WO2007041774A1 - Multicomponent nucleic acid enzymes and methods for their use - Google Patents

Multicomponent nucleic acid enzymes and methods for their use Download PDF

Info

Publication number
WO2007041774A1
WO2007041774A1 PCT/AU2006/001473 AU2006001473W WO2007041774A1 WO 2007041774 A1 WO2007041774 A1 WO 2007041774A1 AU 2006001473 W AU2006001473 W AU 2006001473W WO 2007041774 A1 WO2007041774 A1 WO 2007041774A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
mnazyme
substrate
nucleic acid
target
method
Prior art date
Application number
PCT/AU2006/001473
Other languages
French (fr)
Inventor
Elisa Mokany
Donald John Birkett
Alison Velyian Todd
Tram Bich Doan
Original Assignee
Johnson & Johnson Research Pty Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811Selection methods for production or design of target specific oligonucleotides or binding molecules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6818Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/682Signal amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6823Release of bound markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised

Abstract

The present invention relates to Multicomponent Nucleic Acid Enzymes (MNAzymes) and methods for their use. MNAzymes comprise two or more oligonucleotide components which self-assemble in the presence of one or more MNAzyme assembly facilitator molecules to form a catalytically active structure. Compositions for making MNAzymes, and collections of MNAzymes are provided. Also provided are methods for using MNAzymes for the detection, identification and/or quantification of one or more targets. The methods can be practiced in solution-based assays or in assays where one or more reaction components are attached to a support structure. The methods allow for multiplexing the MNAzyme detection to detect multiple targets in a single reaction. Also provided are kits for making the compositions, and for practicing the methods provided herein.

Description

MULTICOMPONENT NUCLEIC ACID ENZYMES AND METHODS FOR

THEIR USE

CROSS REFERENCE TO RELATED APPLICATIONS

[ 0001 ] This application claims the benefit of US Provisional Patent Application Nos. 5 60/726,291 filed October 13, 2005 and 60/724,567 filed October 7, 2005, respectively, which are incorporated herein by reference in their entirety.

TECHNICAL FIELD

[ 0002 ] The present invention relates to multicomponent catalytic nucleic acids and methods for their use. More particularly, the invention relates to compositions io comprising self-assembling multicomponent nucleic acid enzymes, methods for making such compositions, and methods for using such compositions, including for detecting, identifying and/or quantifying targets such as assembly facilitators and other entities by detecting catalytic modification of substrates by said multicomponent nucleic acid enzymes. i s BACKGROUND OF THE INVENTION

[ 0003 ] Various publications, which may include patents, published applications, technical articles and scholarly articles, are cited throughout the specification in parentheses, and full citations of each may be found at the end of the specification. Each of these cited publications is incorporated by reference herein, in its entirety.

20 [ 0004 ] Nucleic acid molecules can adopt secondary structural configurations which can confer enzymatic or catalytic activity. In vitro evolution technology has facilitated the discovery and development of such catalytic nucleic acids, often referred to as "DNAzymes" or "ribozymes," that are capable of catalyzing a broad range of reactions including cleavage of nucleic acids (Carmi et al, 1996; Raillard and Joyce, .1996;

25 Breaker, 1997; Santoro and Joyce, 1998), ligation of nucleic acids (Cuenoud and Szostak, 1995), porphyrin metallation (Li and Sen, 1996), and the formation of carbon-carbon bonds (Tarasow et al, 1997), ester bonds (Illangasekare et al, 1995) or amide bonds (Lohse and Szostak, 1996).

[ 0005 ] In particular, DNAzymes and ribozymes have been characterized which

30 specifically cleave distinct nucleic acid sequences after hybridizing via Watson Crick base pairing. DNAzymes are capable of cleaving either RNA (Breaker and Joyce, 1994;

Santoro and Joyce, 1997) or DNA (Carmi et al, 1996) molecules. Catalytic RNA - - molecules (ribozymes) are also able to cleave both RNA (Haseloff and Gerlach, 1988) and DNA (Raillard and Joyce, 1996) sequences. The rate of catalytic cleavage of most nucleic acid enzymes is dependent on the presence and concentration of divalent metal ions such as Ba2+, Sr2+, Mg2+, Ca2+, Ni2+, Co2+, Mn2+, Zn2+, and Pb2+ (Santoro and Joyce, s 1998; Brown et al, 2003).

[ 0006 ] Catalytic nucleic acids, such as the hammerhead ribozyme and the 10:23 and 8:17 DNAzymes, have multiple domains. They have a conserved catalytic domain (catalytic core) flanked by two non-conserved substrate binding domains ("hybridizing arms"), which are regions of sequence that specifically bind to the substrate. Haseloff o and Gerlach engineered the hammerhead ribozyme, which was so named for the stem- loop structure that brings the two conserved domains together forming the catalytic core (Haseloff and Gerlach, 1988). The "10:23" and "8:17" DNAzymes are capable of cleaving nucleic acid substrates at specific RNA phosphodiester bonds (Santoro and Joyce, 1997). The 10:23 DNAzyme has a catalytic domain of 15 deoxynucleotides s flanked by two substrate-recognition arms. The 8:17 DNAzyme has a catalytic domain of 14 deoxynucleotides that is also flanked by two substrate-recognition arms.

