WO2007075092A1 - New derivatives of epirubicin, their medicinal application and pharmaceuticals acceptable forms of drugs - Google Patents
New derivatives of epirubicin, their medicinal application and pharmaceuticals acceptable forms of drugs Download PDFInfo
- Publication number
- WO2007075092A1 WO2007075092A1 PCT/PL2005/000086 PL2005000086W WO2007075092A1 WO 2007075092 A1 WO2007075092 A1 WO 2007075092A1 PL 2005000086 W PL2005000086 W PL 2005000086W WO 2007075092 A1 WO2007075092 A1 WO 2007075092A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- epirubicin
- group
- derivatives
- hydrogen atom
- hcv
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H15/00—Compounds containing hydrocarbon or substituted hydrocarbon radicals directly attached to hetero atoms of saccharide radicals
- C07H15/20—Carbocyclic rings
- C07H15/24—Condensed ring systems having three or more rings
- C07H15/252—Naphthacene radicals, e.g. daunomycins, adriamycins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
Definitions
- the present invention relates to new biomedical application of novel derivatives of 7-O-(3'-amino-2',3',6'-trideoxy- ⁇ , ⁇ -L- arabinohexopyranosyl)-adriamycinone (epirubicin, 4'epidoxyrubicine) (Formula 1) where Ri, R2, R3, are the same or different, and represent hydrogen atom, alkyl, isopropyl, alkenyl or alkinyl with alkyl chain containing 1 to 5 carbon atoms, especially acetyl or alkylcarbonyl group with alkyl chain containing 1 to 5 carbon atoms, or dimethylformamidinyl group, at which, if R 1 and R4 simultaneously indicate hydrogen atom, then R3 indicates formamidinyl group, and their application to the treatment of hepatitis C virus (HCV) infections.
- HCV hepatitis C virus
- the present invention relates also to new, medical application of these derivatives for the treatment of hepatitis C virus (HCV) infections and pharmaceutically acceptable form of the drug containing above mentioned epirubicin derivatives of Formula 1, eventually in the form of hydrochloride.
- HCV hepatitis C virus
- Hepatitis C virus is of particular importance: it is highly pathogenic member of hepaciviruses of Fla ⁇ iviridae superfamily, widely distributed overall the world (according to WHO report ca 300 million infected people). Chronic active hepatitis develops in over 85% of acutely infected carriers and leads to liver cirrhosis and hepatocellular carcinoma (Hagedorn and Rice, Eds., The Hepatitis C Viruses, Springer, Heidelberg 2000).
- epirubicin hydrochloride known antitumor drug
- epirubicin hydrochloride is extremely potent anti-hepatitic C virus agent.
- Epirubicin hydrochloride is toxic to mammalian haemopoietic cells and cardiac tissue, however causes less haemotological and cardiac toxicity than equimolar doses of another widely used anti-tumor drug, doxorubicin (adriamycin).
- doxorubicin doxorubicin
- epirubicin derivatives exert potent inhibitory activity against hepatitis C virus (HCV) replication with lower than epirubicin cytotoxicity in Huh7 and PBMC cells, better in vitro therapeutic index
- novel epirubicin derivatives of Formula 1 as active substances for the treatment of HCV virus infections.
- This invention relates also to their pharmaceutically acceptable forms of the drug containing the mentioned derivatives of Formula 1 for the treatment of HCV infection.
- New derivatives of 7-0-(3'-amino-2',3',6'-trideoxy- ⁇ - ⁇ -L- arabinohexapiranosyl)-adriamycinone (epirubicin) as presented in Formula 1, where Ri, R2, R3 and R4 are the same or different and indicate hydrogen atom, alkyl group containing 1 to 5 carbon atoms, isopropyl group, alkenyl or alkinyl group, especially acetyl or alkylcarbonyl group with alkyl chain containing 1 to 5 carbon atoms or dimethyl formamidynyl group, at which, if Ri and R4 simultaneously indicate hydrogen atom, then R3 indicates formamidinyl group.
- epirubicin derivatives exert potent inhibitory effect of HCV replication at nanomolar concentrations and low toxicity and may be used as effective drugs against HCV infections.
- medical application of epirubicin derivatives is characterized as ensuring simultaneously low toxicity against Huh7 and PBMC cells, therapeutic index (TI) better than for epirubicin and lower than for epirubicin in vivo acute toxicity.
- new epirubicin derivatives are employed for the treatment of HCV virus infections.
