cancer resulting from the administration of one or more therapies {e.g., therapeutic agents) to a subject with such a disease. [00116] As used herein, the term "therapeutic agent" refers to any agent that can be used in the treatment, and/or management of a disease (e.g., a disorder associated with overexpression of EphA2 and/or hyperproliferative cell disorder, particularly, cancer). In certain embodiments, the term "therapeutic agent" refers to a Listeria-based EphA2 immunogenic composition of the invention. In certain other embodiments, the term "therapeutic agent" refers to a therapy other than a Listeria-based EphA2 immunogenic composition such as, e.g., a cancer chemotherapeutic, radiation therapy, hormonal therapy, and/or biological therapy/immunotherapy. In other embodiments, more than one therapy (e.g. , a therapeutic agent) may be administered in combination.
[00117] As used herein, a "therapeutically effective amount" refers to that amount of a therapy (e.g., a therapeutic agent) sufficient to treat or manage a disorder (e.g., a disorder associated with EphA2 overexpression, a disorder associated with aberrant angiogenesis and/or hyperproliferative cell disease) and, preferably, the amount sufficient to destroy, modify, control or remove primary, regional or metastatic cancer tissue. A therapeutically effective amount may refer to the amount of a therapy (e.g., a therapeutic agent) sufficient to delay or minimize the onset of a disorder (e.g., hyperproliferative cell
disease), e.g., delay or minimize the spread of cancer. A therapeutically effective amount may also refer to the amount of a therapy (e.g., a therapeutic agent) that provides a therapeutic benefit in the treatment or management of a disorder (e.g., cancer). Further, a therapeutically effective amount with respect to a therapy (e.g., a therapeutic agent) means that amount of a therapy (e.g., therapeutic agent) alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of a disorder (e.g., a hyperproliferative cell disease such as cancer). Used in connection with an amount of a Listeria-based EphA2 immunogenic composition, the term can encompass an amount that improves overall therapy, reduces or avoids unwanted effects, or enhances the therapeutic efficacy of or synergies with another therapy (e.g. , a therapeutic agent).
[00118] As used herein, the term "therapy" refers to any protocol, method and/or agent that can be used in the prevention, treatment and/or management of a disorder (e.g. , a hyperproliferative cell disorder, a disorder associated with aberrant angiogenesis and/or a non-neoplastic hyperproliferative cell disorder) or. a symptom thereof. In certain embodiments, the terms "therapies" and "therapy" refer to a biological therapy, supportive therapy, and/or other therapies useful in treatment, management, prevention, and/or amelioration of a disorder (e.g., a hyperproliferative cell disorder and/or a non-neoplastic hyperproliferative cell disorder) or one or more symptoms thereof known to one of skill in the art such as medical personnel (e.g., a medical doctor or a nurse). [00119] As used herein, the term "synergistic" in the context of the use of a therapy(ies) refers to a combination of therapies (e.g., prophylactic or therapeutic agents) which is more effective than the additive effects of any two or more single therapies (e.g., one or more prophylactic or therapeutic agents). A synergistic effect of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents) permits the use of lower dosages of one or more of therapies (e.g. , one or more prophylactic or therapeutic agents) and/or less frequent administration of said therapies to a subject with a disorder (e.g., a hyperproliferative epithelial and/or endothelial cell disorder). The ability to utilize lower dosages of therapies (e.g., prophylactic or therapeutic agents) and/or to administer said therapies less frequently reduces the toxicity associated with the administration of said therapies to a subject without reducing the efficacy of said therapies in the prevention or treatment of a disorder (e.g., a hyperproliferative cell disorder). In addition, a synergistic effect can result in improved efficacy of therapies (e.g., prophylactic or therapeutic agents) in the prevention or treatment of a disorder (e.g., a disorder associated with aberrant angiogenesis and a hyperproliferative cell disorder). Finally, synergistic
effect of a combination of therapies {e.g., prophylactic or therapeutic agents) may avoid or reduce adverse or unwanted side effects associated with the use of any single therapy. [00120] As used herein, the terms 'T cell malignancies" and "T cell malignancy" refer to any T cell lymphoproliferative disorder, including thymic and post-thymic malignancies. T cell malignancies include tumors of T cell origin. T cell malignancies refer to tumors of lymphoid progenitor cell, thymocyte, T cell, NK-cell, or antigen presenting cell origin. T cell malignancies include, but are not limited to, leukemias, including acute lymphoblastic leukemias, thymomas, acute lymphoblastic leukemias, and lymphomas, including Hodgkin's and non-Hodgkin's disease, with the proviso that T cell malignancies are not cutaneous T cell malignancies, in particular cutaneous-cell lymphomas. In a specific embodiment, T cell malignancies are systemic, non-cutaneous T cell malignancies.
3.2. SEQUENCES
[00121] Below is a brief summary of the sequences presented in the accompanying sequence listing, which is incorporated by reference herein in its entirety:
[00122] SEQ ID NO:1
Human EphA2 (huEphA2) cDNA (full length)
[00123] SEQ ID NO:2
Human EphA2 (huEphA2) polypeptide (full length) [00124] SEQ ID NOs:3-18
Human EphA2 peptides
[00125] SEQ ID NO:19
Construct: LLOss-PEST-hEphA2
Native LLO signal peptide + PEST fused to full-length human EphA2
Not Codon optimized
No epitope tags {e.g., myc or FLAG used in this construct)
Fusion protein coding sequence shown
[00126] SEQ ID NO:20
Construct: LLOss-PEST-hEphA2
Native LLO signal peptide + PEST fused to full-length human EphA2
Not Codon optimized
No epitope tags {e.g., myc or FLAG used in this construct)
Predicted fusion protein shown
[00127] SEQ ID NO:21
EphA2 EX2 domain
Native nucleotide sequence
[00128] SEQ ID NO:22
EphA2 EX2 domain
Nucleotide sequence for optimal codon usage in Listeria
[00129] SEQ ID NO:23
EphA2 EX2 domain
Primary Amino Acid Sequence [00130] SEQ ID NO:24
Construct: LLOss-PEST-EX2_hEphA2
Native LLO signal peptide + PEST fused to external domain of human
EphA2
Not Codon optimized
No epitope tags {e.g., myc or FLAG used in this construct) Fusion protein coding sequence shown
[00131] SEQ ID NO:25
Construct: LLOss-PEST-EX2_hEphA2 Native LLO signal peptide + PEST fused to external domain of human
EphA2
Not Codon optimized
No epitope tags {e.g. , myc or FLAG used in this construct) Predicted fusion protein shown
[00132] SEQ ID NO:26
NativeLLOss-PEST-FLAG-EX2JEphA2-myc-CodonOp (Native L. monocytogenes LLO signal peptide + PEST-Codon optimized
FLAG-EX-2 EphA2-Myc) Nucleotide Sequence (including My promoter)
[00133] SEQ ID NO:27
NativeLLOss-PEST-FLAG~EX2_EphA2-myc-CodonOp (Native L. monocytogenes LLO signal peptide + PEST-Codon optimized
FLAG-EX-2 EphA2-Myc) Primary Amino Acid Sequence
[00134] SEQ ID NO:28
Codon Optimized LLOss-PEST-FLAG-EX2JEρhA2-myc-CodonOρ (Codon Optimized L. monocytogenes LLO signal peptide + PEST-Codon optimized -FLAG-EX-2 EphA2-Myc) Nucleotide Sequence (including hly promoter) [00135] SEQ ID NO.-29
Codon Optimized LLOss-PEST-FLAG-EX2_EphA2-myc-CodonOp (Codon Optimized L. monocytogenes LLO signal peptide + PEST-Codon optimized -FLAG-EX-2 EphA2-Myc) Primary Amino Acid Sequence [00136] SEQ ID NO:30
PhoD-FLAG-EX2_EphA2-myc-CodonOp (Codon optimized B. subtilϊs phoD Tat signal peptide-FLAG-EX-2 EphA2-
Myc)
Nucleotide Sequence (including hly promoter) [00137] SEQ ID NO:31
PhoD-FLAG-EX2_EphA2-myc-CodonOp (Codon optimized B. subtilis phoD Tat signal peptide-FLAG-EX-2 EphA2-
Myc)
Amino acid sequence [00138] SEQ ID NO:32 EphA2 CO domain Native nucleotide sequence
[00139] SEQ ID NO:33 EphA2 CO domain
Nucleotide sequence for optimal codon usage in Listeria [00140] SEQ ID NO.34
EphA2 CO domain Primary Amino Acid Sequence [00141] SEQ ID NO.35
Construct: LLOss-PEST-CO-huEρhA2
Native LLO signal peptide + PEST fused to cytoplasmic domain of human
EphA2
Not Codon optimized No epitope tags (e.g., rnyc or FLAG used in this construct)
Fusion protein coding sequence shown [00142] SEQ ID NO:36
Construct: LLOss-PEST-CO-huEphA2
Native LLO signal peptide + PEST fused to cytoplasmic domain of human EphA2
Not Codon optimized
No epitope tags (e.g.t myc or FLAG used in this construct) Predicted fusion protein shown [00143] SEQ ID NO:37 NativeLLOss-PEST-FLAG-CO_EphA2-myc-CodonOp
(Native L. monocytogenes LLO signal peptide + PEST-Codon optimized -
FLAG-CO_EphA2-Myc) Nucleotide Sequence (including hly promoter) [00144] SEQ ID NO:38 NativeLLOss-PEST-FLAG-CO_EphA2-myc-CodonOp
(Native L. monocytogenes LLO signal peptide + PEST-Codon optimized -
FLAG-CO_EphA2-Myc) Primary Amino Acid Sequence [00145] SEQ ID NO.39 Codon Optimized LLOss-PEST-FLAG-CO_EphA2-myc-CodonOp
(Codon Optimized L. monocytogenes LLO signal peptide + PEST-Codon optimized ~FLAG-CO_EphA2-Myc) Nucleotide Sequence (including hly promoter) [00146] SEQ ID NO:40 Codon Optimized LLOss-PEST-FLAG-CO_EphA2-myc-CodonOp
(Codon Optimized L. monocytogenes LLO signal peptide + PEST-Codon optimized -FLAG-CO_EphA2-Myc) Primary Amino Acid Sequence [00147] SEQ ID NO:41 PhoD-FLAG-CO_EphA2-myc-CodonOp
(Codon optimized B. subtilis phoD Tat signal peptide-FLAG-CO_EphA2-
Myc)
Nucleotide Sequence (including hly promoter) [00148] SEQ ID NO:42
PhoD-FLAG-CO_EphA2-myc-CodonOp
(Codon optimized B. subtilis phoD Tat signal peptide-FLAG-CO_EρhA2-
Myc)
Amino acid sequence [00149] SEQ ID NO:43
Construct: pAM401-MCS
Plasmid pAM401 containing multiple cloning site (MCS) from pPL2 vector
Insertion of small Aat II MCS fragment from pPL2 inserted into pAM401 plasmid between blunted Xba I and Nru I sites. Complete pAM401-MCS plasmid sequence shown
[00150] SEQ ID NO:90
Construct: ActA(N100)-huEphA2 ECD
Native ActA signal peptide + ActA(NlOO) + human EphA2 extracellular domain (ECD) extracellular domain of EphA2 is fused to the ActA signal peptide and the first 100 amino acids of ActA downstream of the actA promoter and inserted in the actA locus Nucleotide sequence [00151] SEQ ID NO:91 Construct: ActA(N100)-huEphA2 ECD
Native ActA signal peptide + ActA(NlOO) + human EphA2 extracellular domain (ECD) extracellular domain of EphA2 is fused to the ActA signal peptide and the first 100 amino acids of ActA downstream of the actA promoter and inserted in the actA locus
Amino acid sequence [00152] SEQ ID NO:92
Construct: BaPa-huEphA2 ICD
BaPa signal peptide + human EphA2 intracellular domain (ICD) intracellular domain of EphA2 is fused to the BaPA signal peptide downstream of My promoter and inserted into the inlB locus Nucleotide sequence [00153] SEQ ID NO:93
Construct: BaPa-huEρhA2 ICD
BaPa signal peptide + human EphA2 intracellular domain (ICD) intracellular domain of EphA2 is fused to the BdPA signal peptide downstream of hly promoter and inserted into the inlB locus Amino acid sequence [00154] SEQ ID NO:94
Construct: ActA(NlOO) human EphA2CO
ActA(NlOO) + huEphA2 ICD intracellular domain of EphA2 fused to the first 100 amino acids of ActA downstream of the actA promoter and inserted into the actA locus Nucleotide sequence
[00155] SEQ ID NO:95
Construct: ActA(NlOO) human EphA2CO ActA(N100) + huEphA2 ICD intracellular domain of EphA2 fused to the first 100 amino acids of ActA downstream of the actA promoter and inserted into the actA locus
Amino acid sequence [00156] SEQ ID NO:96
Construct: BaPA human ExEphA2 BaPa + huEphA2 ECD extracellular domain of EphA2 fused to the BaPa signal peptide downstream of the hly promoter and inserted into the inlB locus Nucleotide sequence [00157] SEQ ID NO:97
Construct: BaPA human ExEphA2 BaPa + huEphA2 ECD extracellular domain of EphA2 fused to the BaPa signal peptide downstream of the hly promoter and inserted into the inlB locus Amino acid sequence [00158] SEQ ID NO:98 Construct: BaPA human EphA2CO
BaPa + huEρhA2 ICD intracellular domain of EphA2 fused to the BaPa signal peptide downstream of the actA promoter and inserted into the actA locus Nucleotide sequence
[00159] SEQ ID NO:99
Construct: BaPA human ExEphCo BaPa + huEρhA2 ICD intracellular domain of EphA2 fused to the BaPa signal peptide downstream of the actA promoter and inserted into the actA locus
Amino acid sequence
4. BRIEF DESCRIPTION OF THE FIGURES
[00160] Figure 1. Listeria intracellular life cycle, antigen presenting cell activation, and antigen presentation. [00161] Figure 2. Western blot analysis of secreted protein from recombinant
Listeria encoding native EphA2 CO domain sequence.
[00162] Figure 3. Western blot analysis of secreted protein from recombinant
Listeria encoding native or codon-optimized LLO sec Al signal peptide fused with codon- optimized EphA2 EX2 domain sequence signal peptide. [00163] Figure 4. Western blot analysis of secreted protein from recombinant
Listeria encoding native or codon-optimized LLO secA2 signal peptide or codon- optimized Tat signal peptide fused with codon-optimized EphA2 CO domain sequence. [00164] Figure 5. Flow cytometry analysis of human EphA2 expression in CT2 murine carcinoma cells. Single cell FACS sorting assays were performed by standard techniques to identify CT26 cell clones expressing high levels of human EphA2.
[00165] Figure 6. Western blot analysis of pooled populations CT26 murine colon carcinoma cells expressing high levels of human EphA2 protein. [00166] Figure 7. Flow Cytometry of B 16F10 cells expressing huEphA2.
[00167] Figure 8. Western blot analysis of lysate from 293 cells 48 hr. following transfection with pCDNA4 plasmid DNA encoding full-length native EphA2 sequence. [00168] Figures 9A-9B. In the CT26 tumor model, therapeutic immunization with positive control Listeria expressing AH1-A5.
[00169] Figures 10A-10B. Preventative immunization with Listeria expressing
ECD of hEphA2 suppresses CT26-hEphA2 tumor growth (Figure 10A) and increases survival (Figure 10B).
[00170] Figures 11A-11D. Preventive studies following i.v. administration of DP-
L4029EphA2-exFlag, Listeria control (DP-L4029), or Listeria positive control containing the AHl protein (DP-L4029-AH1) (5xlO5 cells in 100 μl volume) either subcutaneously or
intravenously. Figure HA demonstrates tumor volume of mice inoculated with CT26 cells expressing the ECD of huEphA2, vehicle (HBSS), Listeria (DP-L4029) or Listeria positive (DP-L4029-AH1) controls. Figure HB demonstrates mean tumor volume of mice inoculated with CT26 cells expressing the ECD of huEphA2 (DP-L4029-EphA2 exFlag) compared to the Listeria (DP-L4029) control. Figure HC illustrates results of the prevention study in the s.c. model, measuring percent survival of the mice post CT26 tumor cell inoculation. Figure HD illustrates the results of the prevention study in the lung metastases model, measuring percent survival of the mice post tumor cell inoculation. [00171] Figure 12. Preventative immunization with Listeria expressing ECD of hEphA2 increases survival following RenCa-hEphA2 tumor challenge.
[00172] Figures 13A-13C. Figures 13A-13C illustrate results of a typical therapeutic study of animals inoculated with CT26 murine colon carcinoma cells transfected with human EphA2 (DP-L4029-EphA2 exFlag), Listeria control (DP-L4029- control) or vehicle (HBSS). In Figure 13A, tumor volume was measured at several intervals post inoculation. Figure 13B illustrates the mean tumor volume of mice inoculated with CT26 cells containing either Listeria control or the ECD of huEphA2. Figure 13C represents the results of a therapeutic study using the lung metastases model- measuring percent survival of mice post inoculation with CT26 cells with either HBSS or Listeria control, or Listeria expressing the ECD of huEphA2.
[00173] Figures 14A-F. Figure 14A. Therapeutic immunization in Balb/C mice with Listeria expressing ICD of hEphA2 suppresses established CT26-hEphA2 tumor growth. Figure 14B. Immunization of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors with recombinant Listeria encoding EphA2 CO domain confers long-term survival. Figure 14C. Long-term survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors immunized with recombinant Listeria encoding OVA.AH1 or OVA.AH1-A5. Figure 14D. Increased survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors when immunized with recombinant Listeria encoding codon-optimized or native EphA2 CO domain sequence. Figure 14E. Increased survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors when immunized with recombinant Listeria encoding codon-optimized secAl signal peptide fused with codon-optimized EphA2 EX2 domain sequence. Figure 14F. Immunization of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors with recombinant Listeria encoding EphA2 CO domain but not with plasmid DNA encoding full-length EphA2 confers long-term survival. [00174] Figure 15. Long-term suppression of CT26-hEphA2 tumor growth upon rechallenge.
[00175] Figure 16. Immunization with Listeria expressing hEphA2 elicits a specific CD8+ T cell response. [00176] Figure 17. Both CD4+ and CD8+ T cell responses are required for optimal hEphA2-directed anti-tumor efficacy.
[00177] Figures 18A-B. Therapeutic vaccination with Listeria expressing human
EphA2 ICD enhances CD45+ tumor infiltrate. Figure 18A depicts images of tumor sections stained with biotinylated rat anti-mouse CD45/B200. Figure 18B is a bar graph normalizing the image data to tumor volume. [00178] Figures 19 A-C. General EphA2 Expression Strategy. Figure 19A represents a monocistronic, single locus approach, where a construct contains a fusion of huEphA2 ECD and ICD nucleic acid sequences which is expressed from a single promoter. Figure 19B represents a monocistronic, two loci approach, where two separate constructs containing huEphA2 ECD or ICD, respectively, are expressed from two promoters. Figure 19C represents a bicistronic, single locus approach, where a construct contains huEphA2 ECD and ICD nucleic acid sequences on separate cistrons, but is expressed from a single promoter.
[00179] Figures 20A-E. Nucleotide sequences of representative dual monocistronic expression cassettes. Figure 2OA: Extracellular domain of EphA2 is fused
to first lOOaa of actA and inserted into actA locus. Flanking sequence necessary for homologous recombination into the actA locus is shown in plain text. Sequence coding for the first 100 amino acids of actA is in bold text. The EphA2 extracellular domain is cloned into engineered BamHI and Sad sites (underlined) and indicated in italics text. Figure 2OB: Intracellular domain of EphA2 is fused to the BaPA signal peptide downstream of hly promoter and inserted into the inlB locus. Flanking sequence necessary for homologous recombination into the inlB locus is shown in plain text. The hly promoter and BdPA signal peptide is downstream of an engineered Kpnl site (underlined) and the BaPA signal peptide is Indicated by bold text. The EphA2 intracellular domain is shown in italics text and is cloned into engineered BamHI and Sad sites (underlined). Figure 2OC: Intracellular domain of EphA2 is fused to first lOOaa of actA and inserted into actA locus. The EphA2 Extracellular domain is cloned into engineered BamHI and Sad sites. Figure 2OD: Extracellular domain of EphA2 is fused to BaPa signal peptide downstream of hly promoter and inserted into inlB locus. The ephA2 extracellular domain is cloned into engineered BamHI and Sad sites. Figure 2OE: Intracellular domain of EphA2 is fused to BaPa signal peptide and inserted into actA locus. The EphA2 extracellular domain is cloned into engineered BamHI and Sad sites. [00180] Figure 21. Western Blot Analysis of Secreted EphA2 from Listeria
Strains. Western blot analysis of secreted protein from recombinant Listeria encoding full-length EphA2 from a monocistronic, single locus approach or the EphA2 ICD from a bicistronic approach.
[00181] Figure 22. Secretion of EphA2 Intracellular Domain by Dual
Monocistronic Vaccine Strains. Western blot analysis of secreted protein from recombinant Listeria encoding EphA2 ICD from a monocistronic. two loci approach. [00182] Figure 23. Secretion of EphA2- ActA(N100) Fusions from Dual
Monocistronic Listeria strains. Western blot analysis of secreted protein from recombinant Listeria encoding either EphA2 ICD or ECD fused to ActA(Nl-lOO) from a monocistronic, two loci approach. [00183] Figures 24A-24B. Preventative Model: Comparison of Monocistronic Dual Loci Strains. Preventative immunization with Listeria expressing hEphA2 ECD and ICD from separate loci suppresses CT26-hEphA2 tumor growth (Figure 24A). Tumor volume measurements were taken from individual mice on day 21 (Figure 24B). "(NlOO)CoEx" represents ACtA(N 100)Comono Exmono, "(NlOO)ExCo" represents ActA(N100)Exmono Comono, and "CoEx" represents Comono/Exmono.
[00184] Figure 25. Preventative Model: I.M. Administration. Preventative i.m. immunization with Listeria expressing hEphA2 ECD and ICD from separate loci suppresses CT26-hEphA2 tumor growth. Data shown represents tumor volume measurements from individual mice on day 21. "(NlOO)CoEx" represents ActA(N100)Comono Exmono, "(NlOO)ExCo" represents ActA(N100)Exmono Comono, "CoEx" represents Comono/Exmono, and "FL-USP45" represents FL-EρhA2. [00185] Figures 26A-26C. Therapeutic Model: I.V. Administration. Therapeutic immunization in Balb/C mice with various Listeria strains expressing ECD and ICD of hEphA2 suppresses established CT26-hEphA2 tumor growth (Figure 26A). Tumor volume measurements were taken from individual mice on day 27 (Figure 26B).
Therapeutic immunization in Balb/C mice with ActA(N100)ExmonoComono strain increases survival (Figure 26C). "(NlOO)ExCo" represents ActA(N100)Exmono Comono, and "FL-inlB" represents FL-EphA2. [00186] Figure 27. Dose Down of Act A(Nl 00)Exmono Comono. Therapeutic immunization in Balb/C mice with ActA(N100)ExmonoComono Strain expressing ECD and ICD of hEphA2 suppresses established CT26-hEphA2 tumor growth at different doses. "(NlOO)ExCo" represents ACtA(N 100)Exmono Comono. [00187] Figures 28A-B. Efficacy Established with S.C. Administration.
Therapeutic immunization in Balb/C mice with AdA(Nl 00)ExmonoComono strain via a subcutaneous route suppresses established CT26-hEphA2 tumor growth at different doses (Figure 28A). Tumor volume measurements were taken from individual mice on day 27 (Figure 28B). "(NlOO)ExCo" represents ActA(N100)Exmono Comono. [00188] Figures 29A-D. Route of Administration Study for LLO91-99 Splenic T
Cell Reponses upon Administration of ActA(N100)ExmonoComono Strain. ELISPOT: 1 week post-primary (Figure 29A), 1 week post-boost (Figure 29B). ICS: 1 week postprimary (Figure 29C), 1 week post-boost (Figure 29D). Immunization with Listeria expressing hEphA2 elicits a specific CD8+ T cell response with different routes of administration. [00189] Figures 30A-D. Route of Administration Study for LLO91-99 Splenic T Cell Reponses upon Administration of ActA(N100)Comono Exmono Strain. ELISPOT: 1 week post-primary (Figure 30A), 1 week post-boost (Figure 30B). ICS: 1 week postprimary (Figure 30C), 1 week post-boost (Figure 30D). Immunization with Listeria expressing hEphA2 elicits a specific CD8+ T cell response with different routes of administration.
[00190] Figure 31. Confirmation of the EphA2 Immunodominant Epitope Peptide
#231. ELISPOT plates are shown.
[00191] Figure 32. Complete Purified Peptide Library Indicates Epitope Overlaps.
ELISPOT plates are shown. [00192] Figure 33. Epitope Discovery - CD4/CD8 Depletion. ELISPOT plates are shown.
[00193] Figure 34. Epitope Discovery - ICS Confirms CD4.
[00194] Figure 35. A schematic diagram depicting the process of selecting recombinant Lm strains that have undergone homologous recombination for integration of the EphA2 expression cassette. An allelic exchange vector containing the EphA2 expression cassette is electroporated into an Lm strain. At the permissive temperature of 300C, the vector is maintained episomally in the presence of chloramphenicol (Cm). At the non-permissive temperature (41°C), homologous recombination directed by the flanking sequences of the target locus takes place in the presence of Cm. This results in integration of the EphA2 expression cassette into the target locus. The remaining vector sequences are removed by a second homologous recombination event during several passages in the absence of Cm.
[00195] Figure 36. A schematic diagram depicting the cloning process of the pKSVactAN100ExEphA2 allelic exchange vector. [00196] Figure 37. A schematic diagram depicting the cloning process of the pKSVmlB-BaPAEphA2Co allelic exchange vector.
[00197] Figures 38A-B. A schematic diagram depicting the cloning process of the pKSVactAN100-MurineEphA2ExFLAG and pKSV-inlBMurineEρhA2CO allelic exchange vectors. [00198] Figure 39. Secretion of human EphA2 ICD from Dual Monocistronic
Listeria strains. Western blot analysis of secreted protein from recombinant Listeria (i.e., ActA(N100)ExmonoComono) encoding both human EphA2 ICD and ECD fused to ActA(Nl-lOO) was carried out. TCA-precipitated supernatants from mid-log cultures of ActA(Nl 00)ExmonoComono (MEDI-543) were analyzed for expression of ICD with the C20 polyclonal antibody (Santa Cruz). The 46 kDa protein corresponding to the EphA2 ICD protein is marked with an arrow.
[00199] Figure 40. Secretion of murine EphA2 ICD domain from Dual
Monocistronic Listeria strains. Western blot analysis of secreted murine EphA2 ICD from recombinant Listeria (Le., murine counterpart of ActA(NlOO)ExmonoComono) encoding
both murine EphA2 ICD and ECD fused to ActA(Nl-lOO) was carried out. TCA- precipitated supernatants from mid-log cultures of the indicated Listeria clones were analyzed for expression of murine EphA2 ICD with the C20 polyclonal antibody (Santa Cruz). The 48 kDa protein corresponding to the murine EphA2 ICD is marked with an arrow. Lanes 1-4 are different clones of the murine counterpart of
ActA(N100)ExmonoComono (see Example 10). Lanes 5 and 6 are clones of an intermediate Lm strain containing only the murine EphA2 ICD. Lane 7 is a negative control strain and lane 8 is ActA(N100)ExmonoComono. [00200] Figures 41A-C and 42A-B. Nucleotide and amino acid sequences for the expression cassettes of murine EphA2 ECD (Figures 41 A-C) and ICD (Figures 42A-B). Figures 41 A-C shows the nucleotide and amino acid sequences of the entire murine EphA2 ECD expression cassette comprising of the actA promoter (partial) and 5' UTR (plain text), ActA-NlOO (bold text), ECD (underlined text), and FLAG epitope (italicized text). Figures 42A-B shows the nucleotide and amino acid sequences of the entire murine EphA2 ICD expression cassette comprising of the hly promoter (partial) and 5' UTR (plain text), BaPA signal peptide (bold text), and ICD (underlined text). [00201] Figures 43A-B and 44A-B show a schematic of the cassettes, and their nucleotide sequences which were introduced into a single Listeria strain (Le., CERS 382.20) by sequential chromosome integration into the respective loci to give rise to ActA(N100)ExmonoComono {i.e., MEDI-543). Figures 43A shows the nucleotide sequences of the actA promoter (SEQ ID NO:85), 5'UTR (plain text) including the Shine- Dalgarno sequence (bold text), sequence coding for the first 100 amino acids of ActA (shaded text) (SEQ ID NO:110), and sequence coding for the EphA2 extracellular domain (underlined text). The corresponding encoded amino acid sequences are indicated in one letter amino acid code in Figure 43B. Listeria monocytogenes recognize the "GTG" three- letter codon for valine corresponding to the GUG translation initiation site of the ActA N- terminus and insert a methionine in the first position instead of valine. Figure 44 shows the nucleotide sequences of the hly promoter (SEQ ID NO: 111), Shine-Dalgarno sequence (underlined text), sequence coding for the BaPA signal peptide (bold text), and sequence coding for the human EphA2 intracellular domain (italicized text).
[00202] Figure 45 shows the nucleotide sequences of the expression cassette comprising the hly promoter (SEQ ED NO: 111) including the 5'UTR and Shine-Dalgarno sequence, BaPA signal peptide, and human EphA2 ECD domain. The corresponding amino acid sequence encoded by the expression cassette is shown.
5. DETAILED DESCRIPTION OF THE INVENTION
[00203] The present invention is based, in part, on the inventors' discovery that a
Listeria-based immunogenic composition comprising Listeria engineered to express two EphA2 antigenic peptides can confer beneficial therapeutic and prophylactic benefits against hyperproliferative diseases involving EphA2-expressing cells. [00204] The present invention provides methods and compositions that provide for the prevention, treatment, inhibition, and management of disorders associated with overexpression of EphA2, disorders associated with aberrant angiogenesis and/or hyperproliferative cell disorders. A particular aspect of the invention relates to methods and compositions containing compounds that, when administered to a subject with a hyperproliferative cell disorder involving EphA2-expressing cells, either elicit or mediate an immune response against EphA2, resulting in a growth inhibition of the EphA2- expressing cells involved in the hyperproliferative cell disorder. The present invention further relates to methods and compositions for the treatment, inhibition, or management of metastases of cancers of epithelial cell origin, especially human cancers of the breast, ovarian, esophageal, lung, skin, prostate, bladder, and pancreas, and renal cell carcinomas and melanomas. The invention further relates to methods and compositions for the prevention, treatment, inhibition, or management of cancers of T cell origin, especially leukemias and lymphomas. Further, the compositions and methods of the invention include other types of active ingredients in combination with the Listeria-based EphA2 immunogenic compositions of the invention. In certain embodiments, the compositions of the invention are used to treat, prevent or manage other non-neoplastic hyperproliferative cell disorders, for example, but not limited to asthma, psoriasis, restenosis, COPD, etc. [00205] The present invention also relates to methods for the treatment, inhibition, and management of cancer and other hyperproliferative cell disorders that have become partially or completely refractory to current or standard therapy {e.g., a cancer therapy, such as chemotherapy, radiation therapy, hormonal therapy, and biological/immunotherapy).
5.1. EphA2-Expressing Listeria
[00206] The present invention provides Listeria bacteria engineered to express one, two, three or more EphA2 antigenic peptides. In accordance with the invention, any species, strain and/or type of Listeria can be engineered to express one, two, three or more EphA2 antigenic peptides. Non-limiting examples of species of Listeria bacteria include Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri. In a preferred embodiment, the Listeria is Listeria monocytogenes. [00207] In one aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from a single Listeria locus. In a specific embodiment, the Listeria locus is not required for growth and spread of the Listeria. In a specific embodiment, the Listeria locus is required for growth and spread of the Listeria {e.g., the actA gene). In another embodiment, the Listeria locus is a virulence gene. Non-limiting examples of such Listeria loci include actA, internalin (int) A, inlB, inlC, MD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl. In a specific embodiment, attenuated Listeria are engineered to express two EphA2 antigenic peptides from the actA or irilB locus. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [00208] In accordance with the invention, Listeria may be engineered to express two EphA2 antigenic peptides from a single locus using a vector comprising a bicistronic expression cassette. In a specific embodiment, the bicistronic expression cassette comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non- limiting examples of promoters); (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1
to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[00209] In one aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are not required for growth and spread of the Listeria. In another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci that are required for growth and spread of the Listeria. In yet another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more of the loci are not required for growth and spread and one or more of the loci are required for growth and spread of the Listeria.
[00210] In a specific embodiment, Listeria, preferably attenuated Listeria, are engineered to express multiple (2, 3, 4 or more) EphA2 antigenic peptides from multiple (2, 3, 4 or more) Listeria loci, wherein one or more of the Listeria loci are virulence genes. Non-limiting examples of such Listeria loci include actA, internalin (int) A, inlB, inlC, inlD, inlD, inlE, inlF, inlG, inlH, My, plcA, pclB, and mpl. In accordance with the invention, Listeria may be engineered to express multiple EphA2 antigenic peptides from multiple loci using multiple vectors. In a specific embodiment, these vectors may comprise monocistronic, bicistronic and/or polycistronic expression cassettes. [00211] In a specific embodiment of the invention, Listeria, preferably attenuated Listeria, are engineered to express two EphA2 antigenic peptides from two Listeria loci. In a specific embodiment, the Listeria loci are not required for proliferation of the Listeria. In a preferred embodiment, the loci are virulence genes. In a specific embodiment, attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the inlB locus. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. In a preferred embodiment, attenuated Listeria are engineered to express a first EphA2 antigenic peptide from the actA locus and a second EphA2 antigenic peptide from the intlB locus, wherein the first EphA2 antigen peptide comprises the extracellular domain of EphA2 (preferably, human EphA2) fused to amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or
1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S), and the second EphA2 antigenic peptide comprises the intracellular domain of EphA2 (preferably, human EphA2) with, in certain embodiments, a lysine to methionine substitution at position 646 fused to the BaPa signal peptide. [00212] In accordance with the invention, Listeria may be engineered to express two EphA2 antigenic peptides from a two locus using two vectors, each vector comprising a monocistronic expression cassette. In a specific embodiment, each monocistronic construct comprises the following elements: (1) a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters); (2) a Shine-Dalgamo sequence; and (3) a nucleotide sequence encoding an EphA2 antigenic peptide. The two monocistronic expression cassettes may or may not comprise the same EphA2 antigenic peptide, hi a specific embodiment, the expression cassettes comprise different EphA2 antigenic peptides. In a specific embodiment, one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 or a fragment thereof. In a specific embodiment, the EphA2 antigenic peptides are fusion proteins comprising a signal peptide. Non-limiting examples of signal peptides are provided in Section 5.2.3.3.1 below. In a preferred embodiment, one expression cassette comprises an EphA2 antigenic peptide comprising the extracellular domain of EphA2 or a fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S), and the other expression cassette comprises an EphA2 antigenic peptide comprising the intracellular domain of EphA2 with, in certain embodiments, a lysine to methionine substitution at position 646 or a fragment thereof and a BaPa signal peptide. [00213] In another aspect of the invention, Listeria, preferably attenuated Listeria, are engineered to express three or more EphA2 antigenic peptides from a single Listeria locus. In a specific embodiment, the Listeria locus is required for growth and spread of the Listeria (e.g., the act A locus). In a specific embodiment, the Listeria locus is a virulence gene. Non-limiting examples of such Listeria loci include actA, internalin (inl) A, inlB, inlC, inlD, inlD, ME, inlF, inlG, inlH, hly, plcA, pclB, and mpl. hi a specific embodiment, attenuated Listeria are engineered to express two EphA2 antigenic peptides from die actA and/or inlB locus. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[00214] In accordance with the invention, Listeria may be engineered to express three or more EphA2 antigenic peptides from a single locus using a vector comprising a polycistronic expression cassette. In a specific embodiment, the polycistronic expression cassette comprises the following elements: (1) a single prokaryotic promoter regulating the expression of all of the EphA2 antigenic peptides; (2) a Shine-Dalgarno sequence; (3) a first nucleotide sequence encoding a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; (6) a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide); (7) a Shine-Dalgarno sequence; and (8) a third nucleotide sequence encoding a third EphA2 antigenic peptide (which may or may not be different from the first and/or second EphA2 antigenic peptides). In certain embodiments, the EphA2 antigenic peptides comprise EphA2 or a derivative, analog or fragment thereof, hi other embodiments, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, one or more of the EphA2 antigenic peptides are fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [00215] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the act A or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides), hi another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a
derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [00216] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid comprising a first nucleotide sequence encoding a first EphA2 antigenic peptide and a second nucleotide sequence encoding a second EphA2 antigenic peptide. Ln certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides), hi another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[00217] The present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, one or more of the nucleic acids is integrated into the Listeria chromosomal DNA. In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the nucleic acids are integrated into the Listeria chromosomal DNA. In a specific embodiment,
the first nucleic acid is integrated into the actA locus and the second is integrated into the inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. Li a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [00218] In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof. In another embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 has been substituted for lysine. In accordance with these embodiments, the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). Non-limiting examples of signal peptides are provide below in Section 5.2.3.3.1. [00219] In a preferred embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide is a fusion protein comprising the first 100 amino acid residues of ActA (preferably ActA of Listeria monocytogenes L0403S) and the extracellular domain of EphA2 (preferably, human
EphA2) or a fragment thereof, and the second nucleic acid comprises a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine. In accordance with this embodiment, the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA. Li a preferred embodiment, the first nucleic acid is integrated into the act A locus and the second nucleic acid is integrated into the inlB locus. [00220] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA2 antigenic peptide expression cassette comprising a regulatory element, such as a promoter (see Section 5.2.3.1 below for non-limiting examples of promoters), and a nucleotide sequence encoding an EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the octA or MB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion proteins comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[00221] The present invention provides Listeria, preferably attenuated Listeria, comprising a nucleic acid, the nucleic acid comprising an EphA antigenic expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence and a second nucleotide sequence encoding a second EphA2 antigenic peptide. The expression cassette can be part of a vector, such as described below. In certain embodiments, the nucleic acid is integrated into the Listeria chromosomal DNA. In a specific embodiment, the nucleic acid is integrated into the actA
or inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section
5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below. [00222] The present invention provides Listeria, preferably attenuated Listeria, comprising multiple nucleic acids, wherein each nucleic acid comprises an EphA2 antigenic cassette comprising a nucleotide sequence encoding an EphA2 antigenic peptide. In certain embodiments, one or more of the nucleic acids is integrated into the Listeria chromosomal DNA. In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide, and die second nucleic acid comprises a second EphA2 antigenic peptide cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide (which may or may not be different from the first EphA2 antigenic peptide). In certain embodiments, the nucleic acids are integrated into the Listeria chromosomal DNA. In a specific embodiment, the first nucleic acid is integrated into the actA locus and the second is integrated into die inlB locus. In certain embodiments, the EphA2 antigenic peptide comprises EρhA2 or a derivative, analog or fragment thereof. In other embodiments, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof. In a specific embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and a signal peptide (see Section 5.2.3.3.1 below for non-limiting examples of signal peptides). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and amino acid residues 1 to 25, 1 to 50, 1 to 75, 1
to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising EphA2 or a derivative, analog or fragment thereof and the amino acid sequence of the BaPA signal sequence. Non-limiting examples of EphA2 antigenic peptides are provided in Section 5.2.3.3 below.
[00223] In a specific embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof. In another embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first
EphA2 antigenic peptide expression cassette comprising a promoter and a first nucleotide sequence encoding a first EphA2 antigenic peptide comprising the extracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof, and the second nucleic acid comprises a second EphA2 expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide comprising the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine. In accordance with these embodiments, the first and/or second EphA2 antigenic peptides may be fusion proteins further comprising a signal peptide or amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S). Non-limiting examples of signal peptides are provided below in Section 5.2.3.3.1. [00224] In a preferred embodiment, the present invention provides Listeria, preferably attenuated Listeria, comprising two nucleic acids, wherein the first nucleic acid comprises a first nucleotide sequence encoding a first EphA2 antigenic peptide expression cassette comprising a promoter and a first EphA2 antigenic peptide that is a fusion protein comprising the first 100 amino acid residues of ActA and the extracellular domain of EphA2 (preferably, human EphA2) or a fragment tiαereof, and the second nucleic acid comprises a second EphA2 antigenic peptide expression cassette comprising a promoter and a second nucleotide sequence encoding a second EphA2 antigenic peptide that is a
fusion protein comprising the BaPa signal peptide and the intracellular domain of EphA2 (preferably, human EphA2) or a fragment thereof with the methionine at amino acid residue 646 substituted for lysine. In accordance with this embodiment, the first and/or nucleic acids may be integrated into the Listeria chromosomal DNA. In a preferred embodiment, the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the inlB locus.
