WO2007083101A2 - Use in an alternative treatment of cancer - Google Patents

Use in an alternative treatment of cancer Download PDF

Info

Publication number
WO2007083101A2
WO2007083101A2 PCT/GB2007/000125 GB2007000125W WO2007083101A2 WO 2007083101 A2 WO2007083101 A2 WO 2007083101A2 GB 2007000125 W GB2007000125 W GB 2007000125W WO 2007083101 A2 WO2007083101 A2 WO 2007083101A2
Authority
WO
WIPO (PCT)
Prior art keywords
agent
fenretinide
stress
cells
pdi
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2007/000125
Other languages
French (fr)
Other versions
WO2007083101A3 (en
Inventor
Mark Birch-Machin
Penny Lovat
Christopher Redfern
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cancer Research Technology Ltd
Original Assignee
Cancer Research Technology Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cancer Research Technology Ltd filed Critical Cancer Research Technology Ltd
Publication of WO2007083101A2 publication Critical patent/WO2007083101A2/en
Publication of WO2007083101A3 publication Critical patent/WO2007083101A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis

Definitions

  • the present invention relates to the use of agents for the treatment of cancer.
  • Agents useful for the treatment of cancer act by a variety of pathways, for example some compounds intercalate between strands of DNA thereby preventing replication, some compounds inhibit microtubule assembly thereby preventing cell division and some compounds interfere with the blood supply to a tumour.
  • Cancer cells acquire survival mechanisms which allow them to circumvent DNA damage, such as inactivation of the P53 gene family 1 .
  • death can be induced as a result of a stress-signalling pathway activated by accumulation of misfolded or mutated proteins in the endoplasmic reticulum (ER) .
  • ER endoplasmic reticulum
  • Chromosomal rearrangements during carcinogenesis can result in the accumulation of aberrant proteins in the ER 3 , and therefore to survive the consequences of genomic instability, an increased homeostatic response to ER stress may be important in cancer cells.
  • Prion diseases are characterised by extensive neuronal apoptosis and accumulation of misfolded prion protein (PrP sc ) 7 .
  • Hetz identified a correlation between upregulation of the ER chaperone of the glucose-regulated protein Grp58 (also known as ERp57) and the accumulation of PrP sc .
  • fenretinide N-(4-hydroxyphenyl)retinamide
  • Fenretinide has an increasingly important profile as a cancer preventative and chemotherapeutic agent and normal, non-cancerous cells are unaffected by it 8 . Therefore the inventors carried out further studies to characterise the mechanism of cancer cell death induced by fenretinide.
  • tumours in particular cutaneous melanoma, become 'bullet proof against chemotherapeutic drugs due to an intrinsic resistance to cell death.
  • a first aspect of the present invention there is provided the use of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function, for the preparation of a medicament.
  • a second aspect of the present invention there is provided the use of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disufide isomerase or GRP78 function, for the preparation of a medicament for the treatment of cancer.
  • any agent giving rise to any degree of inhibition of protein disulfide isomerase and/or inhibition of GRP78 function is suitable for use in the present invention.
  • Inhibition may be by any direct and/or indirect mechanism.
  • the inhibition may comprise a reduction in PDI and/or GRP78 expression.
  • the inventors have studied the ER stress response in cancer cells, in particular neuroblastoma and melanoma cells.
  • ER stress protein chaperones include ERp57, ERdj5, GRP78. Knockdown of these proteins in vitro results in an increase in the apoptotic response to ER stress inducing agents such as fenretinide.
  • RNA in vivo The in vitro results were achieved using siRNA and were not expected to be suitable for in vivo knockdown of ER stress protein chaperones, since the use of RNA in vivo is in its infancy. Furthermore, there are problems with target specificity and therefore off-target effects. The use of RNA in vivo also provokes an interferon response thereby adversely affecting the immune system.
  • ER stress-induced chaperones are functionally and structurally related to the enzyme protein disulphide isomerase (PDI), and developed the novel idea that PDI inhibitors might have the same effect as siRNA-mediated knockdown of ERp57 or ERdj5 in increasing the cell death response to ER stress-inducing agents such as fenretinide.
  • PDI protein disulphide isomerase
  • agents which give rise to inhibition of protein disulfide isomerase and/or GRP78 function in combination with agents which induce ER stress do in fact increase apopotosis in cancer cells.
  • the combination of the present invention is particularly suitable for the treatment of melanoma and neuroblastoma.
  • the agent giving rise to inhibition of PDI inhibits the activity of ERdj5 and ERp57.
  • fenretinide and velcade are two particularly preferred examples.
  • Other known ER stress inducers include thapsigargin, Brefeldin A, tunicamycin, and AIF-4 20 ' 21 .
  • Bacitracin is a known PDI inhibitor 22 ' 23 .
  • Another known inhibitor of PDI function is scrambled RNase 22 .
  • inhibitory antibodies may usefully be employed as inhibitors of PDI 22 .
  • Inhibitory antibodies may be prepared by any of the methods well known to the skilled person.
  • agents which inhibit the expression of PDI are also suitable for use in the present invention.
  • any inhibitory antibodies, or active fragments thereof may be used.
  • Inhibitors of GRP78 expression may also be used in the present invention.
  • WO 2006/101073 discloses a compound capable of inhibiting the induction of the expression of GRP78 and named "prunustatin". Prunustatin has a structure similar to that of a known compound SW- 163 A and can be produced by Streptomyces Violaceoniger strain 4521 -S VS3 or the like. This compound may be employed in the present invention.
  • WO 03/044209 discloses a tetronic acid derivative versipelostatin, which inhibits GRP78 expression, is isolated from a metabolite of Streptomyces versipellis 4083-SVS6 strain. This compound may also be used in the present invention.
  • GRP78 can bind caspases thereby preventing activation of apoptosis.
  • This caspase-binding function is dependent on the ATP-binding domain of GRP78 25 and abrogated by increases in dATP .
  • an agent which gives rise to inhibition of GRP78 function may comprise an agent which interferes with caspase binding by GRP78, for instance a purine nucleoside analogue, for example 2cdA 24 . Purine nucleoside analogues increase intracellular dATP.
  • bacitracin for the preparation of a medicament for the treatment of cancer.
  • a method for enhancing the efficacy of drugs which induce the apoptosis of tumour cells via ER stress comprising the steps of: administering a combination of at least one agent which induces ER stress and at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function.