- HCV infections containing known carriers and additions, according to the invention, characterized as containing epirubicin derivatives presented in Formula 1, where R 1 , R2, R3 and R4 have above mentioned importance, eventually in the form of hydrogen chloride salt.
- 4'-epidoxorubicin hydrochloride (58 mg, 0.10 mmol) was dissolved in acetone (6.8 mL) and diisopropylethylamine (18 ⁇ L) was added. The solution was cooled to 0 0 C in an ice bath and 10 ⁇ L (0.11 mmol) of acetic anhydride was added while stirring. The reaction mixture was allowed to warm to room temperature and then stirred for 2 hours. The solution was evaporated and subsequently the residue was dissolved in ca. 13 mL CHCI3. Furthermore the solution was washed with 0.1 M phosphate buffer pH 7.0 (3 times), and water (2 times). The organic layer was dried over anhydrous sodium sulphate and evaporated in vacuo.
- anti-HCV antiviral activity of epirubicin derivatives was tested in in vitro cell culture model using the HCV subgenomic replicon stably transfected into Huh7 cell lines (clone BM4.5) (Ju-Tao Gao et at, J Virol. 2001) .
- Huh7 cells containing the HCV replicon were grown in cell culture medium in presence of varying concentration of epirubicin. The media and drug were changed everyday for 5 days. After 5 days of treatment the cells were lysed and total RNA extracted. The isolated RNA was then assayed for presence of HCV replication by Northern Blot analysis, using a HCV probe targeting the NS5B region of HCV. In addition, the hybridisation with the ⁇ -actin radiolabeled probe allowed the normalization of the results i.e. to assess the impact of drug on housekeeping gene expression.
- the cell lines were treated everyday with epirubicin from concentration of 2 nM to 900 nM for 5 days and at the end of treatment RNA from the treated cells were isolated. The total RNA was then probed with a HCV specific probe using Northern blot analysis to detect the HCV RNA. The resulting blot was then exposed to phosphorimager densitometry and the viral replication quantified.
- HCV - RNA was qualitatively estimated by Real Time Polymerase Chain Reaction (RT PCR). Quantitation of HCV- RNA was also performed by real time PCR ( Figure 2).
- Total RNA from the lymphocytes was prepared using Total RNA extraction kit (ASsA Biotechnology, Gdynia, Tru, www.aabiot.com) .
- RNA recovered from cells was used as template for detection of 5' noncoding region of HCV RNA by RT-nested PCR: first PCR primers and for nested PCR resulted with 250 bp fragment.
- RT was done in one step for 60 min at 42°C and for 15 min at 75 0 C.
- 3 ⁇ l of cDNA was used for first PCR: 30 cycles of amplification, each consisting of 10 s at 94°C, 10 s at 55°C, and 20 s at 72 0 C. 2 ⁇ l of product of first round was used for the second amplification, 35 cycles, each cycle consisted of 10 s at 94°C, 10 s at 65°C, and 20 s at 72°C and was completed by an extension of 7 min at 72°C.
- the first round used 10 pmoles of primers NTR 1 LOW (GGTGCACGGTCTACGAGACCT) . and NTR 1 UP
- PCR products were analyzed by electrophoresis through a 1% "Nusieve agarose gel (FMC)", using ethidium bromide staining.
- Table 2 are presented data of cytotoxicity (CC50 and CC90), anti-HCV activity (IC50 and IC90) and of therapeutic index (TI50 and TI90) .
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
Abstract
New derivatives of 7-O-(3'amino-2',3',6'-trideoxy-α,β,L- arabinoheksopiranosyl)-adriamycinone (epirubicin) presented at Formula 1, where R1, R2, R3 and R4 are the same and indicate hydrogen atom, alkyl group, isopropyl, alkenyl or alkinyl, especially acetyl or alkylcarbonyl group, all with alkyl chain containing 1 to 5 carbon atoms or dimethylformamidinyl group, at which if R1 and R4 indicate simultaneously hydrogen atom, then R3 indicates dimethylformamidinyl group. According to the invention, medical application of novel epirubicin derivatives is characterized by the fact, that derivatives presented at Formula 1 are used as active substances potently inhibiting hepatitis C virus (HCV) replication. Pharmaceutically acceptable form of the drug against hepatitis C virus (HCV) infections as active substance contains epirubicin derivatives presented at Formula (1), where R1, R2, R3 and R4 have above mentioned indications, eventually in the form of hydrochloride. According to invention, form of the drug ensures simultaneously low toxicity in Huh 7 and PBMC cells, therapeutic index (TI) better than for epirubicin, and lower than for epirubicin acute toxicity in vivo.