5.1.1. Attenuation
[00225] To allow the safe use of Listeria as a therapy in humans and animals, the bacteria are preferably attenuated in their virulence for causing disease. The end result is to reduce the risk of toxic shock or other side effects due to administration of the Listeria to the patient. Such attenuated Listeria can occur naturally or be produced recombinantly or by exposure to mutagens (e.g., mutagenic chemicals and radiation). In a specific embodiment, the Listeria are attenuated by subjecting the bacteria to psoralen treatment. The attenuated Listeria can be isolated by a number of techniques. These techniques include the use of antibiotic-sensitive strains of microorganisms, mutagenesis of the microorganisms, selection for microorganism mutants that lack virulence factors, and construction of new strains of microorganisms with altered cell wall lipopolysaccharides. [00226] In certain embodiments, the Listeria can be attenuated by the deletion or disruption of DNA sequences which encode for virulence factors which insure survival of the Listeria in the host cell, especially macrophages and neutrophils, by, for example, homologous recombination techniques and chemical or transposon mutagenesis. Many, but not all, of these studied virulence factors are associated with survival in macrophages such that these factors are specifically expressed within macrophages due to stress, for example, acidification, or are used to induce specific host cell responses, for example, macropinocytosis, Fields et al., 1986, Proc. Natl. Acad. ScL USA 83:5189-5193.
Examples of virulence genes include, but are not limited to, My,plcA,plcB, mpl, actA, inlA, and MB. See also Autret et al., 2001, Infection and Immunity 69:2054-2065. [00227] In one embodiment, the attenuated Listeria are deficient in DNA repair
(e.g., mutant in a DNA repair gene such as, e.g., eg, PhrB, UvrA, UvrB, UvrC, UvrD and/or RecA), attenuated in their tissue tropism (e.g., MB mutant) and/or attenuated in their ability to spread from cell to cell (e.g., actA mutant). Attenuated Listeria and methods for producing such attenuated strains are described in greater detail in U.S. Patent Application Publication Nos. 2004/0013690, 2004/0228877, 2004/0197343 and
International Publication Nos. WO 2004/110481 and WO 2005/071088, each of which are herein incorporated by reference in its entirety.
[00228] In some embodiments, the capacity of the attenuated Listeria for cell-to-cell spread is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or at least about 90%, relative to Listeria without the attenuating mutation (e.g., the wild type bacterium). In some embodiments, the capacity of the attenuated Listeria for cell-to-cell spread is reduced by at least about 25% relative to Listeria without the attenuating mutation. In some embodiments, the capacity of the attenuated Listeria attenuated for cell-to-cell spread is reduced by at least about 50% relative to Listeria without the attenuating mutation.
[00229] In vitro assays for determining whether or not Listeria bacterium is attenuated for cell-to-cell spread are known to those of ordinary skill in the art. For example, the diameter of plaques formed over a time course after infection of selected cultured cell monolayers can be measured. Plaque assays within L2 cell monolayers can be performed as described previously in Sun, A., A. Camilli, and D.A. Portnoy. 1990, Isolation of Listeria monocytogenes small-plaque mutants defective for intracellular growth and cell-to-cell spread. Infect. Immun. 58:3770-3778, with modifications to the methods of measurement, as described by in Skoble, J., D.A. Portnoy, and M.D. Welch. 2000, Three regions within ActA promote Arp2/3 complex-mediated actin nucleation and Listeria monocytogenes motility. /. Cell Biol. 150:527-538. In brief, L2 cells are grown to confluency in six-well tissue culture dishes and then infected with bacteria for 1 h. Following infection, the cells are overlayed with media warmed to 400C that is comprised of DME containing 0.8% agarose, Fetal Bovine Serum (e.g., 2%), and a desired concentration of Gentamicin. The concentration of Gentamicin in the media dramatically affects plaque size, and is a measure of the ability of a selected Listeria strain to effect cell-to-cell spread (Glomski, I J., M.M. Gedde, A.W. Tsang, J.A. Swanson, and D.A. Portnoy. 2002. /. Cell Biol 156:1029-1038). For example, at 3 days following infection of the monolayer the plaque size of Listeria strains having a phenotype of defective cell- to-cell spread is reduced by at least 50% as compared to wild-type Listeria, when overlayed with media containing Gentamicin at a concentration of 50 μg/ml. On the other hand, the plaque size between Listeria strains having a phenotype of defective cell-to-cell spread and wild-type Listeria is similar, when infected monolayers are overlayed with media + agarose containing only 5 μg/ml gentamicin. Thus, the relative ability of a selected strain to effect cell-to-cell spread in an infected cell monolayer relative to wild-
type Listeria can be determined by varying the concentration of gentamicin in the media containing agarose. Optionally, visualization and measurement of plaque diameter can be facilitated by the addition of media containing Neutral Red (GIBCO BRL; 1:250 dilution in DME + agarose media) to the overlay at 48 h. post infection. Additionally, the plaque assay can be performed in monolayers derived from other primary cells or continuous cells. For example HepG2 cells, a hepatocyte-derived cell line, or primary human hepatocytes can be used to evaluate the ability of selected Listeria mutants to effect cell- to-cell spread, as compared to wild-type Listeria. In some embodiments, Listeria comprising mutations or other modifications that attenuate the Listeria for cell-to-cell spread produce "pinpoint" plaques at high concentrations of gentamicin (about 50 μg/ml). [00230] In some embodiments, the Listeria is attenuated for entry into non- phagocytic cells (relative or a non-mutant or wildtype bacterium). In some embodiments, the Listeria is defective with respect to one or more internalins (or equivalents). Non- limiting examples of internalins include inlA, inlB, inlC, inlD, inlE, inlF, inlG and inlH. In some embodiments, the Listeria is defective with respect to internalin A. In some embodiments, the Listeria is defective with respect to internalin B. In some embodiments, the Listeria comprises a mutation in inlA. In some embodiments, the Listeria comprises a mutation in MB. In some embodiments, the Listeria comprises a mutation in both actA and inlB. In some embodiments, the Listeria is deleted in functional ActA and internalinB. In some embodiments, the Listeria is an AactAAinlB double deletion mutant. In some embodiments, the Listeria is defective with respect to both ActA and internalin B. In accordance with these embodiments, such mutants may be generated by deleting the coding sequence of ActA and internalin B only, while retaining the flanking regions (including the transcriptional cis elements) intact and unmodified. Techniques known to those of skill in the art may be used to generate such mutants.
[00231] In some embodiments, the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or at least about 90%, relative to a bacterium without the attenuating mutation (e.g., the wild type bacterium). In some embodiments, the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 25% relative to Listeria without the attenuating mutation. In some embodiments, the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 50% relative to Listeria without the attenuating mutation. In some embodiments,
the capacity of the attenuated Listeria for entry into non-phagocytic cells is reduced by at least about 75% relative to Listeria without the attenuating mutation. [00232] In some embodiments, the attenuated Listeria strain are not attenuated for entry into more than one type of non-phagocytic cell. For instance, the attenuated strain may be attenuated for entry into hepatocytes, but not attenuated for entry into epithelial cells. As another example, the attenuated strain may be attenuated for entry into epithelial cells, but not hepatocytes. It is also understood that attenuation for entry into a non- phagocytic cell of particular modified Listeria is a result of mutating a designated gene, for example a deletion mutation, encoding an invasin protein which interacts with a particular cellular receptor, and as a result facilitates infection of a nonphagocytic cell. For example, Listeria AinlB mutant strains are attenuated for entry into non-phagocytic cells expressing the hepatocyte growth factor receptor (c-met), including hepatocyte cell lines (e.g., HepG2), and primary human hepatocytes.
[00233] In some embodiments, even though the mutant Listeria are attenuated for entry into non-phagocytic cells, the Listeria are still capable of uptake by phagocytic cells, such as at least dendritic cells and/or macrophages. In one embodiment the ability of the attenuated Listeria to enter phagocytic cells is not diminished by the modification made to the strain, such as the mutation of an invasin (i.e., approximately 95% or more of the measured ability of the strain to be taken up by phagocytic cells is maintained post- modification). In other embodiments, the ability of the attenuated Listeria to enter phagocytic cells is diminished by no more than about 10%, no more than about 25%, no more than about 50%, or no more than about 75%.
[00234] In some embodiments of the invention, the amount of attenuation in the ability of the Listeria to enter non-phagocytic cells ranges from a two-fold reduction to much greater levels of attenuation relative to a wild-type Listeria strain. In some embodiments, the attenuation in the ability of the Listeria to enter non-phagocytic cells is at least about 0.3 log, about 1 log, about 2 log, about 3 log, about 4 log, about 5 log, or at least about 6 log. In some embodiments, the attenuation is in the range of about 0.3 to >8 log, about 2 to >8 log, about 4 to >8 log, about 6 to >8 log, about 0.3-8 log, also about 0.3- 7 log, also about 0.3-6 log, also about 0.3-5 log, also about 0.3-4 log, also about 0.3-3 log, also about 0.3-2 log, also about 0.3-1 log. In some embodiments, the attenuation is in the range of about 1 to >8 log, 1-7 log, 1-6 log, also about 2-6 log, also about 2-5 log, also about 3-5 log.
[00235] As a method of insuring the attenuated phenotype and to avoid reversion to the non-attenuated phenotype, the Listeria may be engineered such that it is attenuated in more than one manner, e.g.f a mutation affecting tissue tropism (e.g., inlB mutant) and a mutation affecting the ability to spread from cell to cell (e.g., actA mutant). In a preferred embodiment, the Listeria comprise a mutation (e.g., a deletion, addition or substitution) in internalin B and a mutation in actA.
[00236] A variety of exemplary mutant strains of Listeria that are attenuated are described in the U.S. Patent Application Nos. 60/446,051 (filed February 6, 2003), 60/449,153 (filed February 21, 2003), 60/511,719 (filed October 15, 2003), 60/511,919 (filed October 15, 2003), 60/511,869 (filed October 15, 2003), 60/541,515 (filed February 2, 2004), and 10/883,599 (filed June 30, 2004), as well as in U.S. Patent Publication Nos. 2004/0197343 and US 2004/0228877, each of which is incorporated by reference herein in its entirety. Mutant strains of Listeria are also described in the International Application No. PCT/US2004/23881, filed July 23, 2004, which is incorporated by reference herein in its entirety. In some embodiments, the Listeria is a mutant strain of Listeria monocytogenes that is actA' (e.g., DP-L4029 (the DP-L3078 strain described in Skoble et al., J. of Cell Biology, 150:527-537 (2000), incorporated by reference herein in its entirety, which has been cured of its prophage as described in (Lauer et al., /. Bacteriol. 184:4177 (2002); U.S. Patent Publication No. 2003/0203472)), actA' MB' (e.g., ΩP-L4029inlB, deposited with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Virginia 20110-2209, United States of America, on October 3, 2003, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and designated with accession number PTA-5562), actA" uvrAB' (e.g., DP-L4029wvrAB, deposited with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Virginia 20110-
2209, United States of America, on October 3, 2003, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and designated with accession number PTA-5563), or actA' inlB uvrAB". In some embodiments, the attenuated Listeria bacterium (e.g., a Listeria monocytogenes bacterium) is an ΔactAΔinlB double deletion mutant.
5.2. Expression Systems
[00237] The EphA2 antigenic peptides are preferably expressed in Listeria using a heterologous gene expression cassette (sometimes referred to herein as an "expression
cassette" or an "EphA2 antigenic peptide expression cassette"). An EphA2 antigenic peptide monocistronic gene expression cassette is typically comprised of the following ordered elements: (1) a promoter; (2) a Shine-Dalgarno sequence; and (3) an EphA2 antigenic peptide. In a specific embodiment, the EρhA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising a signal peptide and EphA2 or a derivative, analog or fragment thereof. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125 or 1 to 150 of actA and EphA2 or a derivative, analog or fragment thereof. [00238] An EphA2 antigenic peptide bicistronic gene expression cassette is typically comprised of the following elements: (1) a promoter; (2) a Shine-Dalgarno sequence; (3) a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine- Dalgarno sequence; and (6) a second EphA antigic peptide. Optionally, the expression cassette may also contain a transcription termination sequence, in constructs for stable integration within the bacterial chromosome. While not required, inclusion of a transcription termination sequence as the final ordered element in a heterologous gene expression cassette may prevent polar effects on the regulation of expression of adjacent genes, due to read-through transcription. In a specific embodiment, the EphA2 antigenic peptide comprises EphA2 or a derivative, analog or fragment thereof. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising a signal peptide and EphA2 or a derivative, analog or fragment thereof. In another embodiment, the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125 or 1 to 150 of ActA (preferably ActA of Listeria monocytogenes L0403S) and EphA2 or a derivative, analog or fragment thereof. [00239] The expression cassettes typically introduced into the Listeria as part of a vector. Non-limiting examples of vectors are provided hereinbelow. The expression vectors introduced into the Listeria are preferably designed such that the Listeria-pτoduced EphA2 peptides and, optionally, a second tumor antigen, are secreted by the Listeria. Exemplary secretion signals that can be used with Listeria are ActA, BaPa, BsPhoD, p60, SecA, tat, and usp45, as described in Section 5.2.3.3.1, infra. In a specific embodiment, the secretion signal is ActA or BaPa.
[00240] Preferred embodiments of components of the EphA2 antigenic peptide expression system, to be used in conjunction with nucleic acids encoding EphA2 antigenic peptides described in Section 5.2.3.3, are provided below.
5.2.1. Codon Optimization
[00241] In some embodiments, one or more of the nucleotide sequences within the expression cassette and/or expression vector are codon-optimized (relative to the native coding sequence). It is desirable to utilize codons favored by Listeria for optimal translation efficiency of a selected heterologous protein. In some embodiments, a polynucleotide in the recombinant nucleic acid molecules (and/or in the expression cassette and/or expression vector) described herein that encodes a signal peptide is codon- optimized for expression in Listeria. In some embodiments, a polynucleotide encoding a polypeptide other than a signal peptide, such as an antigen (e.g., EphA2 or a derivative, analog or fragment thereof) or other therapeutic protein, is codon-optimized for expression in Listeria. In some embodiments, both a polynucleotide encoding a signal peptide and a polynucleotide encoding another polypeptide fused to the signal peptide are codon- optimized for expression in Listeria. See, e.g., U.S. Application Publication No. US 2005/0249748, which is incorporated by reference herein in its entirety, for techniques for codon optimization for expression in Listeria. In some embodiments, a polynucleotide encoding a secreted protein (or fragment thereof) used as a scaffold or a polynucleotide encoding an autolysin (or fragment or variant thereof) is codon-optimized. [00242] A polynucleotide comprising a coding sequence is "codon-optimized " if at least one codon of the native coding sequence of the polynucleotide has been replaced with a codon that is more frequently used by the organism in which the coding sequence is to be expressed (the "target organism") than the original codon of the native coding sequence.
[00243] In various embodiments, the preferred codon usage for bacterial expression can be determined as described in Nakamura et aL, 2000, Nucl. Acids Res. 28:292. In some embodiments, codon-optimized expression of EphA2 antigenic peptides, from Listeria monocytogenes is desired. In a specific embodiment, the coding sequence is optimized for expression in Lm by modifying the coding sequence with BLUE HERON (Blue Heron Biotechnology, Bothell, WA) using a proprietary algorithm to match codon utilization in Lm and to reduce secondary structure in nascent transcripts that impede translational efficiency.
[00244] The optimal codons utilized by Listeria monocytogenes for each amino acid are shown in Table 3 below.
5.2.2. Construct Backbone
[00246] One of ordinary skill in the art will recognize that a variety of plasmid construct backbones are available which are suitable for use in the assembly of an EphA2 antigenic expression cassette. A particular plasmid construct backbone is selected based on whether expression of the EphA2 antigenic expression cassette from the bacterial chromosome or from an extra-chromosomal episome is desired. [00247] Given as non-limiting examples, incorporation of an EphA2 antigenic expression cassette into the bacterial chromosome of Listeria monocytogenes {Listeria) is accomplished with an integration vector that contains an expression cassette for a listeriophage integrase that catalyzes sequence-specific integration of the vector into the Listeria chromosome. For example, the integration vectors known as pPLl and pPL2 program stable single-copy integration of a heterologous protein (e.g., EphA2-antigenic peptide) expression cassette within an innocuous region of the bacterial genome, and have
been described in the literature (Lauer etal., 2002, J. Bacteriol. 184:4177-4178; U.S. Patent Application Publication No. 20030203472). The integration vectors are stable as plasmids in E. coli and are introduced via conjugation into the desired Listeria background. Each vector lacks a Lwfønα-specific origin of replication and encodes a phage integrase, such that the vectors are stable only upon integration into a chromosomal phage attachment site. Starting with a desired plasmid construct, the process of generating a recombinant Listeria strain expressing a desired protein(s) takes approximately one week. The pPLl and pPL2 integration vectors are based, respectively, on the U153 and PSA listeriophages. The pPLl vector integrates within the open reading frame of the comK gene, while pPL2 integrates within the tRNAArg gene in such a manner that the native sequence of the gene is restored upon successful integration, thus keeping its native expressed function intact. The pPLl and pPL2 integration vectors contain a multiple cloning site sequence in order to facilitate construction of plasmids containing the heterologous protein {e.g., EphA2-antigenic peptide) expression cassette. [00248] Alternatively, incorporation of the EphA2- antigenic peptide expression cassette into the Listeria chromosome can be accomplished through alleleic exchange methods, known to those skilled in the art. In particular, compositions in which it is desired to not incorporate a gene encoding an antibiotic resistance protein as part of the construct containing the heterologous gene expression cassette, methods of allelic exchange are desirable. For example, the pKSV7 vector (Camilli et al., 1993, MoL
Microbiol. 8:143-157), contains a temperature-sensitive Listeria Gram-positive replication origin which is exploited to select for recombinant clones at the non-permissive temperature that represent the pKS V7 plasmid recombined into the Listeria chromosome. In particular, the pE194ts origin of replication and chloramphenicol (Cm) acetyltransferase gene (cat) of pKSV7 allow temperature-dependent selection of choramphenicol-resistant (Cm1) Listeria. At 300C, pKSV7 replicates autonomously in Listeria with a copy number of about 5, and at 410C the plasmid is unable to replicate in Listeria. When combined with homologous sequence sufficient to direct recombination with the Listeria chromosome, plasmid integrants can be selected in Cm at non-permissive temperatures for plasmid replication. The pKSV7 allelic exchange plasmid vector contains a multiple cloning site sequence in order to facilitate construction of plasmids containing the heterologous protein (e.g., EphA2-antigenic peptide) expression cassette. For insertion into the Listeria chromosome, the heterologous EphA2-antigenic peptide expression cassette construct is optimally flanked by approximately 1 kb of chromosomal DNA
sequence that corresponds to the precise location of desired integration. In a particular embodiment, about 1 kb of sequences upstream and downstream of the desired integration site is incorporated into the expression cassette. The pKSV7-expression cassette plasmid may be introduced into a desired bacterial strain by electroporation, according to standard methods for electroporation of Gram positive bacteria.
[00249] For generation of Listeria expressing one or more EphA2 antigenic peptide expression cassettes via homologous recombination, plasmid integration using the ρKSV7 plasmid achieved following recombination at temperatures non-permissive for Gram- positive plasmid replication in the presence of Cm. The resulting Cmr intermediates contain one or more plasmid copies integrated into the bacterial chromosome and are therefore merodiploid with respect to regions flanking the EphA2 insertion. Plasmid sequences are excised from merodiploid strains when cultured under non-selective conditions that favor a second recombination event. The resulting Cm-sensitive (Cms) strains may be screened for the one or more EphA2 inserts by PCR and secretion is confirmed by Western blot of TCA-precipitated culture supernatants.
[00250] In other compositions, it may be desired to express an EphA2-antigenic peptide from a stable plasmid episome. Maintenance of the plasmid episome through passaging for multiple generations requires the co-expression of a protein that confers a selective advantage for the plasmid-containing bacterium. As non-limiting examples, the protein co-expressed from the plasmid in combination with an EphA2-antigenic peptide may be an antibiotic resistance protein, for example chloramphenicol, or may be a bacterial protein (that is expressed from the chromosome in wild-type bacteria), that can also confer a selective advantage. Non-limiting examples of bacterial proteins include enzymes required for purine or amino acid biosynthesis (selection under defined media lacking relevant amino acids or other necessary precursor macromolecules), or a transcription factor required for the expression of genes that confer a selective advantage in vitro or in vivo (Gunn et al., 2001, J. Imrnuol. 167:6471-6479). As a non-limiting example, pAM401 is a suitable plasmid for episomal expression of a selected heterologous protein (e.g., EphA2-antigenic peptide) in diverse Gram-positive bacterial genera (Wirth et al., 1986, J. Bacteήol 165:831-836).
5.2.3. EphA2-Antigenic Peptide Expression Cassette
[00251] The present invention generally employs expression cassettes to facilitate cloning into a suitable vector. An EρhA2 antigenic peptide monocistronic gene expression
cassette is typically comprised of the following ordered elements: (1) a promoter; (2) a Shine-Dalgarno sequence; and (3) an EphA2 antigenic peptide. An EphA2 antigenic peptide bicistronic gene expression cassette is typically comprised of the following elements: (1) a promoter; (2) a Shine-Dalgarno sequence; (3) a first EphA2 antigenic peptide; (4) an intragenic sequence; (5) a Shine-Dalgarno sequence; and (6) a second EphA antigenic peptide. Optionally, the expression cassette may also contain a transcription termination sequence, in constructs for stable integration within the bacterial chromosome. The components of the expression cassette are discussed in more detailed below.
5.2.3.1. Promoters
[00252] In some embodiments, the promoters in the expression cassettes described herein (or recombinant nucleic acid molecules described herein) are prokaryotic promoters. For instance, the prokaryotic promoters can be Listeria promoters. Preferred promoters include, but are not limited to, sequences derived from the hly gene which encodes LLO, the p60 (iap) gene, and the actA gene which encodes a surface protein necessary for actin assembly. Other promoter sequences of interest include the plcA gene which encodes PI-PLC, the mpl gene, which encodes a metalloprotease, and the inlA gene which encodes intemalin, a Listeria membrane protein. The heterologous regulatory elements such as promoters derived from phage and promoters derived from other bacterial species may also be employed. In some embodiments, the Listeria promoter is an hly promoter. In some embodiments, the promoters are prfA-dependent promoters (e.g., eta actA promoter). In some embodiments, the promoters are constitutive promoters (e.g., ap60 promoter). In some embodiments, the expression cassette comprising a recombinant nucleic acid molecule described herein comprises an hly, actA, oτp60 promoter operably linked to the polynucleotides of the recombinant nucleic acid molecule. One of the ordinary skill in the art will be readily able to identify additional prokaryotic and/or Listeria promoters suitable for use in the expression cassettes in view of the intended use of the expression cassette and host bacteria into which the expression cassette will be placed. [00253] In some embodiments, the expression cassettes (or recombinant nucleic acid molecules described herein) comprise a promoter (e.g., an actA promoter) as well as untranslated sequences (5' and/or 3' untranslated sequences) that appear to enhance RNA expression and/or stability. In a specific embodiment, the expression cassettes (or
recombinant nucleic acid molecules described herein) comprise an act A promoter and 5' untranslated sequences of act A.
[00254] In a particular embodiment, the expression cassette of the invention comprises the native actA promoter and 5' untranslated region (UTR). PrfA-dependent transcription from the actA promoter results in synthesis of a 150 nucleotide 5' UTR RNA prior to the ActA protein GUG translation initiation site. Listeria monocytogenes mutants deleted of the actA promoter 5' UTR express low levels of ActA, resulting in a phenotype characterized by absence of intracellular actin recruitment, inability to spread from cell-to- cell, and attenuated, as compared to the wild-type parent bacterium (Wong et. al., Defective Cellular Microbiology 6:155-166). In a preferred embodiment, the expression cassette of the invention comprises the native actA promoter and the entire 5' UTR approximately 150 nucleotide long.
[00255] The promoters driving the expression of the EphA2 antigenic peptides may be either constitutive, in which the peptides are continually expressed; inducible, in which the peptides are expressed only upon the presence of an inducer molecule(s); or cell-type specific embodiment, in which the peptides or enzymes are expressed only in certain cell types.
5.2.3.2. Shine-Dalgarno Sequence [00256] At the 3' end of the promoter is a poly-purine Shine-Dalgarno sequence, the element required for engagement of the 30S ribosomal subunit (via 16S rRNA) to the heterologous gene RNA transcript and initiation of translation. The Shine-Dalgarno sequence (SEQ ID NO: 112) has typically the following consensus sequence in the 3'end of a promoter (or 5' UTR) (SEQ ID NO:66): 5'-NAGGAGGU-N5-10-AUG (start codon)- 3'. There are variations of the poly-purine Shine-Dalgamo sequence. Notably, the Listeria My gene that encodes listerolysin O (LLO) has the following Shine-Dalgarno sequence (SEQ ID NO: 113) in the 3'end of the promoter (or 5' UTR) (SEQ ID NO:67): 5'-AAGGAGAGTGAAACCCATG-S' (Shine-Dalgarno sequence is underlined, and the translation start codon is bolded). The Listeria actA gene has the following Shine- Dalgarno sequence (SEQ ID NO: 114) in the 3'end of the promoter (or 5' UTR) (SEQ ID NO: 109): 5'-CGAGGAGGGAGT AT AAGTG-3 ' (Shine-Dalgarno sequence is underlined, and the translation start codon is bolded).
5.2.3.3. EphA2 Antigenic Peptides
[00257] As discussed above, the present invention relates to the use of Listeria that have been engineered to express one, two, three or more EphA2 antigenic peptides. Without being bound by any mechanism, such Listeria are capable of eliciting an immune response to EphA2 upon administration to a subject with a disease involving aberrant expression (e.g., overexpression) of EphA2, resulting in a cellular or humoral immune response against endogenous EphA2.
[00258] In principle, an EphA2 antigenic peptide (sometimes referred to as an
"EphA2 antigenic polypeptide") for use in the methods and compositions of the present invention can be any EphA2 antigenic peptide that is capable of eliciting an immune response against EphA2-expressing cells involved in a hyperproliferative disorder or a disorder involving aberrant angiogenesis. Thus, an EphA2 antigenic peptide can be an EphA2 polypeptide, preferably an EphA2 polypeptide of SEQ ID NO:2, or a fragment or derivative of an EphA2 polypeptide that (1) displays antigenicity of EphA2 (ability to bind or compete with EphA2 for binding to an anti-EphA2 antibody, (2) displays immunogenicity of EphA2 (ability to generate antibody which binds to EphA2), and/or (3) contains one or more T cell epitopes of EphA2.
[00259] In certain embodiments, the EphA2 antigenic peptide is a sequence provided below or a fragment or derivative thereof: [00260] Genbank Accession No. NP_004422 Human
[00261] Genbank Accession No. NP_034269 Mouse
[00262] Genbank Accession No. BAB63910 Chicken (partial)
[00263] Genbank Accession No. NMJX) 1040678 Macaca mulatta (rhesus monkey) Genbank Accession No. DQ478608 Macaca fascicularis [00264] In certain embodiments, the EphA2 antigenic peptide comprises (or consists of) full length EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) full length human EphA2 (SEQ ID NO:2). In other embodiments, the EphA2 antigenic peptide comprises (or consists of) a fragment of EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) fragment of human EphA2 (SEQ ID NO:2).
[00265] In other embodiments, the EphA2 antigenic peptide comprises (or consists of) the intracellular domain (ICD) of EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) residues 558 to 976 of SEQ ID NO:2. In accordance with these embodiments, the intracellular domain may comprise (or consist of)
a lysine to methionine substitution at amino acid residue 646. In other embodiments, the EphA2 antigenic peptide comprise (or consist of) a fragment of the EphA2 intracellular domain (ICD). In one embodiment, the EphA2 antigenic peptide is an immunodominant epitope of EphA2, preferably in the intracellular domain. In specific embodiments, the immunodominant epitope is amino acids 917 to 935, 917 to 931 or 921 to 935 of human EphA2. In certain embodiments, the antigenic peptide consists of 8 to 15 amino acids or 12 to 14 amino acids of this epitope. In other embodiments, the antigenic peptide consists of 8 or 9 amino acids of this epitope. [00266] In other embodiments, the EphA2 antigenic peptide comprises (or consists of) the extracellular domain (ECD) of EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) residues 22 to 554 of SEQ ID NO:2. In other embodiments, the EphA2 antigenic peptide comprises (or consists of) a fragment of the EphA2 extracellular domain (ECD). In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) a fragment of the EphA2 extracellular domain. [00267] In yet other embodiments, the EphA2 antigenic peptide comprises (or consists of) more than one domain of the full length human EphA2. In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) the extracellular domain and the intracellular cytoplasmic domain, joined together. In accordance with this embodiment, the transmembrane domain of EphA2 is deleted. [00268] In certain embodiments of the invention, the tyrosine kinase activity of
EphA2 is ablated. Thus, EphA2 may contain deletions, additions or substitutions of amino acid residues that result in the elimination of tyrosine kinase activity. In a preferred embodiment, a lysine to methionine substitution at position 646 is present. [00269] In a specific embodiment, the EphA2 antigenic peptide comprises (or consists of) the extracellular and cytoplasmic domains of EphA2, joined together, and the peptide has a lysine to methionine substitution as position 646. In accordance with this embodiment, the transmembrane domain is deleted.
[00270] In certain embodiments, the peptide corresponds to or comprises an EphA2 epitope that is exposed in a cancer cell but occluded in a non-cancer cell. In a preferred embodiment, the EphA2 antigenic peptides preferentially include epitopes on EphA2 that are selectively exposed or increased on cancer cells but not non-cancer cells ("exposed EphA2 epitope peptides").
[00271] The present invention preferably encompasses the use of a plurality of
EphA2 antigenic peptides, e.g., 2, 3, 4, 5, 6, or more EphA2 antigenic peptides, in the
compositions and methods of the present invention. In a preferred embodiment, the plurality of EphA2 antigenic peptides are on separate cistrons. [00272] The full-length EρhA2 or fragments of EphA2 that are useful in the methods and compositions present invention may contain deletions, additions or substitutions of amino acid residues within the amino acid sequence encoded by an EphA2 gene. Preferably mutations result in a silent change, thus producing a functionally equivalent EphA2 gene product. By "functionally equivalent", it is meant that the mutated EρhA2 gene product has the same function as the wild-type EphA2 gene product, e.g., contains one or more epitopes of EphA2.
[00273] An EphA2 antigenic peptide sequence preferably comprises (or consists of) an amino acid sequence that exhibits at least about 65% sequence similarity to human EphA2, more preferably exhibits at least 70% sequence similarity to human EphA2, yet more preferably exhibits at least about 75% sequence similarity human EphA2. In other embodiments, the EphA2 polypeptide sequence preferably comprises (or consists of) an amino acid sequence that exhibits at least 85% sequence similarity to human EphA2, yet more preferably exhibits at least 90% sequence similarity to human EphA2, and most preferably exhibits at least about 95% sequence similarity to human EphA2. [00274] The present invention encompasses EphA2 antigenic peptides comprising
EphA2 or a fragment thereof that are encoded by nucleotide sequences that have at least 65% homology to human EρhA2 or a fragment thereof, more preferably has at least 70% homology to human EphA2 or a fragment thereof, yet more preferably has at least about 75% homology to human EphA2 or a fragment thereof. In other embodiments, the present invention encompasses EphA2 antigenic peptides comprising EphA2 or a fragment thereof that are encoded by nucleotide sequences that have at least 85% homology to human EphA2 or a fragment thereof, preferably at least 90% homology to human EphA2 or a fragment thereof, and more preferably at least about 95% homology to human EphA2 or a fragment thereof.
[00275] In a particular embodiment, the EphA2 antigenic peptide is encoded by nucleotide sequences that have been codon-optimized for expression in bacteria. In another embodiment, the EphA2 antigenic peptide is encoded by nucleotide sequences that have been codon-optimized for expression in Listeria.
[00276] In a particular embodiment, the EphA2 antigenic peptides comprise (or consist of) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a nucleotide sequence that encodes human EphA2 or a fragment thereof, such as the
intracellular domain or extracellular domain, under stringent conditions. In a specific embodiment, the nucleotide sequences encoding EphA2 antigenic peptides that hybridize under high stringency, intermediate or lower stringency hybridization conditions, e.g., as defined infra, to nucleotide sequences that encode an EphA2 or a fragment thereof. It is understood that the nucleotide sequences hybridize over the full length EphA2 or a corresponding fragment (e.g., EphA2 extracellular domain or EphA2 intracellular domain) depending on the nucleotide sequence that encodes an EphA2 antigenic peptide. In a preferred embodiment, the nucleotide sequences hybridize over the full length human EphA2 or a corresponding fragment (e.g., human EphA2 extracellular domain or human EphA2 intracellular domain) depending on the nucleotide sequence that encodes the human EphA2 antigenic peptide.
[00277] In a specific embodiment, EphA2 antigenic peptides that comprise (or consist of) at least 10, 20, 30, 40, 50, 75, 100, or 200 amino acids of an EphA2 polypeptide, preferably of SEQ ID NO:2 are used in the present invention. In a preferred embodiment, EphA2 antigenic peptides that comprise (or consist of) at least 10, 20, 30, 40, 50, 75, 100, or 200 contiguous amino acids of an EphA2 polypeptide, preferably of SEQ ID NO:2 are used in the present invention. In a preferred embodiment, an EphA2 antigenic peptide comprises (or consists of) all or a fragment of the extracellular domain of an EphA2 polypeptide of SEQ ID NO:2. In another preferred embodiment, an EphA2 antigenic peptide comprises (or consists of) all or a fragment, derivative or analog of the intracellular domain of an EphA2 polypeptide of SEQ ID NO:2. In accordance with these embodiments, the extracellular or intracellular domains may be codon-optimized and the intracellular domain may have an amino acid substitution at position 646 that ablates kinase activity. [00278] In certain embodiments of the present invention, an EphA2 antigenic peptide is a fusion protein. Thus, the present invention encompasses EphA2 antigenic peptides that are fusion proteins comprising all or a fragment, derivative or analog of EphA2 operatively associated, linked and/or conjugated to a heterologous component, e.g., a heterologous peptide, such as a signal peptide. Heterologous components can include, but are not limited to sequences which facilitate isolation and purification of the fusion protein. Heterologous components can also include sequences which confer stability to EphA2 antigenic peptides. Such fusion partners are well known to those of skill in the art. In certain embodiments, a fusion protein comprises a signal peptide sequence and an EphA2 antigenic peptide.
[00279] In a specific embodiment, the heterologous component is the native Listeria
ActA protein or a fragment thereof. In another embodiment, the heterologous component is amino acid residues 1 to 25, 1 to 50, 1 to 75, 1 to 100, 1 to 125, or 1 to 150 of actA, wherein amino acid residue 1 is the N-terminal amino acid residue of ActA. In another embodiment, the heterologous component is the first 15, the first 20, the first 25, the first 30, the first 35, the first 40, the first 45, the First 50, the first 55, the first 60, the first 65, the first 70, the first 75, the first 80, the first 85, the first 90, the first 95, the first 100, the first 110, the first 125, the first 150, or the first 175 amino acid residues of ActA. In a preferred embodiment, the heterologous component is the NH2 terminal 1-100 amino acids of actA. In a further embodiment, the amino acid sequence of ActA or a fragment thereof is fused to the NH2 terminus of EphA2, or a derivative, analog or fragment thereof. Without being bound by any mechanism, the actA protein sequences may help expression and secretion of EρhA2 or a derivative, analog or fragment thereof. [00280] The present invention encompasses the use of fusion proteins comprising EphA2 or a derivative, analog or fragment thereof (e.g. , a polypeptide of SEQ ID NO:2 or a fragment thereof) and a heterologous polypeptide (Le., a polypeptide or fragment thereof, preferably a fragment of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 contiguous amino acids of the polypeptide). The fusion can be direct, but may occur through linker sequences. The heterologous polypeptide may be fused to the N-terminus or C-terminus of the EphA2 antigenic peptide. Alternatively, the heterologous polypeptide may be flanked by EphA2 polypeptide sequences.
[00281] A fusion protein can comprise EphA2 or a derivative, analog or fragment thereof fused to a heterologous signal sequence at its N-terminus. Various signal sequences are commercially available. In addition to the signal sequences described in Section 5.2.3.3.1, prokaryotic heterologous signal sequences useful in the methods of the invention include, but are not limited to, the phoA secretory signal (Sambrook et al., eds., 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) and the protein A secretory signal (Pharmacia Biotech, Piscataway, NJ).
[00282] EphA2 or a derivative, analog or fragment thereof can be fused to tag sequences, e.g., a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, CA), among others, many of which are commercially available for use in the methods of the invention. As described in Gentz et al., 1989, Proc.
Natl. Acad. ScL USA, 86:821-824, for instance, hexa-histidine provides for convenient purification of the fusion protein. Other examples of peptide tags are the hemagglutinin "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, 1984, Cell, 37:767) and the "flag" tag (Knappik et at, 1994, Biotechniques, 17(4):754-761). These tags are especially useful for purification of recombinantly produced EphA2 antigenic peptides.
[00283] An affinity label can be fused at its amino terminal to the carboxyl terminal of EphA2 or a derivative, analog or fragment thereof for use in the methods of the invention. The precise site at which the fusion is made in the carboxyl terminal is not critical. The optimal site can be determined by routine experimentation. An affinity label can also be fused at its carboxyl terminal to the amino terminal of EphA2 or a derivative, analog or fragment thereof for use in the methods and compositions of the invention. [00284] A variety of affinity labels known in the art may be used, such as, but not limited to, the immunoglobulin constant regions (see also Petty, 1996, Metal-chelate affinity chromatography, in Current Protocols in Molecular Biology, Vol. 2, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience), glutathione S-transferase (GST; Smith, 1993, Methods MoI. Cell Bio. 4:220-229), the E. coli maltose binding protein (Guan et al., 1987, Gene 67:21-30), and various cellulose binding domains (U.S. Patent Nos. 5,496,934; 5,202,247; 5,137,819; Tomme et al, 1994, Protein Eng. 7:117-123), etc. Other affinity labels are recognized by specific binding partners and thus facilitate isolation by affinity binding to the binding partner which can be immobilized onto a solid support. Some affinity labels may afford the EphA2 antigenic peptide novel structural properties, such as the ability to form multimers. These affinity labels are usually derived from proteins that normally exist as homopolymers. Affinity labels such as the extracellular domains of CD8 (Shiue et al, 1988, /. Exp. Med. 168: 1993-2005), or CD28 (Lee et al, 1990, J. Immunol. 145:344-352), or fragments of the immunoglobulin molecule containing sites for interchain disulfide bonds, could lead to the formation of multimers. [00285] As will be appreciated by those skilled in the art, many methods can be used to obtain the coding region of the above-mentioned affinity labels, including but not limited to, DNA cloning, DNA amplification, and synthetic methods. Some of the affinity labels and reagents for their detection and isolation are available commercially. [00286] Various leader sequences known in the art can be used for the efficient secretion of the EphA2 antigenic peptide from bacterial cells such as Listeria (von Heijne,
1985, J. MoL Biol. 184:99-105). In addition to the signal sequences described above and in Section 5.2.3.3.1, suitable leader sequences for targeting EphA2 antigenic peptide expression in bacterial cells include, but are not limited to, the leader sequences of the E.coli proteins OmpA (Hobom et al, 1995, Dev. Biol Stand. 84:255-262), Pho A (Oka et al, 1985, Proc. Natl Acad. Sci 82:7212-16), OmpT (Johnson et al, 1996, Protein
Expression 7:104-113), LamB and OmpF (Hoffman & Wright, 1985, Proc. Natl. Acad. Sci. USA 82:5107-5111), β-lactamase (Kadonaga et al, 1984, /. Biol. Chem. 259:2149- 54), enterotoxins (Morioka-Fujimoto et al, 1991, /. Biol. Chem. 266:1728-32), and the Staphylococcus aureus protein A (Abrahmsen et al, 1986, Nucleic Acids Res. 14:7487- 7500), and the B. subtilis endoglucanase (Lo et al., Appl. Environ. Microbiol. 54:2287- 2292), as well as artificial and synthetic signal sequences (Maclntyre et al., 1990, MoI. Gen. Genet. 221:466-74; Kaiser et al, 1987, Science, 235:312-317). [00287] In certain embodiments, the fusion partner comprises a non-EphA2 polypeptide corresponding to an antigen associated with the cell type against which a therapeutic or prophylactic immune is desired. For example, the non-EphA2 polypeptide can comprise an epitope of a tumor-associated antigen, such as, but not limited to, MAGE- 1, MAGE-2, MAGE-3, gplOO, TRP-2, tyrosinase, MART-I, β-HCG, CEA, Ras, β- catenin, gρ43, GAGE-I, GAGE -2, N-acetylglucosaminyltransferase-V, pl5, β-catenin, BAGE-I, PSA, MUM-I, CDK4, HER-2/neu, Human papillomavirus-E6, Human papillomavirus-E7, and MUC-I, 2, 3.
