WO2007056858A1 - Anti-alpha2 integrin antibodies and their uses - Google Patents

Anti-alpha2 integrin antibodies and their uses Download PDF

Info

Publication number
WO2007056858A1
WO2007056858A1 PCT/CA2006/001876 CA2006001876W WO2007056858A1 WO 2007056858 A1 WO2007056858 A1 WO 2007056858A1 CA 2006001876 W CA2006001876 W CA 2006001876W WO 2007056858 A1 WO2007056858 A1 WO 2007056858A1
Authority
WO
WIPO (PCT)
Prior art keywords
integrin
antibody
seq
acid sequence
humanized anti
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2006/001876
Other languages
English (en)
French (fr)
Inventor
Elias Lazarides
Catherine Woods
Mark Bernard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chromos Molecular Systems Inc
Ichnos Sciences SA
Original Assignee
Chromos Molecular Systems Inc
Glenmark Pharmaceuticals SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2006315037A priority Critical patent/AU2006315037C1/en
Priority to KR1020087014770A priority patent/KR101442266B1/ko
Priority to HRP20150691TT priority patent/HRP20150691T1/hr
Priority to EA200801314A priority patent/EA016245B9/ru
Priority to DK06804739.8T priority patent/DK1948798T3/en
Priority to HK09100422.9A priority patent/HK1121186B/en
Priority to BRPI0620469-4A priority patent/BRPI0620469A2/pt
Priority to ES06804739.8T priority patent/ES2541302T3/es
Priority to SI200631946T priority patent/SI1948798T1/sl
Priority to CA2629715A priority patent/CA2629715C/en
Priority to AP2008004471A priority patent/AP2809A/xx
Priority to RS20150437A priority patent/RS54111B1/sr
Priority to JP2008540416A priority patent/JP5184367B2/ja
Priority to PL06804739T priority patent/PL1948798T3/pl
Priority to CN200680051249.9A priority patent/CN101360826B/zh
Priority to EP06804739.8A priority patent/EP1948798B1/en
Application filed by Chromos Molecular Systems Inc, Glenmark Pharmaceuticals SA filed Critical Chromos Molecular Systems Inc
Priority to NZ568272A priority patent/NZ568272A/en
Publication of WO2007056858A1 publication Critical patent/WO2007056858A1/en
Priority to IL191264A priority patent/IL191264A/en
Priority to ZA2008/04148A priority patent/ZA200804148B/en
Anticipated expiration legal-status Critical
Priority to NO20082454A priority patent/NO20082454L/no
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • C07K16/2842Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily against integrin beta1-subunit-containing molecules, e.g. CD29, CD49
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70546Integrin superfamily
    • C07K14/7055Integrin beta1-subunit-containing molecules, e.g. CD29, CD49
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567Framework region [FR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70546Integrin superfamily, e.g. VLAs, leuCAM, GPIIb/GPIIIa, LPAM
    • G01N2333/7055Integrin beta1-subunit-containing molecules, e.g. CD29, CD49