Description
NEW DERIVATIVES OF EPIRUBICIN, THEIR MEDICINAL APPLICATION AND PHARMACEUTICALS ACCEPTABLE
FORMS OF DRUGS
The present invention relates to new biomedical application of novel derivatives of 7-O-(3'-amino-2',3',6'-trideoxy-α,β-L- arabinohexopyranosyl)-adriamycinone (epirubicin, 4'epidoxyrubicine) (Formula 1) where Ri, R2, R3, are the same or different, and represent hydrogen atom, alkyl, isopropyl, alkenyl or alkinyl with alkyl chain containing 1 to 5 carbon atoms, especially acetyl or alkylcarbonyl group with alkyl chain containing 1 to 5 carbon atoms, or dimethylformamidinyl group, at which, if R1 and R4 simultaneously indicate hydrogen atom, then R3 indicates formamidinyl group, and their application to the treatment of hepatitis C virus (HCV) infections. The present invention relates also to new, medical application of these derivatives for the treatment of hepatitis C virus (HCV) infections and pharmaceutically acceptable form of the drug containing above mentioned epirubicin derivatives of Formula 1, eventually in the form of hydrochloride. Hepatitis C virus is of particular importance: it is highly pathogenic member of hepaciviruses of Flaυiviridae superfamily, widely distributed overall the world (according to WHO report ca 300 million infected people). Chronic active hepatitis develops in over 85% of acutely infected carriers and leads to liver cirrhosis and hepatocellular carcinoma (Hagedorn and Rice, Eds., The Hepatitis C Viruses, Springer, Heidelberg 2000).
Recently we discovered that epirubicin hydrochloride, known antitumor drug, is extremely potent anti-hepatitic C virus agent. Epirubicin hydrochloride is toxic to mammalian haemopoietic cells and cardiac tissue, however causes less haemotological and cardiac toxicity than equimolar doses of another widely used anti-tumor drug, doxorubicin (adriamycin). In addition probability of developing congestive heart failure in man at total cumulative dose not exceeding
150 mg/m2 of human body surface is extremely low. We submitted the patent application to Polish and EU Patent Office (No PL375008, EP05460019.2 respectively) on July 7, 2005.
At present we surprisingly discovered that epirubicin derivatives (Formula 1, as referred to below), exert potent inhibitory activity against hepatitis C virus (HCV) replication with lower than epirubicin cytotoxicity in Huh7 and PBMC cells, better in vitro therapeutic index
(TI) (Table 1), and lower in vivo toxicity in mice.
According to the present invention there is provided the use of novel epirubicin derivatives of Formula 1 as active substances for the treatment of HCV virus infections. This invention relates also to their pharmaceutically acceptable forms of the drug containing the mentioned derivatives of Formula 1 for the treatment of HCV infection.
New derivatives of 7-0-(3'-amino-2',3',6'-trideoxy-α-β-L- arabinohexapiranosyl)-adriamycinone (epirubicin) as presented in Formula 1, where Ri, R2, R3 and R4 are the same or different and indicate hydrogen atom, alkyl group containing 1 to 5 carbon atoms, isopropyl group, alkenyl or alkinyl group, especially acetyl or alkylcarbonyl group with alkyl chain containing 1 to 5 carbon atoms or dimethyl formamidynyl group, at which, if Ri and R4 simultaneously indicate hydrogen atom, then R3 indicates formamidinyl group.
Medical application of epirubicin new derivatives rely upon epirubicin derivatives presented in Formula 1, where Ri, R2 and R4 are the same or different and indicate hydrogen atom, alkyl group containing 1 to 5 carbon atoms, isopropyl group, alkenyl or alkinyl group, especially acetyl or alkylcarbonyl group with alkyl chain containing 1 to 5 carbon atoms or dimethyl formamidinyl group, at which, if Ri and R4 simultaneously indicate hydrogen atom, then R3 indicates dimethylformamidinyl group, are employed as active substances inhibiting potently hepatitis C virus (HCV) replication.
At present it was pointed first time that new epirubicin derivatives exert potent inhibitory effect of HCV replication at nanomolar concentrations and low toxicity and may be used as effective drugs against HCV infections. According to the invention, medical application of epirubicin derivatives is characterized as ensuring simultaneously low toxicity against Huh7 and PBMC cells, therapeutic index (TI) better than for epirubicin and lower than for epirubicin in vivo acute toxicity.
