WO2007057652A1 - Method of target enrichment - Google Patents

Method of target enrichment Download PDF

Info

Publication number
WO2007057652A1
WO2007057652A1 PCT/GB2006/004244 GB2006004244W WO2007057652A1 WO 2007057652 A1 WO2007057652 A1 WO 2007057652A1 GB 2006004244 W GB2006004244 W GB 2006004244W WO 2007057652 A1 WO2007057652 A1 WO 2007057652A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequences
nucleic acid
target
population
probe
Prior art date
Application number
PCT/GB2006/004244
Other languages
French (fr)
Inventor
Niall Anthony Gormley
John Stephen West
Original Assignee
Solexa Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Solexa Limited filed Critical Solexa Limited
Priority to EP06808536A priority Critical patent/EP1957667A1/en
Publication of WO2007057652A1 publication Critical patent/WO2007057652A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing

Definitions

  • the present invention relates to a method of.-reducing the complexity of a nucleic acid sample in a reproducible manner by enriching for specific nucleic acid target sequences in the population. Specifically it relates to a method to enrich for specific target sequences using libraries of oligonucleotides such as micro-arrays, for example, for use in sequencing and particularly sequencing by synthesis .
  • DNA sequencing is a fundamental tool enabling the screening of genes for such genetic mutations associated with disease. High throughput, high accuracy sequencing methods are therefore required to screen the complete genome sequence of an animal in order to identify unique nucleic acid sequences which may indicate the presence of physiological or pathological conditions .
  • DNA sequencing of large and complex genomes is currently limited by cost. With a significant proportion of human genomic DNA comprising repetitive sequence, reducing the complexity of the sample reduces the amount of sequencing required. Furthermore, with prior genetic information, it is possible to correlate a phenotype, such as a predisposition to a disease, with the genetic variation of one or more regions of the genome, and what is desired is the application and advantages of high throughput sequencing methods specifically to these regions of interest among many individuals. Such studies are currently not feasible due to cost. . In addition, in certain circumstances, it is desirable to generate a ⁇ genome-wide' analysis of a particular genomic feature, such as exons, to correlate genetic diversity in the protein-coding regions across many individuals. Consequently development of strategies that focus on targeted sequencing of gene rich regions provide an alternative approach to whole genome sequencing.
  • the method further includes amplifying the captured target polynucleotide by hybridising at least one primer oligonucleotide to the target polynucleotide and using nucleic acid amplification that initiates from the primer oligonucleotide.
  • the method utilises two separate probes for use in diagnostic assays, for example in testing for the presence of bacteria in a biological sample.
  • Collins et al, US5,750,338, describe a method of assay for target polynucleotides which include-des the steps of isolating target polynucleotides from extraneous non-target polynucleotides, debris, and impurities and amplifying the target polynucleotide.
  • the method provides for detection of nucleic acid targets in clinical samples.
  • Urdea US5,200,314, describes an analyte polynucleotide strand having an analyte sequence which is detected within a sample containing polynucleotides by contacting the analyte polynucleotide with a capture probe under hybridization conditions, where the capture probe has a first binding partner specific for a solid-phase second binding partner.
  • the resulting duplex is then immobilized by specific binding between the binding partners / and non-bound polynucleotides are separated from the bound species.
  • the analyte polynucleotide is optionally displaced from the solid phase, then amplified by PCR.
  • the PCR primers each 0 have a polynucleotide region capable of hybridizing to a region of the analyte polynucleotide, and at least one of the primers further has an additional binding partner capable of binding a solid-phase binding partner.
  • the amplified product is then separated from the reaction 5 mixture by specific binding between the binding partners, and the amplified product is detected.
  • Nisson et al, US ⁇ ,268,133 discloses the use of amino acid denaturants for denaturing or separating double 0 stranded nucleic acid molecules and more specifically, provides a method for the rapid isolation and recovery of a desired target DNA or RNA molecules from a mixture or library containing such molecules. Th-e method involves the use of haptenylated probes and amino acid denaturants to 5 select the desired molecules and eliminate the undesired library members from a sample. Their invention also provides a method in which larger or full-length nucleic acid molecules can be isolated from the subpopulation of desired molecules. ,0
  • WO01/46470 in the name of Karolinska Innovations relates to a method for enrichment of specific nucleic acid segments, such as a DNA, e.g. single nucleotide polymorphisms (SNPs) , sequences that have been deleted, sequences that are identical between two complex genomes, etc.
  • SNPs single nucleotide polymorphisms
  • the disclosed method includes steps for providing a first sample A and a second sample B derived from different sources and digestion of both said samples; amplification of sample A with a suitable primer and dNTPs comprising one unconventional base and amplification of sample B with a labelled primer and all the conventional dNTPs, followed by combination of samples A and B; denaturation and hybridization; treatment with a nuclease specific for said unconventional base, such as uracil-DNA glycosylase (UDG) , and isolation of the specific segment originally present in sample B by use of the primer label.
  • a nuclease specific for said unconventional base such as uracil-DNA glycosylase (UDG)
  • UDG uracil-DNA glycosylase
  • Their invention further relates to a kit which comprises components suitable for working the above described method.
  • WO02/06528 in the name of Somalogic, Inc. relate to a method and apparatus for the automated generation of nucleic acid ligands.
  • the disclosure includes a method and device for performing automated SELEX. The steps of the SELEX process are performed at one or more work stations on a work surface by a robotic manipulator controlled by a computer.
  • the document also includes methods and reagents to obviate the need for size-fractionation of amplified candidate nucleic acids before beginning the next round of the SELEX process.
  • SELEX or Systematic Evolution of Ligands by Exponential enrichment is a procedure in which an initial pool of randomized polynucleotides (RNA or DNA, single stranded) is created, containing- on the order of ⁇ 10 A 15 molecules of a fixed length. The pool is then screened for some desired characteristic for example, binding affinity for ATP. The molecules that are selected in this way are used as "parents" in the synthesis (with mutation) of a new pool of molecules, and the process repeats with more rounds of selection and amplification.
  • the result of SELEX is a set of highly functional molecules of DNA or RNA that perform their selected function.
  • US6,013,440 Lipshutz et al, relates generally to matrices for conducting nucleic acid affinity chromatography. Specifically the invention relates to methods of preparing affinity chromatography matrices that bind a plurality of different pre-selected nucleic acids.
  • Su et al, US6,632,611 disclose methods and kits for amplifying a target sequence from within a nucleic acid population.
  • the invention provides selection probes which are complementary to at least a portion of said target sequence and mechanisms for adding a probe sequence to the 3' end of a target sequence that is hybridized to a selection probe.
  • the added 3 ' probe sequence and a probe sequence added at the 5 ' end of the target by adaptor ligation allow for selective amplification of the target -sequence .
  • Said method comprises:
  • probe-target complexes (b) combining said first population of nucleic acid sequences with a set -of probe sequences under conditions allowing for hybridisation of the probe sequences and said first population of nucleic acid sequences to form probe-target complexes; and (c) purifying the probe-target complexes to discard the un-hybridised nucleic acid target sequences; (d) sequencing the remaining probe selected population of target sequences.
  • the method further comprises a ligation step wherein adaptors are ligated to the fragmented first population of nucleic acid sequences, either prior to or subsequent to the enrichment step.
  • the method further comprises an amplification step whereby the fragmented first population of nucleic acid sequences are amplified using, for example, PCR.
  • said amplification step is performed following ligation of , adaptors to the fragmented first population of nucleic acid sequences.
  • said amplification step is performed on the first population of nucleic acid sequences as a whole and in contrast to the methods of the prior art is not intended to amplify only a subset of said first population .
  • the target sequences can be removed from the probe-target complex prior to sequencing, for example by elution. Removal by denaturation of the selected targets from the immobilised capture probes will generally give a solution of single stranded targets.
  • the method further comprises the step of ligating adaptors to the enriched target sequences after separation of said target sequences from the probe target complexes.
  • the target sequences remain bound to the probe (s) and are sequenced directly on the array using, for example, sequencing by synthesis (SBS) .
  • the target sequences are removed from the array and are further amplified and/or immobilised to produce clustered arrays, or sequenced directly as single molecules .
  • enrichment of a first population of nucleic acid sequences and subsequent sequencing of target sequences takes place on a single surface i.e. a single array or ⁇ chip' .
  • Figure Ia illustrates a simplified and schematised embodiment of the use of a microarray to enrich a fragmented complex nucleic acid sample for a population of target sequences .
  • Figure Ib illustrates a simplified and- schematised embodiment of the use of a microarray to enrich a fragmented complex nucleic acid sample for a population of target sequences wherein adaptors are ligated to the fragmented genomic DNA prior to enrichment.
  • Figures 2a and 2b illustrate a simplified and schematised embodiment of the use of a microarray for ⁇ one-chip' enrichment and sequencing.
  • Genomic DNA is fragmented, adaptors are ligated to the ends of the fragments which are then amplified.
  • the capture probes hybridise to the target sequences which are then extended to produce a complimentary sequence bound to the capture probe.
  • the capture probe can then be bound to the surface of an array, target sequence is removed and the complimentary sequence is sequenced.
  • Micro-arrays have been used primarily for gene expression analyses, although the strategy of using an ordered array of bio-molecules on such an array has also been extended to mutation- detection, polymorphism analysis, mapping and evolutionary studies.
  • capture probes allows the researcher to positively select for regions of the genome which are of interest whilst concomitantly negatively selecting for the remainder of the genome.
  • Such an approach has the advantage, for example, that highly repetitive DNA sequences which comprise 40% of genomic DNA can be removed quickly and efficiently from a complex population.
  • the complexity of sequence is reduced thus increasing throughput of subsequent sequencing.
  • further enrichment for a target region or feature, such as exons would further reduce the complexity of the sample.
  • the nucleic acid sample applied to the array will not first be fluorescently labelled.
  • the method may be performed using micro-arrays there is the added benefit that the volume of input sample required is significantly reduced over methods of the prior art.
  • the ability to use smaller quantities of input sample is a significant advantage over techniques in the prior art which often require complex strategies to increase the amount of nucleic acid by amplification.
  • a further advantage is that the cost of carrying out both the enrichment and subsequent sequencing is also significantly reduced since less sequence data needs to be generated to produce meaningful results .
  • the term ⁇ enrichment' refers to the process of increasing the' relative abundance of particular nucleic acid sequences in a sample relative to the level of nucleic acid sequences as a whole initially present in said sample before treatment.
  • the enrichment step provides a percentage or fractional increase rather than directly increasing for example, the copy number of the nucleic acid sequences of interest as amplification methods, such as PCR, would.
  • the methods as described herein may be used to remove DNA strands that it is not desired to sequence, rather than to specifically amplify only the sequences of interest.
  • removing 50% of the DNA sample gives a two fold reduction in the cost and time of sequencing the remaining regions of biological interest from the whole genome.
  • the methods as described herein can also be used to select large regions of a genome (eg megabases) for resequencing of multiple individuals, or can select out all the exons in a genomic sample.
  • the synthesis of one array, or pool of oligonucleotides can be used to process multiple samples of interest, and thus the costs of the oligonucleotide synthesis can be amortised over many individual samples.
  • the complex nucleic acid sample or input sample is an initial sample of nucleotide sequences prior to enrichment, such as genomic DNA.
  • genomic DNA As non-limiting examples, such a sample may consist of genomic DNA, cDNA, RNA, PCR products, pools or subsets thereof.
  • Said method comprises:
  • said fragmented nucleic acid population comprises sequence fragments which are less than about 1000 base pairs in length, more preferably such sequences are in the range 100-1000 base pairs in length. Still more preferably such sequences are in the range of from 450-750 base pairs in length. It would be apparent to the skilled artisan that the following non-limiting fragmentation methods may be used: restriction endonucleases, other suitable enzymes, mechanical forms of fragmentation, such as nebulisation or sonication, or non-enzymatic chemical fragmentation .
  • adaptors may be ligated to the fragmented first population of nucleic acid sequences, either prior to or subsequent to the enrichment step.
  • the fragmented first population of nucleic acid sequences may be subjected to an amplification step using, for example, PCR.
  • said amplification step is performed following ligation of adaptors to the fragmented first population of nucleic acid sequences.
  • said amplification ' step is performed on the first population of nucleic acid sequences as a whole and in contrast to the methods of the prior art is not intended to amplify only a subset of said first population.
  • the capture probes are preferably nucleic acids, such as oligonucleotides, capable of binding to a target nucleic acid sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