[ 0007 ] A catalytic nucleic acid can cleave a nucleic acid substrate with a target sequence that meets minimum requirements. The substrate sequence must be substantially complementary to the hybridizing arms of the catalytic nucleic acid, and the G substrate must contain a specific sequence at the site of cleavage. Specific sequence requirements at the cleavage site include, for example, a purine:pyrimidine ribonucleotide sequence for cleavage by the 10:23 DNAzyme (Santoro and Joyce, 1997), and the sequence uridine:X for the hammerhead ribozymes (Perriman et al, 1992), wherein X can equal A, C, or U, but not G. S [ 0008 ] Catalytic nucleic acids have been shown to tolerate only certain modifications in the area that forms the catalytic core (Perreault et al, 1990; Perreault et al, 1991; Zaborowska et al, 2002; Cruz et al, 2004; Silverman, 2004)). Examples of sequences responsible for catalytic activity of DNAzymes are listed in Table 1. Table 1: Exemplary sequences for some active DNAzymes and their substrates

Figure imgf000004_0001

[ 0009 ] The substitution of certain deoxyribonucleotides for certain ribonucleotides in known ribozymes has been attempted under certain conditions (McCaIl et al., 1992). Ribozymes that have been fully converted into DNA have no activity due to the conformational differences of RNA and DNA (Perreault et al., 1990). These studies demonstrate that RNA enzymes cannot be modified into working DNA enzymes by merely replacing ribonucleotides with deoxyribonucleotides. [ 0010 ] There have been some studies which attempted to develop certain homodimeric or heterodimeric ribozymes for therapeutic applications (Kuwabara et al., 1999; Kuwabara et al., 2000; Oshima et al., 2003). In those studies, the catalytic core of the ribozyme comprised solely of ribonucleotides. Moreover, the capacity for DNAzymes to function in dimeric or multimeric formats has not been considered, nor has any information been provided as to how to extrapolate from a dimeric ribozyme to a dimeric DNAzyme in terms of a possible structure of a dimeric DNAzyme and resulting activity.

[ 0011 ] Catalytic nucleic acids have been used in combination with in vitro amplification protocols as a means of generating a detectable signal, thus allowing real time monitoring of amplified nucleic acid target sequences (Todd et al., 2000) (US 6,140,055; US 6,201,113; WO 99/45146; PCT/IB99/00848; WO 99/50452). Zymogene detection (US 6,140,055; US 6,201,113; WO 99/45146; PCT/IB99/00848; WO 99/50452), also known in the art as DzyNA detection (Todd et al., 2000), results in concurrent target and signal amplification. This occurs because the catalytic DNAzymes or ribozymes co-amplify along with target sequences to produce amplicons that function as true enzymes capable of multiple turnover. As such, each catalytic nucleic acid amplicon cleaves multiple reporter substrates. The DNAzymes and ribozymes are introduced into the amplicons by using primers with 5' tags that are inactive, anti-sense Λ sequences of catalytic nucleic acids. When these sequences are copied during in vitro amplification the catalytically active sense sequences are co-amplified along with target sequence. The zymogene/DzyNA approach is very flexible since catalytic signal amplification can be linked to target amplification methods including PCR (polymerase chain reaction), strand displacement amplification ("SDA"), or rolling circle amplification ("RCA"), producing DNAzyme amplicons; and nucleic acid sequence-based amplification ("NASBA"), self-sustained sequence replication ("3SR"), or transcription- mediated amplification ("TMA") amplification methods producing ribozyme amplicons. Further, since numerous catalytic nucleic acid molecules with a broad range of catalytic activities have been discovered or evolved, the zymogene approach can use a reporter substrate other than a nucleic acid where the readout of the assay is dependent on a chemical modification other than cleavage of a nucleic acid substrate. The zymogene/DzyNA (Todd et al., 2000) or NASBA/ribozyme (WO 00/58505) approach may be considered sensitive and useful, but there is potential for noise due to amplification of primer sequences.

[ 0012 ] NASBA has been used to produce RNA amplicons containing target nucleic acid and one section of the catalytic core of the hammerhead ribozyme (GAArA), introduced as antisense sequence tagged to a primer and then copied (WO 00/58505). The additional sequence required for catalytic activity (CUrGANrGrA) was introduced as sense sequence on a second molecule, which was labeled with a fluorophore and quencher, and which also served as the reporter substrate. Certain of the ribonucleotide bases (rN above) must remain as ribonucleotides, or catalytic ribozyme activity is lost. Two molecules consisting entirely of DNA were considered unable to form catalytically active heterodimer enzymes (WO 00/58505). [ 0013 ] Catalytic nucleic acids have also been used for detection of single nucleotide polymorphisms ("SNPs"). The strict requirement for Watson Crick base pairing between the catalytic nucleic acid binding arms and the substrate has allowed the development of methods that allow discrimination of closely related short sequences. DNAzymes and ribozymes have been shown to discriminate between two sequences differing by as little as a single base (Cairns et al., 2000) (WO 99/50452).

