WO2007093618A1 - Caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2 - Google Patents

Caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2 Download PDF

Info

Publication number
WO2007093618A1
WO2007093618A1 PCT/EP2007/051445 EP2007051445W WO2007093618A1 WO 2007093618 A1 WO2007093618 A1 WO 2007093618A1 EP 2007051445 W EP2007051445 W EP 2007051445W WO 2007093618 A1 WO2007093618 A1 WO 2007093618A1
Authority
WO
WIPO (PCT)
Prior art keywords
vglut
protein
obsessive
disorders
seq
Prior art date
Application number
PCT/EP2007/051445
Other languages
English (en)
Inventor
Russell Mark Hampson
Diederik Willem Elisabeth Moechars
Zsuzsanna Callaerts-Vegh
Rudi Theo Angelica D'hooge
Theo Frans Meert
Original Assignee
Janssen Pharmaceutica N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Pharmaceutica N.V. filed Critical Janssen Pharmaceutica N.V.
Publication of WO2007093618A1 publication Critical patent/WO2007093618A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0356—Animal model for processes and diseases of the central nervous system, e.g. stress, learning, schizophrenia, pain, epilepsy
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2835—Movement disorders, e.g. Parkinson, Huntington, Tourette
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/30—Psychoses; Psychiatry
    • G01N2800/301—Anxiety or phobic disorders