  • the compounds may be administered simultaneously or sequentially depending upon the treatment regime.
  • agents Whilst it may be possible for agents to be administered as raw chemicals, it is preferable to present the compounds in a pharmaceutical composition.
  • a pharmaceutical composition comprising an effective amount of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function, which together provide a therapeutic effect.
  • compositions for medical use will be formulated in accordance with any of the methods well known in the art of pharmacy for administration in any convenient manner.
  • the compounds will usually be admixed with at least one other ingredient providing a compatible pharmaceutically acceptable additive, carrier, diluent or excipient, and may be presented in unit dosage form.
  • the carrier(s) must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • the possible formulations include those suitable for oral, rectal, topical and parenteral (including subcutaneous intramuscular and intravenous) administration or for administration to the lung or other absorptive site such as the nasal passages.
  • AU methods of formulation in making up such pharmaceutical compositions will generally include the step of bringing one and/or all of the agents into association with a carrier which constitutes one or more accessory ingredients.
  • the formulations are prepared by uniformly and intimately bringing all of the agents into association with a liquid carrier or with a finely divided solid carrier or with both and then, if necessary, shaping the product into desired formulations.
  • Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets, tables or lozenges, each containing a predetermined amount of the compounds described herein; as a powder or granules; or a suspension in an aqueous liquid or non-aqueous liquid such as a syrup, an elixir, an emulsion or a draught.
  • the compounds described herein may also be presented as bolus, electuary or paste.
  • a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
  • Compressed tables may be prepared by compressing, in a suitable machine, the compounds described herein in a tree-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Moulded tables may be made by moulding, in a suitable machine, a mixture of the powdered compound of formula I with any suitable carrier.
  • a syrup may be made by adding the compounds described herein to a concentrated, aqueous solution of a sugar, for example sucrose, to which may be added any desired accessory ingredients.
  • Such accessory ingredient(s) may include flavourings, an agent to retard crystallisation of the sugar or an agent to increase the solubility of any other ingredient, such as a polyhydric alcohol, for example glycerol or sorbitol.
  • Formulations for rectal administration may be presented as a suppository with a usual carrier such as cocoa butter.
  • Formulations suitable for parental administration conveniently comprise a sterile aqueous preparation of the compounds described herein, which is preferably isotonic with the blood of the recipient.
  • formulations of this invention may include one or more accessory ingredients, for example a diluent, buffer, flavouring agent, binder, surface active agent, thickener, lubricant and/or a preservative (including an antioxidant) or other pharmaceutically inert excipient.
  • accessory ingredients for example a diluent, buffer, flavouring agent, binder, surface active agent, thickener, lubricant and/or a preservative (including an antioxidant) or other pharmaceutically inert excipient.
  • the agents of the present invention may also be made up for administration in liposomal formulations, which can be prepared by methods well-known in the art.
  • the invention also includes the use of the agents hereinbefore defined for the manufacture of medicaments or pharmaceutical compositions for treating cancer, wherein the agents themselves provide an effective antitumour agent.
  • apoptosis by fenretmide is accompanied by the induction of the ER stress-associated transcription factor GADD153/CHOP. This suggests that the activation of ER stress responses is a consequence of treating cells with fenretinide, a previously unreported phenomenon.
  • ERdj5 an ER-resident protein containing DnaJ and thioredoxin domains
  • ERp57 an ER-resident protein-disulfide isomerase
  • calreticulum and calnexin both ER-resident chaperones
  • Table 1 shows a comparison of the results.
  • eIF2 ⁇ phosphorylation and splicing of Xbp-1 mRNA are the events used to define ER stress, hi SH-S Y5 Y and SK-MeI-110 cell, phosphorylation of eIF2 ⁇ was induced by thapsigargin (1.5 ⁇ M and 7.5 ⁇ M, respectively) and within 15 minutes of treatment with fenretinide (3 ⁇ M and 15 ⁇ M, respectively) (Fig. 1C). Under similar conditions for both cell lines the splicing of Xbp-1 mRNA was induced within 6 hours of thapsigargin treatment and within 6-18 hours after treatment with fenretinide (Fig. ID).
  • ERp57 is a thiol-oxidoreductase chaperone of the PDI family and can be physically associated with calnexin and calreticulin, but in addition to the DnaJ and thioredoxin domains it is a chaperone that co-localises with PDIs, has a PDI-like domain and interacts with GRP78. Since effective ER stress responses may protect cancer stem cells from chemotherapeutic drug-induced apoptosis, the ER resident proteins ERdj5 and ERp57 may be targets for the development of novel chemotherapeutic strategies.
  • Figure 1 shows various Western blots exemplifying the induction of ER-stress genes in response to fenretinide or thapsigargin in SH-SY5Y and SK-MeI-110;
  • Figure 2 shows various bar graphs exemplifying the siRNA-mediated knockdown of ERdj5 or ERp57 increased apoptosis in response to fenretinide in SH-S Y5 Y and SK-MeI-110 cells;
  • Figure 3 shows a flow cytometry histogram illustrating the cell cycle of
  • Figure 4 shows a flow cytometry histogram illustrating the cell cycle of
  • Figure 5 shows various bar graphs illustrating the relationship between fenretinide and apoptosis in various melanoma cell-types
  • Figure 6 shows various bar graphs illustrating the effect of a combination of fenretinide and bacitracin on apoptosis in various melanoma cell types
  • Figure 7 shows a graph illustrating the induction of apoptosis in human A375 melanoma cells using bacitracin, velcade, or bacitracin plus velcade at a fixed dose of 15,000:1;
  • Figure 8 shows bar graphs illustrating the effect of an anti-GRP78 antibody on fenretinide- and velcade-induced apoptosis of CHL-I cells;
  • Figure 9 shows bar graphs illustrating the effect of an anti-GRP78 antibody on fenretinide- and velcade-induced apoptosis of WM266-4 cells;
  • Figure 10 shows bar graphs illustrating the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide and different concentrations of the purine nucleoside inhibitor 2cdA;
  • Figure 11 shows bar graphs illustrating the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide with bacitracin, 2cdA, or bacitracin plus 2cdA;