Otherwise, new epirubicin derivatives are employed for the treatment of HCV virus infections.
Pharmaceutically acceptable form of the drug employed against
HCV infections, containing known carriers and additions, according to the invention, characterized as containing epirubicin derivatives presented in Formula 1, where R1, R2, R3 and R4 have above mentioned importance, eventually in the form of hydrogen chloride salt.
In investigations as presented below it was pointed out first time, that new epirubicin derivatives as presented in Formula 1 exert potent inhibitory effect on HCV replication at nanomolar concentrations and may be applied as effective drugs against HCV infections.
The following examples are not intended to limit the scope of the invention in any way.
Example 1
JV3 -acetyl-4'-epidoxorubicin (1, BNBOl)
4'-epidoxorubicin hydrochloride (58 mg, 0.10 mmol) was dissolved in acetone (6.8 mL) and diisopropylethylamine (18 μL) was added. The solution was cooled to 0 0C in an ice bath and 10 μL (0.11 mmol) of acetic anhydride was added while stirring. The reaction mixture was allowed to warm to room temperature and then stirred for 2 hours. The
solution was evaporated and subsequently the residue was dissolved in ca. 13 mL CHCI3. Furthermore the solution was washed with 0.1 M phosphate buffer pH 7.0 (3 times), and water (2 times). The organic layer was dried over anhydrous sodium sulphate and evaporated in vacuo. The residue was chromatographed (column of silica gel; CHCI3 to CHCl3:MeOH 1: 1); m. p. 180 0C; MS (ES+) 586.14; NMR (CDCl3) δ 1.36 (d, 3, 5'-CH3), 2.01 (s, 3, 3'-N-COCH3), 2.06 (m, 2, 2'-H2), 2.19 (d, 1, 8A- H), 2.41 (d, 1, 8B-H), 3.02 - 3.12 (m, 3, 3'-H and 4'-H/4'-OH), 3.28 (d, 1, 10A-H), 3.32 (d, 1, lOB-H), 3.78 - 3.81 (m, 1, 5'-H), 4.09 (s, 3, 4-OCH3), 4.80 (dd, 3, 14-H2/ 14-OH), 5.30 (br s, 1, 9-OH), 5.43 (d, 1, l'-H), 5.51 (d, 1, 7-H), 7.41 (d, 1, 3-H), 7.80 (t, 1, 2-H), 8.05 (d, 1, 1-H), 13.26 (s, 1, 11-OH), 14.02 (s, 1, 6-OH).
Example 2
JV3-, O4', Oi4-triacetyl-4'-epidoxorubicin (2, BNE02)
4'-epidoxorubicin hydrochloride (100 mg, 0.17 mmol) was dissolved in dry chloroform (10 mL) and 20 mg 4-dimethylaminopyridine was added. The solution was cooled to 0 0C in an ice bath and 400 μL (4.24 mmol) of acetic anhydride was added while stirring. The reaction mixture was allowed to warm to room temperature and then stirred. The progress of the reaction was checked by TLC (CHCl3:MeOH 9: 1). Then the solution was washed with 0.1 M phosphate buffer pH 7.0 (3 times), and water (2 times). The organic layer was dried over anhydrous sodium sulphate and evaporated in vacuo. The residue was chromatographed (column of silica gel; CHCl3 to CHCl3:MeOH 1: 1); ; m. p. 178 0C; MS (ES+) 670.25. NMR (DMSO-de) δ 1.09 (d, 3, 5'-CH3), 1.69 (s, 3, 14-0-COCH3), 1.97 (s, 3, 4'-0-COCH3), 2.08 - 2.12 (m, 5, 3'-N-COCH3, 8H2), 2.94/3.08(d/d, 1/ 1, 2'-H2), 4.05 (s, 3, 4-OCH3), 4.10 - 4.13 (m, 1, 5'-H), 4.43 (t, 1, l'-H), 4.96 - 4.97 (m, 1, 7-H), 5.22 (d, 2, 14-H2), 5.79 (s, 1, 9-OH), 7.66 (t, 1, 2-H), 7.72 (d, 1, 3-H), 7.92 (d, 1, 1-H), 13.28 (s, 1, 11-OH), 14.01 (s, 1, 6-OH).