Definitions

  • VGLUT2 vesicular glutamate transporter 2
  • DNPI differentiation-associated NaTPi cotransporter
  • the present invention provides evidence that VGLUT2 is associated with anxiety inducing conditions, in particular with obsessive-complusive spectrum disorders, including obsessive-compulsive disorder (OCD).
  • OCD obsessive-compulsive disorder
  • the present invention relates to methods for treating anxiety and anxiety related disorders. More particularly, the invention relates to methods of treating obsessive- compulsive spectrum disorders comprising the step of administering an effective amount of a VGLUT 2 antagonists to a subject in need of such treatment.
  • DSM-IV refers to the fourth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV TM.), published in 1994 by the American Psychiatric Association, Washington, D. C.
  • DSM-IV defines anxiety and related disorders as panic disorders without agoraphobia, panic disorders with agoraphobia, agoraphobia without history of panic disorder, specific phobia, social phobia, obsessive-compulsive disorder, post-traumatic stress disorder, acute stress disorder, generalized anxiety disorder, anxiety disorder due to a general medical condition, substance-induced anxiety disorder and anxiety disorder not otherwise specified.
  • Anxiety disorders are generally treated by counseling or with drugs.
  • Classes of drugs which are widely prescribed for the treatment of anxiety disorders include the benzodiazepines (such as diazepam) and buspirone hydrochloride.
  • the benzodiazepines were introduced during the 1960's. They have achieved widespread acceptance, but their use is nevertheless restricted due to their adverse side-effect profile, in particular their tendency to induce dependence.
  • Buspirone hydrochloride was introduced during the early 1980's. It lacks the dependence-inducing side effects of the benzodiazepines, but has a slow onset of action (about 4 weeks).
  • OCD obsessive-compulsive disorder
  • estimated life time prevalence rates in the United States ranging from 1.9% to 3.3% (Shapira et al, Depression and Anxiety 6; 170-173 (1997).
  • the DSM-IV includes as its diagnostic criteria for OCD that: the person exhibits either obsessions or compulsions; at some point during the course of the disorder the person has recognized that the obsessions or compulsions are excessive or unreasonable; the obsessions or compulsions caused marked stress, are time-consuming or significantly interfere with the person's normal routine, occupational/academic functioning, or usual social activities or relationships; if another axis I disorder is present, the content of the obsessions or compulsions is not restricted to it; and the disturbance is not due to the direct physiologic effects of a substance or a general medical condition.
  • the DSM-IV sets four indicia of obsessions.
  • the person has recurrent and/or persistent thoughts, impulses or images that are experienced at some time during the disturbance as intrusive and inappropriate and as causing marked anxiety or distress.
  • the thoughts, impulses or images are not simply excessive worries about real- life problems.
  • the person attempts to ignore or suppress such thoughts, impulses or images or to neutralize them through some other thought or action.
  • the person recognizes that the obsessional thoughts, impulses, or images are products of his or her own mind and are not imposed from without.
  • the DSM-IV sets forth two indicia of compulsion.
  • Individuals who meet the DSM-IV criteria for OCD can be scored using the Yale- Brown Obsessive-Compulsive Scale (Y-BOCS). Y-BOCS scores range from O to 40. Generally, 0 to 7 is considered a subclinical syndrome, 8-15 is considered mild, 16-23 is considered moderate, 24-31 is considered severe, and 32-40 is considered extremely severe.
  • Obsessive-compulsive spectrum disorders include somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome.
  • ICDs impulse control disorders
  • paraphilia and nonparaphilic sexual addictions include somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome.
  • ICDs impulse control disorders
  • paraphilia and nonparaphilic sexual addictions include Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome.
  • movement disorders including Tourette's syndrome.
  • Somatoform disorders include body dysmorphic disorder (BDD) and hyperchondriasis.
  • Body dysmorphic disorder (BDD) is a preoccupation with an imagined slight defect in appearance that causes significant distress or impairment in functioning.
  • Individuals suffering from BDD have preoccupations similar to OCD obsessions in that they have repetitive intrusive thoughts, often perform time-consuming, repetitive and sometimes ritualistic behaviors.
  • Hypochondriasis is a preoccupation with the fear of having, or the idea that one has, a serious disease based on the person's misinterpretation of bodily signs or symptoms.
  • Hypochondriacal preoccupations resemble OCD obsessions in that they are often experienced as intrusive and persistent, and the individuals often display repetitive checking behaviors.
  • Eating disorders include anorexia nervosa, bulimia nervosa and binge eating disorder (BED).
  • the DSM-IV defines anorexia nervosa as a refusal to maintain a minimally normal body weight; intensive fear of gaining weight or becoming fat even though underweight; significant disturbance in perception of body shape or size; and, in females, amenorrhea.
  • the DSM-IV defines bulimia nervosa as recurrent episodes of binge eating followed by inappropriate compensatory behaviors designed to prevent a weight gain.
  • BED is characterized by recurrent episodes of binge eating in the absence of regular use of inappropriate compensatory behaviors.
  • all three disorders are characterized by a core preoccupation with food and body weight. Individuals suffering from eating disorders often perform specific rituals, and have an abnormal preoccupation with food and weight. -A-
  • the DSM-IV defines an impulse control disorder (ICD) as the failure to resist the impulse, drive or temptation to perform some act that is harmful.
  • ICDs include intermitted explosive disorder (IED), compulsive buying or shopping, repetitive self- mutilation (RSM), onychophagia, psychogenic excoriation, kleptomania, pathological gambling, and trichotillomania.
  • IED intermitted explosive disorder
  • RSSM repetitive self- mutilation
  • Most individuals suffering from ICDs experience increasing sense of tension or arousal before committing the act, then pleasure, gratification or relief at the time of committing the act.
  • Individuals suffering from ICD often experience impulses which are intrusive, persistent and associated with anxiety or tension.
  • Individuals suffering from paraphilias and nonparaphilic sexual addictions (NPSAs) experience similar increasing senses of tension or arousal before committing the act, then pleasure, gratification or relief at the time of committing the act.
  • NPSAs nonparaphilic sexual addiction
  • Tourette's syndrome is a chronic neuropsychiatric disorder characterized by motor tics and one or more vocal tics beginning before the age of 18 years.
  • the DSM-IV defines a tic as a sudden, rapid, recurrent, nonrhythmic, stereotyped motor movement or vocalization.
  • Tourette's syndrome patients may be able to suppress tics for varying lengths of time, but eventually experience them as irresistible and perform them.
  • Tourette's patients exhibit obsessions resembling OCD obsessions, for example, they often feel the need to perform tics until they are felt to be "just right.”
  • Autism is characterized by difficulties with social interaction, speech and communication, and by a compulsive core. Autistic individuals often display compulsive, repetitive behaviors.
  • Behavior modification therapy is often efficacious in treating obsessive-compulsive spectrum disorders, including OCD.
  • behavior modification therapy generally requires prolonged periods of treatment.
  • an individual may not respond favorably to behavior modification therapy unless the severe OC spectrum disorder symptoms are first controlled or decreased.
  • the drug therapy will be one that has a short onset of action, preferably less than two weeks.
  • Some OC spectrum disorders, such a bulimia nervosa have been shown to respond to monoamine oxidase inhibitors (MAOIs).
  • MAOIs monoamine oxidase inhibitors
  • SRIs serotonin reuptake inhibitors
  • Tourette's syndrome, hypochondriasis, anorexia nervosa, and ICDs such as intermitted explosive disorder (IED), kleptomania, pathological gambling, trichotillomania, compulsive shopping, onychophagia and psychogenic excoriation may respond to SRIs.
  • IED intermitted explosive disorder
  • kleptomania pathological gambling
  • trichotillomania compulsive shopping
  • onychophagia psychogenic excoriation
  • OCD obsessive-compulsive disorder
  • VGLUT 2 +/ ⁇ mice Through the phenotypic analysis of the VGLUT 2 +/ ⁇ mice, it has now been found that VGLUT 2 antagonism strongly reduces burying in the defensive marble-burying test, and extinguished conditioned taste aversion in the taste aversion test.
  • the present invention provides the use of VGLUT 2 in an assay to identify obsessive-complusive spectrum disorder compounds.
  • the present invention provides a method for determining whether a compound is useful in the treatment of obsessive-compulsive spectrum disorders, said method comprising the steps of; a) providing a composition comprising a VGLUT 2 protein; b) contacting the VGLUT 2 protein with the test compound; and c) measuring the activity of the VGLUT 2 protein; wherein a decrease in the VGLUT 2 activity in the presence of the test compound is an indicator of an anti obsessive-compulsive spectrum disorder compound.