  • Such probes may include natural or modified bases and may be RNA or DNA.
  • the bases in probes may be joined by a linkage other than a phosphodiester bond so long as it does not interfere with hybridisation.
  • probes may also be peptide nucleic acids (PNA) in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages .
  • PNA peptide nucleic acids
  • Capture probes are reference populations of nucleic acid sequences. These have been selected such that said probes relate to, by way of non-limiting examples, a set of genes of interest, all of the exons of a genome, particular genetic regions of interest, disease or physiological states and the like.
  • reference populations will include commercially available populations available as micro-arrays or ⁇ chips' more commonly used in expression profiling such as the Affymetrix® Exon Gene-Chip®.
  • the capture probes can also be synthesised as oligonucleotides in solution, and can be used either in solution or immobilised on beads.
  • the beads could contain multiple copies of individual sequences, such that each beads contains a single, different sequence, or can just contain the whole pool of oligonucleotides immobilised on each bead such that each bead is the same mixture of sequences.
  • Capture probes may also be prepared from a sample of DNA from any source, for example bacterial artificial chromosomes (BACs), PCR fragment ' s, whole chromosomes or cDNA libraries.
  • BACs bacterial artificial chromosomes
  • PCR fragment ' s PCR fragment ' s
  • whole chromosomes or cDNA libraries.
  • Use of a suitably available nucleic acid sample that can be fragmented and enriched as described means that the same region can be re-sequenced from multiple individuals without the need for chemical synthesis of specific capture probes across that region.
  • Any available nucleic acid can be fragmented and undergo a ligation with an adaptor sequence to establish common known ends on each fragment .
  • Such fragment libraries can be amplified using primers complementary to the known ends and modified with groups amenable to surface attachment, such as, for example, biotin.
  • the fragment pools once made single stranded, are attached to a suitably functionalised surface, such as, for example, streptavidin beads. If the bead pool is exposed to a single stranded target DNA sample, then the fragments of the target DNA sample complementary to the single stranded fragments immobilised on the beads will bind, and the non- complementary sequences will remain unbound in solution and can be easily separated from the immobilised fragments.
  • the hybridisation step may be performed either on the solid surface, such as on beads, to which the single stranded capture probes have been bound, or in solution. ⁇ If the hybridisation is performed in solution, subsequent addition of beads results in binding of all the capture probes, either as duplexes with the target sample, or as single strands. The remainder of the target DNA which has not formed duplexes with one of the capture probes will not be able to bind to the beads. Unbound target sample can be removed from the beads by washing, for example, and the duplex sample can be treated to elute the hybridised target into solution.
  • the enriched sample may be eluted from the beads and can be attached to a surface and used for sequencing, either as arrays of single molecules, or amplified to form clustered arrays of clonal single molecules, for example as described in WO9844151.
  • the enriched sample may be amplified whilst still attached to the beads by, for example, emulsion phase PCR, or may be eluted from the beads and amplified in solution prior to surface attachment .
  • ⁇ targef or ⁇ target sequence' refer to nucleic acid sequences of interest that is, those which hybridise to the capture probes. Thus the term includes those larger nucleic acid sequences, a sub-sequence of which binds to the probe and/or to the overall bound sequence. Since "the target sequences are for use in sequencing methods, said target sequences do not need to have been previously defined to any extent, other than the bases complementary to the capture probes . Capture probes hybridise to target sequences in the ⁇ complex nucleic acid sample. It will be apparent to one skilled in the art that prior to hybridisation said complex nucleic acid sample .will preferably comprise single stranded nucleic acid sequences.
  • the capture probes are preferably immobilised onto a support, either before or after hybridisation, such that sequences that do not hybridise to said capture probes can be removed for example, by washing.
  • the target sequences can be removed from the probe-target complex prior t ⁇ sequencing for example by elution. Removal by denaturation of the selected targets from the immobilised capture probes will generally give a solution of single stranded targets.
  • adaptors may be ligated to the enriched target sequences after removal of said target sequences from the probe target complexes.
  • the target sequences may also be further fragmented after elution from the support used for enrichment. For example, it may be advantageous to initially fragment the target sample to an average size of 10 kB, and thereby require fewer probe sequences to select out a specific megabase region. A 10 kB region can be selected, but not easily amplified, and 5 therefore further fragmentation, to an average of a few hundred bases may be used after the enrichment step. If a second fragmentation step is used, then the universal adaptors will need to be ligated onto the enriched target sequences after the removal from the support and after the 10 further fragmentation step.
  • the solid support may be any of the conventional supports used in arrays or ⁇ DNA chips', beads, including magnetic beads or polystyrene latex microspheres, arrays of 15 beads, or substrates such as membranes, slides and wafers made from cellulose, nitrocellulose, glass, plastics, silicon and the like.
  • the solid support is a flat planar surface 20 or an array of beads. Still more preferably said solid support is an array and most preferably said array is a ⁇ high density array' such as a micro-array.
  • Arrays are collections of biomolecular probes such as 25 nucleic acids which are immobilised onto a solid support; as non-limiting examples, the biomolecular probes could be oligonucleotides of varying length (preferably 25 to ⁇ Omers) , PCR products representing a cDNA clone library or BAC clones such as those used in comparative genome 3.0 hybridisation.
  • Multi-polynucleotide arrays or clustered arrays are ⁇ high density arrays' of nucleic acid molecules which may be produced using techniques .generally known in the art.
  • WO98/44151 and WO00/18957 both describe methods of nucleic acid amplification which allow amplification products to be immobilised on a solid support in order to form arrays comprised of clusters or ⁇ colonies' of immobilised nucleic acid molecules .
  • An array of amplified molecules from a previously enriched, or otherwise obtained target may be used to select the same target regions from a new sample.
  • the enriched DNA can be sequenced directly on the array, or removed from the array for subsequent sequencing by any desired sequencing process .
  • said array contains greater than 100 probes . More preferably said array contains greater than 1000 probes, still more preferably said array contains greater than 10,000 probes. Still yet more preferably said array contains greater than 100,000 probes.
  • Immobilisation of the probes may be by specific covalent or non-covalent interactions. If the molecule is a polynucleotide, immobilisation will preferably be at either the 5' or 3' position so that the polynucleotide is attached to the solid support at one end only. However, the polynucleotide may be attached to the solid support at any position along its length, the attachment acting to tether the polynucleotide to the solid support. The immobilised polynucleotide is then able to undergo interactions with other molecules or cognates at positions distant from the solid support. Typically the interaction will be such that it is possible to remove any molecules bound to the solid support through non-specific interactions, e.g. by washing.
  • the target sequences remain bound to the .probe and can be sequenced directly on the array using, for example, sequencing by synthesis (SBS) .
  • SBS sequencing by synthesis
  • Single molecule arrays and their use in sequencing is described in WO0006770.
  • the target sequences are removed from the array and may be optionally amplified in solution prior to immobilisation.
  • the target sequences, and their complementary copies can be immobilised on a solid support.
  • the immobilised arrays can be further amplified to produce
  • Any suitable method for of sequencing may be used to determine a sequence read of the immobilised enriched
  • Suitable methods of sequencing include the use of sequencing by addition of nucleotide bases, for example sequencing by synthesis (SBS) using nucleoside triphosphates (as described in WO04018-497) and DNA polymerases, or using oligonucleotide cassettes and
  • the enriched targets may also be sequenced by pyrosequencing (Nature. 437:376-380 (2005)), or by MPSS where the strands are degraded rather than extended (Nat Biotechnol. 6:630-6344 (2000)).
  • a new polynucleotide strand based-paired to a template strand is built up in the 5' to 3 ' direction by successive incorporation of individual nucleotides complementary to the template strand.
  • the substrate nucleoside triphosphates used in the sequencing reaction are each labelled on the base with different labels permitting determination of the identity of the incorporated nucleotide as successive, nucleotides are added.
  • the labelled nucleoside triphosphates also have a 3' blocking group which prevents further incorporation of complementary bases by the polymerase. The label of the incorporated base can then be determined and the blocking group removed to allow further polymerisation to occur.
  • nucleic acid sequencing based on successive cycles of incorporation of fluorescently labelled nucleic acid analogues .
  • identity of the added base is determined after each nucleotide addition by detecting the fluorescent label.
  • US 5,302,509 describes a method for sequencing a ⁇ polynucleotide template which involves performing multiple extension reactions using a DNA polymerase to successively incorporate labelled polynucleotides complementary to a template strand.
  • the present inventors have developed methods of sequencing multiple nucleic acid molecules in parallel based on the use of arrays, wherein multiple template molecules immobilised on the array are sequenced in parallel.
  • arrays may be single molecule arrays or clustered arrays.
  • the nucleotide (s) incorporated into the strand of nucleic acid complementary to the template nucleic are each fluorescently labelled. The inclusion of a fluorescent label facilitates detection/identification of the base present in the incorporated nucleotide (s) .
  • Appropriate fluorophores are well known in the art. . .
  • the labels may be the same for each type of nucleotide, or each nucleotide type may carry a different label. This facilitates the identification of incorporation of a particular nucleotide. Thus, for example modified adenine, guanine, cytosine and thymine would all have attached a different fluorophore to allow them to be • discriminated from one another readily.
  • Detectable labels such as fluorophores can be linked to nucleotides via the base using a suitable linker.
  • the linker may be acid labile, photolabile or contain a disulfide linkage.
  • Preferred labels and linkages include those disclosed in W003/048387.
  • linkages in particular phosphine-cleavable azide-containing linkers, may be employed in the invention as described in greater detail in W02004/018493.
  • the contents of WO 03/048387 and WO 2004/018493 are incorporated herein in their entirety by reference. ⁇
  • the nucleotides, described in W02004/018493 comprise a purine or pyrimidine base and a ribose or deoxyribose sugar moiety which has a removable blocking group covalently attached thereto, preferably at the 3'0 position.
  • 3' blocking groups are also described in W02004/018497 , the contents of which are also incorporated herein in its entirety by reference. Use of such 3 ' -blocked nucleotides permits controlled incorporation of nucleotides in a stepwise manner, since the presence of a blocking group at the 3'-0H position prevents incorporation of additional nucleotides.
  • the detectable label may, if desirable, be incorporated into the blocking groups as is disclosed in W02004/018497.
  • the substrate nucleoside triphosphates used in the sequencing reaction are each labelled on the base with the same label and/or wherein the labelled nucleoside triphosphates do not have a 3' blocking group to prevent further incorporation of complementary bases by the polymerase
  • the nucleotides can be supplied individually and serially and incorporation of a base can then be determined before applying the next nucleotide.
  • Methods for detecting fluorescently labeled nucleotides generally require use of incident light (e . g. laser light) of a wavelength specific for the fluorescent label, or the use of other suitable sources of ⁇ , illumination, to excite the fluorophore.
  • Fluorescent light emitted from the fluorophore may then-foe detected at the appropriate wavelength using a suitable detection system such as for example a Charge-Coupled-Device (CCD) camera, which can optionally be coupled to a magnifying device, a fluorescent imager or a confocal microscope.
  • CCD Charge-Coupled-Device
  • detection of an incorporated base may be carried out by using a confocal scanning microscope to scan the surface of the array with a laser, to image fluorescent labels attached to the incorporated nucleotide (s) .
  • a sensitive 2-D detector such as a charge-coupled detector (CCD)
  • CCD charge-coupled detector
  • SNOM scanning near-field optical microscopy
  • SNOM scanning near-field optical microscopy
  • TRFM surface-specific total internal reflection fluorescence microscopy
  • Detection buffers containing antioxidants show a clear improvement (over corresponding buffers absent such antioxidants) at preventing light-induced chemical artefacts in cycles of sequencing-by-synthesis based on detection of fluorescently labeled nucleotide analogues, as described in WO06064199.
  • antioxidants prevents/reduces light-induced chemicai reactions from damaging the integrity of the nucleic acid template and allows accurate determination of the identity of the incorporated base over at least 2, preferably at least 10 and more preferably at least 16 cycles of nucleotide incorporation .
  • nucleotides Preferably from 10 to 50 and more preferably from 16 to 30 nucleotides are successively incorporated, and identified, in the sequencing reaction.
  • the ability to accurately sequence 10 or more, and preferably 16 or more, consecutive nucleotides in a sequencing reaction is a significant advantage in applications such as genome realignment.
  • sequence reaction the terms "sequencing reaction", “sequencing .
  • methodology or “method of sequencing” generally refer to any polynucleotide "sequencing-by-synthesis” reaction which involves sequential addition of one or more nucleotides or oligonucleotides to a growing polynucleotide chain in the 5' to 3' direction using a polymerase or ligase in order to form an extended polynucleotide chain complementary to the template nucleic acid to be sequenced.
