WO2007100875A2 - Nac-i as a prognostic marker and a target for therapeutic target in human cancer - Google Patents

Nac-i as a prognostic marker and a target for therapeutic target in human cancer Download PDF

Info

Publication number
WO2007100875A2
WO2007100875A2 PCT/US2007/005218 US2007005218W WO2007100875A2 WO 2007100875 A2 WO2007100875 A2 WO 2007100875A2 US 2007005218 W US2007005218 W US 2007005218W WO 2007100875 A2 WO2007100875 A2 WO 2007100875A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
nac
seq
ovarian
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/005218
Other languages
French (fr)
Other versions
WO2007100875A3 (en
Inventor
Ie-Ming Shih
Tian-Li Wang
Kentaro Nakayama
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Publication of WO2007100875A2 publication Critical patent/WO2007100875A2/en
Anticipated expiration legal-status Critical
Publication of WO2007100875A3 publication Critical patent/WO2007100875A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • NAC-I AS A PROGNOSTIC MARKER AND A TARGET FOR THERAPEUTIC TARGET IN HUMAN CANCER
  • Ovarian carcinoma represents one of such insidious and aggressive cancers. It is the most lethal gynecologic malignancy in women with approximately 25,000 new cases in the United States each year. Despite considerable effort directed at early detection, no cost effective screening tests have been developed and women generally present with disseminated disease at diagnosis.
  • Epithelial ovarian carcinoma is the most common and most lethal of all gynecologic malignancies. Only 30% of ovarian tumors are diagnosed at an early stage (Stage I/II), when survival rates reach 90%. The rest are diagnosed at an advanced stage, with survival rates of less than 20%. Accordingly, the need exists for the identification of novel cancer biomarkers that will allow for detection of cancer, e.g., ovarian cancer. Moreover, the need exists for additional therapeutic targets for the treatment and prevention of cancer.
  • the instant application is based, at least in part, on the discovery that the nucleic acid encoding NAC-I and the NAC-I polypeptide are overexpressed in cancer tissue. Moreover, the NAC-I polypeptide and nucleic acid molecules are overexpressed in recurrent cancer. Accordingly, in one aspect, the invention provides methods for detecting cancer in a subject by detecting the amount of the nucleic acid of SEQ ID NO:1, or a fragment thereof, in a biological sample from the subject, wherein the overexpression of SEQ ID NO:1 is indicative that the subject has cancer. In one embodiment, the amount of the nucleic acid of SEQ ID NO:1 or a fragment thereof, is detected by FISH.
  • the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor.
  • the tumor is a recurrent tumor.
  • the sample is an ovarian tissue sample.
  • the invention provides methods for detecting cancer in a subject by detecting the amount of the polypeptide of SEQ ID NO:2, or a fragment thereof, in a biological sample from the subject, wherein the overexpression of SEQ TD NO:2 is indicative that the subject has cancer.
  • the polypeptide of SEQ ID NO:2 or a fragment thereof is detected by immunohistochemistry.
  • the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor.
  • the tumor is a recurrent tumor.
  • the sample is an ovarian tissue sample.
  • the invention provides methods for detecting the recurrence of cancer in a subject, by detecting the amount of SEQ ID NO:1 in a biological sample from the subject, wherein an overexpression of SEQ ID NO:1 as compared to a control is indicative of a recurrence of cancer.
  • the amount of the nucleic acid of SEQ ID NO:1 or a fragment thereof is detected by FISH.
  • the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor.
  • the tumor is a recurrent tumor.
  • the sample is an ovarian tissue sample.
  • the method further comprises the step of treating the subject based on the recurrence of the cancer.
  • the invention provides methods for detecting a recurrence of cancer in a subject, by detecting the amount of SEQ ED NO:2 in a biological sample from the subject, wherein an overexpression of SEQ ID NO:2 as compared to a control is indicative of a recurrence of cancer.
  • the polypeptide of SEQ ID NO:2 or a fragment thereof is detected by immunohistochemistry.
  • the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor.
  • the tumor is a recurrent tumor.
  • the sample is an ovarian tissue sample.
  • the method further comprises the step of treating the subject based on the recurrence of the cancer.
  • the invention provides, methods of detecting the recurrence of ovarian cancer in a subject by determining the amount of the polypeptide of SEQ ID NO:2 present in a biological sample from the subject, wherein an amount higher than a control level indicates that the subject has a recurrence of ovarian cancer.
  • the invention provides methods for identifying a compound for treating or preventing of cancer comprising, contacting a cell with a test compound, determining if the test compound inhibits the expression of the nucleic acid of SEQ ID NO:1, thereby identifying a compound for the treatment or prevention of cancer.
  • the invention provides methods for identifying a compound for the treatment or prevention of cancer comprising, contacting a cell with a test compound, determining if the test compound inhibits the expression or activity of the polypeptide of SEQ ID NO:2, thereby identifying a compound for the treatment or prevention of cancer.
  • the compound is a small molecule, a peptide, a polypeptide, or a nucleic acid molecule.
  • the peptide or polypeptide is an antibody or fragment thereof
  • the nucleic acid molecule is an siRNA, shRNA, antisense nucleic acid, or ribozyme.
  • the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer, hi a specific embodiment, the cancer is ovarian cancer.
  • the invention provides methods of treating or preventing cancer in a subject by administering to a subject a compound that inhibits the expression or activity of a nucleic acid of SEQ ID NO : 1 or a polypeptide of SEQ ID NO:2, thereby treating the subject.
  • the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer.
  • the cancer is ovarian cancer.
  • the compound is selected from the group consisting of a small molecule, a peptide, a polypeptide, and a nucleic acid molecule, hi a related embodiment, the peptide or polypeptide is an antibody or fragment thereof, hi another related embodiment, the nucleic acid molecule is an siRNA, shRNA, antisense nucleic acid, or ribozyme.
  • the invention provides kits comprising an antibody, or fragment thereof, for use in determining the amount of the polypeptide of SEQ ID NO:2 in a sample and instructions for use.
  • the kit further comprises a control, hi another embodiment, the kit is for the diagnosis of cancer. In a related embodiment, the kit is for determining the recurrence of cancer, e.g., ovarian, lung, liver or breast cancer.
  • the invention provides kits comprising a nucleic acid probe for use in determining the amount of the nucleic acid of SEQ ID NO:1 in a sample and instructions for use.
  • the kit further comprises a control, hi another embodiment, the kit is for the diagnosis of cancer, hi a related embodiment, the kit is for determining the recurrence of cancer, e.g., ovarian, lung, liver or breast cancer, hi another embodiment, the probe comprises a label.
  • the invention further provides antibodies that specifically recognizes NAC-I .
  • the antibodies are monoclonal antibodies, e.g., mouse monoclonal antibodies.
  • the antibodies are produced by the hybridoma deposited as accession number .
  • NAC-I expression level is analyzed by counting NAC-I specific tags from SAGE libraries in both cancer tissue (T, solid symbols) and the corresponding normal tissues (N, open symbols).
  • the NAC-I tags are normalized to tags per 100,000 (y-axis).
  • the dash line in each tumor type indicates the "ceiling" tag number in normal tissue libraries. Each symbol represents an individual specimen.
  • Figures 2A-F depicts the immunoreactivity of NAC-I in ovarian cancer tissues.
  • A Immunoprecipitation/ Western blot analyses using NAC-I and V5 antibodies in RK3E cells transfected with pCDNA6-NAC-l/V5 (RK3E-C1) or vector only control (Vec). A discrete band corresponding to NAC-I protein mass is identified in this reciprocal analysis.
  • B-D The NAC-I immunointensity is undetectable or weak in normal ovarian surface epithelium (B) but is strong in a high-grade serous carcinoma (C and D).
  • E, F Immunofluorescence of NAC-I protein localization in ovarian cancer cells in a tissue section.
  • Tumor cells contain NAC-I protein, which is located in discrete nuclear bodies (E).
  • E discrete nuclear bodies
  • the adjacent stromal cells are negative for NAC-I immunoreactivity.
  • a higher magnification demonstrates the NAC-I nuclear bodies using a confocal fluorescence microscope (F).
  • G Ultrastructure of NAC-I bodies. Immunogold labeling of NAC-I expressing RK3E cells demonstrates electron-dense bodies decorated by gold particles in the nuclear matrix.
  • Figures 3A-C depict NACl expression correlates with tumor progression in ovarian serous carcinomas.
  • B: Quantitative real-time PCR analysis shows higher NAC-I expression levels in high-grade carcinomas (HG) than in ovarian surface epithelial cells (OSE), low-grade carcinomas (LG) and cystadenomas. Moreover, recurrent carcinomas have significantly higher expression levels than primary tumors (p 0.012). The data is expressed as fold increase as compared to the average of OSE.
  • Figures 4A-C depict co-immunoprecipitation and co-localization of NAC-I deletion mutants and full-length NAC-I .
  • A Diagram of NAC-I and NAC-I deletion mutants. Full-length (FL) construct contains V5 tag at C-terminus while all the deletion mutants contain Xpress (Xp) tag at N-terminus. Yellow box: BTB/POZ domain; blue box: DUFl 172 domain.
  • B Co-immunoprecipitation shows that full- length NAC-I , Nl 30 and N250 bind to NAC-I .
  • the predicted molecular mass not including the tag sequence are: full-length NAC-I (57.3 Kd) 3 N130 (14.4 Kd), N250 (27.8 Kd), C250 (30.3 Kd), and M120 (14 Kd).
  • C Cells with stable full-length NAC- 1/V5 expression were transfected with different deletion mutants with the Xp tag.
  • Double immunofluorescence shows that full-length NAC-I, N130 and N250 deletion mutants colocalize with full-length NAC-I.
  • full-length NAC-I proteins form discrete round and oval shape NAC-I nuclear bodies while both N130 and N250 form irregular aggregates with the full-length NAC-I .
  • C250 nor Ml 20 colocalizes with the full-length NAC-I protein.
  • Figures 5A-D depicts the effects of N130 induction on cellular proliferation and apoptosis.
  • a & B Cell growth curves show that after induction of N130 (-Dox), cell growth is significantly suppressed as compared to the non-induced cells (+Dox). Li contrast, induction of C250 does not have an apparent effect on cell growth.
  • C Cell cycle analysis shows an increase in G2/M fraction in Nl 30 induced HeLa cells (bottom panel) as compared to non-induced cells (top panel) 24 hours after induction, indicating a G2/M block.
  • D Percentage of apoptotic and proliferating cells are determined by counting annexin V- and BrdU-positive cells, respectively, in both Nl 30 induced and non-induced cells. Data are presented as mean + SD. *, P ⁇ 0.05; **, PO.001, ***, PO.0001, Student's t test.
  • Figures 6A-F depicts constitutive expression of NAC-I in immortalized ovarian surface epithelial cells (MOSE) (A, B & C) and NIH3T3 cells (D and E).
  • MOSE immortalized ovarian surface epithelial cells
  • FIG. 6A-F depicts constitutive expression of NAC-I in immortalized ovarian surface epithelial cells (MOSE) (A, B & C) and NIH3T3 cells (D and E).
  • Western blot analysis shows NAC-I expression in stable clones of NAC-I expressing MOSE cells (A) and NIH3T3 cells (D). Growth curves show a higher proliferation activity in both NAC-I clones as compared to vector transfected control under a low serum (0.5%) culture condition in MOSE cells (A) and NIH3T3 cells (D).
  • the weights of subcutaneous tumors increase in NAC-I expressing MOSE tumors as compared to control MOSE in nude mice (
  • a representative photomicrograph shows a subcutaneous NAC-I expressing MOSE tumor (C). Similarly, the combined tumor weights of tumors in the peritoneal wall of the NAC-I expressing NIH3T3 cells are greater than the controls (E).
  • F Cell proliferation was determined by a BrdU incorporation assay and all NAC-I expressing clones have a higher proliferation rate than the vector only control. Data are presented as mean + SD.
  • Figures 7A-D depict NAC-I immunoreactivity of cervical adenocarcinomas, but not in normal endocervical glands. Cervical adenocarcinomas show neoplastic glands infiltrating into the stroma (A and B). A fragment of benign endocervical tissue demonstrates normal endocervical glands (C) and fails to show detectable NAC- 1 immunoreactivity (D).
  • Figures 8A-C depict the efficiency of N130 induction based on real time PCR (A and B) and cytometry (C).
  • Figures 9A-C demonstrate that the induction of the control C250 mutant did not have significant effects on cellular proliferation in SKO V3 cells or HeLa cells. Expression of N130 significantly suppressed colony formation in both cell lines.
  • Figures 10A-B demonstrate coimmunoprecipitation of Nl 30 deletion mutants and full-length NAC-I protein.
  • Both N65 and N30-122 could not effectively suppress cellular proliferation as compared to N130 (B).
  • FIGS 1 IA-D depict the results of NAC-I gene knock down.
  • NAC-I expressing SKO V3 and HeLa cells had significantly reduced cell number after NAC-I siRNA treatment (A and B).
  • NAC-I siRNA did not show a significant effect on the cell growth of OVCAR3 cells that did not express abundant NAC-I ( Figure 1 IB).
  • Figure 11C we found that the apoptosis-inducing effect of the siRNAs used here was potent, but was less pronounced than the N130 dominant negative NAC-I ( Figure 11C), indicating that the latter approach could be a more effective experimental system to inactivate NAC-I function.
  • Figures 12A-D depict (A) N130 expression in HeLa tumor cells. Interruption of NAC-I homomeric interaction by the N130 deletion mutant almost completely prevents tumor formation (open circles) but not in wild-type (closed circles).
  • B discontinuation of doxycyclin treatment in established tumors results in a decrease in green fluorescent protein, indicating Nl 30 induction.
  • C Tumor volumes did not increase in the N130-induced group (open circle), whereas the control noninduced tumors continue increasing tumor volumes.
  • D Histopathological examination of tumors in both groups reveals an increased apoptotic activity in Nl 30 induced tumors.
  • Figures 13A-B depict Nl 30 expression in SKO V3 tumors in vivo. Expression of the N130 deletion mutant prevents tumor formation in all mice (open circles) but not in SKO V3 cells without Nl 30 induction (closes circles) (A). Nl 30 induction after SKOV3 tumors have established results in a decrease in tumor volumes (open circles) but not in control tumors (closed circles).
  • Figures 14A-B set froth the nucleic acid and polypeptide sequence of NAC-I as SEQ ID NO:1 and SEQ ID NO:2, respectively.
  • Figures 15A-F depict that NAC-I protein expression is upregulated in post- chemotherapy ovarian carcinoma: Two peritoneal effusions showing strong (A) and weak (B) nuclear NAC-I expression.
  • the specimen in A was obtained post- chemotherapy, effusion B prior to the administration of chemotherapy.
  • Reactive cells, mainly lymphocytes, in figure B are negative.
  • Strong NAC-I expression in a post- chemotherapy metastasis to the colon (C), with no expression in a pre-chemotherapy primary tumor (D).
  • Figures 16A-B demonstrate the predictive role of NAC-I in post-chemotherapy effusions.
  • the term "cell-proliferative disorder” denotes malignant as well as nonmalignant populations of transformed cells which morphologically often appear to differ from the surrounding tissue.
  • the cell proliferative disorder is cancer.
  • Transformed cells refers to cell which have spontaneously converted to a state of unrestrained growth, i.e., they have acquired the ability to grow through an indefinite number of divisions in culture. Transformed cells may be characterized by such terms as neoplastic, anaplastic and/or hyperplastic with respect to their loss of growth control.
  • cancer is used to mean a condition in which a cell in a subject's body undergoes abnormal, uncontrolled proliferation.
  • cancer is a cell-proliferative disorder.
  • Non-limiting examples of cancers include breast cancer, ovarian cancer, cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer.
  • administering is defined herein as a means providing the composition to the subject in a manner that results in the composition being inside the subject's body. Such an administration can be by any route including, without limitation, subcutaneous, intradermal, intravenous, intra-arterial, intraperitoneal, and intramuscular.
  • treating a subject or subjecting a subject to “treatment” it is meant that the subject's symptoms are partially or totally alleviated, or remain static following treatment according to the invention.
  • a subject that has been treated can exhibit a partial or total alleviation of symptoms (for example, tumor load).
  • treatment is intended to encompass prophylaxis, therapy and cure.
  • a “therapeutically effective amount” is defined herein an effective amount of composition for producing some desire therapeutic effect.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "effective amount" (ED 50 ) of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • sample is defined herein as blood, blood product, biopsy tissue, serum, and any other type of fluid or tissue that can be extracted from a subject or a mammal.
  • sample and “biological sample” are used interchangeably in this application.
  • a "subject" can be any mammal, e.g., a human.
  • NAC-I polypeptides or nucleic acids encoding NAC-I polypeptides, or portions thereof may act as markers useful in the detection of a cell-proliferative disorder, the monitoring of a cell-proliferative disorder or as targets for treating a cell- proliferative disorder.
  • NAC-I marker refers to a NAC-I polypeptide or a nucleic acid (such as an mRNA) encoding a NAC-I polypeptide.
  • NAC-I polypeptide refers to the full-length NAC-I polypeptide, or fragment thereof.
  • NAC-I polypeptide includes fragments of NAC-I.
  • the NAC-I polypeptide of the invention is encoded by SEQ ID NO:1, or a fragment thereof. In another embodiment, the NAC-I polypeptide of the invention is encoded by a nucleic acid that hybridizes to SEQ ID NO: 1 under stringent conditions.
  • the NAC-I polypeptide comprises the amino acid sequence of SEQ ID NO:2, or a fragment thereof. In another embodiment, the NAC-I polypeptide comprises an amino acid sequence having conservative amino acid substitutions as compared to SEQ ID NO:2, or a fragment of said amino acid sequence.
  • the claimed invention includes the use of variants of the NAC-I polypeptides.
  • Variants of the present invention may have an amino acid sequence that is different by one or more amino acid substitutions to the amino acid sequence disclosed in SEQ ID NO: 2.
  • Embodiments which comprise amino acid deletions and/or additions are also contemplated.
  • the variant may have conservative changes (amino acid similarity), wherein a substituted amino acid has similar structural or chemical properties, for example, the replacement of leucine with isoleucine.
  • Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or proposed pharmacological activity may be reasonably inferred in view of this disclosure and may further be found using computer programs well known in the art, for example, DNAStarTM software.
  • Amino acid substitutions may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as a biological and/or pharmacological activity of the native molecule is retained.
  • Negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, and valine; amino acids with aliphatic head groups include glycine, alanine; asparagine, glutamine, serine; and amino acids with aromatic side chains include tryptophan, phenylalanine, and tyrosine.
  • Identity is a measure of the similarity of nucleotide sequences or amino acid sequences, hi order to characterize the identity, subject sequences are aligned so that the highest percentage identity (match) is obtained, after introducing gaps, if necessary, to achieve maximum percent identity. N- or C-terminal extensions shall not be construed as affecting identity. "Identity” per se has an art-recognized meaning and can be calculated using published techniques. Computer program methods to determine identity between two sequences, for example, include DNAStarTM software (DNAStar Inc. Madison, Wis.); the GCGTM program package (Devereux, J., et al.
  • the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence or amino acid sequence and that gaps in homology of up to about 90% of the total number of nucleotides in the reference sequence are allowed.
  • the NAC-I polypeptide is a variant of SEQ ID NO:2. In one embodiment, the NAC-I polypeptide is at least 99%, 98%, 97%, 96%, 95%, 90%, 85% or 80% identical to SEQ ID NO:2. In another embodiment, the NAC-I polypeptide is encoded by a nucleic acid that is at least 99%, 98%, 97%, 96%, 95%, 90%, 85% or 80% homologous to SEQ ID NO: 1.
  • NAC-I Modulators The present invention also provides NAC-I modulators.
  • the NAC-I modulators are NAC-I antagonists.
  • a "NAC-I antagonist” is any molecule which inhibits the biological or functional effect of naturally occurring NAC-I.
  • a NAC-I antagonist may inhibit the biological or functional effect of naturally occurring NAC-I by any means.
  • a NAC-I antagonist inhibits the biological or functional effect of naturally occurring NAC-I by decreasing the expression or activity of NAC- 1.
  • a NAC-I antagonist inhibits the biological or functional effect of naturally occurring NAC-I by specifically binding to NAC-I.
  • a NAC-I antagonist may be a peptide or a peptidomimetic, an antibody or fragment thereof that binds NAC-I, a nucleic acid molecule, or a small molecule.
  • the invention comprises an isolated antibody or fragment thereof which binds specifically to a NAC-I polypeptide, or fragment thereof.
  • the antibody or fragment thereof binds specifically to a NAC-I polypeptide or fragment thereof encoded by a nucleic acid comprising SEQ ID NO: lor a fragment thereof, or comprising the amino acid sequence of SEQ ID NO:2.
  • the antibody or fragment thereof binds specifically to the extracellular domain of a NAC-I polypeptide.
  • the invention comprises an isolated antibody or fragment thereof which is a NAC-I antagonist.
  • the antibody or fragment thereof further comprises a label, wherein the label is selected from the group consisting of a fluorescent label, a radiolabel, a toxin, a metal compound and biotin.
  • the fluorescent label is selected from the group consisting of Texas Red, phycoerythrin (PE), cytochrome c, and fluorescent isothiocyante (FITC).
  • the radiolabel is selected from the group consisting of 32 P, 33 P 5 43 K, 47 Sc, 52 Fe, 57 Co, 64 Cu, 67 Ga, 67 Cu, 68 Ga, 71 Ge, 75 Br, 76 Br, 77 Br, 77 As, 77 Br, 81 Rb/ 81 MKr, 87 MSr, 90 Y, 97 Ru, 99 Tc, 100 Pd, 101 Rh, 103 Pb, 105 Rh, 109 Pd, 111 Ag, 111 In, 113 In, 119 Sb, m Sn, 123 1, 125 1, 127 Cs, 128 Ba, 129 Cs, 131 1, 131 Cs, 143 Pr, 153 Sm, 161 Tb, 166 Ho, 169 Eu, 177 Lu, 186 Re, 188 Re, 189 Re, 191 Os, 193 Pt, 194 Ir, 197 Hg, 199 Au, 203 Pb, 211 At, 212 Pb, 212 Bi and 213 Bi
  • the toxin is selected from the group consisting of ricin, ricin A chain (ricin toxin), Pseudomonas exotoxin (PE), diphtheria toxin (DT), Clostridium perfringens phospholipase C (PLC), bovine pancreatic ribonuclease (BPR), pokeweed antiviral protein (PAP), abrin, abrin A chain (abrin toxin), cobra venom factor (CVF), gelonin (GEL), saporin (SAP), modeccin, viscurnin and volkensin.
  • ricin ricin A chain
  • PE Pseudomonas exotoxin
  • DT diphtheria toxin
  • PLC Clostridium perfringens phospholipase C
  • BPR bovine pancreatic ribonuclease
  • PAP pokeweed antiviral protein
  • abrin abrin
  • abrin A chain
  • peptides based on the sequence of NAC-I specific antisera or monoclonal antibodies can be made using standard methods.
  • Chickens, or a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., an antigenic fragment which is capable of eliciting an antibody response).
  • Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. For instance, a peptidyl portion of one of the subject proteins can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • antibody producing cells can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Hybridoma cells can be screened irnmunochemically for production of antibodies specifically reactive with the NAC-I polypeptides and the monoclonal antibodies isolated.
  • antibody as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject proteins or complexes including the subject proteins.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab')2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments.
  • the antibody of the present invention is further intended to include bispecific and chimeric molecules, as well as single chain (scFv) antibodies.
  • the subject antibodies include humanized antibodies, which can be prepared as described, e.g., in U.S. Pat. No. 5,585,089.
  • Antibodies of the present invention can be made recombinantly.
  • Linkers may be added to the nucleic acid sequences of the heavy and light chains to increase flexibility of the antibody. In the case of a scFv, the linkers are added to connect the VH and VL chains and the varying composition can effect solubility, proteolytic stability, flexibility, and folding.
  • the invention provides mouse monoclonal antibodies such as those described in the Examples. In one embodiment, the monoclonal antibody recognizes the C-terminal end of NAC-I.
  • One embodiment of the present inventions are peptides, and compositions thereof, which may be used to detect a NAC-I polypeptide or to treat a subject having a disease or disorder characterized by overexpression of NAC-I.
  • Peptides of the present invention can comprise 5-50 amino acid residues. More preferably, peptides of the present invention comprise 5-30 amino acid residues. More preferably, peptides of the present invention comprise 5-20 amino acid residues. More preferably, peptides of the present invention comprise 10-15 amino acid residues.
  • a peptide of the invention is Nl 30 which is described in the examples.
  • Another aspect of the invention provides a peptide or peptidomimetic, e.g., wherein one or more backbone bonds are replaced or one or more side chains of a naturally occurring amino acid are replaced with sterically and/or electronically similar functional groups.
  • the peptide or peptidomimetic is formulated in a pharmaceutically acceptable excipient.
  • the instant invention provides nucleic acid molecules encoding NAC-I, and fragments thereof.
  • the nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 89%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or more identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1, or a portion of any of this nucleotide sequence.
  • nucleic acid molecule of the invention can comprise only a portion of the nucleic acid sequence of SEQ ID NO: 1.
  • the invention further provides antisense oligonucleotides. These are relatively short nucleic acids that are complementary (or antisense) to the coding strand (sense strand) of the rnRNA encoding a particular protein. Although antisense oligonucleotides are typically RNA based, they can also be DNA based. Additionally, antisense oligonucleotides are often modified to increase their stability.
  • the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc.
  • oligonucleotide may be conjugated to another molecule.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxytriethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, S-methoxyaminomethyl ⁇ -thiouracil, beta-D-man
  • the antisense oligonucleotide can also contain a neutral peptide-like backbone.
  • peptide nucleic acid (PNA)-oligomers are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:14670 and in Eglom et al. (1993) Nature 365:566.
  • PNA peptide nucleic acid
  • One advantage of PNA oligomers is their capability to bind to complementary DNA essentially independently from the ionic strength of the medium due to the neutral backbone of the DNA.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an -anomeric oligonucleotide.
  • oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131 -6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
  • Oligonucleotides of the invention maybe synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209)
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
  • an appropriate oligonucleotide can be readily performed by one of skill in the art. Given the nucleic acid sequence encoding a particular protein, one of skill in the art can design antisense oligonucleotides that bind to that protein, and test these oligonucleotides in an in vitro or in vivo system to confirm that they bind to and mediate the degradation of the mRNA encoding the particular protein. To design an antisense oligonucleotide that specifically binds to and mediates the degradation of a particular protein, it is important that the sequence recognized by the oligonucleotide is unique or substantially unique to that particular protein.
  • sequences that are frequently repeated across protein may not be an ideal choice for the design of an oligonucleotide that specifically recognizes and degrades a particular message.
  • One of skill in the art can design an oligonucleotide, and compare the sequence of that oligonucleotide to nucleic acid sequences that are deposited in publicly available databases to confirm that the sequence is specific or substantially specific for a particular protein.
  • the messages may encode related protein such as isoforms or functionally redundant protein.
  • related protein such as isoforms or functionally redundant protein.
  • one of skill in the art can align the nucleic acid sequences that encode these related proteins, and design an oligonucleotide that recognizes both messages.
  • a number of methods have been developed for delivering antisense DNA or
  • RNA to cells e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
  • modified antisense molecules designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA.
  • a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
  • Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive.
  • Such promoters include but are not limited to: the SV40 early promoter region (Bemoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3 r long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al, 1982, Nature 296:39-42), etc.
  • the SV40 early promoter region Bemoist and Chambon, 1981, Nature 290:304-310
  • the promoter contained in the 3 r long terminal repeat of Rous sarcoma virus Yamamoto et al., 1980, Cell 22:787-797
  • plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site.
  • viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systematically).
  • RNAi constructs comprise double stranded RNA that can specifically block expression of a target gene.
  • RNA interference or “RNAi” is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner.
  • dsRNA double-stranded RNA
  • RNAi appears to involve mRNA degradation, however the biochemical mechanisms are currently an active area of research. Despite some mystery regarding the mechanism of action, RNAi provides a useful method of inhibiting gene expression in vitro or in vivo.
  • dsRNA refers to siRNA molecules, or other RNA molecules including a double stranded feature and able to be processed to siRNA in cells, such as hairpin RNA moieties.
  • loss-of-function refers to genes inhibited by the subject RNAi method, refers to a diminishment in the level of expression of a gene when compared to the level in the absence of RNAi constructs.
  • RNAi refers to (indicates) the ability to distinguish which RNAs are to be degraded by the RNAi process, e.g., degradation occurs in a sequence-specific manner rather than by a sequence-independent dsRNA response, e.g., a PKR response.
  • RNAi construct is a generic term used throughout the specification to include small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs.
  • RNAi constructs herein also include expression vectors (also referred to as RNAi expression vectors) capable of giving rise to transcripts which form dsRNAs or hairpin RNAs in cells, and/or transcripts which can produce siRNAs in vivo.
  • RNAi expression vector refers to replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed.
  • Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
  • promoter and other regulatory elements generally varies according to the intended host cell.
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and vector are used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • RNAi constructs contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (i.e., the "target" gene).
  • the double- stranded RNA need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi.
  • the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence.
  • the number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 3 1 end of the siRNA strand that is complementary to the target RNA do not significantly contribute to ⁇ specificity of the target recognition.
  • Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred.
  • the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing).
  • a portion of the target gene transcript e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing.
  • Production of RNAi constructs can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro.
  • RNAi constructs may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties.
  • the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA.
  • bases may be modified to block the activity of adenosine deaminase.
  • RNAi construct may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • Methods of chemically modifying RNA molecules can be adapted for modifying RNAi constructs (see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J MoI Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61).
  • RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2'-substituted ribonucleosides, a- configuration).
  • the double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands.
  • RNA duplex formation may be initiated either inside or outside the cell.
  • the RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
  • the subject RNAi constructs are "small interfering RNAs" or "siRNAs.” These nucleic acids are around 19-30 nucleotides in length, and even more preferably 21-23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease "dicing" of longer double-stranded RNAs.
  • the siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target rnRNA is degraded by the nucleases in the protein complex.
  • the 21- 23 nucleotides siRNA molecules comprise a 3' hydroxyl group.
  • siRNA molecules of the present invention can be obtained using a number of techniques known to those of skill in the art.
  • the siRNA can be chemically synthesized or recombinantly produced using methods known in the art.
  • short sense and antisense RNA oligomers can be synthesized and annealed to form double-stranded RNA structures with 2-nucleotide overhangs at each end (Caplen, et al. (2001) Proc Natl Acad Sci USA, 98:9742-9747; Elbashir, et al. (2001) EMBO J, 20:6877-88).
  • These double-stranded siRNA structures can then be directly introduced to cells, either by passive uptake or a delivery system of choice, such as described below.
  • the siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer.
  • the Drosophila in vitro system is used.
  • dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides.
  • the siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.
  • chromatography e.g., size exclusion chromatography
  • At least one strand of the siRNA molecules has a 3' overhang from about 1 to about 6 nucleotides in length, though may be from 2 to 4 nucleotides in length. More preferably, the 3' overhangs are 1-3 nucleotides in length. In certain embodiments, one strand having a 3' overhang and the other strand being blunt-ended or also having an overhang. The length of the overhangs may be the same or different for each strand. In order to further enhance the stability of the siRNA, the 3' overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • RNAi construct is in the form of a long double- stranded RNA.
  • the RNAi construct is at least 25, 50, 100, 200, 300 or 400 bases.
  • the RNAi construct is 400-800 bases In length.
  • the double-stranded RNAs are digested intracellularly, e.g., to produce siRNA sequences in the cell.
  • use of long double-stranded RNAs in vivo is not always practical, presumably because of deleterious effects which may be caused by the sequence-independent dsRNA response.
  • the use of local delivery systems and/or agents which reduce the effects of interferon or PE-R are preferred.
  • the RNAi construct is in the form of a hairpin structure (named as hairpin RNA).
  • hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature, 2002, 418:38-9; McManus et al., RNA, 2002, 8:842-50; Yu et al., Proc Natl Acad Sci USA 7 2002, 99:6047-52).
  • hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that siRNAs can be produced by processing a hairpin RNA in the cell.
  • a plasmid is used to deliver the double-stranded RNA, e.g., as a transcriptional product.
  • the plasmid is designed to include a "coding sequence" for each of the sense and antisense strands of the RNAi construct.
  • the coding sequences can be the same sequence, e.g., flanked by inverted promoters, or can be two separate sequences each under transcriptional control of separate promoters. After the coding sequence is transcribed, the complementary RNA transcripts base-pair to form the double-stranded RNA.
  • the present invention provides a recombinant vector having the following unique characteristics: it comprises a viral replicon having two overlapping transcription units arranged in an opposing orientation and flanking a transgene for an RNAi construct of interest, wherein the two overlapping transcription units yield both sense and antisense RNA transcripts from the same transgene fragment in a host cell.
  • RNAi constructs can comprise either long stretches of double stranded RNA identical or substantially identical to the target nucleic acid sequence or short stretches of double stranded RNA identical to substantially identical to only a region of the target nucleic acid sequence. Exemplary methods of making and delivering either long or short RNAi constructs can be found, for example, in WOO 1/68836 and WO01/75164.
  • Ribozyme molecules designed to catalytically cleave an mRNA transcript can also be used to prevent translation of mRNA (See, e.g., PCT International Publication WO90/11364, published Oct. 4, 1990; Sarver et al., 1990, Science 247:1222-1225 and U.S. Pat. No. 5,093,246). While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA.
  • target mRNA has the following sequence of two bases: 5'-UG-3'.
  • the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591.
  • the ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes”) such as the one which occurs naturally in Tetrahymena thermophila (known as the TVS, or L- 19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231 :470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216).
  • Cech-type ribozymes such as the one which occurs naturally in Tetrahymena thermophila (known as the TVS, or L- 19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:
  • the Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
  • the invention encompasses those Cech-type ribozymes that target eight base-pair active site sequences.
  • the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and can be delivered to cells in vitro or in vivo.
  • a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • compositions can be used as a composition when combined with a pharmaceutically acceptable carrier or excipient.
  • Pharmaceutically acceptable carriers are physiologically acceptable and retain the therapeutic properties of the antibodies or peptides present in the composition.
  • Pharmaceutically- acceptable carriers are well-known and generally described in, for example, Remington's Pharmaceutical Sciences (18.sup.th Edition, ed. A. Gennaro, Mack Publishing Co., Easton, Pa., 1990).
  • exemplary pharmaceutically acceptable carrier is physiological saline.
  • the instant invention also provides methods of treating a subject using a combination treatment.
  • a NAC-I modulator is used with a chemotherapeutic agent.
  • Chemotherapeutic agents contemplated by the present invention include chemotherapeutic drugs that are commercially available.
  • the chemotherapeutic can be an inhibitor of chromatin function, a topoisomerase inhibitor, a microtubule inhibiting drug, a DNA damaging agent, an antimetabolite (such as folate antagonists, pyrimidine analogs, purine analogs, and sugar-modified analogs), a DNA synthesis inhibitor, a DNA interactive agent (such as an intercalating agent), and/or a DNA repair inhibitor.
  • a DNA damaging agent such as folate antagonists, pyrimidine analogs, purine analogs, and sugar-modified analogs
  • an antimetabolite such as folate antagonists, pyrimidine analogs, purine analogs, and sugar-modified analogs
  • a DNA synthesis inhibitor such as an intercalating agent
  • a DNA interactive agent such as an intercalating agent
  • Chemotherapeutic agents may be categorized by their mechanism of action into, for example, the following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors
  • anti-metabolites/anti-cancer agents such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors
  • antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, tenyposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, doxorubicin, epirubicin, hexamethylmelamineoxaliplatin, ⁇ pho
  • the invention provides a method for diagnosis of a cell -proliferative disorder in a subject comprising detecting the presence of a NAC-I marker in a sample, wherein the presence of said marker is indicative of the cell-proliferative disorder.
  • the cell-proliferative disorder is cancer
  • the cancer is breast cancer, ovarian, cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer.
  • the cancer is ovarian cancer.
  • the invention also provides a method for assessing NAC-I status in a subject comprising detecting the presence of a NAC-I marker in a biological sample obtained from a subject.
  • the method for assessing NAC-I status further comprising quantifying the amount of NAC-I marker in the biological sample, wherein the amount of NAC-I marker in the biological sample is indicative of NAC-I status.
  • the invention also provides methods for detecting the recurrence of cancer in a subject by detecting the presence or amount of a NAC-I marker in an biological sample.
  • the invention also provides prognostic methods for determining the length of time a subject will survive based on the levels of NAC-I expression.
  • the NAC-I marker can be any of the markers described above, hi one embodiment, the NAC-I marker is a NAC-I polypeptide or a fragment thereof. In a another embodiment, the marker is a NAC-I nucleic acid.
  • the NAC-I marker is a NAC-I polypeptide encoded by a nucleic acid comprising SEQ ID NO:1 or a fragment thereof.
  • the NAC-I marker is a polypeptide encoded by a nucleic acid that hybridizes to SEQ ID NO:1 under stringent conditions.
  • the NAC-I marker is a NAC-I polypeptide which comprises the amino acid sequence of SEQ ID NO:2 or a fragment thereof.
  • the methods of the present invention may be performed in any relevant sample.
  • a sample can be a tissue, a cell or a body fluid.
  • the tissue is ovarian tissue, preferably biopsy tissue.
  • the body fluid can be any body fluid, including but not limited to blood, serum, plasma, urine, saliva, sputum and breast ductal secretions.
  • the body fluid is blood or serum.
  • the NAC-I marker is a NAC-I polypeptide or a fragment thereof.
  • a NAC-I polypeptide may be detected using any assay method available in the art, a subset of which is discussed below. Non-limiting examples of such methods include immunohistochemistry, ELISAs, MRI and Western blots.
  • the presence of NAC-I polypeptide marker is determined by: (a) contacting said sample with a binding moiety which binds specifically to said NAC-I polypeptide or fragment thereof to produce a binding moiety-NAC-1 polypeptide complex, and (b) detecting the binding moiety-NAC-1 polypeptide complex, wherein the presence of said complex is indicative of cancer, e.g., breast or ovarian cancer.
  • the binding moiety is an antibody or a fragment thereof.
  • the antibody is a monoclonal antibody.
  • the antibody is a polyclonal antibody.
  • the antibody further comprises a label.
  • the label is selected from the group consisting of a radioactive label, a fluorescent label, a chemiluminescent label, a spin label, a colored label, and an enzymatic label.
  • the method for detecting the presence of a NAC-I polypeptide further comprises the step of measuring the concentration or amount of the polypeptide in the sample.
  • the protein may be reacted with a binding moiety, such as an antibody, capable of specifically binding the protein being detected.
  • Binding moieties such as antibodies, may be designed using methods available in the art so that they interact specifically with the protein being detected.
  • a labeled binding moiety may be utilized.
  • the sample is reacted with a labeled binding moiety capable of specifically binding the protein, such as a labeled antibody, to form a labeled complex of the binding moiety and the target protein being detected. Detection of the presence of the labeled complex then may provide an indication of the presence of a breast cancer in the individual being tested.
  • the marker protein may be detected using a binding moiety capable of specifically binding the marker protein.