[ 0014 ] DNAzymes have properties which provide advantages over ribozymes for certain in vitro applications. DNA is inherently more stable than RNA and hence is more robust with a longer shelf life. DNA can be stored for long periods at room temperature either in solution or in a lyophilized form. DNAzymes also are preferable over the majority of protein enzymes in certain applications because, for example, they are not irreversibly denatured by exposure to high temperatures during amplification.

[ 0015 ] Thus, there is an ongoing need in the art for simple, fast, and cost effective methods for detecting, identifying and quantifying nucleic acid sequences and other entities, which preferably provide catalytic nucleic acids based on DNAzymes and/or ribozymes.

SUMMARY OF THE INVENTION [ 0016 ] According to a first aspect of the present invention, there is provided a composition comprising at least two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an MNAzyme assembly facilitator to form a catalytically active multi- component nucleic acid enzyme (MNAzyme), wherein each of said at least first and said second oligonucleotide components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion; wherein upon self-assembly, the sensor arm portion of said first and second oligonucleotide components act as sensor arms of the MNAzyme, the substrate arm portion of the first and second oligonucleotide components act as substrate arms of the MNAzyme, and the catalytic core portion of the first and second oligonucleotide components act as a catalytic core of the MNAzyme; and wherein the sensor arms of the MNAzyme interact with said MNAzyme assembly facilitator so as to maintain the first and second oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of the MNAzyme, said catalytic core capable of modifying at least one substrate, and wherein said substrate arms of said MNAzyme engage a substrate so that said catalytic core of said MNAzyme can modify said substrate.

[ 0017 ] At least one of said oligonucleotide components, assembly facilitator or substrate may comprise DNA or an analogue thereof. [ 0018 ] The assembly facilitator may be a target to be identified, detected or quantitated. The target may comprise a nucleic acid. The nucleic acid may be selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, tRNA, mRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons, or any combination thereof. The ribosomal RNA may be 16S ribosomal RNA.

[ 0019 ] The source of the nucleic acid may be selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof.

[ 0020 ] The nucleic acid may be amplified. The amplification may comprise one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).

[ 0021 ] The composition may further comprise at least a third oligonucleotide component which acts to stabilise at least one of said substrate arm portions or sensor arm portions.

[ 0022 ] At least one of said assembly facilitator, said oligonucleotide components or substrate or a combination thereof may be comprised of more than one molecule.

[ 0023 ] The catalytic core portions of the first oligonucleotide component may be selected from the group comprising SEQ ID NOs 149 - 153, 155 - 157, 159 and 161, and the catalytic core portions of the second oligonucleotide component may be selected from the group comprising SEQ ID NOs 166 - 170 and 172.

[ 0024 ] The composition may further comprise at least one inhibitor of said self assembly of said MNAzyme.

[ 0025 ] At least one of said oligonucleotide components or assembly facilitator or substrate or a combination thereof may further comprise at least one aptamer or portion thereof. The aptamer or portion thereof may be comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or combination thereof.

[ 0026 ] The composition may further comprise at least one inhibitor of said self assembly of said MNAzyme. [ 0027 ] At least one of said first or said second oligonucleotide components or said assembly facilitator or said substrate may further comprise at least one portion of self complementary sequence capable of forming a hairpin structure. The hairpin structure / may inhibit self assembly of said MNAzyme. The inhibition of self assembly may be removed upon contact of an aptamer with a target. The aptamer, or portion thereof, may bind a target selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof.

[ 0028 ] The substrate may comprise a nucleic acid or a protein. The nucleic acid may comprise at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof. The protein may comprise at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof. The substrate may further comprise at least one nanoparticle or microparticle, or combination thereof. The substrate may be attached to an insoluble support or be free in solution. The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

[ 0029 ] The substrate arms may engage said substrate through complementary base pairing.

[ 0030 ] The modification of said substrate by said MNAzyme may provide a detectable effect. The modification of said substrate may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds, or any combination thereof. The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof. The detectable effect may be measured, wherein the magnitude of said measurement is indicative of the quantity of a target.