Definitions

  • the present invention generally relates to antibodies directed to ⁇ 2 ⁇ 1 integi n and their uses, including humanized anti-alpha 2 ( ⁇ 2) integrin antibodies and methods of treatment with anti- ⁇ 2 integrin antibodies.
  • the integrin ⁇ 2 ⁇ 1 (Very late antigen 2; VLA-2) is expressed on a variety of cell types including platelets, vascular endothelial cells, epithelial cells, activated monocytes/macrophages, fibroblasts, leukocytes, lymphocytes, activated neutroph s and mast cells.
  • VLA-2 Very late antigen 2
  • integrin ⁇ 2 ⁇ 1 is expressed on a variety of cell types including platelets, vascular endothelial cells, epithelial cells, activated monocytes/macrophages, fibroblasts, leukocytes, lymphocytes, activated neutroph s and mast cells.
  • the most typical ligards for ⁇ 2 ⁇ 1 include collagen and laminin, both of which are found in extracellular matrix.
  • the l-domain of the ⁇ 2 integrin binds to collagen in a divalent-cation depi: ndent manner whereas the same domain binds to laminin through both divalent cation dependent and independent mechanisms.
  • the specificity of the ⁇ 2 ⁇ 1 integrin varies w th cell type and serves as a collagen and/or laminin receptor for particular cell typ s, for example ⁇ 2 ⁇ 1 integrin is known as a collagen receptor for platelets and a himinin receptor for endothelial cells.
  • Echovirus-1 , decorin, E-cadherin, matrix metalloproteinase I (MMP-I), endorepel in and multiple collectins and the C1q complement protein are also ligands for ⁇ 2 ⁇ 1 i ⁇ :egrin.
  • MMP-I matrix metalloproteinase I
  • endorepel in and multiple collectins and the C1q complement protein are also ligands for ⁇ 2 ⁇ 1 i ⁇ :egrin.
  • the ⁇ 2 ⁇ 1 integrin has been implicated in several biological and pathological processes including collagen-induced platelet aggregation, cell migration on collagen, cell-dependent reorganization of collagen fibers as well as collagen-dependent cellular responses that result in increases in cytokine expression and proliferation, (Gendron, J.
  • lntegrins are heterodimers comprised of one ⁇ and one ⁇ subunit, and comprise a large family of cell surface proteins that mediate cell adhesion to extracellular matrix (ECM) as well as plasma proteins and are central to some types of cell-cell interactions, lntegrins interact with ECM components through their extracellular domains.
  • ECM extracellular matrix
  • integrins Upon binding to ligands, integrins transduce intracellular signals to the cytoskeleton that modify cellular activity in response to these cellular adhesion events, referred to as outside-in signaling (see, e.g., Hemler, Ann . ⁇ Rev Immunol 8:365:365-400 (1999); Hynes, Cell. 110(6):673-87 (2002)). Such signaling can also activate other integrin subtypes expressed on the same cell, referred to as inside-out signaling. Inside-out signaling further occurs via regulatory signals that originate within cell cytoplasm such as a disruption of the clasp between an ⁇ and ⁇ subunit, which are then transmitted to the external ligand-binding domain of the receptor.
  • Integrins can play important roles in the cell adhesion events that control development, organ morphogenesis, physiology and pathology as well as normal tissue homeostasi s, and immune and thrombotic responses, and in addition, they serve as environmental s ⁇ ; nsors for the cell. These proteins are characterized as being in a closed conformation under normal conditions that, upon activation undergo rapid conformational change that exposes the ligand binding site. X-ray crystal structure is a recent tool that has been used in the study of integrin structure and mechanisms of activation. The underste nding of integrin structural features facilitates the better understanding of binding sites, differentiated states and their active and inactive formations.
  • the bindir g site for ligand/counter-receptor for all integrins lies within the ⁇ domain and is comprised of a metal ion dependent binding site, referred to as the MIDAS domain (Dembo el al, J Biol.Chem. 274, 32108-32111 (1988); Feuston et al., J. Med. Chem. 46:5316-5325 (2003); Gadek et al., Science 295(5557): 1086-9 (2002)); Gurrath et al., Eur. J. Bio :;hem. 210:911-921 (1992)).
  • MIDAS domain a metal ion dependent binding site
  • the MIDAS site is located within an extra inserted d :>main at the N-terminus known as the I, A or I/A domain, a feature they share with lhe ⁇ subunits of the leukocyte ⁇ 2 family of integrins (Randi and Hogg, J Biol Chem. 269: 12395-8 (1994), Larson et al J Cell Biol. 108(2):703-12 (1989), Lee et al., J Biol Chem. 269: 12395-8 (1995); Emsley et al, J. Biol. Chem.
  • the I domains are structurally homologous to the A1 domain of von Willebrandt factor, with a Rossman-fold topology of six ⁇ -sheet strands surrounded by seven ⁇ -helices (Colombatti and Bonaldo, Blood 77(11):2305-15 (1991); Larson el al, J Cell Biol. 108(2):703-712 (1989); Emsley et al, J. Biol. Chem. 272:28512-28517 ( 1997); Nolte et al; FEBS Letters, 452(3):379-385 (1999)).
  • the collagen-binding integrins have an additional ⁇ -helix known as the ⁇ C helix (Emsley et al, J. Biol. Chem. 272:28512- 28517 (1997) and Cell 100:47-56 (2000); Nolte et al; FEBS Letters, 452(3):379-385 (1999)).
  • Some antibodies that block ⁇ 2 ⁇ 1 integrir were reported to show impact on delayed hypersensitivity responses and efficacy in a r iurine model of rheumatoid arthritis and a model of inflammatory bowel disease (Kriegels :ein et al., J. Clin. Invest. 110(12): 1773-82 (2002); de Fougerolles et. al., J. Clin. Invest. 105:721- 720 (2000) and were reported to attenuate endothelial cell proliferation and migration in vitro (Senger et al., Am. J. Pathol. 160(1 ): 195-204 (2002), suggesting that the blocking of ⁇ 2 ⁇ 1 integrin might prevent/inhibit abnormal or higher than normal angiogenesis, as observed in various cancers.
  • Platelets normally circulate in the blood in an inactive resting state, however, they are primed to respond rapidly at sites of injury to a wide variety of agonists. Upon stimulation, they undergo shape changes and become highly reactive with plasma proteins, such as fibrinogen and von Willebrand factor (vWf), other platelets, and the endothelial lining of the vessel wall. These interactions all cooperate to facilitate the rapid formation of a hemostatic fibrin platelet plug (Cramer, 2002 in Hemostasiu and Thrombosis, 4 th edition).
  • vWf von Willebrand factor
  • platelet receptors Upon binding ligand, platelet receptors transduce out ⁇ ide-in signal pathways which in turn, trigger inside-out signaling that results in activation of secondary receptors such as the platelet fibrinogen receptor, ⁇ llb ⁇ 3 integrin, leac ing to platelet aggregation.
  • secondary receptors such as the platelet fibrinogen receptor, ⁇ llb ⁇ 3 integrin, leac ing to platelet aggregation.
  • Antibodies or peptide ligand mimetics that bind to or interact with platelet receptors are anticipated to induce a similar signaling cascade leading to platelet activation. Even minor activation of platelets can result in platelet thrombotic responses, thrombocytopenia and bleeding complications.
  • ⁇ 2 ⁇ 1 integrin is the only collagen-binding integrin expressed on platelets arid has been implicated to play some role in platelet adhesion to collagen and heme stasis (Gruner et al., Blood 102:4021-4027 (2003); Nieswandt and Watson, Blood 102(21:449- 461 (2003); Santoro et a/., Thromb. Haemost. 74:813-821 (1995); Siljander et a/., Blood 15:1333-1341 (2004); Vanhoorelbeke et al., Curr. Drug Targets Cardiovasc. Haematol. Disord. 3(2): 125-40 (2003)).
  • platelet ⁇ 2 ⁇ 1 may play a role in the regulalion of the size of the platelet aggregate (Siljander et al., Blood 103(4): 1333-1341 (2004)).
  • ⁇ 2 ⁇ 1 integrin has also been shown as a laminin-binding integrin expressed on endothelial cells (Languino et al., J Cell Bio. 109:2455-2462 (1989)). Endothelia cells are thought to attach to laminin through an integrin-mediated mechanism, however it has been suggested that the ⁇ 2 I domain may function as a ligand-specific sequence involved in mediating endothelial cell interactions (Bahou et al., Blood.
  • ⁇ 2 ⁇ 1 integrin plays an important role in the moverm-nt of leukocytes through inflammatory tissue, it would be desirable to develop therapeutic agents that could target ⁇ 2 ⁇ 1 for diseases ⁇ 2 ⁇ 1 integrin-associated disorders and/or cellular processes associated with the disorders, including cancer, inflammatory diseases and autoimmune diseases, if such agents would not activate platelets.
  • theie is a need in the art for the development of compounds capable of targeting ⁇ 2 ⁇ 1 in :egrin, such as the ⁇ 2 ⁇ 1 integrin on leukocytes, which would not be associated with adverse bleeding complications.
  • the anti-human ⁇ 2 ⁇ 1 integrin blocking antibody BHA2.1 was first described by Hangan et al., (Cancer Res. 56:3142-3149 (1996)).
  • Other anti- ⁇ 2 ⁇ 1 integrin antibodies are known and have been used in vitro, such as the commercially available antibodies AK7 (Mazurov et al., Thromb. Haemost. 66(4):494-9 (1991 ), P1 E6 (Wayner et al., I. Cell Biol. 107(5):1881-91 (1988)), 10G11 (Giltay et al., Blood 73(5):1235-41 (1989) and A2- 11 E10 (Bergelson et al., Cell Adhes.
  • Figure 1 Graphical results of studies of effects of anti- ⁇ 2 integrin antibody on paralytic disease in mouse EAE model when administered at first sign of disease (See Example 7).
  • Figure 2 Graphical results of studies of effects of anti- ⁇ 2 integrin on paralytic disease when administered during induction phase (See Example 7).
  • the present invention provides anti-alpha 2 ( ⁇ 2) integrin antibodies and me thods for their use, notably humanized anti-alpha 2 ( ⁇ 2) integrin antibodies and methods for their use.
  • the anti- ⁇ 2 integrin antibody includes one or more h .iman constant regions (e.g., C L and/or C H ) and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 19 and/or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:21 or amino acid sequence variants th ereof.
  • the anti- ⁇ 2 in iegrin antibody may be a full length antibody (e.g., comprising human immunoglobulin constant regions) or an antibody fragment (e.g. Fab or F(ab') 2 or Fab 1 or Fv or scFv fragrr sjnts).
  • the antibody may be labeled with a detectable label, immobilized on a solid phase and/or conjugated with a heterologous compound (such as a cytotoxic agent) [17]
  • a detectable label such as a cytotoxic agent
  • a heterologous compound such as a cytotoxic agent
  • Diagnostic and therapeutic uses for anti- ⁇ 2 integrin antibodies are contemplated as well as prophylactic or preventative uses.
  • a method for determining the presence of ⁇ 2 ⁇ 1 integrin protein comprising expo:; ing a sample suspected of containing the ⁇ 2 ⁇ 1 integrin protein to an anti- ⁇ 2 integrin an ibody and determining binding of the antibody to the sample.
  • a kit is provided comprising an anti- ⁇ 2 integrin antibody and instructions for using the antibody to detect the ⁇ 2 ⁇ 1 integrin protein.
  • Gene therapy applications for anti- ⁇ 2 integrin antibodies are contemp lated.
  • Various vectors e.g., retroviral vectors, chromsomes
  • encoding the anti- ⁇ 2 ⁇ 1 heavy and light chain gene sequences may be transferred to cells (e.g., fibroblasts, stem c «; Is) to generate populations of cells secreting anti- ⁇ 2 ⁇ 1 MAb. These cells may possess specific "homing" properties to different cell types, tissues, and/or organs.
  • ani body- producing cells in turn may be introduced into a patient for localized delivery of thi- anti- ⁇ 2 ⁇ 1 MAb.
  • mesenchymal stem cells modified with an anti- ⁇ 2 ⁇ l MAb vector could be injected into the brain of a patient suffering from multiple sclerosis
  • the stem cells differentiate into neural cells and secrete the anti- ⁇ 2 ⁇ 1 MAb to treat the inflammation associated with the multiple sclerosis.
  • anti- ⁇ 2 ⁇ 1 may be conjugated to viruses encoding therapeutic genes (e.g., ricin).
  • the modified viruses would bind specifically to cells expressing ⁇ 2 ⁇ 1 on the cell surface, enabling increased transgene transfer efficiency.
  • immunoconjugates composed of anti ⁇ 2 ⁇ 1 antibody-liposome complexes encapsulating nucleic acids encoding therapeutic genes may be introduced intravenously into a patient.
  • the anti- ⁇ 2 ⁇ 1-immunoconjugate would bind to cells expressing ⁇ 2 ⁇ 1 integrin and facilitate efficient uptake of the therapeutic genes.
  • nucleic acid encoding an anti- ⁇ 2 integrin antibody
  • a vector comprising that nucleic acid, optionally operably linked to control sequences recognized by a host cell transformed with the vector; a host cell comprising that vector; a process for producing the anti- ⁇ 2 integrin antibody comprising culturing the host cell so that the nucleic acid is expressed and, optionally, recovering the antibody from thni host cell culture (e.g., from the host cell culture medium).
  • compositions for therapeutic uses may be sterile and may be lyophilized.
  • a method for treating an ⁇ 2 ⁇ 1 in lugrin- associated disorder comprising administering to a subject a pharmaceutically effective amount of an anti- ⁇ 2 integrin antibody such as a humanized anti- ⁇ 2 integrin antibody to the mammal.
  • other agents e.g., another ⁇ 2 ⁇ 1 criz ⁇ grin antagonist
  • a humanized anti- ⁇ 2 integrin antibody comprising a heavy chain variable region comprising the amino acid sequence of (a) H 2DR2
  • VIWARGFTNYNSALMS SEQ ID NO:2
  • HCDR1 GLSLTNYGIH, SEQ ID 1.10:1
  • HCDR2 VIWARGFTNYNSALMS, SEQ ID NO:2
  • HCDR3 ANDGVYYAMDY, S i ⁇ Q ID
  • the above-mentioned heavy chain variable region com prises the amino acid sequence of SEQ ID NO:185.
  • the above-mentioned heavy chain variable region comprises the amino acid sequence of SEQ ID NO:185 in which (a) position 71 is Lys, (b) position 73 is Asn, (c) position 78 is VaI, or (d) any combination of (a)-(c). [23] In a further embodiment, the above-mentioned heavy chain variable region comprises an amino acid sequence selected from SEQ ID NOs:70-79 and SEQ ID NO:185 in which (a) position 71 is Lys, (b) position 73 is Asn, (c) position 78 is VaI, or (d) any combination of (a)-(c). [23] In a further embodiment, the above-mentioned heavy chain variable region comprises an amino acid sequence selected from SEQ ID NOs:70-79 and SEQ ID
  • the above-mentioned anti- ⁇ 2 integrin antibody further comprises a FW4 region comprising the amino acid sequence WGQGTLVTVSS (SI ⁇ Q ID
  • the above-mentioned anti- ⁇ 2 integrin antibody comprises the amino acid sequence of HCDR1 (SEQ ID NO:1), HCDR2 (SEQ ID NO:2) and HCDR3
  • the above-mentioned anti- ⁇ 2 integrin antibody f .irther comprises a light chain.
  • the invention further provides a humanized anti- ⁇ 2 integrin antibody comprii-ing a light chain variable region comprising the amino acid sequence of (a) an LCDR1 selected from SANSSVNYIH (SEQ ID NO:4) or SAQSSWNYIH (SEQ ID NO:112), (b) LCDR2
  • the above-mentioned light chain variable region comprises the amino acid sequence of SEQ ID NO: 186.
  • the above-mentioned light chain variable region comprises the amino acid sequence of SEQ ID NO: 186 in which (a) position 2 is Phe, (b) position 45 is
  • the above-mentioned light chain variable region comprises an amino acid sequence selected from SEQ ID NO:41, SEQ ID NOs:80-92 and SIIiQ ID
  • the above-mentioned humanized anti- ⁇ 2 integrin an tibody further comprises a FW4 region comprising the amino acids sequence FGQGTKVI ⁇ lK of
  • the above-mentioned humanized anti-oc2 integrin an tibody comprises the amino acid sequence of LCDR1 (SEQ ID NO:4), LCDR2 (SEQ ID NO:5) and LCDR3 (SEQ ID NO:6)
  • the above-mentioned humanized anti- ⁇ 2 integrin antibody further comprises a heavy chain.
  • the invention further provides a humanized anti- ⁇ 2 integrin antibody comprising:
  • VIWARGFTNYNSALMS SEQ ID NO:2
  • HCDR1 GLSLTNYGIH, SEQ ID MO: 1
  • HCDR2 VIWARGFTNYNSALMS, SEQ ID NO:2
  • HCDR3 ANDGVYYAMDY, S ⁇ Q ID
  • the light chain variable region comprises the amino acid sequence ol SEQ ID NO: 185, (b) the light chain variable region comprises the amino acid sequence ol SEQ
  • ID NO:186 or (c) both (a) and (b).
  • the light chain variable region comprises the amino acid sequence of SEQ ID NO: 186 in which (a) position 2 is Phe, (b) position 45 is Lys, (c) position 48 is Tyr, or (d) any combination of (a)-(c); or (iii) both (i) and (ii).
  • the heavy chain variable region comprises an amino acid sequence se ected from SEQ ID NOs:70-79 and SEQ ID NOs:109-111 ;
  • the light chain variable region comprises an amino acid sequence selected from SEQ ID NO:41 , SEQ ID NOs:i30-92 and SEQ ID NO:108; or (c) both (a) and (b).
  • the above-mentioned anti- ⁇ 2 integrin antibody recognize:;, the I domain of human ⁇ 2 integrin.
  • the above-mentioned anti- ⁇ 2 integrin antibody binds ⁇ 2 ⁇ 1 integrin.
  • the above-mentioned anti- ⁇ 2 integrin antibody binds an epitope of ⁇ 2 integrin, the epitope comprising:
  • an anti- ⁇ 2 integrin antibody wherein the antibody binds an epitope of ⁇ 2 integrin, the epitope comprising:
  • the above-mentioned humanized anti- ⁇ 2 integrin antibocy is a full length antibody.
  • the above-mentioned humanized anti- ⁇ 2 integrin antibody is an antibody fragment.
  • the above-mentioned humanized anti- ⁇ 2 integrin antibody is bound to a detectable label.
  • the above-mentioned humanized anti- ⁇ 2 integrin antibody is immobilized on solid phase.
  • the above-mentioned humanized anti- ⁇ 2 integrin antibody inhibits binding of ⁇ 2 or ⁇ 2 ⁇ 1 integrin to an ⁇ 2 ⁇ 1 integrin ligand.
  • the above-mentioned ⁇ 2 ⁇ 1 integrin ligand is selectee: from collagen, laminin, Echovirus-1 , decorin, E-cadherin, matrix metalloproteinase I (M VIP-I), endorepellin, collectin and C1q complement protein.
  • the invention further provides a method for determining whether a s iimple contains ⁇ 2 integrin, ⁇ 2 ⁇ 1 integrin, or both, comprising contacting the sample wi th the above-mentioned humanized anti- ⁇ 2 integrin antibody and determining whether the antibody binds to the sample, said binding being an indication that the sample contains ⁇ 2 integrin, ⁇ 2 ⁇ 1 integrin, or both.
  • the invention further provides a kit comprising the above-mentioned humanized anti- ⁇ 2 integrin, optionally further comprising instructions for its use to detect ⁇ 2 or ⁇ 2 ⁇ 1 integrin protein.
  • the invention further provides an isolated nucleic acid encoding a humanize ⁇ :l anti- ⁇ 2 ⁇ 1 integrin antibody mentioned above.
  • the invention further provides a vector comprising the above-mentioned r jcleic acid.
  • the invention further provides a host cell comprising the above-mentioned r ucleic acid or vector.
  • the invention further provides a process of producing a humanized cinti- ⁇ 2 integrin antibody comprising culturing the above-mentioned host cell under conditions permitting expression of the antibody.
  • the methiod further comprises recovering the humanized anti- ⁇ 2 integrin antibody from the host cell.
  • the method further comprises recovering the humanized anti- ⁇ 2 integrin antibody from the host cell culture medium.
  • the invention further provides a screening method comprising: detecting binding of ⁇ 2 or ⁇ 2 ⁇ 1 integrin to an antibody comprising the VL region of SEQ ID NO:19 a id the
  • the ⁇ 2 or ⁇ 2 ⁇ 1 integrin is immobilizec on a solid support.
  • the invention further provides a screening method comprising: detecting binding of ⁇ 2 ⁇ 1 integrin to collagen in the presence of a test antibody, wherein test anl body refers to an antibody that binds to an ⁇ 2 I domain; detecting binding of the test anl body to the ⁇ 2 I domain in the presence of Mg ++ ions; detecting binding of the test antibody to the ⁇ 2 I domain in the presence of Ca ++ ions; detecting binding of the test antibody Io the cc2 I domain in the presence of cation-free media; and selecting the test antib :>dy if inhibits the binding of ⁇ 2 ⁇ 1 integrin to collagen and binds to the ⁇ 2 I domain n the presence of Mg ++ ions and Ca ++ ions and cation-free media.
  • the invention further provides a composition comprising the above-menlioned humanized anti- ⁇ 2 integrin antibody and a pharmaceutically acceptable carrier.
  • the invention further provides a method of treating an ⁇ 2 ⁇ 1 integrin-asso ::iated disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the above-mentioned anti- ⁇ 2 integrin antibody or composition.
  • the invention further provides a method for inhibiting leukocyte bindi ng to collagen comprising administering to a subject an amount of the above-mentioned anti- ⁇ 2 ⁇ 1 integrin antibody effective to inhibit the binding of the leukocytes to collagen.
  • the invention further provides a use of the above mentioned humanized ⁇ nti- ⁇ 2 integrin antibody as a medicament.
  • the invention further provides a use of the above mentioned humanized ⁇ nti- ⁇ 2 integrin antibody or composition for the treatment of an ⁇ 2 ⁇ 1 integrin-associated dis :>rder.
  • the invention further provides a use of the above mentioned humanized anti- ⁇ 2 integrin antibody or composition for the preparation of a medicament for the treatment of an ⁇ 2 ⁇ 1 integrin-associated disorder.
  • the invention further provides a composition for the treatment of an ⁇ 2 ⁇ 1 inlegrin- associated disorder, the composition comprising the above-mentioned humanized ⁇ nti- ⁇ 2 integrin antibody and a pharmaceutically acceptable carrier or diluent.
  • the invention further provides a package comprising the above-men :ioned humanized anti- ⁇ 2 integrin antibody or composition together with instructions for the treatment of an ⁇ 2 ⁇ 1 integrin-associated disorder.
  • the ⁇ 2 ⁇ 1 integrin-associated disorder is selected from inflammatory disease, autoimmune disease and a disease characterized by abnormal or increased angiogenesis.
  • the ⁇ 2 ⁇ 1 integrin-associated disorder is selected from inflammatory bowel disease, Crohn's disease, ulcerative colitis, reactions to tran; plant, optical neuritis, spinal cord trauma, rheumatoid arthritis, systemic lupus erythemj itosus
  • SLE diabetes mellitus, multiple sclerosis, Reynaud's syndrome, experinental autoimmune encephalomyelitis, Sjorgen's syndrome, scleroderma, juvenile onset diabetes, diabetic retinopathy, age related macular degeneration, cardiovascular di; ease, psoriasis, cancer as well as infections that induce an inflammatory response.
  • the ⁇ 2 ⁇ 1 integrin-associated disorder is selected from multiple sclerosis (e.g., characterized by relapse, acute treatment, delayed treatment), rheu ⁇ atoid arthritis, optical neuritis and spinal cord trauma.
  • the above-mentioned method is not associated with (a) platelet activation, (b) platelet aggregation, (c) a decrease in circulating platelet count, (d) bleeding complications, or (e) any combination of (a) to (d).
  • the above-mentioned anti- ⁇ 2 integrin antibody comprises a heavy chain comprising SEQ ID NO:174 or SEQ ID NO:176 and a light chain comprising
  • the above-mentioned anti- ⁇ 2 integrin antibody compuitively inhibits the binding of an antibody comprising the UL region of SEQ ID NO: 19 and t ie VH region of SEQ ID NO:21 to human ⁇ 2 ⁇ 1 integrin or the I domain thereof.
  • the above-mentioned method is associated with an alleviation of a flare or neuroligical sequelae associated with multiple sclerosis.
  • the above-mentioned anti- ⁇ 2 integrin antibody inhibits the binding of ⁇ 2 ⁇ 1 integrin to collagen and is not a ligand mimetic.
  • a moiety such as a molecule, p otein, nucleic acid, vector, composition, complex, etc.
  • binding to the epitope is not associated with (a) platelet activation, (b) platelet aggregation, (c) a decrease in circulating platelet count, (d) bh-eding complications, (e) ⁇ 2 integrin activation, or (f) any combination of (a) to (e).
  • Preferred antibodies bind to the l-domain of human ⁇ 2 ⁇ 1 integrin.
  • the preferred antibodies are able to block ⁇ 2-dependent adhesion of cells to the extracellular matrix (ECM), particularly to at least one or both of collagen and laminin.
  • ECM extracellular matrix
  • Humanized antibodies are provided, including antibodies based on an antibody referred to herein as TMC-2206.
  • Anti- ⁇ 2 integrin antibodies are provided that are highly specific for h jman ⁇ 2 ⁇ 1 integrin, and whose administration is not associated with undesired effects such as bleeding complications or complications due to cellular activation.
  • the binding specificity (e.g., epitope specificity) of these antibodies is associated with their unexpected non- hemorrhagic profile.
  • the humanized anti- ⁇ 2 ⁇ 1 integrin antibody may have a heavy chain v ⁇ niable region comprising the amino acid sequence of HCDR1 (GFSLTNYGIH; SEQ ID NO:1) and/or HCDR2 (VIWARGFTNYNSALMS; SEQ ID NO:2) and/or HCDR3 (ANDGVYYAMDY; SEQ ID NO:3).
  • the humanized anti- ⁇ 2 ⁇ 1 integrin antibody may have a light chain variable region comprising the amino acid sequence of LCDRI (SANSSVNYIH; SEQ ID NO:4 or SAQSSWNYIH; SEQ ID NO:112) and/or LCDR2 (DTSKLAS; SEQ ID NO:5) and/or LCDR3 (QQWTTNPLT; SEQ ID NO:6).
  • LCDRI SANSSVNYIH; SEQ ID NO:4 or SAQSSWNYIH; SEQ ID NO:112
  • DTSKLAS SEQ ID NO:5
  • LCDR3 QQWTTNPLT
  • the humanized anti- ⁇ 2 ⁇ 1 integrin antibodies have a heavy chain comprising HCDR1 (GFSLTNYGIH; SEQ ID NO:1 ) and/or HCDR2 (VIWARGFTNYNSALMS; SEQ ID NO:2) and/or HCDR3 (ANDGVYYAMDY; SEi Q ID NO:3) and a light chain variable region comprising the amino acid sequence of LCDR1 (SANSSVNYIH; SEQ ID NO:4) and/or LCDR2 (DTSKLAS; SEQ ID NO:5) and/or LCDR3 (QQWTTNPLT; SEQ ID NO:6).
  • the antibody comprises an amino acid sequence variant of one or more of such CDRs, which variant comprises c:ne or more amino acid insertion(s) within or adjacent to a CDR residue and/or deletion(s) within or adjacent to a CDR residue and/or substitution(s) of CDR residue(s) (with substitulion(s) being the preferred type of amino acid alteration for generating such variants).
  • the present invention provides antibodies specifically reactive with human alpha 2 ( ⁇ 2) integrin, including humanized antibodies, and methods for their use.
  • the humanized antibodies may have human framework regions (FWs) and complementarity deteri lining regions (CDRs) from a non-human antibody, typically a mouse, specifically reactiv is with human ⁇ 2 integrin.
  • Nucleotide sequences encoding, and amino acid sequ ences comprising heavy and light chain antibodies are provided.
  • one or more of the CDR regions are derived from or based on the murine antibody secreted by the hybridoma clone, BHA2.1 [referred to herein as the TMC-2206 antibody].
  • anti- ⁇ 2 integrin antibodies include those that (a) bind to the I domain of ⁇ 2 integr n, (b) inhibit the function of ⁇ 2 integrin (e.g., collagen or laminin binding), (c) bind to ⁇ 2 integrin on resting platelets without inducing platelet activation and (d) recognize the b nding epitope of TMC-2206 (e.g., compete with TMC-2206 for the binding to ⁇ 2 integrin).
  • Such antibodies may bind preferentially to the inactive or closed conformation of the target ⁇ 2 integrin molecule without competing for the ligand binding site.
  • Unexpected advar tages of anti- ⁇ 2 integrin antibodies as described herein that bind preferentially to the closed conformation of the ⁇ 2 ⁇ 1 integrin and/or bind to ⁇ 2 ⁇ 1 integrin without competing far the ligand binding site include preventing potential p atelet activation, platelet aggregation, decreases in circulating platelet count and/or bl ⁇ ; eding complications in a treated subject.
  • Blooding complications refers to any adverse effect on blood levels and physiology, including platelet thrombotic responses, thrombocyto penia, increased time to clot, increased bleeding time and blood loss that limit therapeutic .ise of the anti- ⁇ 2 integrin antibody.
  • ⁇ 2 ⁇ 1 integrin is a molecule comprised of an ⁇ 2 integrin subunit (see, e.g., S : ⁇ Q ID NO:7, for DNA sequence and SEQ ID NO:8 for protein sequence of human ⁇ 2) frcm the family of alpha integrins, and a ⁇ 1 integrin subunit (see, e.g., SEQ ID NO:9 for DNA sequence and SEQ ID NO: 10 protein sequence of human ⁇ 1 ) from the family ol beta integrins, and may be from any subject including a mammal, but preferably is l orn a human.
  • the ⁇ 2 ⁇ 1 integrin may be purified from any natural source, or may be pro :luced synthetically (e.g., by use of recombinant DNA technology).
  • the nucleic acid coding sequences for ⁇ 2 integrin and for ⁇ 1 integrin are described in Takada and Hemler J. Cell Biol. 109(1 ):397-407 (1989; GenBank submission X17033; subsequently updated tc entry NM 002203) and Argraves, W.S, J. Cell. Biol. Sep 105(3): 1183-90 (1987; Ge ibank submission X07979.1 and related sequences representing alternatively spliced var ants), respectively.
  • the T domain of the ⁇ 2 ⁇ 1 integrin molecule refers to a region of this ⁇ 2 ⁇ 1 if tegrin molecule within the ⁇ 2 subunit, and is described, for example, in Kamata et a/., .J Biol. Chem. 269:9659-9663(1994); Emsley et a/., J. Biol. Chem. 272:28512 (1997) ar :i Cell 101 :47 (2000).
  • the amino acid sequence of a human I domain of ⁇ 2 integrin is shown as SEQ ID NO:11 (see also, e.g., SEQ ID NO: 107).
  • the I domain of ⁇ 2 integrin contains a MIDAS type of ligand binding site (Metal
  • the amino acid sequences for an I domain of ⁇ 2 integrin in rat shown as SEQ ID NO:9: ' ⁇ (see also, e.g., SEQ ID NO: 113) and in mouse shown as SEQ ID NO:94 (see also, e.g., SEQ ID NO:114) are shown in Table 28.
  • a TMC-2206 (BHA2.1 ) epitope refers to a region of the I domain of human ⁇ 2 integrin to which the TMC-2206 antibody binds. This epitope spans a iegion encompassing amino acid residues, K40, N73, Q89, Y93, R165, and N166 and optionally, other amino acid residues of the ⁇ 2 integrin I domain.
  • An ⁇ 2 integrin-associated disorder refers to a disorder, disease, or conditio n that involves ⁇ 2 integrin-dependent processes/function (e.g., binding, activity) that mediate aberrant cellular reactions within target tissue.
  • ⁇ 2 integrin-dep €indent processes involved in disease include collagen-dependent cellular responses such as those involved in increases in cytokine expression and proliferation, aspects of 1 -cell-, mast cell- and neutrophil-function, inflammatory disorders, mammary gland :luctal morphogenesis, epidermal wound healing, and angiogenesis.
  • ⁇ 2 integrin- associated disorders include, but are not limited to, inflammatory diseases or disorders including but not limited to inflammatory bowel disease (such as Crohn's diseas e and ulcerative colitis), reactions to transplant (including transplant rejection), optic neuritis, spinal cord trauma, rheumatoid arthritis, multiple sclerosis (including treatmont of neurological sequelae associated therewith as well as multiple sclerosis characterised by relapse), autoimmune diseases or disorders (including systemic lupus erythematosus (SLE), diabetes mellitus, Reynaud's syndrome, experimental autoirr mune encephalomyelitis, Sjorgen's syndrome, scleroderma), juvenile onset diabetes , and disorders associated with abnormal or higher than normal angiogenesis (such as diabetic retinopathy, age related macula degeneration, cardiovascular disease, psoriasis, rheumatoid arthritis and cancer) as well as infections that induce an inflamr iatory response.
  • Treatment of an ⁇ 2 ⁇ 1 integrin-associated disorder refers to both therapeui ic use and prophylactic or preventative use of the anti- ⁇ 2 integrin antibodies described I erein. Those in need of treatment include those already diagnosed with the disorder as v/ell as those in which the onset of the disorder is to be prevented or delayed.
  • a mammal including for purposes of treatment, refers to any animal classii ied as a mammal, including humans, domestic and farm animals, and zoo, sports or pet animals such as dogs, horses, cats, cows etc. Preferably, the mammal is human.
  • Intermittent or periodic dosing is a dosing that is continuous for a certain period of time and is at regular intervals that are preferably separated more than by one day.
  • the term antibody or immunoglobulin is used in the broadest sense, and covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, and antibody fragments so long as they exhibit the desired biological activity.
  • Antibody fragments comprise a portion of a full length ani body, generally an antigen binding or variable region thereof.
  • antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments, diabodies, linear antibodies, single chain antibody molecules, single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody frag ⁇ ents.
  • Antibody fragments can also refer to binding moieties comprising CDRs or a itigen binding domains including, but not limited to, VH regions (V H , V H -V H ), antkalins, PepBodiesTM, antibody-T-cell epitope fusions (Troybodies) or Peptibodies.
  • a monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (e.g., polyclonal) antibody preparations which typically include different antibodies directed against dilferent determinants (e.g., epitopes) on an antigen, each monoclonal antibody is directed ⁇ itjainst at least a single determinant on the antigen.
  • dilferent determinants e.g., epitopes
  • monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody l: ⁇ any particular method.
  • monoclonal antibodies may be made by the hybridoma method first described by Kohler et al., Nature 256:495 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567).
  • Monoclonal antibodies may also be isolated from phage antibody libraries, for example, using the techniques described in Clackson et al., Nature 352:624-628 (1991 ) and Marks et al., J. MoI. Biol.
  • Monoclonal antibodies can also be isolated using the techniques described in U.S. Patent Nos. 6,025,155 and 6,077,677 as well as U.S. Patent Application Publication Nos. 2002/0160970 and 2003/0083293 (see also, e.g., Lindenbaum, et al., Nucleic Acids Research 32 (21 ):0177 (2004)).
  • Monoclonal antibodies can include chimeric antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody cl nss or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so Ic ig as they exhibit the desired biological activity (see, e.g., U.S. Patent No. 4,816,567; and Morrison et al., Proc. Natl. Acad Sci. USA 81 : 6851-6855 (1984) for mouse-human chimeric antibodies).
  • a hypervariable region refers to the amino acid residues of an antibody which are responsible for antigen-binding.
  • the hypervariable region comprises amino acid re s dues from a complementarity determining region or CDR (e.g., residues 24-34 (L1 ), 50-5G (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (H1 ), 50-65 (H2) and 9 E5-1O2 (H3) in the heavy chain variable domain; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md.
  • CDR complementarity determining region
  • the CDR and framework regions are identified based on the Kabat numbering s ystem except that the CDR1 of the heavy chain is defined by Oxford Molecular's AbM del nition as spanning residues 26 to 35.
  • Oxford Molecular's AbM antibody modeling sortware http://people.cryst.cck.ac.uk/ ⁇ ubc07s/) (Martin et al., Proc. Natl Acad. Sci.
  • Humanized forms of non-human (e.g., murine) antibodies may be ch meric antibodies which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient or acceptor antibody) in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-human species (donor antibody) su ::h as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity.
  • donor antibody donor antibody
  • individual or groups of Fv framework region (FR) residues :>f the human immunoglobulin may be replaced by corresponding non-human res dues.
  • humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable regions or domains, in which all or substantially all of the hypervariable loops correspond to those of a non-r uman immunoglobulin and all or substantially all of the FR regions are those of a r uman immunoglobulin sequence.
  • the humanized antibody optionally also will comprise ai least a portion of an immunoglobulin constant region (e.g., Fc), typically that of a human immunoglobulin (see, e.g., Queen er a/., Proc. Natl. Acad. Sci. USA 86:10029 (1989), and Foote and Winter, J. MoI. Biol. 224: 487 (1992)).
  • Single-chain Fv or scFv antibody fragments may comprise the V H and V L ⁇ gions or domains of antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the V M and V L domains which enables the scFv to form the desired structure for antigen binding (for a review, see, e.g., Pluckthun in The Pharmacology of Monoclonal Antibodies, vol 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315 (1994)).
  • Diabody refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (V H ) connected to a light chain variable domain (V L ) in the same polypeptide chain (V H - V L ).
  • V H heavy chain variable domain
  • V L light chain variable domain
  • the domair s are forced to pair with the complementary domains of another chain and create two antigen- binding sites.
  • Diabodies are described more fully in, for example, EP 404,097', WO 93/11161 ; and Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993).
  • Linear antibody refers to antibodies such as those described in Zapata -it al., Protein Eng. 8(10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (V H -C H 1- V H -C H 1 ) which form a pair of antigen binding re gions. Linear antibodies can be bispecific or monospecific.
  • an isolated antibody refers to one which has been identified and separated und/or recovered from a component of its natural environment. Contaminant component of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinacecus or nonproteinaceous solutes.
  • the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, anci most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonrei lucing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
  • An epitope tagged antibody refers to one wherein the antibody of the invention is fused to an epitope tag.
  • the epitope tag polypeptide has enough residues to prov de an epitope against which an antibody thereagainst can be made, yet is short enougl such that it does not interfere with activity of the anti- ⁇ 2 ⁇ 1 integrin antibody.
  • the epitope tag preferably is sufficiently unique so that the antibody thereagainst does not substa itially cross-react with other epitopes.
  • Suitable tag polypeptides generally have at least 6 amino acid residues and usually between about 8-50 amino acid residues (preferably between about 9-30 residues).
  • Examples include the flu HA tag polypeptide and its antibody 12CA5 (Field et al., MoI. Cell. Biol. 8: 2159-2165 (1988)); the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto (Evan et al., MoI. Cell. Biol. 5(12):3610-3616 (1985)); and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody (Paborsky et al., Protein Engineering 3(6): 547-553 (1990)).
  • the epitope tag is a salvage receptor binding epitope which is an epitope of the Fc region of an IgG molecule (e.g., IgG 1 , IgG 2 , IgG 3 , or IgG 4 ) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
  • an IgG molecule e.g., IgG 1 , IgG 2 , IgG 3 , or IgG 4
  • a cytotoxic agent refers to a substance that inhibits or prevents the fund on of cells and/or causes destruction of cells.
  • The can include radioactive isotopes (e.g., 131 I, 125 I 1 90 Y and 186 Re), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof.
  • a non-cyt:)toxic agent refers to a substance that does not inhibit or prevent function of cells and/or does not cause destruction of cells.
  • a non-cytotoxic agent may include an agent that can be activated to become cytotoxic.
  • a non-cytotoxic agent may include a bead, liposome, matrix or particle (see, e.g., U.S.
  • a chemotherapeutic agent refers to a chemical compound useful in the treatment of cancer.
  • chemotherapeutic agents include but are not limil ud to Adriamycin, Doxorubicin, 5-Fluorouracil, Cytosine arabinoside ("Ai a-C"), Cyclophosphamide, Thiotepa, Taxotere (docetaxel), Busulfan, Cytoxin, Taxol, Methotrexate, Cisplatin, Melphalan, Vinblastine, Bleomycin, Etoposide, Ifosfemide, Mitomycin C, Mitoxantrone, Vincristine, Vinorelbine, Carboplatin, Tenip:)side, Daunomycin, Carminomycin, Aminopterin, Dactinomycin, Mitomycins, Esperamicini- (see U.S.
  • a prodrug refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form (sec e.g., Wilman, "Prodrugs in Cancer Chemotherapy” Biochemical Society Transactions, 14, pp. 375-382, 615th Meeting Harbor (1986) and Stella et al., "Prodrugs: A Chemical Approach to Targeted Drug Delivery,” Directed Drug Delivery, Borchardt et al., (ed.), pp. 24 ''-267, Humana Press (1985).
  • Prodrugs include, but are mot limited to, phosphate-conti-iining prodrugs, thiophosphate-containing prodrugs, sulfate-containing prodrugs, peiptide- containing prodrugs, D-amino acid-modified prodrugs, glycosylated prodrugs, ⁇ -l ⁇ ;tam- containing prodrugs, optionally substituted phenoxyacetamide-containing prodru gs or optionally substituted phenylacetamide-containing prodrugs, 5-fluorocytosine and ot ier 5- fluorouridine prodrugs which can be converted into the more active cytotoxic free drug.
  • cytotoxic drugs that can be derivatized into a prodrug form can be those chemotherapeutic agents described above.
  • a label refers to a detectable compound or composition which is conjugated or coupled directly or indirectly to the antibody.
  • the label may itself be detectable by itself (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
  • Solid phase refers to a non-aqueous matrix to which the antibody of the present invention can adhere. Examples of solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones.
  • the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column).
  • This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.
  • a liposome refers to a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such ⁇ i s the antibodies of the invention and, optionally, a chemotherapeutic agent) to a mammal.
  • a drug such ⁇ i s the antibodies of the invention and, optionally, a chemotherapeutic agent
  • the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
  • An isolated nucleic acid molecule refers to a nucleic acid molecule l iat is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the antibody nucleic acid.
  • an isolated nucleic acid molecule includes a rucleic acid molecule contained in cells that ordinarily express the antibody where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
  • a viral vector refers to a vehicle for the transfer of a nucleic acid (e.g. DNA or RNA) to cells through viral infection or transduction.
  • a nucleic acid e.g. DNA or RNA
  • examples of viral vectors include retroviruses, adenoviruses, pox viruses, and baculovirus.
  • a non-viral vector refers to a nucleic acid vehicle such as a CAN, plasm id or chromosome that is delivered to cells by non-viral methods such as electropo ⁇ ation, injections, and cationic reagent mediated transfection.
  • Expression control sequences refer to those DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site.
  • Eukaryotic cells are Y nown to utilize promoters, polyadenylation signals, and enhancers.
  • a nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotei n that participates in the secretion of the polypeptide; a promoter or enhancer is operably inked to a coding sequence if it affects the transcription of the sequence; or a ribosome b nding site is operably linked to a coding sequence if it is positioned so as to facilitate trans ation.
  • operably linked DNA sequences are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.
  • enhancers do not h ⁇ ve to be contiguous. Linking is accomplished by ligation at convenient restriction sites. I such sites do not exist, the synthetic oligonucleotide adaptors or linkers are us ed in accordance with conventional practice.
  • a further aspect of the present invention is the treatment of ⁇ 2 ⁇ 1 inlegrin- associated disorders by administering to a subject a nucleic acid molecule encoding an anti- ⁇ 2 integrin antibody of the invention.
  • Suitable methods of administration include gene therapy methods (see below).
  • a nucleic acid of the invention may be delivered to cells in vivo using methods such as direct injection of DNA, receptor-mediated DNA uptake, viral-me :liated transfection or non-viral transfection and lipid based transfection, all of which may involve the use of gene therapy vectors.
  • Direct injection has been used to introduce naked DNA into cells in vivo (see e.g., Acsadi et al. (1991 ) Nature 332:815-818; Wolff et al. ( 1990) Science 247:1465-1468).
  • a delivery apparatus e.g., a "gene gun" for injecting DMA into cells in vivo may be used.
  • Such an apparatus may be commercially available (e.g., from BioRad).
  • Naked DNA may also be introduced into cells by complexing the to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem. 263:14621 ; Wilson el al. (1S92) J. Biol. Chem. 267:963-967; and U.S. Pat. No. 5,166,320). Binding of the DNA ligand complex to the receptor may facilitate uptake of the DNA by receptor-mediated endocytosis.
  • a cation such as polylysine
  • a DNA-ligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into the cytoplasm may be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel el al. (1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci. USA 90:2122-2126).
  • Retroviruses are well characterized for use as gene therapy vecto s (for a review see Miller, A. D. (1990) Blood 76:271). Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Exa nples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art.
  • Suitable packaging virus lines include .psi.Crip, .psi.Cre, .psi.2 and .psi.Am.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for ex ample Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci.
  • an adenovirus may be manipulated so that it encodes and expresses a nucleic acid compound of the invention, but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991 ) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
  • Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus, are well known to those skilled in the art.
  • Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells (Lemarchand et al. (1992) Proc. Natl. Acad. Sci. USA 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin el al. (1992) Proc. Natl. Acad. Sci. USA 89:2581-2584).
  • Adeno-associated virus may be used as a gene therapy vector for de-livery of DNA for gene therapy purposes.
  • AAV is a naturally occurring defective virui; that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle (Muzyczka et al. Curr. Topics in Micro, and Immunol. (1992) 158:97-129).
  • AAV may be used to integrate DNA into non-dividinc; cells (see for example Flotte et al. (1992) Am. J. Respir. Cell. MoI. Biol. 7:349-356; Samu ski et al. (1989) J. Virol.
  • An AAV vector such as that described in Tratschin et al. (1985) MoI. Cell. Biol. 5:3251 -3260 may be used to introduce DNA into cells (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA 81 :6466-6470; Tratschin et al. (1985) MoI. Cell. Biol. 4:2072- 2081 ; Wondisford et al. (1988) MoI. Endocrinol. 2:32-39; Tratschin et al. (1984) J. Virol. 5" :611- 619; and Flotte et al. (1993) J. Biol. Chem. 268:3781-3790).
  • Lentiviral gene therapy vectors may also be adapted for use in the invention.
  • Cell, cell line, and cell culture are often used interchangeably and all such designations include progeny.
  • Transformants and transformed cells include the primary subject cell and cultures derived therefrom without regard for the num :>er of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
  • Humanized antibodies as described herein include antibodies that have va riable region frameworks derived from a human acceptor antibody molecule, hypervaria :>le or CDR sequences from a donor murine antibody, and constant regions, if present, derived from human sequences.
  • Antibodies of the present invention have been constructed comprising CDRi; from both the heavy chain variable and light chain variable regions of the murine moncdonal antibody clone BHA2.1 (Hangan et al., Cancer Res. 56:3142-3149 (1996)).
  • Preferred starting materials for constructing antibodies are anti- ⁇ 2 integrin antibodies such as those secreted by the BHA2.1 hybridoma (e.g., TMC-2206) that are function-blocking antibodies directed against human ⁇ 2 integrin and are dependent for binding and activity c n the presence of an intact l-domain within the targeted ⁇ 2 integrin.
  • antil odies with the epitope specificity of TMC-2206 (or BHA2.1 ), including antibodies which blind to the inactive conformation of the ⁇ 2 integrin molecule, and/or do not act as gand mimetics.
  • antibodies with the epitope specificity of TMC-2206 (or Bh A2.1) that, although they interact with ⁇ 2 ⁇ 1 integrin present on both leukocytes and pla elets, do not cause platelet activation, impair aggregation of activated platelets on collagen, have minimal or no effect on bleeding and/or are not associated with bl( sding complications at administered concentrations, including therapeutic doses in vivo.
  • Antibodies may be constructed wherein the human acceptor molecule for th u light chain variable region is selected based on homology considerations between po tential acceptor molecule variable regions and with the light chain variable region of the murine antibody. Germline candidate human acceptor molecules are preferred to reduce potential antigenicity. Germline databases are made up of antibody sequences th ⁇ il read through the end of the heavy chain FW3 region and partially into the CDR3 seqi ence. For selection of a FW4 region, it is preferred to search databases of mature an tibody sequences which have been derived from the selected germline molecule, and also preferred to select a reasonably homologous FW4 region for use in the recom binant antibody molecule.
  • Human acceptor molecules are preferably selected from the same light chain class as the murine donor molecule, and of the same canonical structural class of the variable region of the murine donor molecule. Secondary considerations for selection of the human acceptor molecule for the light chain variable region include homology in CDR length between the murine donor molecule and the human acceptor molecule. Human acceptor antibody molecules are preferably selected by homology searches to the V-BASE database, and other databases such as the Kabat and the public NCBI databases may be used as well.
  • a prelerred light chain human acceptor molecule is SEQ ID NO:37 with the germline antibody sequence A14 for the FW 1-3 region and the sequence FGQGTKVEIK for FW4 (S iEQ ID NO:38) which represents a common FW-4 of mature kappa 1 light chains (e.g., lighi chain sequence AAB24132 (NCBI entry gi/259596/gb/AAB24132).
  • Antibodies may be constructed wherein the human acceptor molecule for the heavy chain variable region is selected based on homology considerations be tween potential acceptor molecule variable regions and the heavy chain variable region of the murine antibody. Germline candidate human acceptor molecules are preferred to r sduce potential antigenicity. Germline databases are made up of antibody sequences thai read through the end of the heavy chain FW3 region and partially into the CDR3 sequence. For selection of a FW4 region, it is preferred to search databases of mature anlibody sequences which have been derived from the selected germline molecule, and also preferred to select a reasonably homologous FW4 region for use in the recombinant antibody molecule.
  • Human acceptor molecules are preferably selected from the same heavy chain class as the murine donor molecule, and of the same canonical structural class of the variable region of the murine donor molecule. Secondary considerations for selection of the human acceptor molecule for the heavy chain variable region ir elude homology in CDR length between the murine donor molecule and the human acceptor molecule. Human acceptor antibody molecules are preferably selected by hort ology search to the V-BASE database, although other databases such as the Kabat and the public NCBI databases may be used as well.
  • a pre : erred heavy chain acceptor molecule is SEQ ID NO:39 with the germline antibody sequence 4- 59 for the FW 1-3 region (SEQ ID NO: 12) and antibody, CAA48104.1 (NCBI entry, gi/33583/emb/CAA48104.1 ) a mature antibody derived from the 4-59 germline sequence for the FW 4 region (SEQ ID NO: 13) (http://www.ncbi.nlm.nih.gov).
  • Methods for humanizing a nonhuman ⁇ 2 integrin antibody are described herein, including in the Examples below.
  • the nonhuman antibody starting material is obtained, including by preparation from immunization or by purchase of commercially available antibodies. Exenplary techniques for generating antibodies are described herein.
  • the ⁇ 2 ⁇ 1 integrin antigen to be used for production of antibodies may t:e, for example, a soluble form of ⁇ 2 ⁇ 1 integrin or other fragment of ⁇ 2 ⁇ 1 integrin (e.g., an ⁇ 2 ⁇ 1 integrin fragment comprising a human ⁇ 2 integrin l-domain (SEQ ID NO: 11 ); see also, e.g., SEQ ID NO: 107).
  • Other forms of ⁇ 2 integrin useful for generating antibodies "/ill be apparent to those skilled in the art based on the sequence of ⁇ 2 integrin (e.g., a f uman ⁇ 2 integrin as in SEQ ID NO:8).
  • Animals may be immunized against the antigen, immunogenic conjugates, or derivatives by combining the antigen or conjugate (e.g., 100 ⁇ g for rabbits or 5
  • the animals are boosted with the antigen or conjugate (e.g., with 1/5 to 1/10 of the original amount used to immunize) in Fround's complete adjuvant by subcutaneous injection at multiple sites.
  • Seven to 14 days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus.
  • the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or thrc jgh a different cross-linking reagent.
  • Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to en iance the immune response.
  • Monoclonal antibodies may be made using the hybridoma method first des cribed by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA m ⁇ : thods (e.g., U.S. Patent No. 6,204,023). Monoclonal antibodies may also be made using the techniques described in U.S. Patent Nos. 6,025,155 and 6,077,677 as well as U.S. Patent Application Publication Nos. 2002/0160970 and 2003/0083293 (see also, e.g., Lindenbaum, et al., Nucleic Acids Research 32 (21 ):0177 (2004)).
  • a mouse or other appropriate host animal such as a rat, hamster or monkey
  • is immunized e.g., as hereinabove described
  • lymphocytes may be immunized in vitro.
  • Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (see, e.g., Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).
  • the hybridoma cells thus prepared are seeded and grown in a suitable c ulture medium that preferably contains one or more substances that inhibit the grov.th or survival of the unfused, parental myeloma cells.
  • a suitable c ulture medium that preferably contains one or more substances that inhibit the grov.th or survival of the unfused, parental myeloma cells.
  • the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the grourth of HGPRT-deficient cells.
  • Preferred myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium.
  • preferred myeloma cell lines are r iurine myeloma lines, such as those derived from MOP-21 and M.C.-11 mouse tumors available from the SaIk Institute Cell Distribution Center, San Diego, Calif. USA, and SP-2 oi X63- Ag8-653 cells available from the American Type Culture Collection, Rockville, Md. USA.
  • Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (e.g., Kozbor, J. Immunol., 133 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).
  • [125] Culture medium in which hybridoma cells are growing is assayed for produclion of monoclonal antibodies directed against the antigen.
  • the binding specifi city of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can be determined, for exa mple, by the Scatchard analysis of Munson et al., Anal. Biochem., 107: 220 (1980).
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).
  • Suitable culture media fcr this purpose include, for example, D-MEM or RPMI-1640 medium.
  • the hybr doma cells may be grown in vivo as ascites tumors in an animal.
  • the monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purifi cation procedures including, for example, protein A chromatography, hydrophobic inter nction chromatography, hydroxylapatite chromatography, gel electrophoresis, dialysis, ⁇ nd/or affinity chromatography.
  • DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the monoclonal antibodies).
  • the hybridoma cells serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfectc d into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells, including those that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • Recom :>inant production of antibodies is described in further detail below.
  • Such variants include, for example, deletions from, and/or insertions into and/or substitutions of, residues within the .-imino acid sequences shown for the anti- ⁇ 2 integrin antibody TMC-2206 (e.g., derived fr :>m or based on variable region sequences as shown in SEQ ID NOS: 19 and 21 ). Any combination of amino acid deletion, insertion, and substitution is made to arrive ; ⁇ t the final construct, provided that the final construct possesses the desired charactei istics.
  • the amino acid changes also may alter post-translational processes of the hum? nized anti- ⁇ 2 integrin antibody, such as changing the number or position of glycosylation s.ites.
  • Patent No. 6,548,640 The six CDR loops are presented in a cluster, and based on crystallographic analysis, critical framework re; idues within the so-called "Vernier" zone flanking the CDRs or in the heavy-light chain interface can be readily identified (see, e.g., Chothia and Lesk, J. MoI. Biol. 196(4):901-17 ( 987); Chothia et al., J. MoI. Biol. 186(3):651-63 (1985); Chothia et al, Nature 342(6252):S 77-83 (1989)).
  • Exemplary heavy chain residues which may be substituted in a humanized anti- ⁇ x2 integrin antibody include any one or more of the following framework residue numbers: H37, H48, H67, H71 , H73, H78 and H91 (Kabat numbering system). Preferably a : least four of these framework residues are substituted.
  • a particularly preferable iset of substitutions for the heavy chain in humanized anti- ⁇ 2 integrin antibodies as exemplified herein is H37, H71 , H73 and H78.
  • residues in the light chain can ah.o be substituted.
  • Exemplary light chain residues for substitution include any one or rmre of the following residue numbers: L1 , L2, L4, L6, L46, L47, L49 and L71.
  • a : least three of these framework residues are substituted.
  • a particularly preferable ;et of substitutions for the light chain in humanized anti- ⁇ 2 integrin antibodies as exemplified herein is L2, L46 and L49.
  • a useful method for identification of certain residues or regions of a humanized anti- ⁇ 2 integrin antibody that are preferred locations for mutagenesis is called "a lanine scanning mutagenesis" (see, e.g., Cunningham and Wells Science, 244: 1081 -1085 (1989)).
  • a residue or group of target residues are identified (e.g., charged residues such as arg, asp, his, lys, and glu) and replaced by a neutral or negatively charged -iimino acid (preferably alanine or polyalanine) to affect the interaction of the amino acid ;; with ⁇ 2 ⁇ 1 integrin antigen.
  • Those amino acid locations demonstrating functional sensitivity to the substitutions then are refined by introducing further or other variants at, or for, the sites of substitution.
  • the site for introducing an amino acid sequence va ⁇ ation is predetermined, the nature of the mutation per se need not be predetermined .
  • ala scann ng or random mutagenesis is conducted at the target codon or region and the expressed humanized anti- ⁇ 2 integrin antibody variants are screened for the desired activity.
  • Amino acid sequence insertions include amino- and/or carboxyl-terminal fi.sions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
  • terminal insertions include a humanized anti- ⁇ 2 integrin antibody with un N- terminal methionyl residue or the antibody fused to an epitope tag.
  • Other inseitional variants of a humanized anti- ⁇ 2 integrin antibody molecule include the fusion to the N- or C-terminus of a humanized anti- ⁇ 2 integrin antibody of an enzyme or a polypeptide ⁇ /hich increases the serum half-life of the antibody (see below).
  • variants Another type of variant is an amino acid substitution variant. These variants, have at least one amino acid residue in a humanized anti- ⁇ 2 integrin antibody molecule removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis include the hypervariable loops, but framework alterations are also contemplated. Hypervariable region residues or framework residues involved in antigen binding are generally substituted in a relatively conservative manner. Such conservative substitutions are shown below under the heading of "pre f erred substitutions”. If such substitutions result in a change in biological activity, then more substantial changes, denominated "exemplary substitutions" or as further described below in reference to amino acid classes, are introduced and the products screened.
  • Substantial modifications in the biological properties of the antibody are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • Naturally occurring residues are divided into groups based on common side-chain properties: (1 ) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acidic: as
  • Non-conservative substitutions will entail exchanging a member of one of lhese classes for another class. Any cysteine residue not involved in maintaining the ⁇ roper confirmation of a humanized anti- ⁇ 2 integrin antibody also may be substituted, gererally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) may be added to the antibody to improve its stability (particularly where the antibody is an antibody fragment such as an Fv fragment).
  • Another type of amino acid variant of the antibody alters the original glycos> ( ation pattern of the antibody. By altering is meant deleting one or more carbohydrate m ⁇ iieties found in the antibody and/or adding one or more glycosylation sites that are not prej ent in the antibody.
  • N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine re ;.idue.
  • the tripeptide sequences asparagine-X-serine and asparagine-X-threonine, when : X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain.
  • X is any amino acid except proline
  • O- linked glycosylation refers to the attachment of one of the sugars N-aceylgalactosc mine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used.
  • glycosylation sites to the antibody is conveniently accomplished by altering the amino acid sequence such that it contains or lacks ( me or more of the above-described tripeptide sequences (for N-linked glycosylation sites) The alteration may also be made by the addition of, substitution by, or deletion of, one oi more serine or threonine residues to the sequence of the original antibody (for O- linked glycosylation sites).
  • Nucleic acid molecules encoding amino acid sequence variants of humanized anti- ⁇ 2 integrin antibody are prepared by a variety of methods known in the art.
  • These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, or ca ssette mutagenesis of an earlier prepared variant or a non-variant version of humanized a iti- ⁇ 2 integrin antibody.
  • amino acid sequence variants of a humanized anti- ⁇ 2 integrin ant ibody will have an amino acid sequence having at least 75% amino acid sequence identii / with the original humanized antibody amino acid sequences of either the heavy or the light chain (e.g., variable region sequences as in SEQ ID NO:21 or SEQ ID MO: 19, respectively), more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and most preferably at least 95%, including for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
  • sequence identity is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the humanized anti- ⁇ 2 integrin residues, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions (as described above) as part of the sequence identity. None of N-terminal, C-terminal, or internal extensions, deletions, or insertions into the antibody sequence shall be construed as affecting sequence identity or homology. Thus sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides.
  • two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences, or along a pre-determined portion of one or both sequences).
  • the programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM250 (a standard scoring matrix; see Dayhoff et al., in Atlas of Protein Sequence and Structure, vol 5, supp. 3 (1978)) can be us sd in conjunction with the computer program.
  • the percent identity can the be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the num :>er of gaps introduced into the longer sequences in order to align the two sequences.
  • Antibodies having the characteristics identified herein as being desirable! in a humanized anti- ⁇ 2 integrin antibody are screened for by methods as described herein.
  • methods for screening candidate anti- ⁇ 2 integrin antibodies for pre erred characteristics and functionalities include screening for antibodies ⁇ /hich bind to the epitope on ⁇ 2 ⁇ 1 integrin bound by an antibody of interest (e.g., those .vhich compete with, inhibit or block binding of the TMC-2206 antibody to ⁇ 2 ⁇ 1 integrin).
  • an antibody of interest e.g., those .vhich compete with, inhibit or block binding of the TMC-2206 antibody to ⁇ 2 ⁇ 1 integrin.
  • Exemplary methods and materials are described in Example 13. Cross-blocking a ssays can be performed and are described, for example, in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988).
  • epitope mapping for example, as described in Champe et al., J. Biol. Chem.
  • Immobilized ⁇ 2 ⁇ 1 integrin can similarly be used to determine relative binding potencies by measuring K 1 values in competition assays (see, e.g., Example 2).
  • fluorescently labeled Eu-TMC-2206 is used in the presence of vi-irying concentrations of unlabeled candidate antibody, for example, using an assay system similar to that described above. Following a specified incubation time, the amount of bound Eu-TMC-2206 is determined.
  • the inhibition curves are fitted with the "oris site competition" model using Prism software (GraphPad, Inc. CA) to obtain IC 50 values iand to calculate the K, using the equation of Cheng and Prusoff (Biochem, Pharmacol. 22(23):3099-108(1973)).
  • Labeled cells are prepared and the cell concentration is adjusted; ce Is are kept in the dark until used.
  • a collagen-coated plate (rat-tail collagen Type I; BD Biosciences) is prepared and each serially diluted antibody solution is added Io the collagen plate. Labeled cells are then added to the well and the plate is incubated. After washing, cells are lysed and the fluorescence intensity (excitation, 485 nm; emission, 535 nm) is read. The inhibitory activity of each antibody is calculated. [147] Additionally, binding constants of the candidate antibodies for the immobilized ⁇ 2 ⁇ 1 integrin ligand can be calculated as described in Example 2.
  • Wells in a 9 :> well microtiter plate are coated with platelet ⁇ 2 ⁇ 1 -integrin (custom-coated with human p atelet ⁇ 2 ⁇ 1 by GTI Inc., Wl) and then blocked.
  • platelet ⁇ 2 ⁇ 1 -integrin custom-coated with human p atelet ⁇ 2 ⁇ 1 by GTI Inc., Wl
  • fluorescently labeled TMC-2206 or isotype control IgG antibody are used (see Examples below).
  • the fluorescently labeled antibody, inc uding Eu-TMC-2206 or Eu-isotype control IgG is applied to the blocked ⁇ 2 ⁇ 1 -integrin microtiter plates.
  • TMC-2206 derivatives including humanized antibodies derived from or based on TMC-2206
  • Ki value in a competition i ⁇ ssay.
  • Eu-labelled TMC-2206 is added to ⁇ 2 ⁇ 1 -coated wells in the presence of unlabelled anti- ⁇ 2 integrin antibodies, including TMC-22I06 or chimeric (including humanized) antibodies derived from or based on TMC-22C6, or isotype control IgG antibody at various concentrations. After a period of incubation to reach equilibrium, the wells are washed and the bound labeled antibody level :; are measured as retained Eu label in each well.
  • the Ki value can be derived from the EC50 values using the Ko value obtained for the Eu-TMC-2206 antibody by the direct binding studies as described above.
  • the humanized anti- ⁇ 2 integrin antibody is an anlibody fragment.
  • anlibody fragment Various techniques have been developed for the production of anlibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Meilhods 24: 107-117 (1992) and Brennan et al., Science 229: 81 (1985)). However, lhese fragments can be produced directly by recombinant host cells, such as bacteria (see, e.g., Better et al., Science 240(4855): 1041 -1043 (1988); U.S. Patent No. 6,204,023.
  • Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab') 2 fragments (Carter et al., Bio/Technology 10: 163-167 (1 1)92)).
  • F(ab') 2 fragments can be isolated directly from recombinant host cell culture.
  • Other techniques for the production of antibody fragments will be apparent to the skilled practitioner.
  • multispecific humanized anti- ⁇ 2 integrin antibodies having binding specificities for at least two different epitopes.
  • Exemplary bispecific antibodies e.g., with two different binding arms
  • an anti- ⁇ 2 integrin arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD2 or CD3), or Fc receptors for IgG (Fc ⁇ R), such as Fc ⁇ R1 (CD64), Fc ⁇ RII (CD32) and Fc ⁇ RIII (CD16) so as to focus cellular defense mechanisms on a cell which has ⁇ 2 ⁇ 1 integrin bound to its surface.
  • Bispecific antibodies can be used to localized cytotoxic agents to cells with ⁇ 2 ⁇ 1 integrin bound to their surface.
  • bispecific antibodies possess a ⁇ 2 ⁇ 1 integrin binding arm and an arm .vhich binds the cytotoxic agent (e.g., gelonin, saporin, anti-interferon alpha, vinca alkaloid ricin A chain, or radioisotope hapten).
  • cytotoxic agent e.g., gelonin, saporin, anti-interferon alpha, vinca alkaloid ricin A chain, or radioisotope hapten.
  • Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g., F(ab') 2 bispecific antibodies).
  • the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture.
  • the preferred interface comprises at least a part of the CH3 domain of an antibody constant domain.
  • one or more small amino acid side chains are replaced with larger side chains (e.g., tyrosine or tryptophan).
  • Compensatory cavities of identical or smaller size :o the large side chain(s) are created on the interface of the second antibody by replacin ⁇ i large amino acid side chains with smaller ones (e.g., alanine or threonine).
  • This provi des a mechanism for increasing the yield of the heterodimers over other unwanted end- products such as homodimers (see, e.g., WO96/27011 ).
  • Bispecific antibodies include cross-linked or heteroconjugate antibodies
  • one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin.