[00288] In certain embodiments, EphA2 or a derivative, analog or fragment thereof is functionally coupled to an internalization signal peptide, also referred to as a "protein transduction domain," that would allow its uptake into the cell nucleus. In certain specific embodiments, the internalization signal is that of Antennapedia (reviewed by Prochiantz, 1996, Curr. Opin. Neurobiol. 6:629-634, Hox A5 (Chatelin et al., 1996, Mech. Dev.
55:111-117), HIV TAT protein (Vives et al., 1997, J. Biol. Chem. 272:16010-16017) or VP22 (Phelan et ah, 1998, Nat. Biotechnol 16:440-443).
[00289] Any fusion protein may be readily purified by utilizing an antibody specific or selective for the fusion protein being expressed.
5.2.3.3.1 Signal Peptides
[00290] The terms "signal peptide," "signal sequence," and "secretion signal" are used interchangeably herein. In some embodiments, the signal peptide helps facilitate transportation of a polypeptide fused to the signal peptide across the cell membrane of a
cell (e.g., a bacterial cell) so that the polypeptide is secreted from the cell. Accordingly, in some embodiments, the signal peptide is a "secretory signal peptide" or "secretory sequence". In some embodiments, the signal peptide is positioned at the N-terrninal end of the polypeptide to be secreted. [00291] In some embodiments, the sequence encoding the signal peptide in the recombinant nucleic acid or expression cassette is positioned within the recombinant nucleic acid or expression cassette such that the encoded signal peptide will effect secretion of the polypeptide to which it is fused from the desired Listeria. In some embodiments, in a recombinant nucleic acid or an expression cassette, the nucleotide sequence encoding the signal peptide is positioned in frame (either directly or separated by intervening polynucleotides) at the 5' end of the polynucleotide that encodes the polypeptide to be secreted (e.g., a polypeptide comprising an antigen). [00292] In some embodiments, the signal peptides that are part of the fusion proteins and/or protein chimeras encoded by the recombinant nucleic acid, expression cassettes and/or expression vectors, are heterologous to at least one other polypeptide sequence in the fusion protein and/or protein chimera. In some embodiments, the signal peptide encoded by the recombinant nucleic acid, expression cassette and/or expression vector is heterologous (Le., foreign) to the Listeria into which the recombinant nucleic acid, expression cassette and/or expression vector is to be incorporated or has been incorporated. In some embodiments, the signal peptide is native to the Listeria in which the recombinant nucleic acid molecule, expression cassette and/or expression vector is to be incorporated.
[00293] In some embodiments, the nucleotide sequence encoding the signal peptide is codon-optimized for expression in Listeria (such as Listeria monocytogenes). In some embodiments, the nucleotide sequence that is codon-optimized for a particular bacterium is foreign to the Listeria. In other embodiments, the nucleotide sequence that is codon- optimized for the particular Listeria is native to that Listeria. [00294] A large variety of signal peptides are known in the art. In addition, a variety of algorithms and software programs, such as the "SignalP" algorithms, which can be used to predict signal peptide sequences are available in the art. For instance, see: Antelmann et al., Genome Res., 11: 1484-502 (2001); Menne et al., Bioinformatics, 16:741-2 (2000); Nielsen et al., Protein Eng., 10:1-6 (1997); Zhang et al, Protein ScI, 13:2819-24 (2004); Bendtsen et al., J. MoI Biol, 340:783-95 (2004) (regarding SignalP 3.0); Hiller et al, Nucleic Acids Res., 32:W375-9 (2004); Schneider et al, Proteomics
4:1571-80 (2004; Chou, Curr. Protein Pept. Sd., 3:615-22 (2002); Shah etaL, Bioinformatics, 19:1985-96 (2003); and Yuan et aL, Biochem. Biophys. Res. Commun. 312: 1278-83 (2003).
[00295] In some embodiments the signal peptide is prokaryotic. In some alternative embodiments, the signal peptide is eukaryotic. The use of eukaryotic signal peptides for expression of proteins in Escherichia coli for example, is described in Humphreys et al., Protein Expression and Purification, 20:252-264 (2000).
[00296] In some embodiments, the signal peptide is a bacterial signal peptide. In some embodiments, the signal peptide is a non-Listeria signal peptide. In some embodiments, the signal peptide is a Listeria signal peptide. In some embodiments the signal peptide is derived from gram-positive bacterium. In some embodiments, the signal peptide is derived from an intracellular bacterium.
[00297] In some embodiments, the signal peptide (e.g., a non-secAl bacterial signal peptide) used in a recombinant nucleic acid molecule, expression cassette, or expression vector is derived from Listeria. In some embodiments, this signal peptide is derived from Listeria monocytogenes. In some embodiments, the signal peptide is a signal peptide from Listeria monocytogenes. In some embodiments, the signal peptide is not derived from Listeria, but is instead derived from a bacterium other than a bacterium belonging to the genus Listeria. In some embodiments, the bacterial signal peptide is derived from a Bacillus bacterium.
[00298] Bacteria utilize diverse pathways for protein secretion, including sec Al and
Twin-Arg Translocation (Tat), which are located at the N-terminal end of the pre-protein. The majority of secreted proteins utilize the Sec pathway, in which the protein translocates through the bacterial membrane-embedded proteinaceous Sec pore in an unfolded conformation. In contrast, the proteins utilizing the Tat pathway are secreted in a folded conformation.
[00299] Other signal peptides that can be used include, but are not limited to B. anthracis protective antigen ("BaPa"), Bs phoD, p60, LI usp45 (van Asseldonk et al., 1993, MoI Gen Genet. 240:428^34). In particular, these signal peptides may provide better secretion and/or expression in the constructs disclosed herein. The Listeria protein p60 is a peptidoglucan autolysin that is secreted by the secA2 pathway. See, e.g., U.S. Patent Application Publication No. US 2005/0249748, which is incorporated herein by reference, for secretory signal peptides and the use of them to produce fusion proteins.
[00300] Nucleotide sequence encoding signal peptides corresponding to either of these protein secretion pathways (including, but not limited to, the signal peptides described in Section 5.1.2.4 and the signal and leader peptides described in Section 5.2.1) can be fused genetically in-frame to a desired heterologous protein coding sequence. The signal peptides optimally contain a cleavage site recognized by a peptidase at their carboxyl terminus for release of the authentic desired protein into the extra-cellular environment (Sharkov and Cai. 2002, J. Biol. Chem. 277:5796-5803; Nielsen et. al 1997, Protein Engineering 10:1-6) Signal peptide cleavage sites can be predicted using programs such as SignalP 3.0 (Bendtsen et al, 2004, /. MoI. Biol. 340:783-795). The signal peptides can be derived not only from diverse secretion pathways, but also from diverse bacterial genera. Signal peptides have a common structural organization, having a charged N-terminus (N-domain), a hydrophobic core region (H-domain) and a more polar C-terminal region (C-domain), however, they do not show sequence conservation. The C- domain of the signal peptide carries a type I signal peptidase (SPase I) cleavage site, having the consensus sequence A-X-A, at positions —1 and —3 relative to the cleavage site. Proteins secreted via the sec pathway have signal peptides that average 28 residues. Signal peptides related to proteins secreted by the Tat pathway have a tripartite organization similar to Sec signal peptides, but are characterized by having an RR-motif (R-R-X-#-#, where # is a hydrophobic residue), located at the N-domain / H-domain boundary. Bacterial Tat signal peptides average 14 amino acids longer than sec signal peptides. The Bacillus subtilis secretome may contain as many as 69 putative proteins that utilize the Tat secretion pathway, 14 of which contain a SPase I cleavage site (Jongbloed et al, 2002, J. Biol. Chem. 277:44068-44078; Thalsma et al, 2000, Microbiol. MoI. Biol. Rev. 64:515-547). Shown in Table 4 below are non-limiting examples of signal peptides that can be used in fusion compositions with a selected heterologous gene, resulting in secretion from the bacterium of the encoded protein.
[00301] TABLE 4: signal sequences useful for bacterial expression and secretion of
EphA2. TABLE 4
[00302] There are a variety of proteins among diverse bacterid genera that are secreted via the Tat pathway. In some embodiments, selected Tat signal peptides corresponding to these proteins are fused genetically in-frame to a desired sequence encoding an EphA2 antigenic peptide, to facilitate secretion of the functionally linked Tat signal peptide-EphA2 protein chimera via the Tat pathway. Tat signal sequences from other bacteria can also be used as signal peptides, including, but not restricted to, phoD from B. subtilis. See Jongbloed et al, 2002, J. Biol. Chem. 277:44068-44078; Jongbloed et al, 2000, J. Biol. Chem. 275:41350-41357; Pop et al, 2002, J. Biol. Chem. 277:3268- 3273; van Dijl et al, 2002, J. Biotechnology 98:243-254; and Tjalsma et al, 2000,
Microbiology and Molecular Biology Reviews 64:515-547. Provided below are other non-limiting examples of proteins from Bacillus subtilis and Listeria (innocua and monocytogenes) that are predicted to utilize Tat pathway secretion. [00303] Other proteins identified that have been predicted to be secreted by the Tat pathway include the following: >gi|2635523|emb|CAB15017.1| similar to two (component sensor histidine kinase (YtsA) (Bacillus subtilis); >gi|2632548|emb|CAB 12056.1| phosphodiesterase/alkaline phosphatase D (Bacillus subtilis); >gi|2632573|emb|CAB12081.1| similar to hypothetical proteins (Bacillus subtilis); >gi|2633776|emb|CAB13278.1| similar to hypothetical proteins (Bacillus subtilis); >gi|2634674|emb[CAB14172.1| menaquinolxytochrome c oxidoreductase (iron (sulfur subunit) (Bacillus subtilis); >gi|2635595|emb|CAB15089.1| yubF (Bacillus subtilis);
>gi|263636l|emb|CAB15852.1| alternate gene name: ipa (29d~similar to hypothetical proteins (Bacillus subtilis); >gi|16799463|ref|NP_469731.1| conserved hypothetical protein similar to B. subtilis YwbN protein (Listeria innocua); >gi|l6801368|ref|NP_471636.1| similar to 3 (oxoacyl (acyl (carrier protein synthase (Listeria innocua); and >gi|16802412|ref|NP_463897.1| conserved hypothetical protein similar to B. subtilis YwbN protein (Listeria monocytogenes EGD (e)). [00304] Organisms utilize codon bias to regulate expression of particular endogenous genes. Thus, signal peptides utilized for secretion of selected EphA2 antigenic peptides may not contain codons that utilize preferred codons, resulting in non- optimal levels of protein synthesis. In some embodiments, the signal peptide sequence fused in frame with a nucleotide sequence encoding EphA2 or a derivative, analog or fragment thereof is codon-optimized for codon usage in a selected Listeria. In some embodiments for expression and secretion from recombinant Listeria monocytogenes, a nucleotide sequence of a selected signal peptide is codon optimized for expression in Listeria monocytogenes, according to Table 4, supra.
5.2.3.3.2 Nucleotide Sequences Encoding EphA2 Antigenic Peptides
[00305] The present invention encompasses nucleotide sequences encoding peptides described in section 5.2.3.3. In preferred embodiments, the nucleotide sequences are those in SEQ ID NOS:90, 92, 94, 96 or 98. The present invention also encompasses nucleotide sequences that are homologous to nucleotide sequences encoding peptides described in Section 5.2.3.3.
[00306] The present invention also encompasses nucleotide sequences encoding
EphA2 antigenic peptides that hybridize under high stringency, intermediate or lower stringency hybridization conditions, e.g., as defined infra, to nucleotide sequences that encode an EphA2 or a fragment thereof. It is understood that the nucleotide sequences hybridize over the full length EphA2 or a corresponding fragment (e.g., EphA2 extracellular domain or EphA2 intracellular domain) depending on the nucleotide sequence that encodes an EphA2 antigenic peptide. In a preferred embodiment, the nucleotide sequences hybridize over the full length human EphA2 or a corresponding fragment (e.g., human EphA2 extracellular domain or human EphA2 intracellular domain) depending on the nucleotide sequence that encodes the human EphA2 antigenic peptide.
[00307] By way of example and not limitation, procedures using such conditions of low stringency for regions of hybridization of over 90 nucleotides are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. ScL USA 78:6789-6792). Filters containing DNA are pretreated for 6 hours at 400C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X 106 cpm 32P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 400C, and then washed for 1.5 h at 55°C in a solution containing 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 600C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re- exposed to film. Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).
[00308] Also, by way of example and not limitation, procedures using such conditions of high stringency for regions of hybridization of over 90 nucleotides are as follows. Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65°C in buffer composed of 6X SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65°C in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20 X lO6 cpm of 32P-labeled probe. Washing of filters is done at 37°C for 1 h in a solution containing 2X SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1X SSC at 500C for 45 min before autoradiography. [00309] Other conditions of high stringency which may be used depend on the nature of the nucleic acid (e.g., length, GC content, etc.) and the purpose of the hybridization (detection, amplification, etc.) and are well known in the art. For example, stringent hybridization of a nucleic acid of approximately 15-40 bases to a complementary sequence in the polymerase chain reaction (PCR) is done under the following conditions: a salt concentration of 50 mM KCl, a buffer concentration of 10 mM Tris-HCl, a Mg2+ concentration of 1.5 mM, a pH of 7-7.5 and an annealing temperature of 55-600C. Selection of appropriate conditions for moderate stringencies is also well known in the art (see, e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; see also, Ausubel et al.,
eds., in the Current Protocols in Molecular Biology series of laboratory technique manuals, © 1987-1997, Current Protocols, © 1994-1997 John Wiley and Sons, Inc.). [00310] In some embodiments, the present invention encompasses nucleotide sequences with 100%, 99.5%, 99%, 98.5%, 98%, 97.5%, 97%, 96.5%, 96%, 95.5%, 95%, 94%, 93%, 92%, 91% 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10% identity to nucleotide sequences encoding EphA2 (preferably, human EphA2, SEQ DD NO:1) or derivatives, analogs or fragments thereof (e.g., EphA2 intracellular domain or EphA2 extracellular domain). In specific embodiments, the nucleotide seqeuences of the invention are isolated or purified using methods and techniques well known in the art or methods described herein.
5.2.3.4. Transcription Termination Sequence
[00311] In some embodiments, a transcription termination sequence can be inserted into the heterologous protein expression cassette, downstream from the C-terminus of the translational stop codon related to the heterologous protein. Appropriate sequence elements known to those who are skilled in the art that promote either rho-dependent or rho-independent transcription termination can be placed in the heterologous protein expression cassette.
5.2.3.5. Intragenic Sequences
[00312] In some embodiments, the bicistronic or polycistronic expression cassettes comprise an intergenic sequence (e.g., from a native bacterial bicistronic or polycistronic gene) positioned between the coding sequences of the two peptides. In some embodiment, the intergenic sequence comprises a sequence which promotes ribosomal entry and initiation of translation. In some embodiments, the intergenic sequence is the Listeria monocytogenes actA-plcB intergenic sequence. Typically, the intergenic sequence is positioned between a polynucleotide sequence encoding a first polypeptide (or a first fusion protein comprising a first polypeptide and a signal peptide) and a polynucleotide sequence encoding a second polypeptide (or a second fusion protein comprising a second polypeptide and signal peptide).
[00313] Utilization of polycistronic expression requires that the 30s ribosome subunit stay on the polycistronic RNA message following translation termination of the
first coding sequence and release of the 50s ribosome sub-unit, and subsequently "read- through" the RNA message to the next initiation codon, during which the 50s ribosome sub-unit binds to the RNA-bound 30s ribosome subunit, and re-initiating translation. [00314] Listeria monocytogenes, like other bacteria, utilizes polycistronic expression of its genomic repertoire. By way of the example, the sequence of a Listeria monocytogenes intergenic region from a selected polycistronic message can be used to construct polycistronic expression cassettes for expression of a selected heterologous protein from recombinant Listeria species. For example, several of the prfA-dependent virulence factors from Listeria monocytogenes are expressed from polycistronic message. For instance, the Listeria monocytogenes ActA and PIcB proteins are expressed as a bicistronic message. The DNA sequence corresponding to the Listeria monocytogenes actA-plcB intergenic sequence (5 '-3') is shown below:
5'-TAAAAACACAGAACGAAAGAAAAAGTGAGGTGAATGA-S' (SEQ ID NO:89) [00315] The Shine-Dalgarno sequence for translation initiation oϊplcB is shown in bold. The first 3 nucleotides of the sequence correspond to an Ochre stop codon.
[00316] Alternatively, other known intergenic or synthetic sequences can be used to construct polycistronic expression cassettes for use in Listeria or other bacteria. Construction of intergenic regions which lead to substantial secondary RNA structure should be prevented, to avoid unwanted transcription termination by a rho-independent mechanism.
[00317] Importantly, if secretion of any or all translated proteins expressed from the polycistronic message is desired, signal peptides must be functionally linked to each coding region. In some embodiments, these signal peptides differ from each other.
5.3. Methods of Producing Recombinant Nucleic Acid Sequences [00318] Methods of preparing recombinant nucleic acids, including those described above, are well known to those of ordinary skill in the art. For example, if the nucleotide sequence of the EphA2 antigenic peptide is known, a nucleic acid encoding the peptide may be assembled from chemically synthesized oligonucleotides {e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the peptide, annealing and ligating those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR. In another example, recombinant nucleic acid molecules can be prepared by synthesizing long oligonucleotides on a DNA synthesizer which overlap with
each other and then performing extension reaction and/or PCR to generate the desired quantity of double-stranded DNA. See, e.g., sections 6.2.5, 6.10.2, and 6.10.5.1 which describe the preparation of EphA2 expression cassettes.
[00319] The double-stranded DNA can be cut with restriction enzymes and inserted into the desired expression or cloning vectors. See, e.g., sections 6.2.3-6.2.5, 6.10.1, 6.10.2 and 6.10.5.1 which describe the cloning of EphA2 expression cassettes into the appropriate vectors. Sequencing may be performed to verify that the correct sequence has been obtained. Also by way of non-limiting example, alternatively, one or more portions of the recombinant nucleic acid molecules may be obtained from plasmids containing the portions. PCR of the relevant portions of the plasmid and/or restriction enzyme excision of the relevant portions of the plasmid can be performed, followed by ligation and/or PCR to combine the relevant polynucleotides to generate the desired recombinant nucleic acid molecules. Such techniques are standard to the art. Standard cloning techniques may also be used to insert the recombinant nucleic acid sequence into a plasmid and replicate the recombinant nucleic acid within a host cell, such as bacteria. The recombinant nucleic acid can then be isolated from the host cell.
[00320] Alternatively, a polynucleotide encoding an EphA2 antigenic peptide may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular peptide is not available, but the sequence of the EphA2 antigenic peptide is known, a nucleic acid encoding the peptide may be chemically synthesized or obtained from a suitable source (e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing EphA2) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a. cDNA clone from a cDNA library that encodes the peptide. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in die art.
[00321] Further, a nucleic acid that is useful hi the present methods may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et αi, 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et αl., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate
EphA2 antigenic peptides having a different amino acid sequence from the amino acid sequence depicted in SEQ ID NO:2, for example to create amino acid substitutions, deletions, and/or insertions.
[00322] Polynucleotides encoding fusion proteins can be produced by standard recombinant DNA techniques. For example, a nucleic acid molecule encoding a fusion protein can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence {see, e.g., Current Protocols in Molecular Biology, Ausubel et aL, eds., John Wiley & Sons, 1992).
[00323] The nucleotide sequence coding for a fusion protein can be inserted into an appropriate expression vector, Le., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The expression of a fusion protein may be regulated by a constitutive, inducible or tissue-specific or -selective promoter. It will be understood by the skilled artisan that fusion proteins, which can facilitate solubility and/or expression, and can increase the in vivo half-life of the EphA2 antigenic peptide and thus are useful in the methods of the invention. The EphA2 antigenic peptides or peptide fragments thereof, or fusion proteins can be used in any assay that detects or measures EphA2 antigenic peptides or in the calibration and standardization of such assay.
[00324] The methods of invention encompass the use of EphA2 antigenic peptides or peptide fragments thereof, which may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing the EphA2 antigenic peptides of the invention by expressing nucleic acid sequences encoding EphA2 antigenic antigenic peptides are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing, e.g., EphA2 antigenic peptide coding sequences (including but not limited to nucleic acids encoding all or an antigenic portion of a polypeptide of SEQ ID NO:2) and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et aL, 1989, supra, and Ausubel et aL, 1989, supra. Alternatively, RNA capable of encoding EphA2 antigenic peptide sequences
may be chemically synthesized using, for example, synthesizers {see, e.g., the techniques described in Oligonucleotide Synthesis, 1984, Gait, MJ. ed., IRL Press, Oxford).
5.4. Introduction of Listeria Eph A2 Expression Cassettes into Listeria [00325] The invention also provides a method of using any of the expression cassettes described herein to produce a recombinant Listeria bacterium. In some embodiments, the method of using an expression cassette described herein to make a recombinant Listeria bacterium comprises introducing the expression cassette into a Listeria. Ih some embodiments, the expression cassette is integrated into the genome of the Listeria bacterium. In certain embodiments, the expression cassette is integrated into a chromosome of the Listeria bacterium by homologous recombination. In other embodiments, the expression cassette is on a plasmid which is incorporated within the Listeria bacterium. In some embodiments, incorporation of the expression cassette into the Listeria bacterium occurs by conjugation. The introduction of the expression cassette into the Listeria bacterium can be effected by any of the standard techniques known in the art. For instance, incorporation of the expression cassette into the Listeria bacterium can occur by conjugation, transduction (transfection), or transformation. [00326] The EphA2 antigenic peptide expression cassette plasmids can be introduced optimally into a desired Listeria species, strain or type by electroporation, according to standard methods for electroporation of Gram positive bacteria. See, e.g., section 6.10. Briefly, bacteria electroporated with the EphA2 antigenic peptide expression cassette plasmid are selected by plating on BHI agar media containing chloramphenicol (10 μg/ml) or plating on VPP (Vegetable Peptone Phosphate, Oxoid Ltd.)/Stp (streptomycin)/Cm agar media, and incubated at the permissive temperature of 300C. Single cross-over integration into the bacterial chromosome is selected by passaging several individual colonies for multiple generations at the non-permissive temperature of 41°C in media containing chloramphenicol. Finally, plasmid excision and curing (double cross-over) is achieved by passaging several individual colonies for multiple generations at the permissive temperature of 300C in BHI media or VPP media not containing chloramphenicol. Verification of integration of the EphA2 antigenic peptide expression cassette into the Listeria chromosome can be accomplished by PCR, utilizing a primer pair that amplifies a region defined from within the EphA2 antigenic peptide expression cassette to the Listeria! chromosome targeting sequence not contained in the plasmid vector construct.
[00327] In another method, the plasmid can then be introduced into E. coli by transformation, followed by introduction and integration into Listeria (DP-L4056) by conjugation, exactly as described by Lauer et al., or into another desired strain of Listeria, such as an actA' mutant strain (DP-L0429), LLO L461T strain (DP-L4017), or actA'linlB' strain (DP-L4029ifctø).
[00328] Derivation and maintenance of CERS 382.20 and all EphA2-expressing stains were performed in animal product-free medium (Vegetable Peptone Phosphate, Oxoid, Ltd.).
5.5. Assays for EphA2 Antigenic Peptides [00329] The present invention provides Listeria-based EphA2 immunogenic compositions comprising Listeria bacteria engineered to express an EphA2 antigenic peptide. Any assay known in the art for determining whether a peptide is a T cell epitope or a B cell epitope may be employed in testing EphA2 peptides for suitability in the present methods and compositions. [00330] For example, for determining whether a peptide is a T cell epitope,
ELISPOT assays and methods for intracellular cytokine staining can be used for enumeration and characterization of antigen-specific CD4+ and CD8+ T cells. Lalvani et al. (1997) /. Exp. Med. 186:859-865; Waldrop et al. (1997) /. Clin Invest. 99:1739-1750. [00331] EphA2 antigenic peptides can be determined by screening synthetic peptides corresponding to portions of EphA2. Candidate antigenic peptides can be identified on the basis of their sequence or predicted structure. A number of algorithms are available for this purpose.
[00332] Exemplary protocols for such assays are presented below.
5.5.1. Peptides That Display Immunogenicity of EphA2 [00333] The ability of EphA2 peptides to elicit EphA2-specific antibody responses in mammals can be examined, for example, by immunizing animals {e.g., mice, guinea pigs or rabbits) with individual EphA2 peptides emulsified in Freund's adjuvant. [00334] After three injections (5 to 100 μg peptide per injection), IgG antibody responses are tested by peptide-specific ELISAs and imrnunoblotting against EphA2. [00335] EphA2 peptides which produce antisera that react specifically with the
EphA2 peptides and also recognized full length EphA2 protein in immunoblots are said to display the antigenicity of EphA2.
5.5.2. CD4+ T-CELL PROLIFERATION ASSAY
[00336] For example, such assays include in vitro cell culture assays in which, peripheral blood mononuclear cells ("PBMCs") are obtained from fresh blood of a patient with a disease involving overexpression of EphA2, and purified by centrifugation using FICOLL-PLAQUE PLUS (Pharmacia, Upsalla, Sweden) essentially as described by Kruse and Sebald, 1992, EMBO J. 11:3237-3244. The peripheral blood mononuclear cells are incubated for 7-10 days with candidate EphA2 antigenic peptides. Antigen presenting cells may optionally be added to the culture 24 to 48 hours prior to the assay, in order to process and present the antigen. The cells are then harvested by centrifugation, and washed in RPMI 1640 media (GibcoBRL, Gaithersburg, MD). 5 x 104 activated T cells/well are in RPMI 1640 media containing 10% fetal bovine serum, 10 mM HEPES, ph 7.5, 2 mM L-glutamine, 100 units/ml penicillin G, and 100 μg/ml streptomycin sulphate in 96 well plates for 72 hrs at 370C, pulsed with 1 μCi 3H-thymidine (DuPont NEN, Boston, MA)/well for 6 hrs, harvested, and radioactivity measured in a TOPCOUNT scintillation counter (Packard Instrument CoL, Meriden, CT).
5.5.3. Intracellular Cytokine Staining (ICS)
[00337] Measurement of antigen-specific, intracellular cytokine responses of T cells can be performed essentially as described by Waldrop et ah, 1997, /. Clin. Invest. 99:1739-1750; Openshaw etal, 1995, /. Exp. Med. 182:1357-1367; or Estcourt et al, 1997, Clin. Immunol. Immunopathol 83:60-67. Purified PBMCs from patients with a disease involving EphA2-overexpressing cells are placed in 12x75 millimeter polystyrene tissue culture tubes (Becton Dickinson, Lincoln Park, NJ.) at a concentration of IxIO6 cells per tube. A solution comprising 0.5 milliliters of HL-I serum free medium, 100 units per milliliter of penicillin, 100 units per milliliter streptomycin, 2 millimolar L glutamine (Gibco BRL), varying amounts of individual EphA2 antigenic candidate peptides, and 1 unit of anti-CD28 mAb (Becton-Dickinson, Lincoln Park, NJ.) is added to each tube. Anti-CD3 mAb is added to a duplicate set of normal PBMC cultures as positive control. Culture tubes are incubated for 1 hour. Brefeldin A is added to individual tubes at a concentration of 1 microgram per milliliter, and the tubes are incubated for an additional 17 hours.
[00338] PBMCs stimulated as described above are harvested by washing the cells twice with a solution comprising Dulbecco's phosphate-buffered saline (dPBS) and 10 units of Brefeldin A. These washed cells are fixed by incubation for 10 minutes in a
solution comprising 0.5 milliliters of 4% paraformaldehyde and dPBS. The cells are washed with a solution comprising dPBS and 2% fetal calf serum (FCS). The cells are then either used immediately for intracellular cytokine and surface marker staining or are frozen for no more than three days in freezing medium, as described (Waldrop et al., 1997, /. Clin. Invest. 99:1739-1750).
[00339] The cell preparations were rapidly thawed in a 37°C water bath and washed once with dPBS. Cells, either fresh or frozen, are resuspended in 0.5 milliliters of permeabilizing solution (Becton Dickinson Irnmunocytometry systems, San Jose, Calif.) and incubated for 10 minutes at room temperature with protection from light. Permeabilized cells are washed twice with dPBS and incubated with directly conjugated mAbs for 20 minutes at room temperature with protection from light. Optimal concentrations of antibodies are predetermined according to standard methods. After staining, the cells were washed, refixed by incubation in a solution comprising dPBS 1% paraformaldehyde, and stored away from light at 4°C for flow cytometry analysis.
5.5.4. ELISPOT Assays
[00340] The ELISPOT assay measures Thl-cytokine specific induction in murine splenocytes following Listeria vaccination. ELISPOT assays are performed to determine the frequency of T lymphocytes in response to endogenous antigenic peptide stimulation, and are as described in Geginat et al., 2001, /. Immunol. 166:1877-1884. Balb/c mice (3 per group) are vaccinated with L. monocytogenes expressing candidate EphA2 antigenic peptides or HBSS as control. Whole mouse spleens are harvested and pooled five days after vaccination. Single cell suspensions of murine splenocytes are plated in the presence of various antigens overnight in a 37°C incubator. [00341] Assays are performed in nitrocellulose-backed 96-well microtiter plates coated with rat anti-mouse IFN- γ mAb. For the testing of the candidate EρhA2 antigenic peptide, a 1 x 10"5 M peptide solution is prepared. In round-bottom 96-well microtiter plates per well 6 x 105 unseparated splenocytes in 135 μl culture medium (a modification of Eagle's medium (Life Technologies, Eggenstein, Germany) supplemented with 10% FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1 x 10"5 M 2-ME, and 2 mM glutamine) are mixed with 15 μl of the 1 x 10"5 M peptide solution to yield a final peptide concentration of 1 x 10"6M. After 6 h of incubation at 37°C, cells are resuspended by vigorous pipetting, and 100 μl or 10 μl of cell suspension (4 x 105/well or 4 x 104/well, respectively) is transferred to Ab-coated ELISPOT plates and incubated overnight at 370C.
In the ELISPOT plates, the final volume was adjusted to 150 μl to ensure homogenous distribution of cells.
[00342] Purified CD4+ or CD8+ T cells are tested in a modified assay as follows:
15 μl prediluted peptide (1 x 10"s M) is directly added to Ab-coated ELISPOT plates and mixed with 4 x 10s splenocytes from nonimmune animals as APC to yield a final volume of 100 μl. After 4 h of preincubation of APC at 37°C, 1 x 105 CD4+ or CD8+ cells purified from L. monocytogenes-immυne mice are added per well in a volume of 50 μl and plates are incubated overnight at 370C. The ELISPOT-based ex vivo MHC restriction analysis is performed after loading of cell lines expressing specific MHC class I molecules with 1 x 10"6 M peptide for 2 h at 37°C. Subsequently, unbound peptides are washed off (four times) to prevent binding of peptides to responder splenocytes. Per well of the ELISPOT plate, 1 x 105 peptide-loaded APC are mixed with 4 x 105 or 4 x 104 responder splenocytes in a final volume of 150 μl. After overnight incubation at 37°C, ELISPOT plates are developed with biotin-labeled rat anti-mouse IFN- γmAb, HRP streptavidin conjugate, and aminoethylcarbazole dye of spots per splenocytes seeded. The specificity and sensitivity of the ELISPOT assay is controlled with IFN- γ secreting CD8 T cell lines specific for a control antigen.
5.6. Prophylactic/Therapeutic Methods
5.6.1. Treatment, Management and/or Prevention of Hyperproliferative Disorders
[00343] The present invention provides methods for treating, preventing, and/or managing a disorder associated with aberrant (e.g., overexpression) of EphA2, comprising administering to a subject in need thereof one or more L/,stera.-based EphA2 immunogenic compositions of the invention. The present invention also provides for treating, preventing, and/or managing hyperproliferative cell disorders, preferably cancer, comprising administering to a subject in need thereof one or more Listeria-based EphA2 immunogenic compositions of the invention. The immunogenic compositions of the invention can be a pharmaceutical composition or a vaccine composition. [00344] The present invention encompasses methods for eliciting an immune response against an EphA2-expressing cell associated with a hyperproliferative cell disorder, comprising administering to a subject one or more Listeria-based EphA2 compositions of the invention in an amount effective for eliciting an immune response against the EphA2-exρressing cell-
[00345] The present invention also encompasses methods for eliciting an immune response against an EphA2-expressing cell associated with a hyperproliferative cell disorder, comprising administering to a subject a Listeria-based EphA2 composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for eliciting an immune response against the EphA2-expressing cell. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the Listeriα-based EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono.
[00346] In another specific embodiment, the disorder to be treated, prevented, or managed is a pre-cancerous condition associated with cells that overexpress EphA2. In more specific embodiments, the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
[00347] The present invention provides methods for treating, preventing, and/or managing a disorder associated with aberrant (e.g., overexpression) of EphA2, comprising administering to a subject in need thereof one or more Listeriα-based EphA2 immunogenic compositions of the invention and one or more other therapies. The present invention also provides methods for treating, preventing, and/or managing a hyperproliferative cell disorders, preferably cancer, comprising administering to a subject in need thereof one or more Listeriα-based EphA2 immunogenic compositions of the invention and one or more other therapies. Examples of other therapies include, but are not limited to, those listed below in Section 5.6.3, infra. [00348] In one embodiment, a Listeria-based EphA2 immunogenic composition of the invention is administered in combination with one or more other therapies {e.g., prophylactic or therapeutic agents) useful in the treatment, prevention and/or management of disorders associated with EphA2 overexpression and/or hyperproliferative cell disorders, such as cancer. In certain embodiments, one or more Listeriα-based EphA2 immunogenic compositions are administered to a subject, preferably a human, concurrently with one or more other therapies (e.g., therapeutic agents) useful for the treatment and/or management of cancer. The term "concurrently" is not limited to the administration of therapies (e.g., prophylactic or therapeutic agents) at exactly the same time, but rather it is meant that a Listeriα-based EphA2 immunogenic composition of the
invention and another therapy are administered to a subject in a sequence and within a time interval such that the Listeria-based EphA2 immunogenic composition can act together with the other therapy to provide an increased benefit than if they were administered otherwise. For example, each therapy (e.g., prophylactic or therapeutic agent) may be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, they should be administered sufficiently close in time so as to provide the desired therapeutic or prophylactic effect. Each therapy (e.g. , prophylactic or therapeutic agent) can be administered separately, in any appropriate form and by any suitable route. In certain embodiments, the Listeria- based EphA2 immunogenic compositions of the invention are administered before, concurrently or after surgery. Preferably, the surgery completely removes localized tumors or reduces the size of large tumors. Surgery can also be done as a preventive measure or to relieve pain. [00349] In various embodiments, the therapies (e.g., prophylactic or therapeutic agents) are administered less than 1 hour apart, at about 1 hour apart, at about 1 hour to about 2 hours apart, at about 2 hours to about 3 hours apart, at about 3 hours to about 4 hours apart, at about 4 hours to about 5 hours apart, at about 5 hours to about 6 hours apart, at about 6 hours to about 7 hours apart, at about 7 hours to about 8 hours apart, at about 8 hours to about 9 hours apart, at about 9 hours to about 10 hours apart, at about 10 hours to about 11 hours apart, at about 11 hours to about 12 hours apart, no more than 24 hours apart or no more than 48 hours apart. In preferred embodiments, two or more therapies are administered within the same patient visit.
[00350] The dosage amounts and frequencies of administration provided herein are encompassed by the terms therapeutically effective and prophylactically effective. The dosage and frequency further will typically vary according to factors specific for each patient depending on the specific therapeutic or prophylactic agents administered, the severity and type of cancer, the route of administration, as well as age, body weight, response, and the past medical history of the patient. Suitable regimens can be selected by one skilled in the art by considering such factors and by following, for example, dosages reported in the literature and recommended in the Physician's Desk Reference (56th ed., 2002, 57th ed., 2003 and 58th ed., 2004).
5.6.1.1. Patient Population
[00351] The invention provides methods for treating, preventing, and/or managing a disorder associated with EphA2 overexpression and/or hyperproliferative cell disease, particularly cancer, comprising administrating to a subject in need thereof one or more Listeria-based EphA2 immunogenic compositions of the invention in an effective amount or an amount effective to elicit an immune response against EphA2-expressing cells associated with the hyperproliferative disorder. In a preferred embodiment, the Listeriα- based EρhA2 composition is engineered to express two or more EphA2 antigenic peptides. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In another embodiment, the two or more EphA2 antigenic peptides are each encoded by separate monocistronic expression cassette. Preferably, the two or more EphA2 antigenic peptides include EphA2 ICD and EphA2 ECD. In a most preferred embodiment, the Listeriα-based EphA2 composition comprises ActA(N 100) Exmono Comono. In another embodiment, an effective amount of a Listeriα- based EphA2 immunogenic composition of the invention is administered in combination with an effective amount of one or more other therapies (e.g., therapeutic or prophylactic agents) to a subject to treat, prevent, and/or manage a disorder associated with EphA2 overexpression and/or hyperproliferative cell disease, particularly cancer. The subject is preferably a mammal such as non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) and a primate (e.g., monkey, such as a cynomolgous monkey and a human). In a preferred embodiment, the subject is a human.
[00352] hi a specific embodiment, the hyperproliferative disorder prevented, treated and/or managed in accordance with the methods of the invention is cancer. Specific examples of cancers that can be treated, prevented and/or managed in accordance with the methods encompassed by the invention include, but are not limited to, cancers that overexpress EphA2. In one embodiment, the cancer is of an epithelial origin. Examples of such cancers are cancer of the lung, colon, prostate, breast, and skin. Other cancers include cancer of the bladder and pancreas and renal cell carcinoma and melanoma. In another embodiment, the cancer is a solid tumor. In another embodiment, the cancer is of a T cell origin. Examples of such cancers are leukemias and lymphomas. Additional cancers are listed by example and not by limitation in the following Section 5.6.1.2. In particular embodiments, methods of the invention can be used to treat and/or prevent metastasis from primary tumors.
[00353] The methods and compositions of the invention comprise the administration of one or more Listeria-based EphA2 immunogenic compositions of the invention to subjects/patients suffering from or expected to suffer from cancer, e.g., have a genetic predisposition for a particular type of cancer, have been exposed to a carcinogen, or are in remission from a particular cancer. As used herein, "cancer" refers to primary or metastatic cancers. Such patients may or may not have been previously treated for cancer. The methods and compositions of the invention may be used as any line of cancer therapy, e.g., a first line, second line or third line of cancer therapy. Included in the invention is also the treatment of patients undergoing other cancer therapies and the methods and compositions of the invention can be used before any adverse effects or intolerance of these other cancer therapies occurs. The invention also encompasses methods for administering one or more Listeriα-based EphA2 immunogenic compositions of the invention to treat or ameliorate symptoms in refractory patients. In a certain embodiment, that a cancer is refractory to a therapy means that at least some significant portion of the cancer cells are not killed or their cell division arrested. The determination of whether the cancer cells are refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of treatment on cancer cells, using the art-accepted meanings of "refractory" in such a context. In various embodiments, a cancer is refractory where the number of cancer cells has not been significantly reduced, or has increased. The invention also encompasses methods for administering one or more Listeriα-based EphA2 immunogenic compositions to prevent the onset or recurrence of cancer in patients predisposed to having cancer.