  • Figure 12 shows bar graphs illustrating the combined effect of bacitracin, anti- GRP78 antibody and 2cdA on fenretinide-induced apoptosis of CHL-I and WM266-4 cells.
  • ER stress genes induced by fenretinide in SH-SY5Y cells treated with or without 3 ⁇ M Fenretinide for 6 h were identified from microarray analysis: cells were lysed using Trizol (Invitrogen Life Technologies, Carlsbad, CA) and total RNA extracted according to the manufacturer's instructions. Poly(A)+RNA was isolated by oligo-dT latex bead chromatography (Qiagen Inc, Valencia, CA USA). Reverse transcriptase, primed with poly(dT), was used to synthesize Cy3- and Cy5-labelled cDNA using the Cyscribe cDNA labelling kit (Amersham Biosciences UK Ltd, Amersham, UK).
  • Labelled cDNA probes were hybridised to glass slide micro-arrays containing 24,000 genes (Stanford University, USA) and detected using a Packard MicroArray scanner (Packard BioScience, Billerica, MA) with Quant Array sotfware. Experiments were performed in triplicate and expression confirmed by Western blotting and RT-PCR in separate experiments.
  • RNA extracted from cells treated with thapsigargin or fenretinide was used to quantify ERdj5 and GAPDH (as a loading control) in RNA extracted from cells treated with thapsigargin or fenretinide. Note that the order of thapsigargin and fenretinide-treated samples is reversed compared with A.
  • Cells were lysed and total RNA extracted with Trizol.
  • a poly(dT) primer (1 mM) was used to generate cDNA from 2 ⁇ g of RNA and human ERdjS sequence was amplified with the primer pair GCCATTTTAGTGGGCACAGATCAGG and CAGCCAGCCAATACCAGCAGCA.
  • Amplification of human GAPDH sequence was with the primer pairs GATATCGCCGCGCTCGTCGTCG and AGGTAGTCAGTCAGGTCCCGGC. For PCR reactions the number of cycles used for each primer pair was adjusted so that amplification remained within an approximately linear range.
  • C Western blots (as in A) probed using antibodies for eIF2 ⁇ (Cell Signaling, diluted 1:1000) and phosphorylated eIF2 ⁇ (P-eIF2 ⁇ ; Cell Signaling, diluted 1:1000). For this experiment, cells were treated with fenretinide for 0.25, 0.5, 1, 2 or 4 h, or thapsigargin for 4 h.
  • Controls were at Oh, induction of XBP-I splicing in response to fenretinide or thapsigargin.
  • the human XBP-I sequence was amplifed by RT-PCR with thte primer pair AAACAGAGTAGCAGCTCAGACTGC and CCTTCTGGGTAGACCTCTGGGAG 18 ' E and F, Expression of the ERp57 and GRP78 protein (E) and ERp57 and ERdj5 mRNA (F) in response to 3 or 15 ⁇ M fenretinide (SH-S Y5 Y and SK-MeI- 100 cells, respectively) for 22 h was not blocked by 2 ⁇ M baicalein added 2 h before the fenretinide.
  • SiRNA-mediated knockdown of ERdj5 or ERp57 increased apoptosis in response to fenretinide in SH-SY5Y and SK-MeI-110 cells.
  • siRNAs were evaluated against a scrambled siRNA control, and at doses of 2OnM and 40 nM for each siRNA in both cell lines.
  • a and B Apoptosis of SH-S Y5 Y cells (A) or SK-MeI-110 cells (B) after transfection with 20 nM or 30 nM scrambled control siRNA (siRNA control), ERdj5-2 siRNA or ERdj5-3 siRNA and subsequent treatment with (grey bars) or without (black bars) 3 ⁇ M fenretinide.
  • RT PCR results to verify EDdj5 knockdown, evaluated against a GAPDH loading control by RT-PCT as in Fig. 1, are shown in the panel below the graphs (C, control; F, fenretinide- treated).
  • siRNA knockdown experiments were done by plating 0.25 x 10 6 cells in 6 well plates overnight and transfection for 24 h with 29 nM or 40 nM (final concentrations) siRNA using lipofectamine in Optimem culture medium (Invitrogen) 16 . After incubation overnight at 37 0 C, fetal bovine serum was added to 10% and cells incubated with or without 3 ⁇ M fenretinide for a further 24 hrs. Four replicates were used per condition, three for analysis of apoptosis and one for RT-PCR to verify knockdown.
  • SiRNAs 5 supplied desalted and annealed by Eurogentec were: ERdj5-2 GGAGGAGAUUGUUUGACUU; ERdj5-3 AGACAAGCUUUCAAGAAAU; ERp57-l GGACAAGACUGUGGCAUAU; ER ⁇ 57-2 GAAGCUAAAUCCAAAGAAA; Scrambled non-silencing control UUCUCCGAACGUGUCACGU.
  • Apoptosis was evaluated by flow cytometry of propidium iodide (PI)-stained cells 19 '
  • PI propidium iodide
  • knockdown siRNA-1 or knockdown siRNA-2 was by 2-way ANOVA on siRNA type and siRNA dose (20 or 40 nM).
  • siRNA type and siRNA dose 20 or 40 nM.
  • F 2;12 >177,P ⁇ 0.00001 the ERdj5 or ERp57 siRNAs significantly increased apoptosis relative to the control siRNA
  • Fig. 3 It is clear from Fig. 3 that untreated SK-mel-110 cells undergo little apoptosis. The amount of apoptosis seen (Fig. 3a) is commensurate with apoptosis which occurs naturally in the lifetime of cells.
  • fenretinide brings about apoptosis in SK-mel-110 cells.
  • bacitracin is of minimal toxicity to the melanoma cells, with a similar degree of apoptosis being observed to that of the control. That is, that which occurs in the normal life cycle of cells. Treating the cells with fenretinide produces a marked increase in the degree of apoptosis observed compared to treatment with bacitracin.
  • Fig. 8 show the effect of an anti-GRP78 antibody (Santa Cruz Biotechnology) on CHL-I cells.
  • the data confirm that the PDI inhibitor bacitracin increases fenretinide- or velcade-induced apoptosis.
  • the data further demonstrate that the anti-GRP78 antibody increases fenretinide- or velcade-induced apoptosis.
  • Fig. 10 show the results of a dose response assay using the purine nucleoside analogue 2cdA.
  • This purine nucleoside analogue inhibits the caspase- binding properties of GRP78.
  • CHL-I cells or WM266-4 cells were treated with increasing concentrations of 2cdA in the presence or absence of fenretinide. It can be seen from Fig. 10 that concentrations of 2cdA of l ⁇ m and above increased fenretinide-induced apoptosis.
  • Fig. 11 show the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide with bacitracin, 2cdA, or bacitracin plus 2cdA.
  • Bacitracin and 2cdA were both shown to increase fenretinide-induced apoptosis.
  • apoptosis was further increased by the combination of fenretinide with bacitracin and 2cdA.
  • Fig. 12 show the effect treating CHL-I or WM266-4 cells with fenretinide and various combinations of bacitracin, polyclonal anti-GRP78 antibody and 2cdA.
  • Frickel EM 5 Frei P 5 Bouvier M, Stafford WF 5 Helenius A, GLockshuber R, et. al. ERp57 is a multifunctional thiol-disulfide oxidoreductase. J. Biol. Chem. 2004;279(l 8): 18277-87.
  • Valproate protects cells from ER stress-induced lipid accumulation and apoptosis by inhibiting glycogen synthase kinase-3. J Cell Sci. 2005 Jan l;118(Pt l):89-99.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pain & Pain Management (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention includes the use of at least one agent which induces endoplasmic reticulum (ER) stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase (PDI) or GRP78 function for the preparation of a medicament, more particularly a medicament for the treatment of cancer, and to pharmaceutical compositions comprising an effective amount of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of PDI or GRP78 function, and which together provide a therapeutic effect.