  • the identity of the base present in one or more of the added (oligo) nucleotide (s) is determined in a detection or "imaging” step.
  • the identity of the added base is preferably determined after each nucleotide incorporation step.
  • the sequence of the template may then be inferred using conventional Watson-Crick base-pairing rules.
  • the nucleic acid template to be sequenced in a sequencing reaction may be any polynucleotide that it is desired to sequence.
  • the nucleic acid"template for a sequencing reaction will typically comprise a double stranded region having a free 3' hydroxyl group which serves as a primer or initiation point for ' the addition of further nucleotides in the sequencing reaction.
  • the region of the template to be sequenced will overhang this free 3 ' hydroxyl group on the complementary strand.
  • the primer bearing the free 3' hydroxyl group may be added as a separate component (e .g. a short oligonucleotide) which hybridises to a region of the template to be sequenced.
  • the primer and the template strand to be sequenced may each form part of a partially self- complementary nucleic acid strand capable of forming an intramolecular duplex, such as for example a hairpin loop structure.
  • Nucleotides are added successively to the free 3' hydroxyl group, resulting in synthesis of a polynucleotide chain in the 5' to 3 1 direction. After each nucleotide addition the nature of the base which has been added may be determined, thus providing sequence information for the nucleic acid template.
  • incorporation of a nucleotide into a nucleic acid strand (or polynucleotide) refers to joining of the nucleotide to the free 3 ' hydroxyl group of the nucleic acid strand via formation of a phosphodiester linkage with the 5' phosphate group of the nucleotide.
  • the nucleic acid template to be sequenced may be DNA or RNA, or even a hybrid molecule comprised of deoxynucleotides and ribonucleotides.
  • the nucleic acid may comprise naturally occurring and/or non-naturally occurring nucleotides and natural or non-natural backbone linkages.
  • Nucleic acid templates to be sequ ⁇ nced may be attached to a solid support via any suitable linkage method known in the art. Preferably linkage will be via covalent attachment. If the templates are "arrayed" on a solid support then the array may take any convenient form. Thus, the method of the invention is applicable to all types of "high density” arrays, including single-molecule arrays and clustered arrays.
  • the enrichment method of the invention may be carried out using essentially any type of array formed by immobilisation of nucleic acid molecules on a solid support, and more particularly any type of high-density array, including bead arrays.
  • the .sequencing aspect of the invention may be carried out using essentially any type of array formed by immobilisation of nucleic acid molecules on a solid support, and more particularly any type of high- density array, including single molecule, amplified single molecule (cluster) arrays, arrays of beads on which molecules have been amplified (for example in an emulsion PCR reaction) , or arrays of beads on which amplified molecules have been hybridised.
  • arrays formed by immobilisation of nucleic acid molecules on a solid support and more particularly any type of high- density array, including single molecule, amplified single molecule (cluster) arrays, arrays of beads on which molecules have been amplified (for example in an emulsion PCR reaction) , or arrays of beads on which amplified molecules have been hybridised.
  • Multi-polynucleotide or clustered arrays distinct regions on the array comprise multiple copies of single polynucleotide template molecules .
  • Multi-polynucleotide or clustered arrays of nucleic acid molecules may be produced using techniques generally known in the art .
  • WO98/44151 and WO00/18957 both describe methods of nucleic acid amplification which allow amplification products to be immobilised on a solid support in order to form arrays comprised of clusters or .”-colonies" of immobilised nucleic acid molecules.
  • the arrays are amplified such that both strands of a duplex are immobilised, but cleavage of one of the strands from the surface (for example using a chemical and/or a subsequent heat treatment to cleave and denature one of the amplification primers used to generate the copies of the immobilised single molecules) , results in an array of single stranded templates suitable for sequencing.
  • the nucleic acid molecules present on the clustered arrays prepared according to these methods are suitable templates for sequencing using the method of the invention.
  • Both WO98/44152 and WOOO/18957 describe methods of parallel sequencing of multiple templates located at distinct locations on a solid support, and in particular sequencing of "clustered" arrays.
  • the single stranded arrays described above can be hybridised with a suitable sequencing primer, complementary to -a ' region common to each of the amplified templates, to provide a free 3'-hydroxyl group suitable for sequencing against the unknown, variable region of the amplified templates.
  • Single molecule arrays are generally formed by immobilisation of a single polynucleotide molecule at each discrete site that is detectable on the array.
  • Single-molecule arrays comprised of nucleic acid molecules that are individually resolvable by optical means and the use of such arrays in sequencing are described, for example, in WO00/06770.
  • Single molecule arrays comprised of individually resolvable nucleic acid molecules including a hairpin loop structure are described in WO 01/57248.
  • the method of the invention is suitable for sequencing template molecules on single molecule arrays prepared according to the disclosures of WO 00/06770 or WO 01/57248.
  • the fluorescent moiety may be attached to a nucleic acid via any suitable covalent or non-covalent linkage.
  • the fluorescent moiety may be attached to an oligonucleotide primer or probe which is hybridised to a target nucleic acid molecule.
  • enrichment of a first population of nucleic acid sequences and subsequent sequencing of target sequences takes place on a single surface i.e. a single array or ⁇ chip' . More preferably the sequencing is by sequencing by synthesis.
  • target sequences are sequenced in parallel at the same time. More preferably greater than 100 target sequences are sequenced at a time. More preferably greater than 1000 target sequences are sequenced at one time, still more preferably greater than 10,000 target sequences are sequenced at one time. Still yet more preferably greater than 100,000 target sequences are sequenced at one time.
  • probes can be designed that hybridise to the 5' end of one exon from each of the four following genes present in the human BAC BCX98J21: PPPlRlO, ABCFl, PRR3, GNLl.
  • PPPlRlO a probe that hybridise to the 5' end of one exon from each of the four following genes present in the human BAC BCX98J21.
  • Each probe is 60 bases in length, contains a 5' biotin group and hybridises uniquely at its intended sequence in the BAC.
  • the sequences of the probes are as follows: Probe #1 ( PPPlRlO )
  • Probe #2 ( GNLl ) CTCCCGTTTGTCCTGCAACTGCTTCTTCTTCTGCTTCACGCTGAATGGCTTCTTCCTCG G
  • a solution is prepared containing a mixture of all four probes at a concentration of lmicromolar each in 5xSSC buffer and is added to a tube containing 1 microgram of BAC DNA that has been previously fragmented to less than 1000 base pairs using a nebulizer (Invitrogen® #K7025-05) in a total volume of 50 ul .
  • the solution rs heated to 97.5°C for 5 minutes, then cooled to room temperature to anneal the probes to their target sequences in the BAC fragments.
  • DNA-NaOH solution can be exchanged for 5xSSC buffer by using a MicroSpin® S300 HR column (AmershamPharmacia® #27-5130-01) .
  • a set (500,000) of probes can be designed that hybridise to unique positions among the 10 regions of the human genome selected by the HapMap ENCODE resequencing and genotyping project.
  • Each probe approximately 60 bases in length and contains a 5' phosphorothioate group.
  • a solution is prepared of a mixture of- all probes at a total concentration of 10 micromolar in 100 mM potassium phosphate buffer pH7.
  • the probe set is grafted onto the surface of an array chip by flowing the solution of probes over the functionalised array surface at 15 ul/min at 51 0 C.
  • the chip is then washed by pumping consecutively across the surface of the array: 100 mM potassium phosphate buffer pH7, TE buffer (10 mM Tris pH8, 10 mM EDTA) and 5xSSC.
  • lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) .
  • the DNA is diluted to 10 nM in 5xSSC and then pumped onto the surface of the array.
  • the array is heated to 97.5°C for 5 minutes, then cooled to room temperature to anneal the fragmented total human DNA to the probe sequences on the surface of the array.
  • Non-hybridised DNA is then removed by washing the surface of the array consecutively with the following solutions: 5xSSC, 0.3x SSC, and 5xSSC.
  • the DNA that has hybridised to the surface probes can be recovered by pumping TE (10 mM Tris pH8, 1 mM EDTA) onto the array and heating the array to 97.5°C for 5 minutes. Immediately thereafter, the. contents of the array are pumped into a. collecting tube at 97.5 0 C and cooled to 4 0 C.
  • lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) .
  • the DNA is diluted to 1 nM in 5xSSC and then pumped onto the surface of an Affymetrixl® Genechip® Exon Array spotted microarray.
  • the array is heated to 97.5 0 C for 5 minutes, then cooled to 45 0 C.
  • the array is further incubated at 45°C for 16 hours to anneal the fragmented total human DNA to the primer oligonucleotides on -the surface of the array.
  • Non-hybridised DNA is then removed by washing the surface of the array with 3 cycles of the following consecutive wash -solutions: 6x SSPE/0.01% Tween-20, 100 mM MES/0.01% Tween-20.
  • the DNA that has hybridised to the surface probes can be recovered by pumping TE (10 mM Tris pH8, 1 mM EDTA) onto the array and heating the array to 97.5°C for 5 minutes. Immediately thereafter, the contents of the array are pumped into a collecting tube at 97.5 0 C and cooled to 4 0 C.
  • lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) .
  • the DNA is diluted to 1 nM in 5xSSC and then pumped onto the surface of an Affymetrixl® Genechip® Exon Array spotted microarray.
  • the array is heated to 97.5 0 C for 5 minutes, then cooled to 45°C.
  • the array is further incubated at 45 0 C for 16 hours to anneal the fragmented total human DNA to ⁇ the primer oligonucleotides on the surface of the array.
  • Non-hybridised DNA is then removed by washing the surface of the array with 3 cycles of the following consecutive wash solutions: ⁇ x SSPE/0.01% Tween-20, 100 mM MES/0.01% Tween-20.
  • the chip is then subject to multiple cycles of SBS sequencing.
  • the DNA source used is purified Human cell line DNA supplied by the Coriell Cell Repositories, Camden, NJ 08103 USA, catalog no. NA07055.
  • the DNA is first prepared for the ligation reaction to a single adaptor by: fragmentation of the DNA by nebulisation, then polishing of the DNA ends to make them blunt-ended and phosphorylated.
  • the ligation reaction is performed with the prepared fragmented DNA and an adaptor preformed by annealing ⁇ 01igo A' and ⁇ 01igo B'
  • the product of the ligation reaction is subject to cycles of PCR with a single primer ⁇ 01igo C (sequence given below) to selectively amplify ligated product that contains adaptor at both ends of the fragments.
  • the product of the PCR reaction is purified from unligated adaptor and primer ⁇ 01igo C by gel electrophoresis. These products are next denatured, then renatured in the presence of a set of probes .
  • the set (500,000) of probes can be designed such that they hybridise to unique positions among the 10 regions of the human genome selected by the HapMap ENCODE resequencing and genotyping project.
  • Each probe is approximately 80 bases in length and contains a common (universal) sequence ''Sequence D' at the 5' end as well as a terminal 5' phosphorothioate group.
  • a polymerisation reaction is performed with klenow polymerase and dNTPs to extend the hybridised probes to the 5' end of the DNA fragments forming a duplex.
  • the duplexes are next coupled to the surface of a DNA chip in conjunction with two amplification primers whose sequences are identical to the 5' end of ⁇ 0ligo A' and ⁇ Sequence D' .
  • the DNA coupled to the chip is denatured and washed to remove hybridised DNA.
  • the chip can then be subjected to cluster amplification and sequencing by SBS.
  • Buffer glycerol 53.1 ml, water 42.1 ml, 1 M TrisHCl pH7.5 3.7 ml, 0.5 M EDTA 1.1 ml
  • Nebulizer Invitrogen® (#K7025-05) • Qiagen® columns PCR purification kit (#28104)
  • Oligo 5 ' AAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATC
  • Oligo B 5' GATCGGAAGAGCGTCGTGTAG 5OmM Tris/50mM NaCl pH7 • PCR machine
  • the adapter strands are annealed in a PCR machine programmed as follows: Ramp at 0.5°C/sec to 97.5 0 C Hold at 97.5°C for 150 sec Then a step of 97.5 0 C for 2 sec with a temperature drop of 0.1°C/cycle for 775 cycles
  • Oligo C AATGATACGGCGACCACCGA
  • the purified ligated DNA is diluted 25 fold, then a PCR reaction mix prepared as follows :
  • Thermocycling is carried out in a PCR machine under the following conditions :
  • PCR products are purified from enzymes, buffer, etc on a Qiagen® MinElute® column, eluting in lO ⁇ l EB. 30
  • Loading buffer 50 inM Tris pH8, 40 mM EDTA, 40% w/v sucrose
  • the entire sample from the purified PCR amplification reaction is loaded into one lane of a 2% agarose gel containing ethidium bromide and run at 120V for 50 min.
  • the gel is then viewed on a ⁇ White-light®' box and fragments from above 300bp to at least 750bp excised and purified with a Qiagen® Gel purification kit, eluting in 30 ⁇ l EB.
  • a Qiagen® Gel purification kit eluting in 30 ⁇ l EB.
  • two MinElute® columns are used, eluting each in 15 ⁇ l EB and pool.
  • the probes all consist of the following format: 5'PS- Sequence D-Probe sequence where ⁇ PS' represents a 5' phosphorothioate and 'Sequence
  • the gel-purified DNA is denatured by adding NaOH at a final concentration of 100 mM and incubating at room temperature for 5 minutes. This solution is neutralised by adding 100 microlitres of pre-warmed hybridisation solution ( ⁇ xSSPE, 0.1% Tween 20) containing the probe set at a final concentration of 10 micromolar, and incubated at 37°C for 1 hour.
  • ⁇ xSSPE pre-warmed hybridisation solution
  • Tween 20 pre-warmed hybridisation solution
  • the DNA is then purified on a Qiagen® MinElute® column, with a final elution in 10 microlitres of EB.
  • Probe extension Materials ImM dNTPs mix 1Ox buffer (10OmM Tris-HCl, pH 7.9, 10OmM MgC12, 10 rtiM DTT, 50OmM NaCl) Klenow fragment (3'->5' exo-) NEB #M0212S
  • the coupling of DNA to the surface of a chip and sequencing of the template molecules on arrays may be carried out according to the disclosures of WO 00/06770, WO 01/57248 or WOO ⁇ /064199 or PCT/GB2006/002687 the contents of which are herein incorporated by reference.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method of enriching for specific target sequences using libraries of oligonucleotides, such as microarrays. In particular, the invention relates to a method of enriching for specific nucleic acid target sequences in a population of nucleic acid sequences in order to provide targets for sequencing.