[ 0031 ] At least one of said oligonucleotide components, said assembly facilitator or said substrate may be selected from the group comprising DNA, RNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, or a combination thereof. The assembly facilitator and said substrate may comprise nucleic acids that are completely or partially complementary to at least part of said first or second oligonucleotide components. At least one of said oligonucleotide components, said assembly facilitator or said substrate may comprise at least one nucleotide substitution or addition selected from the group comprising 4-acetylcytidine, 5- (carboxyhydroxylmethyl)uridine, 2'~O-methylcytidine, 5-carboxymethylaminomethyl thiouridine, dihydrouridine, 2'-O-methylpseudouridine, beta D-galactosylqueosine, 2'-O- methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1- methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2- methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6- methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5- methoxyaminomethyl-2-thiouridine, beta D-mannosylmethyluridine, 5- methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6- isopentenyladenosine, N-((9-beta-ribofuranosyl-2-methylthiopurine-6- yl)carbamoyl)threonine, N-((9-beta-ribofuranosylpurine-6-yl)N-methyl- carbamoyl)threonine, uridine-5-oxyacetic acid methylester, uridine-5-oxyacetic acid (v), wybutoxosine, pseudouridine, queosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2- thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6- yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutosine, 3-(3-amino-3-carboxypropyl)uridine, beta D-arabinosyl uridine, beta D-arabinosyl thymidine. [ 0032 ] The composition may further comprise at least a third oligonucleotide component and a fourth oligonucleotide component that self-assemble in the presence of at least one additional assembly facilitator to form at least one additional catalytically active MNAzyme, wherein each of said at least third and fourth oligonucleotide components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion; wherein upon self-assembly of at least a third oligonucleotide component and a fourth oligonucleotide component, the sensor arm portion of said at least third and said at least fourth oligonucleotide components form sensor arms of said at least one additional catalytically active MNAzyme, the substrate arm portion of said at least third and said at least fourth oligonucleotide components form substrate arms of said at least one additional catalytically active MNAzyme, and the catalytic core portion of said at least third and said at least fourth oligonucleotide components form a catalytic core of said at least one additional catalytically active MNAzyme; _ and wherein the sensor arms of said at least one additional MNAzyme interact with said at least one additional assembly facilitator so as to maintain said at least third and said at least fourth oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of said at least one additional MNAzyme, said catalytic core capable of acting on at least one additional substrate, and wherein the substrate arms of said at least one additional MNAzyme engage at least one additional substrate so that the catalytic core of said at least one additional MNAzyme can act on said at least one additional substrate.

[ 0033 ] Each of the additional substrates may be the same, different or a combination thereof.

[ 0034 ] According to a second aspect of the present invention, there is provided a method for detecting the presence of at least one assembly facilitator comprising

(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an assembly facilitator to form at least one catalytically active multi- component nucleic acid enzyme (MNAzyme);

(b) contacting the two or more oligonucleotide components with a sample putatively containing the assembly facilitator under conditions permitting:

(1) the self-assembly of said at least one catalytically active MNAzyme, and

(2) the catalytic activity of said MNAzyme; and

(c) determining the presence of the catalytic activity of said at least one MNAzyme, wherein the presence of the catalytic activity is indicative of the presence of said at least one assembly facilitator. [ 0035 ] At least one of said oligonucleotide components or assembly facilitator may be comprised of DNA or an analogue thereof.

[ 0036 ] The assembly facilitator may be a target to be identified, detected or quantified. The target may comprise a nucleic acid. The nucleic acid may be selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, mRNA, tRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons thereof or any combination thereof. The ribosomal RNA may be 16S ribosomal RNA. _ _

[ 0037 ] The source of the nucleic acid may be selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof.

[ 0038 ] The method may further comprise a step of amplifying the assembly facilitator. The step of amplifying may comprise one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA)5 transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR). [ 0039 ] At least one of said assembly facilitator, said oligonucleotide components or substrate or a combination thereof may be comprised of more than one molecule.

[ 0040 ] The method may further comprise determination of the presence of said catalytic activity during or after said amplification.

[ 0041 ] The self assembly of the MNAzyme may require contact of the assembly facilitator with one or both of said first and second oligonucleotide components.

[ 0042 ] The method may further comprise at least a third oligonucleotide component that contacts at least a portion of either or both of the first and second oligonucleotide components to self-assemble the MNAzyme. The third oligonucleotide component may be comprised of more than molecule. [ 0043 ] According to a third aspect of the present invention, there is provided a method for detecting the presence of at least one assembly facilitator comprising

(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of at least a first assembly facilitator to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme);

(b) providing at least a first substrate, said first substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect;

(c) contacting said two or more oligonucleotide components with a sample putatively containing said at least first assembly facilitator under conditions permitting:

(1) the self-assembly of said at least first MNAzyme, and

(2) the catalytic activity of said at least first MNAzyme; and (d) detecting said detectable effect.

[ 0044 ] At least one of said oligonucleotide components, assembly facilitator or substrate may be comprised of DNA or an analogue thereof.

[ 0045 ] The assembly facilitator may be a target to be identified, detected or quantified. The target may comprise a nucleic acid. The nucleic acid may be selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, tRNA, mRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons, or any combination thereof. The ribosomal RNA maybe 16S ribosomal RNA. [ 0046 ] The source of the nucleic acid may be selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof.

[ 0047 ] The method may further comprise the step of amplifying the nucleic acid. The step of amplifying may comprise one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).

[ 0048 ] At least one of said assembly facilitator or said first or said second oligonucleotide components or substrate or combination thereof may be comprised of more than one molecule.

[ 0049 ] The method may further comprise detecting said detectable effect during or after said amplification. The detectable effect may be indicative of the presence of said assembly facilitator. The detectable effect may be quantitatively or qualitatively measured.