Description

TREATMENT OF CANCER
The present invention relates to the use of agents for the treatment of cancer.
Agents useful for the treatment of cancer act by a variety of pathways, for example some compounds intercalate between strands of DNA thereby preventing replication, some compounds inhibit microtubule assembly thereby preventing cell division and some compounds interfere with the blood supply to a tumour.
Cancer cells acquire survival mechanisms which allow them to circumvent DNA damage, such as inactivation of the P53 gene family1. In normal cells, death can be induced as a result of a stress-signalling pathway activated by accumulation of misfolded or mutated proteins in the endoplasmic reticulum (ER) . Chromosomal rearrangements during carcinogenesis can result in the accumulation of aberrant proteins in the ER3, and therefore to survive the consequences of genomic instability, an increased homeostatic response to ER stress may be important in cancer cells.
Understanding ER stress has led to a greater understanding of the mechanisms of cell death and therefore potentially better drugs for treating/preventing a wide range of conditions/diseases .
Maniratanachote et at investigated further the in vitro apoptotic cell death of various hepatic cell types reported by Bae and Song5 as a result of exposure to the antidiabetic drug troglitazone (TRO).
Maniratanachote et at were interested in the involvement of proteins whose up or down regulation correlated with the TRO induced toxic effects. Analysis of a protein spot separated by electrophoresis revealed two protein chaperones, immunoglobulin heavy chain binding protein (BiP or Grρ78), and protein disulphide isomerase-related protein (PDIrp or ERp72). The findings suggest that TRO targets the ER and causes the overexpression of BiP, a chaperone in response to cytotoxicity i.e. BiP is overexpressed by the cell in an attempt to survive. A second paper by Hetz et at investigates the relationship between prion replication and induction of ER stress. Prion diseases are characterised by extensive neuronal apoptosis and accumulation of misfolded prion protein (PrPsc)7. Hetz identified a correlation between upregulation of the ER chaperone of the glucose-regulated protein Grp58 (also known as ERp57) and the accumulation of PrPsc.
Hetz concluded that targeting GRP58 may have applications for developing novel strategies for treatment and early diagnosis of prion disease.
It has been found that certain chemotherapeutic agents induce apoptosis in cancer cells. Unlike most retinoids, fenretinide (N-(4-hydroxyphenyl)retinamide) induces apoptosis. Fenretinide has an increasingly important profile as a cancer preventative and chemotherapeutic agent and normal, non-cancerous cells are unaffected by it8. Therefore the inventors carried out further studies to characterise the mechanism of cancer cell death induced by fenretinide.
It was found that apoptosis was accompanied by the induction of the ER stress- associated transcription factor GADDISS/CHOP9. This suggests that the activation of ER stress responses is a consequence of treating cells with fenretinde.
Certain types of tumours, in particular cutaneous melanoma, become 'bullet proof against chemotherapeutic drugs due to an intrinsic resistance to cell death.
Thus, it is an object of the present invention to provide a chemotherapeutic regime which enhances the cell-killing effects of ER stress-inducing agents by manipulating ER stress responses in order to induce apoptosis.
According to a first aspect of the present invention there is provided the use of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function, for the preparation of a medicament. According to a second aspect of the present invention there is provided the use of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disufide isomerase or GRP78 function, for the preparation of a medicament for the treatment of cancer.
It is to be understood that any agent giving rise to any degree of inhibition of protein disulfide isomerase and/or inhibition of GRP78 function is suitable for use in the present invention. Inhibition may be by any direct and/or indirect mechanism. Thus, the inhibition may comprise a reduction in PDI and/or GRP78 expression.
The inventors have studied the ER stress response in cancer cells, in particular neuroblastoma and melanoma cells. When cells are subject to ER stress the production of a number of ER stress protein chaperones is induced in cancer cells. These proteins include ERp57, ERdj5, GRP78. Knockdown of these proteins in vitro results in an increase in the apoptotic response to ER stress inducing agents such as fenretinide.
The in vitro results were achieved using siRNA and were not expected to be suitable for in vivo knockdown of ER stress protein chaperones, since the use of RNA in vivo is in its infancy. Furthermore, there are problems with target specificity and therefore off-target effects. The use of RNA in vivo also provokes an interferon response thereby adversely affecting the immune system.
The inventors reasoned that a common property of ER stress-induced chaperones is that they are functionally and structurally related to the enzyme protein disulphide isomerase (PDI), and developed the novel idea that PDI inhibitors might have the same effect as siRNA-mediated knockdown of ERp57 or ERdj5 in increasing the cell death response to ER stress-inducing agents such as fenretinide.
It was then found that agents which give rise to inhibition of protein disulfide isomerase and/or GRP78 function in combination with agents which induce ER stress do in fact increase apopotosis in cancer cells. These results suggest that agents which give rise to inhibition of PDI and/or GRP78 function make cancer cells more susceptible to ER stress and thus apoptosis occurs more readily.
The combination of the present invention is particularly suitable for the treatment of melanoma and neuroblastoma.
When treating melanoma and neuroblastoma, the agent giving rise to inhibition of PDI inhibits the activity of ERdj5 and ERp57.
Whilst any agent which induces ER stress is suitable for use with the present invention, fenretinide and velcade are two particularly preferred examples. Other known ER stress inducers include thapsigargin, Brefeldin A, tunicamycin, and AIF-420'21.
Whilst any agent which gives rise to inhibition of PDI is suitable for use with the present invention, the antibiotic bacitracin and derivatives thereof are particularly preferred. Bacitracin is a known PDI inhibitor22' 23. Another known inhibitor of PDI function is scrambled RNase22.
It will also be apparent that inhibitory antibodies, or active fragments thereof, may usefully be employed as inhibitors of PDI22. Inhibitory antibodies may be prepared by any of the methods well known to the skilled person.
Additionally or alternatively, agents which inhibit the expression of PDI are also suitable for use in the present invention.
With regard to inhibtion of GRP78 function, again, any inhibitory antibodies, or active fragments thereof, may be used.
Inhibitors of GRP78 expression may also be used in the present invention. WO 2006/101073 discloses a compound capable of inhibiting the induction of the expression of GRP78 and named "prunustatin". Prunustatin has a structure similar to that of a known compound SW- 163 A and can be produced by Streptomyces Violaceoniger strain 4521 -S VS3 or the like. This compound may be employed in the present invention. WO 03/044209 discloses a tetronic acid derivative versipelostatin, which inhibits GRP78 expression, is isolated from a metabolite of Streptomyces versipellis 4083-SVS6 strain. This compound may also be used in the present invention.
It is known that GRP78 can bind caspases thereby preventing activation of apoptosis. This caspase-binding function is dependent on the ATP-binding domain of GRP7825 and abrogated by increases in dATP . Thus, an agent which gives rise to inhibition of GRP78 function may comprise an agent which interferes with caspase binding by GRP78, for instance a purine nucleoside analogue, for example 2cdA24. Purine nucleoside analogues increase intracellular dATP.
According to a third aspect of the present invention there is provided the use of bacitracin for the preparation of a medicament for the treatment of cancer.
In vitro studies using a variety of cancer cell lines have shown that the percentage of apoptosis at least doubles when fenretinide and bacitracin are used together compared to fenretinide alone. Bacitracin on its own had no effect on these cancer cells, m fact, the percentage of apoptosis seen for the combination of agents is significantly greater than the sum of the percentage of apoptosis seen when each agent is used independently. This demonstrates that the two agents act synergistically.