  • the invention provides the use of a compound identified using an assay according to the invention, in the preparation of a medicament for treating obsessive-compulsive spectrum disorders, in particular in the preparation of a medicament to treat obsessive-compulsive disorder, as well as to treat somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome.
  • ICDs impulse control disorders
  • paraphilia and nonparaphilic sexual addictions sdeham's chorea
  • torticollis autism
  • movement disorders including Tourette's syndrome.
  • the invention provides a method of treatment of obsessive- compulsive spectrum disorders, in particular in the treatment of a medicament to treat obsessive-compulsive disorder, as well as to treat somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome, said method comprising the step of administering an effective amount of an VGLUT 2 inhibitor to a subject in need of such treatment.
  • the present invention provides the use of VGLUT 2 knock out animals as a model to study the effects of obsessive-compulsive spectrum disorders. In particular to study the effects of a stressor in an obsessive-compulsive spectrum disorder animal model.
  • FIG. 1 Targeted disruption of the VGLUT2 gene.
  • A Structure of the wild type locus, targeting vector and recombinant locus. Boxes represent the known exons, in white and grey indicated are the non-coding and coding regions.
  • a lambda pKOS based targeting construct was generated by replacing exon 2 by the IRESBgeo/PGK-Puro selection cassette, disrupting the open reading frame (site of interruption shown in B). Bleu and red arrows indicate position of the PCR primers used for genotyping the wild type and targeted allele respectively.
  • C The wild type and targeted allele give a 333 bp (lane 5 to 7) and 503 bp (lane 2 to 3) PCR product respectively and identify VGLUT2 +/+
  • VGLUT2 +/" (lane 1 and 5) and VGLUT2 7" (lane 2 and 6) animals.
  • E Expression of the VGLUT2 protein in brain derived from 18.5 day old embryos as detected VGLUT2 +/+ mouse (lane 4 and 5) was absent in the VGLUT2 ⁇ ⁇ mouse (lane 9 and 10) as determined by western blot.
  • VGLUT2 protein was detected in lliivveerr ddeerriivveedd ffrroomm 18.5 day old VGLUT2 +/+ (lane 2 and 3) or VGLUT2 7" (lane 6 and 7) embryos .
  • Figure 2 Behavioral performance of VGLUT2 +/" mice and wildtype littermates in water maze, defensive marble burying and conditioned taste aversion tests. Acquisition training of the water maze task shows comparable learning performance in both groups (A). Mean escape latency during the 10 trial blocks does not differ significantly between wildtype (open circles) and VGLUT2 +/" mice (closed squares). Mean time in quadrant during the final probe trial (B) shows preference for the target quadrant in wildtype mice (open bars) but not in VGLUT2 +/" mice (closed bars). VGLUT2 +/" mice spent equal amounts of time in the target quadrant and one of the adjacent quadrants. These quadrants were on the side where the experimenter was standing to remove the mice from the pool.
  • VGLUT2 +/" mice showed a strong tendency to swim towards the experimenter, which influenced this measure.
  • VGLUT2 +/" mice closed bar
  • buried only half the amount of marbles buried by the wildtype mice open bar.
  • Conditioned taste aversion during 5 extinction trials revealed a difference between wildtype (open symbols) and VGLUT2 +/" mice (closed symbols) when the group was split into high (circles) and low responders (squares).
  • WT wildtype mice
  • HZ VGLUT2 +/ ⁇ mice
  • AI aversion index
  • T target quadrant
  • ADJl and ADJ2 two adjacent quadrants
  • oppT opposite quadrant.
  • Error bars on all figures are SEMs; asterisk indicates significance of difference from wildtype mean, * p ⁇ 0.05.
  • the present invention provides the use of a VGLUT 2 enzyme in an assay to identify compounds useful in treating obsessive-compulsive spectrum disorders. Consequently, in a further aspect the present invention provides the use of a VGLUT 2 enzyme in an assay to identify anti obsessive-compulsive spectrum disorders.
  • the VGLUT 2 protein or fragment as used herein refers to an isolated protein selected from the group consisting of; i.
  • mouse VGLUT 2 (SEQ ID No:4), rat VGLUT 2 (SEQ ID No:6), human VGLUT 2 variant (SEQ ID No:8), human VGLUT 2 (SEQ ID No:2) or a fragment thereof, wherein said fragment is at least 10, preferably at least 15, in particular at least 20 amino acids long or ii. an amino acid sequence encoding an VGLUT 2 protein, wherein said amino acid sequence has at least 80% sequence identity, preferably at least 90% sequence identity, more preferably at least 95 % or most preferably at least 98% sequence identity with the human VGLUT 2 protein (SEQ ID No:2) over its entire length.
  • VGLUT 2 protein in an assay according to the invention, wherein said VGLUT 2 protein is preferably being selected from; i. polynucleotides encoding the mouse (EMBL:NM_080853 - SEQ ID No:3), rat (EMBL:NM_053427 - SEQ ID No:5), human VGLUT 2 variant (SEQ ID No:3), rat (EMBL:NM_053427 - SEQ ID No:5), human VGLUT 2 variant (SEQ
  • VGLUT 2 enzyme or human (EMBL:NM_020346 - SEQ ID No:l) VGLUT 2 enzyme; or ii. a polynucleotide sequence encoding an VGLUT 2 protein, wherein said polynucleotide sequence has at least 75% sequence identity, in particular at least 80% identity, preferably at least 90% sequence identity, more preferably at least 95 % or most preferably at least 98% sequence identity with the polynucleotide encoding for the human IMPA2 protein (SEQ ID No:7) or human (EMBL:NM_020346 - SEQ ID No:l) VGLUT 2 enzyme; or ii. a polynucleotide sequence encoding an VGLUT 2 protein, wherein said polynucleotide sequence has at least 75% sequence identity, in particular at least 80% identity, preferably at least 90% sequence identity, more preferably at least 95 % or most preferably at least 98% sequence identity with the polynucleotide encoding for the
  • the present invention provides a method for determining whether a compound is useful in the treatment of obsessive-compulsive spectrum disorders, said method comprising the steps of; a) providing a composition comprising an VGLUT 2 protein; b) contacting the VGLUT 2 protein with the test compound; and c) measuring the activity of the VGLUT 2 protein; wherein a decrease in the VGLUT 2 activity in the presence of the test compound is an indicator of an anti obsessive-compulsive spectrum disorder compound.
  • compositions comprising the VGLUT 2 protein could either be cellular extracts, whole cells or organisms expressing the VGLUT 2 proteins according to the invention.
  • the cells used in the methods according to the invention can be amphibian cells, bacterial cells, yeast cells, insect cells or immortalized or native mammalian cells.
  • Examples for amphibia cells are Xenopus laevis oocytes, for bacteria cells E. coli cells, for yeast cells Saccharomyces cerevisiae, for insect cells SF9 cells, for immortalized mammalian cells COS-I or HeLa cells and for native mammalian cells the CHO or HEK 293 cells.
  • the composition comprising a VGLUT 2 protein consists of whole cells or membrane preparations of cells expressing VGLUT 2, more particular of Xenopus sp. oocytes or COS-I cells expressing VGLUT 2.
  • the aqueous medium can be temperature-controlled here, for example between 4°C and 40 0 C, and is preferably at room temperature or at 37°C.
  • the incubation time can be varied between a few seconds and several hours, depending on the interaction of the substance with the composition comprising the VGLUT 2 protein. Incubation times of between 1 minute and 60 minutes are preferred.
  • the aqueous medium may comprise suitable salts and/or buffer systems, such that, for example, a pH of between 6 and 8, preferably pH 7.0-7.5, is maintained in the medium during the incubation.
  • Suitable substances such as coenzymes, nutrients etc., may also be added to the medium.
  • the suitable conditions can easily be optimized by persons skilled in the art as function of the interaction of the substance to be investigated with the part of protein or protein on the basis of experience, the literature or preliminary experiments, in order to obtain the clearest possible measurement value in the method.
  • the binding of the compound to the protein is typically done via the displacement of a known labelled ligand of the protein or part of the protein.
  • a ligand here is a molecule which binds to the protein or part of the protein with a high specificity and is displaced from the binding site by a substance to be tested which also binds. Labelling is to be understood as meaning an artificial modification to the molecule, which facilitates detection. Examples are radioactive, fluorescent or luminescent labelling.
  • the binding to the protein is done using membrane preparations of cells expressing VGLUT 2.
  • the VGLUT 2 protein may be free in solution or bound to a solid support.
  • the VGLUT 2 protein is suspended in a hydrophobic environment employing natural or synthetic detergents, membrane suspensions and the like.
  • Preferred detergent complexes include the zwitterionic detergent 3 -[(3- cholamidopropyl)-dimethylammonio]-l -propane sulfonate (CHAPS) as well as sodium deoxycholate.
  • This assay consists of 1) the membranes containing VLGUT 2, 2) a radioactive labelled ligand, 3) a binding buffer (such as for example 50 mM HEPES pH 7.4, 1 mM EDTA) and the compound to be investigated for binding. After contacting using the abovementioned conditions, the amount of bound ligand is measured. If the test compound shows binding to the protein, this is detected as a reduced radioactive incorporation in the ligand/VGLUT2 protein complex.
  • This binding assay is suitably miniaturized such that it can be carried out in multiwell microtiter plates (96-, 384-, or 1536-well).
  • the physically detectable means is competition with labeled inorganic phosphate (Pi) or binding of ligand in an oocyte transient expression system.
  • the composition comprising VGLUT 2 is prepared as elsewhere described herein, preferably using recombinant DNA technology.