  • Heteroconjugate antibodies may be made using any convenient cross-l inking methods. Suitable cross-linking agents are well known in the art, and are disclosed, for example, in U.S. Patent No. 4,676,980 along with a number of cross-linking techniques.
  • Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. Bispecific antibodies can be prepared using chemical linkage.
  • Fab'-SH fragments recovered from E. coli, can be chemically coupled tc: form bispecific antibodies.
  • Shalaby et al. (J. Exp. Med. 175:217-225 ( 992)) describe the production of a fully humanized bispecific antibody F(ab') 2 molecule.
  • each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody.
  • the bispecific antibody thus formed was able to bind to cells overexpressing the HER2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.
  • bispecific antibodies have been produced using leucine zippers (see, e.g., Kostgelny et al., J. Immunol. 148(5): 1547-1553 (1992)).
  • the leucine zipper peptides from the Fos an :i Jun proteins were linked to Fab' portions of two different antibodies by gene fusion.
  • the antibody homodimers were reduced at the hinge region to form monomers and then re- oxidized to form antibody heterodimers. This method can also be utilized for the production of antibody heterodimers.
  • the diabody technology has provided an alternative mechanism for making bispecific antibody fragments.
  • the fragments comprise a heavy chain variable region (VH) connected to a light-chain variable region (VL) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the VI I and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites.
  • bispecific antibody fragments by the use of single-chain Fv (JIFV or scFv) dimers also has been reported (see, e.g., Gruber et al., J. Immunol. 1521:5368 (1994)).
  • the bispecific antibody may be a linear antibody, for example, produced as described in Zapata et al., Protein Eng. 8(10):1057-1062 (1995).
  • Antibodies with more than two valencies are contemplated.
  • trispecific antibodies can be prepared (see, e.g., Tutt et al., J. Immunol. 147:60 (1991 )).
  • Homodimeric antibodies with enhanced antkumor activity may also be prepared using heterobifunctional cross-linkers (see, e.g., those described in Wolff et al., Cancer Research 53:2560-2565 (1993)).
  • an antibody can be engineered which has dual Fc regions and may thereby have enhanced CMC and/or ADCC capabilities (see, e.g., Stevenson et al., Anti-Cancer Drug Design 3:219-230 (1989)).
  • Immunoconjugates comprising a humanized anti- ⁇ 2 integrin antibody conjugated to a moiety, e.g., a molecule, composition, complex, or agent, for example a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active tocin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope (e.g., a radioconjugate), for the targeting of the agent to an anti- ⁇ 2 integrin-exp ⁇ ssing cell, tissue or organ.
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active tocin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope (e.g., a radioconjugate)
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g
  • Enzymatically active toxins and fragments thereof which can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin or the tricothecenes.
  • a variety of radionuclides are available for the production of radioconjugated anti-alpha 2 integrin antibodies. Examples include 212 Bi, 131 In, 3 Y or 186
  • Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as di ⁇ ethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as gluteraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), or bis-active fluorine compounds (such as 1 ,5-difluoro-2,4-dinitrobenzene).
  • SPDP N-succinimi
  • a ricin immunotoxin can be prepared as described in Vitetta et ai, Science 238:1098 (1987).
  • Carbon-14-labeled 1- isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) s an exemplary chelating agent for conjugation of radionuclide to the antibody (see, e.g., WO94/11026).
  • the antibody may be conjugated to a receptor (such as streptavidin) for utilization in pretargeting ⁇ 2 integrin-expressing cell, tissue or organ wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent anc! then administration of a ligand (e.g., avidin) which is conjugated to an agent, for example a cytotoxic agent (e.g., a radio-nuclide).
  • a receptor such as streptavidin
  • a ligand e.g., avidin
  • an agent for example a cytotoxic agent (e.g., a radio-nuclide).
  • the anti- ⁇ 2 integrin antibodies disclosed herein may also be formulated as immunoliposomes.
  • Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688 ( 1985); Hwang et al., Proc. Natl. Acad. Sci. USA 77: 4030 (1980); and U.S. Patenl Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed i n U.S. Patent No. 5,013,556.
  • Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG- derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. Fab' fragments; of an anti-oc2 integrin antibody can be conjugated to the liposomes as described in Martin et al., J. Biol. Chem. 257: 286-288 (1982) via a disulfide interchange reaction.
  • a chemotherapeutic agent ⁇ e.g., doxorubicin is optionally contained within the liposome (see, e.g., Gabizon et al., J. National Cancer Inst. 81(19): 1484 (1989)).
  • Humanized anti- ⁇ 2 integrin antibodies may also be used in Antibody Directed Enzyme Prodrug Therapy (ADEPT) by conjugating the antibody to a prodrug-acth/ating enzyme which converts a prodrug (e.g., a peptidyl chemotherapeutic agent, see e.g., WO81/01145) to an active drug, (see, e.g., WO88/07378 and U.S. Patent No.
  • ADEPT Antibody Directed Enzyme Prodrug Therapy
  • the enzyme component of the immunoconjugate useful for ADEPT includes any enzyme capable of acting on a prodrug in such a way so as to covert it into its more active* form.
  • Enzymes that are useful include, but are not limited to, alkaline phosphatase useilul for converting phosphate-containing prodrugs into free drugs; arylsulfatase usef .il for converting sulfate-containing prodrugs into free drugs; cytosine deaminase usul for converting non-toxic 5-fluorocytosine into the anti-cancer drug, 5-fluorouracil; protoases, such as serratia protease, thermolysin, subtilisin, carboxypeptidases and cathopsins (such as cathepsins B and L), that are useful for converting peptide-containing prc: drugs into free drugs; D-alanylcarboxypeptidases, useful for converting prodrugs that contnin D- amino acids
  • antibodies with enzymatic activity can be used to convert the prodrugs of the invention into free active drugs (see, e.g., Massey, Nature 328: 457-458 (1987)).
  • Enzymes may be covalently bound to the anti- ⁇ 2 integrin antibodies by techniques well known in the art, including the use of the heterobifunctional crossl nking reagents discussed above.
  • fusion proteins comprising at least the antigen binding region of an anti-cc2 integrin antibody linked to at least a functionally active portion of an enzyme can be constructed using recombinant DNA techniques well known in the art (see, e.g., Neuberger et al., Nature 312: 604-608 (1984)).
  • an an :ibody fragment rather than an intact antibody, for example, to increase tissue or lumor penetration. It may also be desirable to modify the antibody fragment in order to increase its serum half-life. This may be achieved by incorporation of a salvage receptor b nding epitope into the antibody fragment, for example, by mutation of the appropriate re ⁇ : ion in the antibody fragment or by incorporating the epitope into a peptide tag that is then fused to the antibody fragment at either end or in the middle, for example, by DNA or peptide synthesis (see, e.g., WO96/32478).
  • Covalent modifications of the humanized anti- ⁇ 2 integrin antibodies may be made, for example, by chemical synthesis or by enzymatic or chemical cleavage of the ani body. Other types of covalent modifications of the antibody are introduced into the molec .lie by reacting targeted amino acid residues of the antibody with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C-terminal res dues. Cysteinyl residues, for example, most commonly are reacted with ⁇ -haloacetate ⁇ (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives.
  • Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, ⁇ -bromo- ⁇ -(5-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2- pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or ch bro-7- nitrobenzo-2-oxa-1 ,3-diazole.
  • Histidyl residues are derivatized by re notion with diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively specific 1 :>r the histidyl side chain.
  • Para-bromophenacyl bromide also is useful; the reaction is prei -srably performed in 0.1 M sodium cacodylate at pH 6.0.
  • Lysinyl and amino-terminal res idues for example, are reacted with succinic or other carboxylic acid anhydrides. Derivat nation with these agents has the effect of reversing the charge of the lysinyl residues.
  • Suitable reagents for derivatizing ⁇ -amino-containing residues include imidoeste ⁇ ; such as methyl picotinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitrobenzenesulfonic acid, O-methylisourea, 2,4-pentanedione, and transam nase- catalyzed reaction with glyoxylate.
  • Arginyl residues for example, are modified by reaction with one or several conventional reagents, among them phenylglyoxa , 2,3- butanedione, 1 ,2-cyclohexanedione, and ninhydrin.
  • arginine res idues requires that the reaction be performed in alkaline conditions because of the high ⁇ K a of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
  • Tyrosyl residues are specifically modified with particular interest in introducing spectral labels into i /rosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively.
  • Tyrosyl residues are iodinated using 125 I or 131 I to prepare labeled proteins for use in radioimmunoassay.
  • aspartyl and glutamyl residues are converted to asparaginyl and glutei minyl residues by reaction with ammonium ions.
  • Glutaminyl and asparaginyl residue ⁇ s are frequently deamidated to the corresponding glutamyl and aspartyl residues, respec tively. These residues are deamidated under neutral or basic conditions. The deamidatec form of these residues falls within the scope of this invention.
  • Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or thieonyl residues, methylation of the ⁇ -amino groups of lysine, arginine, and histidine side chains (T. E.
  • Another type of covalent modification involves chemically or enzymalically coupling glycosides to the antibody. These procedures are advantageous in that tt sy do not require production of the antibody in a host cell that has glycosylation capableiti es for N- or O-linked glycosylation.
  • the sugar(s) may be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteine, (d) free hydroxyl groups such as those of serine, threonine, or hydroxyproline, (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan, or (f) the amide group of glutamine (see, e.g., WO87/05330; Aplii i and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981 )).
  • Enzymatic cleavage of carboh /drate moieties on antibodies can be achieved by the use of a variety of endo- and exo- glycosidases, (see, e.g., Thotakura et al., Meth. Enzymol. 138: 350 (1987)).
  • Another type of covalent modification of the antibody comprises linking the antibody to one of a variety of nonproteinaceous polymers, such as polyethylene glycol, polypropylene glycol, or polyoxyalkylenes (see, e.g., U.S. Patent Nos. 4,640,835; 4,496,689; 4,301 ,144; 4,670,417; 4,791 ,192 or 4,179,337).
  • nucleic acid(s) encoding a humanized anti- ⁇ 2 integrin antibody as well as vectors and host cells comprising the nucleic acid, and recombinant techniques lor the production of the antibody are described herein.
  • the nucleic acid(s) encoding the antibody are isolated and inserted nto a replicable vector for further cloning (amplification of the DNA) or for expression.
  • DNA encoding the antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).
  • Many vectors are available .
  • the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
  • An anti- ⁇ 2 integrin antibody may be produced recombinantly, including as a usion polypeptide with a heterologous polypeptide, which is preferably a signal sequer ce or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
  • the heterologous signal sequence selected preferably is one that is recognized and processed (e.g., cleaved by a signal peptidase) by the host cell.
  • a prokaryotic signal sequence including, for example, pectate lysase (such as :>elB), alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin Il leaders.
  • a yeast signal sequence may be utilized, including, for example, the yeast invertase leader, a factor leader (including Saccharomyces and Kluyveromyces ⁇ - factor leaders), or acid phosphatase leader, the C.
  • albicans glucoamylase leader or the signal described in WO90/13646.
  • mammalian signal sequences as well as viral secretory leaders for example, the herpes simplex gD signa , are available and may be utilized.
  • the DNA for such a precursor region e.g., the isignal sequence
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells.
  • this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences.
  • origins of replication or autonomously replicating sequences are well known for a variety of bacteria, yeast, and viiuses.
  • the origin of replication from the plasmid pBR322 is suitable for most ; ⁇ ram- negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.
  • the origin of replication component is not needed for mammalian expression vectors (e.g., the SV40 origin may typically be used only because it contains the early promoter).
  • Expression and cloning vectors may contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracyclin e, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, (e.g., the gene encoding D-alanine racemase for Bacilli).
  • One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs methotrexate, neomycin, histidinol, puro ⁇ ycin, mycophenolic acid and hygromycin.
  • Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the anti- ⁇ 2 integrin anhbody nucleic acid, such as DHFR, thymidine kinase, metallothionein-l and -II, prefi-rably primate metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.
  • DHFR thymidine kinase
  • prefi-rably primate metallothionein genes adenosine deaminase, ornithine decarboxylase, etc.
  • DHFR selection gene are first identified by culturing all of the transformants in a culture medium that contains methotrexate
  • DH f 1 R Chinese hamster ovary
  • host cells particularly wild-type hosts that contain endogi-nous DHFR transformed or co-transformed with DNA sequences encoding anti- ⁇ 2 inlegrin antibody, wild-type DHFR protein, and another selectable marker such as aminoglycoside 3'-phosphotransferase (APH) can be selected by cell growth in medium contairing a selection agent for the selectable marker, including an aminoglycosidic antibiotic, such as kanamycin, neomycin, or G418 (see e.g., U.S. Patent No. 4,965,199).
  • APH aminoglycoside 3'-phosphotransferase
  • trp1 One suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 (Stinchcomb et al., Nature, 282: 39 (1979)).
  • the trp1 gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptopha n, for example, ATCC No. 44076 or PEP4-1 (see, e.g., Jones, Genetics, 85: 12 (1977)).
  • the presence of the trp1 lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are complemenled by known plasmids bearing the Leu2 gene.
  • vectors derived from the 1.6 ⁇ circular plasmid pKD1 can be us.ed for transformation of Kluyveromyces yeasts.
  • an expression system for large- scale production of recombinant calf chymosin was reported for K. lactis by Va i den Berg, Bio/Technology, 8:135 (1990).
  • Stable multi-copy expression vectors for secre ion of mature recombinant human serum albumin by industrial strains of Kluyveromyces have also been disclosed (see, e.g., Fleer et al., Bio/Technology, 9: 968-975 (1991)).
  • Expression and cloning vectors usually contain a promoter that is recogni2 ed by the host organism and is operably linked to the anti- ⁇ 2 integrin antibody nucleic; acid.
  • Promoters suitable for use with prokaryotic hosts include the arabinose promoter (e.g., araB), phoA promoter, ⁇ -lactamase and lactose promoter systems, alkaline phosphatase, a tryptophan (trp) promoter system, and hybrid promoters such as the tac promoter.
  • arabinose promoter e.g., araB
  • phoA promoter phoA promoter
  • ⁇ -lactamase and lactose promoter systems alkaline phosphatase
  • trp tryptophan
  • hybrid promoters such as the tac promoter.
  • other known bacterial promoters are suitable.
  • Promoters for use in ba ::terial systems also will contain a Shine-Dalgamo (S. D
  • Promoter sequences are known for eukaryotes. Most eukaryotic genes h ⁇ ive an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated. Another sequence found 70 to 80 bases upstream from th ⁇ ⁇ start of transcription of many genes is a CNCAAT (SEQ ID NO: 115) region where N m ay be any nucleotide. At the 3' end of most eukaryotic genes is an AATAAA (SEQ ID Nd: 116) sequence that may be the signal for addition of the poly A tail to the 3' end of the ( oding sequence.
  • promoter sequences for use with yeast hosts include b .it are not limited to the promoters for 3-phosphoglycerate kinase or other glycolytic enz'/mes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyi uvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • promoters for use with yeast hosts include b .it are not limited to the promoters for 3-phosphoglycerate kinase or other glycolytic enz'/mes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyi
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, ai 8 the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothiunein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
  • Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
  • Yeast enhancers also are advantageously used with yeast promoters.
  • Anti- ⁇ 2 integrin antibody transcription from vectors in mammalian host culls is controlled, for example, by promoters obtained from the genomes of viruses su ::h as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma */irus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus or Simian Virjs 40 (SV40), from heterologous mammalian promoters, for example, the actin promoter or an immunoglobulin promoter, from heat-shock promoters, provided such promoter;; are compatible with the host cell systems.
  • promoters obtained from the genomes of viruses su ::h as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma */irus, avian sarcoma virus, cytomegalo
  • the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV4 ⁇ viral origin of replication.
  • the immediate early promoter of the human cytomegalovi r us is conveniently obtained as a Hind ⁇ E restriction fragment.
  • a system for expressin ⁇ i DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed ir U.S. Patent No. 4,419,446, and a modification of this system is described in U.S. Pate fit No.
  • Examples include the SV40 enhancer on the late side of the replication orig in (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer ⁇ :n the late side of the replication origin, and adenovirus enhancers (see, also, e.g., Yaniv, Nature 297: 17-18 (1982) on enhancing elements for activation of eukaryotic promoters).
  • the enhancer may be spliced into the vector at a position 5 1 or 3' to the anti- ⁇ 2 inlegrin antibody-encoding sequence, but is preferably located at a site 5' from the promoter.
  • Other gene regulation systems well known in the art (e.g. inducible systems, su ::h as tetracycline inducible systems and GeneSwitchTM) can be used to control the transci ption of DNA encoding an anti- ⁇ 2 integrin.
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mlRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding an anti- ⁇ 2 integrin antibody.
  • One useful transcription termination component is the bovine growth hormone polyadenylation region (see, e.g., WO94/ 11026 and the expression vector disclosed therein).
  • Suitable host cells for cloning or expressing the DNA in the vectors herein a re the prokaryote, yeast, or higher eukaryote cells as described above.
  • Suitable prokaryoles for this purpose include eubacteria, including gram-negative or gram-positive organisms, for example, Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, E ⁇ vinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B.
  • Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, E ⁇ vinia, Klebsiella, Proteus
  • Salmonella e.g., Salmonella typhimurium
  • E. coli cloning hosts include E. coli 294 (ATCC 31 ,446), E. coli B, E. coli X1776 (ATCC 31 ,537), and F. coli W3110 (ATCC 27,325).
  • eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for anti-alpha 2 integrin antibody-encoding vectors.
  • Saccharomyces cerevisiae or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms.
  • a number of other genera, species, and strains are commonly available and useful, such as Schizosaccharoriyces pombe; Kluyveromyces hosts including K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. WaItH (AJCC 56,500), K.
  • drosopMarum ATCC 36,906
  • K. thermotolerans K. marxianus
  • yarrowia EP 402,226
  • Pichia pastoris EP 183,070
  • Candida Trichoderma reesia
  • Neurospora crassa Schwanniomyces such as Schwanniomyces occidentalis
  • filamentous fungi including Neurospora, Penicillium, Tolypocladium, or Aspergillus hosts such as A. nidulans or A. niger.
  • Suitable host cells for the expression of glycosylated anti- ⁇ 2 integrin antiboc y are derived from multicellular organisms.
  • invertebrate cells include plaril and insect cells.
  • Numerous baculoviral strains and variants and corresponding perm ssive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes augypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori have been identified.
  • a variety of viral strains for transfection are publicly available, for example, the L-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used, particularly for transfection of Spodoptera frugiperda cells.
  • Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and to bacco can also be utilized as hosts.
  • mammalian host cells include: a monkey kidney CV1 line transformed by SV40 (e.g., COS-7, ATCC CRL 1651 ); a human embryonic kidney line 293 c: r 293 cells subcloned for growth in suspension culture (see e.g., Graham et al., J. Gen Virol.
  • CHO Chinese hamster ovary cells, including CHO cells lacking DHFR (see, e.g., DHFR Urlaub -it al., Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); mouse Sertoli cells ((e.g., TM4, Mather, Biol. Reprod.
  • monkey kidney cells e.g., CV1 ATCC CCL 70
  • African green monkey kidney cells e.g., VERO-76, ATCC CRL-1587
  • human cervical carcinoma cells e.g., HELA, ATCC CCL 2
  • canine kidney cells e.g., MDCK, ATCC CCI.
  • buffalo rat liver cells e.g., BRL 3A, ATCC CRL 1442
  • human lung cells e.g., W138, ATCC CCL 75
  • human liver cells e.g., Hep G2, HB 8065
  • mouse mammary tumor e.g., MMT 060562, ATCC CCL51
  • TRI cells see, e.g., Mather et al., Annals N.Y Acad. Sci. 383: 44-68 (1982)
  • MRC 5 cells FS4 cells
  • a human hepatoma line e.g., Hep G2
  • Host cells are transformed with an above-described expression or cloning vectors for anti- ⁇ 2 integrin antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants and/or amplifying the genes encoding the desired sequences.
  • the host cells used to produce an anti- ⁇ 2 integrin antibody may be culture :! in a variety of media.
  • Commercially available media such as Ham's F10 (Sigma), M nimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host cells.
  • any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCINTM drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
  • Culture conditions such as temperature, pH, and the like, are selected by those skilled in the art, including those culture conditions previously used with the host cell selected for expression.
  • Anti- ⁇ 2 integrin antibodies can be purified from cells, including microbial or mammalian cells using, for example, protein A chromatography, ion exchange chromatography, hydrophobic interaction chromatography, gel electrophoresis, dialysis, and/or affinity chromatography.
  • protein A chromatography, ion exchange chromatography, hydrophobic interaction chromatography, gel electrophoresis, dialysis, and/or affinity chromatography.
  • the suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present n the antibody.
  • Protein A can be used to purify antibodies that are based on human ⁇ 1 , ⁇ 2, or ⁇ 4 heavy chains (see, e.g., Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)).
  • Protein G is useful for mouse isotypes and for human ⁇ 3 (see, e.g., Guss et al, EMBO J. 5: 1516- 1517 (1986)).
  • the matrix to which the affinity ligand is attached is most often agarose, but other matrices are available.
  • Mechanically stable matrices such as controllec: pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose.
  • the antibody comprises a CH3 domain
  • the Bakerbond ABXTM JT. Baker, Phillipsburg, N.J.
  • Protein purification can include one or more of the following techniques such as fractionati :)n on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSETM, chromatography on an an on or cation exchange resin (e.g., a polyaspartic acid column), chromatofocusing, SDS-F AGE, ammonium sulfate precipitation and/or hydrophobic interaction chromatography.
  • fractionati fractionati :)n on an ion-exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSETM, chromatography on an an on or cation exchange resin (e.g., a polyaspartic acid column), chromatofocusing, SDS-F AGE, ammonium sulfate precipitation and/or hydrophobic interaction chromatography.
  • Formulations of an anti- ⁇ 2 integrin antibody are prepared for storage by mixing the antibody having the desired d sgree of purity with optional physiologically acceptable carriers, diluents, excipienls or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (198!))), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, diluents, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic ⁇ icids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalk ⁇ nium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as ierum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as gly
  • the antibody formulation may also contain more than one active compound for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. It may be desirable to use anti- ⁇ 2 integrin antibody in addition to one or more agents currently used to prevent or treat the disorder in quc stion. In addition, it may be desirable to further provide an immunosuppressive agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the active ingredients may also be entrapped in microcapsule prepare :!, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles or nanocapsules) :;r in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles or nanocapsules
  • Such techniques are disclosed, for example, in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
  • Formulations to be used for in vivo administration are preferably sterile. T his is readily accomplished, for example, by filtration through sterile filtration membranes.
  • Sustained-release preparations may be prepared. Suitable examph s of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalc( hoi)), polylactides (U.S. Patent No.
  • copolymers of L-glutamic acid and y e1 hyl-L- glutamate non-degradable ethylene-vinyl acetate
  • degradable lactic acid-glycolk acid copolymers such as the Lupron DepotTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hydroxybutyric: acid While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable re lease of molecules for over 100 days, certain hydrogels release proteins for shortei time periods.
  • the ⁇ When encapsulated antibodies remain in the body for a long time, the ⁇ may denature or aggregate as a result of exposure to moisture at 37 0 C, resulting in a l ⁇ iss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • the anti- ⁇ 2 antibodies may be used as affinity purification agents.
  • the antibodies are immobilized on a solid phase such a Sephadex resin or filter paper, using methods well known in the art.
  • the immobilized antibody is contacted ivith a sample containing the ⁇ 2 ⁇ 1 integrin protein (or fragment thereof) to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the ⁇ 2 ⁇ 1 integrin protein, which is bound io the immobilized antibody.
  • the support is washed with another suitable solvent such as glycine buffer at pH 5.0, that will release the ⁇ 2 ⁇ 1 integrin protein from the antibody.
  • Anti- ⁇ 2 integrin antibodies may also be useful in diagnostic assays for ⁇ 2 ⁇ 1 integrin protein, e.g., detecting its expression in specific cells, tissues, or serum
  • the antibody typically will be labeled with a detectable moiety.
  • Numerous labels are available which can be generally grouped into the following categories of radioisotopes, fluorescent labels and enzyme-substrate I libels. Radioisotopes, such as 35 S, 14 C, 125 1, 3 H, and 131 I, are useful labels.
  • the antibody ⁇ an be labeled with the radioisotope, for example, using the techniques described in C urrent Protocols in Immunology, Volumes 1 and 2, Coligen et al., Ed.
  • Fluorescent labels such as rare earth chelates (europium chc lates) or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, Lissci rnine, phycoerythrin and Texas Red are also useful.
  • the fluorescent labels can be conjugated to the antibody, for example, using the techniques disclosed in Current Protocols in Immunology, supra. Fluorescence can be quantified, for example, using a fluorirneter.
  • Various enzyme-substrate labels are also useful (see, e.g., U.S. Patent No.
  • the enzyme generally catalyzes a chemical alteration of the chrome genie substrate which can be measured using various techniques.
  • the er zyme may catalyze a color change in a substrate, which can be measured spectrophotometrically.
  • the enzyme may alter the fluorescence or chemiluminescence of the substrate. Techniques for quantifying a change in fluorescence are described above.
  • the chemiluminescent substrate becomes electronically excited by a chemical reaction and may then emit light which can be measured (e.g., using a chemiluminometer) or donates energy to a fluorescent acceptor.
  • luciferases e.g., firefly luciferase and bacterial
  • enzyme-substrate combinations include, for example: (i) Horseradish peroxidase (HRPO) with hydrogen peroxidase as a substrate, wherein the hydrogen peroxidase oxidizes a dye precursor (e.g., orthophenylene diamine (OPD) or 3,3', 5,5'-tetramethyl benzidine hydrochloride (TMB)); (ii) alkaline phosphatase (AP) with para-Nitrophenyl phosphate as chromcgenic substrate; and (iii) ⁇ -D-galactosidase ( ⁇ -D-Gal) with a chromogenic substrate (e.
  • HRPO Horseradish peroxidase
  • OPD orthophenylene diamine
  • TMB 3,3', 5,5'-tetramethyl benzidine hydrochloride
  • AP alkaline phosphatase
  • ⁇ -D-galactosidase ⁇ -D-Gal
  • a label is indirectly conjugated with the antibody.
  • the antibody c; ⁇ n be conjugated with biotin and any of the three broad categories of labels mentioned nbove can be conjugated with avidin, or vice versa.
  • Biotin binds selectively to avidin and thus, the label can be conjugated with the antibody in this indirect manner.
  • the antibody Cein be conjugated with a small hapten (e.g., digoxin) and one of the different types of labels mentioned above can be conjugated with an anti-hapten antibody (e.g., anti-digoxin antibody).
  • an anti-hapten antibody e.g., anti-digoxin antibody
  • An anti- ⁇ 2 integrin antibody need not be labeled, and the presence thereof can be detected using a labeled antibody which binds to the anti- ⁇ 2 integrin antibody.
  • a ⁇ ti- ⁇ 2 integrin antibodies may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation a ssays (see, e.g., Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 [CRC Press, Inc. 1987)).
  • Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody.
  • the amount of ⁇ 2 ⁇ 1 integrin protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies.
  • the antibodies generally are insolu :>ilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which i smain unbound.
  • Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected.
  • the test sample analyte is bound by a first antibody which is immobilized on ⁇ solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex (see, e.g., U.S. Patent No. 4,376,110).
  • the second antibod> may itself be labeled with a detectable moiety (e.g., direct sandwich assays) or m ay be measured using an antiimmunoglobulin antibody that is labeled with a detectable moiety (e.g., indirect sandwich assay).
  • a detectable moiety e.g., direct sandwich assays
  • m ay be measured using an antiimmunoglobulin antibody that is labeled with a detectable moiety
  • one type of sandwich assay is an IuLISA assay, in which case the detectable moiety is an enzyme.
  • tissue sample including a tumor sample, rriiay be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin.
  • Anti- ⁇ 2 integrin antibodies may also be used for in vivo diagnostic ai.says. Generally, the antibody is labeled with a radionuclide ( 111 In, 99 Tc, 14 C, 131 I 1 125 I, 3 H, : ⁇ 2 P or 35 S) so that the tissue, for example, a tumor, can be localized using immunoscintiogfaphy.
  • a radionuclide 111 In, 99 Tc, 14 C, 131 I 1 125 I, 3 H, : ⁇ 2 P or 35 S
  • an anti- ⁇ 2 integrin antibody can be provided in a kit, such as a packaged combination of reagents in predetermined amounts with instructions, including for performing a diagnostic assay.
  • the kit will include substrates and cofactors required by the enzyme (e.g., a substrate precursor which provides the detectable chromophore or fluorophore).
  • substrates and cofactors required by the enzyme e.g., a substrate precursor which provides the detectable chromophore or fluorophore.
  • Other additives may be included in the kit such as stabilizers, buffers (e.g., a block bulfer or lysis buffer) and the like.
  • the relative amounts of the various reagents provided in I he kit may be varied widely, for example, to provide for concentrations in solution of the reagents which substantially optimize the sensitivity of the assay.
  • the reagents rriiay be provided as dry powders, usually lyophilized, including excipients, for example, which on dissolution will provide a reagent solution having the appropriate concentration.
  • An anti- ⁇ 2 integrin antibody may be used to treat various ⁇ 2 ⁇ 1 integrin associated disorders as described herein.
  • the anti- ⁇ 2 integrin antibody is administered b / any suitable means, including parenteral, subcutaneous, intraperitoneal, intrapulmonary, or intranasal. If desired for local immunosuppressive treatment, intralesional administration of the antibody (including perfusing or otherwise contacting the graft with the anlibody before transplantation) is done. Parenteral administration includes intramu; cular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • the anti- ⁇ 2 integrin antibody is suitably administered by pulse infusion, for example , with declining doses of the antibody.
  • the dosing is given by injections, most preferably intravenous or subcutaneous injections. This may depend in part on wl iether the administration is brief or chronic.
  • the appropriate dosage of antibo:iy will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the anti- ⁇ 2 integrin antibody is administered for prevent w/e or therapeutic purposes, previous therapy, the patient's clinical history and response :o the antibody, and the discretion of the attending physician.