[ 0050 ] The substrate may be a nucleic acid or a protein. The nucleic acid may comprise at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof. The protein comprises at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof. The substrate may further comprise at least one of a nanoparticle or microparticle or combination thereof. The substrate may be attached to an insoluble support or be free in solution. - -

[ 0051 ] The substrate may comprise a nucleic acid and said substrate arms may engage said substrate through complementary base pairing.

[ 0052 ] The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of the substrate by the MNAzyme, a detectable effect provided by the detectable portion is increased or decreased. The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.

[ 0053 ] The method may further comprise amplifying the detectable effect by use of a detectable effect amplification cascade. The detectable effect amplification cascade may comprise one or more of a ribozyme/ligase cascade, a circular nucleic acid enzyme cascade, a protein enzyme cascade, or one or more enzymes attached to a support, or any combination thereof.

[ 0054 ] The modification of said substrate may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds.

[ 0055 ] The method may further comprise providing at least a third and fourth oligonucleotide component, said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional assembly facilitator to form at least one additional catalytically active MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified by the additional MNAzyme, wherein said modification provides said additional detectable effect.

[ 0056 ] The at least one additional detectable effect may be independently detectable.

[ 0057 ] At least one of each additional substrate may be attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme. _ _

[ 0058 ] One additional substrate may be attached to at least one insoluble support so that a detectable effect is produced when that substrate is modified by its respective MNAzyme.

[ 0059 ] According to a fourth aspect of the present invention, there is provided a method for detecting the presence of at least one target comprising

(a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and at least a second oligonucleotide component are capable of self-assembly in the presence of said target to form a catalytically active multi- component nucleic acid enzyme (MNAzyme); and wherein at least one of said first and said second oligonucleotide components further comprises at least one aptamer portion;

(b) contacting said oligonucleotide components with a sample putatively containing said at least one target under conditions permitting:

(1) binding of said target to said aptamer portions and

(2) catalytic activity of the MNAzyme; and (c) determining the presence of the catalytic activity of the MNAzyme, wherein the presence of the catalytic activity is indicative of the presence of said target.

[ 0060 ] At least one of said oligonucleotide components may be attached to a solid support.

[ 0061 ] At least one of said oligonucleotide components may be comprised of DNA or an analogue thereof.

[ 0062 ] The target may be identified, detected or quantified.

[ 0063 ] The method may further comprise providing at least a third and fourth oligonucleotide component, said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional target to form at least one additional catalytically active MNAzyme and wherein at least one of said third or fourth oligonucleotide components comprises at least one additional aptamer portion which binds said at least one additional target.

[ 0064 ] According to a fifth aspect of the present invention, there is provided a method for detecting the presence of at least one target comprising

(a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component are capable of self- _ _ assembly in the presence of at least one assembly facilitator and said at least one target to form at least one catalytically active multi-component nucleic acid enzyme (MNAzyme); and wherein at least one of said first or said second oligonucleotide components or said at least one assembly facilitator further comprises at least one aptamer or portion thereof and wherein said target is capable of binding said at least one aptamer or portion thereof;

(b) providing at least one inhibitor of said self assembly of said MNAzyme

(c) contacting said oligonucleotide components, assembly facilitator and said inhibitor with a sample putatively containing said at least one target under conditions permitting: ( 1 ) binding of said target to said at least one aptamer or portion thereof and

(2) catalytic activity of said at least one MNAzyme; and

(3) removal of said inhibition of said self assembly of said catalytically active MNAzyme; and

(d) determining the presence of the catalytic activity of said MNAzyme, wherein the presence of said catalytic activity is indicative of the presence of said target.

[ 0065 ] The at least one target may be selected from the group comprising proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions, nucleic acids or any derivatives, portions or combinations thereof.

[ 0066 ] At least one of said oligonucleotide components, assembly facilitator or inhibitor may be attached to an insoluble support.

[ 0067 ] At least one of said oligonucleotide components, assembly facilitator, aptamer or aptamer portion may further comprise said inhibitor. [ 0068 ] At least one of said first or said second oligonucleotide components or assembly facilitator may further comprise a portion of self complementary sequence capable of forming a hairpin structure. The hairpin structure may inhibit self assembly of said catalytically active MNAzyme.

[ 0069 ] The aptamer or portion thereof may be comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or combination thereof.

[ 0070 ] The inhibition of self assembly of said catalytically active MNAzyme may be removed upon contact of said aptamer or aptamer portion with the target. — I J —

[ 0071 ] The inhibitor may be capable of binding at least one of the group comprising said aptamer or portion thereof.

[ 0072 ] The inhibitor may be selected from the group comprising RNA, DNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, or a combination thereof.

[ 0073 ] The method may further comprise providing a substrate that can be modified by said MN Azyme to provide a detectable effect. The modification may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon- carbon bonds, ester bonds or amide bonds. The substrate may be not modified by said first or second oligonucleotide components individually or by both said first and second oligonucleotide components in the absence of said assembly facilitator and said target.

[ 0074 ] The substrate may comprise a nucleic acid or a protein. The nucleic acid comprises at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof. The protein may comprise at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof.