[00354] In particular embodiments, the Listeriα-based EphA2 immunogenic compositions of the invention are administered to reverse resistance or reduced sensitivity of cancer cells to certain hormonal, radiation and chemotherapeutic agents thereby resensitizing the cancer cells to one or more of these agents, which can then be administered (or continue to be administered) to treat or manage cancer, including to prevent metastasis. In a specific embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention are administered to patients with increased levels of the cytokine IL-6, which has been associated with the development of cancer cell resistance to different treatment regimens, such as chemotherapy and hormonal therapy. In another specific embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention are administered to patients suffering from breast cancer that have a decreased responsiveness or are refractory to tamoxifen treatment. In another specific embodiment,
the Listeria-based EphA2 immunogenic compositions of the invention are administered to patients with increased levels of the cytokine IL-6, which has been associated with the development of cancer cell resistance to different treatment regimens, such as chemotherapy and hormonal therapy. [00355] In alternate embodiments, the invention provides methods for treating or managing a patients' cancer comprising administering to the patient one or more Listeriα- based EphA2 immunogenic compositions of the invention in combination with any other therapy or to patients who have proven refractory to other therapies but are no longer on these therapies. In certain embodiments, the patients being treated by the methods of the invention are patients already being treated with chemotherapy, radiation therapy, hormonal therapy, or biological therapy/immunotherapy. Among these patients are refractory patients and those with cancer despite treatment with existing cancer therapies. In other embodiments, the patients have been treated and have no disease activity and one or more Listeriα-based EphA2 immunogenic compositions of the invention are administered to prevent the recurrence of cancer.
[00356] In preferred embodiments, the existing therapy is chemotherapy. In particular embodiments, the existing therapy includes administration of chemotherapies including, but not limited to, methotrexate, taxol, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, cisplatin, carboplatin, mitomycin, dacarbazine, procarbizine, etoposides, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, asparaginase, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, etc. Among these patients are patients treated with radiation therapy, hormonal therapy and/or biological therapy/immunotherapy. Also among these patients are those who have undergone surgery for the treatment or management of cancer.
[00357] Alternatively, the invention also encompasses methods for treating or managing patients undergoing or having undergone radiation therapy. Among these are patients being treated or previously treated with chemotherapy, hormonal therapy and/or biological therapy/immunotherapy. Also among these patients are those who have undergone surgery for the treatment of cancer.
[00358] In other embodiments, the invention encompasses methods for treating patients undergoing or having undergone hormonal therapy and/or biological therapy/immunotherapy. Among these are patients being treated or having been treated
with chemotherapy and/or radiation therapy. Also among these patients are those who have undergone surgery for the treatment of cancer.
[00359] Additionally, the invention also provides methods of treatment or management of cancer as an alternative to chemotherapy, radiation therapy, hormonal therapy, and/or biological therapy/immunotherapy where the therapy has proven or may prove too toxic, i.e., results in unacceptable or unbearable side effects, for the subject being treated. The subject being treated with the methods of the invention may, optionally, be treated with other cancer therapies such as surgery, chemotherapy, radiation therapy, hormonal therapy or biological therapy, depending on which therapy was found to be unacceptable or unbearable.
[00360] In other embodiments, the invention provides administration of one or more
Listeria-based EphA2 immunogenic compositions of the invention without any other cancer therapies for the treatment of cancer, but who have proved refractory to such treatments. In specific embodiments, patients refractory to other cancer therapies are administered one or more EphA2 immunogenic compositions in the absence of cancer therapies.
[00361] In other embodiments, patients with a pre-cancerous condition associated with cells that overexpress EphA2 can be administered immunogenic compositions of the invention to treat the disorder and decrease the likelihood that it will progress to malignant cancer. In a specific embodiments, the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
[00362] In a specific embodiment, the hyperproliferative disorder prevented, treated and/or managed in accordance with the methods of the invention is a non-neoplastic hyperproliferative disorder, in particular, a non-neoplastic disorder associated with EphA2 overexpression. Non-limiting examples of such disorders include asthma, chromic obstructive pulmonary disorder (COPD), fibrosis {e.g., lung, kidney, heart and liver fibrosis), restenosis (smooth muscle and/or endothelial), psoriasis, etc. These methods include methods analogous to those described above for treating, preventing and managing cancer, for example, by administering the EphA2 immunogenic compositions of the invention, combination therapy (see, e.g., Section 5.6.3, infra, for examples of other therapies to administer in combination with the EphA2 immunogenic compositions to a subject to treat, prevent or manage a hyperproliferative disorder other than cancer), administration to patients refractory to particular treatments, etc.
5.6.1.2. Cancers
[00363] Cancers and related disorders that can be treated, prevented, or managed by methods and compositions of the present invention include, but are not limited to, cancers of an epithelial cell origin and/or an endothelial origin and cancers and related disorders that are characterized by overexpression of EphA2. Examples of such cancers include the following: leukemias, such as but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias, such as, myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia leukemias and myelodysplastic syndrome; chronic leukemias, such as but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as but not limited to Hodgkin's disease, non-Hodgkin's disease; multiple myelomas such as but not limited to smoldering multiple myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma; Waldenstrom's macroglobulinemia; monoclonal gammopathy of undetermined significance; benign monoclonal gammopathy; heavy chain disease; bone and connective tissue sarcomas such as but not limited to bone sarcoma, osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft-tissue sarcomas, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, neurilemmoma, rhabdomyosarcoma, synovial sarcoma; brain tumors such as but not limited to, glioma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, nonglial tumor, acoustic neurinoma, craniopharyngioma, medulloblastoma, meningioma, pineocytoma, pineoblastoma, primary brain lymphoma; breast cancer including but not limited to ductal carcinoma, adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease, and inflammatory breast cancer; adrenal cancer such as but not limited to pheochromocytom and adrenocortical carcinoma; thyroid cancer such as but not limited to papillary or follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer; pancreatic cancer such as but not limited to, insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin- secreting tumor, and carcinoid or islet cell tumor; pituitary cancers such as but limited to Cushing's disease, prolactin-secreting tumor, acromegaly, and diabetes insipius; eye cancers such as but not limited to ocular melanoma such as iris melanoma, choroidal melanoma, and cilliary body melanoma, and retinoblastoma; vaginal cancers such as
squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer such as squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget' s disease; cervical cancers such as but not limited to, squamous cell carcinoma, and adenocarcinoma; uterine cancers such as but not limited to endometrial carcinoma and uterine sarcoma; ovarian cancers such as but not limited to, ovarian epithelial carcinoma, borderline tumor, germ cell tumor, and stromal tumor; esophageal cancers such as but not limited to, squamous cancer, adenocarcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma; stomach cancers such as but not limited to, adenocarcinoma, fungating (polypoid), ulcerating, superficial spreading, diffusely spreading, malignant lymphoma, liposarcoma, fibrosarcoma, and carcinosarcoma; colon cancers; rectal cancers; liver cancers such as but not limited to hepatocellular carcinoma and hepatoblastoma; gallbladder cancers such as adenocarcinoma; cholangiocarcinomas such as but not limited to papillary, nodular, and diffuse; lung cancers such as non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large-cell carcinoma and small-cell lung cancer; testicular cancers such as but not limited to germinal tumor, seminoma, anaplastic, classic (typical), spermatocytic, nonseminoma, embryonal carcinoma, teratoma carcinoma, choriocarcinoma (yolk-sac tumor), prostate cancers such as but not limited to, prostatic intraepithelial neoplasia, adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma; penal cancers; oral cancers such as but not limited to squamous cell carcinoma; basal cancers; salivary gland cancers such as but not limited to adenocarcinoma, mucoepidermoid carcinoma, and adenoidcystic carcinoma; pharynx cancers such as but not limited to squamous cell cancer, and verrucous; skin cancers such as but not limited to, basal cell carcinoma, squamous cell carcinoma and melanoma, superficial spreading melanoma, nodular melanoma, lentigo malignant melanoma, acral lentiginous melanoma; kidney cancers such as but not limited to renal cell carcinoma, adenocarcinoma, hypernephroma, fibrosarcoma, transitional cell cancer (renal pelvis and/ or uterer); Wilms' tumor; bladder cancers such as but not limited to transitional cell carcinoma, squamous cell cancer, adenocarcinoma, carcinosarcoma. In addition, cancers include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma and papillary adenocarcinomas (for a review of such disorders, see Fishman et al., 1985, Medicine, 2d Ed., J-B. Lippincott Co.,
Philadelphia and Murphy eial., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A., Inc., United States of America).
[00364] The methods and compositions of the invention are also useful in the treatment or prevention of a variety of cancers or other abnormal proliferative diseases, including (but not limited to) the following: carcinoma, including that of the bladder, breast, colon, kidney, liver, lung, ovary, pancreas, stomach, cervix, thyroid and skin; including squamous cell carcinoma; hematopoietic tumors of lymphoid lineage, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T cell lymphoma, Burkitt's lymphoma; hematopoietic tumors of myeloid lineage, including acute and chronic myelogenous leukemias and promyelocytic leukemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyoscarcoma; other tumors, including melanoma, seminoma, tetratocarcinoma, neuroblastoma and glioma; tumors of the central and peripheral nervous system, including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin, including fibrosarcoma, rhabdomyoscarama, and osteosarcoma; and other tumors, including melanoma, xeroderma pigmentosum, keratoactanthoma, seminoma, thyroid follicular cancer and teratocarcinoma. It is also contemplated that cancers caused by aberrations in apoptosis would also be treated by the methods and compositions of the invention. Such cancers may include but not be limited to follicular lymphomas, carcinomas with p53 mutations, hormone dependent tumors of the breast, prostate and ovary, and precancerous lesions such as familial adenomatous polyposis, and myelodysplastic syndromes. In specific embodiments, malignancy or dysproliferative changes (such as metaplasias and dysplasias), or hyperproliferative disorders, are treated or prevented in the skin, lung, colon, breast, prostate, bladder, kidney, pancreas, ovary, or uterus. In other specific embodiments, sarcoma, melanoma, or leukemia is treated or prevented. [00365] In some embodiments, the cancer is malignant and overexpresses EphA2.
In other embodiments, the disorder to be treated is a pre-cancerous condition associated with cells that overexpress EphA2. In a specific embodiments, the pre-cancerous condition is high-grade prostatic intraepithelial neoplasia (PIN), fibroadenoma of the breast, fibrocystic disease, or compound nevi.
[00366] In preferred embodiments, the mediods and compositions of the invention are used for the treatment and/or prevention of breast, ovarian, esophageal, colon, ovarian,
lung, and prostate cancers and melanoma and are provided below by example rather than by limitation.
[00367] In another preferred embodiment, the methods and compositions of the invention are used for the treatment and/or prevention of cancers of T cell origin, including, but not limited to, leukemias and lymphomas.
5.6.1.3. Treatment of Breast Cancer
[00368] In specific embodiments, patients with breast cancer are administered an effective amount of one or more Listeπα-based EphA2 immunogenic compositions of the invention. In another embodiment, the Listeria-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for breast cancer therapy including but not limited to: doxorubicin, epirubicin, the combination of doxorubicin and cyclophosphamide (AC), the combination of cyclophosphamide, doxorubicin and 5-fluorouracil (CAF), the combination of cyclophosphamide, epirubicin and 5-fluorouracil (CEF), her-2 antibodies, e.g. , herceptin, tamoxifen, the combination of tamoxifen and cytotoxic chemotherapy, taxanes (such as docetaxel and paclitaxel). In a further embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention can be administered with taxanes plus standard doxorubicin and cyclophosphamide for adjuvant treatment of node-positive, localized breast cancer. [00369] In a specific embodiment, patients with pre-cancerous fibroadenoma of the breast or fibrocystic disease are administered a Listeriα-based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant breast cancer. In another specific embodiment, patients refractory to treatment, particularly hormonal therapy, more particularly tamoxifen therapy, are administered a Listeriα-based EphA2 immunogenic composition of the invention to treat the cancer and/or render the patient non-refractory or responsive.
5.6.1.4. Treatment of Colon Cancer
[00370] In specific embodiments, patients with colon cancer are administered an effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention. In another embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for colon cancer therapy including but not limited to:
AVASTIN™ (bevacizumab), the combination of 5-FU and leucovorin, the combination of 5-FU and levamisole, irinotecan (CPT-Il) or the combination of irinotecan, 5-FU and leucovorin (IFL).
5.6.1.5. Treatment of Prostate Cancer [00371] In specific embodiments, patients with prostate cancer are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention. In another embodiment, the Listeriα-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for prostate cancer therapy including but not limited to: external- beam radiation therapy, interstitial implantation of radioisotopes (Le., I , palladium, iridium), leuprolide or other LHRH agonists, non-steroidal antiandrogens (flutamide, nilutamide, bicalutamide), steroidal antiandrogens (cyproterone acetate), the combination of leuprolide and flutamide, estrogens such as DES, chlorotrianisene, ethinyl estradiol, conjugated estrogens U.S. P., DES-diphosphate, radioisotopes, such as strontium-89, the combination of external-beam radiation therapy and strontium-89, second-line hormonal therapies such as aminoglutethimide, hydrocortisone, flutamide withdrawal, progesterone, and ketoconazole, low-dose prednisone, or other chemotherapy regimens reported to produce subjective improvement in symptoms and reduction in PSA level including docetaxel, paclitaxel, estramustine/docetaxel, estramustine/etoposide, estramustine/vinblastine, and estramustine/paclitaxel.
[00372] In a specific embodiment, patients with pre-cancerous high-grade prostatic intraepithelial neoplasia (PBSf) are administered a Listeriα-based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant prostate cancer.
5.6.1.6. Treatment of Melanoma
[00373] In specific embodiments, patients with melanoma are administered an effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention. In another embodiment, the Zisførz'iz-based EρhA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for melanoma cancer therapy including but not limited to: dacarbazine (DTIC), nitrosoureas such as carmustine (BCNU) and lomustine (CCNU), agents with modest single agent activity including vinca alkaloids, platinum compounds,
and taxanes, the Dartmouth regimen (cisplatin, BCNU, and DTIC), interferon alpha (IFN- α), and interleukin-2 (IL-2). In a specific embodiment, an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention can be administered in combination with isolated hyperthermic limb perfusion (ELP) with melphalan (L-PAM), with or without tumor necrosis factor-alpha (TNF-α) to patients with multiple brain metastases, bone metastases, and spinal cord compression to achieve symptom relief and some shrinkage of the tumor with radiation therapy.
[00374] In a specific embodiment, patients with pre-cancerous compound nevi are administered a Listeriα-based EphA2 immunogenic composition of the invention to treat the disorder and decrease the likelihood that it will progress to malignant melanoma.
5.6.1.7. Treatment of Ovarian Cancer
[00375] In specific embodiments, patients with ovarian cancer are administered an effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention. In another embodiment, the L/srer/α-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for ovarian cancer therapy including but not limited to: intraperitoneal radiation therapy, such as P32 therapy, total abdominal and pelvic radiation therapy, cisplatin, the combination of paclitaxel (Taxol) or docetaxel (Taxotere) and cisplatin or carboplatin, the combination of cyclophosphamide and cisplatin, the combination of cyclophosphamide and carboplatin, the combination of 5-FU and leucovorin, etoposide, liposomal doxorubicin, gemcitabine or topotecan. It is contemplated that an effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention is administered in combination with the administration Taxol for patients with platinum-refractory disease. Included is the treatment of patients with refractory ovarian cancer including administration of: ifosfamide in patients with disease that is platinum-refractory, hexamethylmelamine (HMM) as salvage chemotherapy after failure of cisplatin-based combination regimens, and tamoxifen in patients with detectable levels of cytoplasmic estrogen receptor on their tumors.
5.6.1.8. Treatment of Lung Cancers [00376] In specific embodiments, patients with small lung cell cancer are administered an effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention. In another embodiment, the Lwrer/α-based EphA2
immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for lung cancer therapy including but not limited to: thoracic radiation therapy, cisplatin, vincristine, doxorubicin, and etoposide, alone or in combination, the combination of cyclophosphamide, doxorubicin, vincristine/etoposide, and cisplatin (CAV/EP), local palliation with endobronchial laser therapy, endobronchial stents, and/or brachytherapy.
[00377] In other specific embodiments, patients with non-small lung cell cancer are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with an effective amount of one or more other agents useful for lung cancer therapy including but not limited to: palliative radiation therapy, the combination of cisplatin, vinblastine and mitomycin, the combination of cisplatin and vinorelbine, paclitaxel, docetaxel or gemcitabine, the combination of carboplatin and paclitaxel, interstitial radiation therapy for endobronchial lesions or stereotactic radiosurgery.
5.6.1.9. Treatment of T cell Malignancies
[00378] In specific embodiments, patients with T cell malignancies, such as leukemias and lymphomas, are administered an effective amount of one or more Listeriα- based EphA2 immunogenic compositions of the invention. In another embodiment, the Lisieriα-based EphA2 immunogenic compositions of the invention can be administered in combination with an effective amount of one or more other agents useful for the prevention, treatment or amelioration of cancer, particularly T cell malignancies or one or more symptoms thereof, said combination therapies comprising administering to a subject in need thereof a prophylactically or therapeutically effective amount of one or more Listeriα-based EphA2 immunogenic compositions of the invention and a prophylactically or therapeutically effective amount of one or more cancer therapies, including chemotherapies, hormonal therapies, biological therapies, immunotherapies, or radiation therapies.
[00379] In another specific embodiment, patients with T cell malignancies are administered an effective amount of one or more Li steriα-based EphA2 immunogenic compositions of the invention in combination with one or more cancer chemotherapeutic agents, such as but not limited to: doxorubicin, epirubicin, cyclophosphamide, 5- fluorouracil, taxanes such as docetaxel and paclitaxel, leucovorin, levamisole, irinotecan, estramustine, etoposide, vinblastine, dacarbazine, nitrosoureas such as carmustine and
lomustine, vinca alkaloids, platinum compounds, cisplatin, mitomycin, vinorelbine, gemcitabine, carboplatin, hexamethylmelamine and/or topotecan. Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to radiation therapy, biological therapies, hormonal therapies and/or surgery. [00380] In yet another specific embodiment, patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with one or more types of radiation therapy, such as external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, indium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy. Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to chemotherapies, biological therapies/immunotherapies, hormonal therapies and/or surgery. [00381] In yet another specific embodiment, patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with one or more biological therapies/immunotherapies or hormonal therapies, such as tamoxifen, leuprolide or other LHRH agonists, non-steroidal antiandrogens (flutamide, nilutamide, bicalutamide), steroidal antiandrogens (cyproterone acetate), estrogens (DES, chlorotrianisene, ethinyl estradiol, conjugated estrogens U.S.P., DES-diphosphate), aminoglutethimide, hydrocortisone, flutamide withdrawal, progesterone, ketoconazole, prednisone, interferon- α, interleukin-2, tumor necrosis factor-α, and/or melphalan. Biological therapies also included are cytokines such as but not limited to TNF ligand family members such as TRAIL anti-cancer agonists that induce apoptosis, TRAIL antibodies that bind to TRAIL receptors 1 and 2 otherwise known as DR4 and DR5 (Death Domain Containing Receptors 4 and 5), as well as DR4 and DR5. TRAIL and TRAIL antibodies, ligands and receptors are known in the art and described in U.S. Patent Nos. 6,342,363, 6,284,236, 6,072,047 and 5,763,223. Such methods can optionally further comprise the administration of other cancer therapies, such as but not limited to radiation therapy, chemotherapies, and/or surgery.
[00382] In yet another specific embodiment, patients with T cell malignancies are administered an effective amount of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with standard and experimental therapies of T cell malignancies. Standard and experimental therapies of T cell malignancies that can
be used in the methods and compositions of the invention include, but are not limited to, antibody therapy (e.g., Campath®, anti-Tac, HuM291 (humanized murine IgG2 monoclonal antibody against CD3), antibody drug conjugates (e.g., Mylotarg), radiolabeled monoclonal antibodies (e.g., Bexxar, Zevalin, Lym-1)), cytokine therapy, aggressive combination chemotherapy with or without cytotoxic agents, purine analogs, hematopoietic stem cell transplantation, and T cell mediated therapy (e.g., CD8+ T cells with anti-leukemic activity against target antigens including but not limited to leukemia specific proteins (e.g., bcr/abl, PML/RARa, EMV/AML-1), leukemia-associated proteins (e.g., proteinase 3, WT-I, h-TERT, hdm-2)). (See Riddell et el, 2002, Cancer Control, 9(2): 114-122; Dearden et al. , 2002, Medical Oncology, 19, Suppl. S27-32; Waldmann et al 2000, Hematology (Am Soc Hematol Educ Program):394-408).
5.6.2. Treatment or Prevention of Disorders Associated with Aberrant Angiogenesis
[00383] EphA2 is as a marker of angiogenic blood vessels and plays a critical role in angiogenesis or neovascularization (see, e.g. , Ogawa et al. , 2000, Oncogene. 19(52):6043-52; Hess et al, 2001, Cancer Res. 61(8):3250-5). Angiogenesis is characterized by the invasion, migration and proliferation of smooth muscle and endothelial cells. The growth of new blood vessels, or angiogenesis, contributes to pathological conditions such as diabetic retinopathy (Adonis et al, 1994, Amer. J. Ophthal., 118:445), rheumatoid arthritis (Peacock et al, 1992, J. Exp. Med., 175:1135) and osteoarthritis (Ondrick et al, 1992, Clin.-Podiatr.-Med.-Surg. 9:185). [00384] The Listeria-based EphA2 immunogenic compositions of the invention may therefore be administered to a subject in need thereof to prevent, manage, treat and/or ameliorate a disorder associated with aberrant angiogenesis or one or more symptoms thereof.
[00385] In certain embodiments, the present invention encompasses methods for treating, preventing and/or managing disorders associated with aberrant angiogenesis comprising administering to a subject a Iis?er/α-based EphA2 immunogenic composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for treating or preventing the disorder. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the Listeriα-hased
EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono.
[00386] Disorders that are associated with or characterized by aberrant angiogenesis and may be prevented, treated, and/or managed with the Listeria-based EphA2 immunogenic compositions of the invention include, but are not limited to, neoplastic diseases (non-limiting examples are metastases of tumors and leukemia); diseases of ocular neovascularization (non-limiting examples are age-related macular degeneration, diabetic retinopathy, and retinopathy of prematurity, vascular restenosis); skin diseases (non-limiting examples are infantile hemangiomas, verruca vulgaris, psoriasis, basal cell and squamous cell carcinomas, cutaneous melanoma, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa); arthritis (non-limiting examples are rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome); gynecologic diseases (non- limiting examples are endometriosis, preeclampsia during pregnancy, carcinoma of the ovary, endometrium and cervix); and cardiovascular diseases (non-limiting examples are formation of atherosclerotic plaques, atherosclerosis and coronary artery disease). [00387] In specific embodiments, the disorders that are associated with or characterized by aberrant angiogenesis and that may be prevented, treated and/or managed with the Listeriα-based EphA2 immunogenic compositions of the invention include chronic articular rheumatism, psoriasis, diabetic retinopathy, neovascular glaucoma, macular degeneration, capillary proliferation in atherosclerotic plaques as well as cancers in which EphA2 is expressed in the vasculature. Such cancer disorders can include, for example, solid tumors, tumor metastasis, angiofibromas, retrolental, fibroplasia, hemangiomas, Kaposi's sarcoma. [00388] In certain embodiments, the Listeriα-based EphA2 immunogenic compositions are employed in combination therapy regimens involving other therapies. Non-limiting examples of such therapies include analgesics, angiogenesis inhibitors, anticancer therapies and anti-inflammatory agents, in particular analgesics and angiogenesis inhibitors.
5.6.2.1. Patient Population
[00389] The present invention encompasses methods for treating, managing, and/or preventing a disorder associated with aberrant angiogenesis or a symptom thereof, in a subject comprising administering one or more Listeriα-based EphA2 immunogenic
compositions. The methods of the invention comprise the administration of one or more Listeria-based EphA2 immunogenic compositions to patients suffering from or expected to suffer from (e.g., patients with a genetic predisposition for or patients that have previously suffered from) a disorder associated with aberrant angiogenesis. The present invention also encompasses methods for treating, managing, and/or preventing a disorder associated with aberrant angiogenesis or a symptom thereof, in a subject, comprising administering to a subject a Listeriα-based EphA2 immunogenic composition of the invention engineered to express two or more EphA2 antigenic peptides, in an amount effective for treating, managing, and/or preventing the disorder. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the Listeriα- based EphA2 immunogenic composition administered to a subject in need thereof comprises ActA(NlOO) Exmono Comono. [00390] Such patients may have been previously treated or are currently being treated for the disorder. In accordance with the invention, a Listeriα-based EphA2 immunogenic composition may be used as any line of therapy, including, but not limited to, a first, second, third and fourth line of therapy. Further, in accordance with the invention, a Listeriα-based EphA2 immunogenic composition can be used before any adverse effects or intolerance of the Listeriα-based EphA2 immunogenic composition therapies occurs. The invention encompasses methods for administering one or more Listeriα-based EphA2 immunogenic compositions of the invention to prevent the onset or recurrence of a disorder associated with aberrant angiogenesis. [00391] In one embodiment, the invention also provides methods of treatment or management of a disorder associated with aberrant angiogenesis as alternatives to current therapies. In a specific embodiment, the current therapy has proven or may prove too toxic (Le., results in unacceptable or unbearable side effects) for the patient. In another embodiment, the patient has proven refractory to a current therapy, hi such embodiments, the invention provides for the administration of one or more Listeriα-based EphA2 immunogenic compositions of the invention without any other therapies for treating or managing the disorder associated with aberrant angiogenesis. hi certain embodiments, one or more Listeriα-based EphA2 immunogenic compositions of the invention can be administered to a patient in need thereof instead of another therapy to treat or manage a disorder associated with aberrant angiogenesis.
[00392] The present invention also encompasses methods for administering one or more Listeria-based EρhA2 immunogenic compositions of the invention to treat or ameliorate symptoms of a disorder associated with aberrant angiogenesis in patients that are or have become refractory to non-Listeriα-based EphA2 immunogenic composition therapies. The determination of whether the symptoms are refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a therapy on affected cells in the disorder associated with aberrant angiogenesis, or in patients that are or have become refractory to non-Listeriα-based EphA2 immunogenic composition therapies.
5.6.3. Other Therapies
[00393] In some embodiments, therapy by administration of one or more Listeriα- based EphA2 immunogenic compositions is combined with the administration of one or more therapies such as, but not limited to, chemotherapies, radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies. Prophylactic/therapeutic agents include, but are not limited to, proteinaceous molecules, including, but not limited to, peptides, polypeptides, proteins, including post-translationally modified proteins, peptides etc.; or small molecules (less than 1000 daltons), inorganic or organic compounds; or nucleic acid molecules including, but not limited to, double-stranded or single-stranded DNA, or double-stranded or single-stranded RNA, as well as triple helix nucleic acid molecules. Prophylactic/therapeutic agents can be derived from any known organism (including, but not limited to, animals, plants, bacteria, fungi, and protista, or viruses) or from a library of synthetic molecules.
[00394] In certain embodiments, the Listeriα-based EphA2 composition is engineered to express two or more EphA2 antigenic peptides. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the Listeriα-based EρhA2 immunogenic composition administered to a subject in need thereof comprises ACtA(NlOO) Exmono Comono. [00395] In a specific embodiment, the methods of the invention encompass administration of a Listeriα-based EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents, including antibodies, that are inhibitors of kinases such as, but not limited to, ABL, ACK,
AFK, AKT (e.g., AKT-I, AKT-2, and AKT-3), ALK, AMP-PK, ATM, Auroral, Aurora2, bARKl, bArk2, BLK, BMX, BTK, CAK, CaM kinase, CDC2, CDK, CK, COT, CTD, DNA-PK, EGF-R, ErbB-1, ErbB-2, ErbB-3, ErbB-4, ERK (e.g., ERKl, ERK2, ERK3, ERK4, ERK5, ERK6, ERK7), ERT-PK, FAK, FGR (e.g., FGFlR, FGF2R), FLT (e.g., FLT- 1 , FLT-2, FLT-3, FLT-4), FRK, FYN, GSK (e.g. , GSKl, GSK2, GSK3-alpha, GSK3-beta, GSK4, GSK5), G-protein coupled receptor kinases (GRKs), HCK, HER2, HKII, JAK (e.g., JAKl, JAK2, JAK3, JAK4), JNK (e.g., JNKl, JNK2, JNK3), KDR, KIT, IGF-I receptor, IKK-I, IKK-2, INSR (insulin receptor), IRAKI, IRAK2, IRK, ITK, LCK, LOK, LYN, MAPK, MAPKAPK-I, MAPKAPK-2, MEK, MET, MFPK, MHCK, MLCK, MLK3, NEU, NIK, PDGF receptor alpha, PDGF receptor beta, PHK, PI-3 kinase, PKA, PKB, PKC, PKG, PRKl, PYK2, p38 kinases, pl35tyk2, p34cdc2, p42cdc2, p42mapk, p44mρk, RAF, RET, RIP, RJP-2, RK, RON, RS kinase, SRC, SYK, S6K, TAKl, TEC, TIEl, TIE2, TRKA, TXK, TYK2, UL13, VEGF, VEGFRl, VEGFR2, YES, YRK, ZAP- 70, and all subtypes of these kinases (see e.g., Hardie and Hanks (1995) The Protein . Kinase Facts Book, I and II, Academic Press, San Diego, Calif.). In preferred embodiments, a Listeria-b&sed EphA2 immunogenic composition of the invention is administered in combination with the administration of one or more prophylactic/therapeutic agents that are inhibitors of Eph receptor kinases (e.g., EphA2, EphA4). In a most preferred embodiment, an EphA2 immunogenic composition of the invention is administered in combination with the administration of one or more prophylactic/therapeutic agents that are inhibitors of EphA2. [00396] In a specific embodiment, the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of an EρhA2 immunodominant epitope. In a specific embodiment, the EphA2 immunodominant epitope comprises (or consists of) amino residues 917 to 935. In certain embodiments, the antigenic peptide consists of 8 to 15 amino acids or 12 to 14 amino acids of this epitope.
[00397] In a specific embodiment, the methods of the invention encompass administration of a Listeriα-based EphA2 immunogenic composition of the invention in combination with the administration of one or more therapeutic antibodies. Examples of therapeutic antibodies that can be used in methods of the invention include but are not limited to AVASTIN® which is an anti-VEGF antibody; antibodies that immunospecifically bind to EphA2 induce signal transduction (i.e., EphA2 agonistic antibodies); antibodies that immunospecifically bind to EphrinAl; HERCEPTIN®
(Trastuzumab) (Genentech, CA) which is a humanized anti-HER2 monoclonal antibody for the treatment of patients with metastatic breast cancer; REOPRO® (abciximab) (Centocor) which is an anti-glycoprotein Ilb/IIIa receptor on the platelets for the prevention of clot formation; ZENAP AX® (daclizumab) (Roche Pharmaceuticals, Switzerland) which is an immunosuppressive, humanized anti-CD25 monoclonal antibody for the prevention of acute renal allograft rejection; PANOREX™ which is a murine anti- 17-IA cell surface antigen IgG2a antibody (Glaxo Wellcome/Centocor); BEC2 which is a murine anti-idiotype (GD3 epitope) IgG antibody (undone System); EMC-C225 which is a chimeric anti-EGFR IgG antibody (ImClone System); VITAXIN™ which is a humanized anti-αvβ3 integrin antibody (Applied Molecular Evolution/Medlmmune);
Campath 1H/LDP-03 which is a humanized anti CD52 IgGl antibody (Leukosite); Smart M195 which is a humanized anti-CD33 IgG antibody (Protein Design Lab/Kanebo); RITUXAN™ which is a chimeric anti-CD20 IgGl antibody (H)EC Pharm/Genentech, Roche/Zettyaku); LYMPHOCIDE™ which is a humanized anti-CD22 IgG antibody (Immunomedics); LYMPHOCIDE™ Y-90 (Immunomedics); Lymphoscan (Tc-99m- labeled; radioimaging; Immunomedics); Nuvion (against CD3; Protein Design Labs); CM3 is a humanized anti-ICAM3 antibody (ICOS Pharm); IDEC-114 is a primatized anti- CD80 antibody (IDEC Pharm/Mitsubishi); ZEVALIN™ is a radiolabeled murine anti- CD20 antibody (IDEC/Schering AG); IDEC-131 is a humanized anti-CD40L antibody (EDEC/Eisai); IDEC-151 is a primatized anti-CD4 antibody (IDEC); IDEC-152 is a primatized anti-CD23 antibody (IDEC/Seikagaku); SMART anti-CD3 is a humanized anti-CD3 IgG (Protein Design Lab); 5Gl.1 is a humanized anti-complement factor 5 (C5) antibody (Alexion Pharm); D2E7 is a humanized anti-TNF-alpha antibody (CAT/BASF); CDP870 is a humanized anti-TNF-alpha Fab fragment (Celltech); IDEC-151 is a primatized anti-CD4 IgGl antibody (IDEC Pharm/SmithKline Beecham); MDX-CD4 is a human anti-CD4 IgG antibody (Medarex/Eisai/Genmab); CD20-sreptdavidin (+biotin- yttrium 90; NeoRx); CDP571 is a humanized anti-TNF-alpha ϊgG4 antibody (Celltech); LDP-02 is a humanized anti- αvβ7antibody (LeukoSite/Genentech); OrthoClone OKT4A is a humanized anti-CD4 IgG antibody (Ortho Biotech); ANTO V A™ is a humanized anti- CD40L IgG antibody (Biogen); ANTEGREN™ is a humanized anti-VLA-4 IgG antibody (Elan); and CAT- 152 is a human anti-TGF-beta2 antibody (Cambridge Ab Tech). [00398] In another specific embodiment, the methods of the invention encompass administration of a Listeria-hascά EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents that
are angiogenesis inhibitors such as, but not limited to: Angiostatin (plasminogen fragment); antiangiogenic antithrombin III; Angiozyme; ABT-627; Bay 12-9566; Benefin; Bevacizumab (AVASTIN™); BMS-275291; cartilage-derived inhibitor (CDI); CAI; CD59 complement fragment; CEP-7055; Col 3; Combretastatin A-4; Endostatin (collagen XVIII fragment); fibronectin fragment; Gro-beta; Halofuginone; Heparinases; Heparin hexasaccharide fragment; HMV833; Human chorionic gonadotropin (hCG); IM-862; Interferon alpha/beta/gamma; Interferon inducible protein (IP-IO); Interleukin-12; Kringle 5 (plasminogen fragment); Marimastat; Metalloproteinase inhibitors (TIMPs); 2- Methoxyestradiol; MMI 270 (CGS 27023A); MoAb IMC-ICl 1; Neovastat; NM-3; Panzem; PI-88; Placental ribonuclease inhibitor; Plasminogen activator inhibitor; Platelet factor-4 (PF4); Prinomastat; Prolactin 16kD fragment; Proliferin-related protein (PRP); PTK 787/ZK 222594; Retinoids; Solimastat; Squalamine; SS 3304; SU 5416; SU6668; SUl 1248; Tetrahydrocortisol-S; tetrathiomolybdate; thalidomide; Thrombospondin-1 (TSP-I); TNP-470; Transforming growth factor-beta (TGF-β); Vasculostatin; Vasostatin (calreticulin fragment); ZD6126; ZD6474; farnesyl transferase inhibitors (FTI); and bisphosphonates.