Description

Method of Target Enrichment
Field of the invention
The present invention relates to a method of.-reducing the complexity of a nucleic acid sample in a reproducible manner by enriching for specific nucleic acid target sequences in the population. Specifically it relates to a method to enrich for specific target sequences using libraries of oligonucleotides such as micro-arrays, for example, for use in sequencing and particularly sequencing by synthesis .
Background to the invention
The draft sequence of the human genome was published in 2001 by the Human Genome Consortium (Nature VoI 409; issue 6822) and Celera genomics (Science, VoI 291, Issue 5507, 1304-1351), thus marking the beginning of the genetics chapter for society. Capitalizing on this investment and realizing the potential of the Human Genome Project requires a better understanding of genetic variation and its effect in disease. —
It has been estimated that any two copies of the human genome differ from one another by as little as 0.1%, in other words a total of three million variants, or one variant every 1000 bases, over a total of three billion that make up the human genome. The consensus sequence of the human genome was based on information from just 12 genomes (six individuals; each person has two genomes, one from each parent) , yet today there are six billion individuals worldwide (Bennet, S., Current Drug Discovery, February 2004, pl5-19) .
Since such variation affects disease susceptibility and responses to drugs it is essential to identify the genetic factors which contribute to biological variation. DNA sequencing is a fundamental tool enabling the screening of genes for such genetic mutations associated with disease. High throughput, high accuracy sequencing methods are therefore required to screen the complete genome sequence of an animal in order to identify unique nucleic acid sequences which may indicate the presence of physiological or pathological conditions .
DNA sequencing of large and complex genomes is currently limited by cost. With a significant proportion of human genomic DNA comprising repetitive sequence, reducing the complexity of the sample reduces the amount of sequencing required. Furthermore, with prior genetic information, it is possible to correlate a phenotype, such as a predisposition to a disease, with the genetic variation of one or more regions of the genome, and what is desired is the application and advantages of high throughput sequencing methods specifically to these regions of interest among many individuals. Such studies are currently not feasible due to cost. , In addition, in certain circumstances, it is desirable to generate a λgenome-wide' analysis of a particular genomic feature, such as exons, to correlate genetic diversity in the protein-coding regions across many individuals. Consequently development of strategies that focus on targeted sequencing of gene rich regions provide an alternative approach to whole genome sequencing.
Weisburg et al, US6, 534,273, describe a method for capturing a target polynucleotide present in a sample onto a solid support with an attached immobilised probe by using a capture probe and two different hybridisation conditions that control the order of hybridisation, where the first hybridisation condition allows hybridisation of the capture probe to the target polynucleotide, and the second hybridisation condition allows hybridisation of the capture probe to the immobilised probe. The method further includes amplifying the captured target polynucleotide by hybridising at least one primer oligonucleotide to the target polynucleotide and using nucleic acid amplification that initiates from the primer oligonucleotide. The method utilises two separate probes for use in diagnostic assays, for example in testing for the presence of bacteria in a biological sample.
Collins et al, US5,750,338, describe a method of assay for target polynucleotides which inclu-des the steps of isolating target polynucleotides from extraneous non-target polynucleotides, debris, and impurities and amplifying the target polynucleotide. The method provides for detection of nucleic acid targets in clinical samples.
Urdea, US5,200,314, describes an analyte polynucleotide strand having an analyte sequence which is detected within a sample containing polynucleotides by contacting the analyte polynucleotide with a capture probe under hybridization conditions, where the capture probe has a first binding partner specific for a solid-phase second binding partner.
5 The resulting duplex is then immobilized by specific binding between the binding partners/ and non-bound polynucleotides are separated from the bound species. The analyte polynucleotide is optionally displaced from the solid phase, then amplified by PCR. The PCR primers each 0 have a polynucleotide region capable of hybridizing to a region of the analyte polynucleotide, and at least one of the primers further has an additional binding partner capable of binding a solid-phase binding partner. The amplified product is then separated from the reaction 5 mixture by specific binding between the binding partners, and the amplified product is detected.
Nisson et al, USβ,268,133, discloses the use of amino acid denaturants for denaturing or separating double 0 stranded nucleic acid molecules and more specifically, provides a method for the rapid isolation and recovery of a desired target DNA or RNA molecules from a mixture or library containing such molecules. Th-e method involves the use of haptenylated probes and amino acid denaturants to 5 select the desired molecules and eliminate the undesired library members from a sample. Their invention also provides a method in which larger or full-length nucleic acid molecules can be isolated from the subpopulation of desired molecules. ,0
WO01/46470 in the name of Karolinska Innovations relates to a method for enrichment of specific nucleic acid segments, such as a DNA, e.g. single nucleotide polymorphisms (SNPs) , sequences that have been deleted, sequences that are identical between two complex genomes, etc. The disclosed method includes steps for providing a first sample A and a second sample B derived from different sources and digestion of both said samples; amplification of sample A with a suitable primer and dNTPs comprising one unconventional base and amplification of sample B with a labelled primer and all the conventional dNTPs, followed by combination of samples A and B; denaturation and hybridization; treatment with a nuclease specific for said unconventional base, such as uracil-DNA glycosylase (UDG) , and isolation of the specific segment originally present in sample B by use of the primer label. Their invention further relates to a kit which comprises components suitable for working the above described method.
WO02/06528 in the name of Somalogic, Inc. relate to a method and apparatus for the automated generation of nucleic acid ligands. The disclosure includes a method and device for performing automated SELEX. The steps of the SELEX process are performed at one or more work stations on a work surface by a robotic manipulator controlled by a computer. The document also includes methods and reagents to obviate the need for size-fractionation of amplified candidate nucleic acids before beginning the next round of the SELEX process. SELEX or Systematic Evolution of Ligands by Exponential enrichment, is a procedure in which an initial pool of randomized polynucleotides (RNA or DNA, single stranded) is created, containing- on the order of ■ 10A15 molecules of a fixed length. The pool is then screened for some desired characteristic for example, binding affinity for ATP. The molecules that are selected in this way are used as "parents" in the synthesis (with mutation) of a new pool of molecules, and the process repeats with more rounds of selection and amplification. The result of SELEX is a set of highly functional molecules of DNA or RNA that perform their selected function.
US6,013,440, Lipshutz et al, relates generally to matrices for conducting nucleic acid affinity chromatography. Specifically the invention relates to methods of preparing affinity chromatography matrices that bind a plurality of different pre-selected nucleic acids.
Su et al, US6,632,611, disclose methods and kits for amplifying a target sequence from within a nucleic acid population. The invention provides selection probes which are complementary to at least a portion of said target sequence and mechanisms for adding a probe sequence to the 3' end of a target sequence that is hybridized to a selection probe.
The added 3 ' probe sequence and a probe sequence added at the 5 ' end of the target by adaptor ligation allow for selective amplification of the target -sequence .
Morgan et al (1992) disclose methods to direct cDNA selection allowing rapid and reproducible isolation of low abundance cDNA' s encoded by large genomic clones.
Gill et al- (2002) disclose a DNA microarray method for genome-wide monitoring of competitively grown transformants to identify genes whose overexpression confers a specific cellular phenotype. These documents disclose methods of enriching a nucleic acid sample, usually by amplification, for the detection of specific target sequences. None of them provide a rapid, cost-effective method for reducing the complexity of a nucleic acid sample suitable for sequencing and particularly sequencing by synthesis. Furthermore, no methods have been described that utilise sample enrichment with high throughput sequencing methodology, such as, for example, reversible terminator chemistry described herein.
Summary of the invention
In a first aspect of the invention there is provided a method of enriching a complex nucleic acid sample for a population of target sequences for use in subsequent sequencing wherein each of said target sequences relates to a set of capture probes .
Said method comprises:
(a) fragmenting a first population of nucleic acid sequences;
(b) combining said first population of nucleic acid sequences with a set -of probe sequences under conditions allowing for hybridisation of the probe sequences and said first population of nucleic acid sequences to form probe-target complexes; and (c) purifying the probe-target complexes to discard the un-hybridised nucleic acid target sequences; (d) sequencing the remaining probe selected population of target sequences.
In one embodiment of the invention, the method further comprises a ligation step wherein adaptors are ligated to the fragmented first population of nucleic acid sequences, either prior to or subsequent to the enrichment step.
In a further embodiment of the invention the method further comprises an amplification step whereby the fragmented first population of nucleic acid sequences are amplified using, for example, PCR. Preferably said amplification step is performed following ligation of , adaptors to the fragmented first population of nucleic acid sequences. Yet more preferably said amplification step is performed on the first population of nucleic acid sequences as a whole and in contrast to the methods of the prior art is not intended to amplify only a subset of said first population .
In another embodiment of the invention the target sequences can be removed from the probe-target complex prior to sequencing, for example by elution. Removal by denaturation of the selected targets from the immobilised capture probes will generally give a solution of single stranded targets.
In another embodiment of the invention the method further comprises the step of ligating adaptors to the enriched target sequences after separation of said target sequences from the probe target complexes. In another embodiment of the invention the target sequences remain bound to the probe (s) and are sequenced directly on the array using, for example, sequencing by synthesis (SBS) .
In yet another embodiment of the invention the target sequences are removed from the array and are further amplified and/or immobilised to produce clustered arrays, or sequenced directly as single molecules .
In still yet another embodiment of the invention, enrichment of a first population of nucleic acid sequences and subsequent sequencing of target sequences takes place on a single surface i.e. a single array or λchip' .
Brief description of the drawings
Figure Ia illustrates a simplified and schematised embodiment of the use of a microarray to enrich a fragmented complex nucleic acid sample for a population of target sequences .
Figure Ib illustrates a simplified and- schematised embodiment of the use of a microarray to enrich a fragmented complex nucleic acid sample for a population of target sequences wherein adaptors are ligated to the fragmented genomic DNA prior to enrichment.
Figures 2a and 2b illustrate a simplified and schematised embodiment of the use of a microarray for λone-chip' enrichment and sequencing. Genomic DNA is fragmented, adaptors are ligated to the ends of the fragments which are then amplified. The capture probes hybridise to the target sequences which are then extended to produce a complimentary sequence bound to the capture probe. The capture probe can then be bound to the surface of an array, target sequence is removed and the complimentary sequence is sequenced.
Detailed description of the invention
It is an object of the present invention to provide a method for enrichment of a complex nucleic acid sample with capture probes, relating for example to genetic features of interest. More specifically the invention relates to the use of a predetermined panel of oligonucleotides, such as an array, designed to enrich said complex nucleic acid sample for use in sequencing and more particularly sequencing by synthesis.
Micro-arrays have been used primarily for gene expression analyses, although the strategy of using an ordered array of bio-molecules on such an array has also been extended to mutation- detection, polymorphism analysis, mapping and evolutionary studies.
To date however there has been no disclosure on the use of such arrays to enrich a complex nucleic acid sample with specific nucleic acid sequences relating to genetic features of interest 'for use in sequencing by synthesis.
The use of capture probes allows the researcher to positively select for regions of the genome which are of interest whilst concomitantly negatively selecting for the remainder of the genome. Such an approach has the advantage, for example, that highly repetitive DNA sequences which comprise 40% of genomic DNA can be removed quickly and efficiently from a complex population. As a direct result the complexity of sequence is reduced thus increasing throughput of subsequent sequencing. However, further enrichment for a target region or feature, such as exons, would further reduce the complexity of the sample. Usually, and in contrast to expression analysis studies for example, the nucleic acid sample applied to the array will not first be fluorescently labelled.
Since the method may be performed using micro-arrays there is the added benefit that the volume of input sample required is significantly reduced over methods of the prior art. The ability to use smaller quantities of input sample is a significant advantage over techniques in the prior art which often require complex strategies to increase the amount of nucleic acid by amplification. A further advantage is that the cost of carrying out both the enrichment and subsequent sequencing is also significantly reduced since less sequence data needs to be generated to produce meaningful results .
The term ^enrichment' refers to the process of increasing the' relative abundance of particular nucleic acid sequences in a sample relative to the level of nucleic acid sequences as a whole initially present in said sample before treatment. Thus the enrichment step provides a percentage or fractional increase rather than directly increasing for example, the copy number of the nucleic acid sequences of interest as amplification methods, such as PCR, would. The methods as described herein may be used to remove DNA strands that it is not desired to sequence, rather than to specifically amplify only the sequences of interest. At the level of the whole genome, removing 50% of the DNA sample gives a two fold reduction in the cost and time of sequencing the remaining regions of biological interest from the whole genome. The methods as described herein can also be used to select large regions of a genome (eg megabases) for resequencing of multiple individuals, or can select out all the exons in a genomic sample. The synthesis of one array, or pool of oligonucleotides, can be used to process multiple samples of interest, and thus the costs of the oligonucleotide synthesis can be amortised over many individual samples.
The complex nucleic acid sample or input sample is an initial sample of nucleotide sequences prior to enrichment, such as genomic DNA. As non-limiting examples, such a sample may consist of genomic DNA, cDNA, RNA, PCR products, pools or subsets thereof.
In a first embodiment there is provided a method of enriching a complex nucleic acid sampϊe for a population of target sequences for use in subsequent sequencing wherein each of said target sequences relates to a set of capture probes .
Said method comprises:
(a) fragmenting a first population of nucleic acid sequences; (b) combining said first population of nucleic acid sequences with a set of probe sequences under conditions allowing for hybridisation of the probe sequences and said first population of nucleic acid sequences to form probe-target complexes; and
(c) purifying the probe-target complexes to discard the un-hybridised nucleic acid target sequences;
(d) sequencing the remaining probe selected population of target sequences
Preferably said fragmented nucleic acid population comprises sequence fragments which are less than about 1000 base pairs in length, more preferably such sequences are in the range 100-1000 base pairs in length. Still more preferably such sequences are in the range of from 450-750 base pairs in length. It would be apparent to the skilled artisan that the following non-limiting fragmentation methods may be used: restriction endonucleases, other suitable enzymes, mechanical forms of fragmentation, such as nebulisation or sonication, or non-enzymatic chemical fragmentation .
In one embodiment, adaptors may be ligated to the fragmented first population of nucleic acid sequences, either prior to or subsequent to the enrichment step.