  • the binding moiety may comprise, for example, a member of a specific binding pair, such as antibody- antigen, enzyme-substrate, nucleic acid-nucleic acid, protein-nucleic acid, protein- protein, or other specific binding pair known in the art. Binding proteins may be designed which have enhanced affinity for a target protein.
  • the binding moiety may be linked with a detectable label, such as an enzymatic, fluorescent, radioactive, phosphorescent or colored particle label.
  • the labeled complex may be detected, e.g., visually or with the aid of a spectrophotometer or other detector.
  • a NAC- 1 marker may be detected using any of a wide range of immunoassay techniques available in the art. For example, the skilled artisan may employ the sandwich immunoassay format to detect breast cancer in a body fluid sample. Alternatively, the skilled artisan may use conventional immuno-histochemical procedures for detecting the presence of NAC-I polypeptide a tissue sample using one or more labeled binding proteins.
  • two antibodies capable of binding the marker protein generally are used, e.g., one immobilized onto a solid support, and one free in solution and labeled with a detectable chemical compound.
  • chemical labels that may be used for the second antibody include radioisotopes, fluorescent compounds, spin labels, colored particles such as colloidal gold and colored latex, and enzymes or other molecules that generate colored or electrochemically active products when exposed to a reactant or enzyme substrate.
  • the complexed protein is detected by washing away non-bound sample components and excess labeled antibody, and measuring the amount of labeled antibody complexed to protein on the support's surface.
  • the antibody free in solution which can be labeled with a chemical moiety, for example, a hapten, may be detected by a third antibody labeled with a detectable moiety which binds the free antibody or, for example, the hapten coupled thereto.
  • immunoassay design considerations include preparation of antibodies (e.g., monoclonal or polyclonal antibodies) having sufficiently high binding specificity for the target protein to form a complex that can be distinguished reliably from products of nonspecific interactions.
  • antibodies e.g., monoclonal or polyclonal antibodies
  • antibody is understood to mean binding proteins, for example, antibodies or other proteins comprising an immunoglobulin variable region-like binding domain, having the appropriate binding affinities and specificities for the target protein. The higher the antibody binding specificity, the lower the target protein concentration that can be detected.
  • Antibodies to an isolated NAC-I polypeptide which are useful in assays for detecting a cancer in an individual may be generated using standard immunological procedures well known and described in the art. See, for example, Practical Immunology, Butt, N. R., ed., Marcel Dekker, NY, 1984. Briefly, an isolated target protein is used to raise antibodies in a xenogeneic host, such. as a mouse, goat or other suitable mammal. The marker protein is combined with a suitable adjuvant capable of enhancing antibody production in the host, and is injected into the host, for example, by intraperitoneal administration. Any adjuvant suitable for stimulating the host's immune response may be used.
  • a commonly used adjuvant is Freund's complete adjuvant (an emulsion comprising killed and dried microbial cells). Where multiple antigen injections are desired, the subsequent injections may comprise the antigen in combination with an incomplete adjuvant (e.g., cell-free emulsion).
  • Polyclonal antibodies may be isolated from the antibody-producing host by extracting serum containing antibodies to the protein of interest. Monoclonal antibodies may be produced by isolating host cells that produce the desired antibody, fusing these cells with myeloma cells using standard procedures known in the immunology art, and screening for hybrid cells (hybridomas) that react specifically with the target protein and have the desired binding affinity.
  • Antibody binding domains also may be produced biosynthetically and the amino acid sequence of the binding domain manipulated to enhance binding affinity with a preferred epitope on the target protein. Specific antibody methodologies are well understood and described in the literature. A more detailed description of their preparation can be found, for example, in Butt (1984) (supra). In addition, genetically engineered biosynthetic antibody binding sites, also known in the art as BABS or sFv's, may be used in the practice of the instant invention.
  • BABS comprising (i) non-covalently associated or disulfide bonded synthetic VH and VL dimers, (ii) covalently linked VH- VL single chain binding sites, (iii) individual VH or VL domains, or (iv) single chain antibody binding sites are disclosed, for example, in U.S. Pat. Nos. 5,091,513; 5,132,405; 4,704,692; and 4,946,778.
  • BABS having requisite specificity for the NAC-I polypeptide can be derived by phage antibody cloning from combinatorial gene libraries (see, for example, Clackson et al. (1991) Nature 352: 624- 628; or U.S. Pat. No.
  • Marker proteins may also be detected using gel electrophoresis techniques available in the art.
  • two-dimensional gel electrophoresis the proteins are separated first in a pH gradient gel according to their isoelectric point. The resulting gel then is placed on a second polyacrylamide gel, and the proteins separated according to molecular weight (see, for example, O'Farrell (1975) J. Biol. Chem. 250: 4007-4021; or Berkelman et al. (October 1998) 2-D Electrophoresis Using Immobilized pH Gradients: Principles and Methods, Amersham Pharmacia Biotech Pub. 80-6429-60, Rev. A).
  • One or more marker proteins may be detected by first isolating proteins from a sample obtained from an individual suspected of having cancer, and then separating the proteins by two-dimensional gel electrophoresis to produce a characteristic two- dimensional gel electrophoresis pattern. The pattern may then be compared with a standard gel pattern produced by separating, under the same or similar conditions, proteins isolated from normal or cancer cells. The standard gel pattern may be stored in, and retrieved from an electronic database of electrophoresis patterns. The presence of a NAC-I polypeptide in the two-dimensional gel provides an indication that the sample being tested was taken from a person with cancer, e.g., ovarian cancer.
  • Mass spectrometry may also be used to detect a marker protein.
  • Preferred mass spectrometry methods include MALDI-TOF mass spectrometry and MALDI-TOF using derivatized chip surfaces (SELDI).
  • Useful mass spectrometry methods for detecting a marker protein are described, for example, in the Examples and in U.S. Pat. Nos. 5,719,060; 6,124,137; 6,207,370; 6,225,047; 6,281,493; and 6,322,970.
  • detection methods may be used in combination with each other, with other detection methods, and/or with one or more purification methods to reduce the complexity of a biological sample.
  • proteins isolated by two- dimensional gel electrophoresis could be probed with an antibody that specifically binds the marker protein, or could be assayed by mass spectrometry.
  • a biological sample may be subjected to biochemical fractionation prior to analysis by mass spectrometry or by other techniques such as gel electrophoresis and/or immunoassays.
  • a marker protein may also be detected indirectly, for example, by subjecting it to enzymatic treatment, and subsequently detecting the products of that treatment.
  • the NAC-I marker is a nucleic acid encoding NAC-I or a fragment thereof.
  • a nucleic acid encoding NAC-I can be detected using any method available in the art of subset of which is discussed below.
  • the presence of a NAC-I nucleic acid marker is detected by a nucleic acid probe which may be designed using standard methods and are used to identify DNA or mRNA encoding NAC-I . See, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989).
  • the nucleic acid probe is complementary to at least a portion of a DNA or RNA encoding a NAC-I polypeptide.
  • the nucleic acid probe capable of detecting NAC-I is in a microarray containing a plurality of probes.
  • a detecting step according to the invention may comprise amplifying nucleic acid encoding a NAC-I polypeptide using a polymerase chain reaction ("PCR") or a reverse-transcriptase polymerase chain reaction. Detection of products of the PCR may be accomplished using known techniques, including hybridization with nucleic acid probes complementary to the amplified sequence.
  • PCR polymerase chain reaction
  • reverse-transcriptase polymerase chain reaction reverse-transcriptase polymerase chain reaction
  • Gene probes comprising complementary RNA or, preferably, DNA to NAC-I nucleotide sequences or mRNA sequences encoding NAC-I polypeptides may be produced using established recombinant techniques or oligonucleotide synthesis.
  • the probes hybridize with complementary nucleic acid sequences presented in the test specimen, and can provide extraordinar specificity.
  • a short, well-defined probe, coding for a single unique sequence is most precise and preferred. Larger probes are generally less specific.
  • oligonucleotide of any length may hybridize to an mRNA transcript
  • oligonucleotides typically within the range of 8-100 nucleotides, preferably within the range of 15-50 nucleotides are envisioned to be most useful in standard hybridization assays.
  • Choices of probe length and sequence allow one to choose the degree of specificity desired.
  • Hybridization is carried out at from 50 to 65 0 C in a high salt buffer solution, formamide or other agents to set the degree of complementarity required.
  • the state of the art is such that probes can be manufactured to recognize essentially any DNA or RNA sequence. For additional particulars, see, for example, Berger et al.
  • the labeled reagents may be provided in solution or coupled to an insoluble support, depending on the design of the assay.
  • the various conjugates may be joined covalently or noncovalently, directly or indirectly. When bonded covalently, the particular linkage group will depend upon the nature of the two moieties to be bonded.
  • a large number of linking groups and methods for linking are taught in the literature. Broadly, the labels may be divided into the following categories: chromogens; catalyzed reactions; chemiluminescence; radioactive labels; and colloidal-sized colored particles.
  • the chromogens include compounds which absorb light in a distinctive range so that a color may be observed, or emit light when irradiated with light of a particular wavelength or wavelength range, e.g., fluorescers. Both enzymatic and nonenzymatic catalysts may be employed. In choosing an enzyme, there will be many considerations including the stability of the enzyme, whether it is normally present in samples of the type for which the assay is designed, the nature of the substrate, and the effect if any of conjugation on the enzyme's properties. Potentially useful enzyme labels include oxiodoreductases, transferases, hydrolases, lyases, isomerases, ligases, or synthetases. Interrelated enzyme systems may also be used.
  • a chemiluminescent label involves a compound that becomes electronically excited by a chemical reaction and may then emit light that serves as a detectable signal or donates energy to a fluorescent acceptor.
  • Radioactive labels include various radioisotopes found in common use such as the unstable forms of hydrogen, iodine, phosphorus or the like.
  • Colloidal-sized colored particles involve material such as colloidal gold that, in aggregate, form a visually detectable distinctive spot corresponding to the site of a substance to be detected. Additional information on labeling technology is disclosed, for example, in U.S. Pat. No. 4,366,241.
  • a common method of in vitro labeling of nucleotide probes involves nick translation wherein the unlabeled DNA probe is nicked with an endonuclease to produce free 3 1 hydroxyl termini within either strand of the double-stranded fragment. Simultaneously, an exonuclease removes the nucleotide residue from the 5' phosphoryl side of the nick. The sequence of replacement nucleotides is determined by the sequence of the opposite strand of the duplex. Thus, if labeled nucleotides are supplied, DNA polymerase will fill in the nick with the labeled nucleotides. Using this well-known technique, up to 50% of the molecule can be labeled.
  • the oligonucleotide selected for hybridizing to the target nucleic acid may be isolated and purified using standard techniques and then preferably labeled (e.g., with 35 S or 32 P) using standard labeling protocols.
  • a sample containing the target nucleic acid then is run on an electrophoresis gel, the dispersed nucleic acids transferred to a nitrocellulose filter and the labeled oligonucleotide exposed to the filter under stringent hybridizing conditions, e.g., 50% formamide, 5xSSPE, 2x Denhardt's solution, 0.1% SDS at 42°C, as described in Sambrook et al. (1989) supra.
  • the filter may then be washed using 2 x SSPE, 0.1% SDS at 68 0 C, and more preferably using 0.1 X SSPE, 0.1% SDS at 68° C.
  • Other useful procedures known in the art include solution hybridization, and dot and slot RNA hybridization.
  • the amount of the target nucleic acid present in a sample is then quantitated by measuring the radioactivity of hybridized fragments, using standard procedures known in the art.
  • Nucleic acid in a sample may also be detected by, for example, a Southern blot analysis by reacting the sample with a labeled hybridization probe, wherein the probe is capable of hybridizing specifically with at least a portion of the target nucleic acid molecule.
  • Nucleic acid in a sample may also be detected by Northern blot analysis.
  • a nucleic acid binding protein may also be used to detect nucleic acid encoding breast cancer-associated proteins.
  • the invention provides a kit for detecting a cell- proliferative disorder comprising an agent which binds specifically to a NAC-I marker and instructions for use.
  • the kit may comprise a reference sample, e.g., a negative and/or positive control.
  • the negative control would be indicative of a normal cell type and the positive control would be indicative of cancer.
  • Such a kit may also be used for identifying potential candidate therapeutic agents for treating cancer.
  • the first binding moiety is labeled.
  • the kit further comprises a second binding moiety which binds specifically to the first binding moiety.
  • kit can be used for the detection of any cell-proliferative cancer including, without limitation, breast cancer, ovarian cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer.
  • the kit is for the detection of ovarian cancer.
  • the kit may also be used to diagnose the recurrence of cancer, e.g., ovarian cancer.
  • the binding moiety in the kit is an antibody or fragment thereof which specifically binds to NAC-I.
  • Antibodies and binding fragments thereof can be lyophilized or in solution.
  • the preparations can contain stabilizers to increase the shelf-life of the kits, e.g., bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • the kit can contain further preparations of solutions to reconstitute the preparations. Acceptable solutions are well known in the art, e.g., PBS.
  • the antibody is a polyclonal antibody, a monoclonal antibody, a humanized antibody, a chimeric antibody, a recombinant antibody, or fragment thereof.
  • the antibody, or fragment thereof is immunoreactive with the extracellular domain of NAC-I or with soluble NAC-I.
  • Kits of the present invention can further include the components for an ELISA assay for measuring NAC-I and fragments thereof.
  • Samples to be tested in this application include, for example, blood, serum, plasma, urine, lymph, tissue and products thereof.
  • kits are used in immunoassays, such as immunohistochemistry to test subject tissue biopsy sections.
  • the kits may also be used to detect the presence of a NAC-I marker in a biological sample obtained from a subject using immunohistocytochemistry.
  • the compositions of the kit of the present invention can be formulated in single or multiple units for either a single test or multiple tests.
  • the invention comprises a method of monitoring the effectiveness of a treatment for a cell-pro liferative disorder in a mammal, comprising quantifying the amount of a NAC-I marker in a sample, wherein a decrease in the NAC-I marker is indicative of the effectiveness of the treatment.
  • the above-described method can be used to monitor the effectiveness of a cancer treatment.
  • the method is used to monitor the effectiveness of ovarian cancer treatment.
  • the concentration of a NAC-I polypeptide or fragment thereof is compared to a standard sample obtained from healthy and/or untreated subject. Samples can be collected at discrete intervals during treatment and compared to the standard. It is contemplated that changes in the level of NAC-I will be indicative of the efficacy of treatment.
  • the step of detecting the presence and abundance of the marker protein or its transcript in samples of interest is repeated at intervals and these values then are compared, the changes in the detected concentrations reflecting changes in the status of the tissue.
  • an increase in the level of NAC-I may correlate with progression of the cancer.
  • the monitoring steps occur following administration of the therapeutic agent or procedure (e.g., following administration of a chemotherapeutic agent or following radiation treatment).
  • a decrease in the level of NAC-I may correlate with a regression of the cancer.
  • cancer may be identified by the presence of NAC-I as taught herein. Once identified, the cancer may be treated using compounds that reduce in vivo the expression and/or biological activity of the NAC-I . Furthermore, the methods provided herein can be used to monitor the progression and/or treatment of the disease.
  • NAC-I is present at detectably higher levels in cancer cells, e.g., ovarian cancer cells, relative to normal cells, and in recurrent cancer cells as compared to normal cells, NAC-I may be used as target molecule for cell-pro liferative disorders in which NAC-I is upregulated.
  • the invention provides methods and compositions for treating a cell-proliferative disorder.
  • the cell-proliferative disorder is cancer.
  • the cancer is ovarian cancer.
  • the invention further comprises administering a chemotherapeutic agent.
  • the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of pharmaceutical composition comprising a NAC-I antagonist.
  • the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a compound which binds specifically to a NAC-I polypeptide to inactive or reduce the biological activity of NAC-I .
  • the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of the antibody or fragment thereof which binds specifically to a NAC-I polypeptide. In one embodiment, the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of the antibody or fragment thereof which binds specifically to a NAC-I polypeptide. In one embodiment, the antibody or fragment thereof inactivates or reduces the biological activity of the protein.
  • the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a small molecule, for example, a small organic molecule which inhibits or reduces the biological activity of NAC-I.
  • a small molecule for example, a small organic molecule which inhibits or reduces the biological activity of NAC-I.
  • the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a compound that modulates the expression of NAC-I polypeptide. In one embodiment, the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of a compound that modulates the expression a NAC-I polypeptide.
  • the invention provides a method of modulating a cell- proliferative disorder in a subject comprising modulating the expression of a NAC-I polypeptide in vivo.
  • the cell-proliferative disorder is cancer.
  • the cancer is breast cancer.
  • the modulating of the expression of a NAC-I polypeptide comprises contacting a cell with a nucleic acid selected from the group consisting of a siRNA, an shRNA, an antisense nucleic acid or a ribozyme.
  • a cancer therapeutic of the invention can be an oligonucleotide or peptide nucleic acid sequence complementary and capable of hybridizing under physiological conditions to part, or all, of the gene encoding the marker protein or to part, or all, of the transcript encoding the marker protein thereby to reduce or inhibit transcription and/or translation of the marker protein gene.
  • the same technologies may be applied to reduce or inhibit transcription and/or translation of a.
  • the anti-sense oligonucleotides or peptide nucleic acid sequences may be administered by a variety of specialized oligonucleotide delivery techniques.
  • oligonucleotides may be encapsulated in liposomes, as described in Mannino et al. (1988) BioTechnology 6: 682, and Feigner et al. (1989) Bethesda Res. Lab. Focus 11:21.
  • Lipids useful in producing liposomal formulations include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
  • compositions of the invention may further include compounds such as cyclodextrins and the like which enhance delivery of oligonucleotides into cells.
  • cationic detergents e.g. Lipofectin
  • reconstituted virus envelopes have been successfully used to deliver RNA and DNA to cells (see, for example, Arad et al. (1986) Biochem. Biophy. Acta 859: 88-94).
  • the anti-sense oligonucleotides and/or peptide nucleic acid sequences are administered to the individual in a therapeutically effective amount, for example, an amount sufficient to reduce or inhibit target protein expression in malignant cells.
  • the actual dosage administered may take into account whether the nature of the treatment is prophylactic or therapeutic in nature, the age, weight, health of the subject, the route of administration, the size and nature of the malignancy, as well as other factors.
  • the daily dosage may range from about 0.01 to 1,000 mg per day. Greater or lesser amounts of oligonucleotide or peptide nucleic acid sequences may be administered, as required.
  • the skilled artisan can, using methodologies well known in the art, screen small molecule libraries (either peptide or non-peptide based libraries) to identify candidate molecules that reduce or inhibit the biological function of the NAC-I .
  • the small molecules preferably accomplish this function by reducing the in vivo expression of the target molecule, or by interacting with the target molecule thereby to inhibit either the biological activity of the target molecule or an interaction between the target molecule and its in vivo binding partner.
  • the skilled artisan may enhance the efficacy of the small molecule using rational drug design methodologies well known in the art.
  • the skilled artisan may use a variety of computer programs which assist the skilled artisan to develop quantitative structure activity relationships (QSAR) which further to assist the design of additional candidate molecules de novo.
  • QSAR quantitative structure activity relationships
  • the screening assays may be automated thereby facilitating the screening of a large number of small molecules at the same time. Such automation procedures are within the level of skill in the art of drug screening and, therefore, are not discussed herein.
  • Candidate peptide-based small molecules may be produced by expression of an appropriate nucleic acid sequence in a host cell or using synthetic organic chemistries. Similarly, non-peptidyl-based small molecules may be produced using conventional synthetic organic chemistries well known in the art.
  • the identified small molecules may be combined with a suitable pharmaceutically acceptable carrier, such as physiological saline or other useful carriers well characterized in the medical art.
  • the pharmaceutical compositions may be provided directly to malignant cells, for example, by direct injection, or may be provided systemically, provided the binding protein is associated with means for targeting the protein to target cells. Finally, suitable dose ranges and cell toxicity levels may be assessed using standard dose range experiments. As described above, actual dosages administered may vary depending, for example, on the nature of the malignancy, the age, weight and health of the individual, as well as other factors.
  • One embodiment of the present invention are methods of treating a cell- proliferative disorder, e.g., cancer such as ovarian cancer, with pharmaceutical compositions of antibodies, antigen binding fragments, peptides, nucleic acids, small molecules and other compounds as described above.
  • the subject receiving treatment is a human subject.
  • Pharmaceutical compositions of the invention can be administered to a subject in need there of by, for example, injection.
  • compositions of the present invention are administered in a therapeutically effective amount which are effective for producing some desired therapeutic effect by inducing tumor-specific killing of tumor cells in a subject and thereby blocking the biological consequences of that pathway in the treated cells eliminating the tumor cell or preventing it from proliferating, at a reasonable benefit/risk ratio applicable to any medical treatment.
  • One embodiment of the present invention contemplates the use of any of the pharmaceutical compositions of the present invention to make a medicament for treating cancer.
  • Medicaments can be formulated based on the physical characteristics of the subject/subject needing treatment, and can be formulated in single or multiple formulations based on the stage of the cancerous tissue.
  • Medicaments of the present invention can be packaged in a suitable pharmaceutical package with appropriate labels for the distribution to hospitals and clinics wherein the label is for the indication of treating a specific cancer in a subject.
  • Medicaments can be packaged as a single or multiple units. Instructions for the dosage and administration of the pharmaceutical compositions of the present invention can be included with the pharmaceutical packages.
  • compositions of the present invention can be administered to a subject by any convenient route, including, for example, subcutaneous, intradermal, intravenous, intra-arterial, intraperitoneal, or intramuscular injection.
  • the antibodies, antigen binding fragments, or peptides are labeled with a radiolabel or a toxin that kills the target cell upon binding of the antibodies, antigen binding fragments, or peptides to NAC- 1.
  • the toxin is any one of ricin, ricin A chain (ricin toxin), Pseudomonas exotoxin (PE), diphtheria toxin (DT), Clostridium perfringens phospholipase C (PLC), bovine pancreatic ribonuclease (PBR), pokeweed antiviral protein (PAP), abrin, abrin A chain (abrin toxin), cobra venum factor (CVF), gelonin (GEL), saporin (SAP) modeccin, viscumin or volkensin.
  • ricin A chain ricin toxin
  • PE Pseudomonas exotoxin
  • DT diphtheria toxin
  • PLC Clostridium perfringens phospholipase C
  • PBR bovine pancreatic ribonuclease
  • PAP pokeweed antiviral protein
  • abrin abrin
  • abrin A chain abri
  • Antibodies, antigen binding fragments, peptides nucleic acid molecules small molecules, and peptidomimetics of the present invention can also be used in combination therapy with chemotherapeutic agents such as the chemotherapeutic agents discussed above.
  • the pharmaceutical compositions can be administered separately or concomitantly. In one aspect of the present invention, the pharmaceutical compositions are administered in a single formulation. In one aspect of the present invention, the pharmaceutical compositions are administered as separate formulations.
  • the invention also comprises methods to screen for compounds which can be used to treat a cell-proliferative disorder such as cancer.
  • the method comprises (a) identifying a NAC-I modulator, e.g., an antagonist, and (b) determining whether said NAC-I antagonist is effective against a cell-proliferative disorder.
  • Said methods can be carried out using methods which are well known in the art. For example, determining whether a NAC-I modulator is effective against a cell-proliferative disorder can be carried out using any in vitro or in vivo models of a cell-proliferative disorder.
  • the invention also comprises a method to screen for NAC-I modulators, comprising: (a) contacting a NAC-I polypeptide with a test compound under conditions suitable for detecting the binding of the NAC-I polypeptide to the test compound, (b) determining whether the test compound binds the NAC-I polypeptide, and (c) further determining whether the test compound prevents, inhibits or reduces the binding of NAC-I, wherein a test compound that binds the NAC-I polypeptide and prevents, inhibits or reduces the binding of NAC-I is a NAC-I antagonist.
  • the method further comprises determining whether the test compound binds the extracellular domain of said NAC-I polypeptide.
  • BTB bric-a-brac tramtrack broad complex
  • POZ bric-a-brac tramtrack broad complex
  • BTB/POZ protein-protein interaction motif at the N-terminal that mediates homodimer or heterodimer formation
  • These proteins have been demonstrated to participate in a wide variety of cellular functions including transcription regulation, cellular proliferation, apoptosis, cell morphology, ion channel assembly and protein degradation through ubiquitination (1).
  • BTB/POZ proteins have been implicated in human cancer and they include BCL-6 (4, 5), PLZF (promyelocyte leukemia zinc finger) (4, 6), leukemia/lymphoma related factor (LRF)ZPokemon (7, 8), HIC-I (hypermethylated in cancer-1) and Kaiso (9, 10).
  • BCL-6 gene is the best-characterized oncogene. Frequent gene translocation or mutation has been identified in B-cell lymphoma, resulting in constitutive BCL-6 expression in the tumor cells (4, 5).
  • Proteins matching the PS50097 profile of the BTB/POZ domain amino acid sequence were extracted from the Swiss-Prot/TrEMBL protein databank. A total of 130 BTB/POZ genes were identified. The expression levels of the BTB/POZ gene family members were determined from the ovarian tumor SAGE libraries by obtaining the SAGE tag counts for each BTB/POZ gene.
  • the libraries included the ovarian surface epithelial cells (SV-40 immortalized IOSE29 (26) and short term cultured HOSE4), benign cystadenoma (MLlO), ovarian high-grade serous carcinoma tissues (HG63, HG48, HG92, OVT6, OVT7 and OVT8) and ovarian cancer cell lines
  • NAC-I specific tags included TTCCCGGCCC (SEQ ID NO:3), TGAAGGCAGT (SEQ ID NO:4), CCTATAATCG (SEQ ID NO:5), AGTGCCAGGG (SEQ ID NO:6), AGAATATCAG (SEQ ID NO:7), GAGGGAGGGA (SEQ ID NO:8) and GTTCCCCCAC (SEQ ID NO:3)
  • NAC-I tag counts were retrieved by filtering for tag sequences that matched uniquely to NAC-I according to the April 15, 2005 SAGEMap available on the public NCBI FTP.
  • Paraffin-embedded tumor tissues were obtained from the Department of Pathology at the Johns Hopkins Hospital and effusion ovarian cancer samples were obtained from the Norwegian Radium National Hospital in Norway. These included 182 high-grade ovarian serous carcinoma tissues (154 stage III and 2 S stage IV), 44 low-grade ovarian serous carcinoma tissues (42 stage III and 2 stage IV), 172 high- grade ovarian carcinoma effusion samples (1 stage I, 6 stage II, 97 stage III, and 68 stage IV), and 32 cervical adenocarcinomas. In addition, 21 benign ovarian cystadenomas, 18 normal ovaries and 8 normal cervical tissues were included for comparison. Acquisition of tissue specimens and clinical information was approved by an institutional review board (Johns Hopkins Medical Institutions) or by the Regional Ethics Committee (Norwegian Radium Hospital).
  • immunogold labeling was applied on NAC-I expressing-RK3E cells followed by electron microscopy.
  • N130 and N250 mutants contained the BTB/POZ domain (amino acids 20-122) of NAC-I.
  • two mini-N130 expression constructs were generated and they included N65 (encoding the first 1-65 amino acids of the BTB domain), N30-122 (30-122 amino acids). PCR products of the NAC-I deletion mutants were cloned into an expression vector, pCDNA4 with an Xpress tag at the N-terminus.
  • RK3E cells were first stably transfected with PCDNA6/V5/NAC- 1 then transiently transfected with the pCDNA4/NAC- 1 deletion mutants. Co-immunoprecipitation was performed to assess the specific structural motifs that bound to full-length NAC-I. For immunofluorescence staining, cells were incubated with primary antibodies followed by fluorescence labeled secondary antibodies.
  • the Tet-Off inducible system was used to assess the biological effects of Nl 30.
  • HeLa and SKO V3 cells which constitutively expressed tTA (tetracycline- controlled transactivator) were transfected with pBI-N130/EGFP or pBI-C250/V5- EGFP (control) that bicistronically expressed the products of interest and reporter EGFP upon the binding of tTA to the tetracycline responsive element (TRE) in the absence of inducer (doxycycline, Dox).
  • TRE tetracycline responsive element
  • NAC-I expression is associated with cancer development
  • a total of 11 SAGE libraries were used to screen 130 BTB/POZ domain- containing genes for overexpression in high-grade ovarian serous carcinomas as compared to ovarian surface epithelium and benign ovarian cystadenoma.
  • Sixteen genes were selected based on an average tag counts/library >10 (Table 1).
  • a gene named NAC-I (BTBD14B) showed the highest ratio of average tag counts in ovarian carcinoma to controls (ovarian surface epithelium and benign ovarian cyst) and was therefore selected for validation and characterization in this study.
  • the SAGE database was also used to analyze NAC-I expression in different cancer types and their corresponding normal tissues.
  • NAC-I was upregulated in several tumors from other organs including pancreatic, colorectal, and breast carcinomas.
  • Table 1 The list of BTB/POZ genes that show differential expression between ovarian cancers and benign controls.
  • NAC-I Ab clone 3 a mouse monoclonal antibody (NAC-I Ab clone 3) was generated that reacted to the C- terminal of the NAC-I protein and performed immunohistochemistry in 265 ovarian tumors and normal tissue samples (Table 2).
  • the specificity of the NAC-I antibody was evaluated by reciprocal immunoprecipitation/Western blot analyses in RK3E cells transfected with PCDNA6-V5/NAC-1 and vector control.
  • a single band with a molecular mass of approximate 57 kD corresponding to NAC-I protein was detected in NAC-I transfected cells but not in control cells ( Figure 2A).
  • NAC-I was localized to dot-like structures in those tumors showing strong NAC-I immunointensity (2+ and 3+) ( Figure 2E and 2F).
  • Ultrastructural analysis using immunogold labeling and electron microscopy further revealed that NAC-I was localized to discrete nuclear bodies, tentatively termed "NAC-I bodies", with a diameter ranging from 0.3 to 1.8 ⁇ m ( Figure 2G).
  • NAC-I neurodegenerative disease 2019
  • recurrent tumors represent the true "killer” in cancer patients as the primary tumors are usually removed by surgery. Identification of molecular targets that are present in recurrent tumors would be important in the development of a prognostic test and a novel therapeutic intervention for cancer patients.
  • NAC-I expression was related to tumor 0 progression by analyzing primary and recurrent ovarian high-grade serous carcinomas using immunohistochemistry and quantitative real-time PCR.
  • NAC-I immunohistochemistry was performed at two institutions, Johns Hopkins Medical Institutions (JHMI, solid tumors) and Norwegian National Radium Hospital (NRH, effusions), using independent sets of ovarian cancer specimens and the results 5 presented by a 2x2 contingency table (Figure 3A).
  • JHMI Johns Hopkins Medical Institutions
  • NH Norwegian National Radium Hospital
  • NAC-I plays a role in the development of recurrent ovarian tumors.
  • NAC-I plays a role in the development of recurrent ovarian tumors.
  • NAC-I immunoreactivity and in vitro drug resistance in 60 high-grade serous carcinomas.
  • the in vitro drug resistance results were performed at Oncotech, Inc. (Tustin, CA) using the protocol described at www.oncotech.com/pdfs/edr_4__pager.pdf (11, 12).
  • NAC-I BTB/POZ domain Dominant negative role of NAC-I BTB/POZ domain Because the BTB/POZ domain, has been known to be involved in protein homomerization or heteromerization, we tested whether the NAC-I BTB/POZ domain participated in protein-protein interaction using deletion mutants of NAC-I ( Figure 4A). Based on co-immunoprecipitation and immunofluorescence co-localization studies ( Figure 4B and 4C), we found that the BTB/POZ domain of NAC-I, corresponding to the 1-129 amino acids at the N-terminus (Nl 30 construct), was the minimal structural motif required for NAC-I homo-oligomerization ( Figure 4B).
  • NAC-I deletion mutants/Xpress tags were then transfected into RK3E cells that had been stably transfected with a full-length NAC-I /V5 tag expression vector.
  • full-length NAC-1/V5 co-localized with the full-length NAC-1/Xpress in the NAC-I bodies, indicating that NAC-I interacted with each other.
  • both Nl 30 and N250 deletion mutants containing the BTB/POZ domain also co- localized with full-length NAC-I, but interestingly, both mutants disrupted the formation of NAC-I bodies by transforming them into "cotton candy” like aggregates or large "noodle-like" structures in the nuclei ( Figure 4C).
  • C250 and M120 deletion mutants that did not contain the BTB/POZ domain failed to co-localize with wild-type NAC-I.
  • Cervical adenocarcinomas like ovarian serous carcinomas, frequently overexpressed NAC-I as a high level of NAC-I immunoreactivity (2+ and 3+) occurred in ⁇ 50% (16 of 32) cervical adenocarcinomas while the NAC-I immunoreactivity in normal endocervical glands were undetectable (Figure 7).
  • Nl 30 on cellular proliferation and apoptosis we used the mini-N130 mutants, N65 and N30-122, in which its BTB/POZ oligomerization activity was deficient. Both N65 and N30-122 showed protein expression but were not able to co-imniunoprecipitate with the full-length NAC-I protein ( Figure 10A).
  • NAC-I expression is tumorigenic
  • OSE clones did not grow intraperitoneal tumors 21 days after i.p. injection.
  • the NAC-I expressing NIH3T3 clones produce both subcutaneous and intraperitoneal tumors in the athymic nu/nu mice.
  • the intraperitoneal tumors were always multiple and their combined weights were measured in each mouse ( Figure 6E).
  • the vector transfected N1H3T3 cells did not grow tumors during the course of this study.
  • a total of 48 frozen tissues including 33 high-grade ovarian serous carcinomas (17 primary and 16 recurrent), 10 benign serous cystadenomas, and five samples of normal ovarian surface epithelial cells were analyzed for NAC-I transcript expression by quantitative real-time PCR using an iCycler (Bio-Rad, Hercules, CA) with the SYBR Green dye (Molecular Probes, Eugene, OR). Averages in the threshold cycle number (Ct) of duplicate measurements were obtained. The results were expressed as the difference between the Ct of the gene of interest and the Ct of a control gene, beta- the SAGE libraries analyzed.
  • siRNA knockdown of NAC-I gene expression Two siRNAs that targeted NAC-I were designed and their sense sequences were: UGAUGUACACGUUGGUGCCUGUCACCA (SEQ ID NO:5H)) and GAGGAAGAACUCGGUGCCCUUCUCCAU (SEQ ID NO:4il).
  • Control siRNA off-target control, cat# D-001210-02-05 was purchased from IDT (Corolville, IA). Cells were seeded onto 96 wells and transfected with siRNAs using oligofectamine (Invitrogen, Carlsbad, CA).
  • HeLa cells (3 x 10 6 ) with an N130 inducible construct were injected subcutaneously into the athymic nu/nu mice.
  • Doxycyclin 125 ⁇ g/mouse
  • Tumor volume was measured every other day for 14 days.
  • To determine if Nl 30 has therapeutic effects on established tumors we injected the same amount of HeLa cells and induced N130 expression at day 9 when subcutaneous rumors had formed. The tumors were monitored for induction based on green fluorescence using a small animal fluoroscope imaging device. Tumor volume was measured daily for 9 days after induction and tumors were prepared for histopathological examination.
  • NAC-I expressing MOSE cells ED3
  • NIH3T3 cells ATCC
  • NAC-I is a new cancer associated gene, as NAC-I expression level is significantly increased in several types of cancers including ovarian cancer, cervical adenocarcinoma, and breast cancer.
  • NAC-I was required for cell proliferation and survival and was sufficient to enhance turnorigenicity in athymic nu/nu mice.
  • NAC-I expression may directly contribute to tumor recurrence and tumor progression. It is further demonstrated that intense NAC-I immunoreactivity in primary tumors is highly predictive of a shorter disease-free interval; therefore, NAC- 1 expression may potentially be used alone or in combination with other markers as a prognostic test to identify ovarian cancer patients who are likely to develop early recurrence. This finding can have potential clinical implications because at least 60% of advanced-stage ovarian cancer patients who appear to be disease-free after completing primary therapy ultimately develop recurrent disease (20). Thus, patients with NAC-I positive ovarian serous carcinoma can be monitored more closely to detect recurrent tumor.
  • NAC-I is a gene with oncogenic potential in ovarian carcinomas.
  • NAC-I is expressed in ovarian carcinoma sample from all anatomic sites and that NAC-I expression is upregulated in effusions and elevated in tumor cells at all sites following the administration in chemotherapy.
  • BD surgical pathologist
  • NAC-I monoclonal antibody was generated by immunizing mice with NAC-I recombinant protein using a standard hybridoma protocol as previously described [44]. Hybridoma screening was first based on the reactivity of culture supernatant with NAC-I protein using ELISA and subsequently by immunointensity on paraffin sections and specificity based on Western blot analysis. The NAC-I antibody was purified and used for immunohistochemistry which was performed on paraffin sections using a dilution of 1:100. The specificity of NAC- 1 antibody was demonstrated in a previous report [42]. Pretreatment consisted of microwave oven antigen retrieval in low pH citrate buffer.
  • Staining was scored by an experienced cytopathologist (BD) who was blinded to the patient clinical data. Nuclear localization was interpreted as positive staining. Staining extent was scored on a scale of 0-4, corresponding to percentage of imrnunoreactive tumor cells of 0%, 1-5%, 6-25%, 26-75% and 76-100%, respectively. Staining intensity was scored as negative (0), weak (1) or strong (2). At least 500 tumor cells were scored, when present (>90% of cases). At least 100 tumor cells were counted for each specimen.
  • BD cytopathologist
  • Table 3 Clinicopathologic data of the study cohort (143 patients')
  • NA non available, including specimens from inoperable patients (15) and patients operated in hospitals in which tumor grade was not scored and primary tumor could not be accessed for assessment of grade (4)
  • NA non available, 15 patients who were inoperable and 5 patients with no record e
  • NAC-I is frequently expressed in ovarian carcinoma: Nuclear NAC-I immunoreactivity was detected in carcinoma cells in 173/176 (98%) effusions. Of these, 112 (65%) stained weakly and 61 (35%) stained strongly ( Figures 15-A, 15-B). The percentage of NAC-I positive cells in the 173 specimens was as follows: 1-5%: 7 specimens (4%); 6-25%: 20 specimens (12%); 26-75%: 51 specimens (29%); 76-
  • NAC-I was first discovered in the nucleus accumbens in the brain of rats, where it was shown to be upregulated following chronic cocaine administration [47]. Its molecular partners and targets are largely undefined at present, although recent data has shown that it interacts with two histone deacetylases, HDAC3 and HD AC4, in neuronal cultures [48]. Following our recent functional characterization of NAC-I expression in ovarian carcinomas, we studied its tumor site-related expression and its possible clinical role in tumor recurrence.
  • NAC-I protein was expressed in the majority of ovarian carcinomas at all anatomic sites. However, NAC-I expression was significantly upregulated in carcinoma cells in effusions as compared to corresponding ovarian tumor tissues.
  • Rsf-1 protein a chromatin-remodeling molecule that we identified as a potential oncogene that is frequently amplified and overexpressed in ovarian serous carcinoma
  • Ovarian carcinoma cells in effusions tend to grow as spheroids, while cells in solid tumors do not, a difference that induces changes in expression of many proteins (e.g., adhesion molecules) [52].
  • NAC-I does not appear to be affected by these altered conditions in terms of sub-cellular expression, as it was localized to the nucleus in both solid tumors and effusions.
  • NAC-I upregulation correlates with post-chemotherapy status, especially with paclitaxel. It is possible that administration of carboplatin and paclitaxel creates a selection pressure that favors cancer cells that express higher levels of NAC-I. The causal role of NAC-I in contributing to drug resistance awaits further studies. Recent reports from our group have demonstrated that expression of different tumor- associated molecules, including Rsf-1, the growth factor granulin-epithelin precursor (GEP), the cadherin regulator Smad-interacting protein 1 (SIPl) and the Xeroderma Pigmentosum A (XPA) protein has a different prognostic role in patients with pre- and post-chemotherapy effusions [49, 53-55].
  • GEP growth factor granulin-epithelin precursor
  • SIPl cadherin regulator Smad-interacting protein 1
  • XPA Xeroderma Pigmentosum A
  • NAC-I is expressed in a great majority of ovarian carcinoma sample from all anatomic sites. Besides, our results show that NAC-I expression is upregulated in effusions and elevated in tumor cells at all sites following the administration in chemotherapy. NAC-I is a therapeutic target for ovarian cancer patients who suffered from recurrent diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The instant invention provides cancer markers and methods of prognosis and diagnosis based on detection and/or quantitation of these markers. The invention further provides compositions for the treatment of cancer.