According to a fourth aspect of the present invention there is provided a method for enhancing the efficacy of drugs which induce the apoptosis of tumour cells via ER stress comprising the steps of: administering a combination of at least one agent which induces ER stress and at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function. The compounds may be administered simultaneously or sequentially depending upon the treatment regime.
Whilst it may be possible for agents to be administered as raw chemicals, it is preferable to present the compounds in a pharmaceutical composition.
Thus, according to a further aspect of the present invention there is provided a pharmaceutical composition comprising an effective amount of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase or GRP78 function, which together provide a therapeutic effect.
Such pharmaceutical compositions for medical use will be formulated in accordance with any of the methods well known in the art of pharmacy for administration in any convenient manner. The compounds will usually be admixed with at least one other ingredient providing a compatible pharmaceutically acceptable additive, carrier, diluent or excipient, and may be presented in unit dosage form.
The carrier(s) must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
The possible formulations include those suitable for oral, rectal, topical and parenteral (including subcutaneous intramuscular and intravenous) administration or for administration to the lung or other absorptive site such as the nasal passages.
AU methods of formulation in making up such pharmaceutical compositions will generally include the step of bringing one and/or all of the agents into association with a carrier which constitutes one or more accessory ingredients. Usually, the formulations are prepared by uniformly and intimately bringing all of the agents into association with a liquid carrier or with a finely divided solid carrier or with both and then, if necessary, shaping the product into desired formulations. Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets, tables or lozenges, each containing a predetermined amount of the compounds described herein; as a powder or granules; or a suspension in an aqueous liquid or non-aqueous liquid such as a syrup, an elixir, an emulsion or a draught. The compounds described herein may also be presented as bolus, electuary or paste.
A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tables may be prepared by compressing, in a suitable machine, the compounds described herein in a tree-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Moulded tables may be made by moulding, in a suitable machine, a mixture of the powdered compound of formula I with any suitable carrier. A syrup may be made by adding the compounds described herein to a concentrated, aqueous solution of a sugar, for example sucrose, to which may be added any desired accessory ingredients. Such accessory ingredient(s) may include flavourings, an agent to retard crystallisation of the sugar or an agent to increase the solubility of any other ingredient, such as a polyhydric alcohol, for example glycerol or sorbitol.
Formulations for rectal administration may be presented as a suppository with a usual carrier such as cocoa butter.
Formulations suitable for parental administration conveniently comprise a sterile aqueous preparation of the compounds described herein, which is preferably isotonic with the blood of the recipient.
In addition to the aforementioned ingredients, formulations of this invention, for example ointments, creams and such like, may include one or more accessory ingredients, for example a diluent, buffer, flavouring agent, binder, surface active agent, thickener, lubricant and/or a preservative (including an antioxidant) or other pharmaceutically inert excipient. The agents of the present invention may also be made up for administration in liposomal formulations, which can be prepared by methods well-known in the art.
Therefore, the invention also includes the use of the agents hereinbefore defined for the manufacture of medicaments or pharmaceutical compositions for treating cancer, wherein the agents themselves provide an effective antitumour agent.
The present invention will now be described further by way of example only. The following examples and description of experiments serve further to illustrate the present invention.
As mentioned previously, the inventors have discovered that apoptosis by fenretmide is accompanied by the induction of the ER stress-associated transcription factor GADD153/CHOP. This suggests that the activation of ER stress responses is a consequence of treating cells with fenretinide, a previously unreported phenomenon.
This hypothesis was tested by screening a 24K microarray for the induction of ER- stress genes in SH-SY5Y neuroblastoma cells after 6 hours treatment with fenretinide. In additon to GADD 153, four other genes associated with ER stress were induced greater than 2-fold: ERdj5 (an ER-resident protein containing DnaJ and thioredoxin domains)10; ERp57 (GRP58; an ER-resident protein-disulfide isomerase)11; and calreticulum and calnexin (both ER-resident chaperones)12.
The induction of these genes in SH-SY5Y cells in response to fenretinide was confirmed by Western blotting and reverse-transcriptase-polymerase chain reaction (RT-PCR) in independent experiments (Figs. IA and IB).
In order to confirm the findings, the response of SH-SY5Y cells to thapsigargin, a well-characterised inducer of ER stress13, and fenretinide were compared. These experiments were also performed using a different neuroectodermal tumour cell line, SK-MeI-110 human melanoma cells . Thapsigargin and fenretinide induced cell death in both cell lines. However, as has been reported for other melanoma lines with respect to fenretinide sensitivity15, SK-MeI-110 cells were more resistant than SH- SY5Y cells and needed 5 -fold higher concentrations of either agent to induce comparable levels of cell death.
Table 1 shows a comparison of the results.
Figure imgf000010_0001
NB: all pair wise comparisons after Bonferroni correction, P<0.0013 Table 1
The induction of eIF2α phosphorylation and splicing of Xbp-1 mRNA are the events used to define ER stress, hi SH-S Y5 Y and SK-MeI-110 cell, phosphorylation of eIF2α was induced by thapsigargin (1.5 μM and 7.5 μM, respectively) and within 15 minutes of treatment with fenretinide (3 μM and 15 μM, respectively) (Fig. 1C). Under similar conditions for both cell lines the splicing of Xbp-1 mRNA was induced within 6 hours of thapsigargin treatment and within 6-18 hours after treatment with fenretinide (Fig. ID). These data indicate that fenretinide induces ER stress in SH-S Y5 Y and SK-MeI-110 neuroectodermal tumour cells. Previous studies have shown that the specific 12-lipoxygenase inhibitor baicalein blocks ROS induction and apoptosis in response to fenretinide in SH-SY5Y cells9. Baicalein also blocked the induction of GRP78 and ERp57 protein and mRNA for ERp57 and ERdj5 in response to fenretinide in SH-SY5Y SK-MeI-110 cells (Fig. IE and Fig. IF), suggesting that fenretinide induces ER stress in these cells via the 12-lipoxygenase-dependent induction of ROS.
In order to determine whether the apoptotic response to fenretinide would be increased by knockdown of ER stress chaperones ERp57 and ERdj5, SH-SY5Y and SK-MeI-110 cells were treated with fenretinide after siRNA-mediated knockdown of expression of each gene. RT-PCR for ERp57 and ERdj5, confirmed that fenretinide- induced increase in mRNA levels was blocked by siRNAs for ERp57 and ERdj5, respectively, but not by the control siRNA (Fig. 2). After transfection with the ERp57 siRNA, that basal levels of ERp57 remained similar to control cells (Fig. 2) and similar results were obtained by Western blotting (data not shown); in contrast, one of the two ERdj 5 siRNAs used was efficient at knocking down ERdj5mRNA below the basal levels in control cells (Fig. 2). Under these conditions of ERp57 or ERdj5 knockdown, apoptosis of both cell lines in response to fenretinide was increased by at least 2-fold (Fig. 2).
These results suggest that inhibiting or down-regulating ER stress responses may enhance the cell-killing effects of ER stress-inducing agents such as fenretinide. ERp57 is a thiol-oxidoreductase chaperone of the PDI family and can be physically associated with calnexin and calreticulin, but in addition to the DnaJ and thioredoxin domains it is a chaperone that co-localises with PDIs, has a PDI-like domain and interacts with GRP78. Since effective ER stress responses may protect cancer stem cells from chemotherapeutic drug-induced apoptosis, the ER resident proteins ERdj5 and ERp57 may be targets for the development of novel chemotherapeutic strategies.
Having established that down-regulating components of homeostatic stress responses increased cell death in response to ER stress inducers, this suggested that this approach may lead to new methods for enhancing the efficacy of drugs which induce the apoptosis of tumour cells via ER stress.