[00399] In another specific embodiment, the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of one or more prophylactic/therapeutic agents that are anti-cancer agents such as, but not limited to: acivicin, aclarubicin, acodazole hydrochloride, acronine, adozelesin, aldesleukin, altretamine, ambomycin, ametantrone acetate, aminoglutethimide, amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azacitidine, azetepa, azotomycin, batimastat, benzodepa, bicalutamide, bisantrene hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, bropirimine, busulfan, cactinomycin, calusterone, caracemide, carbetimer, carboplatin, carmustine, carubicin hydrochloride, carzelesin, cedefingol, chlorambucil, cirolemycin, cisplatin, cladribine, crisnatol mesylate, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin hydrochloride, decarbazine, decitabine, dexormaplatin, dezaguanine, dezaguanine mesylate, diaziquone, docetaxel, doxorubicin, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, duazomycin, edatrexate, eflornithine hydrochloride, elsamitrucin, enloplatin, enpromate, soluble EphrinAl, EphrinAl-Fc polypeptides, EphA2-Fc polypeptides, EphA2 antisense, EphrinAl antisense, epipropidine, epirubicin hydrochloride, erbulozole, esorubicin hydrochloride, estramustine, estramustine phosphate sodium, etanidazole, etoposide,
etoposide phosphate, etoprine, fadrozole hydrochloride, fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, flurocitabine, fosquidone, fostriecin sodium, gemcitabine, gemcitabine hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide, ilmofosine, interleukin 2 (including recombinant interleukin 2, or rIL2), interferon alpha-2a, interferon alpha-2b, interferon alpha-nl, interferon alpha-n3, interferon beta-I a, interferon gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, lometrexol sodium, lomustine, losoxantrone hydrochloride, masoprocol, maytansine, mechlorethamine hydrochloride, megestrol acetate, melengestrol acetate, melphalan, menogaril, mercaptopurine, methotrexate, methotrexate sodium, metoprine, meturedepa, mitindomide, mitocarcin, mitocromin, mitogillin, mitomalcin, mitomycin, mitosper, mitotane, mitoxantrone hydrochloride, mycophenolic acid, nitrosoureas, nocodazole, nogalamycin, ormaplatin, oxisuran, paclitaxel, pegaspargase, peliomycin, pentamustine, peplomycin sulfate, perfosfamide, pipobroman, piposulfan, piroxantrone hydrochloride, plicamycin, plomestane, porfimer sodium, porfiromycin, prednimustine, procarbazine hydrochloride, puromycin, puromycin hydrochloride, pyrazofurin, riboprine, rogletimide, safingol, safingol hydrochloride, semustine, simtrazene, sparfosate sodium, sparsomycin, spirogermanium hydrochloride, spiromustine, spiroplatin, streptonigrin, streptozocin, sulofenur, talisomycin, tecogalan sodium, tegafur, teloxantrone hydrochloride, temoporfin, teniposide, teroxirone, testolactone, thiamiprine, thioguanine, thiotepa, tiazofurin, tirapazamine, toremifene citrate, trastuzumab (HERCEPTIN™), trestolone acetate, triciribine phosphate, trimetrexate, trimetrexate glucuronate, triptorelin, tubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine sulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglycinate sulfate, vinleurosine sulfate, vinorelbine tartrate, vinrosidine sulfate, vinzolidine sulfate, vorozole, zeniplatin, zinostatin, zorubicin hydrochloride. Other anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxyvitamin D3, 5-ethynyluracil, abiraterone, aclarubicin, acylfulvene, adecypenol, adozelesin, aldesleukin, ALL-TK antagonists, altretamine, ambamustine, amidox, amifostine, aminolevulinic acid, amrubicin, amsacrine, anagrelide, anastrozole, andrographolide, angiogenesis inhibitors, antagonist D, antagonist G, antarelix, anti-dorsalizing morphogenetic protein- 1, antiandrogens, antiestrogens, antineoplaston, aphidicolin glycinate, apoptosis gene modulators, apoptosis regulators, apurinic acid, ara-CDP-DL-PTBA, arginine deaminase, asulacrine, atamestane, atrimustine, axinastatin 1, axinastatin 2, axinastatin 3, azasetron, azatoxin, azatyrosine,
baccatin III derivatives, balanol, batimastat, BCR/ABL antagonists, benzochlorins, benzoylstaurosporine, beta lactam derivatives, beta-alethine, betaclamycin B, betulinic acid, bFGF inhibitor, bicalutamide, bisantrene, bisaziridinylspermine, bisnafide, bistratene A, bizelesin, breflate, bropirimine, budotitane, buthionine sulfoximine, calcipotriol, calphostin C, camptothecin derivatives, canarypox IL-2, capecitabine, carboxamide- amino-triazole, carboxyamidotriazole, CaRest M3, CARN 700, cartilage derived inhibitor, carzelesin, casein kinase inhibitors (ICOS), castanospermine, cecropin B, cetrorelix, chloroquinox aline sulfonamide, cicaprost, cis-porphyrin, cladribine, clomifene analogues, clotrimazole, collismycin A, colHsmycin B, combretastatin A4, combretastatin analogue, conagenin, crambescidin 816, crisnatol, cryptophycin 8, cryptophycin A derivatives, curacin A, cyclopentanthraquinones, cycloplatam, cypemycin, cytarabine ocfosfate, cytolytic factor, cytostatin, dacliximab, decitabine, dehydrodidemnin B, deslorelin, dexamethasone, dexifosfamide, dexrazoxane, dexverapamil, diaziquone, didemnin B, didox, diethylnorspermine, dihydro-5-azacytidine, dihydrotaxol, dioxamycin, diphenyl spiromustine, docetaxel, docosanol, dolasetron, doxifluridine, droloxifene, dronabinol, duocarmycin SA, ebselen, ecomustine, edelfosine, edrecolomab, eflornithine, elemene, emitefur, epirubicin, epristeride, estramustine analogue, estrogen agonists, estrogen antagonists, etanidazole, etoposide phosphate, exemestane, fadrozole, fazarabine, fenretinide, filgrastim, finasteride, flavopiridol, flezelastine, fluasterone, fludarabine, fluorodaunorunicin hydrochloride, forfenimex, formestane, fostriecin, fotemustine, gadolinium texaphyrin, gallium nitrate, galocitabine, ganirelix, gelatinase inhibitors, gemcitabine, glutathione inhibitors, hepsulfam, heregulin, hexamethylene bisacetamide, hypericin, ibandronic acid, idarubicin, idoxifene, idramantone, ilmofosine, ilomastat, imidazoacridones, imiquimod, immunostimulant peptides, insulin-like growth factor- 1 receptor inhibitor, interferon agonists, interferons, interleukins, iobenguane, iododoxorubicin, ipomeanol, iroplact, irsogladine, isobengazole, isohomohalicondrin B, itasetron, jasplakinolide, kahalalide F, lamellarin-N triacetate, lanreotide, leinamycin, lenograstim, lentinan sulfate, leptolstatin, letrozole, leukemia inhibiting factor, leukocyte alpha interferon, leuprolide+estrogen+progesterone, leuprorelin, levamisole, liarozole, linear polyamine analogue, lipophilic disaccharide peptide, lipophilic platinum compounds, lissoclinamide 7, lobaplatin, lombricine, lometrexol, lonidamine, losoxantrone, lovastatin, loxoribine, lurtotecan, lutetium texaphyrin, lysofylline, lytic peptides, maitansine, mannostatin A, marimastat, masoprocol, maspin, matrilysin inhibitors, matrix metalloproteinase inhibitors, menogaril, merbarone, meterelin,
methioninase, metoclopramide, MIF inhibitor, mifepristone, miltefosine, mirimostim, mismatched double stranded RNA, mitoguazone, mitolactol, mitomycin analogues, mitonaflde, mitotoxin fibroblast growth factor-saporin, mitoxantrone, mofarotene, molgramostim, human chorionic gonadotrophin, monophosphoryl lipid A+myobacterium cell wall sk, mopidamol, multiple drug resistance gene inhibitor, multiple tumor suppressor 1-based therapy, mustard anticancer agent, mycaperoxide B, mycobacterial cell wall extract, myriaporone, N-acetyldinaline, N-substituted benzamides, nafarelin, nagrestip, naloxone+pentazocine, napavin, naphterpin, nartograstim, nedaplatin, nemorubicin, neridronic acid, neutral endopeptidase, nilutamide, nisamycin, nitric oxide modulators, nitroxide antioxidant, nitrullyn, O6-benzylguanine, octreotide, okicenone, oligonucleotides, onapristone, ondansetron, ondansetron, oracin, oral cytokine inducer, ormaplatin, osaterone, oxaliplatin, oxaunomycin, paclitaxel, paclitaxel analogues, paclitaxel derivatives, palauamine, palmitoylrhizoxin, pamidronic acid, panaxytriol, panomifene, parabactin, pazelliptine, pegaspargase, peldesine, pentosan polysulfate sodium, pentostatin, pentrozole, perflubron, perfosfamide, perillyl alcohol, phenazinomycin, phenylacetate, phosphatase inhibitors, picibanil, pilocarpine hydrochloride, pirarubicin, piritrexim, placetin A, placetin B, plasminogen activator inhibitor, platinum complex, platinum compounds, platinum-triamine complex, porfimer sodium, porfiromycin, prednisone, propyl bis-acridone, prostaglandin J2, proteasome inhibitors, protein A-based immune modulator, protein kinase C inhibitor, protein kinase C inhibitors, mϊcroalgal, protein tyrosine phosphatase inhibitors, purine nucleoside phosphorylase inhibitors, purpurins, pyrazoloacridine, pyridoxylated hemoglobin polyoxyethylene conjugate, raf antagonists, raltitrexed, ramosetron, ras farnesyl protein transferase inhibitors, ras inhibitors, ras-GAP inhibitor, retelliptine demethylated, rhenium Re 186 etidronate, rhizoxin, ribozymes, RII retinamide, rogletimide, rohitukine, romurtide, roquinimex, rubiginone Bl, ruboxyl, safingol, saintopin, SarCNU, sarcophytol A, sargramostim, Sdi 1 mimetics, semustine, senescence derived inhibitor 1, sense oligonucleotides, signal transduction inhibitors, signal transduction modulators, single chain antigen binding protein, sizofiran, sobuzoxane, sodium borocaptate, sodium phenylacetate, solverol, somatomedin binding protein, sonermin, sparfosic acid, spicamycin D, spiromustine, splenopentin, spongistatin 1, squalamine, stem cell inhibitor, stem-cell division inhibitors, stipiamide, stromelysin inhibitors, sulfinosine, superactive vasoactive intestinal peptide antagonist, suradista, suramin, swainsonine, synthetic glycosaminoglycans, tallimustine, tamoxifen methiodide, tauromustine, taxol, tazarotene,
tecogalan sodium, tegafur, tellurapyrylium, telomerase inhibitors, temoporfin, temozolomide, teniposide, tetrachlorodecaoxide, tetrazomine, thaliblastine, thalidomide, thiocoraline, thioguanine, thrombopoietin, thrombopoietin mimetic, thymalfasin, thymopoietin receptor agonist, thymotrinan, thyroid stimulating hormone, tin ethyl etiopurpurin, tirapazamine, titanocene bichloride, topsentin, toremifene, totipotent stem cell factor, translation inhibitors, tretinoin, triacetyluridine, triciribine, trimetrexate, triptorelin, tropisetron, turosteride, tyrosine kinase inhibitors, tyrphostins, UBC inhibitors, ubenimex, urogenital sinus-derived growth inhibitory factor, urokinase receptor antagonists, vapreotide, variolin B, vector system, erythrocyte gene therapy, velaresol, veramine, verdins, verteporfin, vinorelbine, vinxaltine, vitaxin, vorozole, zanoterone, zeniplatin, zilascorb, and zinostatin stimalamer. Preferred additional anti-cancer drugs are 5-fluorouracil and leucovorin.
[00400] In more particular embodiments, the present invention also comprises the administration of one or more Listeria-based EphA2 immunogenic compositions of the invention in combination with the administration of one or more therapies such as, but not limited to anti-cancer agents such as those disclosed in Table 5 below, preferably for the treatment of breast, ovary, melanoma, prostate, colon and lung cancers as described above.
TABLE 5
[00401] The invention also encompasses administration of the Listeria-based
EphA2 immunogenic compositions of the invention in combination with radiation therapy comprising the use of x-rays, gamma rays and other sources of radiation to destroy the cancer cells. In preferred embodiments, the radiation treatment is administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. In other preferred embodiments, the radiation treatment is administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass. [00402] tat a specific embodiment, the methods of the invention encompass administration of a Listeriα-based EphA2 immunogenic composition of the invention in combination with the administration of one or more anti- inflammatory agents. Any antiinflammatory agent, including agents useful in therapies for inflammatory disorders, well- known to one of skill in the art can be used in the compositions and methods of the invention. Non-limiting examples of anti-inflammatory agents include non-steroidal antiinflammatory drugs (NS ADDs), steroidal anti-inflammatory drugs, anticholinergics (e.g., atropine sulfate, atropine methylnitrate, and ipratropium bromide (ATRO VENT™)), beta2-agonists (e.g., abuterol (VENTOLIN™ and PROVENTIL™), bitolterol
(TORNALATE™), levalbuterol (XOPONEX™), metaproterenol (ALUPENT™), pirbuterol (MAXAIR™), terbutlaine (BRETHAIRE™ and BRETHINE™), albuterol (PROVENTIL™, REPETABS™, and VOLMAX™), forraoterol (FORADEL AEROLIZERTM), and salmeterol (SEREVENT™ and SEREVENT DISKUS™)), and methylxanthines {e.g. , theophylline (UNIPHYL™, THEO-DUR™, SLO-BBD™, AND TEHO-42™)). Examples of NSAIDs include, but are not limited to, aspirin, ibuprofen, celecoxib (CELEBREX™), diclofenac (VOLTAREN™), etodolac (LODINE™), fenoprofen (NALFON™), indomethacin (INDOCESf™), ketoralac (TORADOL™), oxaprozin (DAYPRO™), nabumentone (RELAFEN™), sulindac (CLINORBL™), tolmentin (TOLECTIN™), rofecoxib (VIOXX™), naproxen (ALEVE™,
NAPROSYN1""), ketoprofen (ACTRON™) and nabumetone (RELAFEN™). Such NSAEDs function by inhibiting a cyclooxgenase enzyme (e.g., COX-I and/or COX-2). Examples of steroidal anti-inflammatory drugs include, but are not limited to, glucocorticoids, dexamethasone (DECADRON™), corticosteroids {e.g., methylprednisolone (MEDROL™)), cortisone, hydrocortisone, prednisone (PREDNISONE™ and DELTASONE™), prednisolone (PRELONE™ and PEDIAPRED™), triamcinolone, azulfidine, and inhibitors of eicosanoids (e.g., prostaglandins, thromboxanes, and leukotrienes {see Table 6, infra, for non-limiting examples of leukotriene and typical dosages of such agents)). [00403] In certain embodiments, the anti-inflammatory agent is an agent useful in the prevention, management, treatment, and/or amelioration of asthma or one or more symptoms thereof. Non-limiting examples of such agents include adrenergic stimulants {e.g., catecholamines {e.g., epinephrine, isoproterenol, and isoetharine), resorcinols {e.g., metaproterenol, terbutaline, and fenoterol), and saligenins {e.g., salbutamol)), adrenocorticoids, blucocorticoids, corticosteroids (e.g., beclomethadonse, budesonide, flunisolide, fluticasone, triamcinolone, methylprednisolone, prednisolone, and prednisone), other steroids, beta2-agonists (e.g., albuterol, bitolterol, fenoterol, isoetharine, metaproterenol, pirbuterol, salbutamol, terbutaline, formoterol, salmeterol, and albutamol terbutaline), anti-cholinergics (e.g., ipratropium bromide and oxitropium bromide), IL-4 antagonists (including antibodies), IL-5 antagonists (including antibodies), IL- 13 antagonists (including antibodies), PDE4-inhibitor, NF-Kappa-β inhibitor, VLA-4 inhibitor, CpG, anti-CD23, selectin antagonists (TBC 1269), mast cell protease inhibitors (e.g., tryptase kinase inhibitors (e.g., GW-45, GW-58, and genisteine), phosphatidylinositide-3' (PD)-kinase inhibitors (e.g., calphostin C), and other kinase
inhibitors (e.g., staurosporiήe) (see Temkin et al, 2002 J Immunol 169(5):2662-2669; Vosseller et al, 1997 MoI. Biol. Cell 8(5):909-922; and Nagai et al, 1995 Biochem Biophys Res Comraun 208(2):576-581)), a C3 receptor antagonists (including antibodies), immunosuppressant agents (e.g., methotrexate and gold salts), mast cell modulators (e.g., cromolyn sodium (INT AL™) and nedocromil sodium (PELADE™)), and mucolytic agents (e.g., acetylcysteine)). In a specific embodiment, the anti-inflammatory agent is a leukotriene inhibitor (e.g., montelukast (SINGULAIR™), zafirlukast (ACCOLATE™), pranlukast (ONON™), or zileuton (ZYFLO™) (see Table 6)).
Table 6. Leukotriene Inhibitors for Asthma Therapy
Table 7. Hi Antihistamines
[00404] In a specific embodiment, the methods of the invention encompass administration of a Listeria-based EphA2 immunogenic composition of the invention in combination with the administration of one or more immunomodulatory agents. An example of an immunomodulatory agent is cyclophosphamide.
[00405] Cancer therapies as well as therapies for hyperproliferative cell disorders other than cancer and their dosages, routes of administration and recommended usage are known in the art and have been described in such literature as the Physician's Desk Reference (56th ed., 2002, 57th ed., 2003, and 58th ed., 2004).
5.7. Compositions
[00406] The compositions of the invention include bulk drug compositions useful in the manufacture of non-pharmaceutical compositions (e.g., impure or non-sterile compositions) and pharmaceutical compositions (Le., compositions that are suitable for administration to a subject or patient) which can be used in the preparation of unit dosage forms. Such compositions comprise a prophylactically or therapeutically effective amount of a prophylactic and/or therapeutic agent disclosed herein or a combination of those agents and a pharmaceutically acceptable carrier. Preferably, compositions of the invention comprise a prophylactically or therapeutically effective amount of one or more Listeria engineered to express one, two, three or more EphA2 antigenic peptides. In a specific embodiment, the pharmaceutical compositions are immunogenic compositions. [00407] The Listeria-based EphA2 immunogenic compositions of the invention may comprise one, two or more EphA2 antigenic peptide-expressing Listeria and a pharmaceutically acceptable carrier. In a preferred embodiment, the Listeria-based EphA2 immunogenic composition of the invention comprises the species Listeria monocytogenes. Preferably, the Listeria strain is attenuated. In certain embodiments, the immunogenic composition is a vaccine. In a preferred embodiment, the Listeria-based EphA2 immunogenic compositions of the invention comprise the Listeria monocytogenes strain ActA(N100)ExmonoComono (Le., MEDI-543). [00408] In a specific embodiment, a composition of the invention comprises a Listeria-based EphA2 immunogenic composition and an additional prophylactic or therapeutic, e.g., anti-cancer, agent. In accordance with this embodiment, the composition may further comprise a pharmaceutically acceptable carrier.
[00409] In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete) or, more preferably, MF59C.1 adjuvant available from Chiron, Emeryville, CA), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. [00410] Generally, the ingredients of compositions of the invention are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. In certain embodiments, the composition is provided as a frozen liquid. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
[00411] The compositions of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histϊdine, procaine, etc. [00412] Various delivery systems are known and can be used to administer a
Listeria-based EphA2 immunogenic composition of the invention or the combination of a
Listeria-based EphA2 immunogenic composition of the invention and a prophylactic agent or therapeutic agent useful for preventing or treating cancer, e.g., encapsulation in liposomes, microparticles, microcapsules, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, /. Biol. Chem. 262:4429-4432), etc. Methods of administering a Listeriα- based EphA2 immunogenic composition or the combination of a Zi-s/emz-based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal, inhaled, and oral routes). In a specific embodiment, a Listeriα-based EphA2 immunogenic composition of the invention or the combination of a Listeriα-based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent are administered intramuscularly, intravenously, or subcutaneously. The Listeriα-based EphA2 immunogenic composition of the invention or the combination of a Listeriα-based EphA2 immunogenic composition of the invention and prophylactic or therapeutic agent may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. [00413] In a specific embodiment, it may be desirable to administer the Listeriα- based EphA2 immunogenic composition of the invention or the combination of a Listeriα- based EphA2 immunogenic composition of the invention and other prophylactic or therapeutic agents of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
[00414] In yet another embodiment, the Listeriα-based EρhA2 immunogenic composition of the invention or the combination of a Listeriα-based EphA2 immunogenic composition of die invention and prophylactic or therapeutic agent can be delivered in a controlled release or sustained release system. In one embodiment, a pump may be used to achieve controlled or sustained release (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald etal., 1980, Surgery 88:507; Saudek et ah, 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used to achieve controlled or sustained release of the EphA2 antigenic peptide-expressing Listeria of the invention (see e.g., Medical Applications of Controlled Release, Langer and Wise (eds.),
CRC Pres., Boca Raton, FL (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. ScL Rev. Macromol. Chem. 23:61; see also Levy etaL, 1985, Science 228:190; During et al., 1989, Ann. Neurol 25:351; Howard et al, 1989, J. Neurosurg. 7 1:105); U.S. Patent Nos. 5,679,377; 5,916,597; 5,912,015; 5,989,463; 5,128,326;
International Publication Nos. WO 99/15154 and WO 99/20253. Examples of polymers used in sustained release formulations include, but are not limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), poly( vinyl alcohol), polyacrylamide, poly(ethylene glycol), polylactides (PLA), polyflactide-co-glycolides) (PLGA), and polyorthoesters. In a preferred embodiment, the polymer used in a sustained release formulation is inert, free of leachable impurities, stable on storage, sterile, and biodegradable. In yet another embodiment, a controlled or sustained release system can be placed in proximity of the prophylactic or therapeutic target, thus requiring only a fraction of the systemic dose {see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). [00415] Controlled release systems are discussed in the review by Langer (1990,
Science 249:1527-1533). Any technique known to one of skill in the art can be used to produce sustained release formulations comprising one or more therapeutic agents of the invention. See, e.g., U.S. Patent No. 4,526,938; International Publication Nos. WO
91/05548 and WO 96/20698; Ning etaL, 1996, Radiotherapy & Oncology 39:179-189; Song et al., 1995, PDA Journal of Pharmaceutical Science & Technology 50:312-391; Cleek etaL, 1997, Pro. Int'L Symp. Control. ReI. Bioact. Mater. 24:853-854; and Lam et al, 1997, Proc. Int'L Symp. Control ReI Bioact. Mater. 24:759-760, each of which is incorporated herein by reference in its entirety.
5.7.1. Formulations
[00416] Immunogenic compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the EphA2 antigenic peptide-expressing Listeria of the invention and their physiologically acceptable salts and solvates be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, parenteral or mucosal (such as buccal, vaginal, rectal, sublingual) administration. In a preferred embodiment, local or systemic parenteral administration is used.
[00417] For oral administration, the Lister /β-based EphA2 immunogenic composition may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
[00418] Preparations for oral administration may be suitably formulated to give controlled release of the active compound. [00419] For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner.
[00420] For administration by inhalation, the prophylactic or therapeutic agents for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[00421] The Listeria-based EphA2 immunogenic composition may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms
as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. [00422] The immunogenic compositions of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. [00423] In addition to the formulations described previously, the prophylactic or therapeutic agents may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the prophylactic or therapeutic agents may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. [00424] The invention also provides that a Listeria-based EphA2 immunogenic composition of the invention is packaged in a hermetically sealed container such as an ampoule or sachette indicating die quantity. In one embodiment, the immunogenic composition is supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water or saline to the appropriate concentration for administration to a subject.
[00425] In a preferred embodiment of the invention, the formulation and administration of various chemotherapeutic, biological/immunotherapeutic and hormonal therapeutic agents for use in combination with the immunogenic composition of the invention are known in the art and often described in the Physician's Desk Reference, (56th ed. 2002). For instance, in certain specific embodiments of the invention, the agents can be formulated and supplied as provided in Table 5.
[00426] In other embodiments of the invention, radiation therapy agents such as radioactive isotopes can be given orally as liquids in capsules or as a drink. Radioactive isotopes can also be formulated for intravenous injections. The skilled oncologist can determine the preferred formulation and route of administration.
[00427] In certain embodiments, the EphA2 antigenic peptide-expressing Listeria of the invention are formulated at 1 mg/ml, 5 mg/ml, 10 mg/ml, and 25 mg/ml for intravenous injections and at 5 mg/ml, 10 mg/ml, and 80 mg/ml for repeated subcutaneous administration and intramuscular injection. In other embodiments, the EphA2 antigenic
peptide-expressing Listeria of the invention are formulated at amounts ranging between approximately IxIO2 CFU/ml to approximately IxIO12 CFU/ml, for example at IxIO2 CFU/ml, 5xlO2 CFU/ml, IxIO3 CFU/ml, 5xlO3 CFU/ml, IxIO4 CFU/ml, 5xlO4 CFU/ml, IxIO5 CFU/ml, 5xlO5 CFU/ml, IxIO6 CFU/ml, 5xlO6 CFU/ml, IxIO7 CFU/ml, 5xlO7 CFU/ml, IxIO8 CFU/ml, 5xlO8 CFU/ml, IxIO9 CFU/ml, 5xlO9 CFU/ml, IxIO10 CFU/ml, 5xlO10 CFU/ml, lxlO11 CFU/ml, 5xlOπ CFU/ml, or IxIO12 CFU/ml. [00428] The compositions may, if desired, be presented in a pack or dispenser device that may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.
5.7.2. Dosages
[00429] The amount of the composition of the invention which will be effective in the treatment, prevention or management of cancer can be determined by standard research techniques. For example, the dosage of the Listeria-based EphA2 immunogenic composition of the invention which will be effective in the treatment, prevention or management of cancer can be determined by administering the composition to an animal model such as, e.g., the animal models disclosed herein or known to those skilled in the art. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. [00430] Selection of the preferred effective dose can be determined (e.g. , via clinical trials) by a skilled artisan based upon the consideration of several factors which will be known to one of ordinary skill in the art. Such factors include the disease to be treated or prevented, the symptoms involved, the patient's body mass, the patient's immune status and other factors known by the skilled artisan to reflect the accuracy of administered pharmaceutical compositions.
[00431] The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the cancer, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
[00432] With respect to the dosage of Listeria in the Listeria-based EphA2 immunogenic compositions of the invention, the dosage is based on the amount colony forming units (c.f.u.). Generally, in various embodiments, the dosage ranges are from
about 1.0 c.f.u./kg to about 1 x 1010 ci.uΛg; from about 1.0 c.f.uJkg to about 1 x 108 c.f.uAg; from about 1 x 102 c.f.u./kg to about 1 x 108 c.f.u./kg; and from about 1 x 104 c.f.uAg to about 1 x 108 c.f.u./kg. In still another embodiment, a single dose of the composition or vaccine comprises from about 1 x 103 CFU/kg to about 1 x 108 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises from about 1 x 104 CFU/kg to about 1 x 107 CFU/kg. In some embodiments, a single dose of the composition comprises at least about 1 CFU/kg. In some embodiments, a single dose of the composition comprises at least about 10 CFU/kg. In another embodiment, a single dose of the composition or vaccine comprises at least about 1 x 102 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises at least about 1 x 103 CFU/kg. In still another embodiment, a single dose of the composition or vaccine comprises from at least about 1 x 104 CFU/kg.
[00433] In some embodiments, the proper (Le., effective dosage amount for one host, such as a human, can be extrapolated from the LD50 data for another host, such as a mouse, using methods known to those in the art. In certain exemplary embodiments, the dosage ranges are 0.001-fold to 10,000-fold of the murine LD50, 0.01-fold to 1,000-fold of the murine LD50, 0.1 -fold to 500-fold of the murine LD50, 0.5-fold to 250-fold of the murine LD50, 1-fold to 100-fold of the murine LD50, and 5-fold to 50-fold of the murine LD50. In certain specific embodiments, the dosage ranges are 0.00.1 -fold, 0.01-fold, 0.1- fold, 0.5-fold, 1-fold, 5-fold, 10-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1,000-fold,
5,000-fold or 10,000-fold of the murine LD50. Dosages found to be effective mice include 1 x 103, 5 x 103, 5 x 104, 1 x 105, 5 x 105, 5 x 106, 1 x 107, and 5 x 107CFU. For example, for intravenous administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 10n CFU, 5 x 10" CFU or 1O32 CFU. For intramuscular administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 101 ' CFU, 5 x 1011 CFU or 1012 CFU. For subcutaneous administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU, 105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 1011 CFU, 5 x 10u CFU or 1012 CFU. For intradermal administration, the composition can be administered at about 103 CFU, 5 x 103 CFU, 104 CFU, 5 x 104 CFU,
105 CFU, 5 x 105 CFU, 106 CFU, 5 x 106 CFU, 107 CFU, 5 x 107 CFU, 108 CFU, 5 x 108 CFU, 109 CFU, 5 x 109 CFU, 1010 CFU, 5 x 1010 CFU, 1011 CFU, 5 x 10u CFU or 1012 CFU. In certain embodiments, the dosage is an absolute amount. In other embodiments, the dosage is converted to an appropriate dosage for a human based on the specified dosages used in a mouse model.
[00434] In some embodiments, a single dose of the immunogenic composition comprises from about 102 to about 1012 of the bacterial organisms. In another embodiment, a single dose comprises from about 105 to about 10H of the bacterial organisms. In another embodiment, a single dose comprises from about 106 to about lθ" of the bacterial organisms. Ih still another embodiment, a single dose of the pharmaceutical composition or vaccine comprises from about 107 to about 1010 of the bacterial organisms. In still another embodiment, a single dose of the pharmaceutical composition or vaccine comprises from about 107 to about 109 of the bacterial organisms. [00435] For other cancer therapeutic agents administered to a patient, the typical doses of various cancer therapeutics known in the art are provided in Table 5. Given the invention, certain preferred embodiments will encompass the administration of lower dosages in combination treatment regimens than dosages recommended for the administration of single agents. [00436] The invention provides for any method of administrating lower doses of known prophylactic or therapeutic agents than previously thought to be effective for the prevention, treatment, management or amelioration of cancer. Preferably, lower doses of known anti-cancer therapies are administered in combination with lower doses of Listeria- based EphA2 immunogenic compositions of the invention.
5.8. Uses [00437] The Listeria immunogenic compositions of the invention can be used to produce antibodies which can be used in diagnostic immunoassays, passive immunotherapy, and generation of antiidiotypic antibodies. For example, an attenuated Listeria bacterium comprising one or more EphA2 antigenic peptides can be administered to a subject (e.g., a human) to generate antibodies which can then be isolated and used in diagnostic assays, passive immunotherapy and generation of antiidiotypic antibodies. The generated antibodies may be isolated by standard techniques known in the art (e.g., immunoaffinity chromatography, centrifugation, precipitation, etc.) and used in diagnostic immunoassays, passive immunotherapy and generation of antiidiotypic antibodies. The
isolated antibodies before being used in passive immunotherapy may be modified, e.g., the antibodies may be chimerized or humanized. See, e.g., U.S. Patent Nos. 4,444,887 and 4,716,111; and International Publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety, for reviews on the generation of chimeric and humanized antibodies.
[00438] The antibodies isolated from subjects administered an Listeria immunogenic composition of the invention may also be used to monitor efficacy of a therapy(ies) and/or disease progression. Any immunoassay system known in the art may be used for diagnosis of disease, monitoring the efficacy of a therapy(ies) and/or assessing or monitoring disease progression including but not limited to competitive and noncompetitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assays), "sandwich" immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, proteinA immunoassays and Immunoelectrophoresis assays, to name but a few. [00439] The antibodies generated by the Listeria bacteria of the invention can also be used in the production of antiidiotypic antibody. The antiidiotypic antibody can then in turn be used for immunization, in order to produce a subpopulation of antibodies that bind the initial antigen, i.e., EphA2 (Jerne, 1974, Ann. Immunol. (Paris) 125c:373; Jerne et al., 1982, EMBO J. 1:234).
5.9. Biological Assays
[00440] Listeria cells generated to express one or more EphA2 antigenic peptides can be screened for the correct EphA2 inserts by PCR and secretion confirmed by Western blot of TCA-precipitated culture supernatants. For example, candidate Listeria cells grown in overnight cultures in yeast extract medium with (YE) or without (YNG) glucose are used to inoculate 50 ml fresh medium and cultured at 37°C to late-log phase (OD600=0.8). Bacteria are removed from cultures by centrifugation and 3 mL TCA are added to culture supernatants. Precipitations are performed overnight at 4°C, and protein precipitates are collected by centrifugation. Pellets are washed 5 times with acetone and then air-dried. Pellets are resuspended in TE containing phenol red and neutralized with NH4OH. Proteins are electrophoresed on NuPAGE 7% Tris-acetate gel (Invitrogen Corp.) and are transferred to nitrocellulose. The correct EphA2 fragment can be detected with an
antibody that immunospecifically binds to the EphA2 fragment. See also section 6.10 (Example 10).
[00441] Toxicity and efficacy of the prophylactic and/or therapeutic protocols of the instant invention can be determined by standard pharmaceutical procedures in experimental animals, e.g. , for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Prophylactic and/or therapeutic agents that exhibit large therapeutic indices are preferred. While prophylactic and/or therapeutic agents that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. Biological activity can be measured in ELISPOT and ICS assays as described in Sections 5.5.3 and 5.54. Other suitable assays are shown below. [00442] The level of cytokine secretion by the spleen cells of mice can be assessed for control and vaccinated C57B1/6 mice. Spleen cells are stimulated for 24 hours with SL8 or LLOigo. Stimulation with irrelevant peptide HSV-gB2 (Invitrogen) is used as a control. The supernatants of the stimulated cells are collected and the levels of T helper- 1 and T helper 2 cytokines are determined using an ELISA assay (eBiosciences, CO) or a Cytometric Bead Array Kit (Pharmingen).
[00443] Listeria cells can be further evaluated by assessing their cytotoxic activity, either in vitro or directly in C57B1/6 mouse in vivo. The CD8+ T cells recognize and lyse their respective target cells in an antigen-specific manner. In vitro cytotoxicity is determined using a chromium release assay. Spleen cells of nave and Listeria-OVA (internal) vaccinated mice are stimulated at a 10:1 ratio with either irradiated EG7.OVA cells (EL-4 tumor cell line transfected to express OVA, ATCC, Manassas, Va.) or with 100 nM SL8, in order to expand the OVA specific T cells in the spleen cell population. After 7 days of culture, the cytotoxic activity of the effector cells is determined in a standard 4-hour 51Cr-release assay using EG7.OVA or SL8 pulsed EL-4 cells (ATCC, Manassas, Va.) as target cells and EL-4 cells alone as negative control. The YAC-I cell line (ATCC, Manassas, Va.) is used as targets to determine NK cell activity, in order to distinguish the activity due to T cells from that due to NK cells. The percentage of specific cytotoxicity is calculated as 100 % (experimental release-spontaneous release)/(maximal release-spontaneous release). Spontaneous release is determined by
incubation of target cells without effector cells. Maximal release is determined by lysing cells with 0.1% Triton X-100. Experiments are considered valid for analysis if spontaneous release is <20% of maximal release.
[00444] For the assessment of cytotoxic activity of Listeria cells in vivo, spleen cells from naive C57B1/6 mice are split into two equivalent aliquots. Each group is pulsed with a specific peptide, either target or control, at 0.5 μg/ml for 90 minutes at 37°C. Cells are then washed 3 times in medium, and twice in PBS+0.1% BSA. Cells are resuspended at 1 x 107 per ml in warm PBS+0.1% BSA (10 ml or less) for labeling with carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes, Eugene, OR). To the target cell suspension, 1.25 μL of a 5 mM stock of CFSE is added and the sample mixed by vortexing. To the control cell suspension, a ten-fold dilution of the CFSE stock is added and the sample mixed by vortexing. The cells are incubated at 37°C for 10 minutes. Staining is stopped by addition of a large volume (>40 ml) of ice-cold PBS. The cells are washed twice at room temperature with PBS, then resuspended and counted. Each cell suspension is diluted to 50 x 106 per ml, and 100 μL of each population is mixed and injected via the tail vein of either nave or vaccinated mice. After 12-24 hours, the spleens are harvested and a total of 5 x 106 cells are analyzed by flow cytometry. The high (target) and low (control) fluorescent peaks are enumerated, and the ratio of the two is used to establish the percentage of target cell lysis. The in vivo cytotoxicity assay permits the assessment of lytic activity of antigen-specific T cells without the need of in vitro re- stimulation. Furthermore, this assays assesses the T cell function in their native environment.
[00445] The data obtained from the animal studies can be used in formulating a range of dosage of the prophylactic and/or therapeutic agents for use in humans. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agent used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i-e-, the concentration of the immunogenic composition or test compound that achieves a half- maximal inhibition of symptoms) as determined in animal studies. Such information can
be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. [00446] The anti-cancer activity of the therapies used in accordance with the present invention also can be determined by using various experimental animal models for the study of cancer, such as an immunocompetent mouse model, e.g., Balb/c or C57ΛB1/6, or transgenic mice where a mouse EphA2 is replaced with the human EphA2, mouse models to which murine tumor cell lines engineered to express human EphA2 are administered, animal models described in Section 6 infra, or any animal model (including hamsters, rabbits, etc.) known in the art and described in Relevance of Tumor Models for Anticancer Drug Development (1999, eds. Fiebig and Burger); Contributions to Oncology (1999, Karger); The Nude Mouse in Oncology Research (1991, eds. Boven and Winograd); and Anticancer Drug Development Guide (1997 ed. Teicher), herein incorporated by reference in their entireties. [00447] The efficacy of therapies comprising Listeria-based EphA2 immunogenic compositions used in accordance with the present invention for the prevention, treatment and/or management of disorders associated with or charactized by aberrant angiogenesis may be assessed of using experimental animal models for the study of angiogenesis. Many assays are well known in the art to assess angiogenesis or angiogenic activity. For a general review of angiogenesis assays, see, e.g., Auerbach et al., 2003, Clinical Chemistry 49:32-40, which is incorporated by reference herein in its entirety. For example, mouse corneal angiogensis assays may be performed (see, e.g., Cheng et al., MoI. Cancer Res., 2002, 1:2-11 and Kenyon et al., 1996, Invest. Ophthalmol. Vis. ScL 37:1625-1632). Briefly, hydron pellents containing sucralfate with either vehicle alone (PBS or IgG) or an angiogenic factor (e.g., bFGF, VEGF) are surgically implanted into corneal micropockets created 1 mm to the lateral corneal limbus of a mouse (e.g., C57/BL6; The Jackson
Laboratory, Bar Harbor, ME). At day 5 post-implantation, corneas are photographed at an incipient angle of 35-50° from the polar axis in the meridian containing the pellet, using a Zeiss split lamp. The fraction of the total corneal image that is vascularized (VA), and the ratio of pixels marking neovascular capillaries both within the vascularized region (RVD) and within the total corneal image (TVD) is calculated using Bioquant software
(Vanderbilt University, Nashville, TN). Statistical analysis may be performed by using the two-tailed, paired Student's t test. The degree of angiogenesis observed in the eyes of animals administered the Listeria-based EphA2 immunogenic compositions can be
compared to the degree of angiogenesis observed in the eyes of animals administered with a placebo.
[00448] Compositions of the invention for use in therapy can be tested in other suitable animal model systems prior to testing in humans, including but not limited to in rats, mice, chicken, cows, monkeys, rabbits, hamsters, etc., for example, the animal models described above. The compounds can then be used in the appropriate clinical trials.
[00449] Further, any assays known to those skilled in the art can be used to evaluate the prophylactic and/or therapeutic utility of the combinatorial therapies disclosed herein for treatment or prevention of cancer.
5.10. Kits
[00450] The invention provides a pack or kit comprising one or more containers filled with a Listeria-based EphA2 immunogenic composition of the invention or a component of a Listeriα-based EphA2 immunogenic composition of the invention. In certain embodiments of the invention, the Listeriα-based EphA2 composition is engineered to express two or more EphA2 antigenic peptides. In one embodiment, the two or more EphA2 antigenic peptides are encoded by a polycistronic expression cassette. In a preferred embodiment, the two or more EphA2 antigenic peptides are each encoded by a separate monocistronic expression cassette. In a preferred embodiment, the EphA2- expressing Listeria incorporated in the kits is ActA(N100) Exmono Comono.
[00451] Additionally, one or more other prophylactic or therapeutic agents useful for the treatment of a cancer or other hyperproliferative disorder can also be included in the pack or kit. Optionally associated with such containers) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
[00452] The present invention provides kits that can be used in the above methods.
In one embodiment, a kit comprises one or more a Listeria-based EphA2 immunogenic compositions of the invention. In another embodiment, a kit further comprises one or more other prophylactic or therapeutic agents useful for the treatment of cancer or another hyperproliferative disorder, in one or more containers. In other embodiments, the prophylactic or therapeutic agent is a biological or hormonal therapeutic.
6. EXAMPLES: Z/ST£y?/A-BA8EO EphA2 VACCINES PROVTOE
THERAPEUTIC AND PROPHYLACTIC BENEFITS AGAINST Eph A2- EXPRESSING CANCERS
[00453] The receptor tyrosine kinase EphA2 is selectively over-expressed in a variety of malignant cell types and tumors. Additionally, recent studies have identified patient-derived T lymphocytes that recognize EphA2. As such, EphA2 provides a much- needed target for active immunotherapy. Here, we show that ectopic expression of human EphA2 in the Gram-positive facultative intracellular bacterium Listeria monocytogenes (Listeria) can provide antigen-specific anti-tumor responses in vaccinated animals. Listeria infects critical antigen presenting cells and thereby provides efficacy as a cancer therapy based its ability to induce potent and robust CD4+ and CD8+ T cell responses against encoded antigens. Attenuated Listeria mutant strains, which retain the antigen delivery potency of wild-type bacteria, yet are nearly 10,000-fold less pathogenic in mice, were employed. To demonstrate the efficacy of a Listeria-based EphA2 vaccine, Listeria actA" strains were engineered to express the extracellular (ECD) or intracellular (ICD) domain of human EphA2 (actA-hEphA2-ECD or actA-hEphA2-ICD). Expression and secretion of hEphA2-EX and -CO from Listeria was confirmed by Western blot analysis. Protective immunization with actA-hEρhA2EX significantly inhibited the subcutaneous growth of CT26 cells that express full-length hEphA2 (p=0.0037). As controls, mice vaccinated with the parental actA strain developed tumors that were comparable to vehicle-treated control mice. Protective immunization with actA-hJEphA2CO significantly increased the survival rate in mice challenged with RenCA-hEphA2. Subsequently, the therapeutic efficacy of actA-hEphA2-ECD or actA-hEphA2-ICD was evaluated using the experimental CT26-hEphA2 lung tumor model. Following intravenous implantation of tumor cells, Balb/c mice were immunized with actA, actA- hEphA2EX or actA-hEphA2-ICD. Immunization with either actA-hEphA2-ECD or actA- hEphA2-ICD significantly prolonged survival (median survival >43 days, p= 0.0035), as compared to matched controls (vehicle or actA median survival time was 19 and 20 days, respectively). Importantly, 80% of the huEphA2 immunized mice survived until Day 43 following tumor implantation. Together, these data demonstrate that Listeria-mediated vaccination targeting the EphA2 tumor antigen can provide both preventative and therapeutic efficacy against a variety of malignancies.
[00454] Further, to demonstrate the efficacy of the Listeria-based EphA2 vaccine of the invention, ActA(N100)ExmonoComσno (MEDI-543) was engineered to express both
the ECD domain of human EphA2 as well as the ICD domain of human EphA2 with a single mutation at residue 646 (lysine to methionine) that ablates kinase activity, by sequential homologous recombination into the actA and inlB loci, respectively, with the ICD inserted first. Expression and secretion of the fusion protein comprising the first 100 amino acids of ActA (ACtA(Nl 00)) and the ECD of human EphA2 and the ICD domain of human EphA2 with the K646M mutation from the Listeria strains (i.e., ActA(N100)ExmonoComono) of the invention were confirmed by Western blot analysis. Protective immunization with ActA(N100)ExmonoComono significantly inhibited the subcutaneous growth of CT26 cells that express full-length hEphA2 in mice. As controls, mice vaccinated with the parental actA strain developed tumors that were comparable to vehicle-treated control mice. Subsequently, the therapeutic efficacy of ACtA(Nl 00)ExmonoComono was evaluated using the experimental CT26-hEphA2 lung tumor model. Following intravenous implantation of tumor cells, Balb/c mice were immunized with ACtA(Nl 00)ExmonoComono, AH1-A5/OVA (Listeria expressing AHl- A5 and ovalbumin), FL-InIB (Listeria expressing full length EphA2), or a control strain. Immunization with ActA(N100)ExmonoComono significantly reduced tumor volume in mice relative to the other Listeria strains tested. Together, these data demonstrate that Lister/α-mediated vaccination targeting the EphA2 tumor antigen can provide both preventative and therapeutic efficacy against a variety of malignancies.