Description

NAC-I AS A PROGNOSTIC MARKER AND A TARGET FOR THERAPEUTIC TARGET IN HUMAN CANCER
RELATED APPLICATIONS
This application claims the benefit of U. S. Provisional Application 60/860,584, filed November 22, 2006 and U. S. Provisional Application 60/777,153, filed February 27, 2006. The contents of each of the aforementioned applications is hereby incorporated by reference herein.
GOVERNMENT SUPPORT
The following invention was supported at least in part by from Department of Defense Grant OC0400600 and NIH grant CA103937. Accordingly, the government may have certain rights in the invention.
BACKGROUND OF THE INVENTION
Currently there are more than 1.3 million people that are diagnosed with cancer each year in the United States alone. Additionally, nearly 500,000 people die from cancer in the United States each year.
The identification of tumor markers suitable for the early detection and diagnosis of cancer holds great promise to improve the clinical outcome of patients. It is especially important for patients presenting with vague or no symptoms or with tumors that are relatively inaccessible to physical examination. Ovarian carcinoma represents one of such insidious and aggressive cancers. It is the most lethal gynecologic malignancy in women with approximately 25,000 new cases in the United States each year. Despite considerable effort directed at early detection, no cost effective screening tests have been developed and women generally present with disseminated disease at diagnosis.
Epithelial ovarian carcinoma is the most common and most lethal of all gynecologic malignancies. Only 30% of ovarian tumors are diagnosed at an early stage (Stage I/II), when survival rates reach 90%. The rest are diagnosed at an advanced stage, with survival rates of less than 20%. Accordingly, the need exists for the identification of novel cancer biomarkers that will allow for detection of cancer, e.g., ovarian cancer. Moreover, the need exists for additional therapeutic targets for the treatment and prevention of cancer.
SUMMARY OF THE INVENTION
The instant application is based, at least in part, on the discovery that the nucleic acid encoding NAC-I and the NAC-I polypeptide are overexpressed in cancer tissue. Moreover, the NAC-I polypeptide and nucleic acid molecules are overexpressed in recurrent cancer. Accordingly, in one aspect, the invention provides methods for detecting cancer in a subject by detecting the amount of the nucleic acid of SEQ ID NO:1, or a fragment thereof, in a biological sample from the subject, wherein the overexpression of SEQ ID NO:1 is indicative that the subject has cancer. In one embodiment, the amount of the nucleic acid of SEQ ID NO:1 or a fragment thereof, is detected by FISH.
In another embodiment, the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor. In another embodiment, the tumor is a recurrent tumor. hi another embodiment, the sample is an ovarian tissue sample. In another aspect, the invention provides methods for detecting cancer in a subject by detecting the amount of the polypeptide of SEQ ID NO:2, or a fragment thereof, in a biological sample from the subject, wherein the overexpression of SEQ TD NO:2 is indicative that the subject has cancer.
In one embodiment, the polypeptide of SEQ ID NO:2 or a fragment thereof, is detected by immunohistochemistry. hi another embodiment, the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor. In another embodiment, the tumor is a recurrent tumor.
In another embodiment, the sample is an ovarian tissue sample. hi another aspect, the invention provides methods for detecting the recurrence of cancer in a subject, by detecting the amount of SEQ ID NO:1 in a biological sample from the subject, wherein an overexpression of SEQ ID NO:1 as compared to a control is indicative of a recurrence of cancer. In one embodiment, the amount of the nucleic acid of SEQ ID NO:1 or a fragment thereof, is detected by FISH.
In another embodiment, the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor. In another embodiment, the tumor is a recurrent tumor.
In another embodiment, the sample is an ovarian tissue sample.
In another embodiment, the method further comprises the step of treating the subject based on the recurrence of the cancer.
In another aspect, the invention provides methods for detecting a recurrence of cancer in a subject, by detecting the amount of SEQ ED NO:2 in a biological sample from the subject, wherein an overexpression of SEQ ID NO:2 as compared to a control is indicative of a recurrence of cancer.
In one embodiment, the polypeptide of SEQ ID NO:2 or a fragment thereof, is detected by immunohistochemistry. hi another embodiment, the biological sample is from a solid tumor, e.g., a liver, breast, lung, or ovarian tumor. In another embodiment, the tumor is a recurrent tumor.
In another embodiment, the sample is an ovarian tissue sample. hi another embodiment, the method further comprises the step of treating the subject based on the recurrence of the cancer. hi another aspect, the invention provides, methods of detecting the recurrence of ovarian cancer in a subject by determining the amount of the polypeptide of SEQ ID NO:2 present in a biological sample from the subject, wherein an amount higher than a control level indicates that the subject has a recurrence of ovarian cancer. In another aspect, the invention provides methods for identifying a compound for treating or preventing of cancer comprising, contacting a cell with a test compound, determining if the test compound inhibits the expression of the nucleic acid of SEQ ID NO:1, thereby identifying a compound for the treatment or prevention of cancer. hi another aspect, the invention provides methods for identifying a compound for the treatment or prevention of cancer comprising, contacting a cell with a test compound, determining if the test compound inhibits the expression or activity of the polypeptide of SEQ ID NO:2, thereby identifying a compound for the treatment or prevention of cancer. In related embodiments, the compound is a small molecule, a peptide, a polypeptide, or a nucleic acid molecule. In another related embodiment, the peptide or polypeptide is an antibody or fragment thereof, the nucleic acid molecule is an siRNA, shRNA, antisense nucleic acid, or ribozyme. In another embodiment, the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer, hi a specific embodiment, the cancer is ovarian cancer.
In another embodiment, the invention provides methods of treating or preventing cancer in a subject by administering to a subject a compound that inhibits the expression or activity of a nucleic acid of SEQ ID NO : 1 or a polypeptide of SEQ ID NO:2, thereby treating the subject.
In another embodiment, the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer. In a specific embodiment, the cancer is ovarian cancer. hi one embodiment, the compound is selected from the group consisting of a small molecule, a peptide, a polypeptide, and a nucleic acid molecule, hi a related embodiment, the peptide or polypeptide is an antibody or fragment thereof, hi another related embodiment, the nucleic acid molecule is an siRNA, shRNA, antisense nucleic acid, or ribozyme. hi another aspect, the invention provides kits comprising an antibody, or fragment thereof, for use in determining the amount of the polypeptide of SEQ ID NO:2 in a sample and instructions for use. hi one embodiment, the kit further comprises a control, hi another embodiment, the kit is for the diagnosis of cancer. In a related embodiment, the kit is for determining the recurrence of cancer, e.g., ovarian, lung, liver or breast cancer. hi another aspect, the invention provides kits comprising a nucleic acid probe for use in determining the amount of the nucleic acid of SEQ ID NO:1 in a sample and instructions for use. hi one embodiment, the kit further comprises a control, hi another embodiment, the kit is for the diagnosis of cancer, hi a related embodiment, the kit is for determining the recurrence of cancer, e.g., ovarian, lung, liver or breast cancer, hi another embodiment, the probe comprises a label.
In another aspect, the invention further provides antibodies that specifically recognizes NAC-I . hi one embodiment, the antibodies are monoclonal antibodies, e.g., mouse monoclonal antibodies. In a specific embodiment, the antibodies are produced by the hybridoma deposited as accession number .
DESCRIPTION OF THE DRAWINGS Figure 1 depicts a scatter plot of NAC-I tags in several major tumor types.
NAC-I expression level is analyzed by counting NAC-I specific tags from SAGE libraries in both cancer tissue (T, solid symbols) and the corresponding normal tissues (N, open symbols). The NAC-I tags are normalized to tags per 100,000 (y-axis). The dash line in each tumor type indicates the "ceiling" tag number in normal tissue libraries. Each symbol represents an individual specimen.
Figures 2A-F depicts the immunoreactivity of NAC-I in ovarian cancer tissues. A: Immunoprecipitation/ Western blot analyses using NAC-I and V5 antibodies in RK3E cells transfected with pCDNA6-NAC-l/V5 (RK3E-C1) or vector only control (Vec). A discrete band corresponding to NAC-I protein mass is identified in this reciprocal analysis. B-D: The NAC-I immunointensity is undetectable or weak in normal ovarian surface epithelium (B) but is strong in a high-grade serous carcinoma (C and D). E, F: Immunofluorescence of NAC-I protein localization in ovarian cancer cells in a tissue section. Tumor cells contain NAC-I protein, which is located in discrete nuclear bodies (E). The adjacent stromal cells are negative for NAC-I immunoreactivity. A higher magnification demonstrates the NAC-I nuclear bodies using a confocal fluorescence microscope (F). (G) Ultrastructure of NAC-I bodies. Immunogold labeling of NAC-I expressing RK3E cells demonstrates electron-dense bodies decorated by gold particles in the nuclear matrix.
Figures 3A-C depict NACl expression correlates with tumor progression in ovarian serous carcinomas. A: Increased NAC-I immunoreactivity correlates with first tumor recurrence. B: Quantitative real-time PCR analysis shows higher NAC-I expression levels in high-grade carcinomas (HG) than in ovarian surface epithelial cells (OSE), low-grade carcinomas (LG) and cystadenomas. Moreover, recurrent carcinomas have significantly higher expression levels than primary tumors (p= 0.012). The data is expressed as fold increase as compared to the average of OSE. C: Immunohistochemistry demonstrates intense immunoreactivity in recurrent tumors as compared to patients' primary rumors in three representative cases. Figures 4A-C depict co-immunoprecipitation and co-localization of NAC-I deletion mutants and full-length NAC-I . A: Diagram of NAC-I and NAC-I deletion mutants. Full-length (FL) construct contains V5 tag at C-terminus while all the deletion mutants contain Xpress (Xp) tag at N-terminus. Yellow box: BTB/POZ domain; blue box: DUFl 172 domain. B: Co-immunoprecipitation shows that full- length NAC-I , Nl 30 and N250 bind to NAC-I . The predicted molecular mass not including the tag sequence are: full-length NAC-I (57.3 Kd)3 N130 (14.4 Kd), N250 (27.8 Kd), C250 (30.3 Kd), and M120 (14 Kd). C: Cells with stable full-length NAC- 1/V5 expression were transfected with different deletion mutants with the Xp tag.
Double immunofluorescence shows that full-length NAC-I, N130 and N250 deletion mutants colocalize with full-length NAC-I. However, only full-length NAC-I proteins form discrete round and oval shape NAC-I nuclear bodies while both N130 and N250 form irregular aggregates with the full-length NAC-I . Neither C250 nor Ml 20 colocalizes with the full-length NAC-I protein.
Figures 5A-D depicts the effects of N130 induction on cellular proliferation and apoptosis. A & B: Cell growth curves show that after induction of N130 (-Dox), cell growth is significantly suppressed as compared to the non-induced cells (+Dox). Li contrast, induction of C250 does not have an apparent effect on cell growth. A:
SKO V3; B: HeLa. C: Cell cycle analysis shows an increase in G2/M fraction in Nl 30 induced HeLa cells (bottom panel) as compared to non-induced cells (top panel) 24 hours after induction, indicating a G2/M block. D: Percentage of apoptotic and proliferating cells are determined by counting annexin V- and BrdU-positive cells, respectively, in both Nl 30 induced and non-induced cells. Data are presented as mean + SD. *, P<0.05; **, PO.001, ***, PO.0001, Student's t test.
Figures 6A-F depicts constitutive expression of NAC-I in immortalized ovarian surface epithelial cells (MOSE) (A, B & C) and NIH3T3 cells (D and E). Western blot analysis shows NAC-I expression in stable clones of NAC-I expressing MOSE cells (A) and NIH3T3 cells (D). Growth curves show a higher proliferation activity in both NAC-I clones as compared to vector transfected control under a low serum (0.5%) culture condition in MOSE cells (A) and NIH3T3 cells (D). The weights of subcutaneous tumors increase in NAC-I expressing MOSE tumors as compared to control MOSE in nude mice (B). A representative photomicrograph shows a subcutaneous NAC-I expressing MOSE tumor (C). Similarly, the combined tumor weights of tumors in the peritoneal wall of the NAC-I expressing NIH3T3 cells are greater than the controls (E). F: Cell proliferation was determined by a BrdU incorporation assay and all NAC-I expressing clones have a higher proliferation rate than the vector only control. Data are presented as mean + SD.
Figures 7A-D depict NAC-I immunoreactivity of cervical adenocarcinomas, but not in normal endocervical glands. Cervical adenocarcinomas show neoplastic glands infiltrating into the stroma (A and B). A fragment of benign endocervical tissue demonstrates normal endocervical glands (C) and fails to show detectable NAC- 1 immunoreactivity (D).
Figures 8A-C depict the efficiency of N130 induction based on real time PCR (A and B) and cytometry (C).
Figures 9A-C demonstrate that the induction of the control C250 mutant did not have significant effects on cellular proliferation in SKO V3 cells or HeLa cells. Expression of N130 significantly suppressed colony formation in both cell lines.
Figures 10A-B demonstrate coimmunoprecipitation of Nl 30 deletion mutants and full-length NAC-I protein. N130 mutants, N65 and N30-122, in which its BTB/POZ oligomerization activity was deficient, showed protein expression but were not able to co-immunoprecipitate with the full-length NAC-I protein (A). Both N65 and N30-122 could not effectively suppress cellular proliferation as compared to N130 (B).
Figures 1 IA-D depict the results of NAC-I gene knock down. NAC-I expressing SKO V3 and HeLa cells had significantly reduced cell number after NAC-I siRNA treatment (A and B). NAC-I siRNA did not show a significant effect on the cell growth of OVCAR3 cells that did not express abundant NAC-I (Figure 1 IB). Furthermore, we found that the apoptosis-inducing effect of the siRNAs used here was potent, but was less pronounced than the N130 dominant negative NAC-I (Figure 11C), indicating that the latter approach could be a more effective experimental system to inactivate NAC-I function. As a control, we expressed N130 in OVCAR3 which expressed only minimal amount of NAC-I protein comparing to HeLa and SKOV3 cells and found that Nl 30 expression did not have a significant effect on the growth of OVCAR3 cells (Figure 1 ID).
Figures 12A-D depict (A) N130 expression in HeLa tumor cells. Interruption of NAC-I homomeric interaction by the N130 deletion mutant almost completely prevents tumor formation (open circles) but not in wild-type (closed circles). (B) discontinuation of doxycyclin treatment in established tumors results in a decrease in green fluorescent protein, indicating Nl 30 induction. (C) Tumor volumes did not increase in the N130-induced group (open circle), whereas the control noninduced tumors continue increasing tumor volumes. (D) Histopathological examination of tumors in both groups reveals an increased apoptotic activity in Nl 30 induced tumors.
Figures 13A-B depict Nl 30 expression in SKO V3 tumors in vivo. Expression of the N130 deletion mutant prevents tumor formation in all mice (open circles) but not in SKO V3 cells without Nl 30 induction (closes circles) (A). Nl 30 induction after SKOV3 tumors have established results in a decrease in tumor volumes (open circles) but not in control tumors (closed circles).
Figures 14A-B set froth the nucleic acid and polypeptide sequence of NAC-I as SEQ ID NO:1 and SEQ ID NO:2, respectively.
Figures 15A-F depict that NAC-I protein expression is upregulated in post- chemotherapy ovarian carcinoma: Two peritoneal effusions showing strong (A) and weak (B) nuclear NAC-I expression. The specimen in A was obtained post- chemotherapy, effusion B prior to the administration of chemotherapy. Reactive cells, mainly lymphocytes, in figure B are negative. Strong NAC-I expression in a post- chemotherapy metastasis to the colon (C), with no expression in a pre-chemotherapy primary tumor (D). Strong NAC-I expression in post chemotherapy metastasis of the colon (E), with no expression in a prechemotherapy primary tumor (F). Figures 16A-B demonstrate the predictive role of NAC-I in post-chemotherapy effusions. A: Kaplan-Meier survival curve showing the correlation between higher NAC-I staining intensity and poor PFS for patients with post-chemotherapy effusions (n=62 patients). Patients with effusions with strong NAC-I expression (n=27, dashed line) had a mean PFS of 7 months compared to 11 months for patients with effusions with weak or negative expression (n=35, solid line; p=0.039). B: Kaplan-Meier survival curve showing the correlation between more advanced FIGO stage (IV vs. Ill) and poor DFS for patients with post-chemotherapy effusions (n=59 patients, 2 patients with stage II disease and one with unknown stage excluded). Patients diagnosed with stage rv disease (n=13, dashed line) had a mean PFS of 4 months compared to 10 months for patients with effusions diagnosed with stage III disease (n=46, solid line; p=0.004).
DETAILED DESCRIPTION OF THE INVENTION As used herein, the term "cell-proliferative disorder" denotes malignant as well as nonmalignant populations of transformed cells which morphologically often appear to differ from the surrounding tissue. In one embodiment, the cell proliferative disorder is cancer.
As used herein, "transformed cells" refers to cell which have spontaneously converted to a state of unrestrained growth, i.e., they have acquired the ability to grow through an indefinite number of divisions in culture. Transformed cells may be characterized by such terms as neoplastic, anaplastic and/or hyperplastic with respect to their loss of growth control.
As used herein, the term "cancer" is used to mean a condition in which a cell in a subject's body undergoes abnormal, uncontrolled proliferation. Thus, "cancer" is a cell-proliferative disorder. Non-limiting examples of cancers include breast cancer, ovarian cancer, cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer.
"Administering" is defined herein as a means providing the composition to the subject in a manner that results in the composition being inside the subject's body. Such an administration can be by any route including, without limitation, subcutaneous, intradermal, intravenous, intra-arterial, intraperitoneal, and intramuscular. By "treating" a subject or subjecting a subject to "treatment", it is meant that the subject's symptoms are partially or totally alleviated, or remain static following treatment according to the invention. A subject that has been treated can exhibit a partial or total alleviation of symptoms (for example, tumor load). The term "treatment" is intended to encompass prophylaxis, therapy and cure.
A "therapeutically effective amount" is defined herein an effective amount of composition for producing some desire therapeutic effect.
A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "effective amount" (ED50) of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
The term "sample" is defined herein as blood, blood product, biopsy tissue, serum, and any other type of fluid or tissue that can be extracted from a subject or a mammal. The terms "sample" and "biological sample" are used interchangeably in this application.
As used herein, a "subject" can be any mammal, e.g., a human.
NAC-I polypeptides, or nucleic acids encoding NAC-I polypeptides, or portions thereof may act as markers useful in the detection of a cell-proliferative disorder, the monitoring of a cell-proliferative disorder or as targets for treating a cell- proliferative disorder.
As used herein a "NAC-I marker" refers to a NAC-I polypeptide or a nucleic acid (such as an mRNA) encoding a NAC-I polypeptide. As used herein the term "NAC-I polypeptide" refers to the full-length NAC-I polypeptide, or fragment thereof. Thus, the term "NAC-I polypeptide" includes fragments of NAC-I.
In one embodiment, the NAC-I polypeptide of the invention is encoded by SEQ ID NO:1, or a fragment thereof. In another embodiment, the NAC-I polypeptide of the invention is encoded by a nucleic acid that hybridizes to SEQ ID NO: 1 under stringent conditions.
In another embodiment, the NAC-I polypeptide comprises the amino acid sequence of SEQ ID NO:2, or a fragment thereof. In another embodiment, the NAC-I polypeptide comprises an amino acid sequence having conservative amino acid substitutions as compared to SEQ ID NO:2, or a fragment of said amino acid sequence.
Variants of NAC-I
The claimed invention includes the use of variants of the NAC-I polypeptides. Variants of the present invention may have an amino acid sequence that is different by one or more amino acid substitutions to the amino acid sequence disclosed in SEQ ID NO: 2. Embodiments which comprise amino acid deletions and/or additions are also contemplated. The variant may have conservative changes (amino acid similarity), wherein a substituted amino acid has similar structural or chemical properties, for example, the replacement of leucine with isoleucine. Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or proposed pharmacological activity may be reasonably inferred in view of this disclosure and may further be found using computer programs well known in the art, for example, DNAStar™ software.
Amino acid substitutions may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as a biological and/or pharmacological activity of the native molecule is retained.
Negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, and valine; amino acids with aliphatic head groups include glycine, alanine; asparagine, glutamine, serine; and amino acids with aromatic side chains include tryptophan, phenylalanine, and tyrosine.
"Identity" is a measure of the similarity of nucleotide sequences or amino acid sequences, hi order to characterize the identity, subject sequences are aligned so that the highest percentage identity (match) is obtained, after introducing gaps, if necessary, to achieve maximum percent identity. N- or C-terminal extensions shall not be construed as affecting identity. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. Computer program methods to determine identity between two sequences, for example, include DNAStar™ software (DNAStar Inc. Madison, Wis.); the GCG™ program package (Devereux, J., et al. Nucleic Acids Research (1984) 12(1): 387); BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J. Molec Biol (1990) 215: 403). Homology (identity) as defined herein is determined conventionally using the well-known computer program, BESTFIT™ (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis., 53711). When using BESTFIT™ or any other sequence alignment program (such as the Clustal algorithm from MegAlign software (DNAStar™) to determine whether a particular sequence is, for example, about 90% homologous to a reference sequence, according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence or amino acid sequence and that gaps in homology of up to about 90% of the total number of nucleotides in the reference sequence are allowed.
In one embodiment, the NAC-I polypeptide is a variant of SEQ ID NO:2. In one embodiment, the NAC-I polypeptide is at least 99%, 98%, 97%, 96%, 95%, 90%, 85% or 80% identical to SEQ ID NO:2. In another embodiment, the NAC-I polypeptide is encoded by a nucleic acid that is at least 99%, 98%, 97%, 96%, 95%, 90%, 85% or 80% homologous to SEQ ID NO: 1.
NAC-I Modulators The present invention also provides NAC-I modulators. In one embodiment, the NAC-I modulators are NAC-I antagonists. As used herein, a "NAC-I antagonist" is any molecule which inhibits the biological or functional effect of naturally occurring NAC-I. A NAC-I antagonist may inhibit the biological or functional effect of naturally occurring NAC-I by any means. In one embodiment, a NAC-I antagonist inhibits the biological or functional effect of naturally occurring NAC-I by decreasing the expression or activity of NAC- 1. In another embodiment, a NAC-I antagonist inhibits the biological or functional effect of naturally occurring NAC-I by specifically binding to NAC-I.
A NAC-I antagonist may be a peptide or a peptidomimetic, an antibody or fragment thereof that binds NAC-I, a nucleic acid molecule, or a small molecule.
Antibodies to NAC-I
Another aspect of the invention pertains to antibodies, or fragments thereof, which specifically binds to a NAC-I . In one embodiment, the invention comprises an isolated antibody or fragment thereof which binds specifically to a NAC-I polypeptide, or fragment thereof. In one embodiment, the antibody or fragment thereof binds specifically to a NAC-I polypeptide or fragment thereof encoded by a nucleic acid comprising SEQ ID NO: lor a fragment thereof, or comprising the amino acid sequence of SEQ ID NO:2. hi another embodiment, the antibody or fragment thereof binds specifically to the extracellular domain of a NAC-I polypeptide.
In one embodiment, the invention comprises an isolated antibody or fragment thereof which is a NAC-I antagonist. In one embodiment, the antibody or fragment thereof further comprises a label, wherein the label is selected from the group consisting of a fluorescent label, a radiolabel, a toxin, a metal compound and biotin. In one embodiment the fluorescent label is selected from the group consisting of Texas Red, phycoerythrin (PE), cytochrome c, and fluorescent isothiocyante (FITC). In another embodiment, the radiolabel is selected from the group consisting of 32P, 33P5 43K, 47Sc, 52Fe, 57Co, 64Cu, 67Ga, 67Cu, 68Ga, 71Ge, 75Br, 76Br, 77Br, 77As, 77Br, 81Rb/81MKr, 87MSr, 90Y, 97Ru, 99Tc, 100Pd, 101Rh, 103Pb, 105Rh, 109Pd, 111Ag, 111In, 113In, 119Sb, m Sn, 1231, 1251, 127Cs, 128Ba, 129Cs, 1311, 131Cs, 143Pr, 153Sm, 161Tb, 166Ho, 169Eu, 177Lu, 186Re, 188Re, 189Re, 191Os, 193Pt, 194Ir, 197Hg, 199Au, 203Pb, 211At, 212Pb, 212Bi and 213Bi. In another embodiment, the toxin is selected from the group consisting of ricin, ricin A chain (ricin toxin), Pseudomonas exotoxin (PE), diphtheria toxin (DT), Clostridium perfringens phospholipase C (PLC), bovine pancreatic ribonuclease (BPR), pokeweed antiviral protein (PAP), abrin, abrin A chain (abrin toxin), cobra venom factor (CVF), gelonin (GEL), saporin (SAP), modeccin, viscurnin and volkensin. A person of skilled in the art would know how to make antibodies or fragments thereof which specifically bind to a NAC-I . For example, by using peptides based on the sequence of NAC-I, specific antisera or monoclonal antibodies can be made using standard methods. Chickens, or a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., an antigenic fragment which is capable of eliciting an antibody response). Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. For instance, a peptidyl portion of one of the subject proteins can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
Following immunization, antisera can be obtained and, if desired, polyclonal antibodies against the target protein can be further isolated from the serum. To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Such techniques are well known in the art, and include, for example, the hybridoma technique (originally developed by Kohler and Milstein, Nature, 256: 495-497, 1975), as well as the human B cell hybridoma technique (Kozbar et al., Immunology Today, 4: 72, 1983), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96, 1985). Hybridoma cells can be screened irnmunochemically for production of antibodies specifically reactive with the NAC-I polypeptides and the monoclonal antibodies isolated.
The term antibody as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject proteins or complexes including the subject proteins. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab')2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. The antibody of the present invention is further intended to include bispecific and chimeric molecules, as well as single chain (scFv) antibodies. The subject antibodies include humanized antibodies, which can be prepared as described, e.g., in U.S. Pat. No. 5,585,089. Also within the scope of the invention are single chain antibodies. All of these modified forms of antibodies as well as fragments of antibodies are intended to be included in the term "antibody" and are included in the broader term "binding moiety". Antibodies of the present invention can be made recombinantly. Linkers may be added to the nucleic acid sequences of the heavy and light chains to increase flexibility of the antibody. In the case of a scFv, the linkers are added to connect the VH and VL chains and the varying composition can effect solubility, proteolytic stability, flexibility, and folding. In specific embodiments, the invention provides mouse monoclonal antibodies such as those described in the Examples. In one embodiment, the monoclonal antibody recognizes the C-terminal end of NAC-I.
Peptides and Peptidomimetics
One embodiment of the present inventions are peptides, and compositions thereof, which may be used to detect a NAC-I polypeptide or to treat a subject having a disease or disorder characterized by overexpression of NAC-I. Peptides of the present invention can comprise 5-50 amino acid residues. More preferably, peptides of the present invention comprise 5-30 amino acid residues. More preferably, peptides of the present invention comprise 5-20 amino acid residues. More preferably, peptides of the present invention comprise 10-15 amino acid residues. In one particular example, a peptide of the invention is Nl 30 which is described in the examples.
Another aspect of the invention provides a peptide or peptidomimetic, e.g., wherein one or more backbone bonds are replaced or one or more side chains of a naturally occurring amino acid are replaced with sterically and/or electronically similar functional groups.
In certain embodiments, the peptide or peptidomimetic is formulated in a pharmaceutically acceptable excipient.
Nucleic Acid Molecules
The instant invention provides nucleic acid molecules encoding NAC-I, and fragments thereof. In one embodiment, the nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 89%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or more identical to the entire length of the nucleotide sequence shown in SEQ ID NO:1, or a portion of any of this nucleotide sequence.
Moreover, the nucleic acid molecule of the invention can comprise only a portion of the nucleic acid sequence of SEQ ID NO: 1.
The invention further provides antisense oligonucleotides. These are relatively short nucleic acids that are complementary (or antisense) to the coding strand (sense strand) of the rnRNA encoding a particular protein. Although antisense oligonucleotides are typically RNA based, they can also be DNA based. Additionally, antisense oligonucleotides are often modified to increase their stability.
The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published Dec. 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134, published Apr. 25, 1988), hybridization-triggered cleavage agents (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule.
The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxytriethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, S-methoxyaminomethyl^-thiouracil, beta-D-mannosylqueosine, S'-methoxycarboxymethyluracil, 5-methoxyuracil, 2- methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracii-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6- diaminopurine. The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2- fluoroarabinose, xylulose, and hexose.
The antisense oligonucleotide can also contain a neutral peptide-like backbone. Such molecules are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:14670 and in Eglom et al. (1993) Nature 365:566. One advantage of PNA oligomers is their capability to bind to complementary DNA essentially independently from the ionic strength of the medium due to the neutral backbone of the DNA. In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet a further embodiment, the antisense oligonucleotide is an -anomeric oligonucleotide. An -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131 -6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
Oligonucleotides of the invention maybe synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