Various experiments were conducted' to confirm this. The results are shown in the attached drawings.
The present invention will now be described further by way of example only and with reference to the accompanying drawings, in which:
Figure 1 shows various Western blots exemplifying the induction of ER-stress genes in response to fenretinide or thapsigargin in SH-SY5Y and SK-MeI-110;
Figure 2 shows various bar graphs exemplifying the siRNA-mediated knockdown of ERdj5 or ERp57 increased apoptosis in response to fenretinide in SH-S Y5 Y and SK-MeI-110 cells;
Figure 3 shows a flow cytometry histogram illustrating the cell cycle of
SK-MeI-110 melanoma cells;
Figure 4 shows a flow cytometry histogram illustrating the cell cycle of
SK-mel-110 melanoma cells following treatment with fenretinide;
Figure 5 shows various bar graphs illustrating the relationship between fenretinide and apoptosis in various melanoma cell-types;
Figure 6 shows various bar graphs illustrating the effect of a combination of fenretinide and bacitracin on apoptosis in various melanoma cell types;
Figure 7 shows a graph illustrating the induction of apoptosis in human A375 melanoma cells using bacitracin, velcade, or bacitracin plus velcade at a fixed dose of 15,000:1; Figure 8 shows bar graphs illustrating the effect of an anti-GRP78 antibody on fenretinide- and velcade-induced apoptosis of CHL-I cells;
Figure 9 shows bar graphs illustrating the effect of an anti-GRP78 antibody on fenretinide- and velcade-induced apoptosis of WM266-4 cells;
Figure 10 shows bar graphs illustrating the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide and different concentrations of the purine nucleoside inhibitor 2cdA;
Figure 11 shows bar graphs illustrating the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide with bacitracin, 2cdA, or bacitracin plus 2cdA; and
Figure 12 shows bar graphs illustrating the combined effect of bacitracin, anti- GRP78 antibody and 2cdA on fenretinide-induced apoptosis of CHL-I and WM266-4 cells.
Figure 1
The induction of ER-stress genes in response to fenretinide or thapsigargin in SH- SY5Y and MK-MeI-110 cells. Fenretinide (Janssen-Cilag Ltd., Basserdorf, Switzerland) or thapsigargin (Sigma Chemical Co.) were added in ethanol or DMSO, respectively, to SH-S Y5 Y and SK-MELI lO cells16 with an equal volume of vehicle used to treat control cells. ER stress genes induced by fenretinide in SH-SY5Y cells treated with or without 3μM Fenretinide for 6 h were identified from microarray analysis: cells were lysed using Trizol (Invitrogen Life Technologies, Carlsbad, CA) and total RNA extracted according to the manufacturer's instructions. Poly(A)+RNA was isolated by oligo-dT latex bead chromatography (Qiagen Inc, Valencia, CA USA). Reverse transcriptase, primed with poly(dT), was used to synthesize Cy3- and Cy5-labelled cDNA using the Cyscribe cDNA labelling kit (Amersham Biosciences UK Ltd, Amersham, UK). Labelled cDNA probes were hybridised to glass slide micro-arrays containing 24,000 genes (Stanford University, USA) and detected using a Packard MicroArray scanner (Packard BioScience, Billerica, MA) with Quant Array sotfware. Experiments were performed in triplicate and expression confirmed by Western blotting and RT-PCR in separate experiments. A, Western blots of total protein, separated by electrophoresis through 12% SDS-PAGE gels (30 μg per track) and blotted onto nitrocellulose, extracted from SH-SY5Y cells (left-hand column) and SK-MEL-110 cells (right-hand column) treated with thapsigargin (Thap; 1.5 μM or 7.5 μM for SH-SY5Y or SK-MeI-110 cells, respectively) or Fenretinide (FenR; 3 μM or 15 μM, respectively) for 0, 6, 18 or 24 h. Blots were probed with antibodies to GADD 153 (Santa Cruz iotechnology Inc, Santa Cruz, CA, USA, diluted 1:1000), ERp57 (Stressgen, Victoria, BC, Canada, diluted l@5000), calreticullinn (Stressgen, dilutee 1:2000), calnexin (Santa Cruz diluted 1:1000), GRP78 (Santa Cruz, diluted 1:1000) and, as a loading control, β-tubulin (Sigma diluted l@5000)9. For detection, secondary peroxidase-conjugated antibodies (Jackson ImmunoResearch Inc, West Grove, PA) were diluted 1:5000 and visualized using the ECL Plus system (Amersham Biosciences UK)17. B, An antibody to ERdj5 was not available so RT-PCS was used to quantify ERdj5 and GAPDH (as a loading control) in RNA extracted from cells treated with thapsigargin or fenretinide. Note that the order of thapsigargin and fenretinide-treated samples is reversed compared with A. Cells were lysed and total RNA extracted with Trizol. A poly(dT) primer (1 mM) was used to generate cDNA from 2μg of RNA and human ERdjS sequence was amplified with the primer pair GCCATTTTAGTGGGCACAGATCAGG and CAGCCAGCCAATACCAGCAGCA. Amplification of human GAPDH sequence was with the primer pairs GATATCGCCGCGCTCGTCGTCG and AGGTAGTCAGTCAGGTCCCGGC. For PCR reactions the number of cycles used for each primer pair was adjusted so that amplification remained within an approximately linear range. C, Western blots (as in A) probed using antibodies for eIF2α (Cell Signaling, diluted 1:1000) and phosphorylated eIF2α (P-eIF2α; Cell Signaling, diluted 1:1000). For this experiment, cells were treated with fenretinide for 0.25, 0.5, 1, 2 or 4 h, or thapsigargin for 4 h. Controls were at Oh, induction of XBP-I splicing in response to fenretinide or thapsigargin. The human XBP-I sequence was amplifed by RT-PCR with thte primer pair AAACAGAGTAGCAGCTCAGACTGC and CCTTCTGGGTAGACCTCTGGGAG18' E and F, Expression of the ERp57 and GRP78 protein (E) and ERp57 and ERdj5 mRNA (F) in response to 3 or 15μM fenretinide (SH-S Y5 Y and SK-MeI- 100 cells, respectively) for 22 h was not blocked by 2 μM baicalein added 2 h before the fenretinide. Western blots were probed for ERρ57, GRP78 and β-tubulin as in A; RT-PCR amplification of ERdj5 was as in B and the human ERp57 sequence was amplified with the primer pair ACGTGCTAGAACTCACGGA and ACTGAAGCTGGCCTGCCTG.
Figure 2
SiRNA-mediated knockdown of ERdj5 or ERp57 increased apoptosis in response to fenretinide in SH-SY5Y and SK-MeI-110 cells. For both ERdj5 and ERp57, two different siRNAs were evaluated against a scrambled siRNA control, and at doses of 2OnM and 40 nM for each siRNA in both cell lines. A and B, Apoptosis of SH-S Y5 Y cells (A) or SK-MeI-110 cells (B) after transfection with 20 nM or 30 nM scrambled control siRNA (siRNA control), ERdj5-2 siRNA or ERdj5-3 siRNA and subsequent treatment with (grey bars) or without (black bars) 3 μM fenretinide. RT=PCR results to verify EDdj5 knockdown, evaluated against a GAPDH loading control by RT-PCT as in Fig. 1, are shown in the panel below the graphs (C, control; F, fenretinide- treated). C and D, Apoptosis of SH-S Y5 Y cells (C) or SK-MeI-110 cells (D) after transfection with 20 nM or 40 nM scrambled control siRNA (siRNA control), ERp57-l siRNA or ERp57-2 siRNA and subsequent treatment with (grey bars) or without (black bars) 3μM fenretinide. On all graphs, error bars are 95% confidence intervals. For both cell lines, the reduction in expression of ERp57 was also evident on Western blots (data not shown). The siRNA knockdown experiments were done by plating 0.25 x 106 cells in 6 well plates overnight and transfection for 24 h with 29 nM or 40 nM (final concentrations) siRNA using lipofectamine in Optimem culture medium (Invitrogen)16. After incubation overnight at 370C, fetal bovine serum was added to 10% and cells incubated with or without 3 μM fenretinide for a further 24 hrs. Four replicates were used per condition, three for analysis of apoptosis and one for RT-PCR to verify knockdown. SiRNAs5 supplied desalted and annealed by Eurogentec (Southampton, UK) were: ERdj5-2 GGAGGAGAUUGUUUGACUU; ERdj5-3 AGACAAGCUUUCAAGAAAU; ERp57-l GGACAAGACUGUGGCAUAU; ERρ57-2 GAAGCUAAAUCCAAAGAAA; Scrambled non-silencing control UUCUCCGAACGUGUCACGU. Apoptosis was evaluated by flow cytometry of propidium iodide (PI)-stained cells19' Statistical analysis of apoptosis in response to fenretinide in the presence of the conrol siRNA, knockdown siRNA-1 or knockdown siRNA-2 was by 2-way ANOVA on siRNA type and siRNA dose (20 or 40 nM). For both cell lines with ERdj5 or ERp57 there was a significant effect of the siRNA (F2;12>177,P<0.00001), and the ERdj5 or ERp57 siRNAs significantly increased apoptosis relative to the control siRNA (F1;12>210,P<0.00001). There was also a significant effect of siRNA dose for all except the SK-MeI-110 cells with the ERp57 siRNAs (FM2>14.5,P<0.0025, except FU2=4.6,P=0.054).
Figure 3
It is clear from Fig. 3 that untreated SK-mel-110 cells undergo little apoptosis. The amount of apoptosis seen (Fig. 3a) is commensurate with apoptosis which occurs naturally in the lifetime of cells.
Figure 4
It is clear from Fig. 4 that when SK-mel-110 cells are treated with fenretinide a significant degree of apoptosis occurs.