  • a sample of the test compound is then introduced to the reaction vessel containing the VGLUT 2 composition followed by the addition of Pi, alternatively, the Pi may be added simultaneously with the test compound.
  • the Pi may be added simultaneously with the test compound.
  • radioactively labelled Pi may be used.
  • the composition comprising the VGLUT 2 protein is then scored for the radioactivity.
  • a reduce in bound radioactivity compared to a positive control indicates the capability of the test compound to bind to the VGLUT 2 protein.
  • these assays may also be performed such that the practitioner measures the radioactivity remaining in the eluent from the aforementioned washing step, not with the protein.
  • VGLUT 2 is being determined, i.e. assays to evaluate ion channel cotransporter, are well known in the art. See, e.g. Aihara Y., et al, (2000) "Molecular cloning of a novel Brain- Type Na + -dependent inorganic phosphate Cotransporter" J. Neurochem. 74(6):2622- 2625. One such assay is described below.
  • the sodium dependent Pi uptake is determined using cells according to the invention, i.e. comprising the VGLUT 2 transporter.
  • the cells are prewashed in a Na + - free uptake medium and subsequently incubated in a Na + - containing uptake medium, further comprising inorganic phosphate doped with labeled inorganic phosphate.
  • doped with radiolabeled inorganic phosphate 32 Pi After incubation the cells are washed with Na + - free uptake medium and the amount of labeled Pi taken up by the cells is being determined. In the particular embodiment, the amount of radioactivity accumulated by the cells is determined using scintillation technology.
  • the Na + -dependent Pi uptake assay is performed using Xenopus laevis oocytes expressing VGLUT 2, in particular human VGLUT 2.
  • oocytes (five to 10 per individual condition) are washed with Na + - free uptake medium (100 mM choline chloride, 2 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , and 10 mM HEPES-Tris, pH 7.5).
  • the oocytes are then placed in Na + -containing uptake medium [(100 mM NaCl, 2 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , and 10 mM HEPES-Tris, pH 7.5), 0.1 mM phosphate (KH 2 PO 4 ) and 30 mCi of 32 Pi (2 mCi/ml)] and incubated for 1 h at room temperature in the presence or absence of the compound to be tested.
  • Na + -containing uptake medium (100 mM NaCl, 2 mM KCl, 1 mM CaCl 2 , 1 mM MgCl 2 , and 10 mM HEPES-Tris, pH 7.5), 0.1 mM phosphate (KH 2 PO 4 ) and 30 mCi of 32 Pi (2 mCi/ml)
  • the cells are washed up to 4 times with cold Na + - free uptake medium, transferred into a scintillation vial, dissolved in 0.2 ml of 10% sodium dodecyl sulfate, and counted.
  • VGLUT2 activity is determined using vesicle preparations and uptake experiments are performed as described by Herzog and co-workers (Herzog et al., 2001). Briefly, synaptosomes and synaptic vesicles were prepared from rodent brain, preferably rat brain cortex, by standards methods (Huttner et al., 1983).
  • control and VGLUT2 expressing immortalized mammalian cells like COS-I or HeLa cells or native mammalian cells like the CHO, PC 12, or HEK 293 cells, preferably BON cells (Herzog et al., 2001) were washed with PBS, and collected by scraping in ice-cold buffer containing 4 mM HEPES-KOH, pH 6.8-7.4 (preferably 7.4) and 0.25-0.32 M sucrose (preferably 0.32 M). Cells were homogenized using a Bioneb Cell Disruption System (Glas-Col Laboratory Products).
  • vesicle protein at 10 ⁇ g/ ⁇ l was added to 90 ⁇ l uptake buffer supplemented with 1-3 mM ATP (preferably 2 mM), 0-10 mM glutamate (preferably 0.6 ⁇ M), and 0.1-1.0 ⁇ M L[ 3 H]glutamate (Amersham Pharmacia Biotech, Uppsala, Sweden) (preferably 0.6 ⁇ M) in the presence or absence of inhibitors, and incubated for 1-15 minutes (preferably 10 minutes) at 4-37° C (preferably 30 0 C).
  • the uptake reaction was stopped by rapid filtration under suction over GF/C glass-fiber filters (Whatman, England) using a 96-well Packard filtration device. The filters were washed 4 times with ice-cold 0.15 M KCl. After the addition of Ultima-Gold MV to the filters, the radioactivity collected on the filters was counted in a Packard scintillation counter.
  • the uptake is determined using radiolabeled inorganic phosphate or radiolabeled L-glutamate, even more particular this assay is used to identify compounds capable to inhibit the activity of the VGLUT 2 protein.
  • Antagonists thus identified are found particular useful in the treatment of anxiety or anxiety related disorders, in particular in the treatment of obsessive-compulsive spectrum disorders.
  • the method to determine whether a test compound is capable to modulate, i.e. to stimulate or inhibit the activity of the VGLUT2 protein comprises the steps of: a) exposing vesicles comprising VGLUT 2 with the compound to be tested, and b) determine the change in Pi or glutamate uptake in said cells compared to the Pi or glutamate uptake in cells not exposed to the test compound.
  • the uptake is determined using radiolabeled inorganic phosphate or radiolabeled L-glutamate, even more particular this assay is used to identify compounds capable to inhibit the activity of the VGLUT 2 protein.
  • Antagonists thus identified are found particular useful in the treatment of anxiety or anxiety related disorders, in particular in the treatment of obsessive-compulsive spectrum disorders.
  • the kinetics of the VGLUT 2 enzyme with and without test modulators can be analyzed using known methods (e.g. Lineweaver-Burke plots, as used, for example by Lee (1996) Xenobiotica 26: (8' ) 1-83 ); for discussion on enzyme kinetic analysis generally see, for example, Suarez (1997) Proc. Nad. Acad Sci. USA 94:7065-7069; Northrop (1997) Bioorg. Med Chem. 5:641-644) and Sterrer (1997) J. Recept. Signal Transduct. Res. 17:511-520.
  • test modulators e.g. competitive or non-competitive antagonists
  • amphibia cells such as for example Xenopus oocytes or of tissue culture cells such as for example CHO or HEK293 cells, genetically manipulated to express VGLUT 2, in an assay according to the invention.
  • Cells suitable for performing an assay according to the invention are preferably higher eukaryotic cells derived from a multicellular organism and advantageously are mammalian cells. Cells may be transformed by any suitable technique available in the art. A number of techniques, such as calcium phosphate precipitation and electroporation are described in Sambrook et al., (1989) Molecular Biology: A Laboratory Manual, Cold Spring Harbor, which is incorporated herein by reference.
  • the invention provides the use of a compound identified using an assay according to the invention, in the preparation of a medicament for treating anxiety or anxiety related disorders, i.e. for treating anxiety and related disorders as panic disorders without agoraphobia, panic disorders with agoraphobia, agoraphobia without history of panic disorder, specific phobia, social phobia, obsessive- compulsive disorder, post-traumatic stress disorder, acute stress disorder, generalized anxiety disorder, anxiety disorder due to a general medical condition, substance-induced anxiety disorder and anxiety disorder not otherwise specified.
  • anxiety or anxiety related disorders i.e. for treating anxiety and related disorders as panic disorders without agoraphobia, panic disorders with agoraphobia, agoraphobia without history of panic disorder, specific phobia, social phobia, obsessive- compulsive disorder, post-traumatic stress disorder, acute stress disorder, generalized anxiety disorder, anxiety disorder due to a general medical condition, substance-induced anxiety disorder and anxiety disorder not otherwise specified.
  • the present invention provides the use of a compound identified using an assay according to the invention, in the preparation of a medicament for treating obsessive-compulsive spectrum disorders including OCD, somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome.
  • the compounds and compositions of the invention may be administered by any suitable route, and the person skilled in the art will readily be able to determine the most suitable route and dose for the condition to be treated. Dosage will be at the discretion of the attended physician or veterinarian, and will be dependent on the state and nature of the condition to be treated, the age and general state of health of the subject to be treated, the route of administration, and any previous treatment which may have been administered.
  • the compound identified as an anti-anxiety compound or an anti obsessive-compulsive spectrum disorder compound using an assay according to the invention may optionally be administered in conjunction with one or more other pharmaceutically active agent suitable for the treatment of the condition, i.e. it may be given together, before or after one or more such agents.
  • the compounds may be used in conjunction with another agent such as selective serotonin reuptake inhibitors (SSRI), serotonin and noradrenalin reuptake inhibitors (SNRI), monoamine oxidase inhibitors (MAOI), benzodiazepines and beta blockers.
  • SSRI selective serotonin reuptake inhibitors
  • SNRI serotonin and noradrenalin reuptake inhibitors
  • MAOI monoamine oxidase inhibitors
  • beta blockers beta blockers.
  • the carrier or diluent, and other excipients will depend on the route of administration, and again the person skilled in the art will readily be able to determine the most suitable formulation for each particular case.
  • the compound of the invention may be administered orally, topically, or parenterally in dosage unit formulations containing conventional pharmaceutically acceptable carriers, adjuvants, and vehicles.
  • parenteral as used herein includes subcutaneous, intravenous, intramuscular, intrathecal, intracranial, injection or infusion techniques.
  • administration of the compound to the CNS through the blood brain barrier.