The selection of an appropriate oligonucleotide can be readily performed by one of skill in the art. Given the nucleic acid sequence encoding a particular protein, one of skill in the art can design antisense oligonucleotides that bind to that protein, and test these oligonucleotides in an in vitro or in vivo system to confirm that they bind to and mediate the degradation of the mRNA encoding the particular protein. To design an antisense oligonucleotide that specifically binds to and mediates the degradation of a particular protein, it is important that the sequence recognized by the oligonucleotide is unique or substantially unique to that particular protein. For example, sequences that are frequently repeated across protein may not be an ideal choice for the design of an oligonucleotide that specifically recognizes and degrades a particular message. One of skill in the art can design an oligonucleotide, and compare the sequence of that oligonucleotide to nucleic acid sequences that are deposited in publicly available databases to confirm that the sequence is specific or substantially specific for a particular protein.
In another example, it may be desirable to design an antisense oligonucleotide that binds to and mediates the degradation of more than one message. In one example, the messages may encode related protein such as isoforms or functionally redundant protein. In such a case, one of skill in the art can align the nucleic acid sequences that encode these related proteins, and design an oligonucleotide that recognizes both messages. A number of methods have been developed for delivering antisense DNA or
RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically. However, it may be difficult to achieve intracellular concentrations of the antisense sufficient to suppress translation on endogenous mRNAs in certain instances. Therefore another approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bemoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3r long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al, 1982, Nature 296:39-42), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systematically).
RNAi constructs comprise double stranded RNA that can specifically block expression of a target gene. "RNA interference" or "RNAi" is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. Without being bound by theory, RNAi appears to involve mRNA degradation, however the biochemical mechanisms are currently an active area of research. Despite some mystery regarding the mechanism of action, RNAi provides a useful method of inhibiting gene expression in vitro or in vivo.
As used herein, the term "dsRNA" refers to siRNA molecules, or other RNA molecules including a double stranded feature and able to be processed to siRNA in cells, such as hairpin RNA moieties.
The term "loss-of-function," as it refers to genes inhibited by the subject RNAi method, refers to a diminishment in the level of expression of a gene when compared to the level in the absence of RNAi constructs.
As used herein, the phrase "mediates RNAi" refers to (indicates) the ability to distinguish which RNAs are to be degraded by the RNAi process, e.g., degradation occurs in a sequence-specific manner rather than by a sequence-independent dsRNA response, e.g., a PKR response.
As used herein, the term "RNAi construct" is a generic term used throughout the specification to include small interfering RNAs (siRNAs), hairpin RNAs, and other RNA species which can be cleaved in vivo to form siRNAs. RNAi constructs herein also include expression vectors (also referred to as RNAi expression vectors) capable of giving rise to transcripts which form dsRNAs or hairpin RNAs in cells, and/or transcripts which can produce siRNAs in vivo.
"RNAi expression vector" (also referred to herein as a "dsRNA-encoding plasmid") refers to replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed. Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a "coding" sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences. The choice of promoter and other regulatory elements generally varies according to the intended host cell. In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto. The RNAi constructs contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (i.e., the "target" gene). The double- stranded RNA need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi. Thus, the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence. The number of tolerated nucleotide mismatches between the target sequence and the RNAi construct sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center of the siRNA duplex are most critical and may essentially abolish cleavage of the target RNA. In contrast, nucleotides at the 31 end of the siRNA strand that is complementary to the target RNA do not significantly contribute to ■ specificity of the target recognition.
Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. hybridization for 12-16 hours; followed by washing). Production of RNAi constructs can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro. The RNAi constructs may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties. For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA. Likewise, bases may be modified to block the activity of adenosine deaminase. The RNAi construct may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis. Methods of chemically modifying RNA molecules can be adapted for modifying RNAi constructs (see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J MoI Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61). Merely to illustrate, the backbone of an RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2'-substituted ribonucleosides, a- configuration).
The double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell. The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition.
In certain embodiments, the subject RNAi constructs are "small interfering RNAs" or "siRNAs." These nucleic acids are around 19-30 nucleotides in length, and even more preferably 21-23 nucleotides in length, e.g., corresponding in length to the fragments generated by nuclease "dicing" of longer double-stranded RNAs. The siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target rnRNA is degraded by the nucleases in the protein complex. In a particular embodiment, the 21- 23 nucleotides siRNA molecules comprise a 3' hydroxyl group. The siRNA molecules of the present invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA can be chemically synthesized or recombinantly produced using methods known in the art. For example, short sense and antisense RNA oligomers can be synthesized and annealed to form double-stranded RNA structures with 2-nucleotide overhangs at each end (Caplen, et al. (2001) Proc Natl Acad Sci USA, 98:9742-9747; Elbashir, et al. (2001) EMBO J, 20:6877-88). These double-stranded siRNA structures can then be directly introduced to cells, either by passive uptake or a delivery system of choice, such as described below.
In certain embodiments, the siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer. In one embodiment, the Drosophila in vitro system is used. In this embodiment, dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides. The siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.
In certain preferred embodiments, at least one strand of the siRNA molecules has a 3' overhang from about 1 to about 6 nucleotides in length, though may be from 2 to 4 nucleotides in length. More preferably, the 3' overhangs are 1-3 nucleotides in length. In certain embodiments, one strand having a 3' overhang and the other strand being blunt-ended or also having an overhang. The length of the overhangs may be the same or different for each strand. In order to further enhance the stability of the siRNA, the 3' overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotide 3' overhangs by 2'-deoxythyinidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium and may be beneficial in vivo. In other embodiments, the RNAi construct is in the form of a long double- stranded RNA. In certain embodiments, the RNAi construct is at least 25, 50, 100, 200, 300 or 400 bases. In certain embodiments, the RNAi construct is 400-800 bases In length. The double-stranded RNAs are digested intracellularly, e.g., to produce siRNA sequences in the cell. However, use of long double-stranded RNAs in vivo is not always practical, presumably because of deleterious effects which may be caused by the sequence-independent dsRNA response. In such embodiments, the use of local delivery systems and/or agents which reduce the effects of interferon or PE-R are preferred.
In certain embodiments, the RNAi construct is in the form of a hairpin structure (named as hairpin RNA). The hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al., Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature, 2002, 418:38-9; McManus et al., RNA, 2002, 8:842-50; Yu et al., Proc Natl Acad Sci USA72002, 99:6047-52). Preferably, such hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that siRNAs can be produced by processing a hairpin RNA in the cell.
In yet other embodiments, a plasmid is used to deliver the double-stranded RNA, e.g., as a transcriptional product. In such embodiments, the plasmid is designed to include a "coding sequence" for each of the sense and antisense strands of the RNAi construct. The coding sequences can be the same sequence, e.g., flanked by inverted promoters, or can be two separate sequences each under transcriptional control of separate promoters. After the coding sequence is transcribed, the complementary RNA transcripts base-pair to form the double-stranded RNA.
PCT application WOO 1/77350 describes an exemplary vector for bi-directional transcription of a transgene to yield both sense and antisense RNA transcripts of the same transgene in a eukaryotic cell. Accordingly, in certain embodiments, the present invention provides a recombinant vector having the following unique characteristics: it comprises a viral replicon having two overlapping transcription units arranged in an opposing orientation and flanking a transgene for an RNAi construct of interest, wherein the two overlapping transcription units yield both sense and antisense RNA transcripts from the same transgene fragment in a host cell. RNAi constructs can comprise either long stretches of double stranded RNA identical or substantially identical to the target nucleic acid sequence or short stretches of double stranded RNA identical to substantially identical to only a region of the target nucleic acid sequence. Exemplary methods of making and delivering either long or short RNAi constructs can be found, for example, in WOO 1/68836 and WO01/75164.
Ribozyme molecules designed to catalytically cleave an mRNA transcript can also be used to prevent translation of mRNA (See, e.g., PCT International Publication WO90/11364, published Oct. 4, 1990; Sarver et al., 1990, Science 247:1222-1225 and U.S. Pat. No. 5,093,246). While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA has the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591.
The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the TVS, or L- 19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231 :470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216). The Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes that target eight base-pair active site sequences.
As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and can be delivered to cells in vitro or in vivo. A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy targeted messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Pharmaceutical Compositions
Each of the embodiments of the present invention can be used as a composition when combined with a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers are physiologically acceptable and retain the therapeutic properties of the antibodies or peptides present in the composition. Pharmaceutically- acceptable carriers are well-known and generally described in, for example, Remington's Pharmaceutical Sciences (18.sup.th Edition, ed. A. Gennaro, Mack Publishing Co., Easton, Pa., 1990). On exemplary pharmaceutically acceptable carrier is physiological saline.
Chemotherapeutic Agents
The instant invention also provides methods of treating a subject using a combination treatment. In one example, a NAC-I modulator is used with a chemotherapeutic agent. Chemotherapeutic agents contemplated by the present invention include chemotherapeutic drugs that are commercially available.
Merely to illustrate, the chemotherapeutic can be an inhibitor of chromatin function, a topoisomerase inhibitor, a microtubule inhibiting drug, a DNA damaging agent, an antimetabolite (such as folate antagonists, pyrimidine analogs, purine analogs, and sugar-modified analogs), a DNA synthesis inhibitor, a DNA interactive agent (such as an intercalating agent), and/or a DNA repair inhibitor.
Chemotherapeutic agents may be categorized by their mechanism of action into, for example, the following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors
(mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, tenyposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, doxorubicin, epirubicin, hexamethylmelamineoxaliplatin, ϊphosphamide, melphalan, merchlorehtamine, mitomycin, mitoxantrone, nitrosourea, plicamycin, procarbazine, taxol, taxotere, teniposide, triethylenethiophosphoramide and etoposide (VP 16)); antibiotics such as dactinomycin (actinomycin D)3 daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (niithramycin) and mitomycin; enzymes (L-asparaginase which systemically metabolizes L-asparagine and deprives cells which do not have the capacity to synthesize their own asparagine); antiplatelet agents; antiproliferative/antimitotic alkylating agents such as nitrogen mustards (mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (hexamethylmelamine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (carmustine (BCNU) and analogs, streptozocin), trazenes—dacarbazinine (DTIC); antiproliferative/antimitotic antimetabolites such as folic acid analogs (methotrexate); platinum coordination complexes (cisplatin, carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide; hormones, hormone analogs (estrogen, tamoxifen, goserelin, bicalutamide, nilutamide) and aromatase inhibitors (letrozole, anastrozole); anticoagulants (heparin, synthetic heparin salts and other inhibitors of thrombin); fibrinolytic agents (such as tissue plasminogen activator, streptokinase and urokinase), aspirin, dipyridamole, ticlopidine, clopidogrel, abciximab; antimigratory agents; antisecretory agents (breveldin); immunosuppressives (cyclosporine, tacrolimus (FK- 506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil); anti-angiogenic compounds (TNP470, genistein) and growth factor inhibitors (vascular endothelial growth factor (VEGF) inhibitors, fibroblast growth factor (FGF) inhibitors); angiotensin receptor blocker; nitric oxide donors; anti-sense oligonucleotides; antibodies (trastuzumab, rituximab); cell cycle inhibitors and differentiation inducers (tretinoin); mTOR inhibitors, topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicm, dactinomycin, eniposide, epirubicin, etoposide, idarubicin, iiinotecan (CPT-11) and mitoxantrone, topotecan, irinotecan), corticosteroids (cortisone, dexamethasone, hydrocortisone, methylpednisolone, prednisone, and prenisolone); growth factor signal transduction kinase inhibitors; mitochondrial dysfunction inducers, toxins such as Cholera toxin, ricin, Pseudomonas exotoxin, Bordetella pertussis adenylate cyclase toxin, or diphtheria toxin, and caspase activators; and chromatin disruptors. Preferred dosages of the chemotherapeutic agents are consistent with currently prescribed dosages.
Methods of Diagnosis
The invention provides a method for diagnosis of a cell -proliferative disorder in a subject comprising detecting the presence of a NAC-I marker in a sample, wherein the presence of said marker is indicative of the cell-proliferative disorder. In one embodiment, the cell-proliferative disorder is cancer, hi another embodiment, the cancer is breast cancer, ovarian, cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer. In one embodiment the cancer is ovarian cancer.
The invention also provides a method for assessing NAC-I status in a subject comprising detecting the presence of a NAC-I marker in a biological sample obtained from a subject. Li one embodiment, the method for assessing NAC-I status further comprising quantifying the amount of NAC-I marker in the biological sample, wherein the amount of NAC-I marker in the biological sample is indicative of NAC-I status.
The invention also provides methods for detecting the recurrence of cancer in a subject by detecting the presence or amount of a NAC-I marker in an biological sample. hi another embodiment, the invention also provides prognostic methods for determining the length of time a subject will survive based on the levels of NAC-I expression. The NAC-I marker can be any of the markers described above, hi one embodiment, the NAC-I marker is a NAC-I polypeptide or a fragment thereof. In a another embodiment, the marker is a NAC-I nucleic acid. hi one embodiment the NAC-I marker is a NAC-I polypeptide encoded by a nucleic acid comprising SEQ ID NO:1 or a fragment thereof. In another one embodiment the NAC-I marker is a polypeptide encoded by a nucleic acid that hybridizes to SEQ ID NO:1 under stringent conditions. hi another embodiment, the NAC-I marker is a NAC-I polypeptide which comprises the amino acid sequence of SEQ ID NO:2 or a fragment thereof. The methods of the present invention may be performed in any relevant sample. A sample can be a tissue, a cell or a body fluid. In one embodiment, the tissue is ovarian tissue, preferably biopsy tissue. The body fluid can be any body fluid, including but not limited to blood, serum, plasma, urine, saliva, sputum and breast ductal secretions. In one embodiment, the body fluid is blood or serum.
Protein Based Assays
In one embodiment, the NAC-I marker is a NAC-I polypeptide or a fragment thereof. A NAC-I polypeptide may be detected using any assay method available in the art, a subset of which is discussed below. Non-limiting examples of such methods include immunohistochemistry, ELISAs, MRI and Western blots.
In one embodiment the presence of NAC-I polypeptide marker is determined by: (a) contacting said sample with a binding moiety which binds specifically to said NAC-I polypeptide or fragment thereof to produce a binding moiety-NAC-1 polypeptide complex, and (b) detecting the binding moiety-NAC-1 polypeptide complex, wherein the presence of said complex is indicative of cancer, e.g., breast or ovarian cancer.
In one embodiment, the binding moiety is an antibody or a fragment thereof. In one embodiment, the antibody is a monoclonal antibody. In another embodiment, the antibody is a polyclonal antibody. In another embodiment the antibody further comprises a label. In one embodiment, the label is selected from the group consisting of a radioactive label, a fluorescent label, a chemiluminescent label, a spin label, a colored label, and an enzymatic label. In one embodiment, the method for detecting the presence of a NAC-I polypeptide further comprises the step of measuring the concentration or amount of the polypeptide in the sample.
In one embodiment, the protein may be reacted with a binding moiety, such as an antibody, capable of specifically binding the protein being detected. Binding moieties, such as antibodies, may be designed using methods available in the art so that they interact specifically with the protein being detected. Optionally, a labeled binding moiety may be utilized. In such an embodiment, the sample is reacted with a labeled binding moiety capable of specifically binding the protein, such as a labeled antibody, to form a labeled complex of the binding moiety and the target protein being detected. Detection of the presence of the labeled complex then may provide an indication of the presence of a breast cancer in the individual being tested. In one approach, for example, the marker protein may be detected using a binding moiety capable of specifically binding the marker protein. The binding moiety may comprise, for example, a member of a specific binding pair, such as antibody- antigen, enzyme-substrate, nucleic acid-nucleic acid, protein-nucleic acid, protein- protein, or other specific binding pair known in the art. Binding proteins may be designed which have enhanced affinity for a target protein. Optionally, the binding moiety may be linked with a detectable label, such as an enzymatic, fluorescent, radioactive, phosphorescent or colored particle label. The labeled complex may be detected, e.g., visually or with the aid of a spectrophotometer or other detector. A NAC- 1 marker may be detected using any of a wide range of immunoassay techniques available in the art. For example, the skilled artisan may employ the sandwich immunoassay format to detect breast cancer in a body fluid sample. Alternatively, the skilled artisan may use conventional immuno-histochemical procedures for detecting the presence of NAC-I polypeptide a tissue sample using one or more labeled binding proteins.
In a sandwich immunoassay, two antibodies capable of binding the marker protein generally are used, e.g., one immobilized onto a solid support, and one free in solution and labeled with a detectable chemical compound. Examples of chemical labels that may be used for the second antibody include radioisotopes, fluorescent compounds, spin labels, colored particles such as colloidal gold and colored latex, and enzymes or other molecules that generate colored or electrochemically active products when exposed to a reactant or enzyme substrate. When a sample containing the marker protein is placed in this system, the marker protein binds to both the immobilized antibody and the labeled antibody, to form a "sandwich" immune complex on the support's surface. The complexed protein is detected by washing away non-bound sample components and excess labeled antibody, and measuring the amount of labeled antibody complexed to protein on the support's surface. Alternatively, the antibody free in solution, which can be labeled with a chemical moiety, for example, a hapten, may be detected by a third antibody labeled with a detectable moiety which binds the free antibody or, for example, the hapten coupled thereto.
Both the sandwich immunoassay and tissue immunohistochemical procedures are highly specific and very sensitive, provided that labels with good limits of detection are used. A detailed review of immunological assay design, theory and protocols can be found in numerous texts in the art, including Butt, W. R., ed. (1984) Practical Immunology, Marcel Dekker, N. Y. and Harlow et al. eds. (1988) Antibodies, A Laboratory Approach, Cold Spring Harbor Laboratory.
In general, immunoassay design considerations include preparation of antibodies (e.g., monoclonal or polyclonal antibodies) having sufficiently high binding specificity for the target protein to form a complex that can be distinguished reliably from products of nonspecific interactions. As used herein, the term "antibody" is understood to mean binding proteins, for example, antibodies or other proteins comprising an immunoglobulin variable region-like binding domain, having the appropriate binding affinities and specificities for the target protein. The higher the antibody binding specificity, the lower the target protein concentration that can be detected.
Antibodies to an isolated NAC-I polypeptide which are useful in assays for detecting a cancer in an individual may be generated using standard immunological procedures well known and described in the art. See, for example, Practical Immunology, Butt, N. R., ed., Marcel Dekker, NY, 1984. Briefly, an isolated target protein is used to raise antibodies in a xenogeneic host, such. as a mouse, goat or other suitable mammal. The marker protein is combined with a suitable adjuvant capable of enhancing antibody production in the host, and is injected into the host, for example, by intraperitoneal administration. Any adjuvant suitable for stimulating the host's immune response may be used. A commonly used adjuvant is Freund's complete adjuvant (an emulsion comprising killed and dried microbial cells). Where multiple antigen injections are desired, the subsequent injections may comprise the antigen in combination with an incomplete adjuvant (e.g., cell-free emulsion). Polyclonal antibodies may be isolated from the antibody-producing host by extracting serum containing antibodies to the protein of interest. Monoclonal antibodies may be produced by isolating host cells that produce the desired antibody, fusing these cells with myeloma cells using standard procedures known in the immunology art, and screening for hybrid cells (hybridomas) that react specifically with the target protein and have the desired binding affinity. Antibody binding domains also may be produced biosynthetically and the amino acid sequence of the binding domain manipulated to enhance binding affinity with a preferred epitope on the target protein. Specific antibody methodologies are well understood and described in the literature. A more detailed description of their preparation can be found, for example, in Butt (1984) (supra). In addition, genetically engineered biosynthetic antibody binding sites, also known in the art as BABS or sFv's, may be used in the practice of the instant invention. Methods for making and using BABS comprising (i) non-covalently associated or disulfide bonded synthetic VH and VL dimers, (ii) covalently linked VH- VL single chain binding sites, (iii) individual VH or VL domains, or (iv) single chain antibody binding sites are disclosed, for example, in U.S. Pat. Nos. 5,091,513; 5,132,405; 4,704,692; and 4,946,778. Furthermore, BABS having requisite specificity for the NAC-I polypeptide can be derived by phage antibody cloning from combinatorial gene libraries (see, for example, Clackson et al. (1991) Nature 352: 624- 628; or U.S. Pat. No. 5,837,500). Briefly, phage each expressing on their coat surfaces BABS having immunoglobulin variable regions encoded by variable region gene sequences derived from mice pre-immunized with NAC-I polypeptide, or fragments thereof, are screened for binding activity against immobilized NAC-I polypeptide. Phage which bind to the immobilized NAC-I polypeptide are harvested and the gene encoding the BABS is sequenced. The resulting nucleic acid sequences encoding the BABS of interest then may be expressed in conventional expression systems to produce the BABS protein.
Marker proteins may also be detected using gel electrophoresis techniques available in the art. In two-dimensional gel electrophoresis, the proteins are separated first in a pH gradient gel according to their isoelectric point. The resulting gel then is placed on a second polyacrylamide gel, and the proteins separated according to molecular weight (see, for example, O'Farrell (1975) J. Biol. Chem. 250: 4007-4021; or Berkelman et al. (October 1998) 2-D Electrophoresis Using Immobilized pH Gradients: Principles and Methods, Amersham Pharmacia Biotech Pub. 80-6429-60, Rev. A).
One or more marker proteins may be detected by first isolating proteins from a sample obtained from an individual suspected of having cancer, and then separating the proteins by two-dimensional gel electrophoresis to produce a characteristic two- dimensional gel electrophoresis pattern. The pattern may then be compared with a standard gel pattern produced by separating, under the same or similar conditions, proteins isolated from normal or cancer cells. The standard gel pattern may be stored in, and retrieved from an electronic database of electrophoresis patterns. The presence of a NAC-I polypeptide in the two-dimensional gel provides an indication that the sample being tested was taken from a person with cancer, e.g., ovarian cancer. As with the other detection assays described herein, the detection of two or more proteins, for example, in the two-dimensional gel electrophoresis pattern further enhances the accuracy of the assay. The assay thus permits the early detection and treatment of cancer. Mass spectrometry may also be used to detect a marker protein. Preferred mass spectrometry methods include MALDI-TOF mass spectrometry and MALDI-TOF using derivatized chip surfaces (SELDI). Useful mass spectrometry methods for detecting a marker protein are described, for example, in the Examples and in U.S. Pat. Nos. 5,719,060; 6,124,137; 6,207,370; 6,225,047; 6,281,493; and 6,322,970. These detection methods may be used in combination with each other, with other detection methods, and/or with one or more purification methods to reduce the complexity of a biological sample. Thus, for example, proteins isolated by two- dimensional gel electrophoresis could be probed with an antibody that specifically binds the marker protein, or could be assayed by mass spectrometry. Similarly, as described in the Examples, a biological sample may be subjected to biochemical fractionation prior to analysis by mass spectrometry or by other techniques such as gel electrophoresis and/or immunoassays. A marker protein may also be detected indirectly, for example, by subjecting it to enzymatic treatment, and subsequently detecting the products of that treatment.
Nucleic Acid Based Assays
In another embodiment, the NAC-I marker is a nucleic acid encoding NAC-I or a fragment thereof. A nucleic acid encoding NAC-I can be detected using any method available in the art of subset of which is discussed below. In one embodiment, the presence of a NAC-I nucleic acid marker is detected by a nucleic acid probe which may be designed using standard methods and are used to identify DNA or mRNA encoding NAC-I . See, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989). hi one embodiment, the nucleic acid probe is complementary to at least a portion of a DNA or RNA encoding a NAC-I polypeptide.
In one embodiment, the nucleic acid probe capable of detecting NAC-I is in a microarray containing a plurality of probes.
A detecting step according to the invention may comprise amplifying nucleic acid encoding a NAC-I polypeptide using a polymerase chain reaction ("PCR") or a reverse-transcriptase polymerase chain reaction. Detection of products of the PCR may be accomplished using known techniques, including hybridization with nucleic acid probes complementary to the amplified sequence.
Gene probes comprising complementary RNA or, preferably, DNA to NAC-I nucleotide sequences or mRNA sequences encoding NAC-I polypeptides may be produced using established recombinant techniques or oligonucleotide synthesis. The probes hybridize with complementary nucleic acid sequences presented in the test specimen, and can provide exquisite specificity. A short, well-defined probe, coding for a single unique sequence is most precise and preferred. Larger probes are generally less specific. While an oligonucleotide of any length may hybridize to an mRNA transcript, oligonucleotides typically within the range of 8-100 nucleotides, preferably within the range of 15-50 nucleotides, are envisioned to be most useful in standard hybridization assays. Choices of probe length and sequence allow one to choose the degree of specificity desired. Hybridization is carried out at from 50 to 65 0C in a high salt buffer solution, formamide or other agents to set the degree of complementarity required. Furthermore, the state of the art is such that probes can be manufactured to recognize essentially any DNA or RNA sequence. For additional particulars, see, for example, Berger et al. (1987) Guide to Molecular Techniques (Methods of Enzymology, vol. 152). A wide variety of different labels coupled to the probes or antibodies may be employed in the assays. The labeled reagents may be provided in solution or coupled to an insoluble support, depending on the design of the assay. The various conjugates may be joined covalently or noncovalently, directly or indirectly. When bonded covalently, the particular linkage group will depend upon the nature of the two moieties to be bonded. A large number of linking groups and methods for linking are taught in the literature. Broadly, the labels may be divided into the following categories: chromogens; catalyzed reactions; chemiluminescence; radioactive labels; and colloidal-sized colored particles. The chromogens include compounds which absorb light in a distinctive range so that a color may be observed, or emit light when irradiated with light of a particular wavelength or wavelength range, e.g., fluorescers. Both enzymatic and nonenzymatic catalysts may be employed. In choosing an enzyme, there will be many considerations including the stability of the enzyme, whether it is normally present in samples of the type for which the assay is designed, the nature of the substrate, and the effect if any of conjugation on the enzyme's properties. Potentially useful enzyme labels include oxiodoreductases, transferases, hydrolases, lyases, isomerases, ligases, or synthetases. Interrelated enzyme systems may also be used. A chemiluminescent label involves a compound that becomes electronically excited by a chemical reaction and may then emit light that serves as a detectable signal or donates energy to a fluorescent acceptor. Radioactive labels include various radioisotopes found in common use such as the unstable forms of hydrogen, iodine, phosphorus or the like. Colloidal-sized colored particles involve material such as colloidal gold that, in aggregate, form a visually detectable distinctive spot corresponding to the site of a substance to be detected. Additional information on labeling technology is disclosed, for example, in U.S. Pat. No. 4,366,241.