[ 0075 ] The substrate may further comprise at least one nanoparticle or microparticle or combination thereof.

[ 0076 ] Detection of the detectable effect may be indicative of said catalytic activity of said catalytically active MNAzyme and wherein said catalytic activity is indicative of said target. The detectable effect may be quantitatively or qualitatively measured. The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.

[ 0077 ] The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased. [ 0078 ] According to a sixth aspect of the present invention, there is provided a method for detecting the presence of at least one target comprising — K) —

(a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component are capable of self- assembly in the presence of at least a first assembly facilitator and said at least a first target to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme);

(b) providing at least a first substrate, said first substrate capable of being modified by said at least first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect;

(c) wherein at least one of said first or said second oligonucleotide components or said at least a first assembly facilitator or said at least a first substrate further comprises an aptamer and wherein said target is capable of binding at least a portion of said aptamer, providing at least a first inhibitor which is capable of inhibiting said self-assembly of said catalytically active MNAzyme in the absence of said target;

(d) contacting said oligonucleotide components, said assembly facilitator, said substrate, and said inhibitor with a sample putatively containing said target under conditions permitting:

(1) binding of said target to said aptamer and

(2) removal of said inhibition of said self assembly of said catalytically active MNAzyme (3) catalytic activity of the MNAzyme; and

(e) determining the presence of said detectable effect thereby detecting the presence of said target.

[ 0079 ] At least one of said oligonucleotide components or assembly facilitator may be comprised of DNA or an analogue thereof. [ 0080 ] The aptamer, or portion thereof, may bind a target selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof. [ 0081 ] At least one of said oligonucleotide components, assembly facilitator, substrate, or inhibitor may be attached to an insoluble support.

[ 0082 ] At least one of said oligonucleotide components, assembly facilitator, aptamer or aptamer portion may further comprise said inhibitor. _ _

[ 0083 ] The aptamer or portion thereof may be comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or combination thereof.

[ 0084 ] At least one of said first or said second oligonucleotide components, assembly facilitator or substrate may further comprise a portion of self complementary sequence capable of forming a hairpin structure. The hairpin structure may inhibit self assembly of said catalytically active MNAzyme. The inhibition of self assembly of said catalytically active MNAzyme may be removed upon contact of said aptamer or aptamer portion with the target.

[ 0085 ] The inhibitor may be capable of binding at least one of the group comprising said aptamer or portion thereof. The inhibitor may be selected from the group comprising RNA, DNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide- nucleic acid chimeras, or a combination thereof.

[ 0086 ] The substrate may comprise a nucleic acid or a protein. The nucleic acid may comprise at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof. The protein may comprise at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof.

[ 0087 ] The substrate may further comprise at least one nanoparticle or microparticle or combination thereof. [ 0088 ] Detection of said detectable effect may detect the presence of said target. The detectable effect may be quantitatively or qualitatively measured. The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.

[ 0089 ] The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased. The modification may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds. — m — [ 0090 ] The method may further comprise providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional assembly facilitator and at least one additional target to form at least one additional catalytically active MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified by the additional MNAzyme, wherein said modification provides an additional detectable effect; and wherein at least one of said third or fourth oligonucleotide component or said additional assembly facilitator or said additional substrate further comprises at least one additional aptamer which binds said at least one additional target; wherein at least one additional inhibitor molecule contacts a portion of said additional aptamer, thereby inhibiting said self-assembly of said catalytically active additional MNAzyme in the absence of said additional target; and wherein said at least one additional assembly facilitator contacts at least a portion of said additional oligonucleotide components.

[ 0091 ] The at least one additional detectable effect may be independently detectable.

[ 0092 ] Each of the additional substrates may be the same, different or a combination thereof. [ 0093 ] At least one of each additional substrate may be attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.

[ 0094 ] According to a seventh aspect of the present invention, there is provided a method for detecting the presence of at least one nucleic acid sequence variant comprising

(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of a sequence variant of a nucleic acid to form a catalytically active multi- component nucleic acid enzyme (MNAzyme); (b) providing at least one substrate, said substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect; - - (c) contacting the two or more oligonucleotide components with a sample putatively containing said sequence variant under conditions permitting:

(1) the self-assembly of said catalytically active MNAzyme, and

(2) the catalytic activity of said MNAzyme; and (d) determining the presence of said detectable effect thereby detecting the presence of said at least one sequence variant.

[ 0095 ] The sequence variant may be selected from the group comprising single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, deletions, duplications, translocations, frameshift sequence variants, nonsense sequence variants, or any combination thereof. The sequence variant may be present in DNA or RNA.

[ 0096 ] Either or both of said first oligonucleotide component and said second oligonucleotide components may be comprised of more than one molecule.

[ 0097 ] The sample containing said sequence variant may be selected from the group comprising bisulfite modified methylated or non-methylated DNA, bisulfite modified methylated or non-methylated RNA, at least one amplicon of bisulfite modified methylated or non-methylated DNA, at least one amplicon of bisulfite modified methylated or non-methylated RNA or a combination thereof.