  • the preferred route of administration will be by direct administration to the CNS, e.g. infusion via canulla or injection. Such administration may be directly into the site of injury, into neighbouring tissues or into the cerebrospinal fluid.
  • the invention includes various pharmaceutical compositions useful for ameliorating disease.
  • the pharmaceutical compositions according to one embodiment of the invention are prepared by bringing a compound of the invention and optionally one or more other pharmaceutically-active agents or combinations of the compound of the invention and one or more other pharmaceutically-active agents into a form suitable for administration to a subject, using carriers, excipients and additives or auxiliaries.
  • Frequently used carriers or auxiliaries include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol and polyhydric alcohols.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobial, anti-oxidants, chelating agents and inert gases.
  • Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington's Pharmaceutical Sciences, 20th ed.
  • the pharmaceutical compositions are preferably prepared and administered in dosage units.
  • Solid dosage units include tablets, capsules and suppositories.
  • different daily doses can be used for treatment of a subject. Under certain circumstances, however, higher or lower daily doses may be appropriate.
  • the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administrations of subdivided doses at specific intervals.
  • the invention provides a method of treatment of a condition associated with anxiety and related disorders as panic disorders without agoraphobia, panic disorders with agoraphobia, agoraphobia without history of panic disorder, specific phobia, social phobia, obsessive-compulsive disorder, posttraumatic stress disorder, acute stress disorder, generalized anxiety disorder, anxiety disorder due to a general medical condition, substance-induced anxiety disorder and anxiety disorder not otherwise specified, comprising the step of administering an effective amount of an VGLUT 2 inhibitor to a subject in need of such treatment.
  • the present invention provides a method of treatment of a condition associated with obsessive-compulsive spectrum disorders including OCD, somatoform disorders, eating disorders, impulse control disorders (ICDs), paraphilia and nonparaphilic sexual addictions, Sydeham's chorea, torticollis, autism, and movement disorders, including Tourette's syndrome, comprising the step of administering an effective amount of a VGLUT 2 inhibitor to a subject in need of such treatment.
  • the terms "treating", “treatment” and the like are used herein to mean affecting a subject, tissue or cell to obtain a desired pharmacological and/or physiological effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or sign or symptom thereof, and/or may be therapeutic in terms of a partial or complete cure of a disease.
  • Treating covers any treatment of, or prevention of disease in a vertebrate, a mammal, particularly a human, and includes: preventing the disease from occurring in a subject which may be predisposed to the disease, but has not yet been diagnosed as having it, inhibiting the disease, i.e. arresting its development; or relieving or ameliorating the effects of the disease, i.e. causing regression of the effects of the disease.
  • the term "effective amount” means an amount of a compound of the present invention effective to yield a desired therapeutic response, for example to prevent or treat a disease which is susceptible to treatment by administration of a pharmaceutical composition comprising a compound of the present invention as active ingredient.
  • the specific "therapeutically effective amount” will be at the discretion of the attendant physician or veterinarian and will of course vary with such factors as the particular condition being treated, the physical condition and clinical history of the subject, the type of animal being treated, the duration of the treatment, the nature of concurrent therapy (if any) and the specific formulations employed.
  • non-human animals and cells which harbor at least one integrated targeting construct that functionally disrupts an endogenous VGLUT 2 gene locus in said non-human animal or cell, typically by deleting or mutating a genetic element, e.g. exon sequence, splicing signal, promoter enhancer, that is required for efficient functional expression of the VGLUT 2 gene product.
  • a portion of the targeting construct integrates into an essential structural or regulatory element of the endogenous VGLUT 2 gene locus, thereby functionally disrupting it to generate a null allele.
  • null alleles are produced by integrating a non-homologous sequence encoding a selectable marker (e.g. a neo gene expression cassette) into an essential structural and/or regulatory sequence of a VGLUT 2 gene by homologous recombination of the targeting construct homology clamps with endogenous VGLUT 2 gene sequences, although other strategies may be employed.
  • a targeting construct is transferred by electroporation or microinjection into a totipotent embryonal stem (ES) cell line, such as the murine AB-I or CCE lines.
  • the targeting construct homologously recombines with endogenous sequences in or flanking a VGLUT 2 gene locus and functionally disrupts at least one allele of the VGLUT 2 gene.
  • homologous recombination of the targeting construct with endogenous VGLUT 2 locus sequences results in integration of a nonhomologous sequence encoding and expressing a selectable marker, such as neo, usually in the form of a positive selection cassette.
  • the functionally disrupted allele is termed a VGLUT 2 null allele.
  • ES cells having at least one VGLUT 2 null allele are selected for by propagating the cells in a medium that permits the preferential propagation of cells expressing the selectable marker. Selected ES cells are examined by PCR analysis and/or Southern blot analysis to verify the presence of a correctly targeted VGLUT 2 allele. Breeding of nonhuman animals which are heterozygous for a null allele may be performed to produce nonhuman animals homozygous for said null allele, so-called "knockout" animals (Donehower et al. (1992) Nature256: 215; Science256: 1392, incorporated herein by reference).
  • ES cells homozygous for a null allele having an integrated selectable marker can be produced in culture by selection in a medium containing high levels of the selection agent (e.g. G418 or hygromycin). Heterozygosity and/or homozygosity for a correctly targeted null allele can be verified with PCR analysis and/or Southern blot analysis of DNA isolated from an aliquot of a selected ES cell clone and/or from tail biopsies.
  • the selection agent e.g. G418 or hygromycin
  • Several gene targeting techniques have been described, including but not limited to: co- electroporation, "hit-and-run", single-crossover integration, and double-crossover recombination (Bradley et al. (1992) Bio/Technology 10: 534).
  • the invention can be practiced using essentially any VGLUT2 homologous gene targeting strategy known in the art.
  • the configuration of a targeting construct depends upon the specific targeting technique chosen. For example, a targeting construct for single-crossover integration or "hit-and-run" targeting need only have a single homology clamp linked to the targeting region, whereas a double-crossover replacement-type targeting construct requires two homology clamps, one flanking each side of the replacement region.
  • a preferred embodiment is a targeting construct comprising, in order: (1) a first homology clamp having a sequence substantially identical to a sequence within about 3 kilobases upstream (i.e. in the direction opposite to the trans lational reading frame of the exons) of an exon of an endogenous VGLUT 2 gene, (2) a replacement region comprising a positive selection cassette having a /?g£promoter driving transcription of a neogene, (3) a second homology clamp having a sequence substantially identical to a sequence within about 3 kilobases downstream of said exon of said endogenous VGLUT 2 gene, and (4) a negative selection cassette, comprising a HSV t&promoter driving transcription of an HSV tkgene.
  • Such a targeting construct is suitable for double- crossover replacement recombination which deletes a portion of the endogenous VGLUT 2 locus spanning said exon and replaces it with the replacement region having the positive selection cassette. If the deleted exon is essential for expression of a functional VGLUT 2 gene product, the resultant exon-depleted allele is functionally disrupted and is termed a null allele.
  • Targeting constructs of the invention comprise at least one VGLUT 2 homology clamp linked in polynucleotide linkage (i.e. by phosphodiester bonds) to a targeting region.
  • a homology clamp has a sequence which substantially corresponds to, or is substantially complementary to, an endogenous VGLUT 2 gene sequence of a nonhuman host animal, and may comprise sequences flanking the VGLUT 2 gene.
  • targeting constructs are generally at least about 50 to 100 nucleotides long, preferably at least about 250 to 500 nucleotides long, more preferably at least about 1000 to 2000 nucleotides long, or longer.
  • Construct homology regions are generally at least about 50 to 100 bases long, preferably at least about 100 to 500 bases long, and more preferably at least about 750 to 2000 bases long. It is believed that homology regions of about 7 to 8 kilobases in length are preferred, with one preferred embodiment having a first homology region of about 7 kilobases flanking one side of a replacement region and a second homology region of about 1 kilobase flanking the other side of said replacement region.
  • the length of homology i.e.
  • a homology region may be selected at the discretion of the practitioner on the basis of the sequence composition and complexity of the endogenous VGLUT 2 gene target sequence(s) and guidance provided in the art (Hasty et al. (1991) MoI. Cell. Biol.i l: 5586; Shulman et al. (1990) MoI. Cell. Biol. 10: 4466).