In a further embodiment the fragmented first population of nucleic acid sequences may be subjected to an amplification step using, for example, PCR. Preferably said amplification step is performed following ligation of adaptors to the fragmented first population of nucleic acid sequences. Yet more preferably said amplification 'step is performed on the first population of nucleic acid sequences as a whole and in contrast to the methods of the prior art is not intended to amplify only a subset of said first population.
The capture probes are preferably nucleic acids, such as oligonucleotides, capable of binding to a target nucleic acid sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Such probes may include natural or modified bases and may be RNA or DNA. In addition the bases in probes may be joined by a linkage other than a phosphodiester bond so long as it does not interfere with hybridisation. Thus probes may also be peptide nucleic acids (PNA) in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages .
Capture probes are reference populations of nucleic acid sequences. These have been selected such that said probes relate to, by way of non-limiting examples, a set of genes of interest, all of the exons of a genome, particular genetic regions of interest, disease or physiological states and the like. For example it can be envisaged that such reference populations will include commercially available populations available as micro-arrays or Λchips' more commonly used in expression profiling such as the Affymetrix® Exon Gene-Chip®. The capture probes can also be synthesised as oligonucleotides in solution, and can be used either in solution or immobilised on beads. The beads could contain multiple copies of individual sequences, such that each beads contains a single, different sequence, or can just contain the whole pool of oligonucleotides immobilised on each bead such that each bead is the same mixture of sequences.
Capture probes may also be prepared from a sample of DNA from any source, for example bacterial artificial chromosomes (BACs), PCR fragment's, whole chromosomes or cDNA libraries. Use of a suitably available nucleic acid sample that can be fragmented and enriched as described means that the same region can be re-sequenced from multiple individuals without the need for chemical synthesis of specific capture probes across that region.
Any available nucleic acid can be fragmented and undergo a ligation with an adaptor sequence to establish common known ends on each fragment . Such fragment libraries can be amplified using primers complementary to the known ends and modified with groups amenable to surface attachment, such as, for example, biotin. The fragment pools, once made single stranded, are attached to a suitably functionalised surface, such as, for example, streptavidin beads. If the bead pool is exposed to a single stranded target DNA sample, then the fragments of the target DNA sample complementary to the single stranded fragments immobilised on the beads will bind, and the non- complementary sequences will remain unbound in solution and can be easily separated from the immobilised fragments.
Thus removal of sequences that were not complementary to those fragments of the capture pool enriches the remaining, immobilised target DNA. The hybridisation step may be performed either on the solid surface, such as on beads, to which the single stranded capture probes have been bound, or in solution. If the hybridisation is performed in solution, subsequent addition of beads results in binding of all the capture probes, either as duplexes with the target sample, or as single strands. The remainder of the target DNA which has not formed duplexes with one of the capture probes will not be able to bind to the beads. Unbound target sample can be removed from the beads by washing, for example, and the duplex sample can be treated to elute the hybridised target into solution.
The enriched sample may be eluted from the beads and can be attached to a surface and used for sequencing, either as arrays of single molecules, or amplified to form clustered arrays of clonal single molecules, for example as described in WO9844151. In an alternative embodiment the enriched sample may be amplified whilst still attached to the beads by, for example, emulsion phase PCR, or may be eluted from the beads and amplified in solution prior to surface attachment .
The terms Λtargef or ^target sequence' refer to nucleic acid sequences of interest that is, those which hybridise to the capture probes. Thus the term includes those larger nucleic acid sequences, a sub-sequence of which binds to the probe and/or to the overall bound sequence. Since "the target sequences are for use in sequencing methods, said target sequences do not need to have been previously defined to any extent, other than the bases complementary to the capture probes . Capture probes hybridise to target sequences in the ■complex nucleic acid sample. It will be apparent to one skilled in the art that prior to hybridisation said complex nucleic acid sample .will preferably comprise single stranded nucleic acid sequences. This can be achieved by a number of well known methods in the art such as, for example using heat to denature or separate complementary strands of double stranded nucleic acids, which on cooling can hybridise to the capture probes.; It is also conceivable that said complex nucleic acid sample could comprise double stranded polynucleotides with a single stranded overhang ( ^sticky ends' ) which may hybridise to said capture probes .
To provide enrichment, the capture probes are preferably immobilised onto a support, either before or after hybridisation, such that sequences that do not hybridise to said capture probes can be removed for example, by washing.
In one embodiment the target sequences can be removed from the probe-target complex prior tσ sequencing for example by elution. Removal by denaturation of the selected targets from the immobilised capture probes will generally give a solution of single stranded targets.
In a further embodiment adaptors may be ligated to the enriched target sequences after removal of said target sequences from the probe target complexes. The target sequences may also be further fragmented after elution from the support used for enrichment. For example, it may be advantageous to initially fragment the target sample to an average size of 10 kB, and thereby require fewer probe sequences to select out a specific megabase region. A 10 kB region can be selected, but not easily amplified, and 5 therefore further fragmentation, to an average of a few hundred bases may be used after the enrichment step. If a second fragmentation step is used, then the universal adaptors will need to be ligated onto the enriched target sequences after the removal from the support and after the 10 further fragmentation step.
The solid support may be any of the conventional supports used in arrays or ΛDNA chips', beads, including magnetic beads or polystyrene latex microspheres, arrays of 15 beads, or substrates such as membranes, slides and wafers made from cellulose, nitrocellulose, glass, plastics, silicon and the like.
Preferably the solid support is a flat planar surface 20 or an array of beads. Still more preferably said solid support is an array and most preferably said array is a Λhigh density array' such as a micro-array.
Arrays are collections of biomolecular probes such as 25 nucleic acids which are immobilised onto a solid support; as non-limiting examples, the biomolecular probes could be oligonucleotides of varying length (preferably 25 to βOmers) , PCR products representing a cDNA clone library or BAC clones such as those used in comparative genome 3.0 hybridisation. Multi-polynucleotide arrays or clustered arrays are λhigh density arrays' of nucleic acid molecules which may be produced using techniques .generally known in the art. By way of example, WO98/44151 and WO00/18957 both describe methods of nucleic acid amplification which allow amplification products to be immobilised on a solid support in order to form arrays comprised of clusters or ^colonies' of immobilised nucleic acid molecules . An array of amplified molecules from a previously enriched, or otherwise obtained target may be used to select the same target regions from a new sample. The enriched DNA can be sequenced directly on the array, or removed from the array for subsequent sequencing by any desired sequencing process .
Preferably said array contains greater than 100 probes . More preferably said array contains greater than 1000 probes, still more preferably said array contains greater than 10,000 probes. Still yet more preferably said array contains greater than 100,000 probes.
Immobilisation of the probes may be by specific covalent or non-covalent interactions. If the molecule is a polynucleotide, immobilisation will preferably be at either the 5' or 3' position so that the polynucleotide is attached to the solid support at one end only. However, the polynucleotide may be attached to the solid support at any position along its length, the attachment acting to tether the polynucleotide to the solid support. The immobilised polynucleotide is then able to undergo interactions with other molecules or cognates at positions distant from the solid support. Typically the interaction will be such that it is possible to remove any molecules bound to the solid support through non-specific interactions, e.g. by washing. In one embodiment the target sequences remain bound to the .probe and can be sequenced directly on the array using, for example, sequencing by synthesis (SBS) . The can either 5 be on a chemically synthesised array, or as a lawn of primers deposited such that a single molecule array of selected templates can be formed.. Single molecule arrays and their use in sequencing is described in WO0006770.
10, In another embodiment the target sequences are removed from the array and may be optionally amplified in solution prior to immobilisation. The target sequences, and their complementary copies can be immobilised on a solid support. The immobilised arrays can be further amplified to produce
15 clustered arrays, or sequenced directly as single molecules .
Any suitable method for of sequencing may be used to determine a sequence read of the immobilised enriched
20 targets. Suitable methods of sequencing include the use of sequencing by addition of nucleotide bases, for example sequencing by synthesis (SBS) using nucleoside triphosphates (as described in WO04018-497) and DNA polymerases, or using oligonucleotide cassettes and
25 ligases; as described in US6306597 or Science,
309:5741,1728-1732 (2005). The enriched targets may also be sequenced by pyrosequencing (Nature. 437:376-380 (2005)), or by MPSS where the strands are degraded rather than extended (Nat Biotechnol. 6:630-6344 (2000)).
3.0
In "sequencing by synthesis" or SBS a new polynucleotide strand based-paired to a template strand is built up in the 5' to 3 ' direction by successive incorporation of individual nucleotides complementary to the template strand. In one embodiment of SBS the substrate nucleoside triphosphates used in the sequencing reaction are each labelled on the base with different labels permitting determination of the identity of the incorporated nucleotide as successive, nucleotides are added. The labelled nucleoside triphosphates also have a 3' blocking group which prevents further incorporation of complementary bases by the polymerase. The label of the incorporated base can then be determined and the blocking group removed to allow further polymerisation to occur.
There are known in the art methods of nucleic acid sequencing based on successive cycles of incorporation of fluorescently labelled nucleic acid analogues . In such "sequencing by synthesis" or "cycle sequencing" methods the identity of the added base is determined after each nucleotide addition by detecting the fluorescent label. In particular, US 5,302,509 describes a method for sequencing a ■ polynucleotide template which involves performing multiple extension reactions using a DNA polymerase to successively incorporate labelled polynucleotides complementary to a template strand.
The present inventors have developed methods of sequencing multiple nucleic acid molecules in parallel based on the use of arrays, wherein multiple template molecules immobilised on the array are sequenced in parallel. Such arrays may be single molecule arrays or clustered arrays. The nucleotide (s) incorporated into the strand of nucleic acid complementary to the template nucleic are each fluorescently labelled. The inclusion of a fluorescent label facilitates detection/identification of the base present in the incorporated nucleotide (s) . Appropriate fluorophores are well known in the art. . .
The labels may be the same for each type of nucleotide, or each nucleotide type may carry a different label. This facilitates the identification of incorporation of a particular nucleotide. Thus, for example modified adenine, guanine, cytosine and thymine would all have attached a different fluorophore to allow them to be • discriminated from one another readily. When sequencing on arrays, a mixture of labelled and unlabelled nucleotides may be used. Detectable labels such as fluorophores can be linked to nucleotides via the base using a suitable linker. The linker may be acid labile, photolabile or contain a disulfide linkage. Preferred labels and linkages include those disclosed in W003/048387. Other linkages, in particular phosphine-cleavable azide-containing linkers, may be employed in the invention as described in greater detail in W02004/018493. The contents of WO 03/048387 and WO 2004/018493 are incorporated herein in their entirety by reference. ~
. The nucleotides, described in W02004/018493 comprise a purine or pyrimidine base and a ribose or deoxyribose sugar moiety which has a removable blocking group covalently attached thereto, preferably at the 3'0 position. 3' blocking groups are also described in W02004/018497 , the contents of which are also incorporated herein in its entirety by reference. Use of such 3 ' -blocked nucleotides permits controlled incorporation of nucleotides in a stepwise manner, since the presence of a blocking group at the 3'-0H position prevents incorporation of additional nucleotides. The detectable label may, if desirable, be incorporated into the blocking groups as is disclosed in W02004/018497.
In further embodiments of SBS or cycle sequencing wherein the substrate nucleoside triphosphates used in the sequencing reaction are each labelled on the base with the same label and/or wherein the labelled nucleoside triphosphates do not have a 3' blocking group to prevent further incorporation of complementary bases by the polymerase it will be apparent to the skilled person that in these cases the nucleotides can be supplied individually and serially and incorporation of a base can then be determined before applying the next nucleotide.
Methods for detecting fluorescently labeled nucleotides generally require use of incident light (e . g. laser light) of a wavelength specific for the fluorescent label, or the use of other suitable sources of ^ , illumination, to excite the fluorophore. Fluorescent light emitted from the fluorophore may then-foe detected at the appropriate wavelength using a suitable detection system such as for example a Charge-Coupled-Device (CCD) camera, which can optionally be coupled to a magnifying device, a fluorescent imager or a confocal microscope. If sequencing is carried out on an array, detection of an incorporated base may be carried out by using a confocal scanning microscope to scan the surface of the array with a laser, to image fluorescent labels attached to the incorporated nucleotide (s) . Alternatively, a sensitive 2-D detector, such as a charge-coupled detector (CCD) , can be used to visualise the signals generated. This technique is particularly useful with single molecule arrays.
Other techniques such as scanning near-field optical microscopy (SNOM) are available and may be used when imaging dense arrays. For a description of scanning near- field optical microscopy, see Moyer et al . , Laser Focus World 29:10, 1993. An additional technique that may be used is surface-specific total internal reflection fluorescence microscopy (TIRFM) ; see, for example, Vale et al . , Nature, (1996) 380:451-453.
Suitable apparatus used for imaging polynucleotide arrays are known in the art and the technical set-up will be apparent to the skilled person. Detection buffers containing antioxidants, such as sodium ascorbate, show a clear improvement (over corresponding buffers absent such antioxidants) at preventing light-induced chemical artefacts in cycles of sequencing-by-synthesis based on detection of fluorescently labeled nucleotide analogues, as described in WO06064199. The inclusion of antioxidants prevents/reduces light-induced chemicai reactions from damaging the integrity of the nucleic acid template and allows accurate determination of the identity of the incorporated base over at least 2, preferably at least 10 and more preferably at least 16 cycles of nucleotide incorporation .
Preferably from 10 to 50 and more preferably from 16 to 30 nucleotides are successively incorporated, and identified, in the sequencing reaction. The ability to accurately sequence 10 or more, and preferably 16 or more, consecutive nucleotides in a sequencing reaction is a significant advantage in applications such as genome realignment. In the context of this invention the terms "sequencing reaction", "sequencing .methodology" or "method of sequencing" generally refer to any polynucleotide "sequencing-by-synthesis" reaction which involves sequential addition of one or more nucleotides or oligonucleotides to a growing polynucleotide chain in the 5' to 3' direction using a polymerase or ligase in order to form an extended polynucleotide chain complementary to the template nucleic acid to be sequenced.
The identity of the base present in one or more of the added (oligo) nucleotide (s) is determined in a detection or "imaging" step. The identity of the added base is preferably determined after each nucleotide incorporation step. The sequence of the template may then be inferred using conventional Watson-Crick base-pairing rules.