[ 0098 ] The self assembly of the multi-component nucleic acid enzyme may require contact of at least a portion of either or both of the first and second oligonucleotide components with the nucleic acid which comprises said sequence variant.

[ 0099 ] The method may further comprise a step of amplifying the nucleic acid containing said sequence variant. The step of amplifying may comprise one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop- mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR). The method may further comprise determination of the presence of said nucleic acid sequence variant during or after said amplification.

[ 00100 ] The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof. [ 00101 ] The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

[ 00102 ] The substrate may be attached to an insoluble support or free in solution. [ 00103 ] The modification may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds.

[ 00104 ] The method may further comprise

(a) providing at least a third oligonucleotide component and at least a fourth oligonucleotide component that self assemble in the presence of at least one additional nucleic acid sequence variant to form at least one additional catalytically active multi- component nucleic acid enzyme (MNAzyme);

(b) contacting said at least third and at least fourth oligonucleotide components with a sample putatively containing at least one additional nucleic acid sequence variant in the presence of at least one additional substrate capable of being modified by said at least one additional MNAzyme, wherein said modification of said at least one additional substrate provides at least one additional detectable effect under conditions permitting:

(1) the self-assembly of at least one MNAzyme, and

(2) the catalytic activity of at least one MNAzyme; and (c) detecting said at least one additional detectable effect, thereby detecting the presence of said at least one additional sequence variant.

[ 00105 ] The at least one additional detectable effect may be independently detectable.

[ 00106 ] Each of the additional substrates may be the same, different or a combination thereof. [ 00107 ] The method may further comprise providing an insoluble support having said substrate attached thereto.

[ 00108 ] At least one of each additional substrate may be attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.

[ 00109 ] According to an eighth aspect of the present invention, there is provided a method for detecting the presence of a sequence variant of a nucleic acid comprising - -

(a) providing two or more oligonucleotide components comprising at least a first oligonucleotide component and a second oligonucleotide component capable of self assembly in the presence of a nucleic acid to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme); (b) contacting the two or more oligonucleotide components with a sample putatively containing the nucleic acid, in the presence of at least a first substrate modifiable by said at least a first MNAzyme, wherein the substrate comprises a detectable portion capable of providing at least a first detectable effect upon modification of the substrate by said at least a first MNAzyme under conditions permitting: (1) the self-assembly of the MNAzyme, and

(2) the catalytic activity of the MNAzyme; and

(c) wherein the absence of the catalytic activity is indicative of the presence of a sequence variant in said nucleic acid.

[ 00110 ] According to a ninth aspect of the present invention, there is provided a method for detecting the presence of at least one methylated nucleic acid comprising

(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of methylated nucleic acid to form at least one catalytically active multi- component nucleic acid enzyme (MNAzyme); (b) providing at least a first substrate, said first substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides at least a first detectable effect;

(c) contacting the two or more oligonucleotide components with a sample putatively containing the methylated nucleic acid under conditions permitting: (1) the self-assembly of the catalytically active MNAzyme, and

(2) the catalytic activity of the MNAzyme; and

(d) determining the presence of said at least one detectable effect thereby detecting the presence of said at least one methylated nucleic acid.

[ 00111 ] The conditions may further comprise a temperature that facilitates hybridization of said MNAzyme with said methylated nucleic acid but not with unmethylated nucleic acid.

[ 00112 ] The method may further comprise amplifying the detectable effect by use of a detectable effect amplification cascade. The detectable effect amplification cascade may - - comprise one or more of a ribozyme/ligase cascade, a circular nucleic acid enzyme cascade, a protein enzyme cascade, or one or more enzymes attached to a support, or any combination thereof.

[ 00113 ] The source of said methylated nucleic acid may be selected from the group comprising synthetic, mammalian, human, animal acid, plant, fungal, bacterial, viral, archael or any combination thereof.

[ 00114 ] The methylated nucleic acid may be selected from the group comprising methylated RNA or methylated DNA.

[ 00115 ] The self assembly of the multi-component nucleic acid enzyme may require contact of the methylated nucleic acid with one or both of the first and second oligonucleotide components.

[ 00116 ] The method may further comprise providing an insoluble support having at least one of said substrate or said first or second oligonucleotide components, or a combination thereof attached thereto. [ 00117 ] The detectable effect may be detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof. [ 00118 ] The substrate may comprise a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

[ 00119 ] The modification may be selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds.

[ 00120 ] The method may further comprise providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional methylated nucleic acid to form at least one additional catalytically active MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified by said additional MNAzyme, wherein said modification provides said additional detectable effect.

[ 00121 ] The at least one additional detectable effect may be independently detectable. [ 00122 ] Each of the additional substrates may be the same, different or a combination thereof.

[ 00123 ] At least one of said additional substrate may be attached to an insoluble support so that only one of an additional detectable portion and an additional quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.