Example 3
3'-JV,iV-Dimethyl-4'-epidoxorubicin (3, BNE06)
To a stirred solution of 4'-epidoxorubicin hydrochloride (100 mg, 0.17 mmol) in 630 μL H2O, 1.3 mL of acetonitrile was added and the mixture was warmed to 30 0C. Then 130 μL of 37% aqueous solution of formaldehyde (1.31 mmol) was added and the solution was stirred for 20 minutes in 23 - 25 0C. Next NaCNBH3 (23 mg, 0.37 mmol in 1.3 mL of acetonitrile) was added drop wise over 15 minutes. After the addition stirring was continued at 24 0C for 20 minutes. Then the reaction mixture was diluted with water (4 mL) and extracted with CHCI3 (2 x 4 mL).The chloroform extracts were combined, dried over anhydrous sodium sulphate and evaporated in vacuo. The residue was chromatographed (silica gel PLC plates) in CHCl3: MeOH:H2O 40: 10: 1); m. p. 220 0C; MS (ES+) 572.28, (ES-) 570.22. NMR (DMSO-de) δ 1.20 (d, 3, 5'-CH3), 1.56 (dt, 1, 2'-H), 1,72 (dd, 1, 2'-H), 2.17 (br s, 8, 3'-N(CHs)3, 8-H2)2.91 - 3.08 (m, 4, 10-H, 4'-OH, 4'-H, 3'-H), 3.80 - 3.85 (m, 1, 5'-H), 3.99 (s, 3, 4-OCH3), 4.55 (br s, 2, 14-H2), 4.85 (br s, 1, 14-OH), 4.97 (t, 1, l'-H), 5.32 (d, 1, 7-H), 5.45 (s, 1, 9-OH), 7.62 (d, 1, 3-H), 7.89 (t, 1, 2- H), 7.94 (d, 1, 1-H), 13.24 (br s, 1, 11-OH), 14.30 (br s, 1, 6-OH).
Example 4
S'-JV-IJV^JV^-DimethylformamidinylJ ^'-epidoxorubicin (4, BNE04)
To a solution of 4'-epidoxorubicin hydrochloride (150 mg, 0.26 mmol, 1 equiv) in dry methanol (7.5 mL) iV.iV-dimethylformamide dimethyl acetal (182 μL, 1.30 mmol, 5 equiv) was added dropwise under Ar. The reaction mixture was stirred for 4 hours, and then solvent was removed under reduced pressure. The residue was chromatographed (column of silica gel; CHCl3 to CHCl3:MeOH 9:1); m. p. 206 0C; MS (ES+) 599.13, (ES-) 597.24; NMR (DMSO-de) δ 1.24 (d, 3, 5'-CH3), 1.99 (ά, 2, 8H2), 2.19 (m, 2, 2'-H2), 3.01 - 3.11 (m and m, 11, 10-H2, 4'-OH, 4'-H, 3'-H, N"-Me2),
3.93 (m, 1, 5'-H)5 4.00 (s, 3, 4-OCH3), 4.57 (d, 2, 14-H2), 4.87 (t, 1, 14- OH), 4.99 (t, 1, l'-H), 5.29 (t, 1, 7-H), 5.48 (s, 1, 9-OH), 7.68 (t, 1, 2-H),
7.94 (d, 2, 1-H and 3-H), 8.08 (s, 1, 3'-NC-H), 13.26 (s, 1, 11-OH), 14.04 (s, 1, 6-OH).
Antiviral activity and cytotoxicity testing.
The potential antiviral (anti-HCV) activity of epirubicin derivatives was tested in in vitro cell culture model using the HCV subgenomic replicon stably transfected into Huh7 cell lines (clone BM4.5) (Ju-Tao Gao et at, J Virol. 2001) .
Huh7 cells containing the HCV replicon were grown in cell culture medium in presence of varying concentration of epirubicin. The media and drug were changed everyday for 5 days. After 5 days of treatment the cells were lysed and total RNA extracted. The isolated RNA was then assayed for presence of HCV replication by Northern Blot analysis, using a HCV probe targeting the NS5B region of HCV. In addition, the hybridisation with the β-actin radiolabeled probe allowed the normalization of the results i.e. to assess the impact of drug on housekeeping gene expression. The cell lines were treated everyday with epirubicin from concentration of 2 nM to 900 nM for 5 days and at the end of treatment RNA from the treated cells were isolated. The total RNA was then probed with a HCV specific probe using Northern blot analysis to detect the HCV RNA. The resulting blot was then exposed to phosphorimager densitometry and the viral replication quantified.