  • the antibody is si itably administered to the patient at one time or over a series of treatments.
  • antibody is an initial candidate dosage for administration to the subject, whether, for example, by one or more se
  • a typical daily dosage might range [from about 1 ⁇ g/kg to about 100 mg/kg] or more, depending on the factors mentioned above.
  • the treatment is sustained until a desired suppression of disease symptoms occurs. Hovever, other dosage regimens may be useful. The progress of this therapy is readily mon tored by those skilled in the art.
  • An anti- ⁇ 2 integrin antibody composition will be formulated, dosed, and administered in a fashion consistent with good medical practice.
  • Factors for conside ration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the 'iite of delivery of the agent, the method of administration, the scheduling of administi fation, results from pharmacological and toxicity studies and other factors known to medical practitioners.
  • a therapeutically effective amount of the antibody to be administei 3d is determined by consideration of such, and is the minimum amount necessary to prevent, ameliorate, or treat an ⁇ 2 ⁇ 1 integrin-associated disorder. Such amount is preferably below the amount that is toxic to the host or renders the host significantly more susceptible to infections.
  • the anti- ⁇ 2 integrin antibody need not be, but may be optionally formulated, coadministered or used as an adjunct therapy with one or more agents currently us.ed to prevent or treat the disorder in question.
  • the antibody may be given in conjunction with a glucocorticosteroid, Remicaid® o - any approved treatment for rheumatoid arthritis.
  • the antibody m uy be given in conjunction with an interferon ⁇ , Avonex, Copaxon, or other approved theiapies for treatment of the signs and symptoms of multiple sclerosis.
  • the antibody may be administered concurrently with or separate from an immunosuppressive agent as defined above, such as cyclosporin A, to modulate the immunosupprc lich effect.
  • an immunosuppressive agent such as cyclosporin A
  • ⁇ 2 ⁇ 1 integrin antagonists may be administered o the mammal suffering from an ⁇ 2 ⁇ 1 integrin-associated disorder.
  • the effective amount of such other agents depends on the amount of anti- ⁇ 2 integrin antibody present in the formulation, the type of disorder or treatment, and other factors discussed above, " hese are generally used in the same dosages and with administration routes as used hereinbefore or about from 1 to 99% of the heretofore employed dosages.
  • An article of manufacture containing materials, including an anti- ⁇ 2 ir tegrin antibody, useful for the treatment of the disorders described above is provided.
  • the article of manufacture comprises a container and a label.
  • Suitable containers include( e, for example, bottles, vials, syringes, and test tubes.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the container holds a composition wf ich is effective for treating the condition and may have a sterile access port (for examp s the container may be an intravenous solution bag or a vial having a stopper pierceabk ⁇ by a hypodermic injection needle).
  • the active agent in the composition is an anti-alpha 2 integrin antibody.
  • the label on, or associated with, the container indicates th. it the composition is used for treating the condition of choice.
  • the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable huffer, such as phosphate-buffered saline, Ringer's solution or dextrose solution. It may f .irther include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for i ise.
  • Antibodies with specificity for ⁇ 2 ⁇ 1 integrin were designed and prepared.
  • the previously unknown sequences of variable regions of a murine antibody designated TMC- 2206 secreted by the hybridoma BHA2.1 were determined as described herein.
  • the VH and VL cDNAs were cloned from mRNA from BHA2.1 hybridoma cells by RT-PCR using one set of primers corresponding to amino acids at the N-terminus of the murine variable region of the heavy (VH) or light (VL) chain, and a second set of primers corresponding to the respective heavy ⁇ 1 and K light chain constant regions.
  • the sequence! was determined from cDNA that had been synthesized from mRNA isolated according to standard methods is described herein.
  • Cytoplasmic mRNA was isolated from approximately 1 million (1 x 10 6 ) BI -IA2.1 hybridoma cells expressing TMC-2206 using standard molecular techniques for those skilled in the art. To isolate poly A mRNA, cells were lysed in 5M guanic: nium thiocyanate, mixed with oligo (dT) cellulose (Ambion, TX) and incubated at room temperature with gentle agitation for 60 minutes. The oligo(dT) cellulose-bound p :>ly(A) RNA was pelleted, washed, then applied to a wash spin column (Ambion, TX).
  • TE 1mM Tris, 1mM EDTA
  • NH 4 Ac ammonium acetate
  • cDNAs were synthesized from the isolated BHA2.1 mRNA via reverse transcription initiated with primers based on the either the N-terminus of the murine variable region of the heavy (VH) or light (VL) chain, and a second set of primers corresponding to the murine ⁇ 1 heavy or K light chain constant regions.
  • the sequence of the BHA2.1 antibody was unknown, thus, commercial degenerate antibody primers for the N-terminus of murine light and heavy chain variable regions were used (Light primer mix, #27-1583-01 and Heavy Primer mix, #27-1586-01 , from Amersham Bioscieno;;s) as shown in Table 1.
  • RT-PCR reactions (Qiagen RT kit) were set up as follows: 0.5 ⁇ g of mRNA, 10 ⁇ L of 5 ⁇ RT buffer, 2 ⁇ L of 10 mM of dNTP mix, 5 ⁇ L of each 10 mM primer solution and 2 ⁇ L of enzyme mix in 50 ⁇ L of total volume.
  • the reaction was initiated with reverse transcription at 5O 0 C for 30 minutes followed by a PCR activation step at 95 0 C for 15 minute -; and ended with a PCR program suitable for the degenerate primer mixes used to amplify the variable regions of both heavy and light chains: 94 0 C for 30 seconds, 56 0 C lor 30 seconds and 72 0 C for 1 minute for 28 cycles with a final extension run for 10 minutes at 72°C.
  • Subsequent PCR reactions used the primer pairs listed in Table 2, which were synthesized by Retrogen (San Diego, CA). All primers are listed as 5 ' to 3 '
  • PCR products of approximately 350 bp in length were obtained for both Vl-I and VL. These PCR products were recovered from a 1% agarose gel, cloned into the pCR2.1- TOPO cloning vector (Invitrogen, CA) and sequenced.
  • the sequencing was performed on a CEQ DNA sequencer using M13 forward and reverse primers (Invitrogen, CA). Plasmid DNA was made from 1.5 mL bacterial cultures using Qiagen kits according to manufacturer's directions. Approximately 300 ng of DNA were used for each PCR sequencing reaction, typically in a volume of 10 ⁇ L The DNA was denatured at 96 0 C for 2 minutes and then mixed with sequencing primer at a final concentration of 0.3 ⁇ M. Four ⁇ L of DTCS Quick Start Master Mix (Beckman Coulter, Fullerton, CA) were added to the mix and sequencing proceeded for 30 cycles: 96 0 C for 20 seconds, 5O 0 C for 20 seconds and 6O 0 C for 2 minutes.
  • VH and VL clones were sequenced by standard techniques, and the deduced amino acid sequences of VH (SEQ ID NO:21 ) and VL (SEQ ID NO:19) are shewn in Tables 3 and 4, respectively. The sequences obtained from all eight clones were identical except for the first one or two amino acids. In the VL clones, Glu-Asn or GIn- Phe occurred in equal frequency.
  • the cloned inserts showed the best match with murine heavy (IgGI) and light (K) chains, which was the expected isotype.
  • the sequences of the cloned VH and VL regions suggested likely leader and flanking constant region sequences, which were used to design more exact primers to clone the entire heavy and light variable region of TMC-2206 from the hybridoma mRN/ [ . All primers were synthesized by Retrogen (San Diego, CA).
  • the primer pair VHL-for CCATGGCTGTCTTGGGGCTGCTCTTCT (SEQ ID NO: 14) and HC-rev GGGGCCAGTGGATAGAC (SEQ ID NO:15; from mouse Fc ⁇ CH1 ), was used to re clone the heavy chain variable region and the primer pair, VLL-for CCATGGATTTTCAAGTGCAGATTTTCAG (SEQ ID NO: 16) and LC ⁇ -rev GTTGGTGCAGCATCAGC (SEQ ID NO: 17), was used to re-clone the light chain variable region from the hybridoma mRNA using the same PCR conditions outlined above.
  • Sequencing of the products confirmed the identity of the first two residues in the TMC- 2206 VL to be L1-Q and L2-F and the identity of the first two residues in the heavy chain to be H1-Q and H2-V.
  • the remaining nucleotide sequences were identical to those cloned using the degenerate primer mixes.
  • the cloned VL region was 106 amino acids and the VH was 119 amino acids in length.
  • CDR1-3 CDRs
  • FW1-4 frameworks
  • Frameworks and CDRs were identified based on the Kabat numbering system (Ka:>at et al., 1983) except that the CDR1 of the heavy chain was defined by the Oxford Molec jlar's AbM definition as spanning residues 26 to 35.
  • the Oxford Molecular's AbM anlibody modeling software http://people.crvst.bbk.ac.uk/ ⁇ ubcqQ7s/.
  • TMC-2206 light chain has a molecular weight of 29 kD by SDS- PAGE that can be shifted by endoglycosidase treatment to 25 kD (typical mokicular weight of antibody light chains).
  • the protein was subjected to pyroglutiimate aminopeptidase digestion using a heat tolerant enzyme from the thermophilic Pyroc occus furiosus before subjecting the heavy and light chains to N-terminal peptide seque icing.
  • Purified pyroglutamate aminopeptidase (0.01 U) from Pyrococcus furiosus (Sigirua, St. Louis, MO) was reconstituted in 50 ⁇ L Digestion Buffer (50 mM sodium phosphalo, pH 7.0, 1 mM EDTA and 10 mM dithiothreitol (DTT)).
  • TMC-2206 A preparation of TMC-2206 was digested using a 1 :100 molar ratio of pyroglutamate aminopeptidase : protein at 95 : C for 1 hour.
  • the digested proteins were resolved using a standard 10% SDS-PAGE gel (Tris- glycine, BioRad Laboratories, Hercules, CA) with sodium mercaptoacetate (0.1 g i t 150 mL of Running Buffer) in the upper reservoir.
  • the gel was then blotted onto lmmobilon P PVDF membrane (Millipore, Billerica, MA) in Transfer Buffer (10 mM CAPS, pH 10. !>, 0.5 g/L DTT and 15% methanol) at 250 mAmp for 1 hour.
  • the blot was stained using a fresh solution of 0.1% Ponceau S in 1% acetic acid for 1 minute followed by destaining n 1% acetic acid.
  • the blot was subjected to peptide sequencing where it was found that 20 of the first 21 N-terminal amino acids of the light chain were successfully sequence':! and showed exact identity with the deduced peptide sequence obtained by cloning. This confirmed the identity of the first amino acid in the cloned VL to be a GIu.
  • the pyroglutamate aminopeptidase digested VH failed to yield any peptide sequence da ⁇ a.
  • the cell suspensio n was extracted with 0.2 mL of chloroform and after centrifugation (14,000 rpm for 5 minutes at 4 0 C), the supernatant was transferred to a new tube where the RNA was precipitaled by mixing with 0.5 mL isopropanol followed by centrifugation (14,000 rpm for 10 minutes at 4 0 C). The RNA pellet was washed with 1 mL 75% ethanol and dissolved in 50 ⁇ L DEPC- treated H 2 O.
  • RT-PCR reaction (Qiagen RT kit) was performed as described above using 0.5 ⁇ g of RNA, 10 ⁇ L of 5x RT buffer, 2 ⁇ L of 10 mM of dNTP mix, 5 ⁇ L of each 10 mM primer solution and 2 ⁇ L of enzyme mix in a total volume of 50 ⁇ L.
  • PCR products were digested with EcoRI and SamHI restriction enzymes and the purified fragments frc n 1% agarose gel were then ligated into the EcoRI/ ⁇ amHI sites of the plRES2-GFP ( ⁇ eavy chain) and plRES2-Ds Red (light chain) vectors. Subsequent sequencing of the variable regions confirmed that no mutations had been introduced by the RT-PCR.
  • pCI-neo Promega, catalog no. E1841 was chosen as the expression veclor for cloning chimeric, including humanized, antibody molecules based on or derived from TMC-2206 as described below.
  • cloning cassettes were prepared for both the VH ar d VL.
  • the DNA encoding an lg ⁇ leader was cloned into the XhcA and EcoRI cloning sites of pCI-neo using the oligonucleotides Ig ⁇ -S (SEQ ID NO:27) an:l lg ⁇ - AS (SEQ ID NO:28) listed in Table 2, which were annealed to each other and then I :jated directly into X ⁇ ol-EcoRI digested pCI-neo using T4 ligase. This provided the parental vector for all subsequent cloning steps.
  • an EcoRI-Sall VH fragmen was made by PCR using the primer pairs TMC-2206-r ⁇ 1 (SEQ ID NO:22) and TMC22 !6VH- hlgG1/4Fc-Sall (SEQ ID NO:29) shown in Table 2 to introduce a Sail restriction site at the 3' end of the murine VH sequence using the cloned heavy chain in the plRES-GFP vector as a template.
  • the human IgGI Fc was obtained from amplification of IMAGE clone 20688 (Invitrogen, Catalog No.
  • the PCR product was digested with EcoRI/Sa/l separated on a 1% agarose gel, purified with a Gel Extraction Kit (Qiagen) and ligated with the human lg ⁇ light chain constant region amplified from the IMAGE clone #4704496 (ATCC) using the primers hKc-Sa/l-F (SEQ ID NO:33) and hKc- ⁇ /ofl-R (SEQ ID NO:34) and the vector described above, pCL-neo- lg ⁇ .
  • the resulting plasmid was named pCI-neo-lg ⁇ -TMC2206VL-hKc.
  • a second light chain chimera was constructed that encoded the parental amino acid sequence light chain chimera plasmid.
  • VL and the human kappa constant regions were amplified with the primer pair TMC-2206VLwt-hKc-R and TMC-2206-k5" (SEQ ID NOS: 36 and 24) and primer pair TMC-2206VLwt-hKc-F and hKc- ⁇ /ofl-R (SEQ ID NOS: 35 and 34) respectively, using the plRES2-DsRed ;>-lgk- TMC2206LC vector from above as a template.
  • the mouse-human chimeric antibody was expressed in 293F cells using transient transfection methodology using a transfection mixture was composed of ⁇ qual parts DNA/OptiMEM and 293fectin/OptiMEM (Invitrogen). Each solution was mad * ;; with OptiMEM prewarmed to room temperature.
  • the DNA/OptiMEM mixture contained 20 ⁇ g of the heavy chain (HC) expression plasmid, 20 ⁇ g of the light chain (LC) expression plasmid, and OptiMEM to a total volume of 1.3 ml_.
  • the 293fectin OptiMEM m ixture contained 53 ⁇ l_ of 293fectin and OptiMEM to a total volume of 1.3 mL
  • the 293 ⁇ ectin mixture was added to the DNA mixture, mixed and incubated for 20 minutes at room temperature.
  • the 2.6 mL transfection mixture was added to a flask containing AO mL 293F cell culture at 10 6 cells/mL.
  • the flask was incubated at 37 0 C, 8% CO 2 with shaking at 120 rpm.
  • the cell suspension was centrifuged and immediately subjected to Protein A affinity chromatography to purify the antibody.
  • the final producl was concentrated, analyzed by SDS-PAGE and protein concentration determined by l.owry assays.
  • mouse-human chimeric antibody had the same binding activity as the parent TMC-2206 antibody
  • purified mouse-human chimeric antibody was tested for its ability to block ⁇ 2 ⁇ 1-integrin mediated cell adhesion.
  • CHO cells expressing a human ⁇ 2 integrin (SEQ ID NO:8) and an endogenous hamsler ⁇ 1 (Symington et al., J Cell Biol. 120(2):523-35. (1993)) were detached from the culture flask by incubating in Ca ++ /Mg ++ -free PBS containing 5 mM EDTA.
  • a collagen-coated plate (rat-tail collagen Type I; BD Biosciences) was blocked with 100 ⁇ L/well of 0.1% BSA in PBS and incubated at room temperature for 30 minutes. Protein samples were serially diluted in serum-free media and 50 ⁇ L of each serially c! luted antibody solution was added to the collagen plate. 50 ⁇ L/well of labeled cells were then added to the well and the plate was incubated for 1.5 hours at 37 0 C.
  • TMC-2206 chimera was a potent inhibitor of ⁇ 2 ⁇ 1 -mediated cell adhesion to collagen Type I and showed potency equivalent to TMC-2206 with an EC50 value :)f 1.8 nM compared to 1.2 nM, respectively.
  • use of control Ig gave no inhibition of binding while use of the murine TMC-2206 or the chimera antibody sl owed binding inhibition when tested over a range of 10 ⁇ 11 to 10 "6 molar concentration.
  • the affinity of the mouse-human chimeric antibody for immobilized ⁇ 2 ⁇ 1 irilegrin was also compared with the parent antibody TMC-2206 for its ability to compete binding of Eu-labelled TMC-2206 to ⁇ 2 ⁇ 1 -coated plates, e.g., by determining Ki values.
  • the affinity of the parent antibody TMC-2206 for the immobilized ⁇ 2 ⁇ 1-integrir was determined by equilibrium binding. Wells in a 96 well microtiter plate were coated with platelet ⁇ 2 ⁇ 1-integrin (custom-coated with human platelet ⁇ 2 ⁇ 1 by GTI Inc., Wl) and then blocked with nonfat milk.
  • TMC-2206 or isotype control IgG antibody were used for the binding and competition assays.
  • E: u-N1- ITC reagent approximately 2 mg of either TMC-2206 or the isotype control, MOPC-21 (Invitrogen) were suspended into and dialyzed against phosphate buffered saline (PBS; 1.47 mM KH 2 PO 4 , 8.1 mM Na 2 HPO 4 ; pH 7.4, 138 mM NaCI and 2.67 mM KCI).
  • PBS phosphate buffered saline
  • the mAb/bicarbonate mixture (0.250 ml.) was gently mixed into a vial containing 0.2 mg ⁇ -(p-isothiocyanatobenzyl ⁇ diethylenetriamine- ⁇ / 1 ,/ ⁇ 2 , ⁇ !/ 3 , ⁇ 3 - tetraacetic acid chelated with Eu 3+ (Eu-NI-ITC; Perkin Elmer Life Sciences) and reacted overnight at 4 0 C without stirring.
  • Each labeled antibody mixture was applied to a separate PD-10 column (GE Biosciences, Piscataway, NJ) pre-equilibrated with Running Buffer (50 mM Tris, pH 7.4 and 138 mM NaCI).
  • Fractions (0.5 mL) were collecte :l and assayed for total protein (Bradford reagent; Bio-Rad Laboratories, Hercules, CA) u:;ing a SpectraMax 384 absorbance plate reader and for europium after 1 :10.000 dilul on in DELFIA Enhancement Solution (Perkin-Elmer) by time-resolved fluorescence (TRF) using a Victor2 multi-label plate reader (Perkin Elmer).
  • the fractions that were positive fc ' both protein and Eu label were pooled and applied to new PD-10 columns and samples collected and assayed for total protein and for europium content by TRF calibrated against a europium standard solution (Perkin-Elmer) to calculate the fluor : protein ratio.
  • the fluorescently labeled antibody either Eu-TMC-2206 or Eu-isotype control IgG, was then applied to the blocked ⁇ 2 ⁇ 1-integrin microtiter plates in a volume of 10 ⁇ L/well.
  • Relative binding potencies to immobilized ⁇ 2 ⁇ 1 integrin were analyzed by measuring K 1 values in a competition assay using 100 pM fluorescently labeled Eu- FMC- 2206 in the presence of varying concentrations of unlabeled TMC-2206 antibody or the chimeric antibody as competitors, using an assay system similar to that described above. Test antibody combinations were then applied to the ⁇ 2 ⁇ 1 integrin coated wells, lested over a concentration range of from 10 ⁇ 11 to 10 '7 M, and following the specified tim -j, the amount of bound Eu-TMC-2206 was determined.
  • the inhibition curves were fitted with the "one site competition" model using Prism software (GraphPad, Inc.) to obtain IC 50 values and to calculate the K, using the equation of Cheng and Prusoff (1973) and the value for K d oi 0.374 nM from above.
  • the activity of the wt chimera was comparable to that of the chimeric: form carrying the two LC mutations introduced by engineering a Sal ⁇ site ( K 1 also 0.27 nM), confirming that these mutations did not affect activity.
  • BSA coated control wells tested with either control IgG or with TMC-2206 did not demonstral ?, any antibody binding.
  • the CDR and framework regions were elucidated generally in accordance with Kabat by alignment with other VH and VL regions using general homology searches using the NCBI protein BLAST database (http://www.ncbi.nih.gov/BLAST/, Ye et al., Nucleic acids Res., JuI 1 : 34 (Web Server Issue): W6-9)), except for HCDR1.
  • HCDRI was defined by the AbM definition as spanning residues 26 to 35.
  • the Oxford Molecular's AbM antibody modeling sohware http://people.crvst.bbk.ac.uk/ ⁇ ubcqQ7s/. Martin et al., Proc. Natl Acad.
  • human acceptors are human germline frameworks because the lack of somatic mutations may lower the deg ee of immunogenicity, however, individual mature antibody frameworks may also be usiod as acceptor molecules.
  • the V-BASE database http://base.mrc-cpe.cam.ac.uk
  • the V-BASE database provides a comprehensive listing of human heavy and light chain germline sequences and wa;; used as a source of human germline sequences to compare with the VH and VL from TMC- 2206; the Kabat database was also used (http://kabatdatabase.com/. Johnson, d. and Wu 1 TT. (2001 ), Nucleic Acids Res., 29, 205-206).
  • the CDR3 and FW4 regions of VH are not included in the V iJASE germline sequences, because part of the CDR3 and framework 4 regions are derived from a different and noncontiguous gene that varies during the maturation of each antibody.
  • the sequence of the antibody, CAA48104 (NCBI entry: gi/33583/emb/CAA48104; http://www.ncbi.nlm.nih.gov/BLAST) was used to provide CDR3 and FW 4 sequences for alignment, and a FW4 acceptor molecule sequence.
  • a comparison of the TMC-2206 VH with 4-59 and the CDR3 and FW4 region ::f the CAA48104 antibody sequence is provided in Table 5.
  • the germline sequence, A14 (SEQ ID NO:37), was one of 38 human VL an ibody sequences in the V-BASE database and was selected as an acceptor VL framework.
  • A14 is in the VK Vl family and its LCDR1 and LCDR2 fall into canonical classes 2 ,; ⁇ nd 1 , respectively.
  • the TMC-2206 LCDR2 is also class 1 , although the TMC-2206 LCDR1 is similar, but not identical, to a canonical class 1 structure.
  • the selected sequence represents a commonly used framework 4 gene for kappa light chains in mature human antibodies (e.g., AAB24132, NCBI entry gi/259596/gb/AAB24132; http://www.ncbi.nlm.nih.gov/BLAST).
  • Tables 7 and 8 list residues that may affect CDR conformation and interchain packing, respectively, and show differences between the TMC-2206 donor VH and VL residues an :l the corresponding human acceptor framework residues (highlighted in bold italics).
  • the L46 residue marked with an asterisk in Table 8 may play a role in both CDR canonical structure presentation and interchain packing.
  • PCR reactions were carried out using the following conditions: Primer 1 and 2 (0.6 ⁇ M final concentration), dNTP (1 mM final concentration), DNA template (1 to 10 ng), and 1 unit of Pfx DNA polymerase (Inviti ogen, CA) typically in a final volume of 50 ⁇ l_.
  • a PCR program consisted of initial denati ration at 95 0 C for 2 minutes, followed by 30 cycles with each cycle being 95 0 C for 30 seconds, 56 0 C for 45 seconds and 68 0 C for one and a half minutes. The final step was 68 0 C for 10 minutes.
  • VH variants lists VL variants and compares the chosen human acceptor frameworks with the initial (1.0) VH and VL variants.
  • VH variants as listed in Table 12 include: hVHLO (SEQ ID NO:21); hVH2.0 (SEQ ID NO:70); IV/H3.0 (SEQ ID NO:71 ); hVH4.0 (SEQ ID NO:72); hVH5.0 (SEQ ID NO:73); hVH ⁇ .O (SEQ ID NO:74); hVH7.0 (SEQ ID NO:75); hVH8.0 (SEQ ID NO:76); hVH9.0 (SEQ ID N 0:77); hVHIO.O (SEQ ID NO:78); hVH11.0 (SEQ ID NO:79); hVH12.0 (SEQ ID NO:109); hVH13.0 (SEQ ID NO:110); hVH14.0 (SEQ ID NO:111 ).
  • VL variants as listed in Table 13 include: hVLLO (SEQ ID NO:41 ); hVL2.0 (SEQ ID NO:80); hVL3.0 (SEQ ID N 0:81 ); hVL4.0 (SEQ ID NO:82); hVL5.0 (SEQ ID NO:83); hVL ⁇ .O (SEQ ID NO:84); hVL7.0 (SEQ ID NO:85); hVL ⁇ .O (SEQ ID NO:86); hVL9.0 (SEQ ID NO:87); hVLIO.O (SEQ ID NO:88); hVL11.0 (SEQ ID NO:89); hVL12.0 (SEQ ID NO:108).
  • each additional variant constructed is also shown.
  • Each variant shown in Table 12 below VH1.0 has the same sequence as VH1.0 (indicated by a dash [-]) unless a specific amino acid substitution, changing the relained murine residue to the human framework counterpart, is shown.
  • each VL variant shown in Table 13 has the same sequence as the VL1.0 variant except for the specific amino acid substitutions indicated.
  • the L1 position was chnnged to the human Asp in VL4.0, since this is a common residue for human K light chain;;;.
  • the hVH3.0 and hVH4.0 heavy chains were co-transfected with hVL3.0 and hVL4.0 light chains in various VH/VL combinations and the resultant antibodies were compared with the hVH1.0/hVL1.0 antibody described above for ligand affinity by head-tc -head comparisons with the unlabelled TMC-2206 monoclonal antibody.
  • the first structure was CDR1 which was one residue longer in the murine TMC-2206 VL.
  • the murine Y at L71 (F in A14) was usi-ful to accommodate this difference.
  • the second area was the L40 to L43 murine loop which was pushed out further into solvent compared to the human which indicated that human L40-43 might be problematic, although activity of the first humanized prototype demonstrated that these back mutations were tolerated in hVLI .O.
  • the third arefi was human framework residues L55 to L59 which were displaced relative to murine structure. Framework residue L73 (L in murine, F in human) was predicted to be responsible for this difference, although back mutation was tolerated in hVLI .O.
  • positions were accessed and ranked in order to reflect the likelihood that a human substitution would cause an effect on antibody perfo ⁇ rance: H48, H67 ⁇ H37, H91 ⁇ H73 ⁇ H78, H71.
  • H48 H67 ⁇ H37
  • H91 ⁇ H73 ⁇ H78, H71 a human back mutation at position H48 was predicted most likely to be the most well tolerated, while a back mutation at positions H78 or H71 was predicted to be the least tolerated.
  • the following order was predicted for positions of interest within the light chain region: L1 ⁇ L4 ⁇ L71 ⁇ L2 ⁇ L47 ⁇ L46 ⁇ L49.
  • the phenylalanine at L2 was sensitive to change as evidenced by the marked loss in binding affinity observed with the hVL4.0 variant compared to the hVL.5.0, hVL6.0 and hVL7.0 variants.
  • Computer modeling indicated that this Phe-L2 may make extensive contact with LCDR3.
  • Database searches of human and murine antibodies additionally indicated that this Phe at the L2 position is rare, sugg ssting that it may represent a somatic mutation that has an impact on antigen binding.
  • VH VL Changes back to human residues Mean ⁇ SD Mean ⁇ i!D
  • VH VL Changes back to human residues Meant SD Mean :! 3D
  • the N26Q change had no statistically significant effect on activity of any of the resultant antibodies as shown in Table 17. Although this glycosylate n site occurs on the light chain CDR 1 of the wild-type TMC-2206 antibody, these data in dicate that it does not appear to play a role in the affinity of function-blocking activity of the TMC- 2206 antibody.
  • Human antibodies of the ⁇ 1 class carry effector functions associated with complement and Fc receptor mediated functions. It is appreciated by those skilled in the art that to avoid antibody-dependent cellular cytotoxicity (ADCC) and comph-ment responses a ⁇ chain lacking this functionality, such as a human ⁇ 4 constant region, is preferred.
  • a ⁇ 1 constant region sequence was replaced by a ⁇ 4 constant region sequence in the VH12.0 and VH14.0 heavy chains as follows.
  • the ⁇ 4 constant region sequence was obtained from Genbank sequence KO1316.
  • Both a ⁇ 1 Fc seq .ience derived from IMAGE clone 20688 used to generate the intact heavy chains of IgGI antibodies with hVH and hVL regions as described herein and the ⁇ 4 Fc derived frcm the KO1316 sequence contain a naturally occurring Apa1 restriction site near the junclion of the variable and constant regions. This site was used to clone a ⁇ 4 constant re ⁇ iion to replace a ⁇ 1 constant region. SamH1 and Not ⁇ restriction sites were placed at the :(' end of the sequence to facilitate subcloning into the pCI-neo expression vector.
  • the ⁇ 4 sequence (SEQ ID NOS: 105 and 106) was then synthesized as a de novo synthetic gene by Blue Heron Biotechnology (Bothell, WA).
  • the Sephacryl S-300 26/60 column was pre-equilibrated in 660 ml SEC Running Buffer (40 mM HEPES, pH 6.5, 20 mM L-histidine, 100 mM NaCI and 0.02% Tween-80).
  • the pooled fractions containing protein eluted from the Protein A column were loaded (i : ⁇ .5 ml sample injection) via a Superloop (Amersham Biosciences). SEC fractions (5 ml each) were collected at a flow rate of 2.0 ml/min.
  • the fractions corresponding to the moncmeric form peak elution at 168.4 ml were pooled, and protein content determined by ..owry assay.
  • Exemplary IgGI antibodies have a hVH 14.0 ⁇ heavy chain (SEQ ID NO: 181 ) or a hVH12.0 ⁇ 1 heavy chain (SEQ ID NO:182) and a hVUO.OQ light chain (SEQ ID NO:178).
  • Exemplary lgG4 antibodies have a hVH14.0 ⁇ 4 heavy chain (SEQ ID NO: 1741 or a hVH12.0 ⁇ 4 heavy chain (SEQ ID NO:176) and a hVL 10.0Q light chain (SE Q ID NO: 178).
  • TMC-2206 IgG 1/ ⁇ Murine Murine 0.22 1.03 ⁇ 0.29 hlgG1/ ⁇ 14.0 10.0Q 0.24 1.30 ⁇ 0.10 hlgG1/ ⁇ 12.0 10.0Q 0.27 2.20+012 hlgG4/ ⁇ 14.0 10.0Q 0.36 2.82 ⁇ 1.04 hlgG4/ ⁇ 12.0 10.0Q 0.27 1.83 ⁇ 0.27
  • the acute peritonitis model was performed in rats and in mice.
  • the TMC -2206 antibody recognizes rat ⁇ 2 ⁇ 1 -integrin, but not its murine counterpart.
  • many in vivo models of inflammatory models are performed in mice and a surrogate a nti-cx2 antibody, Ha 1/29 (Pharmingen, Becton Dickenson, CA, catalog no. 559987), was ui-ed in the murine acute peritonitis model.
  • the cell pellet recovered from the lavage fluid was re-suspended in 500 ⁇ L of 50 mM KH 2 PO 4 buffer (pH 6.0) containing 0.5% hexadecyl-trimethyl-ammonium bromide (HTAB; Sigma-Aldrich, Ml).
  • the samples were sonicated for 60-90 seconds and centrifuged at 14,000 rpm for 5 minutes at 4 0 C.
  • a 2:1 serial dilution of the cleared supernatant was made by transi srring 50 ⁇ L of sample to 50 ⁇ L of HTAB buffer in the well of a microtiter plate.
  • mice (Harlan, IN) weighing 16-21 grams were housed in pairs. Ar imals were given either distilled water or water containing 5 % dextran sodium sulfate (DSS); (ICN, Irvine, CA) ad libitum for 7 days. At this stage the mice exhibit diarrhe.i and noticeable weight loss.
  • the study design was four groups of six mice each; one to serve as na ⁇ ve control, one to serve as the DSS control and two assigned to receive intraperitoneal injections of either 2 or 5 mg/kg doses of anti- ⁇ 2 integrin antibody PS/2 on Days O 1 2, 4, and 6. Mice were euthanized on Day 7 (168 hours after start o : DSS feeding). They were weighed to observe any changes from study initiation, colon length measured and then scored on a scale of 0 to 2, with 2 being most severe, for diarrhea, colon bleeding and rectal bleeding as follows:
  • the three anti-integrin antibodies were associated with a reversal in colon shortening, but only the anti- ⁇ 2 treatment was associated with a significant improvement in stool consistency (diarrhea). Both the anti- ⁇ 2 and anti- ⁇ 4 treatment resulted in a significant improvement in colon bleeding. In this study, none of the antibody treatments induced a significant effect on weight loss.
  • the three anti-integrin treated groups showed significant decrease compared to the Saline control as shown in Table 23.
  • EAE allergic encephalomyelitis
  • mice In a study of 4 groups of mice (8/group; see Figure 1 ), two groups were dosed with 5mg/kg on Days 10, 11 , 12, 14, 15, 18 and 20 with either isotype control or the anti- murine ⁇ 2 integrin antibody, Ha1/29, from the onset of disease symptoms through Day 20, which is through the first acute flare. This was an acute dose regimen.
  • Day 0 was defined as the onset of priming with the synthetic peptide PLP139-151 plus Fre und's adjuvant.
  • Onset of disease was defined as the second day of consecutive weighl loss.
  • mice treated with 5 mg/kg of the anti- ⁇ 2 antibody from the onset of the first flare dampened the extent of the first flare and also limited the extent of the second flare.
  • dosing was initiated after the end of the first flare on Day 18 (e.g., delayed treatment; see Figure 1 )
  • mice treated with 5 ng/kg anti-murine ⁇ 2 integrin antibody also showed lower clinical scores during the first relapse through Day 32, at which point the two groups showed similar disease scores as :;;hown in Table 24.
  • mice When mice were dosed only during the induction phase as shown in F igure 2, the anti- ⁇ 2 integrin mAb had little or no effect on the first attack or subsequent p iases of the EAE model and the mice essentially developed the disease equivalent to that of animals treated with the isotype control.
  • results contrast with those previously obtained using the anti- ⁇ 4 antibody, PS/2, in the EAE model (Yednock et al., Mature 356(6364):63-6 (1992); Theien et al., J. Clin. Invest.
  • mice Histological analysis was performed on brains and spinal cords obtained from the mice either when moribund (stage 4) or at the end of the study. Mice were euthanized with halothane when moribund (clinical score 4), or after the 55-60 day observation period. Animals were perfused with PBS, followed with a 4% paraformaldehyde solution. The brains were divided into five coronal slabs, the spinal cords into ten to I .velve transverse slabs and the tissues were paraffin embedded and 4 ⁇ thick sections slained with Luxol Blue to visualize myelination.
  • Tissues were scored in a blinded fashion for degree of myelination, infiltration (meningitis) and perivascular cuffing.
  • each spinal cord section was divided into quadrants: the anterior funiculus, the posterior funiculus and each lateral funiculus.
  • Any quadrant containing meningitis, perivascular cuffing or demyelination was given a score of 1 in that pathologic class; .
  • the total number of positive quadrants for each pathologic class was determined, then divided by the total number of quadrants present on the slide and multiplied by 100 to give the percent involvement for each pathologic class.
  • An overall pathologic score was also determined by giving a positive score if any lesions were present in the quadrant.
  • anti- ⁇ 2 integrin treatment had a marked effect on the incidence of neurological sequelae (paralysis) and a statistically significant reduction in the ma> imum mean clinical score during the first EAE flare as well as in the subsequent relapse phase (chronic phase of EAE; Table 24).
  • Disease incidence during the first attack (anti- ⁇ 2, 61 %; control IgG 85%) and during the chronic phase (anti- oc2, 77%; control IgG 100%) was lower for the group of anti- ⁇ 2 treated mice compa red to control.
  • Human venous blood was collected using a 21 -gauge needle from the cubital vain of healthy donors who had abstained from medications for at least 10 days into 1/10 volume of acidified citrate-dextrose buffer (ACD: 85 mM sodium citrate, 111 mM dextrose, and 71 mM citric acid, with no adjustment in pH) which contained 500 ng/mL prostaglandin I 2 (PGI 2 , Sigma-Aldrich) if being used for making washed platelets.
  • ACD acidified citrate-dextrose buffer
  • PKI 2 prostaglandin I 2
  • Whole blood was centrifuged at 160 ⁇ ; for 20 minutes at ambient temperature and platelet rich p asma (PRP) was removed without disrupting the buffy coat.
  • Washed platelets were prepared by diluting the PRP 2.5-fold with citrate glucose saline buffer (CGS; 13 mM trisodium citrate, 120 mM sodium chloride and 30 mM dextrose, pH 7.0) buffer and PGI :; (500 ng/ml) and centrifuging at 160 ⁇ g for 20 minutes at ambient temperature to removs? any contaminating leukocytes.
  • CGS citrate glucose saline buffer
  • PGI PGI :