The nucleic acid template to be sequenced in a sequencing reaction may be any polynucleotide that it is desired to sequence. The nucleic acid"template for a sequencing reaction will typically comprise a double stranded region having a free 3' hydroxyl group which serves as a primer or initiation point for' the addition of further nucleotides in the sequencing reaction. The region of the template to be sequenced will overhang this free 3 ' hydroxyl group on the complementary strand. The primer bearing the free 3' hydroxyl group may be added as a separate component (e .g. a short oligonucleotide) which hybridises to a region of the template to be sequenced. Alternatively, the primer and the template strand to be sequenced may each form part of a partially self- complementary nucleic acid strand capable of forming an intramolecular duplex, such as for example a hairpin loop structure. Nucleotides are added successively to the free 3' hydroxyl group, resulting in synthesis of a polynucleotide chain in the 5' to 31 direction. After each nucleotide addition the nature of the base which has been added may be determined, thus providing sequence information for the nucleic acid template.
The term "incorporation" of a nucleotide into a nucleic acid strand (or polynucleotide) refers to joining of the nucleotide to the free 3 ' hydroxyl group of the nucleic acid strand via formation of a phosphodiester linkage with the 5' phosphate group of the nucleotide. The nucleic acid template to be sequenced may be DNA or RNA, or even a hybrid molecule comprised of deoxynucleotides and ribonucleotides. The nucleic acid may comprise naturally occurring and/or non-naturally occurring nucleotides and natural or non-natural backbone linkages.
Nucleic acid templates to be sequ^nced may be attached to a solid support via any suitable linkage method known in the art. Preferably linkage will be via covalent attachment. If the templates are "arrayed" on a solid support then the array may take any convenient form. Thus, the method of the invention is applicable to all types of "high density" arrays, including single-molecule arrays and clustered arrays. The enrichment method of the invention may be carried out using essentially any type of array formed by immobilisation of nucleic acid molecules on a solid support, and more particularly any type of high-density array, including bead arrays. The .sequencing aspect of the invention may be carried out using essentially any type of array formed by immobilisation of nucleic acid molecules on a solid support, and more particularly any type of high- density array, including single molecule, amplified single molecule (cluster) arrays, arrays of beads on which molecules have been amplified (for example in an emulsion PCR reaction) , or arrays of beads on which amplified molecules have been hybridised.
In multi-polynucleotide or clustered arrays distinct regions on the array comprise multiple copies of single polynucleotide template molecules . Multi-polynucleotide or clustered arrays of nucleic acid molecules may be produced using techniques generally known in the art . By way of example, WO98/44151 and WO00/18957 both describe methods of nucleic acid amplification which allow amplification products to be immobilised on a solid support in order to form arrays comprised of clusters or ."-colonies" of immobilised nucleic acid molecules. The arrays are amplified such that both strands of a duplex are immobilised, but cleavage of one of the strands from the surface (for example using a chemical and/or a subsequent heat treatment to cleave and denature one of the amplification primers used to generate the copies of the immobilised single molecules) , results in an array of single stranded templates suitable for sequencing. The nucleic acid molecules present on the clustered arrays prepared according to these methods are suitable templates for sequencing using the method of the invention. Both WO98/44152 and WOOO/18957, the contents of which are incorporated herein. by reference describe methods of parallel sequencing of multiple templates located at distinct locations on a solid support, and in particular sequencing of "clustered" arrays. The single stranded arrays described above can be hybridised with a suitable sequencing primer, complementary to -a' region common to each of the amplified templates, to provide a free 3'-hydroxyl group suitable for sequencing against the unknown, variable region of the amplified templates.
Nevertheless, the method of the invention may also be used in the context of sequencing templates on single molecule arrays of nucleic acid templates . Single molecule arrays are generally formed by immobilisation of a single polynucleotide molecule at each discrete site that is detectable on the array. Single-molecule arrays comprised of nucleic acid molecules that are individually resolvable by optical means and the use of such arrays in sequencing are described, for example, in WO00/06770.
„ Single molecule arrays comprised of individually resolvable nucleic acid molecules including a hairpin loop structure are described in WO 01/57248. The method of the invention is suitable for sequencing template molecules on single molecule arrays prepared according to the disclosures of WO 00/06770 or WO 01/57248. The fluorescent moiety may be attached to a nucleic acid via any suitable covalent or non-covalent linkage. For example, the fluorescent moiety may be attached to an oligonucleotide primer or probe which is hybridised to a target nucleic acid molecule.
In a preferred embodiment, enrichment of a first population of nucleic acid sequences and subsequent sequencing of target sequences takes place on a single surface i.e. a single array or λchip' . More preferably the sequencing is by sequencing by synthesis.
Preferably a large number of target sequences are sequenced in parallel at the same time.. More preferably greater than 100 target sequences are sequenced at a time. More preferably greater than 1000 target sequences are sequenced at one time, still more preferably greater than 10,000 target sequences are sequenced at one time. Still yet more preferably greater than 100,000 target sequences are sequenced at one time.
Experimental overview
The following experimental details describe the complete exposition of one embodiment of the invention as described above .
Example 1
Four probes can be designed that hybridise to the 5' end of one exon from each of the four following genes present in the human BAC BCX98J21: PPPlRlO, ABCFl, PRR3, GNLl. Each probe is 60 bases in length, contains a 5' biotin group and hybridises uniquely at its intended sequence in the BAC. The sequences of the probes are as follows: Probe #1 ( PPPlRlO )
TCGGTTAAGGAAGCTGTCCAGGCCCTTGAGAAGTTCTTTGGGGTCTATGGGACCCGAAC C
Probe #2 (ABCFl )
GCCGTATCTGAGGAACAGCAGCCTGCACTCAAGGGCAAAAAGGGAAAGGAAGAGAAGTC
A
Probe #3 ( PRR3 )
CCGAAACGAAAGAAGCAGAATCATCACCAGCCACCGACACAGCAGCAGCCCCCGCTGCC C
Probe #2 ( GNLl ) CTCCCGTTTGTCCTGCAACTGCTTCTTCTTCTGCTTCACGCTGAATGGCTTCTTCCTCG G
A solution is prepared containing a mixture of all four probes at a concentration of lmicromolar each in 5xSSC buffer and is added to a tube containing 1 microgram of BAC DNA that has been previously fragmented to less than 1000 base pairs using a nebulizer (Invitrogen® #K7025-05) in a total volume of 50 ul . The solution rs heated to 97.5°C for 5 minutes, then cooled to room temperature to anneal the probes to their target sequences in the BAC fragments.
Wash 40 ul of streptavidin coated magnetic beads (Dynal® Biotech) twice with 100 ul of 2xB&W buffer (Dynal®), finally resuspending the beads in 50 ul of 2xB&W. Add to the solution of annealed DNA and incubate for 15 minutes at room temperature with gentle mixing on a roller mixer platform. Apply the tube of the DNA-bead mix to the magnetic holder (Dynal®) and incubate at room temperature for 2 minutes. Wash the beads three times with lxB&W buffer (Dynal®), each time discarding the supernatant, resuspending the beads in fresh 1XB&W buffer and reapplying to the magnets. Finally, add 50 ul of 100 mM NaOH to the DNA-bead mix and incubate at room temperature for 5 minutes. Reapply to the magnetic holder, then recover the supernatant after a 2 minute incubation, discarding the beads. The DNA recovered in the 100 mM NaOH solution may be neutralised by the addition of a titrated quantity of HCl. Alternatively, the DNA-NaOH solution can be exchanged for 5xSSC buffer by using a MicroSpin® S300 HR column (AmershamPharmacia® #27-5130-01) .
Example 2
A set (500,000) of probes can be designed that hybridise to unique positions among the 10 regions of the human genome selected by the HapMap ENCODE resequencing and genotyping project. Each probe approximately 60 bases in length and contains a 5' phosphorothioate group.
A solution is prepared of a mixture of- all probes at a total concentration of 10 micromolar in 100 mM potassium phosphate buffer pH7. The probe set is grafted onto the surface of an array chip by flowing the solution of probes over the functionalised array surface at 15 ul/min at 510C. The chip is then washed by pumping consecutively across the surface of the array: 100 mM potassium phosphate buffer pH7, TE buffer (10 mM Tris pH8, 10 mM EDTA) and 5xSSC. lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) . The DNA is diluted to 10 nM in 5xSSC and then pumped onto the surface of the array. The array is heated to 97.5°C for 5 minutes, then cooled to room temperature to anneal the fragmented total human DNA to the probe sequences on the surface of the array. Non-hybridised DNA is then removed by washing the surface of the array consecutively with the following solutions: 5xSSC, 0.3x SSC, and 5xSSC. The DNA that has hybridised to the surface probes can be recovered by pumping TE (10 mM Tris pH8, 1 mM EDTA) onto the array and heating the array to 97.5°C for 5 minutes. Immediately thereafter, the. contents of the array are pumped into a. collecting tube at 97.50C and cooled to 40C.
Example 3
lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) . The DNA is diluted to 1 nM in 5xSSC and then pumped onto the surface of an Affymetrixl® Genechip® Exon Array spotted microarray. The array is heated to 97.50C for 5 minutes, then cooled to 450C. The array is further incubated at 45°C for 16 hours to anneal the fragmented total human DNA to the primer oligonucleotides on -the surface of the array. Non-hybridised DNA is then removed by washing the surface of the array with 3 cycles of the following consecutive wash -solutions: 6x SSPE/0.01% Tween-20, 100 mM MES/0.01% Tween-20. The DNA that has hybridised to the surface probes can be recovered by pumping TE (10 mM Tris pH8, 1 mM EDTA) onto the array and heating the array to 97.5°C for 5 minutes. Immediately thereafter, the contents of the array are pumped into a collecting tube at 97.50C and cooled to 40C.
Example 4
lug of total human DNA can be fragmented to less than 1000 base pairs using a nebulizer (Invitrogen #K7025-05) . The DNA is diluted to 1 nM in 5xSSC and then pumped onto the surface of an Affymetrixl® Genechip® Exon Array spotted microarray. The array is heated to 97.50C for 5 minutes, then cooled to 45°C. The array is further incubated at 450C for 16 hours to anneal the fragmented total human DNA to ■ the primer oligonucleotides on the surface of the array. Non-hybridised DNA is then removed by washing the surface of the array with 3 cycles of the following consecutive wash solutions: βx SSPE/0.01% Tween-20, 100 mM MES/0.01% Tween-20. The chip is then subject to multiple cycles of SBS sequencing.
Example 5
The following experimental details describe the complete exposition of one embodiment of the invention. The DNA source used is purified Human cell line DNA supplied by the Coriell Cell Repositories, Camden, NJ 08103 USA, catalog no. NA07055. The DNA is first prepared for the ligation reaction to a single adaptor by: fragmentation of the DNA by nebulisation, then polishing of the DNA ends to make them blunt-ended and phosphorylated. The ligation reaction is performed with the prepared fragmented DNA and an adaptor preformed by annealing λ01igo A' and Λ01igo B'
(sequences given below) . Next, the product of the ligation reaction is subject to cycles of PCR with a single primer Λ01igo C (sequence given below) to selectively amplify ligated product that contains adaptor at both ends of the fragments. The product of the PCR reaction is purified from unligated adaptor and primer λ01igo C by gel electrophoresis. These products are next denatured, then renatured in the presence of a set of probes . The set (500,000) of probes can be designed such that they hybridise to unique positions among the 10 regions of the human genome selected by the HapMap ENCODE resequencing and genotyping project. Each probe is approximately 80 bases in length and contains a common (universal) sequence ''Sequence D' at the 5' end as well as a terminal 5' phosphorothioate group. After the probes have hybridised, a polymerisation reaction is performed with klenow polymerase and dNTPs to extend the hybridised probes to the 5' end of the DNA fragments forming a duplex. The duplexes are next coupled to the surface of a DNA chip in conjunction with two amplification primers whose sequences are identical to the 5' end of λ0ligo A' and ^Sequence D' . The DNA coupled to the chip is denatured and washed to remove hybridised DNA. The chip can then be subjected to cluster amplification and sequencing by SBS.
Nebulization Materials:
Human DNA (lmg/ml) Corriell NMA07055
Buffer (glycerol 53.1 ml, water 42.1 ml, 1 M TrisHCl pH7.5 3.7 ml, 0.5 M EDTA 1.1 ml)
Nebulizer Invitrogen® (#K7025-05) • Qiagen® columns PCR purification kit (#28104)
Mix: 25μl (5 micrograms) of DNA 725μl Buffer
Procedure :
Chill the DNA solution and fragment in a nebulizer on ice for 5 to 6 minutes under at least 32psi of pressure. Recover the solution by centrifugation (volume usually .somewhere between 400 and βOOμl) , split into 3 aliquots and purify with a Qiagen® PCR-purification kit, but using only one column, and finally elute in 30μl of EB (Qiagen®) .
End-repair Materials :
T4 DNA Polymerase NEB #M0203S • 1OxNEB 2 buffer NEB #M7002S
10Ox BSA NEB #M9001S dNTPs mix (1OmM each) NEB #N0447S
E. coli DNA Pol I large fragment (Klenow, NEB #M0210S)
T4 polynucleotide kinase NEB #M0201S • T4 PNK buffer NEB #M0201S
100 mM ATP • Qiagen® columns PCR purification kit (#28104)
End repair mix assembled as follows:
DNA 30μl
Water 12μl
10xNEB2 5μl
10OxBSA 0.5μl
1OmM dNTPs 2μl
T4 DNA pol (3ϋ/μl) 5μl
50μl total Incubate the reaction for 15 min at room temperature, then add Iμl of E. coli DNA Pol I large fragment (Klenow) and incubate the reaction for a further 15 min at room temperature. Purify the DNA from enzymes, buffer, etc by loading the reaction mix on a Qiagen® column, finally eluting in 30μl EB. The 5' ends of the DNA are then phosphorylated using polynucleotide kinase as follows:
DNA 30μl
Water 9.5μl
1OxPNK buffer 5μl
10OmM ATP 0.5μl
T4 PNK (lOU/μl) 5μl
50μl total
Incubate the reaction for 30 min at 370C, then heat inactivate at 65°C for 20 min. DNA is then purified from- enzymes, buffer, etc by loading the reaction mix on a Qiagen® column, finally eluting in 30μl EB. Three separate tubes are pooled to give 90μl total.
Anneal adapter Materials :
Oligo : 5 ' AAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATC
Oligo B: 5' GATCGGAAGAGCGTCGTGTAG 5OmM Tris/50mM NaCl pH7 • PCR machine
lOOμM Oligo A 20μl lOOμm Oligo B ' 20μl Tris/NaCl lOμl
50μl at 40μM duplex in 1OmM Tris/lOmM NaCl pH7.5
The adapter strands are annealed in a PCR machine programmed as follows: Ramp at 0.5°C/sec to 97.50C Hold at 97.5°C for 150 sec Then a step of 97.50C for 2 sec with a temperature drop of 0.1°C/cycle for 775 cycles
Ligation reaction
Materials
• 15uM adaptor
• End-repaired fragmented DNA genomic DNA
Quick Ligase NEB #M2200L
Quick Ligase 2x buffer NEB #M2200L • PCR machine
• Qiagen® columns xl PCR purification kit (#28104)
DNA lOμl
2x buffer 25μl
15 uM adaptor lOμl
Quick Ligase 5μl
~50μl total
Incubate for 40 min @ RT
Clean up with a Qiagen® column. Elute in 30μl EB. Pass down a S300 column to get rid of excess adaptor.
PCR amplification Materials: 5 • Ligated DNA
Oligo C: AATGATACGGCGACCACCGA
2x RedTaq™ PCR mix • PCR machine
Qiagen® MinElute columns Qiagen® (#28004 ) 10 . '
The purified ligated DNA is diluted 25 fold, then a PCR reaction mix prepared as follows :
DNA lμl
15 2x Red Taq™ mix 25μl
100 μM Oligo C 0.5μl
Water 23.5μl
~50μl total
20 Thermocycling is carried out in a PCR machine under the following conditions :
2 min @ 7O0C
2 min @ 94°C
[45 sec@ 94°C, 45 sec @ 65°C, 2 min @ 700C] 16 cycles 25. • 5 min @ 7O0C
Hold @ 40C
PCR products are purified from enzymes, buffer, etc on a Qiagen® MinElute® column, eluting in lOμl EB. 30
Gel purification Materials : Agarose Biorad® #161-3-101
100 base pair ladder NEB #N3231L TAE
Loading buffer (50 inM Tris pH8, 40 mM EDTA, 40% w/v sucrose)
• Ethidium bromide
• Gel trays and tank. Electrophoresis unit
The entire sample from the purified PCR amplification reaction is loaded into one lane of a 2% agarose gel containing ethidium bromide and run at 120V for 50 min. The gel is then viewed on a ΛWhite-light®' box and fragments from above 300bp to at least 750bp excised and purified with a Qiagen® Gel purification kit, eluting in 30μl EB. For large gel slices two MinElute® columns are used, eluting each in 15μl EB and pool.
Annealing of the probe sets
The probes all consist of the following format: 5'PS- Sequence D-Probe sequence where ΛPS' represents a 5' phosphorothioate and 'Sequence
D' is as follows:
CAAGCAGAAGACGGCATACGA
The gel-purified DNA is denatured by adding NaOH at a final concentration of 100 mM and incubating at room temperature for 5 minutes. This solution is neutralised by adding 100 microlitres of pre-warmed hybridisation solution (βxSSPE, 0.1% Tween 20) containing the probe set at a final concentration of 10 micromolar, and incubated at 37°C for 1 hour. The DNA is then purified on a Qiagen® MinElute® column, with a final elution in 10 microlitres of EB. Probe extension Materials: ImM dNTPs mix 1Ox buffer (10OmM Tris-HCl, pH 7.9, 10OmM MgC12, 10 rtiM DTT, 50OmM NaCl) Klenow fragment (3'->5' exo-) NEB #M0212S
Mix Probe-hybridised DNA 10 ul
10x buffer 5 ul
ImM dNTP mix 5 ul
H2O 29 ul
Klenow exo- (2ϋnits/ul) 1 ul ~50μl total
Incubate at 37°C for 1 hr, then purify on a Qiagen® DNA purification column, with a final elution in 30ul of EB buffer.
Covalent attachment to array chip
The coupling of DNA to the surface of a chip and sequencing of the template molecules on arrays may be carried out according to the disclosures of WO 00/06770, WO 01/57248 or WOOβ/064199 or PCT/GB2006/002687 the contents of which are herein incorporated by reference.