Results of analysis of dependency from the time of treatment indicate, that epirubicin derivatives at concentrations 0,018 to 0,9 μM effectively inhibit in vitro HCV replication in HCV subgenomic replication (Table 1). Inhibition of HCV replication by epirubicin (BNEOO), N3'- acetylepirubicin (BNEO l), and N3',O4',O14-triacetylepirubicin (BNE02) in HCV(+) lymphocyte cultures was performed as follows. Lymphocytes
were cultured in medium enriched with known concentrations of BNEOO, BNEO l, BNE02. On the 5 and 14 day of culture the cells were collected and after extraction HCV - RNA was qualitatively estimated by Real Time Polymerase Chain Reaction (RT PCR). Quantitation of HCV- RNA was also performed by real time PCR (Figure 2). Total RNA from the lymphocytes was prepared using Total RNA extraction kit (ASsA Biotechnology, Gdynia, Poland, www.aabiot.com) . RNA recovered from cells was used as template for detection of 5' noncoding region of HCV RNA by RT-nested PCR: first PCR primers and for nested PCR resulted with 250 bp fragment.
In brief, RT was done in one step for 60 min at 42°C and for 15 min at 750C. 3 μl of cDNA was used for first PCR: 30 cycles of amplification, each consisting of 10 s at 94°C, 10 s at 55°C, and 20 s at 720C. 2 μl of product of first round was used for the second amplification, 35 cycles, each cycle consisted of 10 s at 94°C, 10 s at 65°C, and 20 s at 72°C and was completed by an extension of 7 min at 72°C. The first round used 10 pmoles of primers NTR 1 LOW (GGTGCACGGTCTACGAGACCT) . and NTR 1 UP
(CGACACTCCACCATAGAT) and for second round NTR 2 LOW (CACTCGCAAGCACCCTATCAGGCAGT) and NTR 2 UP (CCACCATAGATCACTCCCCTGT). PCR products were analyzed by electrophoresis through a 1% "Nusieve agarose gel (FMC)", using ethidium bromide staining.
At Table 1 it was also pointed that 50% inhibitory concentrations (IC50) of epirubicin derivatives with regards to the anti-HCV activity measured in HCV replicon system was found to be low since it was in a range 0.018-0.9 μM, while its 50% cytotoxic concentration (CC50) in Huh7 cells was in the range 0.06-0.9 μM, profitably in the case of N3',O4',Oi4-triacetylepirubicin (BNE02), where therapeutic index is 10. Cytotoxicity (CC50) of epirubicin derivatives in PBMC cells was as low as 39-41 μM (fig. 3). Determination of acute toxicity in mice was performed according to "OECD Guidelines for Testing of Chemicals" (Guideline No
401). In addition compound 2 (BNE02) exerts very low in vivo acute toxicity (LD50 = 1300 mg/kg of mice) as compared with epirubicine (LD50 = 37 mg/kg of mice).
In this study we show for the first time that epirubicin derivatives are capable to exert anti-HCV effects at nanomolar concentrations and good, better than epirubicin, therapeutic index and should be regarded as potent drugs against HCV infections with very low toxicity in vitro and in vivo.
Table 1.
10 Anti-HCV activity in HCV replicon system1 and cytotoxicity of epirubicin derivatives in Huh-7 and PBMC cells.
1 HCV subgenomic replicon stably transfected into Huh-7 cell lines (clone 15 BM4.5) (Ju-Tao Gao et al,, J. Virol. 2001, )
2 Cytotoxic activity (CC50) - 50% cytotoxic concentration
3 Antiviral activity (IC50) - concentration required to inhibit viral replication by 50%
20 In Table 2 are presented data of cytotoxicity (CC50 and CC90), anti-HCV activity (IC50 and IC90) and of therapeutic index (TI50 and TI90) .
Table 2
Claims
1. New derivatives of 7-O-(3'-amino-2',3',6'-trideoxy~α,β,L- arabinohexopyranosyl)-adriamycinone (epirubicin) as presented in Formula 1, where R1, R2, R3 and R4 are the same or different, and indicate hydrogen atom, alkyl group, isopropyl, alkenyl or alkinyl, especially acetyl or alkylcarbonyl group, all with alkyl chain containing 1 to 5 carbon atoms, or dimethylformamidinyl group, at which, if R1 and R4 simultaneously indicate hydrogen atom, then R3 indicates formamidinyl group.