6.1. EXAMPLE 1: USTERIA LIFE CYCLE
[00455] The life cycle of Listeria monocytogenes, encompassing the steps of endocytosis, phagolysosomal lysis, and cell to cell spread, are shown in Figure 1A-1B.
6.2. EXAMPLE 2: CONSTRUCTION OF EphA2-EXPRESSING AND
CONTROL USTERIA STRAINS 6.2.1. Background
[00456] Given the mechanisms by which Listeria programs the presentation of heterologous antigens via the MHC class I pathway, the efficiency of both expression of heterologous genes and secretion of the newly synthesized protein from the bacterium into the cytoplasm of the infected (antigen presenting) cell is related directly to the potency of CD8+ T cell priming and/or activation. As the level of Ag-specific T cell priming is related directly to vaccine efficacy, the efficiency of heterologous protein expression and secretion is linked directly to vaccine potency. Thus, the efficiency of EphA2 expression and secretion was optimized to maximize the potency of Listeria-based vaccines, in terms
of priming and/or activating CD8+ T cell responses specific for the encoded EphA2 protein.
6.2.2. Preparation of mutant Listeria strains.
[00457] Listeria strains were derived from 10403S (Bishop et ah, J. Immunol. 139:2005 (1987)), which is a streptomycin-resistant variant of the wild-type strain 10403. Listeria strains with in-frame deletions of the indicated genes were generated by SOE- PCR and allelic exchange with established methods (Camilli et al., MoI. Microbiol. 8:143 (1993)). The mutant strain LLO L461T (DP-L4017) was described in Glomski, et al., J. Cell. Biol. 156: 1029 (2002), incorporated by reference herein. The act A' mutant (DP- L4029) is the DP-L3078 strain described in Skoble et al., J. of Cell Biology, 150: 527-537 (2000), incorporated by reference herein in its entirety, which has been cured of its prophage. (Prophage curing is described in (Lauer et al., J. Bacteriol. 184:4177 (2002)); U.S. Patent Publication No. 2003/0203472.) [00458] In some vaccines, mutant strains of Listeria that are deficient with respect to internalin B (Genbank accession number AL591975 (Listeria monocytogenes strain
EGD, complete genome, segment 3/12; inlB gene region: nts. 97008-98963), incorporated by reference herein in its entirety, and/or the sequence listed as Genbank accession number NC_003210 (Listeria monocytogenes strain EGD, complete genome, inlB gene region: nts.457008-458963), incorporated by reference herein in its entirety) are used. One particular actA'inlB' strain (DP-L4029m/5) was deposited with the American Type Culture Collection (ATCC) on October 3, 2003, and designated with accession number PTA-5562).
[00459] In some Listeria-based EphA2 based vaccines, one or more EphA2 expression cassettes of interest were integrated into the strain CERS 382.20. The strain CERS 382.20 is an attenuated strain of DP-L4056 deleted of the coding sequence of actA and inlB, wherein the flanking regions, including the cis elements remain. DP-L4056 is a prophage-free derivative of strain 10403S. The process used to isolate strain DP-L4056 from strain 10403S has been described in detail (Lauer etal., J. Bacteriol. 184:4177 (2002)). The streptomycine resistance is conserved in CERS 382.20.
6.2.3. Cloning vectors
[00460] Selected heterologous antigen expression cassette molecular constructs were inserted into pPL2 (Lauer et. al. J. Bacteriol. 2002), or pAM401 (Wirth et. al., J.
Bacteriol. 165:831-836), modified to contain the multiple cloning sequence of pPL2 (Aat II small fragment blunted by T4 polymerase, 171 bps), inserted between Klenow blunted Xba I and Nru /recognition sites, within the tetracycline resistance gene (pAM401-MCS). In general, the hly promoter and (selected) signal peptide sequence (Le., Listeria monocytogene expression optimized BaPA signal peptide) was inserted between the unique Kpn I and Bam HI sites in the pPL2 or pAM401-MCS plasmid vectors. The pAM- BaPA plasmid was constructed by inserting a Kpnl-BamHI DNA fragment containing the hly promoter and Listeria monocytogene expression optimized BaPA signal peptide into the Kpnl-BamHI sites of p AM-MCS. Selected EphA2 genes (sometimes modified to contain N-terminal and C-terminal epitope tags; see description below) were cloned subsequently into these constructs between unique Bam HI and Sac I sites. Alternatively, EρhA2 cDNA containing conservative codon modifications were also cloned into the constructs between unique BamHI and Sad sites. In particular, EphA2 cDNA sequences were modified by BLUE HERON (Blue Heron Biotechnology, Bothell, WA) using a proprietary algorithm to match codon utilization in Listeria and to reduce secondary structure in nascent transcripts that impede translational efficiency. [00461] Molecular constructs based on the pAM401-MCS plasmid vector were introduced by electroporation into selected Listeria monocytogenes strains also treated with lysozyme, utilizing methods common to those skilled in die art. Plasmid integration occured following recombination at temperatures non-permissive for Gram-positive plasmid replication in the presence of chloramphenicol (Cm) (see Figure 35). The resulting Cmr intermediates contained one or more plasmid copies integrated into the bacterial chromosome and were therefore merodiploid widi respect to regions flanking the EphA2 insertion. Plasmid sequences were excised from merodiploid strains when cultured under non-selective conditions that favor a second recombination event. The resulting Cm- sensitive (Cms) strains were screened for the EρhA2 inserts by PCR and secretion confirmed by Western blot of TCA-precipitated culture supernatants. [00462] Recombinant Listeria transformed with various pAM401-MCS based heterologous protein expression cassette constructs were utilized to measure heterologous protein expression and secretion, as described below.
[00463] The pPL2 based heterologous protein expression cassette constructs were incorporated into the tRNAArg gene in the genome of selected Listeria strains, according to the methods as described previously (Lauer et al., 2002, J. Bacteriol. 184:4177-4186). Briefly, the pPL2 heterologous protein expression cassette constructs plasmid was first
introduced into the E. coli host strain SMlO (Simon et ah, 1983, Bio/Technology 1:784- 791) by electroporation or by chemical means. Subsequently, the pPL2-based plasmid was transferred from transformed SMlO to the selected Listeria strains by conjugation. Following incubation on drug-selective BHI agar plates containing 7.5 μg of chloramphenicol per ml and 200 μg of streptomycin per ml as described, selected colonies are purified by passaging 3 times on plates with the same composition. To verify integration of the pPL2 vector at the phage attachment site, individual colonies are picked and screened by PCR using the primer pair of forward primer NC 16 (5'- gtcaaaacatacgctcttatc-3') (SEQ ID NO:47) and reverse primer PL95 (5'- acataatcagtccaaagtagatgc-3') (SEQ ID NO:48). Selected colonies having the pPL2-based plasmid incorporated into the tRNAArg gene in the genome of selected Listeria strains yielded a diagnostic DNA amplicon of 499 bps.
6.2.4. Promoter [00464] Heterologous protein expression cassettes contained the prfA-dependent hly promoter, which drives the transcription of the gene encoding Listeriolysin O (LLO), and is activated within the microenvironment of the infected cell. Nucleotides 205586- 206000 (414 bps) were amplified by PCR from Listeria monocytogenes, strain DP-L4056, using the primer pair shown below. The region amplified includes the hly promoter and also the first 28 amino acids of LLO, comprising the secAl signal peptide (ibid) and PEST domain. The expected sequence of this region for Listeria monocytogenes, strain EGD can be found in GenBank (Accession number: gill6802048|ref|NC_003210.1|[16802048]).
[00465] Primer Pair
[00466] Forward (Kpnl-LLO nts. 1257-1276):
[00467] 57-CTCTGGTACCTCCTTTGATTAGTATATTC (SEQ ED NO:49) [00468] Reverse (Bam HI-LLO nts. X-x):
[00469] 5'-CTCTGGATCCATCCGCGTGTTTCTTTTCG (SEQ ED NO:50)
[00470] (Restriction endonuclease recognition sites are underlined)
[00471] The 422 bp PCR amplicon was cloned into the plasmid vector pCR-XL-
TOPO (ϋivitrogen, Carlsbad, CA), according to the manufacturer's specifications. The nucleotide sequences of Listeria-specitic bases in the pCR-XL-TOPO-hly promoter plasmid clone was determined. Listeria monocytogenes strain DP-L4056 contained eight nucleotide base changes flanking the prfA box in the hly promoter, as compared to the
EGD strain. The hly promoter alignment for the Listeria monocytogenes DP-L4056 and EGD strains is shown in the Figure below (SEQ ID NOs: 68 and 69, respectively). Listeria hly DP-L4056 and EGD Alignment
Query: Listeria EGD
Subject: DP-L4056 (wild-type, Portnoy strain) prfA Box
Query: 1 ggtacctcctttgattagtatattcctatcttaaagtgacttttatgttgaggcattaaσ 60 lllll Mill MllilllMIIIIMIMIM! Mil MJIMMM MIMMMMI
Sbjct: 1 ggtacctcctctgateagtatatccctatcttaaagttacttttatgtggaggcattaac 60 Query: 61 atfctffttaacgacgataaagggacagcaggactagaataaagctataaagcaagcatata 120
MMMIM IHI III IM Mil 1111111111111111111 M 11111 M M I
Sbjct: 61 attfcsrttaatgacgtcaaaaggatagcaagactagaataaagctataaagcaagcatata 120
Query: 121 atattgcgtttcatctttagaagcgaatttcgccaatattataattatcaaaagagaggg 180
M M M IM MMMI MMMMMMMMM IM M I M MIMIM I Il M 11 Il M
Sbjct: 121 atattgcgtttcatctttagaagcgaatttcgccaatattataattatcaaaagagaggg 180
Sbine-Delgarao IJ_O start
Query: 181 gtggcaaacggtatttggcattattaggttaaaaaatgtagaaggagagtgaaacccatsr 240
Sbjct: 181 gtggcaaacggtatttggcattattaggttaaaaaatgtagaaggagagtgaaacccatg 240 [00472] The 422 bp DNA corresponding to the hly promoter and secAl LLO signal peptide were liberated from the pCR-XL-TOPO-hly promoter plasmid clone by digestion with Kpn I and Bam HI, and cloned into the pPL2 plasmid vector (Lauer et al., 2002, /. Bact), according to conventional methods well-known to those skilled in the art. This plasmid is known as pPL2-hlyP (native).
6.2.5. Cloning and Insertion of EphA2 into pPL2 vectors for expression in selected recombinant Listeria monocytogenes strains
[00473] The external (EX2) and cytoplasmic (CO) domains of EphA2 which flank the EphA2 transmembrane helix were cloned separately for insertion into various pPL2- signal peptide expression constructs. Genes corresponding to the native mammalian sequence or codon-optimized for expression in Listeria monocytogenes of EphA2 EX2 and CO domains were used. The optimal codons in Listeria (see table, ibid) for each of the 20 amino acids were utilized for codon-optimized EphA2 EX2 and EphA2 CO. The codon-optimized EphA2 EX2 and CO domains were synthesized by extension of overlapping oligonucleotides, using techniques common to those skilled in the art. The expected sequence of all synthesized EphA2 constructs was verified by nucleotide sequencing.
[00474] SEQ ID NOS: 23, 21 and 22 represent the primary amino acid sequences, together with the native and codon-optimized nucleotide sequences, respectively, for the
EX2 domain of EphA2.
[00475] SEQ ID NOS: 34, 32 and 33 represent the primary amino acid sequences, together with the native and codon-optimized nucleotide sequences, respectively, for the
CO domain of EphA2.
[00476] Additionally, FLAG (Stratagene, La Jolla, CA) and myc epitope tags were inserted, respectively, in-frame at the amino and carboxy termini of synthesized EphA2
EX2 and CO genes for detection of expressed and secreted EphA2 by Western blot analysis using antibodies specific for the FLAG or proteins. Thus, the expressed protein had the following ordered elements: NHb-Signal Peptide-FLAG-EphA2-myc-CO2.
Shown below are the FLAG and myc epitope tag amino acid and codon-optimized nucleotide sequences.
[00477] FLAG [00478] 5'-GATTATAAAGATGATGATGATAAA (SEQ ID NO^I)
[00479] NH2-DYKDDDDK-CO2 (SEQ ID NO:52)
[00480] Myc
[00481] 5'-GAACAAAAATTAATTAGTGAAGAAGATTTA (SEQ ED NO:53)
[00482] NH2-EQKLISEEDL-CO2 (SEQ ID NO:54)
6.2.6. Detection of synthesized and secreted heterologous proteins by
Western blot analysis
[00483] Synthesis of EphA2 protein and secretion from various selected recombinant Listeria-EphA2 strains was determined by Western blot analysis of trichloroacetic acid (TCA) precipitated bacterial culture fluids. Briefly, mid-log phase cultures of Listeria grown in BHI media were collected in a 50 mL conical centrifuge tube, the bacteria were pelleted, and ice-cold TCA was added to a final [6%] concentration to the bacterial culture supernatant and incubated on ice minimally for 90 min or overnight. The TCA-precipitated proteins were collected by centrifugation at 2400 X g for 20 min at 4°C. The pellet was then resuspended in 300-600 μl volume of TE, pH 8.0 containing 15 μg/ml phenol red. Sample dissolution was facilitated by vortexing. Sample pH was adjusted by NH4OH addition if necessary until color was pink. AU samples were prepared for electrophoresis by addition of 100 μl of 4X SDS loading buffer and incubating for 10 min. at 900C. The samples were then centrifuged from 5 min at 14,000
rpm in. a micro-centrifuge, and the supernatants collected and stored at -2O0C. For Western bolt analysis, 20 μl of prepared fractions (the equivalent of culture fluids from of 1-4 x 109 bacteria), were loaded on the 4-12% SDS-PAGE gel, electrophoresed, and the proteins were transferred to PDDF membrane, according to common methods used by those skilled in the art. Transferred membranes were prepared s for incubation with antibody, by incubating in 5% dry milk in PBS for 2 hr. at room temperature with agitation. Antibodies were used under the following dilutions in PBST buffer (0.1% Tween 20 in PBS): (1) Rabbit anti-Myc polyclonal antibody (ICL laboratories, Newberg, Oregon) at 1:10,000; (2) murine anti-FLAG monoclonal antibody (Stratagene, ibid) at 1:2,000; and, (3) Rabbit anti-EρhA2 (carboxy terminus-specific) polyclonal antibody (sc- 924, Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Specific binding of antibody to protein targets was evaluated by secondary incubation with goat anti-rabbit or anti-mouse antibody conjugated with horseradish peroxidase and detection with the ECL chemilumenescence assay kit (Amersham), and exposure to film.
6.2.7. Secretion of EphA2 protein by recombinant Listeria encoding various forms of Eph A2
6.2.7.1. Listeria: [strains DP-L4029 (actA) or DP-L4017 (LLO L461T)1
[00484] Expression cassette construct: LLOss-PEST-CO-EphA2 (SEQ ID NO:35) [00485] The native sequence of the EphA2 CO domain was genetically fused to the native secAl LLO sequence, and the heterologous antigen expression cassette under control of the Listeria hly promoter was inserted into the pPL2 plasmid between the Kpn I and Sac /sites as described (ibid). The pPL2-EphA2 plasmid constructs were introduced by conjugation into the Listeria strains DP-L4029 (actA) and DP-L4017 (L461T LLO) as described (ibid). Figure 2 shows the results of a Western blot analysis of TCA- precipitated bacterial culture fluids of 4029-EphA2 CO and 4017-EphA2 CO. This analysis demonstrated that recombinant Listeria engineered to contain a heterologous protein expression cassette comprised of native sequences corresponding to the secAl and EphA2 CO fusion protein secreted multiple EphA2-specific fragments that were lower than the 52 kDa expected molecular weight, demonstrating the need for modification of the expression cassette.
6.2.7.2. Listeria: ΓDP-L4029 (actA)] [00486] Expression cassette constructs:
Native LLOss-PEST-FLAG-EX2_EphA2-myc-CodonOp (SEQ ID
NO:26) (CodonOp) LLOss-PEST-(CodonOρ)FLAG-EX2_EρhA2-myc (SEQ ID
NO:28) [00487] The native secAl LLO signal peptide sequence or secAl LLO signal peptide sequence codon-optimized for expression in Listeria was fused genetically with the EphA2 EX2 domain sequence codon-optimized for expression in Listeria, and the heterologous antigen expression cassette under control of the Listeria My promoter was inserted into the pPL2 plasmid between the Kpn I and Sac I sites as described (ibid). The pPL2-EphA2 plasmid constructs were introduced by conjugation into the Listeria strain DP-L4029 (actA) as described (ibid). Figure 3 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria actA encoding either the native or codon-optimized secAl LLO signal peptide fused with the codon-optimized EphA2 EX2 domain. This analysis demonstrated that the combination of utilizing sequence for both signal peptide and heterologous protein optimized for the preferred codon usage in Listeria monocytogenes resulted in expression of the expected full-length EphA2 EX2 domain protein. Expression of full-length EphA2 EX2 domain protein was poor with codon-optimization of the EphA2 coding sequence alone. The level of heterologous protein expression (fragmented or full-length) was highest when utilizing the Listeria monocytogenes LLO secAl signal peptide, codon-optimized for expression in Listeria monocytogenes.
6.2.7.3. Listeria: rPP-L4029 (actA)Λ [00488] Expression cassette constructs:
Native LLOss-PEST-(CodonOp) FLAG-EphA2_CO-myc (SEQ ID NO:37)
CodonOp LLOss-PEST-(CodonOp) FLAG- EphA2_CO-myc (SEQ ID
NO:39)
CodonOp PhoD-(CodonOp) FLAG- EphA2_CO-myc (SEQ ID NO:41) [00489] The native secAl LLO signal peptide sequence or the secAl LLO signal peptide sequence codon-optimized for expression in Listeria, or, alternatively, the Tat signal peptide of the phoD gene from Bacillus subtilis codon-optimized for expression in Listeria, was fused genetically with the EρhA2 CO domain sequence codon-optimized for expression in Listeria, and the heterologous antigen expression cassette under control of
the Listeria My promoter was inserted into the pAM40i-MCS plasmid between the Kpn I and Sac I sites as described (ibid). The pAM401-EphA2 plasmid constructs were introduced by electroporation into the Listeria strain DP-L4029 (actA) as described (ibid). Figure 4 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria actA encoding either the native or codon-optimized sec Al LLO signal peptide, or codon-optimized Bacillus subtilis phoD Tat signal peptide fused with the codon-optimized EphA2 CO domain. This analysis demonstrated once again that the combination of utilizing sequence for both signal peptide and heterologous protein optimized for the preferred codon usage in Listeria monocytogenes resulted in expression of the expected full-length EphA2 CO domain protein. Furthermore, expression and secretion of the expected full-length EphA2 CO domain protein resulted from recombinant Listeria encoding codon-optimized Bacillus subtilis phoD Tat signal peptide fused with the codon-optimized EphA2 CO domain. This result demonstrates the novel and unexpected finding that signal peptides from distinct bacterial species can be utilized to program the secretion of heterologous proteins from recombinant Listeria. Expression of full-length EphA2 CO domain protein was poor with codon-optimization of just the EphA2 sequence. The level of heterologous protein expression was highest when utilizing signal peptides codon-optimized for expression in Listeria monocytogenes.
6.2.8. Construction of Listeria strains expressing AH1/OVA or AHl- A5/OVA
[004901 Mutant Listeria strains expressing a truncated form of a model antigen ovalbumin (OVA), the immunodominant epitope from mouse colorectal cancer (CT26) known as AHl (SPSYVYHQF) (SEQ ID NO:55), and the altered epitope AH1-A5 (SPSYAYHQF (SEQ ID NO:56); Slansky et al., 2000, Immunity, 13:529-538) were prepared. The pPL2 integrational vector (Lauer et al., J. Bacterial. 184:4177 (2002); U.S. Patent Publication No. 2003/0203472) was used to derive OVA and AH1-A5/OVA recombinant Listeria strains containing a single copy integrated into an innocuous site of the Listeria genome.
6.2.9. Construction of OVA-expressing Listeria (DP-L4056) [00491] An antigen expression cassette consisting of hemolysin-deleted LLO fused with truncated OVA and contained in the pPL2 integration vector (pPL2/LLO-OVA) is first prepared. The Listeria-OVA vaccine strain is derived by introducing pPL2/LLO-
OVA into the phage-cured L. monocytogenes strain DP-L4056 at the PSA (Phage from ScottA) attachment site tRNAMs-attBB' .
[00492] PCR is used to amplify the hemoly sin-deleted LLO using the following template and primers: Source: DP-L4056 genomic DNA
Primers:
Forward (Kpnl-LLO nts. 1257-1276):
5'-CTCTGGTACCTCCTTTGATTAGTATATTC (SEQ ID NO:57) (Tm: LLO-spec: 52°C. Overall: 800C.) Reverse (BamHl-XhoI-LLO nts. 2811-2792):
5'-CAATGGATCCCTCGAGATCATAATTTACTTCATCCC (SEQ ID NO:58)
(Tm: LLO-spec: 52°C. Overall: 1020C)
[00493] PCR is also used to amplify the truncated OVA using the following template and primers:
Source: pDP3616 plasmid DNA from DP-E3616 E. coli (Higgins et al., MoI.
Molbiol 31:1631-1641 (1999)). Primers:
Forward (Xhol- Ncol OVA cDNA nts. 174-186): 5'-ATTTCTCGAGTCCATGGGGGGTTCTCATCATC
(SEQ ID NO:59)
(Tm: OVA-spec: 6O0C. Overall: 88°C.) Reverse (Xhol-Notl-Hindlll):
5'-GGTGCTCGAGTGCGGCCGCAAGCTT (SEQ ID NO:60)
(Tm: Overall: 82°C.)
[00494] One protocol for completing the construction process involves first cutting the LLO amplicon with Kpnl and BamHI and inserting the Kpril/BamHI vector into the pPL2 vector (pPL2-LLO). The OVA amplicon is then cut with Xhol and Notl and inserted into the pPL2-LLO which has been cut with Xhol/Notl (Note: The pPL2 vector does not contain any Xhol sites; pDP-3616 contains one Xhol site, that is exploited in the OVA reverse primer design.) The construct pPL2/LLO-OVA is verified by restriction analysis (Kpnl-LLO-XhoI-OVA-Notl) and sequencing. The plasmid pPL2/LLO-OVA is introduced into E. coli by transformation, followed by introduction and integration into
Listeria (DP-L4056) by conjugation, exactly as described by Lauer et al. (or into another desired strain of Listeria).
6.2.10. Construction of Listeria strains expressing AH1/OVA or AHl- A5/OVA [00495] To prepare Listeria expressing either the AH1/OVA or the AH1-A5/OVA antigen sequences, inserts bearing the antigen are first prepared from oligonucleotides and then ligated into the vector ρPL2-LLO-O VA (prepared as described above). [00496] The following oligonucleotides are used in preparation of the AHl or AHl-
A5 insert: AHl epitope insert (Clal-Pstl compatible ends):
Top strand oligo (AHl Top):
5'-CGATTCCCCTAGTTATGTTTACCACCAATTTGCTGCA (SEQ ID NO:61)
Bottom strand oligo (AHl Bottom): 5'-GCAAATTGGTGGTAAACATAACTAGGGGAAT
(SEQ ID NO:62)
AHl -A5 epitope insert (Clal-Avall compatible ends):
[00497] The sequence of the AH1-A5 epitope is SPSYAYHQF (SEQ ID NO:56)
(5'-AGT CCA AGT Tat GCA Tat CAT CAA TTT-3') (SEQ ID NO:63). Top: 5'-CGATAGTCCAAGTTATGCATATCATCAATTTGC
(SEQ ID NO:64)
Bottom: 5'-GTCGCAAATTGATGATATGCATAACTTGGACTAT (SEQ ED NO:65)
[00498] The oligonucletide pair for a given epitope are mixed together at an equimolar ratio, heated at 950C for 5 min. The oligonucleotide mixture is then allowed to slowly cool. The annealed oligonucleotide pairs are then ligated at a 200 to 1 molar ratio with pPL2-LLO/OVA plasmid prepared by digestion with the relevant restriction enzymes. The identity of the new construct can be verified by restriction analysis and/or sequencing. [00499] The plasmid can then be introduced into E. coli by transformation, followed by introduction and integration into Listeria (DP-L4056) by conjugation, exactly as described by Lauer et ah, or into another desired strain of Listeria, such as an act A' mutant strain (DP-L0429), LLO L461T strain (DP-L4017), or actA linlW strain (DP-L4029mrø).
6.3. EXAMPLE 3: GENERATION OF MURINE TUMOR CELL LINES THAT EXPRESS HUMAN EphA2
6.3.1. Background
[00500] A mouse immunotherapy model was created for testing the Listeria-based vaccines of the invention. Three murine tumor cell lines, the CT26 murine colon carcinoma cell line, the Bl 6F10 murine melanoma cell line, and the RenCa murine renal cell carcinoma cell line were created to express high levels of the huEphA2 protein. FACS cell sorting assays were performed to identify CT26, B16F10, and RenCa tumor cells expressing high levels of huEphA2, which were pooled and analyzed by Western blot analysis. Clones were further pooled by FACS cell sorting to generate subclones expressing the highest levels of huEphA2.
6.3.2. Selection of CT26 Murine Colon Carcinoma Cells Expressing High Levels of huEphA2
6.3.2.1. Transfection Assays With Liuofectamine™ [00501] CT26 cells were transfected with constructs containing huEphA2 using standard transfection techniques and commercially available Lipofectamine™ according to the manufacturer's instructions.
6.3.2.2. Flow Cytometry (FACS) Analysis
[00502] Single cell FACS sorting assays were performed by standard techniques to identify CT26 murine carcinoma tumor cell expressing high levels of human EphA2.
[00503] Figure 5 illustrates a representative experiment, showing that the EphA2-3 clone expressed the highest levels of human EphA2 protein.
6.3.2.3. Western Blot of Pooled Populations Expressing High Levels of huEph A2 [00504] Western blotting was also performed using standard techniques to determine the levels of human EphA2 protein expression in CT26 cells following FACS sorting of pooled populations of cells transfected with various constructs containing the huEphA2 gene. Figure 6 depicts results of a representative experiment. Compared to various clones tested, the huEphA2-3 clone expressed the highest levels of human EphA2 protein and was selected for the in vivo efficacy studies described below. Cells were further pooled to generate subclones expressing the highest levels of huEphA2.
6.3.3. Selection of B 16F10 Murine Melanoma Cells Expressing High Levels of huEphA2
6.3.3.1. Retroviral Transduction
[00505] Human EphA2 was introduced into B16F10 murine melanoma cells by a retroviral transduction method to create clones expressing high levels of the protein.
6.3.3.2. Flow Cytometry (FACS) Analysis
[00506] As was performed on the CT26 cells, single cell FACS sorting assays were performed by standard techniques on B16F10 cells expressing huEphA2 to generate clones expressing high levels of huEphA2. Clones expressing the highest levels of huEphA2 were pooled and further examined by Western blot analysis. A representative FACS experiment is depicted in Figure 7, showing a Bl 6F10 subclone expressing high levels of huEphA2.
6.3.3.3. Western Blot of Pooled Populations Expressing High Levels of huEphA2 [00507] Western blotting was also performed as described above to determine levels of huEphA2 protein expression in B16F10 cells following FACS sorting of pooled populations of cells containing the huEphA2 gene introduced by retroviral transduction. Cells were further pooled to generate subclones expressing the highest levels of huEphA2.
6.3.4. Selection of RenCa Murine Renal Cell Carcinoma Cells Expressing High Levels of huEphA2
6.3.4.1. Transfection Assays With LipofectamineTM
[0001] RenCa cells were transfected with constructs containing huEphA2 using standard transfection techniques and commercially available LipofectamineTM according to the manufacturer's instructions.
6.3.4.2. Flow Cytometry (FACS) Analysis
[0002] Single cell FACS sorting assays were performed by standard techniques to identify RenCa renal cell carcinoma tumor cells expressing high levels of human EρhA2.
6.3.4.3. Western Blot of Pooled Populations Expressing High
Levels of huEphA2 [00508] Western blotting was also performed using standard techniques to determine the levels of human EphA2 protein expression in RenCa cells following FACS sorting of pooled populations of cells transfected with various constructs containing the
huEphA2 gene. Cells were further pooled to generate subclones expressing the highest levels of huEphA2.
6.3.5. Transfection of 293 Cells with pCDNA4 plasmids encoding full- length EphA2 [00509] Expression cassette constructs:
[00510] ρCDNA4-EphA2
[00511] The native full-length EphA2 gene was cloned into the eukaryotic CMV promoter-based expression plasmid pCDNA4 (Invitrogen, Carlsbad, CA). Figure 8 shows the results of a Western blot analysis of lystates prepared from 293 cells transfected with the pCDNA4-EphA2 plasmid, and demonstrates the abundant expression in mammalian cells of full-length EphA2 protein.
6.4. EXAMPLE 4: Assessment of antigen-specific immune responses after vaccination
[00512] The vaccines of the present invention can be assessed using a variety of in vitro and in vivo methods. Some assays involve the analysis of antigen-specific T cells from the spleens of mice that have been vaccinated. For example C57B1/6 or Balb/c are vaccinated by intravenous injection of 0.1 LD50 of a Listeria strain expressing OVA (or other appropriate antigen). Seven days after the vaccination, the spleen cells of the mice are harvested (typically 3 mice per group) by placing the spleens into ice cooled RPMI 1640 medium and preparing a single cell suspension from this. As an alternative, the lymph nodes of the mice could be similarly harvested, prepared as a single cell suspension and substituted for the spleen cells in the assays described below. Typically, spleen cells are assessed for intraveneous or intraperitoneal administration of the vaccine while spleen cells and cells from lymph nodes are assessed for intramuscular, subcutaneous or intradermal administration of the vaccine.
[00513] Unless otherwise noted, all antibodies used in these examples can be obtained from Pharmingen, San Diego, CA.
6.4.1. ELISPOT Assay:
[00514] Using a Listeria strain having an OVA antigen as an example, the quantitative frequency of antigen-specific T cells generated upon immunization in a mouse model is assessed using an ELISPOT assay. The antigen-specific T cells evaluated are OVA specific CD8+ or LLO specific CD8+ or CD4+ T cells. This OVA antigen model assesses the immune response to a heterologous tumor antigen inserted into the vaccine
and could be substituted with any antigen of interest. The LLO antigen is specific to Listeria. The specific T cells are assessed by detection of cytokine release (e.g. IFN-γ) upon recognition of the specific antigen. PVDF-based 96 well plates (BD Biosciences, San Jose, CA) are coated overnight at 4°C with an anti-murine IFN-γ monoclonal antibody (mAb R4; 5 μg/ml). The plates are washed and blocked for 2 hours at room temperature with 200 μL of complete RPMI. Spleen cells from vaccinated mice (or non vaccinated control mice) are added at 2 x 105 cells per well and incubated for 20 to 22 hours at 37°C in the presence of various concentrations of peptides ranging from 0.01 to 10 μM. The peptides used for OVA and LLO are either SL8, an MHC class I epitope for OVA, LLO 190 (NEKYAQAYPNVS, Invitrogen) an MHC class II epitope for listeriolysin O (Listeria antigen), LLO296 (VAYGRQVYL), an MHC class I epitope for listeriolysin O, or LLO91 (GYKDGNEYI), an MHC class I epitope for listeriolysin O. LLOigo and LLO296 are used in a C57BI/6 model, while LLO91 is used in a Balb/c model. After washing, the plates are incubated with secondary biotinylated antibodies specific for IFN-γ (XMG 1.2) diluted in PBS to 0.5μg/ml. After incubation at room temperature for 2 hours, the plates are washed and incubated for 1 hour at 37 0C with a 1 nm gold goat anti-biotin conjugate (GAB-I; 1:200 dilution; Ted Pella, Redding, CA) diluted in PBS containing 1 % BSA. After thorough washing, the plates are incubated at room temperature for 2 to 10 minutes with substrate (Silver Enhancing Kit; 30 ml/well; Ted Pella) for spot development. The plates are then rinsed with distilled water to stop the substrate reaction. After the plates have been air-dried, spots in each well are counted using an automated ELISPOT plate reader (CTL, Cleveland, OH). The cytokine response is expressed as the number of IFN-γ spot- forming cells (SFCs) per 2 x 105 spleen cells for either the OVA specific T cells or the Listeria specific T cells.
6.4.2. Intracellular Cytokine Staining Assay (ICS):
[00515] In order to further assess the number of antigen-specific CD8+ or CD4+ T cells and correlate the results with those obtained from ELISPOT assays, ICS is performed and the cells evaluated by flow cytometry analysis. Spleen cells from vaccinated and control groups of mice are incubated with SL8 (stimulates OVA specific CD8+ cells) or LLOi 90 (stimulates LLO specific CD4+ cells) for 5 hours in the presence of Brefeldin A (Pharmingen). The Brefeldin A inhibits secretion of the cytokines produced upon stimulation of the T cells. Spleen cells incubated with an irrelevant MHC class I peptide are used as controls. PMA (phorbol-12-myristate- 13 -acetate, Sigma) 20 ng/ml and
ionomycin (Sigma) 2 μg/ml stimulated spleen cells are used as a positive control for IFN-γ and TNF-α intracellular cytokine staining. For detection of cytoplasmic cytokine expression, cells are stained with FITC-anti-CD4 mAb (RM 4-5) and PerCP-anti-CD8 rnAb (53-6.7), fixed and permeabilized with Cytofix/CytoPerm solution (Pharmingen), and stained with PE-conjugated anti-TNF-α mAb (MP6-XT22) and APC-conjugated anti- IFN-γmAb (XMG 1.2) for 30 minutes on ice. The percentage of cells expressing intracellular DFN-γ and/or TNF-α was determined by flow cytometry (FACScalibur, Becton Dickinson, Mountain View, CA) and data analyzed using CELLQuest software (Becton Dickinson Immunocytometry System). As the fluorescent labels on the various antibodies can all be distinguished by the FACScalibur, the appropriate cells are identified by gating for those CD8+ and CD4+ that are stained with either or both of the anti-EFN-γ or anti-TNF-α.
6.4.3. Cytokine Expression of Stimulated Spleen Cells:
[00516] The level of cytokine secretion by the spleen cells of mice can also be assessed for control and vaccinated C57B1/6 mice. Spleen cells are stimulated for 24 hours with SL8 or LLO190. Stimulation with irrelevant peptide HSV-gB2 (Invitrogen, SSIEFARL) is used as a control. The supernatants of the stimulated cells are collected and the levels of T helper- 1 and T helper 2 cytokines are determined using an ELISA assay (eBiosciences, CO) or a Cytometric Bead Array Kit (Pharmingen).
6.4.4. Assessment of Cytotoxic T cell Activity:
[00517] The OVA specific CD8+ T cells can be further evaluated by assessing their cytotoxic activity, either in vitro or directly in C57B1/6 mouse in vivo. The CD8+ T cells recognize and lyse their respective target cells in an antigen-specific manner. In vitro cytotoxicity is determined using a chromium release assay. Spleen cells of naive and Listeria-OYA (internal) vaccinated mice are stimulated at a 10:1 ratio with either irradiated EG7.OVA cells (EL-4 tumor cell line transfected to express OVA, ATCC, Manassas, VA) or with 100 nM SL8, in order to expand the OVA specific T cells in the spleen cell population. After 7 days of culture, the cytotoxic activity of the effector cells is determined in a standard 4-hour 5lCr-release assay using EG7.OVA or SL8 pulsed EL-4 cells (ATCC, Manassas, VA) as target cells and EL-4 cells alone as negative control. The YAC-I cell line (ATCC, Manassas, VA) is used as targets to determine NK cell activity, in order to distinguish the activity due to T cells from that due to NK cells. The
percentage of specific cytotoxicity is calculated as 100 x (experimental release - spontaneous release) / (maximal release - spontaneous release). Spontaneous release is determined by incubation of target cells without effector cells. Maximal release is determined by lysing cells with 0.1% Triton X-100. Experiments are considered valid for analysis if spontaneous release is < 20% of maximal release.
[00518] For the assessment of cytotoxic activity of O VA-specific CD8+ T cells in vivo, spleen cells from naive C57B1/6 mice are split into two equivalent aliquots. Each group is pulsed with a specific peptide, either target (SLS) or control (HSV-gB2), at 0.5 μg/ml for 90 minutes at 370C. Cells are then washed 3 times in medium, and twice in PBS + 0.1% BSA. Cells are resuspended at 1 x 107 per ml in warm PBS + 0.1% BSA (10 ml or less) for labeling with carboxyfluorescein diacetate succinimidyl ester (CFSE, Molecular Probes, Eugene, OR). To the target cell suspension, 1.25 μL of a 5mM stock of CFSE is added and the sample mixed by vortexing. To the control cell suspension, a tenfold dilution of the CFSE stock is added and the sample mixed by vortexing. The cells are incubated at 37 0C for 10 minutes. Staining is stopped by addition of a large volume
(>40 ml) of ice-cold PBS. The cells are washed twice at room temperature with PBS, then resuspended and counted. Each cell suspension is diluted to 50 x 106 per ml, and 100 μL of each population is mixed and injected via the tail vein of either naϊve or vaccinated mice. After 12-24 hours, the spleens are harvested and a total of 5 x 106 cells are analyzed by flow cytometry. The high (target) and low (control) fluorescent peaks are enumerated, and the ratio of the two is used to establish the percentage of target cell lysis. The in vivo cytotoxicity assay permits the assessment of lytic activity of antigen-specific T cells without the need of in vitro re-stimulation. Furthermore, this assays assesses the T cell function in their native environment.
6.5. EXAMPLE 5: /Ar VIVO Eph A2 EFFICACY STUDIES
6.5.1. Background
[00519] Efficacy studies were performed in mice inoculated with CT26 tumor cells expressing the extracellular domain (ED) of human EphA2 in order to characterize the anti-tumor effect of huEphA2. Endpoints measured were tumor volume and percent survival of the mice after tumor inoculation. The routes of inoculation were subcutaneous (s.c.) and intravenous (Lv.). HBSS and Listeria were administered as controls.
6.5.2. Control Vaccinations With AH1-A5-ExDressingZisfr?r&g
[00520] Balb/c mice (n=5) were immunized with 0.1 LD50 Listeria 3 days post- i.v. inoculation of 1 x 105 CT26 cells. Figure 9 A demonstrates that therapeutic immunization with Listeria expressing AH1-A5 increases survival of the inoculated animals. Figure 9B shows the result of a separate but otherwise equivalent experiment in which lungs of the experimental mice were harvested on Day 19 following cell inoculation and fixed. Gross assessment of lung nodules was also performed, demonstrating the absence of tumors in the lungs of test animals receiving Listeria- AH1/A5 as compared to control animals receiving a Listeria control.
6.5.3. Prophylactic Eph A2 Vaccinations
6.5.3.1. Effect of Immunization with Listeria Expressing ECD of huEphA2 on CT26-hEphA2 Tumor Growth and Survival
[00521] Preventive studies were performed utilizing a pool of CT26 cells expressing huEphA2 generated by the single cell FACS assays described above. Groups of ten Balb/c mice per group were inoculated s.c. and groups of five mice per group were inoculated i.v. with CT26 colon carcinoma cells transfected with human EphA2 ("CT26- hEphA2"). The mice were immunized with 0.1 LD50 Listeria control or Listeria expressing the ECD of hEphA2 in a 200μl bolus. For the studies entailing s.c. inoculations with CD26, AH1/A5 Listeria were used as a positive control. The immunizations were performed 14 and 4 days prior to CT26-hEphA2 tumor challenge. Tumor volume measurements were obtained twice weekly for the course of the study to determine an anti-tumor effect of the vaccinations.
[00522] Figure 1OA demonstrates the anti-tumor efficacy of Listeria expressing the
ECD of hEphA2 against s.c. inoculations of huEphA2-expressing CT26 cells as compared to the negative controls (*p=0.0012). The data are summarized in Table 8 below: TABLE 8
ECD of hEphA2 against i.v. inoculations of huEphA2-expressing CT26 cells as compared to the negative controls *p=0.0017). The data are summarized in Table 9 below: TABLE 9
[00524] Preventive studies were performed according to the schedule described below. These studies utilized a pool of CT26 cells expressing huEρhA2 generated by the single cell FACS assays described above.