  • Targeting constructs have at least one homology region having a sequence that substantially corresponds to, or is substantially complementary to, an endogenous VGLUT 2 gene sequence (e.g. an exon sequence, an enhancer, a promoter, an intronic sequence, or a flanking sequence within about 3-20 kb of a VGLUT 2 gene).
  • Such a targeting transgene homology region serves as a template for homologous pairing and recombination with substantially identical endogenous VGLUT 2 gene sequence(s).
  • such homology regions typically flank the replacement region, which is a region of the targeting construct that is to undergo replacement with the targeted endogenous VGLUT 2 gene sequence (Berinstein et al. (1992) MoI. Cell. Biol.12: 360).
  • a segment of the targeting construct flanked by homology regions can replace a segment of an endogenous VGLUT 2 gene sequence by double-crossover homologous recombination.
  • Homology regions and targeting regions are linked together in conventional linear polynucleotide linkage (5' to 3' phosphodiester backbone).
  • Targeting constructs are generally double-stranded DNA molecules, most usually linear.
  • a first homologous recombination e.g.
  • strand exchange, strand pairing, strand scission, strand ligation) between a first targeting construct homology region and a first endogenous VGLUT 2 gene sequence is accompanied by a second homologous recombination between a second targeting construct homology region and a second endogenous VGLUT 2 gene sequence, thereby resulting in the portion of the targeting construct that was located between the two homology regions replacing the portion of the endogenous VGLUT 2 gene that was located between the first and second endogenous VGLUT 2 gene sequences.
  • homology regions are generally used in the same orientation (i.e. the upstream direction is the same for each homology region of a transgene to avoid rearrangements).
  • Double-crossover replacement recombination thus can be used to delete a portion of an endogenous VGLUT 2 gene and concomitantly transfer a nonhomologous portion (e.g. a neogene expression cassette) into the corresponding chromosomal location.
  • Double-crossover recombination can also be used to add a nonhomologous portion into an endogenous VGLUT 2 gene without deleting endogenous chromosomal portions.
  • double- crossover recombination can also be employed simply to delete a portion of an endogenous VGLUT 2 gene sequence without transferring a nonhomologous portion into the endogenous VGLUT 2 gene (see Jasin et al. (1988) Genes Devel.2: 1353).
  • Upstream and/or downstream from the nonhomologous portion may be a gene which provides for identification of whether a double-crossover homologous recombination has occurred; such a gene is typically the HSV tkgene which may be used for negative selection.
  • targeting constructs of the invention are used for functionally disrupting endogenous VGLUT 2 genes and comprise at least two homology regions separated by a nonhomologous sequence which contains an expression cassette encoding a selectable marker, such as neo (Smith and Berg (1984) Cold Spring Harbor Svmp. Quant. Biol. 49: 171; Sedivy and Sharp (1989) Proc. Natl. Acad. ScL (US.A.)86: 227; Thomas and Capecchi (1987) op.cit. ).
  • some targeting transgenes of the invention may have the homology region(s) flanking only one side of a nonhomologous sequence.
  • Targeting transgenes of the invention may also be of the type referred to in the art as “hit-and-run” or “in-and-out” transgenes (Valancius and Smithies (1991) MoI. Cell. Biol.l l: 1402; Donehower et al. (1992) Nature356: 215; (1991) J. NIH Res.3: 59; which are incorporated herein by reference).
  • the positive selection expression cassette encodes a selectable marker which affords a means for selecting cells which have integrated targeting transgene sequences spanning the positive selection expression cassette.
  • the negative selection expression cassette encodes a selectable marker which affords a means for selecting cells which do not have an integrated copy of the negative selection expression cassette.
  • Preferred expression cassettes for inclusion in the targeting constructs of the invention encode and express a selectable drug resistance marker and/or a HSV thymidine kinase enzyme.
  • Suitable drug resistance genes include, for example: g/?t(xanthine-guanine phosphoribosyltransferase), which can be selected for with mycophenolic acid; neo(neomycin phosphotransferase), which can be selected for with G418 or hygromycin; and DFHR (dihydro folate reductase), which can be selected for with methotrexate (Mulligan and Berg (1981) Proc. Natl. Acad. ScL (TJ.S.A.Y78: 2072; Southern and Berg (1982) J. MoI. 21. Genet.1 : 327; which are incorporated herein by reference).
  • Selection for correctly targeted recombinants will generally employ at least positive selection, wherein a nonhomologous expression cassette encodes and expresses a functional protein (e. g. neo or gpi) that confers a selectable phenotype to targeted cells harboring the endogenously integrated expression cassette, so that, by addition of a selection agent (e.g. G418 or mycophenolic acid) such targeted cells have a growth or survival advantage over cells which do not have an integrated expression cassette. It is preferable that selection for correctly targeted homologous recombinants also employ negative selection, so that cells bearing only nonhomologous integration of the transgene are selected against.
  • a functional protein e. g. neo or gpi
  • a selection agent e.g. G418 or mycophenolic acid
  • such negative selection employs an expression cassette encoding the herpes simplex virus thymidine kinase gene (HSV tk) positioned in the transgene so that it should integrate only by nonhomologous recombination.
  • HSV tk herpes simplex virus thymidine kinase gene
  • Such positioning generally is accomplished by linking the HSV ⁇ expression cassette (or other negative selection cassette) distal to the recombinogenic homology regions so that double-crossover replacement recombination of the homology regions transfers the positive selection expression cassette to a chromosomal location but does not transfer the HSV tkgem (or other negative selection cassette) to a chromosomal location.
  • a nucleoside analog, gancyclovir, which is preferentially toxic to cells expressing HSV tk, can be used as the negative selection agent, as it selects for cells which do not have an integrated HSV ⁇ expression cassette.
  • FIAU may also be used as a selective agent to select for cells lacking HSV tk.
  • targeting constructs of the invention preferably include: (1) a positive selection expression cassette flanked by two homology regions that are substantially identical to host cell endogenous VGLUT 2 gene sequences, and (2) a distal negative selection expression cassette.
  • targeting constructs which include only a positive selection expression cassette can also be used.
  • a targeting construct will contain a positive selection expression cassette which includes a neo gene linked downstream (i.e. towards the carboxy-terminus of the encoded polypeptide in translational reading frame orientation) of a promoter such as the HSV t&promoter or the pgk promoter.
  • the targeting transgene will also contain a negative selection expression cassette which includes an HSV t£gene linked downstream of a HSV promoter.
  • targeting constructs of the invention have homology regions that are highly homologous to the predetermined target endogenous DNA sequence(s), preferably isogenic (i.e. identical sequence). Isogenic or nearly isogenic sequences may be obtained by genomic cloning or high-fidelity PCR amplification of genomic DNA from the strain of nonhuman animals which are the source of the ES cells used in the gene targeting procedure.
  • Targeting transgenes can be transferred to host cells by any suitable technique, including microinjection, electroporation, lipofection, biolistics, calcium phosphate precipitation, and viral-based vectors, among others. Other methods used to transform mammalian cells include the use of Polybrene, protoplast fusion, and others (see, generally, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., 1989, CoId Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., which is incorporated herein by reference).
  • the "knock out animal” or “transgenic animal' as used herein refers to a non-human animal, usually a mammal and in particular a rodent, mice, having a non-endogenous (i.e. heterologous) nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA. This heterologous nucleic acid is introduced into the germ line of said transgenic animal by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal using art known procedures.
  • VGLUT2 knockout mice were developed in collaboration with Lexicon Genetics Inc. Using a PCR probe derived from the second coding exon of murine VGLUT2 genomic clones were isolated by screening of the 129SvEvBrd derived lambda pKOS genomic library (Wattler et al, 1999). A 9.8 kb genomic clone spanning the first three coding exons was used to generate the targeting vector. An IRESBgeo/PGKpuro selection cassette was inserted as an Sfil fragment to replace a 287bp VGLUT2 genomic fragment spanning exon 2 after yeast-mediated homologous recombination.
  • the Notl- linearized vector was electroporated into 129 Sv/Evbrd(LEXl) embryonic stem (ES) cells and puromycine-resistant ES cell clones were isolated and analyzed for homologous recombination by Southern blot analysis.
  • Targeted ES cell clones were injected into C57BL/6(albino) blastocysts, and the resulting chimeras were mated to C57BL/6(albino) females to generate animals heterozygote (+/-) for the mutation. These were subsequently crossed to generate all three genotypes employed in the resorted studies.
  • PCR was used to screen genotypes by using DNA isolated from mouse tail biopsy samples. Primers 5 'GGTGCTGGAG AAGAAGC AG3 ' and