  • the supernatant was collected and centrifuged at 1100 -eg for 10 minutes and the resulting platelet pellet was gently resuspended in CGS buffer, washed and resuspended in normal Tyrodes-Hepes buffer (12 mM NaHCO 3 , 133 mM NaCI, 5.5 mM glucose, 2.9 mM KCI, 10 mM HEPES, 1 mM CaCI 2 , 1 mM MgCI 2 , pH 7.4). The platelets were allowed to recover for up to 30 minutes at 37°C. Washed plj; telets were then counted before adding CaCI 2 and MgCI 2 to 1 mM. Washed platelets frc m rat were prepared in a similar manner, although blood was drawn from the vena c ⁇ : va to minimize platelet activation during the blood draw.
  • Soluble collagen is a potent agonist of platelet aggregation and is used as a routine measure of platelet responsiveness (see e.g., Hemostasis and Thrombosis; (2001 ), ed. Colrrian et al). Studies with ⁇ 2-knock out mice have suggested that platelets from these mice exhibit a mild impaired response to collagen (Holtkotter et al, J. Biol. Chem. 277(13): 10789-94 (2002) E. pub Jan, 11 , 2002; Chen et al., Am. J. Pathol. 161(1):337-344 (2002)).
  • a tail oleed was used to measure baseline blood cell counts. Blood samples were taken at specific time points after IP drug administration (e.g., 10, 30, 60 minutes and 4, 24 and 72 hours) from non-anesthetized rats by retro-orbital draw using a capillary Unopipet. Approximately 40 ⁇ L of blood was then transferred to a tube containing 5 ⁇ L of ACD and immediately sampled in a Hemavet blood cell counter (Drew Scientific). The results of this study unexpectedly showed no significant change from baseline platelet counts at doses of 5mg/kg or 10 mg/kg of TMC-2206.
  • ⁇ 2 ⁇ 1 -integrin is the only collagen-binding integrin, albeit not the only collagen receptor, to be expressed by platelets.
  • other mechanisms exist, especially upon platelet activation, to facilitate firm adhesion to a collagen matrix.
  • the ability of the TMC-2206 antibody to block platelet adhesion to Type I, II, III, IV and Vl collagens was evaluated, both for resting platelets and platelets activated with the moderate platelet agonist, ADP.
  • lmmulon Il platelets were coated with collagen types I, II, III, Vl (Rookland Immunochemical) and IV (Sigma, St. Louis, MO) which had been solubilized without frothing in 5 mM acetic acid, to final concentration of 1 mg/mL
  • Wells were washed twice using modified Tyrode's-HEPES buffer without Ca ++ or BSA, but with 2 mM/Mg " and blocked with 100 ⁇ lJwell Tyrode's-HEPES buffer containing 2 mM/Mg ++ and 0.35% BSA, but without Ca ++
  • the platelet pellet was re-suspended in 1 mL CMFTH buffer (5 mM HEPES, pH 7.3, 12 mM sodium bicarbonate, 137 mM NaCI, 3 mM KCI, 0.3 mM NaH 2 PO 4 , 5 mM dextrose and 0.35% BSA) and kept in the dark as much as possible. Washed platelets from rat were pre :)ared in a similar manner, although blood was drawn from the vena cava into a syringe containing 500 ng/mL PGE 1 in ACD to minimize platelet activation during the blood c: raw.
  • CMFTH buffer 5 mM HEPES, pH 7.3, 12 mM sodium bicarbonate, 137 mM NaCI, 3 mM KCI, 0.3 mM NaH 2 PO 4 , 5 mM dextrose and 0.35% BSA
  • CFSE-labeled platelets were diluted to 2.0x10 5 / ⁇ L using Tyrode's-HEPES Buffer containing 0.35% BSA. Labeled platelets (1.0 ⁇ 10 7 well) were applied to wells conti-iining 20 ⁇ M ADP in Tyrode's-HEPES buffer with 0.35% BSA and variable concentrations of test inhibitor. Microtiter plates containing platelet mixtures were centrifuged at 550 ; ⁇ : g for 10 minutes at room temperature followed by incubation in the dark for an additional 10 minutes. Wells were washed with Tyrode's-HEPES buffer. Fluorescence was read using a Victor2 fluorescence plate reader.
  • TMC-2206 was a potent inhibitor of platelet adhesion to the fibrillar collagens, but was less potent for the non-fibrillar Type IV collagen (10 nM compared to 1-2 nM). Unexpectedly in the presence of ADP, there was an approximately 10- to 20-fold decrease in potency for inhibiting the binding to the fibrillar collagens and the antibody no longer was effective at preventing adhesion to Type IV collagen.
  • TMC-2206 and antibodies with the epitope binding specificity of TMC-2206 are less active at inhibiting the interactions of act vated platelets to fibrillar collagen, and would have little or no effect [in the therapeutic closing range] on binding to Type IV collagen, the predominant collagen subtype of the endothelial vessel wall.
  • Rats were given either an IP or IV injection of TMC-2206 15 minutes prior to testing for bleeding time.
  • Non-anesthetized rats were immobilized in a restraining device and 0.8 cm of the tip of the tail cut rapidly to initiate bleeding.
  • the tail was promptly inserted into a beaker containing 30 mL of PBS maintained at 37 0 C.
  • the time required for the tail to stop bleeding was recorded as bleeding time.
  • Table 26 the data demonstrated that administration of doses of TMC-2206 up to 10 mg/kg had no significant effect on bleeding time.
  • anti- ⁇ 2 integrin antibodies were studied in a model of arterial thrombosis. Another potential manifestation of a bleeding disorder from administration of antibodies reactive with ⁇ 2 ⁇ 1 on platelets could be an increased time for thrombotic occlusion to occur following acute arterial injury due to undesired affects of p atelet function.
  • anti- ⁇ 2 integrin antibodies such as TMC-2206, were tested in a rat ferric chloride-induced model of arterial thrombosis.
  • TMC-2206 antibody was administered to rats via tail vein injection approxi ⁇ ately 30 minutes before induction of arterial injury at the doses ranging from 1 mg/kg to 15 mg/kg. For IV injections, most antibodies were concentrated to 4-5 mg/mL to reduce the injection volumes required for the higher doses.
  • the treatment groups were 1.0, 2. !i, 5.0, 10.0 and 15 mg/kg TMC-2206, 5.0 mg/kg control murine IgGI( ⁇ ) (clone MOPC2 I ) 5.0 mg/kg rabbit polyclonal anti-vWF (DAKO) or saline; there were 3-4 animals in each treatment group.
  • anti- ⁇ 2 integrin antibodies were studied, inc uding epitope mapping studies, to characterize the nature of the TMC-2206 binding site on the ⁇ 2 integrin subunit.
  • An anti- ⁇ 2 integrin antibody that binds directly to the target's b nding site and serves as a direct competitor for ligand binding may be expected to cause platelet activation upon binding the ⁇ 2 ⁇ 1 integrin.
  • an anti- ⁇ 2 irilegrin antibody that binds to the ⁇ 2 ⁇ 1 integrin in an inactive state and does not cause the integrin to become activated might have a similar platelet non-activating profile to that which was unexpectedly found for TMC-2206.
  • Antibodies with the same or similar binding epitope as TMC-2206 would inhibit cell adhesion of leukocytes to collagen, and thus have significant therapeutic utility, but would not be associated with the bleieding complications that an antibody that bound to, and activated, ⁇ 2 ⁇ 1 integrin might have.
  • TMC- 2206 Studies were conducted to investigate whether the epitope recognized by TMC- 2206 lay within the ligand-binding I domain of the ⁇ 2 integrin subunit, or whether ii was simply dependent on the presence of an intact I domain (Hangan et al., Cancer Res. 56:3142-3149 (1996)). For these studies, a GST- ⁇ 2 I domain fusion protein was made using a modified version of the protocol described by Tuckwell et al., J.
  • the human ⁇ 2 I domain was cloned from mRNA isolated from approximately 10 6 CHO cells expressing human ⁇ 2 integrin (Symington et al., J Cell Biol. 120(2):523-35. (1993). Cells were lysed in Trizol reagent (Gibco) and chloroform was added to extract the aqueous phase before adding 0.2 volumes of isopropanol to precipitate the RNA which was collected by centrifugation and resuspended in F : !NAse free water.
  • the primers h ulphal F ( ⁇ 'GGGGATCCAGTCCTGATTTTCAGCTCTCAG; SEQ ID N0.H7) and h ulphal R (5'GGGAATTCAACAGTACCTTCAATGCTG; SEQ ID NO:1 18) (see Tab e 27) were used for a single-step RT-PCR reaction using a standard Qiagen kit to amplify amino acids 123 through 346 of the mature ⁇ 2 integrin subunit and to incorporate a SamHI site at the amino terminus (which adds a GS upstream of residue 124 ol the I domain) and an additional EFIVTD hexapeptide as part of the EcoRI cloning site through to the stop codon.
  • a single band was detected by agarose gel electrophoresis.
  • the PCR reaction was cleaned using a Qiagen PCR Quick Kit, the product digested with rest'iction enzymes and cloned into the pGEX-2TK vector (Amersham, GE) using st ⁇ indard molecular biology techniques.
  • Transformed bacteria were screened for insert ⁇ and several clones sequenced using a CEQ system from Beckman-Coulter. The deduced amino acid sequence as cloned was identical to the available sequence of a huma i ⁇ 2 I domain (SEQ ID NO:11 , shown in Table 28).
  • a single clone containing the correci DNA insert was amplified in DH5 ⁇ cells (Invitrogen) and re-transformed into BL21 eloctro- competent bacteria (Invitrogen).
  • the GST-fusion protein with the human ⁇ 2l domain was expressed in logarithmically growing BL21 bacteria using IPTG as an inducing agent. Approximalely 4 hours after induction, the bacteria were harvested and pelleted at 3000 RPM in JiO ml. conical tubes. The pellet was resuspended in PBS containing 1% Triton X-100 and protease inhibitors. The homogenate was sonicated for 1 minute and centrifuged ai 3000 RPM to clear the lysate of cellular debris.
  • the GST-fusion protein was purified from bacterial lysates using glutathione-Sepharose beads (GE-Amersham) according i:o the manufacturer's instructions and eluted in TBS (pH 8.0) containing 20 mM free glutathione.
  • TBS pH 8.0
  • the purified GST- ⁇ 2 I domain bound collagen with same specificity as has been previously reported (Tuckwell et al., J Cell Sci. 108 (Pt 4): 1629-37 (1995)), na ⁇ ely a greater affinity for Type I compared to Type IV collagen.
  • TMC- 2206 It bound to immobilized TMC- 2206 with an apparent K d by ELISA of 0.31 nM, which was comparable to the observed affinity of TMC-2206 binding to intact ⁇ 2 ⁇ 1 integrin of 0.37 nM derived from the direct binding studies described in Example 2.
  • the soluble GST- ⁇ .2 I domain fusion protein was then evaluated for its ability to compete Eu-labeled TMC-2206 for binding to ⁇ 2 ⁇ 1 -coated plates as described in Example 2.
  • the K, value for soluble GST- ⁇ 2 I domain was fo .ind to be similar (0.18 nM compared to 0.28 nM to that obtained for unlabelled TMC- 2206, indicating that the binding site for TMC-2206 lay within the ⁇ 2 I domain and did not require the presence of the ⁇ 1 subunit.
  • Cation dependency indicates that a binding moiety is targeting the divalent cation- binding site (MIDAS) of an integrin, and thus acting as a ligand mimetic.
  • MIDAS divalent cation- binding site
  • Collagen-binding to ⁇ 2 is Mg ++ -dependent under normal physiological conditions, whereas no b inding occurs when Mg ++ is replaced by Ca ++ (Staatz et al., Cell Biol. 108(5):1917-24 ( 1989); Emsley et al., Cell 101(1 ):47-56 (2000)).
  • the GST- ⁇ 2 I domain f usion protein was immobilized on Reacti-Bind glutathione-coated microtiter plates (Pierce Biotechnology, Inc. Rockford, IL) and the ability of Eu-labeled TMC-2206 to bind under different cation conditions (Ca- and Mg-free, Ca ++ or Mg ++ in concentrations ranging from 0.1 ⁇ M to 3 mM) was determined.
  • Plates were coated by incubating 100 ⁇ l_/well GST- ⁇ 2l fusion protein (2.0 ⁇ g/mL in Divalent Cation-Free Binding Buffer: 50 mM HEPES, pi H 7.4, 150 mM NaCI and 0.5% Tween-20) for 1 hour at room temperature, and wells were washed four times in divalent cation-free Wash Buffer.
  • Divalent Cation-Free Binding Buffer 50 mM HEPES, pi H 7.4, 150 mM NaCI and 0.5% Tween-20
  • two variant murine VH-containing antibodies were generated, one carrying a D100A and one a D100R mutation. Their ability to compete for Eu-TMC-2206 binding was then evaluated in the K 1 assay in comparison with the TMC-2206 mouse-human chimeric antibody.
  • the D100A mutant was completely inactive at concentrations up to 0.9 ⁇ M which represented a greater than 1600-fold shift in potency relative to that of the mouse-human chimeric TMC-2206 antibody.
  • the reverse charge mutant D100R was almost as potent as the mouse-human TMC-2206 chimeric antibody as evidenced by the similar K 1 values (0.41 nM compared to 0.52 nM). This provides evidence against any role for D100 residue of TMC-2206 in docking into the metal chelation complex that forms the MIDAS ligand site.
  • TMC-2206 cross-reacts with rat ⁇ 2 ⁇ 1 integrin but does not cross react with mouse ⁇ 2 ⁇ 1 integrin. Since ⁇ 2 ⁇ 1 integrin proteins share high homology across species, residues within the ⁇ 2 ⁇ 1 that are important for antibody binding were identified by methods that would identify the differences tha' exist between those species that cross react with the antibody compared with those that do not (e.g., Champe et al., J. Biol. Chem.
  • Both mouse and rat GST- ⁇ 2 I domain were cloned as GST-fusion proteins to confirm the appropriate cross-reactivity was retained by the respective I domains by PCR methodology such as that described in Example 3.
  • the murine ⁇ 2 I domain was cloned from mRNA isolated from a Balb/C mouse kidney by RT-PCR using the primers m alpha! F (SEQ ID NO: 121 ) and malphal R (SEQ ID NO: 122) and the rat ⁇ 2 I domain l orn a Sprague Dawley rat kidney by RT-PCR using the primers ralphal F (SEQ ID NO: 123) and ralphal R (SEQ ID NO.124).
  • RNA pellets obtained by low speed centrifugation of fresh blood drawn from individual rhesus and cynomolgus monkeys. The white cells were then snap- frozen in liquid nitrogen. A total of 5 * 10 6 (rhesus) and 2 * 10 6 (cynomolgus) cell;; were lysed in 1 ml_ of Trizol (Invitrogen, Cat#15596-026) and total RNA was prepared as described above. The final RNA pellet was resuspended in 50 ⁇ l of DEPC-treatec H 2 O. This served as the template for the first reverse transcriptase (RT) step.
  • RT reverse transcriptase
  • the RT re action consisted of 8 ⁇ l (2.24 ⁇ g for Rhesus mRNA, 1.44 ⁇ g for cynomolgus mRNA) cellular RNA, 1 ⁇ l (10 mM) of DNTPs and 1 ⁇ l (2 ⁇ M) of the human I domain forward iirimer (GGGGATCCAGTCCTGATTT; SEQ ID NO: 119). This mixture was incubated at 65 :i C for 5 min, chilled on ice.
  • PCR products were separated by 1% agarose gel electrophoresis and the band (of expected size) was purified directly from the agarose gel, digested with BamH ⁇ and EcoRI and cloned into the same sites in the pGEX-2TK vector and transformed into BL21 bacteria.
  • Single colonies were isolated and the inserts sequenced using a Beckmari CEQ 8000 DNA analyzer to verify the identity of the murine and rat ⁇ 2 I domain and det ⁇ ; rmine the sequence homology of the two monkey species with human.
  • the cloned murine sequence showed exact identity with I domain region of the deposited sequence, NM_008396.1.
  • the cloned rat sequence was identical to the Genbank enlry fior the rat integrin, XM_34156.1 , with the exception that the cloned sequence contai ned 6 additional residues to the deposited sequence, which allowed the region between residue 16 and 21 (residues 139 through 144 of the intact ⁇ 2 integrin) of the rat domain to be accurately translated.
  • This amino acid sequence, ACPSLV was identical to the mouse residues at these positions.
  • the two primate sequences showed a very high hon ology with human ⁇ 2 I domain sequences.
  • the rhesus ⁇ 2 I domain in nucleotide sequence (SEQ ID NO:104) showed only one nucleotide difference to the human nucleotide sequence, within codon 50, a change from CTT to CTG, but since both encode a leucine, the deduced protein sequences were identical to human.
  • the cynomolgus ⁇ 2 I domain nucleotide sequence (SEQ ID NO: 103) was identical to human except for codcn 40, where there was a change from the human AAG to GAC.
  • fusion proteins were then expressed and purified as described above for the human GST- ⁇ 2 I domain fusion protein. Analysis of the material eluted o : f the glutathione-Sepharose column indicated that the rodent fusion proteins contained aggregated forms. Therefore, these and the primate fusion proteins were further purified by size exclusion chromatography on a Sephadex 75 10/30 (GE-Amersham) column (primate) by FPLC on an Akta-Basic FPLC system (GE-Amersham) to yield a moncimeric fraction.
  • the GST-fusion proteins were then tested for their ability to bind immobilized TMC-2206 as well as their ability to compete Eu-labeled TMC-2206 from binding to immobilized human ⁇ 2 ⁇ 1 integrin.
  • the K, assays were performed as described above in Example 2.
  • lmmulon 4 plates were coated using 50 ⁇ L of a bicarbonate solution (pH 9.0) containing 5 ⁇ g/ml of TMC-2206. Plates were sealed and coating occurred overnight at 4°C. The next morning, the plates were w.-ished twice with TBS solution and then blocked using 200 ⁇ L of the blocking solution described above for 1 hour at room temperature with shaking. After blocking, the blocking solution was removed but the wells were not washed.
  • the rhesus GST- ⁇ 2 I showed comparable affinity to human whereas unexpectedly the cynomolgus monkey GST- ⁇ 2 I showed no detectable affinity for TMC-2206 up to concentrations of 1 ⁇ Ma. These relative rankings were also observed in the K 1 assay.
  • the lack of cross-reactivity of the cynomolgus I domain-GST fusion protein for TMC -2206 indicates that the K40 residue may be a determinant of the epitope.
  • the difference in affinity of the cloned rat GST- ⁇ 2 I (K d of 0.54 nM and K 1 value of 3.8 nM) as compared with the GST-human ⁇ 2 I fusion protein (K d of 0.18 and K 1 value of 0.33 nM) is consistent with the shift in EC 50 values found in assays of TMC-2206 for its ability to antagonize the adhesion of fresh rat platelets compared to human platelets to Type I collage; n, as described above in Example 9.
  • the lack of cross reactivity of the GST-mouse ⁇ 2 I fusion protein for TMC-2206 is consistent with the lack of cross reactivity of the an :ibody with intact mouse ⁇ 2 ⁇ 1 integrin.
  • the resulting protein Vc- riants were expressed and purified as described above for the wt human ⁇ 2 I domain-GST fusion proteins. These were then tested for activity in three ways: first for their relative ability to bind the different collagens to ensure that the mutations did not introduce gross conformational perturbations that would interfere with ligand binding; second, for their apparent affinity for TMC-2206 (direct binding to immobilized TMC-2206 measured by ELISA) and third, for their ability to act as competitive ligands in the K, assay.
  • the , 1 C, and apparent K d data are also summarized in Table 30.
  • the ⁇ C loop assumes an extended conformation in the open position and both the R165 and the adjacent R166 residue have been postulated to contribute to collagen binding (Emsley et al., J Biol Chem 272:28512 (1997) and Cell 100:47 (IiOOO); Kapyla et al., J Biol Chem 275:3348 (2000)). Therefore, four mutations were constr .icted, the E195W; an R165D mutation to reverse the charge and hence disrupt the salt bridge that forms with E195W in the closed conformation, and an N166D mutation, ag ain to reverse the charge within the ⁇ C helix.
  • the E195W change caused a 45-fold decre use in Ki values as shown in Table 31 indicating that the TMC-2206 antibody exhibits a higher affinity for the closed conformation.
  • Both the R165D and N166D change abolished the ability of the I domain to bind the TMC-2206 epitope even at concentrations as high as 1 ⁇ M, again suggesting that the TMC-2206 antibody recognizes a closed conformation.
  • the Y93 in the closed conformation may play a role in TMC-2206 binding, and may provides one determinant for the species specificity of the binding.
  • TMC-2206 antibody e.g., AK7
  • TMC-2206 antibody its derivatives and antibodies like TMC-2206 (e.g., AK7) that recognize the same or similar epitope as TMC-2206.
  • AK7 atypical, non-ligand mimetic antagonists of ⁇ 2 ⁇ 1-co lagen interactions.
  • TMC-2206 and antibodies like TMC-2206 (e.g., that recognise the same or similar epitope as TMC-2206) binding will not support the integrin-mediated outside-in signaling that would normally occur upon engagement of the cognate collagen ligand, and it is this mode of binding that may contribute to the non-bleeding profile of this antibody and antibodies like TMC-2206.
  • the antibodies were tested together with the same lot of platelet ⁇ 2 ⁇ 1- coated microtiter plates used in the epitope mapping studies for their ability to antagonize the binding of Eu-labelled TMC-2206. In another set of studies, the ability of the antibodies to antagonize binding of freshly isolated, resting platelets to Type I cc lagen was determined.
  • A2-IIE10 showed a 10-fold shift compared to TMC-2206 at blocking platelet adhesion, but an approximately 350-fold shift in its ability to compete Eu-labeled TMC-2206, again indicating that there was not a direct concordance between the two antibodies.
  • P1E6 failed to show any effect in either assay, which indicated that it recognizes an activated conformation.
  • the epitope specificity, function blocking activities, and advantages ate not characteristics of all anti human ⁇ 2 ⁇ 1 function blocking antibodies, but rather the novel characteristic of a novel subgroup of antibodies that include TMC-2206 and isimilar antibodies, including derivatives and/or variants of TMC-2206 that can be identified and/or selected as described herein.
  • rat GST- ⁇ 2 I domain usion protein was immobilized on Reacti-Bind glutathione-coated microtiter plates (Pierce Biotechnology, Inc. Rockford, IL).
  • K d of Eu-TMC-2206 binding to immobilized GST- ⁇ 2l domain from human and rat at 37 0 C was determined as described in Exarr pie 2. Scatchard analysis of bound versus free Eu-TMC-2206 indicated the K d values to be 0.2 nM for human ⁇ 2 I domain and 1.3 nM (a 6-fold decrease) for rat ⁇ 2 I domain.
  • EXAMPLE 14 [312] Another study was conducted on exemplary lgG4 antibodies having a hVH14.0 ⁇ 4 heavy chain (SEQ ID NO: 174) or a hVH12.0 ⁇ 4 heavy chain (SEQ ID NO: 176) and a hVL 10.0Q light chain (SEQ ID NO: 178). This study assessed whether binding of these lgG4 antibodies leads to platelet activation, as measured by effects on collagen-induced platelet aggregation. Blood samples were collected via venipuncture from the antecubital vein into vacuum filled tubes contain 3.8% sodium citrate after discarding the first 3.0 ml of free running blood. All antibodies were diluted in saline to final concentrations of 140 ⁇ g/ml.
  • Each disposable cuvette (containing a disposable electrode assembly i was aliquoted with 0.5 ml citrated whole blood and with 0.5 ml of saline or an antibody solution. Each cuvette was pre-warmed to 37°C for 5 minutes in the warming well of the aggregometer (Model 591 A, Chrono-Log, Havertown, PA), then placed into the re action well, the baseline set, and then either 20 ⁇ l of saline or collagen (1 mg/ml; equine lype I, Chrono-Log)) was added to initiate the aggregation reaction. During aggregation an accumulation of platelets formed on the exposed surfaces of the electrodes, resull ing in an increase in impedance.
  • Humanized TMC-2206 (hlgG4/ ⁇ VH12.0 ⁇ /L10.0Q) was tested in its ability tc: block the binding ⁇ 2 ⁇ 1-integrin mediated cell adhesion to type-l collagen using CHO- ⁇ i: cells, HT1080 (human fibrosarcoma) cells, and human platelets following the procedures outlined in Example 2.
  • Humanized TMC-2206 was a potent inhibitor of cell bine ing to collagen with EC 50 values comparable to TMC-2206 (Table 34).
  • Humanized TMC-2206 was evaluated for its ability to bind to immobilized h uman ⁇ 1 ⁇ 1 in an ELISA format.
  • Human ⁇ 1 ⁇ 1 integrin (Chemicon International) was diluted in Coating Buffer (25 mM Tris, pH 7.5, 150 mM NaCI, 1 mM MgCI 2 ) to a final concenl ration of 0.5 ⁇ g/ml.
  • Coating Buffer 25 mM Tris, pH 7.5, 150 mM NaCI, 1 mM MgCI 2
  • 96-well immunoplates were coated with ⁇ 1 ⁇ 1 at 50ng/well and incubated overnight at 4°C.
  • the plates were washed three times with Wash Buffer (50 mM Tris, pH 7.5, 150 mM NaCI, 2 mM MgCI 2 , 0.5% Tween-20) and blocked with 5% w/v/ skim milk in Wash Buffer for one hour at room temperature.
  • Wash Buffer 50 mM Tris, pH 7.5, 150 mM NaCI, 2 mM MgCI 2 , 0.5% Tween-20
  • Humanized TMC-2206, human I ;jG4/ ⁇ (isotype control), mouse anti-human ⁇ 1 (FB-12, Chemicon International) antibodies were serially diluted in Binding Buffer (0.1 mg/ml BSA, IgG free, in Wash Buffer) Fifty microliters/well of the diluted antibody solutions were added to the ⁇ 1 ⁇ 1-coated plates, incubated for one hour at room temperature, and then washed three times.
  • the absorbance (405 nm) was read using a Spectramax Plus plate reader using Softmax Pro software. Similar to TMC- 2206, humanized TMC-2206 and the lgG4/ ⁇ antibodies did not bind to ⁇ 1 ⁇ 1.
  • the control anti- ⁇ 1 ⁇ 1 antibody (FB-12) bound to ⁇ 1 ⁇ 1 with an EC 50 Of 0.79 ⁇ 0.15 nM.
  • the K D and K 1 values for both the TMC-2206 and humanized TMC-2206 MAbs binding to immobilized ⁇ 2 ⁇ 1 were determined using the competitive binding assay.
  • Wells in a 96-well microtiter plate were coated with platelet ⁇ 2 ⁇ 1-integrin (custom-coated with human platelet ⁇ 2 ⁇ 1 by GTI Inc., Wl) and then blocked with nonfat milk.
  • Hunru- nized TMC-2206 antibody was labeled with Eu-NI-ITC reagent, approximately 2 me was suspended into and dialyzed against phosphate buffered saline (PBS; 1.47 mM KH :!
  • the MAb/bicarbonate mixture (0.250 mL) was gently mixed into a vial containing 0.2 mg ⁇ / 1 -(p- isothiocyanatobenzyO-diethylenetriamine- ⁇ / ⁇ / ⁇ /Metraacetic acid chelated with Eu 3+ (Eu-NI-ITC; Perkin Elmer Life Sciences) and incubated overnight at 4 0 C without stirring.
  • the labeled antibody mixture was applied to a PD-10 column (GE Bioscieinces, Piscataway, NJ) pre-equilibrated with Running Buffer (50 mM Tris, pH 7.4 and 133 mM NaCI).
  • Fractions (0.5 mL) were collected and assayed for total protein (Bradford reagent; Bio-Rad Laboratories, Hercules, CA) using a SpectraMax 384 absorbance plate r eader and for europium after 1 :10.000 dilution in DELFIA Enhancement Solution (Perkin-EiJmer) by time-resolved fluorescence (TRF) using a Victor2 multi-label plate reader (l :i erkin Elmer).
  • the fractions that were positive for both protein and europium label were pooled, applied to a new PD-10 column, and samples collected and assayed for total proteh and for europium content by TRF calibrated against a europium standard solution (P srkin- Elmer) to calculate the fluor : protein ratio.
  • the Eu-humanized-TMC-2206 was then applied to the blocked ⁇ 2 ⁇ 1-integrin microtiter plates in a volume of 10 ⁇ L/well. After incubating the sealed plates for 1 hr at 37 0 C to allow binding to reach equilibrium 2 ⁇ L samples were transferred from each well into a fresh well containing DIi: LFIA Enhancement Solution (100 ⁇ l_/well) for the measurement of free (unbound) label.
  • Enhancement Solution 100 ⁇ L/well was added to the emptied wells for the measurement of bound label.
  • the plate was shaken (Titer Plate Shaker, speed seti ng of 5, 5 minutes at room temperature) and TRF intensities were read using the Victor2 nulti- label plate reader.
  • the K D values were calculated by Scatchard analyses.
  • Relative binding potencies to immobilized ⁇ 2 ⁇ 1 integrin were analy2:sd by measuring K, values in a competition assay using 100 pM Eu-humanized-TMC-2:.O6 in the presence of varying concentrations of unlabeled TMC-2206 antibody or humanized TMC-2206 as competitors, using an assay system similar to that described above in this example.
  • Test antibody combinations were then applied to the ⁇ 2 ⁇ 1 integrin coated wells, tested over a concentration range of from 10 ⁇ 11 to 10 ⁇ 7 M, and following the specified time, the amount of bound Eu-humnanized-TMC-2206 was determined
  • the inhibition curves were fitted with the "one site competition" model using Prism software (GraphPad, Inc.) to obtain IC 50 values and to calculate the K 1 using the equation of Cheng and Prusoff (1973) and the respective values for K D from above.
  • TMC-2206 and humanized TMC-2206 were subjected to surface plasmon resonance (SPR) analysis to determine the kinetic dissociation and associate constants, k d and k a (also known as K ⁇ and k on ), respectively to the ⁇ 2 I domain.
  • SPR surface plasmon resonance
  • k d and k a also known as K ⁇ and k on
  • SPR surface plasmon resonance
  • the interaction is monitored in real time and the amount of bound antigen and the association and dissociation rate constants can be measured with high precision.
  • TMC-2206 was captured on one anti-mouse surface and then humanized TMC-2206 was captured on one Protein A surface. [The other two surfaces (one anti-mouse and one Protein A) served as analytic reference s.]
  • GST-human- ⁇ 2 I domain fusion protein was injected across the four surfaces. Responses obtained from the reference surfaces (due to refractive index mismatches between the antigen and running buffer) were subtracted from the responses obtained from the reaction surfaces.
  • the antigen/antibody complexes were stripped from the surfaces such that the surfaces could be used for another b nding cycle.
  • the highest GST-human- ⁇ 2 I domain fusion protein concentration was 41 nM.
  • the antigen solution was flowed over the surfaces for 2 minutes at 50 ⁇ l/min and the antigen dissociation from the surface was monitored for six minutes.
  • the rate con -itants for the binding of GST-human- ⁇ 2 I domain fusion protein to TMC-2206 and humanized TMC-2206 were determined and found to be similar (Table 37)
  • Cynomolgus and additional rhesus monkey ⁇ 2 I domains were cloned from cDNA derived from total RNA extracted from skin tissue (MediCorp, Inc., Montreal, QC). There was; a 9- fold decrease in Kj for rat ⁇ 2 I binding to humanized TMC-2206 compared to the human ⁇ 2 I domain, while the murine ⁇ 2 I-GST fusion protein showed only slight specific binding at the highest concentration (4 ⁇ M; Table 36).
  • the GST-cynomolgus- ⁇ 2-l-domain studied in this example by the competitive binding and SPR analyses encoded the identical sequence to the human ⁇ 2 I domain.
  • These biochemical studies demonstrated that humanized TMC- 2206 cross-reacted with the human, rhesus, cynomolgus, and rat derived ⁇ 2 I domains but not with the mouse ⁇ 2 I domain.
  • In vitro cellular cross-reactivity studies (Example 20) were performed to verify that humanized TMC-2206 cross-reacted to different species blood cells.
  • Species cross-reactivity was further evaluated by binding humanized TMC-2206 to blood cells from different species by flow cytometry.
  • humanized TMC- 2206 cross-reactivity to different species platelets was evaluated.
  • Blood was obtain ed via veni-puncture from human donors, rats, and rhesus/cynomolgus monkeys. Human blood was collected in 3.8% sodium citrate; rhesus and cynomolgus blood were collected in 10 mM EDTA; and rat blood was collected in heparin.
  • Rat whole blood was incubated with 500 ⁇ g/ml of humanized TMC-2206 conjugated to Alexa-488 (Alexa Flue 488 Protein Labeling kit, A10235, Molecular Probes) for 10 minutes at room temperature, followed by incubation with the PE-conjugated-hamster-anti-mouse-CDei (rat platelet marker; BD Biosciences). All samples were washed once, suspended in phos.phate buffered saline, and then subjected to flow cytometry analyses. [Both of the forward scatter and side scatter gates were set to logarithmic scales to further discriminate platelets from the larger red blood cells and leukocytes.] Humanized TMC-2206 bound to the platelets from all four species (Table 38).
  • Anti-CD45 antibodies were used to stain all leukocytes [for human leukocytes PE Cy ⁇ - conjugated-mouse-anti-human (clone H130, BD Biosciences); for rhesus and cynor ⁇ olgus leukocytes PE-Cy5-conjugated mouse anti-human (clone T ⁇ 116, BD Biosciences ); and for rat leukocytes PE-Cy ⁇ -conjugated-mouse-anti-rat (BD Biosciences).
  • leukocytes for human leukocytes PE Cy ⁇ - conjugated-mouse-anti-human (clone H130, BD Biosciences); for rhesus and cynor ⁇ olgus leukocytes PE-Cy5-conjugated mouse anti-human (clone T ⁇ 116, BD Biosciences ); and for rat leukocytes PE-Cy ⁇ -conjugated-mouse-anti-rat (BD Biosciences).
  • Marker antibodies were used to stain platelets: for human platelets PE-Cy5-conjugated-n' ouse- anti-human-CD42b (BD Biosciences); for rhesus and cynomolgus platelets R-PE- conjugated-mouse-anti-human-CD41a (BD Biosciences); and for rat platelets : *-PE- conjugated-hamster-anti-mouse-CD61 (BD Biosciences].
  • Example 9 the EC 50 values for TMC-2206 inhibiting binding of rat platelets and h uman platelets to rat collagen type I was 6.3 nM and 1.7 nM, respectively.
  • Example 19 the K 1 values for the inhibition of humanized TMC-2206 binding to immobilized ⁇ 2 ⁇ 1 by competitors GST-human- ⁇ 2-l domain and GST-rat- ⁇ 2-l domain fusion proteins were 0.57 nM and 5.23 nM, respectively.
  • Example 12 the Kj values for the inhibition of TMC-2206 binding to ⁇ 2
  • all cell samples were washed before being subjected to flow cytometry analyses, with more humanized TMC- 2206 being washed away from the lower affinity rat ⁇ 2 subunit compared to the pr mate ⁇ 2 subunits.
  • the whole blood was diluted 1 :10 in TBS (pH 7.4) and was followed by a 10-rmnute incubation at room temperature with either saline, lgG4/ ⁇ isotype control (132 ⁇ g/ml final concentration), or humanized TMC-2206 (144 ⁇ g/ml final concentration).
  • saline lgG4/ ⁇ isotype control
  • humanized TMC-2206 144 ⁇ g/ml final concentration
  • thrombin-receptor-activating-peptide- ⁇ (TRAP-6, 10 ⁇ M final concentration; AnaSpec Inc., San Jose, CA) or adenosine diphosphate (ADP, 20 ⁇ M final concentration; Sigma) was added to the samples, followed by a 5-minute incubat on at room temperature.
  • ADP adenosine diphosphate
  • Cells were processed for flow cytometry by the incubatior with marker antibodies: PE-Cy5-conjugated-mouse-anti-human-CD42b (BD Biosciencsjs) to stain platelets; PE-conjugated-mouse-anti-human-CD62P (BD Biosciences) to sti iin P- selectin; and FITC-conjugated-PAC-1 (BD Biosciences) to stain activated GPIIbIIIa [PAC- 1 binds to active conformation of the GPIIbIIIa integrin).
  • the sampling error for each sample was less than 5% (95 % confidence level).
  • TF'AP-6 induced significant increases in P-selectin expression.
  • the addition of humanized TMC- 2206 did not statistically affect TRAP-6 induced P-selectin expression compared to ualine or the isotype control (P - 0.96; one-way ANOVA, 95% confidence interval).
  • Theiefore the binding of humanized TMC-2206 did not inhibit TRAP-6 induced platelet activation.
  • humanized TMC-2206 did not induce platelet activation (no inc rease in P-selectin up-regulation or GPIIbIIIa activation), nor inhibit agonist (TRAP-6, ADP) induced platelet activation.
  • This data complements the platelet aggregation study (Example 15, Table 34) that showed that humanized TMC-2206 did not induced platelet aggregation nor inhibited collagen-induced aggregation.
  • Humanized TMC-2206 was evaluated for its effect on both the extrinsic and intrinsic coagulation pathways by measuring prothrombin time (PT) and activated partial thromboplastin time (aPTT).
  • PT prothrombin time
  • aPTT activated partial thromboplastin time
  • Humanized TMC-2206 was added to the plasma to attain final concentrations of 179, 214, and 286 ⁇ g/mL (corresponding to the C max of a single dose of antibody ai 12.5, 15.0, and 20.0 mg/kg, respectively) before subjecting the samples to the coagulation tests.
  • MIA multiplex immunoassay