[00525] Groups: Eight groups often mice per group. Groups 1-4 were inoculated s.c. and groups 5-8 were inoculated i.v. with CT26 colon carcinoma cells transfected with human EphA2, as shown in Table 10 below:
TABLE 10
[00526J Schedule: Animals received i.v. administrations of the agents listed above
1 in 200μl bolus on Day 0 and Day 10. On Day 14, animals were inoculated with CT26 colon carcinoma cells transfected with human EphA2 ("CT26-huEphA2") either subcutaneously or intravenously (experimental lung metastases model). Tumor volume was measured bi-weekly (s.c inoculation only) and animal weights assessed on a weekly basis. Any animals possessing tumors greater than 2000 mm3 or demonstrating signs of morbidity (hunched posture, impaired breathing, decreases mobility, greater than 20%
weight loss, etc.) were humanely euthanized. The experimental schedule is summarized in Table 11 below: TABLE 11
[00527] In this study, vaccination with Listeria-hυEphA2 exFlag demonstrated a significant anti-tumor effect in both the s.c. and experimental lung metastases models (i.v.). In the s.c. model, a significant reduction in tumor growth was achieved with 3 mice remaining tumor-free. This response was also specific compared to the control Listeria and vehicle treated animals. In the experimental lung metastases model, vaccination with Listeria huEphA2-exFlag also demonstrated efficacy compared to the vehicle treated group.
[00528] Figures 1 IA-I ID illustrate results of the preventive experiments. Figure
1 IA shows that the tumor volume of mice inoculated with CT26-huEphA2 cells following vaccination with Listeria expressing the ECD of huEphA2 ("Listeria ECD huEphA2") was significantly reduced when compared to vaccination with vehicle (HBSS), Listeria (DP- L4029) and Listeria positive (DP-L4029-AH1) controls. This effect can be observed starting at day 21 and continuing until day 32. Figure HB also depicts results of the preventive experiments, showing again that the tumor volume of mice inoculated with CT26-huEphA2 cells following vaccination with Listeria expressing the ECD of huEphA2 (DP-L4029-EphA2 exFlag) was significantly reduced when compared to the Listeria (DP- L4029) control starting at day 21 and continuing until day 32 post inoculation. Figure HC illustrates the results of the prevention study in the s.c. model, measuring the percent survival of mice vaccinated with the indicated Listeria strains or vehicle control post CT26-huEphA2 tumor cell inoculation. Compared to all control groups (Le., HBSS
control, Listeria (DP-L4029) control, Listeria positive (DP-L4029-AH1) control), the DP- L4029-EphA2 exFlag group had the most significant survival rate (indicated by triangles). Figure 1 ID illustrates the results of the prevention study in the lung metastases model, measuring the percent survival of mice vaccinated with the indicated Listeria strains or vehicle control post CT26-huEphA2 tumor cell inoculation. Compared to all control groups, the DP-L4029-EphA2 exFlag group had the most significant survival rate. [00529] The foregoing data demonstrate that preventative immunization with
Listeria expressing the ECD of human EphA2 suppresses CT26-huEphA2 tumor growth and increases survival.
6.5.3.2. Effect of Immunization with Listeria Expressing ICD of huEphA2 on the Survival of Mice Inoculated with RenCa-hEph A2
[00530] Figure 12 presents the data from preventive studies performed utilizing a pool of RenCa cells (American Type Culture Collection, Manassas, VA) expressing huEphA2 generated and screened by the methods described above. Groups often Balb/c mice per group were inoculated subcutaneously with RenCa renal cell carcinoma cells expressing human EphA2 ("RenCa-hEphA2 cells")- The mice were immunized with 0.1 LD50 Listeria control or Listeria expressing the ICD of hEphA2 in a 200ml bolus. The immunizations were performed 18 and 4 days prior to RenCa-hEphA2 cell tumor challenge. Tumor volume measurements were obtained twice weekly for the course of the study to determine an anti-tumor effect of the vaccinations.
[00531] Figure 12 demonstrates the anti-tumor efficacy of Listeria expressing the
ICD of hEphA2 against s.c. inoculations of huEphA2-expressing RenCA cells as compared to the negative controls. A significant anti-tumor response, as assessed by increased survival via Kaplan-Meier analysis, was observed in animals vaccinated with Listeria expressing the ICD of hEphA2 as compared to animals vaccinated with Listeria alone (*p=O.OO79).
6.5.4. Therapeutic EphA2 Vaccinations
[00532] Therapeutic studies were performed utilizing a pool of CT26 cells expressing huEphA2 ("CT26-huEphA2) generated by the single cell FACS assays described above. [00533] A representative therapeutic study was performed as follows:
[00534] Groups: Six groups of ten mice per group. Groups 1-3 were inoculated s.c. and groups 4-6 were inoculated i.v. with CT26 murine colon carcinoma cells, as shown in Table 12 below: TABLE 12
[00535] Schedule: Animals were inoculated with CT26 colon carcinoma cells transfected with human EphA2 ("CT26-huEphA2") prior to vaccination with Listeria expressing the ECD of huEphA2 (DP-L4029-EphA2 exFIag), Listeria control (DP-L4029- control) or vehicle (HBSS) (5 xlO5 cells in 100ml volume). Three days after CT26- huEphA2 tumor cell inoculation subcutaneously or intravenously (experimental lung metastases model), animals received i.v. administrations of the agents listed above (Table 12) in 200ml bolus. Two weeks following the first administration, the animals received a booster vaccination. Tumor volume was measured bi-weekly (s.c inoculation only) and animal weights assessed on a weekly basis. Any animals possessing tumors greater than 2000 mm3 or demonstrating signs of morbidity (hunched posture, impaired breathing, decreases mobility, greater than 20% weight loss, etc.) were humanely euthanized. The schedule is summarized in Table 13 below. TABLE 13
[00536] Figures 13A-13C illustrate the results of a typical therapeutic study. In
Figure 13 A, tumor volume was measured at several intervals post inoculation with CT26- huEphA2. Compared to the HBSS vehicle and Listeria controls, the mice vaccinated with Listeria expressing the ECD of huEphA2 had a significantly lower tumor volume after day 14 and continued onto day 28. Figure 13B depicts the mean tumor volume of mice inoculated with CT26-huEphA2 tumor cells followed by vaccination with either Listeria control or Listeria expressing the ECD of huEphA2 ("Listeria-ECD-huEphA2"). Compared to the controls, the mice vaccinated with Listeria-ECD-huEphA2 had a reduced mean tumor volume. Figure 13C represents the results of the therapeutic study using the lung metastases model, measuring percent survival of the indicated groups of mice post inoculation with CT26-huEphA2 tumor cells. Animals vaccinated with Listeria expressing the ECD of huEphA2 (depicted by triangles) showed a higher percent survival rate compared to controls. [00537] In another study, groups of ten Balb/c mice per group were inoculated s.c. or ϊ.v. with CT26 colon carcinoma cells transfected with human EphA2 ("CT26- huEphA2"). The mice were immunized with 0.1 LD50 act A Listeria control or Listeria expressing the ICD of huEphA2 in a 200μl bolus. In one regimen, the immunizations were performed 6 and 14 days post s.c. CT26-huEphA2 tumor inoculation. In another regimen, the immunizations were performed 3 and 14 days post i.v. CT26-huEphA2 tumor inoculation. Anti-tumor efficacy was determined from twice weekly tumor measurements and survival.
[00538] Significant anti-tumor efficacy was observed in the Listeria-tiEphA2 vaccinated animals (p=0.0035). [00539] Figure 14A demonstrates the tumor measurements of immunized animals.
This data is summarized in Table 14 below: TABLE 14
[00540] Figure 14B demonstrates the survival time of immunized animals. This data is summarized in Table 15 below: TABLE 15
[00541] In Figure 14C, immunization of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors with recombinant Listeria encoding OVA.AH1 (MMTV gp70 immunodominant epitope) (filled squares) or OVA.AH1-A5 (MMTV gp70 immunodominant epitope, with heteroclitic change for enhanced T-cell receptor binding) (open squares) confers long-term survival relative to vehicle (open circles) and Listeria control (filled triangles).
[00542] Figure 14D shows percent survival data comparing vaccination with the indicated Listeria strains in mice challenged with CT26.24 (huEphA2+) tumor cells. The EphA2 CO domain is strongly immunogenic, and a significant long term increase in survival of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors was observed when immunized with recombinant Listeria encoding codon-optimized or native EphA2 CO domain sequence (Figure 14D).
[00543] The EphA2 EX2 domain is poorly immunogenic, and increased survival of
Balb/C mice bearing CT26.24 (huEphA2+) lung tumors was observed only when immunized with recombinant Listeria encoding codon-optimized secAl signal peptide fused with the codon-optimized EphA2 EX2 domain sequence. Therapeutic efficacy was not observed in mice when immunized with recombinant Listeria encoding native secAl signal peptide fused with the codon-optimized EphA2 EX2 domain sequence (Figure
14E). The desirability of using both codon-optimized secAl signal peptide and EphA2
EX2 domain sequences was supported by statistically significant therapeutic anti-tumor efficacy, as shown in the table below:
[00544] A comparison by log-rank test of survival curves shown in Figure 14E and summarized in Table 16 below:
TABLE 16
[00545] Significantly, even though pCDNA4-EphA2 plasmid transfected 293 cells yielded very high levels of protein expression, immunization of Balb/C mice bearing CT26.24 (huEphA2+) lung tumors with the pCDNA4-EphA2 plasmid did not result in any observance of therapeutic anti-tumor efficacy (Figure 14F).
[00546] For therapeutic in vivo tumor studies, female Balb/C mice were implanted
IV with 5 x 105 CT26 cells stably expressing EphA2. Three days later, mice were randomized and vaccinated IV with various recombinant Listeria strains encoding EphA2. In some cases (noted in figures) mice were vaccinated with 100 μg of pCDNA4 plasmid or pCDNA4-EphA2 plasmid in the tibialis anterior muscle. As a positive control, mice were vaccinated IV with recombinant Listeria strains encoding O VA. AHI or OVA.AH1-A5 protein chimeras. Mice were vaccinated on days 3 and 14 following tumor cell implantation. Mice injected with Hanks Balanced Salt Solution (HBSS) buffer or unmodified Listeria served as negative controls. All experimental cohorts contained 5 mice. For survival studies mice were sacrificed when they started to show any signs of stress or labored breathing.
[00547] The foregoing data demonstrate that therapeutic immunization with Listeria expressing hEphA2 suppresses established CT26-hEphA2 tumor growth and increases survival.
6.6. EXAMPLE 6: Long-term Suppression of CT26-hEphA2 Tumor Growth Upon Rechallenge
[00548] Balb/c mice failing to form tumors after preventative immunization with
Listeria expressing either the ICD or ECD of hEphA2 against CT26-hEphA2 tumor challenged, were re-challenged (s.c.) with both CT26 parental cell line and CT26-hEphA2 cells on opposite flanks 56 days after initial tumor challenge and 60 days after the last immunization. Age-matched mice were used as a control in this experiment. [00549] Re-challenge with parental CT26 cells showed no statistically significant differences in tumor growth between groups (data not shown). However, as shown in Figure 15, both groups vaccinated with Listeria expressing either the ICD or ECD of hEphA2 demonstrated a significant suppression of tumor growth upon re-challenge (*p<0.041).
6.7. EXAMPLE 7: Immunization with Listeria Expressing hEphA2 Elicits an EphA2-Specific CD8+ T Cell Response [00550] Balb/c mice (n=3) were immunized with Listeria lAβ IT expressing the intracellular domain of hEphA2 (hEphA2-ICD) or ΔactA expressing codon optimized extracellular domain of hEphA2 (hEphA2-ECD) two weeks apart. Mice were euthanized, and spleens harvested and pooled 6 days after the last immunization. For the ELISPOT assay, the cells were re-stimulated in vitro with P815 cells expressing full-length hEphA2 or cell lysates prepared from these cells. The parental P815 cells or cell lysates served as a negative control. Cells were also stimulated with recombinant hEphA2 Fc fusion protein. EFN-gamma positive spot forming colonies (SFCs) were measured using a 96 well spot reader. [00551] As shown in Figure 16, increased IFN-gamma SFCs were observed with spleen cells derived from mice vaccinated with L/s/er/α-hEphA2. Both hEphA2 expressing cells or cell lysates stimulation resulted in an increase in IFN-gamma SFC which suggests an EphA2-specific CD8+ as well as CD4+ T cell response. Spleen cells from mice vaccinated with the parental Listeria control did not demonstrate an increase in IFN- gamma SFC.
6.8. EXAMPLE 8: Both CD4+ and CD8+ T Cell Responses are Required for Maximal hEphA2-Directed Anti-Tumor Efficacy
[00552] Balb/c mice (n=10) were inoculated i.v. with 2 x 105 CT26-hEphA2 on day
0. CD4+ cells and CD8+ T-cells were depleted by injecting 200 μg antϊ-CD4 (ATCC
hybridoma GKl.5) or anti-CD8 (ATCC hybridoma 2.4-3) on Days 1 and 3, which was confirmed by FACS analysis (data not shown). Mice were then immunized i.v. with 0.1 LD50 Listeria L461T expressing hEphA2 ICD on Day 4 and monitored for survival. [00553] As shown in Figure 17, both CD4+ and CD8+ depleted groups failed to demonstrate the degree of anti-tumor response seen in the non-T cell depleted animals. The data are summarized in Table 17 below: TABLE 17
[00554] The foregoing data indicate a requirement for both CD4+ and CD8+ T cells in optimal suppression of tumor growth.
6.9. EXAMPLE 9: Therapeutic Vaccination with Listeria Expressing Human EphA2 ICD Enhances CD45+ Tumor Infiltrate
[00555] Balb/c mice (n=3) were immunized with 0.1 LD50 actA-Listeria control or
Listeria expressing either the ECD or ICD of hEphA2, 6 days post s.c. CT26-hEphA2 tumor inoculation. 9 days post-vaccination, tumors were harvested, fixed in 10% neutral buffered formalin, embedded in paraffin and sectioned at 4 μxn. Microscope slides were prepared from the tumor sections. The tissues on the slides were deparaffinized and rehydrated as follows: 4 changes with xylene, 5 minutes each; 2 changes with absolute alcohol, 5 minutes each; 1 change with 95% alcohol for 5 minutes; 1 change with 70% for 5 minutes; and two changes with distilled water.
[00556] Steam antigen retrieval was performed in a Black and Decker Rice steamer using target antigen retrieval (TAR) solution (DakoCytomation, Carpinteria, CA) using a modification of the manufacture's protocol. The slides were placed into TAR solution preheated to just below boiling temperature and incubated for 20 minutes. The slides were then removed from the TAR solution and allowed to cool at room temperature for 20 minutes, and rinsed twice in TBS assay buffer. [00557] Staining of the slides with biotinylated antibody was performed as follows:
[00558] Endogenous peroxidase was blocked by immersing the slides in solution of
3% hydrogen peroxide in methanol, for 10 minutes, followed with 2 changes of distilled water, 5 minutes each. Protein was blocked by immersing the slides in a solution of 5% Bovine Serum Albumin (BSA) in Ix Tris buffered saline with 0.01% Tween 20 (TBST) for at least 30 minutes.
[00559] After wiping excess BSA solution from the slide, creating a "pool", centered around tissue, the slide was laid flat in humid chamber and biotinylated rat anti- mouse CD45/B220 (Pharmingen) at 1:100 dilution in a solution of 1%BSA/TBST was applied. The slide was incubated in a humid chamber overnight at room temperature with care taken to prevent drying of the tissue sections.
[00560] The next morning, the slides are washed with 2 changes of TBST, the second one lasting 10 minutes. Streptavidin conjugated with either HRP or AP is applied, incubating for 30 minutes at room temp. The slides are washed with two changes of TBST, visualized with an appropriate substrate chromagen (for Strep-HRP, DAB is used). After a wash in distilled water, the slides are counterstained with Mayers Hematoxylin by immersing the slides in dye for 2 minutes. The slides are then washed in running tap water until water runs clear, immersed in bluing agent (Scotts substitute tap water) for 30 seconds, and washed again in tap water. The slides are dehydrated and cleared in graded alcohols through xylene (or xylene substitute) by the following washes: 95% alcohol for 1 minute, 3 changes absolute alcohol for 1 minute each, and 4 changes xylenes for 1 minute each.
[00561] Mounting media is applied to the cover slips (for xylene, DPX mountant is used) and the slides are allowed to dry over night prior to visualization. [00562] The sections were visualized on a Nikon Eclipse E400 and images captured with a Nikon DXM 1200 digital camera (Figure 18A). Data was further normalized to tumor volume (Figure 18B).
[00563] The results demonstrate that tumor associated infiltrating lymphocytes are increased following therapeutic vaccination.
6.10. Example 10: Construction of Listeria Strains Expressing a Plurality of EphA2 Antigenic Peptides
6.10.1. Cloning Vector
[00564] Selected heterologous antigen expression cassette molecular constructs were inserted into an allelic exchange vector, for example the pKS V7 plasmid vector
(Camilli et al., 1993, MoL Microbiol. 8:143-157). The pKSV7 plasmid replicates in both Gram-negative and Gram-positive hosts. The CoIEl origin of replication and ampicillin resistance gene (blά) allow for plasmid construction in E. coli, and the pE194ts origin of replication and chloramphenicol (Cm) acetyltransferase gene (cat) allow for temperature- dependent selection of chloramphenicol-resistant (Cmr) Listeria monocytogenes. At 300C, pKSV7 replicates autonomously in Listeria, whereas at 41°C, the plasmid is unable to replicate in gram-positive hosts. When combined with homologous sequence sufficient to direct recombination with the Listeria chromosome, plamid integrants can be selected in Cm at non-permissive temperatures for plasmid replication. [00565] To produce a monocistronic construct, an EphA2 antigenic expression cassette comprising from 5' to 3' the actA promoter or My promoter, a Shine-Dalgarno sequence, a selected signal peptide sequence, and a selected nucleic acid sequence encoding an antigenic EphA2 peptide was cloned into an allelic exchange vector, for example, the pKS V7 vector. Depending upon the desired location for integration, the casssette was flanked by 921 base pairs at the amino terminus and 1,024 base pairs at the carboxy terminus of actA nucleotide sequence. Alternatively, the cassette is flanked by 1,546 base pairs at the amino terminus and 1,248 base parts at the carboxy terminus of internalin B (inlB) nucleotide sequence. InIB (internalin B) (Gaillard et al., Cell, 65:1127- 1141 (1991); Genbank accession number AL591975 (Listeria monocytogenes strain EGD, complete genome, segment 3/12, inlB gene region: nts. 97008-98963); and Genbank accession number NC003210 (Listeria monocytogenes strain EGD, complete genome, inlB gene region: nts. 457008-458963), each of which is incorporated by reference herein in its entirety). [00566] To produce a bicistronic construct, an EphA2 antigenic expression cassette comprising from 5' to 3' the actA promoter or hly promoter, a Shine-Dalgarno sequence, a first signal peptide sequence, a first nucleic acid sequence encoding an antigenic EphA2 peptide, an intragenic sequence, a Shine-Dalgarno sequence, a second signal sequence (which may or not be different from the first signal sequence), and a second nucleic acid sequence encoding a different antigenic EphA2 peptide than the first nucleic acid sequence is cloned into vector. Depending upon the desired location for integration, the cassette is flanked by 921 base pairs at the amino terminus and 1,024 base pairs at the carboxy terminus of the actA nucleotide sequence. Alternatively, the cassette is flanked by 1,546 base pairs at the amino terminus and 1,546 base pairs at the carboxy terminus of the inlB nucleotide sequence.
[00567] A monocistronic EρhA2 antigenic peptide expression cassette plasmid, a biscistronic EphA2 antigenic peptide expression cassette plasmid or two monocistronic EphA2 antigenic peptide expression cassette plasmids were introduced into the actA'inlB" Listeria strain (Le., DP-L4029m/5 or CERS 382.20) or the actA'inlB' Listeria strain with a mutated prfA (the prfA comprising E77K) by electroporation, according to standard methods for electroporation of Gram positive bacteria.
[00568] Briefly, bacteria electroporated with the EphA2 antigenic peptide expression cassette plasmid were selected by plating on BHI agar media containing chloramphenicol (10 μg/ml) or by plating on VPP (Vegetable Peptone Phosphate, Oxoid Ltd.)/Stp (streptomycin)/Cm agar media and incubated at the permissive temperature of 3O0C. Single cross-over integration into the bacterial chromosome was selected by passaging several individual colonies for multiple generations at the non-permissive temperature of 41°C in media containing chloramphenicol. Finally, plasmid excision and curing (double cross-over) was achieved by passaging several individual colonies for multiple generations at the permissive temperature of 300C in BHI media or VPP media not containing chloramphenicol. Verification of integration of the EρhA2 antigenic peptide expression cassette into the bacterial chromosome was accomplished by PCR, utilizing a primer pair that amplifies a region defined from within the EphA2-antigenic peptide expression cassette to the bacterial chromosome targeting sequence not contained in the plasmid vector construct.
6.10.2. Construction of EphA2 Antigenic Expression Cassette [00569] Monocistronic and bicistronic EphA2 antigenic expression cassettes are produced using recombinant technology known to those skilled in the art. The monocistronic EphA2 antigenic expression cassettes comprise the following ordered elements from 5' to 3': a promoter, a Shine-Dalargno sequence, a nucleotide sequence encoding a signal peptide sequence, and a nucleotide sequence encoding an EphA2 antigenic peptide. Some of the monocistronic EphA2 antigenic expression cassettes comprise the following ordered elements from 5' to 3': a promoter, a Shine-Dalargno sequence, a nucleotide sequence encoding amino acid residues 1 to 100 of Listeria monocytogenes ActA, preferably from Listeria monocytogenes, and a nucleotide sequence encoding an EphA2 antigenic peptide. Table 18 below provides a list of the monocistronic EphA2 antigenic expression cassettes for production.
[00570] The bicistronic EphA2 antigenic expression cassette comprises the following ordered elements from 5' to 3': a promoter, a Shine-Dalgarno sequence, a nucleotide sequence encoding a first signal peptide sequence, a nucleotide sequence encoding a first EphA2 antigenic peptide, an intragenic sequence, a nucleotide sequence encoding a second signal peptide sequence (which may be different from the first signal sequence), and a nucleotide sequence encoding a second EphA2 antigenic peptide different from the first EphA2 antigenic peptide. Table 19 below provides a list of the bicistronic EphA2 antigenic expression cassettes for production. Table 18: Monocistronic Expression Cassettes*
179
* All monocistronic EphA2 antigenic expression cassettes contain a Shine-Dalgarno sequence (e.g., SEQ ID NO:112, SEQ ID NO:113, or SEQ ID NO:114) as described supra.
** Locus of insertion into the Listeria chromosomal DNA. For proper insertion into the
Listeria chromosomal DNA, the cassette is flanked by 921 base pairs at the amino terminus and 1,024 base pairs at the carboxy terminus of actA. Alternatively, the cassette is flanked by 1,546 base pairs at the amino terminus and 1,248 base pairs at the carboxy terminus of inlB.
Table 19: Bicistronic Expression Cassettes*
181
* All bicistronic EphA2 antigenic expression cassettes contain a Shine-Dalgarno sequence (e.g., SEQ ID NO:112, SEQ ID NO:113, or SEQ ID NO:114) and an intragenic sequence as described supra.
W
182
** Locus of insertion into the Listeria chromosomal DNA. For proper insertion into the Listeria chromosomal DNA, the cassette is flanked by 921 base pairs at the amino terminus and 1,024 base pairs at the carboxy terminus of actA. Alternatively, the cassette is flanked by 1,546 base pairs at the amino terminus and 1,248 base pairs at the carboxy terminus of inlB.
6.10.2.1. Promoter
[00571] EphA2 antigenic peptide expression cassettes contain the prfA-dependent hly or actA promoter. The prfA-dependent hly promoter drives the transcription of the gene encoding Listeriolysin O (LLO), and is activated within the microenvironment of the infected cell. The prfA-dependent actA promoter drives the transcription of the gene encoding a protein required for intracellular motility, and is activated within the microenvironment of the infected cell.
6.10.2.2. Shine-Dalgarno Sequence
[00572] At the 3' end of the promoter, the EphA2 antigenic peptide expression cassette contains a poly-purine Shine-Dalgarno sequence. This sequence is required for engagement of the 3OS ribosomal subunit (via 16S rRNA) to the heterologous gene RNA transcript and initiation of translation. The Listeria hly gene that encodes listerolysin O (LLO) has the following Shine-Dalgarno sequence (SEQ ID NO: 113) in the 3 'end of the promoter (or 5' UTR) (SEQ ID NO:67): 5'-AAGGAGAGTGAAACCCATG-S' (Shine- Dalgarno sequence is underlined (SEQ ID NO:113), and the translation start codon is bolded). The Listeria actA gene, has the following Shine-Dalgarno sequence (SEQ ID NO:114) in the 3'end of the promoter (or 5' UTR) (SEQ ID NO:109): 5'- CGAGG AGGGAGT AT AAGTG-3 ' (Shine-Dalgarno sequence (SEQ ID NO: 114) is underlined, and the translation start codon is bolded).
6.10.2.3. Signal Sequence
[00573] At the 3' end of the Shine-Dalgarno sequence, the EphA2 antigenic peptide expression cassette contains the BaPa signal sequence, the ActA signal sequence, the usp45 signal sequence, or the p60 signal sequence.
[00574] SEQ ID NO: 1 represents the primary amino acid sequence of the full- length EphA2 antigenic peptide and SEQ ID NO: 2 represents the nucleotide sequence encoding the full-length EphA2 antigenic peptide.
W
183
[00575] SEQ ID NO: 23 represents the primary amino acid sequence of the extracellular domain of human ephA2 (Le., EX2 antigenic peptide) and SEQ ID NO: 21 represents the native nucleotide sequence encoding the EX2 antigenic peptide. [00576] SEQ ID NO: 34 represents the primary amino acid sequence of the intracellular domain of human EphA2 (Le., the CO antigenic peptide) and SEQ ID NO: 32 represents the native nucleotide sequence encoding the CO antigenic peptide. [00577] SEQ ID NO: 88 represents the primary amino acid sequence of the EphA2 antigenic peptide comprising the extracellular and intracellular domains of human EphA2 with the transmembrane domain deleted and a substitution of lysine to methionine at amino acid reside 646 (i.e., EID antigenic peptide).
[00578] The optimal codons in Listeria monocytogenes for each of the 20 amino acids are utilized for codon-optimization of the FL, EX2, CO and EID antigenic peptides. The nucleic acid sequences encoding codon-optimized EphA2 EX2, CO, and EED antigenic peptides are synthesized by extension of overlapping oligonucleotides, using techniques common to those skilled in the art. The expected sequence of all synthesized EphA2 constructs is verified by nucleotide sequencing. BLUE HERON (Blue Heron Biotechnology, Bothell, WA) is a proprietary algorithm used to genereate Lm expression optimized sequences of the desired cDNA for cloning. BLUE HERON was used to match codon utilization in Lm and to reduce secondary structure in nascent transcripts that impede translational efficiency.
6.10.3. Preparation of Electrocompetent Lm
[00579] Electrocompetent Listeria monocytogene strains were prepared by penicillin G and lysozyme treatment of mid-log phase cultures grown in VPP (Vegetable Peptone Phosphate, Oxoid Ltd.) containing 0.5M sucrose.
6.10.4. Selection of recombinant Lm
[00580] Competent Listeria monocytogenes (i.e., strain CERS 382.20) were electroporated with recombination plasmids using a 1 kV pulse at 400 ohm and 25 μFd capacitance. Electroporated bacteria were allowed to recover for at least one hour in VPP/0.5 M sucrose prior to plating on VPP/Strp200/Cm7.5. After 48 hours at 300C, individual Cmr colonies were streaked on fresh VPP/Strp/Cm and cultured another 48 hours at 300C. A single colony from each 300C plate was used to inoculate 10 mL VPP broth supplemented with 10 μg/mL Cm (VPP/CmlO). After shaking overnight at 300C,
plasmid DNA was prepared from approximately 9 mL culture and analyzed by restriction digestion. Once the plasmid was confirmed by restriction analysis, the remainder of each 3O0C culture was split 1:1000 and passaged twice at 410C in VPP/CmlO for selection of plasmid integrants. Each second 410C passage was streaked on fresh VPP/CmlO plates for a third and final round of selection at the non-permissive temperature for plasmid replication. Based on previous experience, three passages at 41°C in the presence of Cm were assumed to be adequate for selection of Lm with recombination plasmids successfully integrated into the chromosome. [00581] Several rounds of non-selective passages were required to complete the removal of plasmid vector sequences. A single colony from each 410C plate was used to inoculate 10 mL VPP without Cm and cultured overnight at 300C. Each culture was split 1:1,000 in fresh VPP, cultured overnight at 300C, and then repeated for a total of 3-6 nonselective passages. Cultures from non-selective passaging were plated on VPP, cultured overnight at 37°C, and individual colonies screened for Cm-sensitivity by replicate plating on VPP and VPP/CmlO. Cm5 colonies were analyzed for EphA2 insertions by PCR.
6.10.5. Listeria Strains Produced
[00582] Listeria strains with indicated epitope(s) are produced by introducing into the bacterial chromosomal DNA the monocistronic or bicistronic expression cassette listed in Table 20 below at the indicated locus (construct number refer to those in Table 18 and 19):
Table 20
S28D and S28R refer to mutations in the p60 signal peptide
[00583] The following Listeria strains were produced by introducing into the bacterial chromosomal DNA two monocistronic expression cassettes into the indicated loci:
Table 21
[00584] Figures 2OA and 2OB show a schematic of the cassettes, and their nucleotide sequences which were introduced into a single Listeria strain by sequential chromosome integration into the respective loci to give rise to
ActA(N 100)ExmonoComono-EGD. Figure 2OA shows the flanking nucleotide sequence (plain text) necessary for homologous recombination into the actA locus and the nucleotide sequence of the actA promoter and 5' UTR (plain text), sequence coding for the first 100 amino acids of ActA (bold text), and sequence coding for the EρhA2 extracellular domain (italics text). The nucleotide sequence for the actA promoter, 5' UTR and ActA- NlOO were cloned from the Listeria monocytogenes strain EGD. Figure 2OB shows the flanking nucleotide sequence necessary for homologous recombination into the inlB locus (plain text), sequence of the My promoter (plain text), sequence coding for the BaPA signal peptide (bold text), and sequence coding for the human EphA2 intracellular domain.
[00585] Figures 2OC and 2OD show a schematic of the cassettes, and their nucleotide sequences which were introduced into a single Listeria strain by sequential chromosome integration to give rise to ActA(N100)Comono Exmono. [00586] Figures 2OD and 2OE show a schematic of the cassettes, and their nucleotide sequences which when introduced into a single Listeria strain give rise to Comono Exmono.
[00587] Figures 43 A-B and 44A-B show a schematic of the cassettes, and their nucleotide sequences which were introduced into a single Listeria strain (i.e., CERS 382.20) by sequential chromosome integration into the respective loci to give rise to ActA(N100)ExmonoComono (i.e., MEDI-543). Figure 43A shows the nucleotide sequences of the actA promoter (SEQ ID NO:85), 5'UTR (plain text) including the Shine- Dalgarno sequence (underlined text) (SEQ ID NO: 114), sequence coding for the first 100 amino acids of ActA of Listeria monocytogenes L0403S (SEQ ID NO:110) (bold text) from Listeria monoctygenes strain 10403 S, and sequence coding for the EphA2 extracellular domain (italicized text). The corresponding amino acid sequences encoded by the expression cassette are indicated in one letter amino acid code (SEQ ID NO: 104). Listeria monocytogenes recognize the "GTG" three-letter codon for valine corresponding to the GUG translation initiation site of the ActA N-terminus and insert a methionine in the first position instead of valine. Figure 44 shows the nucleotide sequences of the My promoter (SEQ ID NO: 111), Shine-Dalgarno sequence (bolded text) (SEQ ID NO: 113), sequence coding for the BaPA signal peptide (shaded text), and sequence coding for the human EphA2 intracellular domain (underlined text).
[00588] The ActA(N100)ExmonoComono Listeria strain comprises integration of human EρhA2 ECD into the actA locus and human EphA2 ICD into the MB locus using a selection process consisting of two homologous recombination. The the
ActA(N 100)ExmonoComono Listeria strain was generated by first inserting the ICD expression cassette into the inlB locus of the CERS 382.20 strain via homologous recombination mediated by the pKSVinlB-BaPA EphA2CO plasmid, which contains upstream and downstream sequences flanking the MB locus required for recombination. Positive clones were chosen to undergo another round of homologous recombination to integrate the human EphA2 ECD expression cassette into the actA locus mediated by the pKSVactAN100-ExEphA2 plasmic, which contains the upstream and downstream flanking sequences of the actA locus required for recombination.
[00589] Figure 45 shows the nucleotide sequences of the expression cassette comprising the My promoter (SEQ ID NO: 111) including the 5'UTR and Shine-Dalgarno sequence, BaPA signal peptide, and human EphA2 ECD domain. [00590] Plasmid integration occurred following recombination at temperatures non-permissive for Gram-positive plasmid replication in the presence of Cm (see Figure 35). The resulting Cmr intermediates contained one or more plasmid copies integrated into the bacterial chromosome and were therefore merodiploid with respect to regions flanking the EphA2 insertion. Plasmid sequences were excised from merodiploid strains when cultured under non-selective conditions that favor a second recombination event. The resulting Cm-sensitive (Cms) strains were screened for the EphA2 inserts by PCR and secretion confirmed by Western blot of TCA-precipitated culture supernatants. Derivation and maintenance of CERS 382.20 and all EphA2-expressing stains were performed in animal product-free medium (Vegetable Peptone Phosphate, Oxoid, Ltd.).
6.10.5.1. Constructs to Generate ActA(N100)ExmonoComono Listeria strain
[00591] The pKSVActAN100-ExEphA2 (Figure 36) and pKSVinlB-BaPA
EphA2CO (Figure 37) were constructed for sequential genomic integration into the actA' inlB' Listeria strain CERS 382.20 to generate ACtA(Nl 00)ExmonoComono. The pKSVActAN100-ExEphA2 plasmid was constructed by cloning a codon-optimized ECD DNA fragment into the BamHI-SacI sites of the pKSVactANlOO plasmid, which was generated as described herein (see section 6.10.1). The pKSVActAN100-ExEphA2 plasmid contains the upstream and downstream sequences of the actA locus to facilitate homologous recombination of the coding sequence for a fusion protein comprising the ECD fused at the N-terminus to the first 100 amino acids of ActA into the actA. locus. [00592] The pKSVinlB-BaPA EphA2CO plasmid was generated from the pAM-
BaPA EphA2CO and pKS V-inlBKS plasmids. First, the condon-optimized EphA2 ICD DNA fragment was cloned into the pAM-BaPA plasmid using the BamHI-SacI cloning sites to construct the pAM-BaPA EphA2CO. Next, a Kpnl-Sacl fragment containing EphA2 ICO was isolated from the pAM-BaPA EphA2CO plasmid and cloned into the Kpnl-Sacl sites of pKSV-inlBKS to generate the pKSVinlB-BaPA EphA2CO plasmid.
Murine Counterpart of ActA(N100)ExmonoComono
[00593] The pKSVActAN100-MuEphA2ExFLAG and pKSVinlB-MuEphA2CO plasmids (see Figures 38, 41, and 42) were constructed for sequential genomic integration
into the actA'inlB' Listeria strain CERS 382.20 to generate the murine counterpart of ActA(Nl 00)ExmonoComono, which expresses the ECD domain of murine EphA2 linked to a FLAG epitope and the ICD domain of murine EphA2. The pKS VActANlOO- MuEphA2ExFLAG plasmid was constructed by cloning a murine ECD-FLAG fusion protein into the BamHI-SacI sites of pKSVactANlOO (see section 6.10.1). The murine EphA2 ECD was amplified from a Listeria monocytogenes expression optimized full- length murine EphA2 construct using reverse primer that included sequences encoding the FLAG epitope DYKDDDDK (SEQ DD NO:X) to yield a DNA fragment encoding murine ECD-FLAG fusion protein (Figures 41 A-C). Full-length murine EphA2 was optimized for expression in Lm by the BLUE HERON algorithm (Blue Heron Biotechnology, Bothell, WA).
[00594] The pKSVinlB-MuEphA2CO plasmid was generated in several steps
(Figure 38). First, the murine EphA2 ICD was amplified from the full-length expression- optimized murine EphA2 described above and inserted into the BamHI-SacI sites of pPL2-BaPA to construct the intermediate pPL2 BaPA-MuEphA2CO. The murine EphA2 ICD expression cassette (see Figures 38B and 42A-B) consisting of the hly promoter, BaPA signal peptide and murine EphA2 ICD was subcloned from pPL2 BaPA MuEphA2CO into pKSVinlBKS as a Kpnl-Sacl fragment to complete construction of pKSVinlB-MuEphA2CO. the pPL2-BaPA plasmid was constructed by cloning a Kpnl- BamHI DNA fragment of the hly promoter and BaPA signal peptide into the pPL2 plasmid.
Parent Constructs
[00595] The pKSVdlHindlll-actA plasmid (Figure 36) was constructed by first removing the HindIII site from pKSV7 followed by insertion of the 1092 bp and 1037 bp of sequences upstream and downstream of the act A locus into the EcoRl site of pKSV7. Removing the HindIII site was achieved by filling in Hindlll-digested DNA with DNA polymerase I Klenow fragment followed by intramolecular ligation. The sequence upstream and downstream of the actA locus were amplified from the wild-type, phage- cured Lm strain DP-L4056 and spliced together using Splicing by Overlap Extension PCR (SOE-PCR). The SOE-PCR product was then cloned into pKS V7.
[00596] To construct the pKSVactA-BaPA plasmid, a Hindlll-SacII fragment containing the actA promoter upstream of the BaPA signal peptide and BamHI-XhoI-SacI cloning site were synthesized and inserted into the Hindlll-SacII sites of pKSVdlHindlll-
actA plasmid. The pKSVactA-BaPA plasmid was used to construct the pKSVactANlOO plasmid. A piece of DNA containing the actA promoter and coding sequence for the first 100 amino acids of the ActA gene was amplified from DP-L4056 and cloned into the Hindlll-BamHΪ sites of pKSVactA-BaPA. Thus, pKSVactANlOO does not contain the BaPA signal peptide.
[00597] The pKS V-inlBKS plasmid (Figure 37) was generated by cloning the upstream and downstream sequences flanking the inlB locus required for homologous recombination into the pKS V7 plasmid. The upstream and downstream sequences flanking the inlB locus were amplified from DP-L4056 genomic DNA and spliced together by SOE-PCR. Kpnl and Sad restrictions sites were engineered into SOE-PCR primers to facilitate insertion of the EphA2 expression cassettes. The SOE-PCR product was digested with Spel and Mfel and ligated to pKS V7 digested with EcoRI and Xbal to yield. An endogenous Sad site was removed from the inlB flanking region by oligonucleotide mediated mutagenesis. [00598] Selected heterologous antigen expression cassette molecular constructs were inserted into pPL2 (Lauer et. al. J. Bacteriol. 2002) or pAM401-MCS, a pAM401 (Wirth et. al., J. Bacteriol. 165:831-836) plasmid modified to contain the multiple cloning sequence of pPL2 (see section 6.2.3). The pAM-BaPA plasmid was constructed by inserting a Kpnl-BamHI DNA fragment containing the hly promoter and Lm expression optimized BaPA signal peptide into the Kpnl-BamHI sites of pAM401-MCS.