A common method of in vitro labeling of nucleotide probes involves nick translation wherein the unlabeled DNA probe is nicked with an endonuclease to produce free 31 hydroxyl termini within either strand of the double-stranded fragment. Simultaneously, an exonuclease removes the nucleotide residue from the 5' phosphoryl side of the nick. The sequence of replacement nucleotides is determined by the sequence of the opposite strand of the duplex. Thus, if labeled nucleotides are supplied, DNA polymerase will fill in the nick with the labeled nucleotides. Using this well-known technique, up to 50% of the molecule can be labeled. For smaller probes, known methods involving 3' end labeling may be used. Furthermore, there are currently commercially available methods of labeling DNA with fluorescent molecules, catalysts, enzymes, or chemiluminescent materials. Biotin labeling kits are commercially available (Enzo Biochem Inc.) under the trademark Bio-Probe. This type of system permits the probe to be coupled to avidin which in turn is labeled with, for example, a fluorescent molecule, enzyme, antibody, etc. For further disclosure regarding probe construction and technology, see, for example, Sambrook et al. (1989) supra, or Wu et al. (1997) Methods In Gene Biotechnology, CRC Press, New York.
The oligonucleotide selected for hybridizing to the target nucleic acid, whether synthesized chemically or by recombinant DNA methodologies, may be isolated and purified using standard techniques and then preferably labeled (e.g., with 35S or 32P) using standard labeling protocols. A sample containing the target nucleic acid then is run on an electrophoresis gel, the dispersed nucleic acids transferred to a nitrocellulose filter and the labeled oligonucleotide exposed to the filter under stringent hybridizing conditions, e.g., 50% formamide, 5xSSPE, 2x Denhardt's solution, 0.1% SDS at 42°C, as described in Sambrook et al. (1989) supra. The filter may then be washed using 2 x SSPE, 0.1% SDS at 680C, and more preferably using 0.1 X SSPE, 0.1% SDS at 68° C. Other useful procedures known in the art include solution hybridization, and dot and slot RNA hybridization. Optionally, the amount of the target nucleic acid present in a sample is then quantitated by measuring the radioactivity of hybridized fragments, using standard procedures known in the art.
Nucleic acid in a sample may also be detected by, for example, a Southern blot analysis by reacting the sample with a labeled hybridization probe, wherein the probe is capable of hybridizing specifically with at least a portion of the target nucleic acid molecule. Nucleic acid in a sample may also be detected by Northern blot analysis. A nucleic acid binding protein may also be used to detect nucleic acid encoding breast cancer-associated proteins.
Kits
In one embodiment, the invention provides a kit for detecting a cell- proliferative disorder comprising an agent which binds specifically to a NAC-I marker and instructions for use.
In one embodiment, the kit may comprise a reference sample, e.g., a negative and/or positive control. In that embodiment, the negative control would be indicative of a normal cell type and the positive control would be indicative of cancer. Such a kit may also be used for identifying potential candidate therapeutic agents for treating cancer. In one embodiment, the first binding moiety is labeled. In one embodiment, the kit further comprises a second binding moiety which binds specifically to the first binding moiety.
The above mentioned kit can be used for the detection of any cell-proliferative cancer including, without limitation, breast cancer, ovarian cervical cancer, prostate cancer, colon cancer, lung cancer, skin cancer, leukemia, lymphoma, melanoma or any other type of cancer. In one embodiment the kit is for the detection of ovarian cancer.
The kit may also be used to diagnose the recurrence of cancer, e.g., ovarian cancer. In one embodiment, the binding moiety in the kit is an antibody or fragment thereof which specifically binds to NAC-I. Antibodies and binding fragments thereof can be lyophilized or in solution. Additionally, the preparations can contain stabilizers to increase the shelf-life of the kits, e.g., bovine serum albumin (BSA). Wherein the antibodies and antigen binding fragments thereof are lyophilized, the kit can contain further preparations of solutions to reconstitute the preparations. Acceptable solutions are well known in the art, e.g., PBS. In one embodiment, the antibody is a polyclonal antibody, a monoclonal antibody, a humanized antibody, a chimeric antibody, a recombinant antibody, or fragment thereof. In a preferred embodiment, the antibody, or fragment thereof is immunoreactive with the extracellular domain of NAC-I or with soluble NAC-I.
Kits of the present invention can further include the components for an ELISA assay for measuring NAC-I and fragments thereof. Samples to be tested in this application include, for example, blood, serum, plasma, urine, lymph, tissue and products thereof.
Alternatively, the kits are used in immunoassays, such as immunohistochemistry to test subject tissue biopsy sections. The kits may also be used to detect the presence of a NAC-I marker in a biological sample obtained from a subject using immunohistocytochemistry. The compositions of the kit of the present invention can be formulated in single or multiple units for either a single test or multiple tests.
Methods of Monitoring Therapy
In one embodiment, the invention comprises a method of monitoring the effectiveness of a treatment for a cell-pro liferative disorder in a mammal, comprising quantifying the amount of a NAC-I marker in a sample, wherein a decrease in the NAC-I marker is indicative of the effectiveness of the treatment. The above-described method can be used to monitor the effectiveness of a cancer treatment. In a preferred embodiment, the method is used to monitor the effectiveness of ovarian cancer treatment.
In one embodiment, the concentration of a NAC-I polypeptide or fragment thereof is compared to a standard sample obtained from healthy and/or untreated subject. Samples can be collected at discrete intervals during treatment and compared to the standard. It is contemplated that changes in the level of NAC-I will be indicative of the efficacy of treatment.
Where the assay is used to monitor progression of a cell-pro liferative disorder such as cancer or the efficacy of a treatment, the step of detecting the presence and abundance of the marker protein or its transcript in samples of interest is repeated at intervals and these values then are compared, the changes in the detected concentrations reflecting changes in the status of the tissue. For example, an increase in the level of NAC-I may correlate with progression of the cancer. Where the assay is used to evaluate the efficacy of a therapy, the monitoring steps occur following administration of the therapeutic agent or procedure (e.g., following administration of a chemotherapeutic agent or following radiation treatment). Similarly, a decrease in the level of NAC-I may correlate with a regression of the cancer.
Thus, cancer may be identified by the presence of NAC-I as taught herein. Once identified, the cancer may be treated using compounds that reduce in vivo the expression and/or biological activity of the NAC-I . Furthermore, the methods provided herein can be used to monitor the progression and/or treatment of the disease.
Methods of Treatment
Because NAC-I is present at detectably higher levels in cancer cells, e.g., ovarian cancer cells, relative to normal cells, and in recurrent cancer cells as compared to normal cells, NAC-I may be used as target molecule for cell-pro liferative disorders in which NAC-I is upregulated.
In on embodiment, the invention provides methods and compositions for treating a cell-proliferative disorder. In a preferred embodiment the cell-proliferative disorder is cancer. In a more preferred embodiment, the cancer is ovarian cancer. In one embodiment, the invention further comprises administering a chemotherapeutic agent.
In another embodiment, the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of pharmaceutical composition comprising a NAC-I antagonist. In one embodiment, the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a compound which binds specifically to a NAC-I polypeptide to inactive or reduce the biological activity of NAC-I .
In one embodiment, the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of the antibody or fragment thereof which binds specifically to a NAC-I polypeptide. In one embodiment, the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of the antibody or fragment thereof which binds specifically to a NAC-I polypeptide. In one embodiment, the antibody or fragment thereof inactivates or reduces the biological activity of the protein.
In one embodiment, the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a small molecule, for example, a small organic molecule which inhibits or reduces the biological activity of NAC-I.
In one embodiment, the invention provides a method of treating a cell- proliferative disorder in a mammal, comprising administering to the mammal an effective amount of a compound that modulates the expression of NAC-I polypeptide. In one embodiment, the invention provides a method of treating cancer in a mammal, comprising administering to the mammal an effective amount of a compound that modulates the expression a NAC-I polypeptide.
In one embodiment, the invention provides a method of modulating a cell- proliferative disorder in a subject comprising modulating the expression of a NAC-I polypeptide in vivo. In a preferred embodiment the cell-proliferative disorder is cancer. In one embodiment, the cancer is breast cancer. In one embodiment, the modulating of the expression of a NAC-I polypeptide comprises contacting a cell with a nucleic acid selected from the group consisting of a siRNA, an shRNA, an antisense nucleic acid or a ribozyme. A cancer therapeutic of the invention can be an oligonucleotide or peptide nucleic acid sequence complementary and capable of hybridizing under physiological conditions to part, or all, of the gene encoding the marker protein or to part, or all, of the transcript encoding the marker protein thereby to reduce or inhibit transcription and/or translation of the marker protein gene. Alternatively, the same technologies may be applied to reduce or inhibit transcription and/or translation of a. NAC-I polypeptide or a protein which interacts with a NAC-I polypeptide.
In addition to administration with conventional carriers, the anti-sense oligonucleotides or peptide nucleic acid sequences may be administered by a variety of specialized oligonucleotide delivery techniques. For example, oligonucleotides may be encapsulated in liposomes, as described in Mannino et al. (1988) BioTechnology 6: 682, and Feigner et al. (1989) Bethesda Res. Lab. Focus 11:21. Lipids useful in producing liposomal formulations include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art (see, for example, in U.S. Pat. Nos. 4,235,871; 4,501,728; 4,837,028; and 4,737,323). The pharmaceutical composition of the invention may further include compounds such as cyclodextrins and the like which enhance delivery of oligonucleotides into cells. When the composition is not administered systemically but, rather, is injected at the site of the target cells, cationic detergents (e.g. Lipofectin) may be added to enhance uptake. In addition, reconstituted virus envelopes have been successfully used to deliver RNA and DNA to cells (see, for example, Arad et al. (1986) Biochem. Biophy. Acta 859: 88-94).
For therapeutic use in vivo, the anti-sense oligonucleotides and/or peptide nucleic acid sequences are administered to the individual in a therapeutically effective amount, for example, an amount sufficient to reduce or inhibit target protein expression in malignant cells. The actual dosage administered may take into account whether the nature of the treatment is prophylactic or therapeutic in nature, the age, weight, health of the subject, the route of administration, the size and nature of the malignancy, as well as other factors. The daily dosage may range from about 0.01 to 1,000 mg per day. Greater or lesser amounts of oligonucleotide or peptide nucleic acid sequences may be administered, as required. As will be appreciated by those skilled in the medical art, particularly the chemotherapeutic art, appropriate dose ranges for in vivo administration would be routine experimentation for a clinician. As a preliminary guideline, effective concentrations for in vitro inhibition of the target molecule may be determined first.
The skilled artisan can, using methodologies well known in the art, screen small molecule libraries (either peptide or non-peptide based libraries) to identify candidate molecules that reduce or inhibit the biological function of the NAC-I . The small molecules preferably accomplish this function by reducing the in vivo expression of the target molecule, or by interacting with the target molecule thereby to inhibit either the biological activity of the target molecule or an interaction between the target molecule and its in vivo binding partner.
It is contemplated that, once the candidate small molecules have been elucidated, the skilled artisan may enhance the efficacy of the small molecule using rational drug design methodologies well known in the art. Alternatively, the skilled artisan may use a variety of computer programs which assist the skilled artisan to develop quantitative structure activity relationships (QSAR) which further to assist the design of additional candidate molecules de novo. Once identified, the small molecules may be produced in commercial quantities and subjected to the appropriate safety and efficacy studies.
It is contemplated that the screening assays may be automated thereby facilitating the screening of a large number of small molecules at the same time. Such automation procedures are within the level of skill in the art of drug screening and, therefore, are not discussed herein. Candidate peptide-based small molecules may be produced by expression of an appropriate nucleic acid sequence in a host cell or using synthetic organic chemistries. Similarly, non-peptidyl-based small molecules may be produced using conventional synthetic organic chemistries well known in the art. As described above, for in vivo use, the identified small molecules may be combined with a suitable pharmaceutically acceptable carrier, such as physiological saline or other useful carriers well characterized in the medical art. The pharmaceutical compositions may be provided directly to malignant cells, for example, by direct injection, or may be provided systemically, provided the binding protein is associated with means for targeting the protein to target cells. Finally, suitable dose ranges and cell toxicity levels may be assessed using standard dose range experiments. As described above, actual dosages administered may vary depending, for example, on the nature of the malignancy, the age, weight and health of the individual, as well as other factors. One embodiment of the present invention are methods of treating a cell- proliferative disorder, e.g., cancer such as ovarian cancer, with pharmaceutical compositions of antibodies, antigen binding fragments, peptides, nucleic acids, small molecules and other compounds as described above. In a preferred embodiment, the subject receiving treatment is a human subject. Pharmaceutical compositions of the invention can be administered to a subject in need there of by, for example, injection.
Pharmaceutical compositions of the present invention are administered in a therapeutically effective amount which are effective for producing some desired therapeutic effect by inducing tumor-specific killing of tumor cells in a subject and thereby blocking the biological consequences of that pathway in the treated cells eliminating the tumor cell or preventing it from proliferating, at a reasonable benefit/risk ratio applicable to any medical treatment.
One embodiment of the present invention contemplates the use of any of the pharmaceutical compositions of the present invention to make a medicament for treating cancer. Medicaments can be formulated based on the physical characteristics of the subject/subject needing treatment, and can be formulated in single or multiple formulations based on the stage of the cancerous tissue. Medicaments of the present invention can be packaged in a suitable pharmaceutical package with appropriate labels for the distribution to hospitals and clinics wherein the label is for the indication of treating a specific cancer in a subject. Medicaments can be packaged as a single or multiple units. Instructions for the dosage and administration of the pharmaceutical compositions of the present invention can be included with the pharmaceutical packages.
In exemplary embodiments, the pharmaceutical compositions of the present invention can be administered to a subject by any convenient route, including, for example, subcutaneous, intradermal, intravenous, intra-arterial, intraperitoneal, or intramuscular injection.
In a preferred embodiment, the antibodies, antigen binding fragments, or peptides are labeled with a radiolabel or a toxin that kills the target cell upon binding of the antibodies, antigen binding fragments, or peptides to NAC- 1.
In one embodiment of the present methods, the toxin is any one of ricin, ricin A chain (ricin toxin), Pseudomonas exotoxin (PE), diphtheria toxin (DT), Clostridium perfringens phospholipase C (PLC), bovine pancreatic ribonuclease (PBR), pokeweed antiviral protein (PAP), abrin, abrin A chain (abrin toxin), cobra venum factor (CVF), gelonin (GEL), saporin (SAP) modeccin, viscumin or volkensin.
Antibodies, antigen binding fragments, peptides nucleic acid molecules small molecules, and peptidomimetics of the present invention can also be used in combination therapy with chemotherapeutic agents such as the chemotherapeutic agents discussed above. The pharmaceutical compositions can be administered separately or concomitantly. In one aspect of the present invention, the pharmaceutical compositions are administered in a single formulation. In one aspect of the present invention, the pharmaceutical compositions are administered as separate formulations.
Screening Assays
The invention also comprises methods to screen for compounds which can be used to treat a cell-proliferative disorder such as cancer.
In one embodiment, the method comprises (a) identifying a NAC-I modulator, e.g., an antagonist, and (b) determining whether said NAC-I antagonist is effective against a cell-proliferative disorder. Said methods can be carried out using methods which are well known in the art. For example, determining whether a NAC-I modulator is effective against a cell-proliferative disorder can be carried out using any in vitro or in vivo models of a cell-proliferative disorder. The invention also comprises a method to screen for NAC-I modulators, comprising: (a) contacting a NAC-I polypeptide with a test compound under conditions suitable for detecting the binding of the NAC-I polypeptide to the test compound, (b) determining whether the test compound binds the NAC-I polypeptide, and (c) further determining whether the test compound prevents, inhibits or reduces the binding of NAC-I, wherein a test compound that binds the NAC-I polypeptide and prevents, inhibits or reduces the binding of NAC-I is a NAC-I antagonist. In one embodiment the method further comprises determining whether the test compound binds the extracellular domain of said NAC-I polypeptide.
EXAMPLES
It should be appreciated that the invention should not be construed to be limited to the examples that are now described; rather, the invention should be construed to include any and all applications provided herein and all equivalent variations within the skill of the ordinary artisan.
Example 1 The BTB (bric-a-brac tramtrack broad complex) (also known as POZ) gene family is composed of several proteins that share a conserved BTB/POZ protein- protein interaction motif at the N-terminal that mediates homodimer or heterodimer formation (1-3). These proteins have been demonstrated to participate in a wide variety of cellular functions including transcription regulation, cellular proliferation, apoptosis, cell morphology, ion channel assembly and protein degradation through ubiquitination (1). A subset of BTB/POZ proteins have been implicated in human cancer and they include BCL-6 (4, 5), PLZF (promyelocyte leukemia zinc finger) (4, 6), leukemia/lymphoma related factor (LRF)ZPokemon (7, 8), HIC-I (hypermethylated in cancer-1) and Kaiso (9, 10). Among them, BCL-6 gene is the best-characterized oncogene. Frequent gene translocation or mutation has been identified in B-cell lymphoma, resulting in constitutive BCL-6 expression in the tumor cells (4, 5). Peptide inhibitors that block interaction between the BCL-6 BTB/POZ domain and co- repressors abrogate BCL-6 oncogenic functions in B cells, suggesting that the use of peptide inhibitors of the BTB/POZ domain may represent a novel therapeutic approach for B-cell lymphoma (5). As the role of BTB/POZ proteins in human cancer is emerging, we have analyzed the expression patterns of novel tumor-associated BTB genes in ovarian cancer in silico using the serial analysis of gene expression (SAGE) database. This study demonstrates that NAC-I plays a critical role in tumorigenesis and in the growth and survival of tumor cells.
MATERIALS AND METHODS
Tag counts of the BTB/POZ family genes from SAGE libraries
Proteins matching the PS50097 profile of the BTB/POZ domain amino acid sequence were extracted from the Swiss-Prot/TrEMBL protein databank. A total of 130 BTB/POZ genes were identified. The expression levels of the BTB/POZ gene family members were determined from the ovarian tumor SAGE libraries by obtaining the SAGE tag counts for each BTB/POZ gene. The libraries included the ovarian surface epithelial cells (SV-40 immortalized IOSE29 (26) and short term cultured HOSE4), benign cystadenoma (MLlO), ovarian high-grade serous carcinoma tissues (HG63, HG48, HG92, OVT6, OVT7 and OVT8) and ovarian cancer cell lines
(OVCAR3 and A2780). All libraries have been previously published (27) except HG63, HG48 and HG92 which were established in this study. The NAC-I specific tags included TTCCCGGCCC (SEQ ID NO:3), TGAAGGCAGT (SEQ ID NO:4), CCTATAATCG (SEQ ID NO:5), AGTGCCAGGG (SEQ ID NO:6), AGAATATCAG (SEQ ID NO:7), GAGGGAGGGA (SEQ ID NO:8) and GTTCCCCCAC (SEQ ID
NO:9). Using a minimum tag count setting of > 1, these NAC-I tags were tallied and normalized per 100,000 total tags for each SAGE library. In order to select the candidate gene(s) for further study, we first select those with a high average tag count (> 10 tags/ 100,000 tags) in ovarian carcinoma libraries followed by the highest ratio of average tag counts in ovarian carcinoma to the benign controls (IOSE29, HOSE4 and MLlO).
To determine the NAC-I expression levels among different cancer libraries, we compared NAC-I tag counts among 81 SAGE libraries (cgap.nci.nih.gov/SAGE) (28, 29) from carcinomas and normal tissues of ovary, pancreas, liver, colon, kidney, prostate and breast (30). NAC-I tag counts for each library were retrieved by filtering for tag sequences that matched uniquely to NAC-I according to the April 15, 2005 SAGEMap available on the public NCBI FTP.
Immunohistochemistry and immuno-electron microscopy
Paraffin-embedded tumor tissues were obtained from the Department of Pathology at the Johns Hopkins Hospital and effusion ovarian cancer samples were obtained from the Norwegian Radium National Hospital in Norway. These included 182 high-grade ovarian serous carcinoma tissues (154 stage III and 2 S stage IV), 44 low-grade ovarian serous carcinoma tissues (42 stage III and 2 stage IV), 172 high- grade ovarian carcinoma effusion samples (1 stage I, 6 stage II, 97 stage III, and 68 stage IV), and 32 cervical adenocarcinomas. In addition, 21 benign ovarian cystadenomas, 18 normal ovaries and 8 normal cervical tissues were included for comparison. Acquisition of tissue specimens and clinical information was approved by an institutional review board (Johns Hopkins Medical Institutions) or by the Regional Ethics Committee (Norwegian Radium Hospital).
For immunohistochemistry studies, we generated a mouse NAC-I monoclonal antibody by immunizing mice with the NAC-I recombinant protein using a standard hybridoma protocol (31). Immunohistochemistry was performed on deparaffinized sections using the NAC-I antibody at a dilution of 1 : 100 and an EnVision+System peroxidase kit (DAKO, Carpinteria, CA). Immunoreactivity was scored by two investigators as follows: 0: undetectable, 1+: weakly positive, 2+: moderately positive and 3+: intensely positive. NAC-I immunoreactivity was not detectable (immunointensity score = 0) or weak (1+) in normal ovarian surface epithelium and benign serous cystadenomas. For ultrastructure study of NAC-I bodies, we applied immunogold labeling on NAC-I expressing-RK3E cells followed by electron microscopy.
Co-immunoprecipitation and double immunofluorescence staining A series of NAC-I deletion mutants including N130 (encoding the amino acids
1-129 at the N-terminal), N250 (amino acids 1-263 at the N-terminal), M120 (amino acids 123-263 in the middle portion) and C250 (amino acids 257-528 at the C- terminal) were generated by PCR. Both N130 and N250 mutants contained the BTB/POZ domain (amino acids 20-122) of NAC-I. In addition, two mini-N130 expression constructs were generated and they included N65 (encoding the first 1-65 amino acids of the BTB domain), N30-122 (30-122 amino acids). PCR products of the NAC-I deletion mutants were cloned into an expression vector, pCDNA4 with an Xpress tag at the N-terminus. RK3E cells were first stably transfected with PCDNA6/V5/NAC- 1 then transiently transfected with the pCDNA4/NAC- 1 deletion mutants. Co-immunoprecipitation was performed to assess the specific structural motifs that bound to full-length NAC-I. For immunofluorescence staining, cells were incubated with primary antibodies followed by fluorescence labeled secondary antibodies.
N130 inducible construct, cell proliferation and apoptosis assays
The Tet-Off inducible system was used to assess the biological effects of Nl 30. HeLa and SKO V3 cells which constitutively expressed tTA (tetracycline- controlled transactivator) were transfected with pBI-N130/EGFP or pBI-C250/V5- EGFP (control) that bicistronically expressed the products of interest and reporter EGFP upon the binding of tTA to the tetracycline responsive element (TRE) in the absence of inducer (doxycycline, Dox). Cell proliferation and apoptosis assays were performed as previously described (32).
RESULTS
NAC-I expression is associated with cancer development
A total of 11 SAGE libraries were used to screen 130 BTB/POZ domain- containing genes for overexpression in high-grade ovarian serous carcinomas as compared to ovarian surface epithelium and benign ovarian cystadenoma. Sixteen genes were selected based on an average tag counts/library >10 (Table 1). Among these 16 genes, a gene named NAC-I (BTBD14B) showed the highest ratio of average tag counts in ovarian carcinoma to controls (ovarian surface epithelium and benign ovarian cyst) and was therefore selected for validation and characterization in this study. The SAGE database was also used to analyze NAC-I expression in different cancer types and their corresponding normal tissues. As shown in Figure 1 , in addition to ovarian cancer, NAC-I was upregulated in several tumors from other organs including pancreatic, colorectal, and breast carcinomas. Table 1. The list of BTB/POZ genes that show differential expression between ovarian cancers and benign controls.
Figure imgf000047_0001
In order to validate the SAGE results in ovarian cancer, a mouse monoclonal antibody (NAC-I Ab clone 3) was generated that reacted to the C- terminal of the NAC-I protein and performed immunohistochemistry in 265 ovarian tumors and normal tissue samples (Table 2). The specificity of the NAC-I antibody was evaluated by reciprocal immunoprecipitation/Western blot analyses in RK3E cells transfected with PCDNA6-V5/NAC-1 and vector control. A single band with a molecular mass of approximate 57 kD corresponding to NAC-I protein was detected in NAC-I transfected cells but not in control cells (Figure 2A). Because the immunoreactive tumor cells always exhibited diffuse staining, intensity scores were used to quantify NAC-I expression in tissues. In contrast to normal ovaries and benign ovarian cystadenomas, both low-grade and high-grade serous carcinomas demonstrated a higher NAC-I immunoreactivity with 27% and 40% of cases showing 2+ and 3+, respectively (Chi square test, p< 0.001) (Figure 2B-D, Table 2). The number of high- grade cases with high NAC-I immunointensity (2+ and 3+) was significantly higher than that in low-grade carcinoma (p< 0.01). Immunofluorescence revealed that NAC-I was localized to dot-like structures in those tumors showing strong NAC-I immunointensity (2+ and 3+) (Figure 2E and 2F). Ultrastructural analysis using immunogold labeling and electron microscopy further revealed that NAC-I was localized to discrete nuclear bodies, tentatively termed "NAC-I bodies", with a diameter ranging from 0.3 to 1.8 μm (Figure 2G).
Table 2. NAC- 1 immunoreactivity in the ovarian serous tumor a normal ovaries. t>
Total case lmmunointensity number 0 1+ 2+ 3+
Normal ovary 18 16 (89*) 2 (11) 0 0
Benign cystadenoma 21 10 (48) 11 (52) 0 0 0 Low-grade carcinoma 44 20 (45) 12 (27) 8 (18) 4 (9)
High-grade carcinoma 182 52 (29) 57 (31) 35 (19) 38 (21 )
* Percentage in parenthesis.
Overexpression of NAC-I correlates with recurrent ovarian cancer 5 It is widely accepted that recurrent tumors represent the true "killer" in cancer patients as the primary tumors are usually removed by surgery. Identification of molecular targets that are present in recurrent tumors would be important in the development of a prognostic test and a novel therapeutic intervention for cancer patients. Thus, we addressed whether NAC-I expression was related to tumor 0 progression by analyzing primary and recurrent ovarian high-grade serous carcinomas using immunohistochemistry and quantitative real-time PCR. NAC-I immunohistochemistry was performed at two institutions, Johns Hopkins Medical Institutions (JHMI, solid tumors) and Norwegian National Radium Hospital (NRH, effusions), using independent sets of ovarian cancer specimens and the results 5 presented by a 2x2 contingency table (Figure 3A). Among 182 JHMI high-grade carcinoma cases, we analyzed 166 samples including 110 primary and 56 first recurrent tumors. The remaininglδ specimens that were obtained from 2nd and 3rd recurrence were not included in the analysis. Both JHMI and NRH studies demonstrated that a higher NAC-I staining intensity (2+ and 3+) was more frequently 0 found in recurrent than in primary tumor tissues (p< 0.01 in JHH and p= 0.013 in NRH, chi-square test). To validate the immunohistochemistry results, quantitative real-time PCR was performed using samples from JHMI to assess the correlation of NAC-I mRNA expression levels and the recurrence status. We found that an increased NAC-I transcript level significantly correlated with recurrent disease (p= 0.012, Mann- Whitney test) (Figure 3B). The association of NAC-I expression and recurrent status was independent of clinical stage (III versus IV) at diagnosis.
Among 56 recurrent carcinomas from JHMI, there were 21 cases for which the corresponding primary tumors were available from the same patients for comparison. A statistically significant increase in NAC-I immunointensity (2+ and 3+) was found in recurrent tumors as compared to the primary tumors from the same patients (p= 0.017, chi-square test) (Figure 3C). Based on these findings, we further analyzed to see if NAC-I expression in primary tumors was predicative of disease-free interval (the period between primary surgery and tumor recurrence) in 57 patients with advanced stage high-grade serous carcinomas who underwent optimal primary debulking surgery followed by standard chemotherapeutic regimen in the same institution (JHMI). We found that high NAC-I immunointensity (2+ and 3+) predicted recurrence within one year after diagnosis with an odds ratio of 14.9 (95% CI, 3.00- 74.2; p= 0.0002, Fisher's exact test). The median disease free interval with NAC-I immunointensity of ≥2 was 12 months whereas when the intensity < 2 it was 18 months.