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Neurosurgery (AREA)
PCT/CA2006/001876 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses Ceased WO2007056858A1 (en)

Priority Applications (20)

Application Number Priority Date Filing Date Title
AP2008004471A AP2809A (en) 2005-11-18 2006-11-17 Anti-Alpha2 Integrin antibodies and their uses
HRP20150691TT HRP20150691T1 (hr) 2005-11-18 2006-11-17 Anti-alfa2 integrin protutijela i njihova uporaba
EA200801314A EA016245B9 (ru) 2005-11-18 2006-11-17 Антитела против альфа2-интегрина и их применение
DK06804739.8T DK1948798T3 (en) 2005-11-18 2006-11-17 The anti-alpha2-integrin antibodies and uses thereof
HK09100422.9A HK1121186B (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses
KR1020087014770A KR101442266B1 (ko) 2005-11-18 2006-11-17 항-알파2 인테그린 항체 및 이의 용도
ES06804739.8T ES2541302T3 (es) 2005-11-18 2006-11-17 Anticuerpos anti-integrina alfa2 y sus usos
SI200631946T SI1948798T1 (sl) 2005-11-18 2006-11-17 Anti-alfa 2 integrin protitelesa in njihova uporaba
CA2629715A CA2629715C (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses
RS20150437A RS54111B1 (sr) 2005-11-18 2006-11-17 Anti-alfa 2 integrinska antitela i njihove upotrebe
BRPI0620469-4A BRPI0620469A2 (pt) 2005-11-18 2006-11-17 anticorpo humanizado anti-integrina alfa2, método para determinar se uma amostra contém a integrina alfa2, kit, ácido nucléico isolado, vetor, célula hospedeira, processo para produção de um anticorpo humanizado anti-integrina alfa2, método de triagem, composição, método para o tratamento de distúrbios associados com a integrina alfa2beta1 em pacientes, método para a inibição da ligação de leucócitos ao colágeno, método de direcionar uma molécula, uso de um anticorpo humanizado anti-integrina alfa2, embalagem e epitopo da integrina alfa2 que liga um anticorpo anti-integrina alfa 2
AU2006315037A AU2006315037C1 (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses
PL06804739T PL1948798T3 (pl) 2005-11-18 2006-11-17 Przeciwciała przeciwko integrynie alfa2 i ich zastosowania
CN200680051249.9A CN101360826B (zh) 2005-11-18 2006-11-17 抗α2整联蛋白抗体及它们的用途
EP06804739.8A EP1948798B1 (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses
JP2008540416A JP5184367B2 (ja) 2005-11-18 2006-11-17 抗アルファ2インテグリン抗体およびその使用
NZ568272A NZ568272A (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses
IL191264A IL191264A (en) 2005-11-18 2008-05-05 Antibodies against integrin alpha 2 and their uses
ZA2008/04148A ZA200804148B (en) 2005-11-18 2008-05-14 Anti-alpha2 integrin antibodies and their uses
NO20082454A NO20082454L (no) 2005-11-18 2008-05-30 Anti-alfa2 integrin antistoffer og deres anvendelser

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US73830305P 2005-11-18 2005-11-18
US60/738,303 2005-11-18

Publications (1)

Publication Number Publication Date
WO2007056858A1 true WO2007056858A1 (en) 2007-05-24

Family

ID=38048251

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2006/001876 Ceased WO2007056858A1 (en) 2005-11-18 2006-11-17 Anti-alpha2 integrin antibodies and their uses

Country Status (22)