6.10.6. Detection of synthesized and secreted heterologous proteins by Western blot analysis
[00599] Expression of EphA2 protein was assessed in the supernatants of the various Listeria strains grown in culture. Synthesis of EphA2 protein and secretion from various selected recombinant Listeria-EphA2 strains were determined by Western blot analysis of trichloroacetic acid (TCA) precipitated bacterial culture fluids. Briefly, fresh overnight cultures of candidate Listeria monocytogenes strains grown in yeast extract medium with (YE) or without (YNG) glucose were used to inoculate 50 mL fresh medium and cultured at 37°C to late-log phase (OD600 = 0.8). Late-log phase cultures of Listeria were collected in a 50 mL conical centrifuge tube, the bacteria were removed by centrifugation and 3 mL of ice-cold TCA was added to the bacterial culture supernatant and incubated on ice minimally for 90 min or overnight. The TCA-precipitated proteins were collected by centrifugation at 2400 X g for 20 min at 4°C. The pellet was washed 5
times with acetone and then air-dried. The pellet was then resuspended in 300-600 μl volume of TE, pH 8.0 containing 15 μg/ml phenol red. Sample dissolution was facilitated by vortexing. Sample pH was adjusted by NH4OH addition if necessary until color was pink. All samples were prepared for electrophoresis by addition of 100 μl of 4X SDS loading buffer and incubating for 10 min. at 900C. The samples were then centrifuged from 5 min at 14,000 rpm in a micro-centrifuge, and the supernatants collected and stored at -200C. For Western bolt analysis, 20 μl of prepared fractions (the equivalent of culture fluids from of 1-4 x 109 bacteria), were loaded on the 4-12% SDS-PAGE gel or NuPAGE 7% Tris-acetate gell (Invitrogen Corp.), electrophoresed, and the proteins were transferred to nitrocellulose or PDDF membrane, according to common methods used by those skilled in the art. Transferred membranes were prepared for incubation with antibody, by incubating in 5% dry milk in PBS for 2 hr. at room temperature with agitation. Antibodies were used under the following dilutions in PBST buffer (0.1% Tween 20 in PBS): (1) Rabbit anti-Myc polyclonal antibody (ICL laboratories, Newberg, Oregon) at 1:10,000; (2) murine anti-FLAG monoclonal antibody (Stratagene, ibid) at 1:2,000; (3) Rabbit anti- EphA2 (intracellular domain-specific) C-20 polyclonal antibody (cat. no. sc-924, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at 1:200 or 1:100; and (4) Rabbit anti-ActA polyclonal antibody at 1:200 or 1:500. Specific binding of antibody to protein targets was evaluated by secondary incubation with goat anti-rabbit or anti-mouse antibody conjugated with horseradish peroxidase and detection with the ECL chernilumenescence assay kit (Amersham), and exposure to film.
6.10.6.1. Secretion of EphA2 protein by recombinant Listeria encoding Full-length EphA2 and Bicistronic EphA2
[00600] Full-length EphA2 constructs and bicistronic EphA2 constructs were analyzed by Western Blot for secretion of EphA2. Figure 21 shows the results of the
Western blot analysis of TC A-precipitated bacterial culture fluids of the Listeria strains.
This analysis demonstrated that recombinant Listeria engineered to contain a heterologous monocistronic protein expression cassette comprised of native sequences corresponding to full-length EphA2 or bicistronic protein expression cassette comprised of sequences corresponding to EphA2 CO and EphA2 EX2 secreted EphA2-specific fragments of expected molecular weight.
Table 22
6.10.6.2.Secretion of EphA2 Intracellular Domain by Dual Monocistronic Listeria Strains
[00601] Dual monocistronic vaccine strains of Listeria encoding EphA2 intracellular domain and extracellular domain sequences were assessed for their ability to secrete the EphA2 ICD.
[00602] Figure 22 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria encoding the EphA2 ICD and ECD on separate monocistronic constructs. [00603] This analysis demonstrated that the dual monocistronic vaccine Listeria strains can produce a secreted EphA2.
6.10.6.3. Secretion of EphA2-ActA(N100) Fusions from Dual Monocistronic Listeria Strains
[00604] Dual monocistronic vaccine strains of Listeria encoding EphA2 intracellular domain and extraceullar domain sequences were assessed for their ability to secrete an EphA2 fragment. The first 100 amino acids of the native ActA was fused genetically with either the EphA2 ICD or ECD as described above.
[00605] Figure 23 shows the results of a Western blot analysis of TCA-precipitated bacterial culture fluids of Listeria strains encoding ActA-NlOO fusions from dual monocistronic constructs. The ActA-N100 fusions were detected with an ActA polyclonal antibody.
[00606] This analysis demonstrated that the both the ICD and ECD can be secreted by the Listeria strains.
6.10.6.4. Secretion of murine and human EphA2 ICD from Dual Monocistronic Listeria Strains
[00607] Figure 39 shows the results of a Western blot analysis of secreted protein from recombinant Listeria {i.e., ACtA(Nl 00)ExmonoComono) encoding both the human EphA2 ICD and the human EphA2 ECD fused to ActA(Nl-100). TCA-precipitated
supernatants from mid-log cultures of ActA(N100)ExmonoComono (MEDI-543) were analyzed for expression of ICD with C20 polyclonal antibody (Santa Cruz). The 46 kDa protein corresponding to the ICD is marked with an arrow.
[00608] Figure 40 shows the results of a Western blot analysis of secreted ICD from recombinant Listeria (Le., murine counterpart of ActA(NlOO)ExmonoComono) encoding both the murine EphA2 ICD and the murine EphA2 ECD fused to ACtA(Nl- 100) and a FLAG tag. TCA-precipitated supernatants from mid-log cultures of the indicated Listeria clones were analyzed for expression of murine EphA2 ICD with C20 polyclonal antibody (Santa Cruz, Santa Cruz, CA). The 48 kDa protein corresponding to murine EphA2 ICD is marked with an arrow. Lanes 1-4 are different clones of the murine counterpart of ActA(N100)ExmonoComono (see Example 10). Lanes 5 and 6 are clones of an intermediate Lm strain containing only the murine EphA2 ICD. Lane 7 is a negative control strain and lane 8 is ActA(N100)ExmonoComono.
6.11. EXAMPLE 11: USE OF IN VIVO EphA2 EFFICACY STUDIES 6.11.1. Background
[00609] Efficacy studies were performed in mice inoculated with CT26 tumor cells expressing the full-length EphA2 in order to characterize the anti-tumor effect of the Listeria strains. CT26 tumor cells expressing the full-length human EphA2 of human EphA2 were prepared as described in U.S. Patent Application Publication No. 2005/0281783, incorporated herein by reference in its entirety. Endpoints measured were tumor volume and percent survival of the mice after tumor inoculation. The routes of inoculation were intravenous (i.v.), intramuscular (i.m.) and subcutaneous (s.c). HBSS and Listeria AHl -A5 (a control strain targeting a self-protein in the CT26 tumor cell line) were administered as controls. The following three Listeria strains expressing two EphA2 antigenic peptides were chosen for further study: ActA(N100)-Comono Exmono comprising the expression cassettes depicted in Figures 2OC and 45; ActA(NlOO)- ExmonoComono comprising the expression cassettes depicted in Figures 43 and 44; and ComonoExmono comprising the expression cassettes depicted in Figures 45 and 2OE.
6.11.2. Prophylactic EphA2 Vaccinations [00610] Effect of Immunization with Monocistronic Dual Loci Listeria on CT26- hEphA2 Tumor Growth. Preventive studies were performed utilizing a pool of CT26 cells expressing huEphA2. Groups of approximately ten female Balb/c mice per group were
immunized at day 0 and day 14 with 0.1 LD50 Listeria control or monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 on separate loci in a 200μl bolus. HBSS was used as a control. AH1/A5 Listeria were used as a positive control. Four days later the mice were subject to CT26-hEphA2 tumor challenge by inoculation s.c. in the right flank with 5 x 105 CT26 colon carcinoma cells transfected with human EphA2 ("CT26- huEphA2"). Tumor volume measurements were obtained twice weekly for the course of the study to determine an anti-tumor effect of the vaccinations.
[00611] Figure 24A demonstrates the anti-tumor efficacy of i. v. administration of 5 x 106 CFU of monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 against s.c. inoculations of huEphA2-expressing CT26 cells as compared to the negative controls. Day 0 on Figure 24A represent the day of tumor challenge. Rapid tumor growth was observed in the H-BSS and Listeria-coxύxol groups. The animals immunized with Listeria-hEτphA2 ActA(N100)ExmonoComono, L£støriα-liEphA2-ComonoExmono, or
ComonoExmono all demonstrated a significant suppression of tumor growth compared to the vehicle control. Figure 24B represents the tumor volume measurements taken from the individual animals on day 21 in this experiment. LV. administration is statistically significant compared to HBSS.
[00612] Figure 25 demonstrates the anti -tumor efficacy of i.m. administration of 5 x
107 CFU of monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 against s.c. inoculations of huEphA2-expressing CT26 cells as compared to the negative controls. The data represent the tumor volume measurements taken from the individual animals on day 21 in this experiment. The animals immunized with Z,«/er/α-hEphA2 ActA(N 100)ExmonoComono, Lwfena-hEphA2-ComonoExmono, or Zisteπα-hEphA2- AcIA(Nl 00)-ComonoExmono all demonstrated a significant suppression of tumor growth compared to the vehicle control. Significant efficacy was demonstrated with i.m. administration at a higher dose.
[00613] The foregoing data demonstrate that preventative immunization with monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 suppresses CT26-hEphA2 tumor growth. A greater than 50% decrease in tumor formation was demonstrated.
6.11.3. Therapeutic EphA2 Vaccinations
[00614] Therapeutic studies were performed utilizing CT26 cells derived from a clone expressing huEphA2. Groups of approximately ten female Balb/c mice per group
W
194
were challenged by inoculation s.c. in the right flank with 2 x 105 - 5 x 105 CT26- huEphA2. Once tumor volume reached ~3Omm3, the mice were immunized twice with 5 x 106 CFU of the various monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 on separate loci or vehicle control (HSBB) i.v. at two week intervals. Tumor volume measurements were obtained twice weekly for the course of the study to determine an anti-tumor effect.
[00615] Figure 26A demonstrates the anti-tumor therapeutic efficacy of i.v. administration of 5 x 106 CFU of monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 as compared to the negative controls. Rapid tumor growth was observed in the HBSS and Listeria-contioϊ groups. The animals immunized with Listeria-hEphA2 ActA(N100)ExmonoComono demonstrated a significant suppression of tumor growth. Listeria- AH1/A5 is the positive control group which demonstrates tumor regression. Figure 26B represents the tumor volume measurements taken from the individual animals on day 27 in this experiment. Figure 26C represents the results of the therapeutic study, measuring percent survival of the mice post inoculation with CT26 cells with either HBSS or Listeria control, or Listeria huEphA2-ActA(N100)ExmonoComono strains. Mice treated with monocistronic dual loci Listeria showed a higher percent survival rate compared to controls. [00616] The foregoing data demonstrate that therapeutic immunization with monocistronic dual loci Listeria expressing the ICD and ECD of hEphA2 suppresses
CT26-hEphA2 tumor growth and increases survival. A greater than 50% suppression in tumor growth was demonstrated.
6.11.4. Pose Down of L/^eπa-EphAl-ActA(N100)ExmonoComono [00617] A dose down study was performed using the therapeutic model described above. Groups of ten female Balb/c mice per group were challenged by inoculation s.c. in the right flank with 5 x 105 CT26-huEphA2. Once tumor volume reached ~30mm3, the mice were immunized twice with 5 x 103, 5 x 104, 5 x 105, 5 x 106, or 1 x 107 CFU of Listeria-EphA2 -ActA(N 100)ExmonoComono strain or vehicle control (HSBB) i.v. at two week intervals. Tumor volume measurements were obtained twice weekly for the course of the study to determine optimal dosing.
[00618] Figure 27 represents the tumor volume measurements taken from the individual animals on day 27 in this experiment. Rapid tumor growth was observed in the
HBSS and Listeria-contxol groups. The animals immunized with Listeria-hEphA2 ActA(N100)ExmonoComono demonstrated a significant suppression of tumor growth. [00619] A dose down study was also performed using the therapeutic model using s.c. administration of the Listeria strain. Groups of ten female Balb/c mice per group were challenged by inoculation s.c. in the right flank with 5 x 105 CT26-huEphA2. Once tumor volume reached ~30mm3, the mice were immunized twice with 5 x 104, 5 x 105, or 5 x 106 CFU of Listeria-EphA2 ACtA(N 100)ExmonoComono strain or vehicle control (HSBB) i.v. at two week intervals. Tumor volume measurements were obtained twice weekly for the course of the study to determine optimal dosing. [00620] Figure 28A demonstrates the anti-tumor therapeutic efficacy of s.c. administration of Listeria-hυEphA2 ActA(N100)ExmonoComono as compared to the negative controls. Rapid tumor growth was observed in the HBSS and Zister/α-control groups. The animals immunized with Zi_?teπα-hEphA2 ActA(N100)ExmonoComono demonstrated a significant suppression of tumor growth. Figure 28B represents the tumor volume measurements taken from the individual animals on day 28 in this experiment. [00621] Efficacy was observed at 5 x 105 and 5 x 106 CFU.
6.12. EXAMPLE 12: Safety of ϋs/erc"α-huEphA2-ActA(N100) ExmonoComono
6.12.1. LD50 Assessment Following I.V. Administration [00622] LD50 was assessed in Balb/C and C57B1/6 mice following i.v. administration of IxIO7, 2xlO7, 5xlO7, 1 x 108, 2xlO8, 5xlO8 CFUs of L/^er/α-huEphA2- ActA(N 100)ExmonoComono. Parameters were weight loss, morbidity and mortality. [00623] The results are shown in Table 23.
Table 23. LD50 Assessments with ActA(N100)ExmonoComono Following LV. Administration
[00624] Based on the data, the log LD50 (cfii) in both strains of mice was calculated to be 7.61 giving a LD50 of ~4 x 107 CFU, comparable to that obtained with the platform strain.
6.12.2. MTD Assessment Following S.C. Administration [00625] Maximum tolerated dose (MTD) was assessed in Balb/C mice following s.c. administration of IxIO3, IxIO5, IxIO7, IxIO9 CFUs. The Listeria huEphA2 actA(Nl- 100)Exmono Comono was administered at two sites with the dose split in half for each site. Parameters were clinical chemistry, hematology, weight loss, morbidity and mortality. [00626] At the highest dose of 1 x 109 CFU, some skin lesions and enlarged spleens were observed 1 and 7 days post-administration. No gross changes in hematology nor clinical chemistries were observed at any dose levels compared to control groups.
6.13. EXAMPLE 13: Routes of Administration Assessed by Immunogenicity Studies [00627] S.c, i.d., i.m., and Lv. routes of administration were compared in immunogenicity studies. In one experiment, Balb/c mice were immunized twice at a 14 day interval with 103, 10s, or 107 CFUs of the strain ActA(N100)ExmonoComono expressing two hEphA2 antigenic peptides using one of the following four routes of administration (ROAs): i.v., i.d., s.c, or i.m. In a second experiment, Balb/c mice were immunized twice at a 14 day interval with 103, 10s, or 107 CFUs of the strain
ActA(N100)ComonoExmono-expressing hEphA2 using one of the following two routes of administration (ROAs): i.v., or i.m. Mice were euthanized and spleens harvested and pooled 7 days after the first or last immunizations. ELISPOT assays and ICS assays were performed as described in Example 4. For the ELISPOT and ICS assays, cells were re- stimulated with the immunodominant LLO peptide 91-99. IFN- γ positive spot forming colonies (SFCs) were measured using a 96- well spot reader. For the ICS, IFN-γ was measured by FACS.
[00628] The results are shown in Figures 29A-D for ACtA(Nl 00)ExmonoComono and Figures 30A-D for ActA(N100)ComonoExmono. In both assays, and with both Listeria strains, splenocytes from hEphA2 vaccinated mice demonstrated an LLO specific T cell response. Ih the case of all routes except for i.v., a dose response was observed. Responses between s.c, i.m., and i.d. are comparable. For the i.v. ROA, the response
appears to be maximal at the dose levels examined. Lower doses may be needed to show a dose response.
6.14. EXAMPLE 14: Epitope Discovery
[00629] To determine a minimal epitope(s) as a candidate for use as an antigenic peptide in the constructs of the invention, an overlapping peptide library comprising 241 peptides was tested using ELISPOT assays as described in sections 5.5 and 5.5.4. Each consecutive peptide represents a walk of 4 amino acids down the EphA2 sequence. [00630] EUSPOT assays
[00631] Balb/c mice were vaccinated Lm. with 100 μg vector comprising coding sequence for full-length EphA2 without the transmembrane domain (pcDNA-ECD/ICD), a vector comprising coding sequence for the EphA2 ICD (pcDNA-3.1-ICD), or a null vector (pcDNA3.1). The mice were immunized four times at one to two week intervals plus boosts. [00632] Whole mouse spleens were harvested and pooled five days after the final immunization. 2 x 105 spleen cells in 135 μl culture medium (a modification of Eagle's medium (Life Technologies, Eggenstein, Germany) supplemented with 10% FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1 x 10"5 M 2-ME, and 2 mM glutamine) were added in nitrocellulose-backed 96-well microtiter plates coated with rat anti-mouse IFN- γ mAb in each well. 1 μm of the individual peptides confirmed later by pools from the peptide library was added to the well and incubated 18-20 hours in a 37°C incubator. [00633] 100 μl or 10 μl of cell suspension (4 x 105/well or 4 x 104/well, respectively) is transferred to Ab-coated ELISPOT plates and incubated overnight at 37°C. In the ELISPOT plates, the final volume was adjusted to 150 μl to ensure homogenous distribution of cells. [00634] Purified CD4+ or CD8+ T cells were tested in a modified assay as follows:
15 μl prediluted peptide (I x 10'5 M) was directly added to Ab-coated ELISPOT plates and mixed with 4 x 105 splenocytes from nonimmune animals as APC to yield a final volume of 100 μl. After 4 h of preincubation of APC at 37°C, 1 x 105 CD4+ or CD8+ cells purified from L. monocytogenes-immune mice were added per well in a volume of 50 μl and plates are incubated overnight at 37°C. After overnight incubation at 370C, ELISPOT plates were developed with biotin-labeled rat anti-mouse IFN- γ mAb, HRP streptavidin conjugate, and aminoethylcarbazole dye of spots per splenocytes seeded. The specificity
W
198
and sensitivity of the ELISPOT assay was controlled with IFN- γ secreting CD8 T cell lines specific for a control antigen. [00635] ICS assays
[00636] ICS assays were performed as described in Brocks tedt et al., 2004, PNAS 38:13832-13837.
[00637] Results
[00638] Multiple (three) ELISPOT analyses identified four putative peptides from the peptide library. Peptide 231 identified in the ELISPOT analyses was also predicted to be a minimal CD8+ T cell epitope. Figure 31 confirms that peptide 231, within the intracellular domain, is an immunodominant peptide. Figure 32 shows that the epitope overlaps with peptide 230. The sequences of these peptides are provided below: [00639] Peptide 230 KMQQYTEHFMAAGYT 917-931 (SEQ ID NO: 100)
[00640] Peptide 231 YTEHFMAAGYTAIEK 921-935 (SEQ ID NO: 101)
[00641] Figure 33 shows CD4 and CD8 depletion using Peptides 230 and 231. The absence of any spots on CD4 depleted plates demonstrates that the response against these peptides is CD4+ specific. Figure 34 shows ICS results that confirm a CD4 response for Peptide 231.
[00642] The results show that peptides containing an immunodominant epitope of
EphA2 may be useful in the constructs of the present invention. Thus, an EphA2 antigenic peptide can be Peptide 230 or Peptide 231. A sequence encompassing both of these peptides (as shown below) is also believed to be useful as an EphA2 antigenic peptide. [00643] KMQQYTEHFMAAGYTAIEK 917-935 (SEQ ID NO: 102)
7. Equivalents
[00644] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
[00645] All publications, patents and patent applications mentioned in this specification are herein incorporated by reference into the specification to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference.
Claims
1. A nucleic acid comprising an act A promoter operatively linked to a nucleotide sequence encoding an EphA2 antigenic peptide.
2. The nucleic acid of claim 1 , wherein the EphA2 antigenic peptide is a fusion protein comprising a BaPA signal peptide, a BsphoD signal peptide, a p60 signal sequence or a LI usp45 signal peptide.
3. The nucleic acid of claim 1, wherein the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1-100 of actA.
4. The nucleic acid of claim 2, wherein the EphA2 antigenic peptide is a fusion protein comprising amino acid residues 1-100 of actA.
5. The nucleic acid of claim 1, 2, 3 or 4, wherein the EphA2 antigenic peptide comprises the extracellular domain of EphA2.
6. The nucleic acid of claim 1, 2, 3 or 4, wherein the EphA2 antigenic peptide comprises the intracellular domain of EphA2.
7. The nucleic acid of claim 1 , 2, 3 or 4, wherein the EphA2 antigenic peptide comprises the extracellular and intracellular domains of EphA2 and lacks the transmembrane domain of EphA2.
8. The nucleic acid of claim 7, wherein the EphA2 antigenic peptide has a substitution of lysine to methionine at amino acid residue 646 of EphA2.
9. A nucleic acid comprising an hly promoter operatively linked to a nucleotide sequence encoding an EphA2 antigenic peptide, wherein the EphA2 antigenic peptide is a fusion protein comprising a BaPA signal peptide, a BsphoD signal peptide, a p60 signal sequence or a LI usp45 signal peptide.
10. The nucleic acid of claim 9, wherein the EphA2 antigenic peptide comprises amino acid residues 1-100 of actA.
11. The nucleic acid of claim 9 or 10, wherein the EphA2 antigenic peptide comprises the extracellular domain of EphA2.
12. The nucleic acid of claim 9 or 10, wherein the EphA2 antigenic peptide comprises the intracellular domain of EphA2.
13. The nucleic acid of claim 9 or 10, wherein the EphA2 antigenic peptide comprises the extracellular and intracellular domains of EphA2 and lacks the transmembrane domain of EphA2.
14. The nucleic acid of claim 13, wherein the EphA2 antigenic peptide has a substitution of lysine to methionine at amino acid residue 646 of EphA2.
15. A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 103 or 117.
16. A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 115, 94 or 98.
17. A Listeria bacterium comprising the nucleic acid of claim 1, 2, 3, 4, 9 or 10.
18. The Listeria bacterium of claim 17 which is attenuated.
19. A Listeria bacterium comprising a first nucleic acid comprising the nucleotide sequence of SEQ ID NO: 103 or 117.
20. A Listeria bacterium comprising a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 115, 94 or 98.
21. The Listeria bacterium of claim 19 further comprising a second nucleic acid comprising the nucleotide sequence of SEQ ID NO: 115, 94 or 98.
22. The Listeria bacterium of claim 19 or 20 which is attenuated.
23. The Listeria bacterium of claim 21 which is attenuated.
24. The Listeria bacterium of claim 22, wherein the bacterium is attenuated in its tissue tropism.
25. The Listeria bacterium of claim 22, wherein the bacterium is attenuated in its ability to spread from cell to cell.
26. The Listeria bacterium of claim 22, wherein the bacterium is attenuated in its ability to spread from cell to cell and in its tissue tropism.
27. The Listeria bacterium of claim 23, wherein the bacterium is attenuated in its tissue tropism.
28. The Listeria bacterium of claim 23, wherein the bacterium is attenuated in its ability to spread from cell to cell.
29. The Listeria bacterium of claim 23, wherein the bacterium is attenuated in its ability to spread from cell to cell and its tissue tropism.
30. The Listeria bacterium of claim 29 comprising a mutation in actA.
31. The Listeria bacterium of claim 29 comprising a mutation in internalin (inlA).
32. The Listeria bacterium of claim 29 comprising a mutation in actA and inlA.
33. The Listeria bacterium of claim 30 or 32, wherein the first nucleic acid is integrated into the actA locus.
34. The Listeria bacterium of claim 31 or 32, wherein the second nucleic acid is integrated into the inlA locus.
35. The Listeria bacterium of claim 32, wherein the first nucleic acid is integrated into the actA locus and the second nucleic acid is integrated into the inlB locus.
36. An immunogenic composition comprising: (i) the bacterium of claim 17; and (ii) a pharmaceutically acceptable carrier.
37. An immunogenic composition comprising: (i) the bacterium of claim 22; and (ii) a pharmaceutically acceptable carrier.
38. An immunogenic composition comprising: (i) the bacterium of claim 23, 29 or 35; and (ii) a pharmaceutically acceptable carrier.
39. A method of eliciting an immune response against an EphA2-expressing cell in a subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 17.
40. A method of eliciting an immune response against an EphA2-expressing cell in a subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 22.
41. A method of eliciting an immune response against an EphA2-expressing cell in a subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 23, 29 or 35.
42. The method of claim 39, wherein the subject has cancer.
43. The method of claim 41, wherein the subject has cancer.
44. The method of claim 39, wherein said cancer is of an epithelial cell origin.
45. The method of claim 41, wherein said cancer is of an epithelial cell origin.
46. The method of claim 39, wherein said cancer is of an endothelial cell origin.
47. The method of claim 41 , wherein said cancer is of an endothelial cell origin.
48. The method of claim 39, wherein said cancer is of a T cell origin.
49. The method of claim 41, wherein said cancer is of a T cell origin.
50. The method of claim 44, wherein said cancer is cancer of the skin, lung, colon, breast, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma.
51. The method of claim 45, wherein said cancer is cancer of the skin, lung, colon, breast, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma.
52. The method of claim 48, wherein said cancer is a leukemia or a lymphoma.
53. The method of claim 49, wherein said cancer is a leukemia or a lymphoma.
54. The method of claim 39, wherein the subject has a non-neoplastic hyperproliferative disorder.
55. The method of claim 41, wherein the subject has a non-neoplastic hyperproliferative disorder.
56. The method of claim 54, wherein the hyperproliferative disorder is an epithelial cell disorder.
57. The method of claim 55, wherein the hyperproliferative disorder is an epithelial cell disorder.
58. The method of claim 56, wherein the hyperproliferative disorder is asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
59. The method of claim 57, wherein the hyperproliferative disorder is asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
60. The method of claim 39, wherein the Listeria is Listeria monocytogenes.
61. The method of claim 41, wherein the Listeria is Listeria monocytogenes.
62. The method of claim 39, wherein said administering is subcutaneous, intravenous, or intradermal.
63. The method of claim 41, wherein said administering is subcutaneous, intravenous, or intradermal.
64. A method of preventing or treating a hyperproliferative disorder of EphA2-expressing cells in a human subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 17 in an amount effective to prevent or treat a hyperproliferative disorder of EphA2-expressϊng cells.
65. A method of preventing or treating a hyperproliferative disorder of EphA2-expressing cells in a human subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 22 in an amount effective to prevent or treat a hyperproliferative disorder of EphA2-expressing cells.
66. A method of preventing or treating a hyperproliferative disorder of EphA2-expressing cells in a human subject in need thereof, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 23, 29 or 35 in an amount effective to prevent or treat a hyperproliferative disorder of EphA2-expressing cells.
61. The method of claim 64, wherein the Listeria is Listeria monocytogenes.
68. The method of claim 66, wherein the Listeria is Listeria monocytogenes.
69. The method of claim 64, wherein the disorder is cancer.
70. The method of claim 66, wherein the disorder is cancer.
71. The method of claim 69, wherein the cancer is of an epithelial cell origin.
72. The method of claim 70, wherein the cancer is of an epithelial cell origin.
73. The method of claim 69, wherein the cancer is of an endothelial cell origin.
74. The method of claim 70, wherein the cancer is of an endothelial cell origin.
75. The method of claim 69, wherein the cancer is of a T cell origin.
76. The method of claim 70, wherein the cancer is of a T cell origin.
77. The method of claim 69, wherein said cancer comprises cells that overexpress EphA2 relative to non-cancer cells having the tissue type of said cancer cells.
78. The method of claim 70, wherein said cancer comprises cells that overexpress EphA2 relative to non-cancer cells having the tissue type of said cancer cells.
79. The method of claim 71, wherein said cancer is cancer of the skin, lung, colon, breast, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma.
80. The method of claim 72, wherein said cancer is cancer of die skin, lung, colon, breast, prostate, bladder or pancreas or is a renal cell carcinoma or melanoma.
81. The method of claim 75, wherein said cancer is a leukemia or a lymphoma.
82. The method of claim 76, wherein said cancer is a leukemia or a lymphoma.
83. The method of claim 64, wherein the disorder is a non-neoplastic hyperproliferative disorder.
84. The method of claim 66, wherein the disorder is a non-neoplastic hyperproliferative disorder.
85. The method of claim 83, wherein the hyperproliferative disorder is an epithelial cell disorder.
86. The method of claim 84, wherein the hyperproliferative disorder is an epithelial cell disorder.
87. The method of claim 85, wherein the hyperproliferative disorder is asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
88. The method of claim 86, wherein the hyperproliferative disorder is asthma, chronic pulmonary obstructive disease, lung fibrosis, bronchial hyper responsiveness, psoriasis, and seborrheic dermatitis.
89. The method of claim 69, further comprising administering an additional anti-cancer therapy.
90. The method of claim 70, further comprising administering an additional anti-cancer therapy.
91. The method of claim 89, wherein the additional anti-cancer therapy is an agonistic EphA2 antibody or an anti-idiotype of an agonistic EphA2 antibody.
92. The method of claim 90, wherein the additional anti-cancer therapy is an agonistic EphA2 antibody or an anti-idiotype of an agonistic EphA2 antibody.
93. The method of claim 89, wherein the additional anti-cancer therapy is chemotherapy, biological therapy, immunotherapy, radiation therapy, hormonal therapy, or surgery.
94. The method of claim 90, wherein the additional anti-cancer therapy is chemotherapy, biological therapy, immunotherapy, radiation therapy, hormonal therapy, or surgery.
95. The method of claim 89, wherein said administering is subcutaneous, intravenous, or intradermal.
96. The method of claim 90, wherein said administering is subcutaneous, intravenous, or intradermal.
97. A method of treating a human subject having a disease involving aberrant angiogenesis, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 17 in an amount effective to treat said disease.
98. A method of treating a human subject having a disease involving aberrant angiogenesis, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 22 in an amount effective to treat said disease.
99. A method of treating a human subject having a disease involving aberrant angiogenesis, said method comprising administering to the subject a composition comprising a Listeria bacterium of claim 23, 29 or 35 in an amount effective to treat said disease.
100. The method of claim 97, wherein the disease is macular degeneration, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, infantile hemangioma, verruca vulgaris, psoriasis, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis or coronary artery disease.
101. The method of claim 98, wherein the disease is macular degeneration, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, infantile hemangioma, verruca vulgaris, psoriasis, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis or coronary artery disease.
102. The method of claim 99, wherein the disease is macular degeneration, diabetic retinopathy, retinopathy of prematurity, vascular restenosis, infantile hemangioma, verruca vulgaris, psoriasis, Kaposi's sarcoma, neurofibromatosis, recessive dystrophic epidermolysis bullosa, rheumatoid arthritis, ankylosing spondylitis, systemic lupus, psoriatic arthropathy, Reiter's syndrome, and Sjogren's syndrome, endometriosis, preeclampsia, atherosclerosis or coronary artery disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2007/005512 WO2007103261A2 (en) | 2006-03-01 | 2007-03-01 | Listeria-based epha2 immunogenic compositions |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US60/778,426 | 2006-03-01 | ||
| PCT/US2007/005512 WO2007103261A2 (en) | 2006-03-01 | 2007-03-01 | Listeria-based epha2 immunogenic compositions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007103261A2 true WO2007103261A2 (en) | 2007-09-13 |
| WO2007103261A3 WO2007103261A3 (en) | 2008-12-04 |
Family
ID=38475444
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/005512 Ceased WO2007103261A2 (en) | 2006-03-01 | 2007-03-01 | Listeria-based epha2 immunogenic compositions |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2007103261A2 (en) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7935804B2 (en) | 2006-03-01 | 2011-05-03 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US9128101B2 (en) | 2010-03-01 | 2015-09-08 | Caris Life Sciences Switzerland Holdings Gmbh | Biomarkers for theranostics |
| US9469876B2 (en) | 2010-04-06 | 2016-10-18 | Caris Life Sciences Switzerland Holdings Gmbh | Circulating biomarkers for metastatic prostate cancer |
| US10799533B2 (en) | 2015-10-23 | 2020-10-13 | Cerus Corporation | Plasma compositions and methods of use thereof |
| CN112533939A (en) * | 2018-08-02 | 2021-03-19 | 苏州若泰医药科技有限公司 | Tumor immunotherapy composition based on attenuated Listeria activated antigen presenting cells, preparation method and application |
| US11096963B2 (en) | 2015-06-26 | 2021-08-24 | Cerus Corporation | Cryoprecipitate compositions and methods of preparation thereof |
| US11235090B2 (en) | 2017-03-03 | 2022-02-01 | Cerus Corporation | Kits and methods for preparing pathogen-inactivated platelet compositions |
| US11554185B2 (en) | 2017-12-29 | 2023-01-17 | Cerus Corporation | Systems and methods for treating biological fluids |
| US11883544B2 (en) | 2019-06-28 | 2024-01-30 | Cerus Corporation | System and methods for implementing a biological fluid treatment device |
| US11897927B2 (en) | 2016-11-30 | 2024-02-13 | Advaxis, Inc. | Immunogenic compositions targeting recurrent cancer mutations and methods of use thereof |
| US12011510B2 (en) | 2019-06-22 | 2024-06-18 | Cerus Corporation | Biological fluid treatment systems |
| US12282015B2 (en) | 2016-12-23 | 2025-04-22 | Cerus Corporation | Systems and methods for testing and screening using compound bound substrates |
| CN121064284A (en) * | 2025-09-04 | 2025-12-05 | 中国农业科学院植物保护研究所 | Non-ribosomal peptide-polyketone-polyamine bactericidal active substance Fcl-8 and application thereof |
| US12514944B2 (en) | 2019-06-22 | 2026-01-06 | Cerus Corporation | Systems and methods for implementing treatment of biological fluids |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1682173A4 (en) * | 2003-10-15 | 2007-10-31 | Medimmune Inc | EPHA2 VACCINES BASED ON LISTERIA |
-
2007
- 2007-03-01 WO PCT/US2007/005512 patent/WO2007103261A2/en not_active Ceased
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7935804B2 (en) | 2006-03-01 | 2011-05-03 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US8580939B2 (en) | 2006-03-01 | 2013-11-12 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US9128101B2 (en) | 2010-03-01 | 2015-09-08 | Caris Life Sciences Switzerland Holdings Gmbh | Biomarkers for theranostics |
| US9469876B2 (en) | 2010-04-06 | 2016-10-18 | Caris Life Sciences Switzerland Holdings Gmbh | Circulating biomarkers for metastatic prostate cancer |
| US11096963B2 (en) | 2015-06-26 | 2021-08-24 | Cerus Corporation | Cryoprecipitate compositions and methods of preparation thereof |
| US12514876B2 (en) | 2015-06-26 | 2026-01-06 | Cerus Corporation | Cryoprecipitate compositions and methods of preparation thereof |
| US10799533B2 (en) | 2015-10-23 | 2020-10-13 | Cerus Corporation | Plasma compositions and methods of use thereof |
| US11897927B2 (en) | 2016-11-30 | 2024-02-13 | Advaxis, Inc. | Immunogenic compositions targeting recurrent cancer mutations and methods of use thereof |
| US12282015B2 (en) | 2016-12-23 | 2025-04-22 | Cerus Corporation | Systems and methods for testing and screening using compound bound substrates |
| US12064537B2 (en) | 2017-03-03 | 2024-08-20 | Cerus Corporation | Kits and methods for preparing pathogen-inactivated platelet compositions |
| US11235090B2 (en) | 2017-03-03 | 2022-02-01 | Cerus Corporation | Kits and methods for preparing pathogen-inactivated platelet compositions |
| US11554185B2 (en) | 2017-12-29 | 2023-01-17 | Cerus Corporation | Systems and methods for treating biological fluids |
| US12214092B2 (en) | 2017-12-29 | 2025-02-04 | Cerus Corporation | Systems and methods for treating biological fluids |
| CN112533939A (en) * | 2018-08-02 | 2021-03-19 | 苏州若泰医药科技有限公司 | Tumor immunotherapy composition based on attenuated Listeria activated antigen presenting cells, preparation method and application |
| CN112533939B (en) * | 2018-08-02 | 2024-03-19 | 苏州若泰医药科技有限公司 | A tumor immunotherapy composition, preparation method and application based on antigen-presenting cells activated by attenuated Listeria monocytogenes |
| EP3838915A4 (en) * | 2018-08-02 | 2022-02-09 | Suzhou Royaltech Med Co., Ltd | TUMOR IMMUNOTHERAPY COMPOSITION BASED ON ANTIGEN-PRESENTING CELLS ACTIVATED BY ATTENUATED LISTERIA MONOCYTOGENES, METHOD FOR PREPARATION AND USE |
| US12011510B2 (en) | 2019-06-22 | 2024-06-18 | Cerus Corporation | Biological fluid treatment systems |
| US12514944B2 (en) | 2019-06-22 | 2026-01-06 | Cerus Corporation | Systems and methods for implementing treatment of biological fluids |
| US12558442B2 (en) | 2019-06-22 | 2026-02-24 | Cerus Corporation | Biological fluid treatment systems |
| US11883544B2 (en) | 2019-06-28 | 2024-01-30 | Cerus Corporation | System and methods for implementing a biological fluid treatment device |
| US12343436B2 (en) | 2019-06-28 | 2025-07-01 | Cerus Corporation | System and methods for implementing a biological fluid treatment device |
| CN121064284A (en) * | 2025-09-04 | 2025-12-05 | 中国农业科学院植物保护研究所 | Non-ribosomal peptide-polyketone-polyamine bactericidal active substance Fcl-8 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007103261A3 (en) | 2008-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20050281783A1 (en) | Listeria-based EphA2 vaccines | |
| WO2007103261A2 (en) | Listeria-based epha2 immunogenic compositions | |
| EP1732580A2 (en) | Epha2 vaccines | |
| Le et al. | Clinical development of listeria monocytogenes–based immunotherapies | |
| EP3548623A1 (en) | Immunogenic compositions targeting recurrent cancer mutations and methods of use thereof | |
| US11896654B2 (en) | DNA monoclonal antibodies targeting checkpoint molecules | |
| CA2724649A1 (en) | Compositions comprising prfa* mutant listeria and methods of use thereof | |
| US20230181706A1 (en) | Fusion proteins comprising modified alpha virus surface glycoproteins and tumor associated antigen and methods thereof | |
| WO2019094607A2 (en) | Immunogenic heteroclitic peptides from cancer-associated proteins and methods of use thereof | |
| KR20160130774A (en) | Biomarker directed multi-target immunotherapy | |
| KR20160122829A (en) | Compositions and methods for the treatment of her2/neu over-expressing tumors | |
| WO2018009461A1 (en) | Listeria-based immunogenic compositions comprising wilms tumor protein antigens and methods of use thereof | |
| Kim et al. | Dendritic cell vaccines for brain tumors | |
| KR20170002552A (en) | Combination immuno therapy and radiotherapy for the treatment of her-2-positive cancers | |
| WO2023235805A2 (en) | Dna-encoded bispecific antibodies targeting carbonic anhydrase 9 and methods of use in cancer therapeutics | |
| EP2804626B1 (en) | Autologous cancer cell vaccine | |
| JP6810877B2 (en) | Cancer treatment with a combination of an oral tumor vaccine and an immunosuppressive inhibitor | |
| US20240158521A1 (en) | DNA-ENCODED BISPECIFIC ANTIBODIES TARGETING IL13Ra2 AND METHODS OF USE IN CANCER THERAPEUTICS | |
| Lin et al. | Enhanced antitumor effect against human telomerase reverse transcriptase (hTERT) by vaccination with chemotactic‐hTERT gene‐modified tumor cell and the combination with anti‐4‐1BB monoclonal antibodies | |
| CN113543800A (en) | DNA monoclonal antibodies targeting PD-1 for treatment and prevention of cancer | |
| CN1893972A (en) | Listeria-based EphA2 vaccine | |
| Hessin et al. | Construction and assessment of a novel vaccine targeting hepatocellular carcinoma | |
| Cuzzubbo et al. | P06. 17. A OPTIC NEUROPATHY RELATED TO IMMUNE CHECKPOINT INHIBITORS: A CASE SERIES | |
| HK40062326A (en) | Dna monoclonal antibodies targeting pd-1 for the treatment and prevention of cancer | |
| Hou et al. | Immunotherapy of tumor by targeting angiogenesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07752226 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 07752226 Country of ref document: EP Kind code of ref document: A2 |





