Claims

Claims :
1. A method of obtaining a population of target sequences for the purpose of sequencing, wherein each of said target sequences relates to a pre-determined nucleic acid sequence of interest comprising:
(a) fragmenting a first population of nucleic acid sequences; . ■ (b) combining said first population of nucleic acid sequences with a set of probe sequences under conditions allowing for hybridisation of the probe sequences and said first population of nucleic acid sequences to form probe-target complexes; and
(c) purifying the probe-target complexes to discard the un-hybridised nucleic acid target sequences;
(d) sequencing the remaining probe selected population of target sequences .
2. A method of obtaining a population of target sequences for the purpose of sequencing, wherein each of said target sequences relates to a pre-determined -nucleic acid sequence of interest comprising:
(a) fragmenting a first population of nucleic acid sequences; (b). combining said first population of nucleic acid sequences with a set of probe sequences under conditions allowing for hybridisation of the probe sequences and said first population of nucleic acid sequences to form probe-target complexes; and
(c) purifying the probe-target complexes to discard the un-hybridised nucleic acid target sequences; (d) removing the bound sequences of the said first population of nucleic acid sequences from the probe- target complexes to form said population of target sequences
(e) immobilising said population of target sequences (f) sequencing said immobilised population of target sequences .
3. A method of obtaining a selected population of target sequences for the purpose of sequencing, wherein each of said target sequences relates to a pre-determined nucleic acid sequence of interest comprising,
(a) fragmenting a first population of nucleic acid sequences; (b) combining said fragmented nucleic acid population with a set of probe sequences under conditions allowing for hybridisation of the probe sequences and target sequences to form- probe-target complexes; (c) purifying the probe-target complexes from un- hybridised nucleic acid sequences by washing to leave probe-target complexes;
(d) Removing the selected targets from the purified probe-target complexes; (e) amplifying the target' sequences to produce multiple copies of the selected population of target sequences; (f) Sequencing the multiple copies of the selected population of target sequences.
4. The method of claims 1 to 3 further comprising the step of ligating adaptors after fragmentation of nucleic acid sequences .
5. The method of claim 2 or 3 further comprising the step of ligating adaptors to the target sequences after removing said sequences from the probe-target 'complexes .
6. The method of claim 4 or 5 further comprising amplifying the nucleic acid sequences after ligating adaptor sequences .
7. The method of claims 1 to 6 wherein said pre-determined probe sequences are immobilised on a support prior to hybridisation with the fragmented nucleic acid population.
8. The method of claims 1 to 6 wherein said probe-target complexes are immobilised on a support subsequent to hybridisation of the pre-determined probe sequences with the target sequences.
9. The method of claims 7 or 8 wherein said support is a solid support.
10. The method of claim 7 wherein said support is an array.
11. The method of claim 10 wherein said array is a high density array.
12. The method of claim 9 wherein said solid support is magnetic particles.
13. The method of claim 9 wherein said solid support is beads .
14. The method of any preceding claim wherein said sequencing step comprises incorporation of one or more labelled nucleotide bases each having a reversible terminator attached thereto, and a suitable polymerase, and imaging to determine the identity of each incorporated base
15. Use of an array for the enrichment of a nucleic acid population wherein said use increases the relative abundance of specific target sequences in said nucleic acid population.
16. The use of claim 15 wherein said array is a high density array.
17. The use of claim 15 or 16 wherein the enriched nucleic acid population is for sequencing by synthesis.
PCT/GB2006/004244 2005-11-15 2006-11-14 Method of target enrichment WO2007057652A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP06808536A EP1957667A1 (en) 2005-11-15 2006-11-14 Method of target enrichment

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US73678505P 2005-11-15 2005-11-15
US60/736,785 2005-11-15
US83710806P 2006-08-10 2006-08-10
US60/837,108 2006-08-10

Publications (1)

Publication Number Publication Date
WO2007057652A1 true WO2007057652A1 (en) 2007-05-24

Family

ID=37716031

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/004244 WO2007057652A1 (en) 2005-11-15 2006-11-14 Method of target enrichment

Country Status (3)