2. Medicinal application of new epirubicin derivatives characterized by the fact, that epirubicin derivatives presented in Formula 1, where R1, R2 and R4 are the same or different and indicate hydrogen atom, alkyl group, isopropyl, alkenyl or alkinyl, especially acetyl or alkylcarbonyl group, all with alkyl chain containing 1 to 5 carbon atoms, or dimethylformamidinyl group, at which, if R1 and R4 simultaneously indicate hydrogen atom, then R3 indicates dimethylformamidinyl group, are used as active substances effectively inhibiting hepatitis C virus (HCV) replication.
3. Application according to Claim 2, characterized by the fact that it ensures low toxicity against Huh7 and PBMC cells, therapeutic index (TI) better than for epirubicin and lower than for epirubicin toxicity in vivo.
4. Pharmaceuticall acceptable form of the drug against HCV infections containing known carriers and additions, characterized by the fact, that as active substance contains epirubicin derivatives presented in Formula 1, where R1, R.2, Re and R4 are the same or different, and indicate hydrogen atom, alkyl group, isopropyl, alkenyl or alkinyl, especially acetyl or alkylcarbonyl group, all with alkyl chain containing 1 to 5 carbon atoms, or dimethylformamidinyl group, at which, if R1 and R4 simultaneously indicate hydrogen atom, then R3 indicates dimethylformamidinyl group, eventually in the form of hydrochloride salt.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/PL2006/000080 WO2007075094A1 (en) | 2005-12-27 | 2006-11-14 | New derivatives of epirubicin, their medicinal application and pharmaceuticaly acceptable forms of drugs |
| US12/159,477 US8173610B2 (en) | 2005-12-27 | 2006-11-14 | Derivatives of epirubicin, their medicinal application and pharmaceuticaly acceptable forms of drugs |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PLP-378535 | 2005-12-29 | ||
| PL37853505 | 2005-12-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007075092A1 true WO2007075092A1 (en) | 2007-07-05 |
| WO2007075092A8 WO2007075092A8 (en) | 2008-02-21 |
Family
ID=37762417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/PL2005/000086 WO2007075092A1 (en) | 2005-12-27 | 2005-12-29 | New derivatives of epirubicin, their medicinal application and pharmaceuticals acceptable forms of drugs |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US8173610B2 (en) |
| WO (1) | WO2007075092A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008097112A1 (en) * | 2007-02-07 | 2008-08-14 | Instytut Biotechnologii I Antybiotykow | Amidinoanthracycline antibiotics for use in the treatment of viral infections |
| CN106309461A (en) * | 2015-06-25 | 2017-01-11 | 中国科学院上海生命科学研究院 | Purpose of epirubicin hydrochloride in preparation of inhibitor for blocking interaction p97 and Npl4 |
| WO2023220641A2 (en) | 2022-05-11 | 2023-11-16 | Juno Therapeutics, Inc. | Methods and uses related to t cell therapy and production of same |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE2757102A1 (en) * | 1976-12-22 | 1978-07-06 | Farmaceutici Italia | ANTITUM ORGLYCOSIDES, METHOD FOR THE PRODUCTION THEREOF AND PHARMACEUTICAL AGENTS CONTAINING THESE COMPOUNDS |
| DE3500029A1 (en) * | 1985-01-02 | 1986-09-04 | Farmitalia Carlo Erba S.p.A., Mailand/Milano | Anthracycline esters |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI883338A (en) * | 1987-07-16 | 1989-01-17 | Bristol Myers Co | DOUBORUBICINHYDROCHLORIDES. |
| PL375008A1 (en) | 2005-05-12 | 2006-11-13 | Institut National De La Sante Et De La Recherche Medicale, Inserm | New application of epirubicine hydrochloride in medicine |
-
2005
- 2005-12-29 WO PCT/PL2005/000086 patent/WO2007075092A1/en active Application Filing
-
2006
- 2006-11-14 US US12/159,477 patent/US8173610B2/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE2757102A1 (en) * | 1976-12-22 | 1978-07-06 | Farmaceutici Italia | ANTITUM ORGLYCOSIDES, METHOD FOR THE PRODUCTION THEREOF AND PHARMACEUTICAL AGENTS CONTAINING THESE COMPOUNDS |