The positive correlation of NAC-I expression and recurrent disease suggests that NAC-I plays a role in the development of recurrent ovarian tumors. In order to test if NAC-I expression directly contributes to drug resistance, we correlated NAC-I immunoreactivity and in vitro drug resistance in 60 high-grade serous carcinomas. The in vitro drug resistance results were performed at Oncotech, Inc. (Tustin, CA) using the protocol described at www.oncotech.com/pdfs/edr_4__pager.pdf (11, 12). Cases were grouped according to different immunointensity scores, but there was no significant correlation (p> 0.17, chi-square test) between NAC-I expression and in vitro resistance to carboplatin, cisplatin, and taxol, the standard chemotherapeutic agents for ovarian cancer.
Dominant negative role of NAC-I BTB/POZ domain Because the BTB/POZ domain, has been known to be involved in protein homomerization or heteromerization, we tested whether the NAC-I BTB/POZ domain participated in protein-protein interaction using deletion mutants of NAC-I (Figure 4A). Based on co-immunoprecipitation and immunofluorescence co-localization studies (Figure 4B and 4C), we found that the BTB/POZ domain of NAC-I, corresponding to the 1-129 amino acids at the N-terminus (Nl 30 construct), was the minimal structural motif required for NAC-I homo-oligomerization (Figure 4B). The NAC-I deletion mutants/Xpress tags were then transfected into RK3E cells that had been stably transfected with a full-length NAC-I /V5 tag expression vector. As shown in Figure 4C, full-length NAC-1/V5 co-localized with the full-length NAC-1/Xpress in the NAC-I bodies, indicating that NAC-I interacted with each other. As expected, both Nl 30 and N250 deletion mutants containing the BTB/POZ domain also co- localized with full-length NAC-I, but interestingly, both mutants disrupted the formation of NAC-I bodies by transforming them into "cotton candy" like aggregates or large "noodle-like" structures in the nuclei (Figure 4C). In contrast, C250 and M120 deletion mutants that did not contain the BTB/POZ domain failed to co-localize with wild-type NAC-I.
Suppression of tumor formation upon induction of NAC-I N130 mutant To test if the BTB/POZ domain is involved in tumor growth, we established an inducible (Tet-Off) system by expressing the Nl 30 construct upon removal of doxycycline in two NAC-I -positive tumor cell lines, SKO V3, an ovarian cancer cell line, and HeLa, a cervical adenocarcinoma cell line. Cervical adenocarcinomas, like ovarian serous carcinomas, frequently overexpressed NAC-I as a high level of NAC-I immunoreactivity (2+ and 3+) occurred in ~50% (16 of 32) cervical adenocarcinomas while the NAC-I immunoreactivity in normal endocervical glands were undetectable (Figure 7).
For both SKOV3-N130 and HeLa-Nl 30 cell lines, the efficiency of N130 induction was very high as evidenced by more than 99% of cells expressing green fluorescence based on flow cytometry (data not shown) and increased copy number of N-terminal mRNA sequence as compared to C-terminal sequence based on quantitative real-time PCR (Figure 8 A and B) after removal of doxycycline. Like RK3E cells expressing the N130 mutant (Figure 4C), NAC-I nuclear bodies were transformed to cotton candy-like aggregates in both SKOV3 and HeLa cells after induction of Nl 30 (Figure 8C). As compared to the control (induction of C250), induction of Nl 30 expression significantly reduced cell proliferation in both SKO V3 cells (Figure 5A) and HeLa cells (Figure 5B).
Induction of the control C250 mutant did not have significant effects on cellular proliferation in either of the cell lines. Similarly, expression of Nl 30 significantly suppressed colony formation in both cell lines (Figure 9). The decrease in cellular growth after Nl 30 induction was associated with cell cycle arrest at G2/M phase (percentage of cells in GO/G1:S:G2/M = 50.3%:16.5%:33.2% in non-induced cells vs. 20.1%:17.4%:62.5% in induced cells) (Figure 5C). Nl 30 induction significantly increased the number of annexin V labeled cells and also decreased the number of BrdU labeled cells (except day 3) although the level in the decrease of cells with BrdU uptake is not as dramatic as the increase of annexin V labeled cells (Figure 5D). To further evaluate the effect of Nl 30 on cellular proliferation and apoptosis, we used the mini-N130 mutants, N65 and N30-122, in which its BTB/POZ oligomerization activity was deficient. Both N65 and N30-122 showed protein expression but were not able to co-imniunoprecipitate with the full-length NAC-I protein (Figure 10A). When transfecting these two constructs into the NAC-I over- expressing SKOV3 cells, both N65 and N30-122 could not effectively suppress cellular proliferation as compared to N130 (Figure 10B). In addition, we also knocked down NAC-I using RNAi to determine if there was a similar inhibitory effect to the expression of the Nl 30 dominant negative construct, hi fact, NAC-I expressing SKO V3 and HeLa cells had significantly reduced cell number after NAC-I siRNA treatment (Figure 1 IA and B). In contrast, NAC-I siRNA did not show a significant effect on the cell growth of OVCAR3 cells that did not express abundant NAC-I (Figure 1 IB). Furthermore, we found that the apoptosis-inducing effect of the siRNAs used here was potent, but was less pronounced than the Nl 30 dominant negative NAC-I (Figure 11C), indicating that the latter approach could be a more effective experimental system to inactivate NAC-I function. As a control, we expressed Nl 30 in OVCAR3 which expressed only minimal amount of NAC-I protein comparing to HeLa and SKO V3 cells and found that Nl 30 expression did not have a significant effect on the growth of OVCAR3 cells (Figure 1 ID).
Based on the above findings, we investigated whether disrupting interactions between NAC-I molecules using the Nl 30 dominant negative approach had a growth inhibitory effect in HeLa (Figure 12) and SKO V3 (Figure 13) xenografts in nude mice. First, we tested if expression of Nl 30 could prevent tumorigenesis by inducing Nl 30 expression two days after subcutaneous tumor injection. As shown in Figure 12A and 13A, induction of N130 expression in HeLa and SKOV3 cells almost completely prevented the formation of subcutaneous tumors. In contrast, the control cells grew tumors at all injection sites. Second, we determined if N130 could limit tumor growth in established HeLa and SKO V3 tumors. The expression of Nl 30 was induced by removing doxycyclin, when all the mice harbor palpable tumors.
Five days after discontinuation of doxycyclin, induction of N130 expression was evidenced by green fluorescence in the subcutaneous HeLa tumors since expression of both N130 and EGFP was driven by a bicistronic promoter (Figure
12B). As shown in Figure 12C and Figure 13B, tumors continued growing in control mice whereas the tumors stopped growing or decreased in size after Nl 30 induction. Histological examination of the tumors excised 10 days after Nl 30 induction revealed extensive apoptosis in tumor cells based on morphology and immunoreactivity with the M30 antibody which recognizes the apoptosis-specific caspase-cleaved cytokeratin . epitope (13, 14) (Figure 12D).
The oncogenic potential of NAC-I expression.
To test whether NAC-I expression is tumorigenic, we randomly selected two clones from a spontaneously immortalized MOSE cell line and two NIH3T3 clones that were stably transfected with an NAC-I expression vector (Figure 6). When comparing to vector-transfected controls, all NAC-I -expressing clones had a higher cellular proliferation based on growth curves and BrdU-uptake assays (Figure 6A, D & F). Subcutaneous injections of NAC-I expressing OSE clones in athymic nu/nu mice produced larger tumors than the control cells transfected with the vector only (Figure 6B & C). OSE clones did not grow intraperitoneal tumors 21 days after i.p. injection. The NAC-I expressing NIH3T3 clones produce both subcutaneous and intraperitoneal tumors in the athymic nu/nu mice. The intraperitoneal tumors were always multiple and their combined weights were measured in each mouse (Figure 6E). hi contrast, the vector transfected N1H3T3 cells did not grow tumors during the course of this study.
Quantitative PCR analysis
A total of 48 frozen tissues including 33 high-grade ovarian serous carcinomas (17 primary and 16 recurrent), 10 benign serous cystadenomas, and five samples of normal ovarian surface epithelial cells were analyzed for NAC-I transcript expression by quantitative real-time PCR using an iCycler (Bio-Rad, Hercules, CA) with the SYBR Green dye (Molecular Probes, Eugene, OR). Averages in the threshold cycle number (Ct) of duplicate measurements were obtained. The results were expressed as the difference between the Ct of the gene of interest and the Ct of a control gene, beta- the SAGE libraries analyzed.
siRNA knockdown of NAC-I gene expression Two siRNAs that targeted NAC-I were designed and their sense sequences were: UGAUGUACACGUUGGUGCCUGUCACCA (SEQ ID NO:5H)) and GAGGAAGAACUCGGUGCCCUUCUCCAU (SEQ ID NO:4il). Control siRNA (off-target control, cat# D-001210-02-05) was purchased from IDT (Corolville, IA). Cells were seeded onto 96 wells and transfected with siRNAs using oligofectamine (Invitrogen, Carlsbad, CA).
Tumor xenograft in nude mice
HeLa cells (3 x 106) with an N130 inducible construct were injected subcutaneously into the athymic nu/nu mice. Doxycyclin (125 μg/mouse) was injected i.p. daily to suppress N130 expression in control mice. Tumor volume was measured every other day for 14 days. To determine if Nl 30 has therapeutic effects on established tumors, we injected the same amount of HeLa cells and induced N130 expression at day 9 when subcutaneous rumors had formed. The tumors were monitored for induction based on green fluorescence using a small animal fluoroscope imaging device. Tumor volume was measured daily for 9 days after induction and tumors were prepared for histopathological examination.
To determine the oncogenic potential of NAC-I, we established NAC-I expressing MOSE cells (ED3) and NIH3T3 cells (ATCC) by stably transfecting the cells with pCDNA6/V5/NAC-l . To test the tumorigenicity of the transfected cells in nude mice, we injected three million cells of two NAC-I expressing MOSE clones and two NIH3T3 clones into nude mice (5 mice in OSE group and 7 mice in NIH3T3 group) subcutaneously and intraperitoneally. Cells transfected with the pCDNA6-V5 vector were used as controls. Three weeks after injection, tumors were excised and weighted.
In this study, we demonstrate that NAC-I is a new cancer associated gene, as NAC-I expression level is significantly increased in several types of cancers including ovarian cancer, cervical adenocarcinoma, and breast cancer. We showed that NAC-I was required for cell proliferation and survival and was sufficient to enhance turnorigenicity in athymic nu/nu mice.
NAC-I expression may directly contribute to tumor recurrence and tumor progression. It is further demonstrated that intense NAC-I immunoreactivity in primary tumors is highly predictive of a shorter disease-free interval; therefore, NAC- 1 expression may potentially be used alone or in combination with other markers as a prognostic test to identify ovarian cancer patients who are likely to develop early recurrence. This finding can have potential clinical implications because at least 60% of advanced-stage ovarian cancer patients who appear to be disease-free after completing primary therapy ultimately develop recurrent disease (20). Thus, patients with NAC-I positive ovarian serous carcinoma can be monitored more closely to detect recurrent tumor. It has been demonstrated that ovarian carcinoma patients can most benefit from secondary cytoreduction when the recurrent tumor is small and localized (20-24). Based on immunoprecipitation using the NAC-I antibody and tumor lysates from ovarian cancer tissues that expressed NAC-I, we did not detect other proteins that were pulled down with NAC-I, suggesting that NAC-I may likely homo- oligomerize to each other. The dominant negative strategy using the Nl 30 deletion mutant suggests that homo-oligomerization of NAC-I is required for formation of NAC-I nuclear bodies.
Expression of the N130 mutant but not mini-N130 mutants that failed to bind to NAC-I suppressed cellular proliferation and induced apoptosis, suggesting that interaction among NAC-I molecules or between NAC-I and other partner protein(s) through their BTB/POZ domains is essential for NAC-I regulated tumor cell growth and survival. Besides its critical role in maintaining cell proliferation and survival, these findings suggest that NAC-I is a gene with oncogenic potential in ovarian carcinomas.
These experiments demonstrate that expression of NAC-I, is associated with the development of recurrent ovarian serous carcinoma. Homo-oligomerization of NAC-I proteins is essential for cell survival in carcinomas that express NAC-I.
Example 2:
This example demonstrates that NAC-I is expressed in ovarian carcinoma sample from all anatomic sites and that NAC-I expression is upregulated in effusions and elevated in tumor cells at all sites following the administration in chemotherapy. These results validate that NAC-I is a therapeutic target for ovarian cancer patients.
Materials and Methods Study cohort: Specimens and relevant clinical data were obtained from the
Department of Gynecologic Oncology, National Hospital-Norwegian Radium Hospital (Table 1). Informed consent was obtained according to national Norwegian and institutional guidelines. One hundred and seventy-six fresh non-fixed malignant peritoneal (n=137, 78% of specimens) and pleural (n=39, 22% of specimens) effusions were obtained from 120 patients diagnosed with epithelial (predominantly serous) ovarian carcinoma (146 effusions, 83%), 7 patients with serous carcinoma of the fallopian tube (8 effusions, 5%), and 16 patients with primary peritoneal serous carcinoma (22 effusions, 12%) (Total=143 patients). Due to their closely linked histogenesis and phenotype, these tumors will all be referred to as ovarian carcinomas henceforth.
Effusions were submitted for routine diagnostic purposes to the Department of Pathology, Norwegian Radium Hospital during 1998-2002. Cell blocks were prepared using the thrombin clot method [42]. Diagnoses were established by evaluation of smears and sections from cell blocks, and further confirmed using immunocytochemistry with broad antibody panels against carcinoma, mesothelial and leukocyte epitopes, as previously detailed [43].
Matched solid tumors (n=197) were available for 80 patients. They consisted of 69 primary tumors and 128 solid metastases (59 omental, 32 peritoneal, 14 intestinal, 23 from other anatomic sites). Before analysis, surgical specimens were reviewed by a surgical pathologist (BD) in order to confirm the diagnosis, histological type and grade.
Immunocytochemistry: A NAC-I monoclonal antibody was generated by immunizing mice with NAC-I recombinant protein using a standard hybridoma protocol as previously described [44]. Hybridoma screening was first based on the reactivity of culture supernatant with NAC-I protein using ELISA and subsequently by immunointensity on paraffin sections and specificity based on Western blot analysis. The NAC-I antibody was purified and used for immunohistochemistry which was performed on paraffin sections using a dilution of 1:100. The specificity of NAC- 1 antibody was demonstrated in a previous report [42]. Pretreatment consisted of microwave oven antigen retrieval in low pH citrate buffer. Visualization was achieved using the En Vision ™+ peroxidase system (DakoCytomation, Glostrup, Denmark). Positive controls consisted of an ovarian carcinoma shown to be positive in a pilot study. Negative controls were stained with an antibody for isotypic mouse myeloma protein.
Staining was scored by an experienced cytopathologist (BD) who was blinded to the patient clinical data. Nuclear localization was interpreted as positive staining. Staining extent was scored on a scale of 0-4, corresponding to percentage of imrnunoreactive tumor cells of 0%, 1-5%, 6-25%, 26-75% and 76-100%, respectively. Staining intensity was scored as negative (0), weak (1) or strong (2). At least 500 tumor cells were scored, when present (>90% of cases). At least 100 tumor cells were counted for each specimen.
Statistical analysis: Statistical analysis was performed applying the SPSS- PC package (Chicago, IL). A probability of <0.05 was considered statistically significant. Complete clinicopathologic data were available for the majority of patients (Table 3). Patients in this cohort received standard chemotherapy. Survival data were available for all 143 patients. Analyses of the association between NAC-I protein and clinicopathologic parameters were performed using the two-sided Chi-square test.
Table 3: Clinicopathologic data of the study cohort (143 patients')
Figure imgf000056_0001
Figure imgf000057_0001
a NA= non available
* Including 2 patients with clear cell carcinoma c NA= non available, including specimens from inoperable patients (15) and patients operated in hospitals in which tumor grade was not scored and primary tumor could not be accessed for assessment of grade (4) d NA= non available, 15 patients who were inoperable and 5 patients with no record e Including mixed epithelial tumors and carcinomas not otherwise specified ^Inoperable patients who underwent limited biopsy in order to establish the diagnosis of malignancy s For 176 effusions
Comparative analysis of NAC-I expression in effusions, primary tumors and solid metastases was performed using the Wilcoxon Signed Ranks Test. Progression- free survival (PFS) and overall survival (OS) were calculated from the date of diagnosis to the date of recurrence/death or last follow-up. Univariate survival analyses of PFS and OS were executed using the Kaplan-Meier method and log-rank test. For this analysis, expression categories were grouped in order to maximize the numbers of patients in each category (negative/weak vs. strong expression for intensity, 0-3 vs. 4 for staining extent). For patients with more than one effusion, expression in the specimen that was chronologically the first to be submitted to our laboratory was analyzed. Multivariate analyses for OS and PFS were performed using the Cox Proportional Hazard model.
Results
NAC-I is frequently expressed in ovarian carcinoma: Nuclear NAC-I immunoreactivity was detected in carcinoma cells in 173/176 (98%) effusions. Of these, 112 (65%) stained weakly and 61 (35%) stained strongly (Figures 15-A, 15-B). The percentage of NAC-I positive cells in the 173 specimens was as follows: 1-5%: 7 specimens (4%); 6-25%: 20 specimens (12%); 26-75%: 51 specimens (29%); 76-
100%: 95 specimens (55%). Cancer cells in a given specimen tended to have generally homogenous staining intensity. Inflammatory cells (lymphocytes and macrophages) and reactive mesothelial cells were negative in the majority (>95%) of cases (Figure 15-B). La solid tumors, NAC-I was expressed in 65/69 (94%) primary tumors and
121/128 (95%) metastases. Primary tumors showed weak expression in 55 (85%) specimens and strong expression in the 10 (15%) cases. Metastases showed weak expression in 98 (81%) and strong expression in 23 (19%) specimens. Staining extent was as follows: Primary tumors: 1: 6 cases; 2: 9 cases; 3: 25 cases; 4: 25 cases; Metastases: 1: 14 cases; 2: 23 cases; 3: 32 cases; 4: 52 cases (Figures 15-C, 15-D).
NAC-I is upregulated in ovarian carcinoma effusions: The association between NAC-I expression and anatomic site was analyzed in matched effusions, solid primary and metastatic tumors from the same patients. NAC-I staining intensity and extent were significantly higher in effusions than in the matched primary tumors (p=0.002 for intensity, p=0.003 for extent, Wilcoxon Signed Ranks Test). Similar findings were seen when effusions were compared to solid metastases (p<0.001 for both intensity and extent, Wilcoxon Signed Ranks Test). Expression intensity and extent were comparable in primary tumors and solid metastases (p>0.05).
NAC-I is upregulated in ovarian carcinoma following chemotherapy: In the primary correlation analysis of NAC-I expression in effusions and clinicopatho logic parameters, it was determined that effusion specimens from patients diagnosed with FIGO stage IV disease (n=69) showed less frequently intense staining compared to stage III tumors (n=99) (p=0.03, Chi-square test, 8 effusions from stage I- π cases excluded). There was no association between NAC-I immunoreactivity (intensity or extent) and tumor grade, histological type (serous vs. non-serous types), the extent of residual disease, patient age (^O vs. >60 years) or effusion site (peritoneal vs. pleural) in analysis of the entire cohort (p>0.05, Chi-square test, data not shown).
Analysis of the association between NAC-I expression and previous administration of chemotherapy demonstrated that post-chemotherapy effusions more frequently showed intense NAC-I expression as compared to specimens obtained prior to the administration of chemotherapy (p=0.039, Chi-square test). This difference was observed with respect to both platinum (p=0.045, Chi-square test) and paclitaxel (p=0.002, Chi-square test) treatment (Table 4). Paclitaxel treatment was additionally associated with a higher percentage of stained tumor cells, based on a cut-off at 25% (p=0.042, Chi-square test, data not shown).
Table 4: The association between NAC-I staining intensity and chemotherapy status in 176 effusions a
Figure imgf000060_0001
" Including one patient who received chemotherapy, but the specific agents are unknown
Analysis of all 373 specimens in this study (effusions and solid tumors) for the association between NAC-I expression and chemotherapy status revealed a significantly higher NAC-I staining intensity in ovarian carcinomas that were previously treated with chemotherapy (p=0.002, Chi-square test). As in the analysis of effusions alone, this difference was related to both platinum (p<0.001, Chi-square test) and paclitaxel (p=0.001, Chi-square test) treatment (Table 5). Staining extent showed no association with chemotherapy in this analysis. Table 5: The association between NAC-I staining intensity and chemotherapy status for the entire material (373 specimens "")
Figure imgf000061_0001
" Including one patient who received chemotherapy, but the specific agents are unknown
NAC-I expression in post-chemotherapy effusions predicts poor PFS:
Patient follow-up ranged from 1 to 117 months (mean = 31 months). At the last follow-up, 128 (89%) patients died of disease, 11 (8%) were alive with disease and 4 (3%) were with no evidence of disease. NAC-I staining intensity and extent showed no correlation with OS or PFS in univariate survival analysis of the entire cohort. Separate analyses of patients with pre- and post-chemotherapy effusions showed correlation between strong NAC-I expression and PFS for 61 patients with post- chemotherapy effusions (p=0.039, Figure 16-A). FIGO stage (FV vs. Ill) was the only clinical parameter associated with PFS in this group (p=0.004, Figure 16-B). In Cox analysis in which these two parameters were entered, only FIGO stage was independent predictor of shorter PFS (p=0.009). Discussion
The BTB/POZ gene family members have been assuming a more central role in human cancer in recent years [33-41]. However, most of the data that are available to date documents the role of these proteins in non-epithelial cancer. NAC-I was first discovered in the nucleus accumbens in the brain of rats, where it was shown to be upregulated following chronic cocaine administration [47]. Its molecular partners and targets are largely undefined at present, although recent data has shown that it interacts with two histone deacetylases, HDAC3 and HD AC4, in neuronal cultures [48]. Following our recent functional characterization of NAC-I expression in ovarian carcinomas, we studied its tumor site-related expression and its possible clinical role in tumor recurrence.
In the current study, we found that NAC-I protein was expressed in the majority of ovarian carcinomas at all anatomic sites. However, NAC-I expression was significantly upregulated in carcinoma cells in effusions as compared to corresponding ovarian tumor tissues. We have recently reported a similar finding in a study of Rsf-1 protein, a chromatin-remodeling molecule that we identified as a potential oncogene that is frequently amplified and overexpressed in ovarian serous carcinoma [49]. These observations are in agreement with several previous studies documenting that cancer cells in effusion have unique molecular alterations which are distinct from the cancer cells in solid counterparts [50].
Ovarian carcinoma cells in effusions tend to grow as spheroids, while cells in solid tumors do not, a difference that induces changes in expression of many proteins (e.g., adhesion molecules) [52]. NAC-I does not appear to be affected by these altered conditions in terms of sub-cellular expression, as it was localized to the nucleus in both solid tumors and effusions.
NAC-I upregulation correlates with post-chemotherapy status, especially with paclitaxel. It is possible that administration of carboplatin and paclitaxel creates a selection pressure that favors cancer cells that express higher levels of NAC-I. The causal role of NAC-I in contributing to drug resistance awaits further studies. Recent reports from our group have demonstrated that expression of different tumor- associated molecules, including Rsf-1, the growth factor granulin-epithelin precursor (GEP), the cadherin regulator Smad-interacting protein 1 (SIPl) and the Xeroderma Pigmentosum A (XPA) protein has a different prognostic role in patients with pre- and post-chemotherapy effusions [49, 53-55]. A recently performed proteomics analysis of signaling molecules showed similar findings [56]. However, the present study is the first one in which we report that the expression of a cancer-associated molecule is elevated in both solid tumors and effusions following chemotherapy. These findings suggest that NAC-I is upregulated along the clinical progression of ovarian carcinoma from primary to recurrent disease. Our observation that NAC-I expression correlates, with poor PFS in patients with post-chemotherapy but not pre-chemotherapy effusions further supports this view.
In conclusion, this study provides new evidence that NAC-I is expressed in a great majority of ovarian carcinoma sample from all anatomic sites. Besides, our results show that NAC-I expression is upregulated in effusions and elevated in tumor cells at all sites following the administration in chemotherapy. NAC-I is a therapeutic target for ovarian cancer patients who suffered from recurrent diseases.
References
1. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K. & Prive, G. G. (2005) Genome Biol 6, R82.
2. Bardwell, V. J. & Treisman, R. (1994) Genes Dev 8, 1664-77.
3. Albagli, O., Dhordain, P., Deweindt, C, Lecocq, G. & Leprince, D. (1995) Cell Growth Differ 6, 1193-8.
4. Chen, Z., Brand, N. J., Chen, A., Chen, S. J., Tong, J. H., Wang, Z. Y., Waxman, S. & Zelent, A. (1993) Embo J 12, 1161-7.
5. Polo, J. M., Dell'Oso, T., Ranuncolo, S. M., Cerchietti, L., Beck, D., Da Silva, G. F., Prive, G. G., Licht, J. D. & Melnick, A. (2004) Nat Med 10, 1329-35.
6. Yeyati, P. L., Shaknovich, R., Boterashvili, S., Li, J., Ball, H. J., Waxman, S., Nason-Burchenal, K., Dmitrovsky, E., Zelent, A. & Licht, J. D. (1999) Oncogene 18, 925-34.
7. Maeda, T., Hobbs, R. M., Merghoub, T., Guernah, L, Zelent, A., Cordon- Cardo, C, Teruya-Feldstein, J. & Pandolfi, P. P. (2005) Nature 433, 278-85.
8. Maeda, T., Hobbs, R. M. & Pandolfi, P. P. (2005) Cancer Res 65, 8575-8.
9. van Roy, F. M. & McCrea, P. D. (2005) Nat Rev Cancer 5, 956-64.
10. Park, J. I., Kim, S. W., Lyons, J. P., Ji, H., Nguyen, T. T., Cho, K., Barton, M. C, Deroo, T., Vleminckx, K., Moon, R. T. & McCrea, P. D. (2005) Dev Cell 8, 843-
54.
11. Fruehauf, J. P. & Alberts, D. S. (2003) Recent Results Cancer Res 161, 126-45. 12. Eltabbakh, G. H., Piver, M. S., Hempling, R. E., Recio, F. O., LeIe, S. B., Marchetti, D. L., Baker, T. R. & Blumenson, L. E. (1998) Gynecol Oncol 70, 392-7.
13. Leers, M., Kolgen, W., Bjorklund, V., Bergman, T., Tribbick, G., Persson, B., Bjorklund, P., Ramaekers, F. C, Bjorklund, B. & Schutte, B. (1999) J Pathol 5, 567- 572.
14. Caulin, C, Salvesen, G. S. & Oshima, R. G. (1997) J Cell Biol 138, 1379-94.
15. Cha, X. Y., Pierce, R. C, Kalivas, P. W. & Mackler, S. A. (1997) J Neurosci 17, 6864-71.
16. Roitman, M. F., Wheeler, R. A. & Carelli, R. M. (2005) Neuron 45, 587-97.
17. Koob, G. F. (1996) Neuron 16, 893-6.
18. Mackler, S. A., Korutla, L., Cha, X. Y., Koebbe, M. J., Fournier, K. M., Bowers, M. S. & Kalivas, P. W. (2000) J Neurosci 20, 6210-7.
19. Kalivas, P. W., Duffy, P. & Mackler, S. A. (1999) Synapse 33, 153-9.
20. Diaz-Montes, T. P. & Bristow, R. E. (2005) Curr Oncol Rep 7, 451-8.
21. Harter, P. & du Bois, A. (2005) Curr Opin Oncol 17, 505-14.
22. Gadducci, A., Iacconi, P., Cosio, S., Fanucchi, A., Cristofani, R. & Riccardo Genazzani, A. (2000) Gynecol Oncol 79, 344-9.
23. Gadducci, A., Iacconi, P., Fanucchi, A., Cosio, S., Teti, G. & Genazzani, A. R. (2000) Anticancer Res 20, 1959-64.
24. Zang, R. Y., Li, Z. T., Tang, J., Cheng, X., Cai, S. M., Zhang, Z. Y. & Teng, N. N. (2004) Cancer 100, 1152-61. 25. Dhordain, P., Albagli, O., Ansieau, S., Koken, M. H., Deweindt, C, Quief, S., Lantoine, D., Leutz, A., Kerckaert, J. P. & Leprince, D. (1995) Oncogene 11, 2689-97.
26. Auersperg, N., Pan, J., Grove, B. D., Peterson, T., Fisher, J., Maines-Bandiera, S., Somasiri, A. & Roskelley, C. D. (1999) Proc Natl Acad Sci U S A 96, 6249-54.
27. Hough, C. D., Sherman-Baust, C. A., Pizer, E. S., Montz, F. J., Im, D. D., Rosenshein, N. B., Cho, K. R., Riggins, G. J. & Morin, P. J. (2000) Cancer Res 60, 6281-7.
28. Boon, K., Osorio, E. C, Greenhut, S. F., Schaefer, C. F., Shoemaker, J., Polyak, K., Morin, P. J., Buetow, K. H., Strausberg, R. L., De Souza, S. J. & Riggins, G. J. (2002) Proc Natl Acad Sci U S A 99, 11287-92.
29. LaI, A., Lash, A. E., Altschul, S. F., Velculescu, V., Zhang, L., McLendon, R. E., Marra, M. A., Prange, C, Morin, P. J., Polyak, K., Papadopoulos, N., Vogelstein, B., Kinzler, K. W., Strausberg, R. L. & Riggins, G. J. (1999) Cancer Res 59, 5403-7.
30. Yen, M.-J., Hsu, C. Y., Mao, T. T., Wu, T. C, Roden, R., Wang, T. L. & Shih, I. M. (2006) Clin Cancer Res 12, in press.
31. Shih, I. M-, Elder, D. E., Speicher, D., Johnson, J. P. & Herlyn, M. (1994) Cancer Res 54, 2514-20.
32. Shih Ie, M., Sheu, J. J., Santillan, A., Nakayama, K., Yen, M. J., Bristow, R.
E., Vang, R., Parmigiani, G., Kurman, R. J., Trope, C. G., Davidson, B. & Wang, T. L- (2005) Proc Natl Acad Sci U S A 102, 14004-9.
33. United States Cancer Statistics 2002 (available at: www.cdc. gov/cancer/npcr/uscs; Seer.cancer.gov/statistics)
34. Collins T, Stone JR, Williams AJ. MoI Cell Biol 2001;21:3609-15.
35. Stogios PJ, Downs GS, Jauhal JJ, Nandra SK, Prive GG. Genome Biol 2005;6:R82 36. Albagli-Curiel O. Oncogene 2003;22:507-16.
37. Puccetti E, Zheng X, BrambillaD, Seshire A, Beissert T, Boehrer S, Nurnberger H, Hoelzer D, Ottmann OG, Nervi C, Ruthardt M. Cancer Res 2005;65:6080-8.
38. Liang XQ, Avraham HK, Jiang S, Avraham S. Oncogene 2004;23:5890-900.
39. Reuter S, Bartelmann M, Vogt M, Geisen C, Napierski I9 Kahn T, Delius H, Lichter P, Weitz S, Korn B, Schwartz E. EMBO J 1998;17:215-22.
40. van Roy FM, McCrea PD. Nat Rev Cancer 2005;5:956-64.
41. Valenta T, Lukas J5 Doubravska L, Fafilek B, Korinek V. EMBO J 2006;25:2326- 37.
42. Bibbo M: Comprehensive Cytopathology. Philadelphia: W.B. Saunders; 1991 (p. 543).
43. Nakayama K, Nakayama N, Davidson B, Sheu J, Natini Jinawath, Santillan A,
Salani R, Bristow RE, Morin PJ, Kurman RJ, Wang TL, Shih IM. Proc Natl Acad Sci USA.
44. Davidson B, Nielsen S, Christensen J, Asschenfeldt P, Berner A, Risberg B, Johansen P: Am J Surg Pathol 2001; 25:1405-1412.
45. Shih IM, Elder DE, Speicher D, Johnson JP, Herlyn M. Cancer Res 1994;54:2514- 20.
46. Guerardel C, Deltour S, Pirite S, Monte D, Begue A, Godwin AK, Leprince D. J Biol Chem 2001;276:3078-89.
47. Cha XY, Pierce RC, Kalivas PW, Mackler SA. J Neurosci 1997;17:6864-71. 48. Korutla L, Wang PJ, Mackler SA. J Neurochem 2005;94:786-93.
49. Davidson B, Trope' CG, Wang TL, Shih IeM. Gynecol Oncol
50. Davidson B. Diagn Cytopathol 2004;31:246-54.
51. Soubry A, van Hengel J, Parthoens E5 Colpaert C, Van Marck E, Waltregny D, Reynolds AB, van Roy F. Cancer Res 2005;65:2224-33.
52. Burleson KM, Casey RC, Skubitz KM, Pambuccian SE, Oegema TR, Skubitz APN. Gynecol Oncol 2004;93 : 170-81.
53. Davidson B, Alejandro E, Flørenes VA, Goderstad JM, Risberg B, Kristensen GB, Trope' CG, Kohn EC: Cancer 2004; 100:2139-2147.
54. Elloul S, Bukholt Elstrand M, Nesland JM, Trope CG, Kvalheim G, Goldberg I, Reich R, Davidson B Cancer 2005; 103:1631-1643.
55. Stevens EV, Raffeld M, Espina V, Kristensen GB, Trope' CG, Kohn EC, Davidson B: Cancer 2005; 103:2313-2319.
56. Davidson B, Espina V, Flørenes VA, Liotta LA, Kristensen GB, Trope' CG, Bemer A, Kohn EC: Clinical Cancer Res 2006; 12:791-799.
Incorporation by Reference
The contents of all references, patents, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