Therefore, fenretinide brings about apoptosis in SK-mel-110 cells.
Figure 5
It is clear from Fig. 5 that the degree of apoptosis observed following treatment with fenretinide is dose dependent. This is true for all types of melanoma cells tested.
Figure 6
It is clear from Fig. 6 that bacitracin is of minimal toxicity to the melanoma cells, with a similar degree of apoptosis being observed to that of the control. That is, that which occurs in the normal life cycle of cells. Treating the cells with fenretinide produces a marked increase in the degree of apoptosis observed compared to treatment with bacitracin.
However, when cells are treated with a combination of bacitracin and fenretinide a significant increase in the degree of apoptosis is observed. The degree of apoptosis is greater than the degree of apoptosis seen when the cells were treated with bacitracin or fenretinide alone. Therefore, this suggests that bacitracin and fenretinide act synergistically to enhance the degree of apoptosis observed.
Figure 7
It can be seen from the results in Fig. 7 that there is a synergistic induction of apoptosis when bacitracin plus velcade are administered at a fixed dose ratio of 15,000:1 to human A375 melanoma cells.
Figure 8
The results in Fig. 8 show the effect of an anti-GRP78 antibody (Santa Cruz Biotechnology) on CHL-I cells. The data confirm that the PDI inhibitor bacitracin increases fenretinide- or velcade-induced apoptosis. The data further demonstrate that the anti-GRP78 antibody increases fenretinide- or velcade-induced apoptosis.
The inventors noted that the particular combinations of bacitracin, anti-GRP78 antibody and ER stress-inducing agents resulted in an apoptotic response at levels equivalent to or less than apoptosis induced with either ER stress agent alone. The reasons for this are unclear at this stage.
Figure 9
The results in Fig. 9 confirm the observations seen with CHL-I cells (see Fig. 8) in WM266-4 cells. Thus, the anti-GRP78 antibody increased fenretinide- or velcade- induced apoptosis of WM266-4 cells. Figure 10
The data in Fig. 10 show the results of a dose response assay using the purine nucleoside analogue 2cdA. This purine nucleoside analogue inhibits the caspase- binding properties of GRP78. CHL-I cells or WM266-4 cells were treated with increasing concentrations of 2cdA in the presence or absence of fenretinide. It can be seen from Fig. 10 that concentrations of 2cdA of lμm and above increased fenretinide-induced apoptosis.
Figure 11
The data in Fig. 11 show the apoptotic effect on CHL-I cells and WM266-4 cells of a combination of fenretinide with bacitracin, 2cdA, or bacitracin plus 2cdA. Bacitracin and 2cdA were both shown to increase fenretinide-induced apoptosis. Furthermore, apoptosis was further increased by the combination of fenretinide with bacitracin and 2cdA.
Figure 12
The results in Fig. 12 show the effect treating CHL-I or WM266-4 cells with fenretinide and various combinations of bacitracin, polyclonal anti-GRP78 antibody and 2cdA. These data confirm that 2cdA increases fenretinide-induced apoptosis, an effect further increased by the addition of bacitracin, hi the WM266-4 cells, the combination of anti-GRP78 antibody and 2cdA increased fenretinide-induced apoptosis beyond the effect seen with 2cdA and no antibody. However, this effect was not observed when the combination of anti-GRP78 antibody, 2cdA and fenretinide was used to treat CHL-I cells. Furthermore, the combination of antibody, 2cdA, bacitracin and fenretinide did not increase apoptosis beyond the level achieved using 2cdA, bacitracin and fenretinide. These results indicate that the combination of a PDI inhibitor and a purine nucleoside analogue is effective for increasing ER stress- induced apoptosis of melanoma cells.
It is of course to be understood that the invention is not intended to be restricted to the details of the above embodiments which are described by way of example only. References
1 Wyllie AH5 Bellamy CO5 Bubb VJ5 Clarke AR, Corbet S5 Curtis L5 et. al. Apoptosis and carcinogenesis. Br. J. Cancer, 1999;80 Suppl 1:34-7.
2 Rao RV5 Ellerby HM5 Breseden DE. Coupling endoplasmic reticulum stress to cell death program. Cell Death Differ 2004; l l(4):372-80.
3 Khan MM5 Nomura T5 Chiba T, Tanaka K5 Yoshida H, Mori K et. al. oncoprotein PML-RARalpha induces endoplasmic reticulum (ER)-associated degradation of N-CoR and ER stress. J. Biol. Chem. 2004; 279(12):11814-24.
4 Maniratanachote R5 Minami K5 Kato M, Nakajima M and Yokoi T. Toxicological Sciences 2005;83:293-302.
5 Bae MA5 Rhee H and Song BJ, Toxicol. Lett. 2003;139:67-75.
6 Hetz C5 Russelakis-Carneiro M, Walchli S, Carboni S, Vial-Knecht E5 Maundrell K, Castilla J and Soto C. Journal of Neuroscience 2005; 25(11): 2793- 2802.
7 Prusiner SB, Prions Proc. Natl. Acad. Sci. USA 1998;95:13363-13383.
8 Malone W5 Perloff M5 Crowell J5 Sigman C, Higley H. Fenretinide: a prototype cancer prevention drug. Expert Opin. Investig. Drugs 2003;12(l 1): 1829- 42.
9 Lovat PE, Oliverio S5 Ranalli M5 Corrazzari M5 Rodolfo C5 Bernassola F et. al. GADDl 53 and 12-Lipoxygenase Mediate Fenretinide-induced Apoptosis of Neuroblastoma. Cancer Research 2202;62(18):5158-5167.
10 Cunnea PM, Miranda- VizueteA, Bertoli G, Sinmen T5 Damdimopoulos AE, Herman S5 et. al. ERdj5, an endoplasmic reticulum (ER)-resident protein containing DnaJ and thioredoxin domains, is expressed in secretory cells or following ER stress. J. Biol. Chem. 2003 ;278(2): 1059-66.
11 Frickel EM5 Frei P5 Bouvier M, Stafford WF5 Helenius A, GLockshuber R, et. al. ERp57 is a multifunctional thiol-disulfide oxidoreductase. J. Biol. Chem. 2004;279(l 8): 18277-87.
12 Bedard K5 Szabo E5 Michalak M5 Opas M. Cellular functions of endoplasmic reticulum chaperones calreticulin, calnexin, and ERp57. Int. Rev. Cytol. 2005,245:91-121. 13 Kass GE, Orrnius S. Calcium signalling and cytotoxicity. Environ. Health Perspect. 1999; 107 Suppl 125-35.
14 Albino AP, Juan G, Traganos F, Reinhart L, Connoly J, Rose DP, et. al. Cell cycle arrest and apoptosis of malnoma cells by docosahexanoic acid:association with decreased pRb phosphorylation. Cancer Res. 2000;60(15):4139-45.
15 Montaldo PG, Pagnan G3 Pastorio F, Chisea V, Raffaghello L, Kirchmeier M, et. al. N-(4-hydroxyphenyl) retinamide is cytotoxic to melanoma cells in vitro through induction of programmed cell death. Int. J. Cancer 1999;81(2):262-7
16 Lovat PE, DiSano F, CorazzariM, Fazi B, Donnorso RP, Pearson AD, et. al. Gangliosides link the acidic sphingomyelinase-mediated induction of ceramide to 12- lipoxy-dependent apoptosis or neuroblastoma in response to fenretinide. J. Natl. Cancer Inst. 2004;96(17):1288-99.
17 Corazzari M, Lovat PE, Olivewrio S, Pearson ADJ, Piacentini M, Redfern CPF. GADDl 53 Mediates Apoptosis in Response to Fenretinide but Not Synergy Between Fenretinide and Chemotherapeutic Drugs in Neuroblastoma. Molecular Pharmacology 2003;64:1370-1378.
18 Calfon M, Harding HP. Marcie Calfon's & Heather Harding' s protocol for detection of XBP-I processing in mouse or human cells. 2004;http://saturn.med.nyu.edu/researcli/mp[/ronlab/protocols/XBP- l.splicing.04.09.16.ρdf;October 7, 2005.
19 Lovat PE5 Ranalli M, Annichiarrico-Petruzzelli M, Bernassola FMP, Malcolm AJ et al. Effector mechanisms of fenretinide-induced apoptosis in neuroblastoma. Experimental Cell Research 2000;260:50-60.
20 Price BD, Mannheim-Rodman LA, Calderwood SK. Brefeldin A, thapsigargin, and AIF4- stimulate the accumulation of GRP78 mRNA in a cycloheximide dependent manner, whilst induction by hypoxia is independent of protein synthesis. J Cell Physiol. 1992 Sep;152(3):545-52.
21 Kim AJ, Shi Y, Austin RC, Werstuck GH. Valproate protects cells from ER stress-induced lipid accumulation and apoptosis by inhibiting glycogen synthase kinase-3. J Cell Sci. 2005 Jan l;118(Pt l):89-99.
22 Janiszewski M, Lopes LR, Carmo AO, Pedro MA, Brandes RP, Santos CX, Laurindo FR. Regulation of NAD(P)H oxidase by associated protein disulfide isomerase in vascular smooth muscle cells. J Biol Chem. 2005 Dec 9;280(49):40813- 9.
23 Higuchi T, Watanabe Y, Waga I. Protein disulfide isomerase suppresses the transcriptional activity of NF-kappaB. Biochem Biophys Res Commun. 2004 May 21;318(l):46-52.
24 Robak T, Lech-Maranda E, Korycka A, Robak E. Purine nucleoside analogs as immunosuppressive and antineoplastic agents: mechanism of action and clinical activity. Curr Med Chem. 2006; 13(26):3165-89.
25 Reddy RK, Mao C, Baumeister P, Austin RC, Kaufman RJ, Lee AS. Endoplasmic reticulum chaperone protein GRP78 protects cells from apoptosis induced by topoisomerase inhibitors: role of ATP binding site in suppression of caspase-7 activation. J Biol Chem. 2003 Jun 6;278(23):20915-24.
26 Rao RV, Peel A, Logvinova A, del Rio G, Hermel E, Yokota T, Goldsmith PC, Ellerby LM, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program: role of the ER chaperone GRP78. FEBS Lett. 2002 Mar 13;514(2-3):122-8.