  • VGLUT2 primer 5'TGCTACCTCACAGGAGAATGGAS ' primer 5'GCGCACCTTCTTGCACAAATS ' probe 5 'CCTTTTTCTCCCAGCCGTTAGGCCAS' [5']FAM [3']TAMRA
  • VGLUTl primer 5'CCCCCAAATCCTTGCACTTT3' primer 5 ' AACAAATGGCCACTGAGAAACC3 ' probe 5'GGCGGCCTGGAACCACCCA3' [5']FAM [3']TAMRA actin: primer 5 ' CATCTTGGCCTCACTGTCCAC3 ' primer 5' GGGCCGGACTCATCGTACT3 ' probe 5' TGCTTGCTGATCCACATCTGCTGGA3' [5']FAM [3']TAMRA
  • Brains from E18.5t wild type, heterozygous and homozygous embryos were used to prepare mitochondria with the MITO-ISOl kit from Sigma and following their technical bulletin. Briefly, fresh brain samples (obtained within 1 hour of sacrifice and kept on ice) were washed twice using 2 volumes of Ix extraction buffer A. 75 mg of brain were homogenized with 10 volumes of Ix extraction buffer A containing 2 mg/ml albumin. Use a 3 ml glass tube and PTFE pestle homogenizer with overhead electric motor (20 rpm). Move the pestle up and down 5-10 times for complete homogenization. Keep the homogenate on ice.
  • VGLUT 2 aggregates after boiling, so SDS-PAGE was performed only with 25 ⁇ g non-boiled samples on 7.5 % Tris-Glycine PAGEr Duramide precast gels (Cambrex catnr 59601) and transferred by semi-dryblotting (1 mA per cm2 for 1 hour) to Invitrolon PVDF membranes 0.45 ⁇ M (catnr. LC2005).
  • mice were maintained in an SPF facility that meets all Belgian and EU requirements for animal care. Mice were group-housed in a climate-controlled animal colony with a 12h dark-light cycle (light on 6:00 EST) with free access to food and water, except during behavioural testing. Adequate measures were taken to minimize pain or discomfort. All experiments were carried out in accordance with the European Communities Council Directives (86/609/EEC) and were approved by the local ethical committee.
  • Phenotypical analysis mouse behavioural tests
  • mice were placed individually in transparent plastic cages (15 x 26 x 42 cm) containing 5 cm of sawdust and 24 identical glass marbles (-1.5 cm diameter) evenly spaced 2 cm from the cage wall (Njung'e and Handley, 1991; Millan et al., 2000). The cages were placed on a platform 80 cm above the floor and under bright illumination. After 30 minutes, the mice were returned to their home cage and the number of marbles buried two thirds by saw dust was counted.
  • the platform was removed from the pool, and the search pattern of the mice was recorded for 100 s. After establishing a stable acquisition curve and a clear preference for the target quadrant during probe trials, a reversal test was administered. In this test, platform was placed opposite the trained position and latency to find the platform was measured. swimming paths of the animals were recorded using Etho Vision video tracking equipment and software (Noldus bv, Wageningen, the Netherlands).
  • Motor coordination was assayed using a rotarod.
  • the rod is 3cm in diameter with a knurled surface and is suspended 12.5 cm above the timer trip plates.
  • the rotarod apparatus was used in accelerating mode, gradually increasing from 4 to 40 rpm over the course of 5 minutes (300 sec). Latency to fall off the rod was automatically recorded for each mouse in 2 trials, separated by an interval of 1 hour. The mean value of the fall latency over the two trials was taken for statistical analysis.
  • mice were acclimated to the rod on the morning prior to the testing afternoon.
  • the training session consists of 2 parts, with the first part as a 3-minute session at gradually increasing speed (2 - 20 rpm) and the second part as a 1 -minute session at constant speed (16 rpm). During this training session, mice were placed back on the rod every time they fell off.
  • Results are expressed as mean ⁇ sem. To identify significant differences between WT and DNPI +/- KO mice, statistical comparisons were done with the Wilcoxon-Mann- Whitney Test. In all cases, significant levels were set at p ⁇ 0.05.
  • VGLUT2 expressing cells preferably BON cells (Herzog et al., 2001) were washed with PBS, and collected by scraping in ice-cold buffer containing 4 mM HEPES-KOH, pH 6.8-7.4 (preferably 7.4) and 0.25-0.32 M sucrose (preferably 0.32 M). Cells were homogenized using a Bioneb Cell Disruption System (Glas-Col Laboratory Products).
  • Nuclei, mitochondria, and cell debris were pelleted at 10,000 x g for 5 minutes, and the resulting supernatant was centrifuged at 200,000 x g for 20 minutes. The resulting pellet was resuspended in uptake buffer containing 10 mM HEPES-KOH, pH 6.8-7.4 (preferably 7.4), 0.25-0.32 M sucrose (preferably 0.32 M), 1-4 mM KCl (preferably 4 mM), and 4-8 mM MgSO 4 (preferably 4 mM) (final concentration, 10 mg/ml protein). Glutamate uptake assays were performed as described previously (Bellocchio et al, 2000).
  • vesicle protein at 10 ⁇ g/ ⁇ l was added to 90 ⁇ l uptake buffer supplemented with 1-3 mM ATP (preferably 2 mM), 0-10 mM glutamate (preferably 0.6 ⁇ M), and 0.1-1.0 ⁇ M L[ 3 H]glutamate (Amersham Pharmacia Biotech, Uppsala, Sweden) (preferably 0.6 ⁇ M) in the presence or absence of inhibitors, and incubated for 1-15 minutes (preferably 10 minutes) at 4-37° C (preferably 30 0 C).
  • the uptake reaction was stopped by rapid filtration under suction over GF/C glass-fiber filters (Whatman,
  • VGLUT2 ⁇ ⁇ mice Lethality of VGLUTI 1' newborns VGLUT2 deficient animals were born at the expected Mendelian frequency however, VGLUT2 ⁇ ⁇ mice died at or immediately after birth. El 8.5 embryos, derived from VGLUT2 +/" x VGLUT2 +/" breeding were collected to investigate whether the lack of VGLUT2 protein caused any developmental abnormalities. Following caesarean delivery, mutant embryos appeared completely lifeless, did not react to forceps stimuli, remained in a fetal position and did not exhibit breathing reflex. They became rapidly cyanotic and died within a few minutes after delivery as judged from cessation of heartbeats. Full necropsie and histological examination did not reveal any apparent developmental abnormalities. Serial histological sections through the brain did not show obvious difference in cytoarchitecture (not shown). In the spinal cord region, histology of the motor neurons and dorsal root ganglia along the VGLUT2 ⁇ ⁇ spinal cords was normal
  • VGLUT2 +/ ⁇ mice were indistinguishable from VGLUT2 +/+ littermates in terms of development, growth, immune function and fertility.
  • An in dept neurological analysis did not reveal any difference between VGLUT2 +/ ⁇ and VGLUT2 +/+ mice in neuromotor performance (spontaneous activity in the home cage, open field test, rotarod) anxiety related behaviour (elevated plus maze, social interaction) or learning and memory
  • VGLUT2 +/+ group In the VGLUT2 +/+ group, this subdivision resulted in 4 low and 8 high responders that only showed a difference on extinction trial 5.
  • VGLUT2 +/ ⁇ mice showed essentially normal behavioural and cognitive abilities excepting an apparently isolated decrease in some defensive functions.
  • VGLUT2 +/ ⁇ mice were normal with respect to neuromotor abilities, locomotion and exploratory activity, contextual and cued fear response learning in the step-through and contextual fear test boxes, and taste aversion conditioning.
  • Some interesting changes were observed in the marble burying test, water maze performance and extinction of conditioned taste aversion, which could relate to decreased defensive reactions.
  • acquisition learning of the water maze task was indistinguishable between GLUT2 /+ and VGLUT2 +/ ⁇ mice.
  • VGLUT2 +/" mice failed to show spatial preference for the target quadrant following the 10 days of acquisition training (Fig. 2B). This could be attributed to non-cognitive changes (e.g. exploration or responding to the human experimenter), rather than a deficit in spatial information storage or retrieval per se as more specific measures of spatial accuracy (e.g. number of target entries) were unaltered.
  • Therapeutics for human OCD also decrease marble burying (Ichimaru et al., 1995; Matsushita et al., 2005; Njung'e and Handley, 1991; Shimazaki et al., 2004; Shinomiya et al., 2005), and excessive glutamatergic excitation in the cortico- striato-pallido-thalamo-cortical pathway may play a role in the pathophysiology of OCD (Chakrabarty et al., 2005; Rosenberg et al., 2001).
  • mice antagonism of glutamatergic neurotransmission with a group II metabotropic receptor antagonist resulted in a reduced burying in the marble-burying behaviour test and was suggested for clinical use in OCD (Shimazaki et al., 2004).
  • VGLUT2 +/" mice The present targeting of a glutamatergic component with mainly diencephalic and brainstem distribution could explain the apparent lack of cognitive defects sensu stricto in VGLUT2 +/" mice.
  • Thalamic and brainstem nuclei have various functions in motor command generation and sensory information processing (Kobayashi and Isa, 2002), and are crucially involved in the expression of various defensive reactions (Brandao et al., 2005).
  • VGLUT2 is abundantly expressed in thalamus, and glutamatergic neurotransmission was found to be strongly reduced in VGLUT2 ⁇ ⁇ thalamic cultures.
  • the mediating role of thalamus in the release of defensive behaviours has long been established (Alexinsky et al., 1971; Kanki and
  • Gyertyan L Analysis of the marble burying response: marbles serve to measure digging rather than evoke burying; Behav. Pharmacol. 1995 Jan; 6(1):24-31.
  • Antzoulatos EG Byrne JH. Learning insights transmitted by glutamate. Trends Neurosci. 2004 Sep;27(9):555-60.
  • Kanki JP Adams DB. Ventrobasal thalamus necessary for visually-released defensive boxing of rat. Physiol Behav. 1978 JuI; 21(1):7-12.
  • Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells a general strategy for targeting mutations to non-selectable genes.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Public Health (AREA)
  • Toxicology (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Food Science & Technology (AREA)