What is claimed is:
1. A method for detecting cancer in a subject comprising:
detecting the amount of the nucleic acid of SEQ ID NO:1, or a fragment thereof, in a biological sample from the subject;
wherein overexpression of SEQ ID NO:1 as compared to a control indicates that the subject has cancer.
2. The method of claim I3 wherein the amount of the nucleic acid of SEQ ID NO:1 or a fragment thereof, is detected by FISH.
3. The method of claim 1 , wherein the biological sample is from a solid tumor.
4. The method of claim 3, wherein the solid tumor is selected from the group consisting of a liver, breast, lung, or ovarian tumor.
5. The method of claim 3, wherein the tumor is a recurrent tumor.
6. The method of claim 1, wherein the biological sample is an ovarian tissue sample.
7. A method for detecting cancer in a subject comprising:
detecting the amount of the polypeptide of SEQ ID NO:2, or a fragment thereof, in a biological sample from the subject;
wherein overexpression of SEQ ID NO:2 as compared to a control indicates that the subject has cancer.
8. The method of claim 7, wherein the amount of the polypeptide of SEQ ID NO:2 or a fragment thereof, is detected by immunohistochemistry.
9. The method of claim 7, wherein the biological sample is from a solid tumor.
10. The method of claim 8, wherein the solid tumor is selected from the group consisting of a liver, breast, lung, or ovarian rumor.
11. The method of claim 9, wherein the tumor is a recurrent tumor.
12. The method of claim 7, wherein the biological sample is an ovarian tissue sample.
13. A method for detecting the recurrence of cancer in a subject, comprising:
detecting the amount of SEQ ID NO:1 present in a biological sample from the subject;
wherein overexpression of SEQ ID NO:1 as compared to a control is indicative of a recurrence of cancer.
14. The method of claim 12, wherein the amount of the polypeptide of SEQ ID NO: 1 or a fragment thereof, is detected by FISH.
15. The method of claim 13, wherein the biological sample is from a solid tumor.
16. The method of claim 15, wherein the solid tumor is selected from the group consisting of a liver, breast, lung, or ovarian tumor.
17. The method of claim 15, wherein the tumor is a recurrent tumor.
18. The method of claim 13, wherein the biological sample is an ovarian tissue sample.
19. The method of claim 13, further comprising the step of treating the subject based on the recurrence of the cancer.
20. A method for detecting a recurrence of cancer in a subject, comprising:
detecting the amount of SEQ ID NO:2 present in a biological sample from the subject; wherein overexpression of SEQ ID NO:2 as compared to a control is indicative of a recurrence of cancer.
21. The method of claim 20, wherein the amount of the polypeptide of SEQ ID NO:2 or a fragment thereof, is detected by immunohistochemistry.
22. The method of claim 20, wherein the biological sample is from a solid tumor.
23. The method of claim 22, wherein the solid tumor is selected from the group consisting of a liver, breast, lung, or ovarian tumor.
24. The method of claim 22, wherein the tumor is a recurrent tumor.
25. The method of claim 20, wherein the biological sample is an ovarian tissue sample.
26. The method of claim 17, further comprising the step of treating the subject based on the recurrence of the cancer.
27. A method of detecting the recurrence of ovarian cancer in a subject comprising: determining the amount of the polypeptide of SEQ ID NO:2 present in a biological sample from the subject; wherein an amount higher than a control level indicates that the subject has a recurrence of ovarian cancer.
28. A method for identifying a compound for the treatment or prevention of cancer comprising: contacting a cell with a test compound; determining if the test compound inhibits the expression of the nucleic acid of SEQ ID NO: 1; thereby identifying a compound for the treatment or prevention of cancer.
29. A method for identifying a compound for the treatment or prevention of cancer comprising: contacting a cell with a test compound; determining if the test compound inhibits the expression or activity of the polypeptide of SEQ ID NO:2; thereby identifying a compound for the treatment or prevention of cancer.
30. The method of claim 28 or 29, wherein the compound is selected from the group consisting of a small molecule, a peptide, a polypeptide, and a nucleic acid molecule.
31. The method of claim 30, wherein the peptide or polypeptide is an antibody or fragment thereof.
32. The method of claim 30, wherein the nucleic acid molecule is an siRNA, shKNA, antisense nucleic acid, or ribozyme.
33. The method of claim 28 or 29, wherein the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer.
34. The method of claim 28 or 29, wherein the cancer is ovarian cancer.
35. A method of treating or preventing cancer in a subject comprising: administering to a subject a compound that inhibits the expression or activity of a nucleic acid of SEQ ID NO:1 or a polypeptide of SEQ ID NO:2; thereby treating the subject.
36. The method of claim 35, wherein the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer.
37. The method of claim 35, wherein the cancer is ovarian cancer.
38. The method of claim 35, wherein the compound is selected from the group consisting of a small molecule, a peptide, a polypeptide, and a nucleic acid molecule.
39. The method of claim 38, wherein the peptide or polypeptide is an antibody or fragment thereof.
40. The method of claim 38, wherein the nucleic acid molecule is an siRNA, shRNA, antisense nucleic acid, or ribozyme.
41. A kit comprising an antibody, or fragment thereof, for use in determining the amount of the polypeptide of SEQ ID NO:2 in a sample and instructions for use.
42. The kit of claim 41 , further comprising a control.
43. The kit of claim 41, for use in the diagnosis cancer.
44. The kit of claim 41 , for determining the recurrence of cancer.
45. The kit of claim 43 or 44, wherein the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer.
46. A kit comprising a nucleic acid probe for use in determining the amount of the nucleic acid of SEQ ID NO:1 in a sample and instructions for use.
47. The kit of claim 46, further comprising a control.
48. The kit of claim 46, for use in the diagnosis cancer.
49. The kit of claim 46, for determining the recurrence of cancer.
50. The kit of claim 48 or 49, wherein the cancer is selected from the group consisting of ovarian, lung, liver and breast cancer.
51. The kit of claim 46, wherein the probe comprises a detectable label.
52. An antibody that specifically recognizes NAC-I .
53. The antibody of claim 52, wherein said antibody is a monocolonal antibody.
54. The antibody of claim 53, wherein said monocolonal antibody is a mouse monoclonal antibody.
55. The mouse monoclonal antibody produced by the hybridoma deposited as accession number
PCT/US2007/005218 2006-02-27 2007-02-27 Nac-i as a prognostic marker and a target for therapeutic target in human cancer Ceased WO2007100875A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US77715306P 2006-02-27 2006-02-27
US60/777,153 2006-02-27
US86058406P 2006-11-22 2006-11-22
US60/860,584 2006-11-22