Claims

1. The use of at least one agent which induces endoplasmic reticulum (ER) stress together with at least one agent which gives rise to inhibition of protein disulfide isomerase (PDI) or GRP78 function for the preparation of a medicament.
2. The use of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of PDI or GRP78 function for the preparation of a medicament for the treatment of cancer.
3. The use according to claim 2, wherein said ER stress inducing agent and said agent which gives rise to inhibition of PDI or GRP78 function are used for the treatment of melanoma.
4. The use according to claim 2, wherein said ER stress inducing agent and said agent which gives rise to inhibition of PDI or GRP78 function are used for the treatment of neuroblastoma.
5. The use according to any one of the preceding claims, wherein the ER stress inducing agent comprises an agent selected from fenretinide, velcade, or combinations thereof.
6. The use according to any one of claims 1 to 5, wherein the agent which gives rise to inhibtion of PDI comprises bacitracin.
7. The use according to any one of claims 1 to 6, wherein the agent which gives rise to inhibition of PDI inhibits the activity of ERdj5.
8. The use according to any one of claims 1 to 6, wherein the agent which gives rise to inhibition of PDI inhibits the activity of ERp57.
9. The use according to any one of claims 1 to 8, wherein the agent which gives rise to inhibition of PDI or GRP78 function comprises an inhibitory antibody or an active fragment thereof.
10. The use of bacitracin for the preparation of a medicament for the treatment of cancer.
11. A method for enhancing the efficacy of drugs which induce the apoptosis of tumour cells via ER stress comprising the steps of: administering a combination of at least one agent which induces ER stress and at least one agent which gives rise to inhibition of PDI or GRP78 function.
12. A pharmaceutical composition comprising an effective amount of at least one agent which induces ER stress together with at least one agent which gives rise to inhibition of PDI or GRP78 function, and which together provide a therapeutic effect.
13. A pharmaceutical composition according to claim 12, wherein the ER stress inducing agent comprises fenretinide.
14. A pharmaceutical composition according to claim 12 or claim 13, wherein the agent which gives rise to inhibition of PDI comprises bacitracin.
15. A pharmaceutical composition according to any one of claims 12 to 14, wherein the composition is used for the treatment of melanoma.
16. A pharmaceutical composition according to any one of claims 12 to 14, wherein the composition is used for the treatment of neuroblastoma.
PCT/GB2007/000125 2006-01-17 2007-01-17 Use in an alternative treatment of cancer Ceased WO2007083101A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0600903.9A GB0600903D0 (en) 2006-01-17 2006-01-17 Treatment of cancer
GB0600903.9 2006-01-17

Publications (2)

Publication Number Publication Date
WO2007083101A2 true WO2007083101A2 (en) 2007-07-26
WO2007083101A3 WO2007083101A3 (en) 2007-09-20

Family

ID=35998168

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2007/000125 Ceased WO2007083101A2 (en) 2006-01-17 2007-01-17 Use in an alternative treatment of cancer

Country Status (2)

Country Link
GB (1) GB0600903D0 (en)
WO (1) WO2007083101A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013192364A1 (en) * 2012-06-22 2013-12-27 The University Of Vermont And State Agricultural College Treatments of oxidative stress conditions

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4568665A (en) * 1982-06-25 1986-02-04 Mitchell David C Protein compounds
DE60135352D1 (en) * 2000-08-30 2008-09-25 Univ Johns Hopkins DEVICE FOR INTRA-OCCULAR ACTIVE AGGREGATION
EP1444989A1 (en) * 2003-02-07 2004-08-11 Giorgio Dr. Stassi Sensitizing cells for apoptosis by selectively blocking cytokines
US20050043215A1 (en) * 2003-02-19 2005-02-24 Tamara Minko Complex drug delivery composition and method for treating cancer
US20060068012A1 (en) * 2004-09-29 2006-03-30 Bausch & Lomb Incorporated Process for preparing poly (vinyl alcohol) drug delivery devices with humidity control

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013192364A1 (en) * 2012-06-22 2013-12-27 The University Of Vermont And State Agricultural College Treatments of oxidative stress conditions
US9907828B2 (en) 2012-06-22 2018-03-06 The University Of Vermont And State Agricultural College Treatments of oxidative stress conditions
US10688150B2 (en) 2012-06-22 2020-06-23 The Univserity of Vermont and State Agricultural College Treatments of oxidative stress conditions
US12011476B2 (en) 2012-06-22 2024-06-18 The University Of Vermont And State Agricultural College Treatments of oxidative stress conditions

Also Published As

Publication number Publication date
GB0600903D0 (en) 2006-02-22
WO2007083101A3 (en) 2007-09-20

Similar Documents

Publication Publication Date Title
Madondo et al. Low dose cyclophosphamide: mechanisms of T cell modulation
Chen et al. Collateral damage in cancer chemotherapy: oxidative stress in nontargeted tissues
Mondello et al. Dual inhibition of histone deacetylases and phosphoinositide 3-kinase enhances therapeutic activity against B cell lymphoma
KR102358632B1 (en) Composition for preventing or treating colon cancer comprising streptonigrin and anticancer agent
EP2034835B1 (en) Non-toxic anti-cancer drug combining ascorbate, magnesium and a naphthoquinone
Nemunaitis et al. Phase I study of oral CI-994 in combination with gemcitabine in treatment of patients with advanced cancer
CN112512527A (en) Combinations of enzastaurin and BTK inhibitors and uses thereof
EP2968379A1 (en) Etoposide and prodrugs thereof for use in targeting cancer stem cells
US20230190774A1 (en) METHOD OF USING SUBSTRATES OF AKR1Bl/AKR1B10 AS ANTI-CANCER DRUGS
EP4233879B1 (en) Deoxy- cytidine derivatives for use in cancer therapies
CA2643038A1 (en) Hexose compounds to treat cancer
CN114126652A (en) Antitumor agent and compounding agent
JP7285001B2 (en) Method for treatment of liver cancer with safranal preparation
EP4424316B1 (en) Antitumor pharmaceutical composition comprising azvudine and chemotherapeutic agent
JP7242097B2 (en) Anticancer composition containing immune checkpoint inhibitor
WO2013103836A2 (en) Methods of treating cancer
WO2007083101A2 (en) Use in an alternative treatment of cancer
CN109640978B (en) Pharmaceutical composition containing apigenin, curcumin and honokiol as effective components for preventing or treating lung cancer
US20190343854A1 (en) Pharmaceutical composition for preventing or treating cancer
JP2020512408A (en) Combinations for use in treating lung cancer
KR101997606B1 (en) Pharmaceutical composition for preventing or treating cancer
JP2011513274A (en) Antitumor combination comprising a morpholinyl anthracycline derivative and a demethylating agent
Rao et al. Metformin: A Potential Drug for COVID-19
JP7414230B2 (en) Antihematologic malignant tumor drug
CN100394920C (en) Use of 5-substituted nucleosides to potentiate the apoptotic effects of cytostatic drugs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07700394

Country of ref document: EP

Kind code of ref document: A2