| DE3500029A1 (en) * | 1985-01-02 | 1986-09-04 | Farmitalia Carlo Erba S.p.A., Mailand/Milano | Anthracycline esters |
Non-Patent Citations (1)
| Title |
|---|
| BOROWSKI P ET AL: "NUCLEOTIDE TRIPHOSPHATASE/HELICASE OF HEPATITIS C VIRUS AS A TARGET FOR ANTIVIRAL THERAPY", ANTIVIRAL RESEARCH, ELSEVIER SCIENCE BV., AMSTERDAM, NL, vol. 55, no. 3, 2002, pages 397 - 412, XP008056992, ISSN: 0166-3542 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008097112A1 (en) * | 2007-02-07 | 2008-08-14 | Instytut Biotechnologii I Antybiotykow | Amidinoanthracycline antibiotics for use in the treatment of viral infections |
| CN106309461A (en) * | 2015-06-25 | 2017-01-11 | 中国科学院上海生命科学研究院 | Purpose of epirubicin hydrochloride in preparation of inhibitor for blocking interaction p97 and Npl4 |
| CN106309461B (en) * | 2015-06-25 | 2019-03-12 | 中国科学院上海生命科学研究院 | Purposes of the epirubicin hydrochloride in the inhibitor that preparation can block the interaction of p97 and Npl4 |
| WO2023220641A2 (en) | 2022-05-11 | 2023-11-16 | Juno Therapeutics, Inc. | Methods and uses related to t cell therapy and production of same |
Also Published As
| Publication number | Publication date |
|---|---|
| US20090247623A1 (en) | 2009-10-01 |
| WO2007075092A8 (en) | 2008-02-21 |
| US8173610B2 (en) | 2012-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102123716B (en) | Compositions and methods for treating viral infections | |
| CA2751458C (en) | Purine nucleoside monophosphate prodrugs for treatment of cancer and viral infections | |
| US20060003951A1 (en) | Anti-viral 7-deaza L-nucleosides | |
| US20230000893A1 (en) | Antiviral Agents and Nucleoside Analogs for Treatment of Zika Virus | |
| JP2521426B2 (en) | Selective inhibitors of gene expression | |
| WO2006094347A1 (en) | Bicyclic nucleosides and nucleotides as therapeutic agents | |
| Shubina et al. | Pyridine nucleosides neopetrosides A and B from a marine Neopetrosia sp. sponge. Synthesis of neopetroside A and its β-riboside analogue | |
| AU2008304380A1 (en) | Azacytidine analogues and uses thereof | |
| CN107973833A (en) | Design as the oligonucleotide analogs of therapeutic agent | |
| WO2007009265A1 (en) | NOVEL β-CYCLODEXTRIN-BASED MOLECULES AND DRUG DELIVERY COMPOSITIONS | |
| WO2007075092A1 (en) | New derivatives of epirubicin, their medicinal application and pharmaceuticals acceptable forms of drugs | |
| EP1325922A2 (en) | Therapeutic quassinoid preparations with antineoplastic, antiviral, and herbistatic activity | |
| EP1721614A1 (en) | Epirubicine hydrochloride for treating hepatitis C virus | |
| Shakya et al. | A new class of pyrimidine nucleosides: inhibitors of hepatitis B and C viruses | |
| CA2130926C (en) | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof | |
| De Clercq et al. | Antiviral activity of O'-alkylated derivatives of cytosine arabinoside | |
| CN106749056A (en) | A kind of Bola types ribavirin glycoside compound and its preparation method and application | |
| WO2007075094A1 (en) | New derivatives of epirubicin, their medicinal application and pharmaceuticaly acceptable forms of drugs | |
| PL212279B1 (en) | New derivatives of epirubicines and their medical application and pharmaceutically admitted form of drug | |
| KR20080086481A (en) | Dioxolane derivates for the treatment of cancer | |
| Ji et al. | Synthesis of novel dimeric steroidal-nucleoside phosphoramidates | |
| Thillier et al. | Solid-phase synthesis of 5′-triphosphate 2′-5′-oligoadenylates analogs with 3′-O-biolabile groups and their evaluation as RNase L activators and antiviral drugs | |
| CN102690313B (en) | Cholic acid-naphthoylimine compounds and application thereof | |
| EP4169930A1 (en) | Novel benzimidazole derivative, preparation method therefor, and use thereof as anticancer or antiviral agent | |
| Srivastav et al. | Synthesis and in vitro antiviral activities of 3′-fluoro (or chloro) and 2′, 3′-difluoro 2′, 3′-dideoxynucleoside analogs against hepatitis B and C viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 05819892 Country of ref document: EP Kind code of ref document: A1 |