Publications (2)

Publication Number Publication Date
WO2007100875A2 true WO2007100875A2 (en) 2007-09-07
WO2007100875A3 WO2007100875A3 (en) 2008-11-27

Family

ID=38459663

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/005218 Ceased WO2007100875A2 (en) 2006-02-27 2007-02-27 Nac-i as a prognostic marker and a target for therapeutic target in human cancer

Country Status (1)

Country Link
WO (1) WO2007100875A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023092153A3 (en) * 2021-11-22 2023-09-14 The Texas A&M University System Methods and compositions targeting nucleus accumbens-associated protein-1 for treatment of autoimmune disorders and cancers

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030100495A1 (en) * 2001-08-08 2003-05-29 Jian Zhang Human NAC-1 protein

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023092153A3 (en) * 2021-11-22 2023-09-14 The Texas A&M University System Methods and compositions targeting nucleus accumbens-associated protein-1 for treatment of autoimmune disorders and cancers

Also Published As

Publication number Publication date
WO2007100875A3 (en) 2008-11-27

Similar Documents

Publication Publication Date Title
Chen et al. Hedgehog signal pathway is activated in ovarian carcinomas, correlating with cell proliferation: it's inhibition leads to growth suppression and apoptosis
AU2010295172B2 (en) Methods and compositions for the diagnosis and treatment of thyroid cancer
US20220267854A1 (en) Egfr and ros1 kinase in cancer
JP2008546387A (en) Compositions and methods for treating and diagnosing cancer
CN101611315A (en) Biomarkers for cancer sensitive to anticancer agents and uses thereof
US9885720B2 (en) Methods for detecting and treating cancer
CA2891047A1 (en) Tumor tissue based biomarkers for bevacizumab combination therapies
WO2008128043A2 (en) Diagnostic and prognostic methods for renal cell carcinoma
EP2715365A1 (en) Ros kinase in lung cancer
JP5893037B2 (en) Means and methods for the diagnosis of cancer using antibodies that specifically bind to BRAFV600E
Jung et al. Correlation between chemokine receptor CXCR4 expression and prognostic factors in patients with prostate cancer
JP2015524051A (en) Use of Trop-2 as a predictive marker of response to anti-tumor therapy based on inhibitors of molecules of the CD9, Akt and tetraspanin signaling networks
AU2008296927C1 (en) Methods for diagnosing and treating cancers
JP2011520781A (en) Methods involving MS4A12 for treatment, diagnosis and testing, and agents targeting MS4A12
WO2007100875A2 (en) Nac-i as a prognostic marker and a target for therapeutic target in human cancer
US11029313B2 (en) Method of treating cervical neoplasia in patients infected with human papilloma virus
WO2011129427A1 (en) Diagnostic agent and therapeutic agent for cancer
EP3460476B1 (en) Biomarker composition comprising lrp-1 as active ingredient, for diagnosis of radiation-resistant cancer or prediction of radiation therapy prognosis
US20120058901A1 (en) Assay for the detection of recurrence in breast cancer using the novel tumor suppressor dear1
US20070280969A1 (en) RSF-1 as a prognostic marker and therapeutic target
US20060110395A1 (en) Use of CRKD as a breast cancer marker and cancer therapy target
WO2012078793A2 (en) Methods and compositions related to tazarotene-induced gene 1 (tig1)
Lucà et al. PATZ1 in Non-Small Cell Lung Cancer: A New Biomarker That Negatively Correlates with PD-L1 Expression and Suppresses the Malignant Phenotype. Cancers (Basel) 2023; 15: 2190
Yuan The role of Calpain2 in ZBTB18 regulation in Glioblastoma Multiforme
KR101927577B1 (en) Use of H2A.Z.1 as a hepatocellular carcinomar biomarker

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07751949

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 07751949

Country of ref document: EP

Kind code of ref document: A2