Country Link
US (3) US7807794B2 (https=)
EP (2) EP3023497A1 (https=)
JP (1) JP5184367B2 (https=)
KR (1) KR101442266B1 (https=)
CN (1) CN101360826B (https=)
AP (1) AP2809A (https=)
AU (1) AU2006315037C1 (https=)
CA (1) CA2629715C (https=)
DK (1) DK1948798T3 (https=)
EA (1) EA016245B9 (https=)
ES (1) ES2541302T3 (https=)
HR (1) HRP20150691T1 (https=)
IL (1) IL191264A (https=)
MY (1) MY147669A (https=)
NO (1) NO20082454L (https=)
NZ (1) NZ568272A (https=)
PL (1) PL1948798T3 (https=)
PT (1) PT1948798E (https=)
RS (1) RS54111B1 (https=)
SI (1) SI1948798T1 (https=)
WO (1) WO2007056858A1 (https=)
ZA (1) ZA200804148B (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101054725B1 (ko) 2008-07-31 2011-08-05 재단법인서울대학교산학협력재단 세포외기질 성분을 함유하는 노화조절용 조성물 및 이를이용한 노화세포의 노화조절방법
WO2011104604A2 (en) 2010-02-23 2011-09-01 Glenmark Pharmaceuticals S.A. Anti-alpha2 integrin antibodies and their uses
WO2011113308A1 (zh) * 2010-03-17 2011-09-22 永卓博济(上海)生物医药技术有限公司 一种新型人源化抗cd20单克隆抗体
CN102333791A (zh) * 2009-03-10 2012-01-25 株式会社遗传科技 人源化k33n单克隆抗体的生成、表达和表征
JP2012507499A (ja) * 2008-11-06 2012-03-29 グレンマーク ファーマシューティカルズ, エセ.アー. 抗α2インテグリン抗体を使用する処置
WO2012028622A3 (en) * 2010-08-31 2012-07-05 Sanofi Peptide or peptide complex binding to 2 integrin and methods and uses involving the same
WO2012131555A2 (en) 2011-03-25 2012-10-04 Glenmark Pharmaceuticals S.A. Hetero-dimeric immunoglobulins
WO2012158989A3 (en) * 2011-05-19 2013-01-17 The Regents Of The University Of Michigan Integrin alpha-2 binding agents and use thereof to inhibit cancer cell proliferation
CN110007628A (zh) * 2019-04-10 2019-07-12 深圳市华星光电半导体显示技术有限公司 Goa电路及显示面板
CN111088227A (zh) * 2019-12-31 2020-05-01 广州航华生物医药科技有限公司 一种细胞分离培养液和t细胞分离培养的方法
WO2024001669A1 (zh) * 2022-06-27 2024-01-04 昱言科技(北京)有限公司 靶向itga2的抗体和包含此抗体的抗体药物缀合物

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3023497A1 (en) * 2005-11-18 2016-05-25 Glenmark Pharmaceuticals S.A. Anti-alpha2 integrin antibodies and their uses
US20080267978A1 (en) * 2006-08-28 2008-10-30 Mary Zutter Anti-angiogenic targets for cancer therapy
BRPI0910482A2 (pt) 2008-04-29 2019-09-24 Abbott Lab imunoglobinas de domínio variável duplo e usos das mesmas
PE20100092A1 (es) 2008-06-03 2010-03-12 Abbott Lab Inmunoglobulina con dominio variable dual y usos de la misma
WO2011085136A2 (en) * 2010-01-06 2011-07-14 Elan Pharmaceuticals, Inc. Use of perlecan domain v in treating amyloidogenic disease
WO2011119732A2 (en) * 2010-03-24 2011-09-29 Stc.Unm Method for integrin ligand discovery
UY33492A (es) 2010-07-09 2012-01-31 Abbott Lab Inmunoglobulinas con dominio variable dual y usos de las mismas
US8735546B2 (en) 2010-08-03 2014-05-27 Abbvie Inc. Dual variable domain immunoglobulins and uses thereof
US9170138B2 (en) * 2010-10-01 2015-10-27 The Board Of Trustees Of The Leland Stanford Junior University Enhanced microfluidic electromagnetic measurements
DK3252076T3 (da) 2011-01-14 2019-12-02 Univ California Diagnostisk anvendelse af antistoffer mod ror-1-protein
US20150239956A1 (en) * 2012-06-27 2015-08-27 Asahi Kasei Medical Co., Ltd. High-affinity antibody and method for manufacturing the same
US20160264663A1 (en) * 2013-10-21 2016-09-15 The Centre For Drug Research And Development Anti-podocalyxin antibodies and methods of using the same
CN109311994B (zh) 2015-10-01 2022-06-07 药物研究及发展中心 抗足糖萼蛋白抗体及其使用方法
CN112638403A (zh) * 2018-07-03 2021-04-09 康泰伦特药物解决方案有限责任公司 包括饰胶蛋白聚糖的多功能蛋白质分子及其用途
CN113557246B (zh) * 2019-07-24 2023-09-01 韩国基础科学支援研究院 靶向αvβ3整联蛋白的单域抗体
WO2021050970A1 (en) * 2019-09-13 2021-03-18 Rutgers, The State University Of New Jersey Aav-compatible laminin-linker polymerization proteins
CN114931665B (zh) * 2021-12-14 2024-09-27 广州医科大学 六型胶原α2亚基在神经修复产品中的应用
CN115184517B (zh) * 2022-06-30 2024-08-13 广州金域医学检验中心有限公司 一种血浆氨基酸的在线衍生化检测方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5855888A (en) 1994-04-26 1999-01-05 Kanebo, Ltd. Drug for the treatment of rheumatoid arthritis
EP1121151A1 (en) 1998-10-07 2001-08-08 Karolinska Innovations AB Anti-inflammatory alpha2, beta1 integrin-related substances or antibodies
US6596276B1 (en) 1997-09-30 2003-07-22 Beth Israel Deaconess Medical Center Method for inhibiting tumor angiogenesis in a living subject
US6780603B1 (en) 1995-07-21 2004-08-24 Regents Of The University Of Minnesota Analysis of alpha integrins for the diagnosis of diabetic nephropathy
WO2006022682A2 (en) * 2004-08-06 2006-03-02 Applera Corporation Method and compositions for treating diseases targeting cd49b
US20080267978A1 (en) 2006-08-28 2008-10-30 Mary Zutter Anti-angiogenic targets for cancer therapy

Family Cites Families (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
USRE30985E (en) 1978-01-01 1982-06-29 Serum-free cell culture media
US4275149A (en) 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4318980A (en) 1978-04-10 1982-03-09 Miles Laboratories, Inc. Heterogenous specific binding assay employing a cycling reactant as label
JPS6023084B2 (ja) 1979-07-11 1985-06-05 味の素株式会社 代用血液
WO1981001145A1 (en) 1979-10-18 1981-04-30 Univ Illinois Hydrolytic enzyme-activatible pro-drugs
US4376110A (en) 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4419446A (en) 1980-12-31 1983-12-06 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA process utilizing a papilloma virus DNA as a vector
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
NZ201705A (en) 1981-08-31 1986-03-14 Genentech Inc Recombinant dna method for production of hepatitis b surface antigen in yeast
US4640835A (en) 1981-10-30 1987-02-03 Nippon Chemiphar Company, Ltd. Plasminogen activator derivatives
US4601978A (en) 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
US4560655A (en) 1982-12-16 1985-12-24 Immunex Corporation Serum-free cell culture medium and process for making same
US4657866A (en) 1982-12-21 1987-04-14 Sudhir Kumar Serum-free, synthetic, completely chemically defined tissue culture media
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4675187A (en) 1983-05-16 1987-06-23 Bristol-Myers Company BBM-1675, a new antibiotic complex
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
US4767704A (en) 1983-10-07 1988-08-30 Columbia University In The City Of New York Protein-free culture medium
US4496689A (en) 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US4965199A (en) 1984-04-20 1990-10-23 Genentech, Inc. Preparation of functional human factor VIII in mammalian cells using methotrexate based selection
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
US4879231A (en) 1984-10-30 1989-11-07 Phillips Petroleum Company Transformation of yeasts of the genus pichia
US4737456A (en) 1985-05-09 1988-04-12 Syntex (U.S.A.) Inc. Reducing interference in ligand-receptor binding assays
DE3675588D1 (de) 1985-06-19 1990-12-20 Ajinomoto Kk Haemoglobin, das an ein poly(alkenylenoxid) gebunden ist.
GB8516415D0 (en) 1985-06-28 1985-07-31 Celltech Ltd Culture of animal cells
US4980286A (en) 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
WO1987000201A1 (en) 1985-07-05 1987-01-15 Whitehead Institute For Biomedical Research Epithelial cells expressing foreign genetic material
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US5618920A (en) 1985-11-01 1997-04-08 Xoma Corporation Modular assembly of antibody genes, antibodies prepared thereby and use
AU597574B2 (en) 1986-03-07 1990-06-07 Massachusetts Institute Of Technology Method for enhancing glycoprotein stability
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US6548640B1 (en) 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
US4927762A (en) 1986-04-01 1990-05-22 Cell Enterprises, Inc. Cell culture medium with antioxidant
GB8610600D0 (en) 1986-04-30 1986-06-04 Novo Industri As Transformation of trichoderma
US4791192A (en) 1986-06-26 1988-12-13 Takeda Chemical Industries, Ltd. Chemically modified protein with polyethyleneglycol
GB8705477D0 (en) 1987-03-09 1987-04-15 Carlton Med Prod Drug delivery systems
US5166320A (en) 1987-04-22 1992-11-24 University Of Connecticut Carrier system and method for the introduction of genes into mammalian cells
US5306620A (en) 1987-07-08 1994-04-26 The Scripps Research Institute Antibodies that bind to a ligand-induced binding site on integrin and induce integrin activation
US4975278A (en) 1988-02-26 1990-12-04 Bristol-Myers Company Antibody-enzyme conjugates in combination with prodrugs for the delivery of cytotoxic agents to tumor cells
EP0378576B1 (en) 1987-09-11 1995-01-18 Whitehead Institute For Biomedical Research Transduced fibroblasts and uses therefor
WO1989005345A1 (en) 1987-12-11 1989-06-15 Whitehead Institute For Biomedical Research Genetic modification of endothelial cells
JP2917998B2 (ja) 1988-02-05 1999-07-12 ホワイトヘッド・インスティチュート・フォー・バイオメディカル・リサーチ 修飾された肝細胞およびその用途
AU632065B2 (en) 1988-09-23 1992-12-17 Novartis Vaccines And Diagnostics, Inc. Cell culture medium for enhanced cell growth, culture longevity and product expression
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
FR2646437B1 (fr) 1989-04-28 1991-08-30 Transgene Sa Nouvelles sequences d'adn, leur application en tant que sequence codant pour un peptide signal pour la secretion de proteines matures par des levures recombinantes, cassettes d'expression, levures transformees et procede de preparation de proteines correspondant
EP0402226A1 (en) 1989-06-06 1990-12-12 Institut National De La Recherche Agronomique Transformation vectors for yeast yarrowia
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
DE3920358A1 (de) 1989-06-22 1991-01-17 Behringwerke Ag Bispezifische und oligospezifische, mono- und oligovalente antikoerperkonstrukte, ihre herstellung und verwendung
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5196511A (en) 1989-12-01 1993-03-23 The Scripps Research Institute Peptides and antibodies that inhibit integrin-ligand binding
US5262520A (en) 1989-12-01 1993-11-16 The Scripps Research Institute Peptides and antibodies that inhibit integrin-ligand binding
US5122469A (en) 1990-10-03 1992-06-16 Genentech, Inc. Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins
JP3249516B2 (ja) 1990-10-31 2002-01-21 ソマティクス セラピー コーポレイション 遺伝子治療のためのレトロウイルスのベクター
DE69232137T2 (de) 1991-11-25 2002-05-29 Enzon Inc Multivalente antigen-bindende proteine
US6291196B1 (en) * 1992-01-31 2001-09-18 Research Corporation Technologies, Inc. Melanoma and prostate cancer specific antibodies for immunodetection and immunotherapy
US5714350A (en) * 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
MD1367C2 (ro) 1992-11-13 2000-11-30 Idec Pharmaceuticals Corporation Metode de tratament al limfomului celulelor B, anticorpi anti-CD20, hibridom.
ATE218893T1 (de) 1993-08-12 2002-06-15 Neurotech Sa Biokompatible immunoisolatorische kapseln, die genetisch veränderte zellen enthalten
US5523209A (en) 1994-03-14 1996-06-04 The Scripps Research Institute Methods for identifying inhibitors of integrin activation
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US6096871A (en) 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US5858709A (en) 1996-10-15 1999-01-12 Smithkline Beecham P.L.C. Fibronectin binding protein B compounds
US6025155A (en) 1996-04-10 2000-02-15 Chromos Molecular Systems, Inc. Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US20020160970A1 (en) 1996-04-10 2002-10-31 Gyula Hadlaczky Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
EP0942931A2 (en) 1996-11-21 1999-09-22 Cor Therapeutics, Inc. Modulation of interactions between myosin and integrins
US5932421A (en) 1996-12-06 1999-08-03 The Scripps Research Institute Methods and cell lines for identification of regulators of integrin activation
EP0879602A1 (en) 1997-05-21 1998-11-25 Rijksuniversiteit te Leiden A method to increase the survival of transplanted cells
US6849425B1 (en) * 1999-10-14 2005-02-01 Ixsys, Inc. Methods of optimizing antibody variable region binding affinity
EP1414491A4 (en) 2001-07-09 2005-07-06 Elan Pharm Inc METHOD OF INHIBITING THE TOXICITY OF AMYLOID
US7074175B2 (en) 2001-07-25 2006-07-11 Erik Schroeder Handy Thermotherapy via targeted delivery of nanoscale magnetic particles
US6997863B2 (en) 2001-07-25 2006-02-14 Triton Biosystems, Inc. Thermotherapy via targeted delivery of nanoscale magnetic particles
DE10354806A1 (de) 2003-11-21 2005-06-02 Boehringer Ingelheim Microparts Gmbh Probenträger
BRPI0518994A2 (pt) * 2004-12-31 2008-12-02 Biogen Idec Inc anticorpos ou polipeptÍdeos que se ligam a br3, seus usos e formulaÇÕes lÍquidas
WO2007024921A2 (en) 2005-08-24 2007-03-01 Cell Matrix Combination therapies for inhibiting integrin-extracellular matrix interactions
EP3023497A1 (en) 2005-11-18 2016-05-25 Glenmark Pharmaceuticals S.A. Anti-alpha2 integrin antibodies and their uses
FI20075258A0 (fi) 2007-04-17 2007-04-17 Biotie Therapies Corp Menetelmä integriiniinhibiittorirespondereiden seulomiseksi

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5855888A (en) 1994-04-26 1999-01-05 Kanebo, Ltd. Drug for the treatment of rheumatoid arthritis
EP0759302B1 (en) * 1994-04-26 2000-08-16 Kanebo Ltd. Remedy for rheumatoid arthritis
US6780603B1 (en) 1995-07-21 2004-08-24 Regents Of The University Of Minnesota Analysis of alpha integrins for the diagnosis of diabetic nephropathy
US6596276B1 (en) 1997-09-30 2003-07-22 Beth Israel Deaconess Medical Center Method for inhibiting tumor angiogenesis in a living subject
EP1121151A1 (en) 1998-10-07 2001-08-08 Karolinska Innovations AB Anti-inflammatory alpha2, beta1 integrin-related substances or antibodies
WO2006022682A2 (en) * 2004-08-06 2006-03-02 Applera Corporation Method and compositions for treating diseases targeting cd49b
US20080267978A1 (en) 2006-08-28 2008-10-30 Mary Zutter Anti-angiogenic targets for cancer therapy

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ESTAVILLO D. ET AL.: "Functional analysis of a recombinant glycoprotein Ia/IIa (Integrin alpha2beta1) I domain that inhibits platelet adhesion to collagen and endothelial matrix under flow conditions", J. BIOL. CHEM., vol. 274, December 1999 (1999-12-01), pages 35921 - 35926, XP003013252 *
KAMATA T. ET AL.: "Identification of putative ligand binding sites within I domain of integrin alpha2beta1 (VLA-2, CD49b/CD29)", J. BIOL. CHEM., vol. 269, April 1994 (1994-04-01), pages 9659 - 9663, XP003013251 *
SCHOOLMEESTER A. ET AL.: "Monoclonal antibody IAC-1 is specific for activated alpha2beta1 and binds to amino acids 199 to 201 of the integrin alpha2 I-domain", BLOOD, vol. 104, 15 July 2004 (2004-07-15), pages 390 - 396, XP003013249 *
See also references of EP1948798A4
SMITH C. ET AL.: "Mapping the collagen-binding site in the I domain of the glycoprotein Ia/IIa (Integrin alpha2beta1)", J. BIOL. CHEM., vol. 275, 11 February 2000 (2000-02-11), pages 4205 - 4209, XP003013253 *
TUCKWELL D.S. ET AL.: "Monoclonal antibodies identify residues 199-216 of the integrin alpha2 vWFA domain as a functionally important region within alpha2beta1", BIOCHEM. J., vol. 350, September 2000 (2000-09-01), pages 485 - 493, XP003013250 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101054725B1 (ko) 2008-07-31 2011-08-05 재단법인서울대학교산학협력재단 세포외기질 성분을 함유하는 노화조절용 조성물 및 이를이용한 노화세포의 노화조절방법
JP2012507499A (ja) * 2008-11-06 2012-03-29 グレンマーク ファーマシューティカルズ, エセ.アー. 抗α2インテグリン抗体を使用する処置
JP2015145397A (ja) * 2008-11-06 2015-08-13 グレンマーク ファーマシューティカルズ, エセ.アー. 抗α2インテグリン抗体を使用する処置
US8298531B2 (en) 2008-11-06 2012-10-30 Glenmark Pharmaceuticals, S.A. Treatment with anti-alpha2 integrin antibodies
CN102333791A (zh) * 2009-03-10 2012-01-25 株式会社遗传科技 人源化k33n单克隆抗体的生成、表达和表征
WO2011104604A3 (en) * 2010-02-23 2011-12-01 Glenmark Pharmaceuticals S.A. Anti-alpha2 integrin antibodies and their uses
US11267891B2 (en) 2010-02-23 2022-03-08 Sanofi Fc variant antibodies and their uses
EP3590966A1 (en) 2010-02-23 2020-01-08 Sanofi Anti-alpha2 integrin antibodies and their uses
EP2848632A1 (en) 2010-02-23 2015-03-18 Sanofi Anti-alpha2 integrin antibodies and their uses
WO2011104604A2 (en) 2010-02-23 2011-09-01 Glenmark Pharmaceuticals S.A. Anti-alpha2 integrin antibodies and their uses
US8975376B2 (en) 2010-02-23 2015-03-10 Sanofi Anti-alpha2 integrin antibodies and their uses
RU2545401C2 (ru) * 2010-02-23 2015-03-27 Санофи Антитела к интегрину альфа-2 и их применения
WO2011113308A1 (zh) * 2010-03-17 2011-09-22 永卓博济(上海)生物医药技术有限公司 一种新型人源化抗cd20单克隆抗体
KR101853604B1 (ko) * 2010-08-31 2018-05-03 사노피 α2 인테그린에 결합하는 펩타이드 또는 펩타이드 복합체 및 이와 관련된 방법 및 용도
AU2011298369B2 (en) * 2010-08-31 2014-07-31 Sanofi Peptide or peptide complex binding to 2 integrin and methods and uses involving the same
US9234039B2 (en) 2010-08-31 2016-01-12 Sanofi Peptide or peptide complex binding to ALPHA2 integrin and methods and uses involving the same
RU2588668C2 (ru) * 2010-08-31 2016-07-10 Санофи ПЕПТИД ИЛИ ПЕПТИДНЫЙ КОМПЛЕКС, СВЯЗЫВАЮЩИЙСЯ С альфа2-ИНТЕГРИНОМ, СПОСОБЫ ЕГО ПОЛУЧЕНИЯ И ПРИМЕНЕНИЯ УКАЗАННОГО ВЕЩЕСТВА
WO2012028622A3 (en) * 2010-08-31 2012-07-05 Sanofi Peptide or peptide complex binding to 2 integrin and methods and uses involving the same
WO2012131555A2 (en) 2011-03-25 2012-10-04 Glenmark Pharmaceuticals S.A. Hetero-dimeric immunoglobulins
US8975029B2 (en) 2011-05-19 2015-03-10 The Regents Of The University Of Michigan Integrin alpha-2 binding agents and use thereof to inhibit cancer cell proliferation
WO2012158989A3 (en) * 2011-05-19 2013-01-17 The Regents Of The University Of Michigan Integrin alpha-2 binding agents and use thereof to inhibit cancer cell proliferation
CN110007628A (zh) * 2019-04-10 2019-07-12 深圳市华星光电半导体显示技术有限公司 Goa电路及显示面板
CN111088227A (zh) * 2019-12-31 2020-05-01 广州航华生物医药科技有限公司 一种细胞分离培养液和t细胞分离培养的方法
WO2024001669A1 (zh) * 2022-06-27 2024-01-04 昱言科技(北京)有限公司 靶向itga2的抗体和包含此抗体的抗体药物缀合物

Also Published As

Publication number Publication date
JP2009516506A (ja) 2009-04-23
EA200801314A1 (ru) 2008-10-30
EP1948798B1 (en) 2015-04-01
NO20082454L (no) 2008-07-17
NZ568272A (en) 2012-02-24
IL191264A (en) 2016-04-21
DK1948798T3 (en) 2015-07-06
AU2006315037C1 (en) 2013-05-02
PT1948798E (pt) 2015-08-05
US20110135635A1 (en) 2011-06-09
AU2006315037B2 (en) 2012-09-06
US7807794B2 (en) 2010-10-05
EA016245B1 (ru) 2012-03-30
EP1948798A4 (en) 2010-02-24
AP2809A (en) 2013-12-31
CA2629715A1 (en) 2007-05-24
EA016245B9 (ru) 2013-04-30
RS54111B1 (sr) 2015-12-31
KR20080074184A (ko) 2008-08-12
ZA200804148B (en) 2009-12-30
JP5184367B2 (ja) 2013-04-17
US20070128190A1 (en) 2007-06-07
CA2629715C (en) 2016-05-03
EP3023497A1 (en) 2016-05-25
ES2541302T3 (es) 2015-07-17
EP1948798A1 (en) 2008-07-30
US8759009B2 (en) 2014-06-24
CN101360826B (zh) 2014-04-30
SI1948798T1 (sl) 2015-09-30
CN101360826A (zh) 2009-02-04
KR101442266B1 (ko) 2014-11-04
AU2006315037A1 (en) 2007-05-24
AP2008004471A0 (en) 2008-06-30
US20140341892A1 (en) 2014-11-20
HK1121186A1 (en) 2009-04-17
PL1948798T3 (pl) 2015-12-31
MY147669A (en) 2012-12-31
HRP20150691T1 (hr) 2015-11-06

Similar Documents

Publication Publication Date Title
US8759009B2 (en) Anti-alpha2 integrin antibodies and their uses
RU2588668C2 (ru) ПЕПТИД ИЛИ ПЕПТИДНЫЙ КОМПЛЕКС, СВЯЗЫВАЮЩИЙСЯ С альфа2-ИНТЕГРИНОМ, СПОСОБЫ ЕГО ПОЛУЧЕНИЯ И ПРИМЕНЕНИЯ УКАЗАННОГО ВЕЩЕСТВА
JP6719490B2 (ja) 抗il−36r抗体
JP5775458B2 (ja) 抗α2インテグリン抗体を使用する処置
JP2020512344A (ja) 抗il−36r抗体併用治療
NO334834B1 (no) Anti-alfavbeta6-antistoff, celle som produserer slikt antistoff, samt anvendelse av antistoffet for fremstilling av medikamenter
US9587024B2 (en) Monoclonal antibodies for enhancing or inhibiting insulin-like growth factor 1 (IGF-1)
HK1121186B (en) Anti-alpha2 integrin antibodies and their uses
MX2008006459A (en) Anti-alpha2 integrin antibodies and their uses
BRPI0620469A2 (pt) anticorpo humanizado anti-integrina alfa2, método para determinar se uma amostra contém a integrina alfa2, kit, ácido nucléico isolado, vetor, célula hospedeira, processo para produção de um anticorpo humanizado anti-integrina alfa2, método de triagem, composição, método para o tratamento de distúrbios associados com a integrina alfa2beta1 em pacientes, método para a inibição da ligação de leucócitos ao colágeno, método de direcionar uma molécula, uso de um anticorpo humanizado anti-integrina alfa2, embalagem e epitopo da integrina alfa2 que liga um anticorpo anti-integrina alfa 2
TW202313681A (zh) Mageb2結合構建體

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006315037

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 191264

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2006804739

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2629715

Country of ref document: CA

Ref document number: 568272

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 12008501178

Country of ref document: PH

Ref document number: AP/P/2008/004471

Country of ref document: AP

WWE Wipo information: entry into national phase

Ref document number: 2008050808

Country of ref document: EG

ENP Entry into the national phase

Ref document number: 2008540416

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/a/2008/006459

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2006315037

Country of ref document: AU

Date of ref document: 20061117

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2006315037

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200801314

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 08062124

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 1408/MUMNP/2008

Country of ref document: IN

Ref document number: 1020087014770

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200680051249.9

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2006804739

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0620469

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20080516

WWE Wipo information: entry into national phase

Ref document number: P-2015/0437

Country of ref document: RS