Country Link
US (1) US20070141604A1 (en)
EP (1) EP1957667A1 (en)
WO (1) WO2007057652A1 (en)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008045158A1 (en) * 2006-10-10 2008-04-17 Illumina, Inc. Compositions and methods for representational selection of nucleic acids fro complex mixtures using hybridization
WO2008115185A2 (en) * 2006-04-24 2008-09-25 Nimblegen Systems, Inc. Use of microarrays for genomic representation selection
WO2009106294A1 (en) * 2008-02-29 2009-09-03 Roche Diagnostics Gmbh Methods and systems for uniform enrichment of genomic regions
DE102008013715A1 (en) * 2008-02-29 2010-04-08 Eberhard-Karls-Universität Tübingen Method for DNA analysis
DE102008061774A1 (en) 2008-12-11 2010-06-17 Febit Holding Gmbh Indexing of nucleic acid populations
DE102008061772A1 (en) 2008-12-11 2010-06-17 Febit Holding Gmbh Method for studying nucleic acid populations
WO2010091870A1 (en) * 2009-02-13 2010-08-19 Roche Diagnostics Gmbh Method and systems for enrichment of target genomic sequences
WO2010133972A1 (en) 2009-05-22 2010-11-25 Population Genetics Technologies Ltd Sorting asymmetrically tagged nucleic acids by selective primer extension
WO2011055232A2 (en) 2009-11-04 2011-05-12 Population Genetics Technologies Ltd. Base-by-base mutation screening
EP2334802A1 (en) * 2008-09-09 2011-06-22 Life Technologies Corporation Methods of generating gene specific libraries
WO2011101744A2 (en) 2010-02-22 2011-08-25 Population Genetics Technologies Ltd. Region of interest extraction and normalization methods
EP2535429A1 (en) * 2007-10-23 2012-12-19 F. Hoffmann-La Roche AG Methods and systems for solution based sequence enrichment and analysis of genomic regions
US8383338B2 (en) 2006-04-24 2013-02-26 Roche Nimblegen, Inc. Methods and systems for uniform enrichment of genomic regions
WO2014071070A1 (en) * 2012-11-01 2014-05-08 Pacific Biosciences Of California, Inc. Compositions and methods for selection of nucleic acids
CN105102633A (en) * 2013-03-11 2015-11-25 以琳生物药物有限公司 Enrichment and next generation sequencing of total nucleic acid comprising both genomic DNA and cDNA
US9206418B2 (en) 2011-10-19 2015-12-08 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
US9487828B2 (en) 2012-05-10 2016-11-08 The General Hospital Corporation Methods for determining a nucleotide sequence contiguous to a known target nucleotide sequence
US9650628B2 (en) 2012-01-26 2017-05-16 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US9957549B2 (en) 2012-06-18 2018-05-01 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US10036063B2 (en) 2009-07-24 2018-07-31 Illumina, Inc. Method for sequencing a polynucleotide template
US10102337B2 (en) 2014-08-06 2018-10-16 Nugen Technologies, Inc. Digital measurements from targeted sequencing
US10450597B2 (en) 2014-01-27 2019-10-22 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
EP2722401B1 (en) * 2012-10-19 2020-02-19 Agilent Technologies, Inc. Addition of an adaptor by invasive cleavage
US10570448B2 (en) 2013-11-13 2020-02-25 Tecan Genomics Compositions and methods for identification of a duplicate sequencing read
US11028430B2 (en) 2012-07-09 2021-06-08 Nugen Technologies, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
US11390905B2 (en) 2016-09-15 2022-07-19 Archerdx, Llc Methods of nucleic acid sample preparation for analysis of DNA
US11795492B2 (en) 2016-09-15 2023-10-24 ArcherDX, LLC. Methods of nucleic acid sample preparation

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0427236D0 (en) * 2004-12-13 2005-01-12 Solexa Ltd Improved method of nucleotide detection
US20100093986A1 (en) * 2007-02-02 2010-04-15 Zwick Michael E Methods of direct genomic selection using high density oligonucleotide microarrays
EP2173909A1 (en) * 2007-07-26 2010-04-14 Roche Diagnostics GmbH Target preparation for parallel sequencing of complex genomes
US8298768B2 (en) 2007-11-29 2012-10-30 Complete Genomics, Inc. Efficient shotgun sequencing methods
WO2010038042A1 (en) * 2008-10-02 2010-04-08 Illumina Cambridge Ltd. Nucleic acid sample enrichment for sequencing applications
WO2010048386A1 (en) * 2008-10-24 2010-04-29 Helicos Biosciences Corporation Methods of sample preparation for nucleic acid analysis for nucleic acids available in limited amounts
US20110039304A1 (en) * 2009-08-12 2011-02-17 President And Fellows Of Harvard College Methods to Generate Oligonucleotide Pools and Enrich Target Nucleic Acid Sequences
EP2925893A4 (en) * 2012-12-03 2016-09-07 Elim Biopharmaceuticals Inc Compositions and methods of nucleic acid preparation and analyses
EP3397379A4 (en) * 2015-12-30 2019-05-29 Bio-Rad Laboratories, Inc. Droplet partitioned pcr-based library preparation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1184466A2 (en) * 2000-08-26 2002-03-06 Affymetrix, Inc. Target nucleic acid enrichment and amplification for array analysis
WO2002083943A2 (en) * 2001-04-12 2002-10-24 Epigenomics Ag Microarray method for enriching dna fragments from complex mixtures
US20030082543A1 (en) * 2001-07-20 2003-05-01 Affymetrix, Inc. Method of target enrichment and amplification

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2025181A1 (en) * 1989-10-12 1991-04-13 William G. Weisburg Nucleic acid probes and methods for detecting fungi
AU730633B2 (en) * 1996-05-29 2001-03-08 Phillip Belgrader Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
JP3935509B2 (en) * 1997-02-12 2007-06-27 ワイ. チャン,ユージーン Methods and products for polymer analysis
US7955794B2 (en) * 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US7163790B2 (en) * 2001-11-28 2007-01-16 Bio-Rad Laboratories, Inc. Parallel polymorphism scoring by amplification and error correction
US7354706B2 (en) * 2003-09-09 2008-04-08 The Regents Of The University Of Colorado, A Body Corporate Use of photopolymerization for amplification and detection of a molecular recognition event
JP2007512811A (en) * 2003-11-10 2007-05-24 インベスチゲン, インコーポレイテッド Methods for preparing nucleic acids for detection

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1184466A2 (en) * 2000-08-26 2002-03-06 Affymetrix, Inc. Target nucleic acid enrichment and amplification for array analysis
WO2002083943A2 (en) * 2001-04-12 2002-10-24 Epigenomics Ag Microarray method for enriching dna fragments from complex mixtures
US20030082543A1 (en) * 2001-07-20 2003-05-01 Affymetrix, Inc. Method of target enrichment and amplification

Cited By (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8383338B2 (en) 2006-04-24 2013-02-26 Roche Nimblegen, Inc. Methods and systems for uniform enrichment of genomic regions
WO2008115185A2 (en) * 2006-04-24 2008-09-25 Nimblegen Systems, Inc. Use of microarrays for genomic representation selection
WO2008115185A3 (en) * 2006-04-24 2008-12-24 Nimblegen Systems Inc Use of microarrays for genomic representation selection
US10538759B2 (en) 2006-10-10 2020-01-21 Illumina, Inc. Compounds and method for representational selection of nucleic acids from complex mixtures using hybridization
US9340781B2 (en) 2006-10-10 2016-05-17 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US9139826B2 (en) 2006-10-10 2015-09-22 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US8916350B2 (en) 2006-10-10 2014-12-23 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US8568979B2 (en) 2006-10-10 2013-10-29 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US9587273B2 (en) 2006-10-10 2017-03-07 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
WO2008045158A1 (en) * 2006-10-10 2008-04-17 Illumina, Inc. Compositions and methods for representational selection of nucleic acids fro complex mixtures using hybridization
US9790543B2 (en) 2007-10-23 2017-10-17 Roche Sequencing Solutions, Inc. Methods and systems for solution based sequence enrichment
EP2535429A1 (en) * 2007-10-23 2012-12-19 F. Hoffmann-La Roche AG Methods and systems for solution based sequence enrichment and analysis of genomic regions
US10900068B2 (en) 2007-10-23 2021-01-26 Roche Sequencing Solutions, Inc. Methods and systems for solution based sequence enrichment
DE102008013715B4 (en) * 2008-02-29 2011-12-08 Eberhard-Karls-Universität Tübingen Method for DNA analysis
WO2009106294A1 (en) * 2008-02-29 2009-09-03 Roche Diagnostics Gmbh Methods and systems for uniform enrichment of genomic regions
DE102008013715A1 (en) * 2008-02-29 2010-04-08 Eberhard-Karls-Universität Tübingen Method for DNA analysis
EP2334802A4 (en) * 2008-09-09 2012-01-25 Life Technologies Corp Methods of generating gene specific libraries
EP2334802A1 (en) * 2008-09-09 2011-06-22 Life Technologies Corporation Methods of generating gene specific libraries
DE102008061774A1 (en) 2008-12-11 2010-06-17 Febit Holding Gmbh Indexing of nucleic acid populations
DE102008061772A1 (en) 2008-12-11 2010-06-17 Febit Holding Gmbh Method for studying nucleic acid populations
WO2010091870A1 (en) * 2009-02-13 2010-08-19 Roche Diagnostics Gmbh Method and systems for enrichment of target genomic sequences
CN102317476A (en) * 2009-02-13 2012-01-11 霍夫曼-拉罗奇有限公司 Method and systems for enrichment of target genomic sequences
WO2010133972A1 (en) 2009-05-22 2010-11-25 Population Genetics Technologies Ltd Sorting asymmetrically tagged nucleic acids by selective primer extension
US10036063B2 (en) 2009-07-24 2018-07-31 Illumina, Inc. Method for sequencing a polynucleotide template
WO2011055232A2 (en) 2009-11-04 2011-05-12 Population Genetics Technologies Ltd. Base-by-base mutation screening
WO2011101744A2 (en) 2010-02-22 2011-08-25 Population Genetics Technologies Ltd. Region of interest extraction and normalization methods
US9206418B2 (en) 2011-10-19 2015-12-08 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
US9650628B2 (en) 2012-01-26 2017-05-16 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration
US10036012B2 (en) 2012-01-26 2018-07-31 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
US10876108B2 (en) 2012-01-26 2020-12-29 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
US11781179B2 (en) 2012-05-10 2023-10-10 The General Hospital Corporation Methods for determining a nucleotide sequence contiguous to a known target nucleotide sequence
US10718009B2 (en) 2012-05-10 2020-07-21 The General Hospital Corporation Methods for determining a nucleotide sequence contiguous to a known target nucleotide sequence
US10017810B2 (en) 2012-05-10 2018-07-10 The General Hospital Corporation Methods for determining a nucleotide sequence contiguous to a known target nucleotide sequence
US9487828B2 (en) 2012-05-10 2016-11-08 The General Hospital Corporation Methods for determining a nucleotide sequence contiguous to a known target nucleotide sequence
US9957549B2 (en) 2012-06-18 2018-05-01 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US11697843B2 (en) 2012-07-09 2023-07-11 Tecan Genomics, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
US11028430B2 (en) 2012-07-09 2021-06-08 Nugen Technologies, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
EP2722401B1 (en) * 2012-10-19 2020-02-19 Agilent Technologies, Inc. Addition of an adaptor by invasive cleavage
WO2014071070A1 (en) * 2012-11-01 2014-05-08 Pacific Biosciences Of California, Inc. Compositions and methods for selection of nucleic acids
CN105102633A (en) * 2013-03-11 2015-11-25 以琳生物药物有限公司 Enrichment and next generation sequencing of total nucleic acid comprising both genomic DNA and cDNA
EP2971186A4 (en) * 2013-03-11 2016-11-09 Elim Biopharmaceuticals Inc ENRICHMENT AND NEXT GENERATION SEQUENCING OF TOTAL NUCLEIC ACID COMPRISING BOTH GENOMIC DNA AND cDNA
US10619206B2 (en) 2013-03-15 2020-04-14 Tecan Genomics Sequential sequencing
US10760123B2 (en) 2013-03-15 2020-09-01 Nugen Technologies, Inc. Sequential sequencing
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US10570448B2 (en) 2013-11-13 2020-02-25 Tecan Genomics Compositions and methods for identification of a duplicate sequencing read
US11098357B2 (en) 2013-11-13 2021-08-24 Tecan Genomics, Inc. Compositions and methods for identification of a duplicate sequencing read
US11725241B2 (en) 2013-11-13 2023-08-15 Tecan Genomics, Inc. Compositions and methods for identification of a duplicate sequencing read
US10450597B2 (en) 2014-01-27 2019-10-22 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
US11807897B2 (en) 2014-01-27 2023-11-07 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US10102337B2 (en) 2014-08-06 2018-10-16 Nugen Technologies, Inc. Digital measurements from targeted sequencing
US11390905B2 (en) 2016-09-15 2022-07-19 Archerdx, Llc Methods of nucleic acid sample preparation for analysis of DNA
US11795492B2 (en) 2016-09-15 2023-10-24 ArcherDX, LLC. Methods of nucleic acid sample preparation
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system

Also Published As

Publication number Publication date
EP1957667A1 (en) 2008-08-20
US20070141604A1 (en) 2007-06-21

Similar Documents

Publication Publication Date Title
US20080274904A1 (en) Method of target enrichment
US20070141604A1 (en) Method of target enrichment
US11827927B2 (en) Preparation of templates for methylation analysis
US20190024141A1 (en) Direct Capture, Amplification and Sequencing of Target DNA Using Immobilized Primers
WO2002086163A1 (en) Methods for high throughput genome analysis using restriction site tagged microarrays
WO2013117595A2 (en) Targeted enrichment and amplification of nucleic acids on a support
JP2002330783A (en) Concentration and amplification of target for analyzing array
KR20080005188A (en) Selection probe amplification
WO2009073629A2 (en) Efficient shotgun sequencing methods
EP2609214A2 (en) Methods for nucleic acid capture and sequencing
WO2009109753A2 (en) Multiplex selection and sequencing
EP2785865A1 (en) Method and kit for characterizing rna in a composition
EP4060049B1 (en) Methods for accurate parallel quantification of nucleic acids in dilute or non-purified samples
US20060240431A1 (en) Oligonucletide guided analysis of gene expression
JP4731081B2 (en) Method for selectively isolating nucleic acids
JP2024035109A (en) Methods for accurate parallel detection and quantification of nucleic acids
WO2009055708A1 (en) Selection probe amplification
AU2002307594A1 (en) Methods for high throughput genome analysis using restriction site tagged microarrays

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006808536

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2006808536

Country of ref document: EP