Abstract

La présente invention concerne la caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2 (VGLUT 2), également appelé transporteur de phosphate inorganique sodium-dépendant spécifique au cerveau (DNPI), un système de transport du phosphate inorganique prédominant dans les terminaisons synaptiques des neurones diencéphaliques. En particulier, la présente invention démontre que le VGLUT2 est associé à des pathologies induisant de l'anxiété, en particulier à des troubles de type obsessionnel compulsif, y compris le trouble obsessionnel compulsif (TOC).
PCT/EP2007/051445 2006-02-17 2007-02-14 Caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2 WO2007093618A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP06110111 2006-02-17
EP06110111.9 2006-02-17

Publications (1)

Publication Number Publication Date
WO2007093618A1 true WO2007093618A1 (fr) 2007-08-23

Family

ID=36580402

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2007/051445 WO2007093618A1 (fr) 2006-02-17 2007-02-14 Caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2

Country Status (1)

Country Link
WO (1) WO2007093618A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002008384A2 (fr) * 2000-07-25 2002-01-31 The Regents Of The University Of California Nouveaux transporteurs de glutamate
WO2003029828A2 (fr) * 2001-09-24 2003-04-10 Grünenthal GmbH Procede de criblage pour differentes indications a l'aide de proteines bnpi ou dnpi

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002008384A2 (fr) * 2000-07-25 2002-01-31 The Regents Of The University Of California Nouveaux transporteurs de glutamate
WO2003029828A2 (fr) * 2001-09-24 2003-04-10 Grünenthal GmbH Procede de criblage pour differentes indications a l'aide de proteines bnpi ou dnpi

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MOECHARS DIEDERIK ET AL: "Vesicular glutamate transporter VGLUT2 expression levels control quantal size and neuropathic pain", JOURNAL OF NEUROSCIENCE, vol. 26, no. 46, November 2006 (2006-11-01), pages 12055 - 12066, XP009080948, ISSN: 0270-6474 *
SWANSON CHAD J ET AL: "Metabotropic glutamate receptors as novel targets for anxiety and stress disorders.", NATURE REVIEWS. DRUG DISCOVERY. FEB 2005, vol. 4, no. 2, February 2005 (2005-02-01), pages 131 - 144, XP002386660, ISSN: 1474-1776 *

Similar Documents

Publication Publication Date Title
Fleischmann et al. Impaired long-term memory and NR2A-type NMDA receptor-dependent synaptic plasticity in mice lacking c-Fos in the CNS
Mohn et al. Mice with reduced NMDA receptor expression display behaviors related to schizophrenia
US7632507B2 (en) Synovial cell protein
US20160050895A1 (en) Transgenic non-human organisms with non-functional tspo genes
Wang et al. Isoform‐specific knockout of FE65 leads to impaired learning and memory
EP1891237B9 (fr) Haplotype de gene enpp1 (pc-1) associe au risque de developper une obesite et un diabete de type 2 et applications correspondantes
EP2176290A1 (fr) Modele animal transgenique servant a modeliser l'anxiete pathologique, procede d'identification de composes destines au traitement de maladies ou de troubles causes par l'anxiete pathologique et methode d'utilisation de la proteine wfsl comme cible d'identification de composes presentant une efficacite contre l'anxiete path
Hashiguchi et al. Ataxic phenotype with altered CaV3. 1 channel property in a mouse model for spinocerebellar ataxia 42
CN107998397B (zh) Emc10蛋白作为生物标志物在诊断男性不育中的应用
Huebner et al. Mice lacking the nuclear pore complex protein ALADIN show female infertility but fail to develop a phenotype resembling human triple A syndrome
WO2005098008A1 (fr) Modele murin de crise cardiaque inductible par regime lipidique
US6984771B2 (en) Mice heterozygous for WFS1 gene as mouse models for depression
WO2005041649A1 (fr) Mammifere non humain transgenique
WO2007093618A1 (fr) Caractérisation fonctionnelle du transporteur vésiculaire du glutamate de type 2
AU2003243893A1 (en) Transgenic rat as animal model for human Huntingdon's Disease
EP1662862A1 (fr) Recepteur
JP2003040801A (ja) Ｃｎｓ障害の治療および治療薬の開発におけるニューロンカルシウムセンサー１（ｎｃｓ−１）の新規使用
US20090180959A1 (en) VDCC Gamma-8 Ion Channel
US20060277611A1 (en) Functional characterization of myo-inositol monophosphatase
JP3817638B2 (ja) トランスジェニック非ヒト哺乳動物
Saw Jr et al. Shaker mice and a peek into the House of Usher
US20150245597A1 (en) Heterozygous mouse with an inactivated brd1 allele and uses in psychiatry
Kehrl Inhibitory G-protein Modulation of CNS Excitability.
JP2004534534A (ja) 新しい分子モータータンパク質をコードする遺伝子、およびこの遺伝子に関連する疾患についての診断方法
Heinzer An investigation of very long-chain acyl-CoA synthetase in X-linked adrenoleukodystrophy: Lessons from mouse models

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07704580

Country of ref document: EP

Kind code of ref document: A1