[ 00124 ] According to a tenth aspect of the present invention, there is provided a method for detecting at least one assembly facilitator using an amplification cascade comprising

(a) providing two or more oligonucleotide components comprising at least a first oligonucleotide component and at least a second oligonucleotide component that self assemble in the presence of at least a first assembly facilitator to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme);

(b) providing an insoluble support having at least a first substrate attached thereto, said first substrate is capable of being modified by said MNAzyme, wherein said first substrate comprises at least a third molecule comprising at least a first catalytically active enzyme that is released upon modification of said first substrate by said first MNAzyme;

(c) contacting said two or more oligonucleotide components with a sample putatively containing said assembly facilitator, in the presence of said insoluble support having said first substrate attached thereto under conditions permitting: (1) the self-assembly of said MNAzyme, and

(2) the catalytic activity of said MNAzyme; and

(d) providing an insoluble support having at least a second substrate attached thereto, said second substrate cleavable by said first catalytically active enzyme wherein said second substrate comprises at least a fourth molecule comprising at least a detectable moiety which is released upon modification of said second substrate by said first enzyme; and

(e) wherein said first catalytically active enzyme modifies a plurality of said second substrate thereby releasing a plurality of detectable moieties - -

(f) wherein said detectable moieties are detectable after modification of said second substrate by said first catalytically active enzyme, and;

(g) wherein detection of said detectable moieties is indicative of the presence of said assembly facilitator. [ 00125 ] The detectable moieties may further comprise an additional second catalytically active enzyme capable of modifying said first substrate thereby releasing additional catalytically active enzyme. At least one of said first or said second catalytically active enzyme may be selected from the group comprising MNAzymes, DNAzymes, ribozymes, hydrolytic enzymes, restriction endonucleases, exonucleases, proteases, proteinases, hydrolases, lyticases, peptidases, dipeptidases, esterases, caspases, cathepsisns, desulfhydrases, amidases, glycosidases.

[ 00126 ] The assembly facilitator may comprise a target to be identified, detected or quantified. The target may be selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions, nucleic acids or any derivatives, portions or combinations thereof. The nucleic acid may be selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, mRNA, tRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons thereof or any combination thereof.

[ 00127 ] According to an eleventh aspect of the present invention, there is provided a method for detecting a target using an MNAzyme mediated signal amplification cascade comprising

(a) providing a first oligonucleotide component and a second oligonucleotide component that self assemble in the presence of said target to form a first catalytically active multi-component nucleic acid enzyme (MNAzyme);

(b) providing an insoluble support having a first and a second substrate attached thereto, said first and second substrates are capable of being modified by said first MNAzyme, wherein said first and second substrates comprise at least a third and a fourth oligonucleotide component respectively, capable of forming a second catalytically active MNAzyme, wherein said third and fourth oligonucleotide components are released upon modification of said first and second substrates by said first MNAzyme; - -

(c) providing said insoluble support having a third and a fourth substrate attached thereto, said third and fourth substrates are capable of being modified by said second MNAzyme, wherein said third and fourth substrates comprise at least a fifth and a sixth oligonucleotide component respectively, capable of forming a third catalytically active MNAzyme, wherein said fifth and said sixth oligonucleotide components are released upon modification of said third and fourth substrates by said second MNAzyme, and;

(d) providing an assembly facilitator capable of facilitating the assembly of said second and said third MNAzyme, and;

(e) providing a fifth substrate which is capable of being modified by said second MNAzyme to provide a detectable effect;

(f) contacting said first and second oligonucleotide components with a sample putatively containing said target, in the presence of said assembly facilitator, and in the presence of said insoluble support having said first, second, third and fourth substrates attached thereto under conditions permitting: (1) self-assembly of said first, second and third, MNAzymes, and

(2) catalytic activity of said first, second and third, MNAzymes; and (g) wherein said third MNAzyme modifies said first and second substrates thereby further providing said second MNAzyme wherein said second MNAzyme further modifies at least one of said third, fourth and fifth substrates thereby further providing said third MNAzyme thereby further providing said detectable effect, and;

(h) wherein detection of said detectable effect is indicative of the presence of said target.

[ 00128 ] The target may be identified, detected or quantified. The target may be selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions, nucleic acids or any derivatives, portions or combinations thereof. The nucleic acid may be selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, mRNA, tRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons thereof or any combination thereof.

[ 00129 ] The fifth substrate may be the same as or different to any one of said first, second, third or fourth substrates. - 0 -

[ 00130 ] Each of said first, second, third or fourth substrates may be present on the same solid support or different solid supports or any combination thereof.

[ 00131 ] The modification of at least one of said first, second, third or fourth substrates may further provide a detectable effect.

5 [ 00132 ] According to a twelfth aspect of the present invention, there is provided a method for making a plurality of multi-component nucleic acid enzymes (MNAzymes) that each recognize at least one assembly facilitator and modify a substrate, the method comprising:

(a) providing a plurality of assembly facilitators to be identified, detected or Q quantified,

(b) designing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an assembly facilitator to form a catalytically active multi-component nucleic acid enzyme (MNAzyme), wherein each of the at least first and second oligonucleotide s components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion, wherein upon self-assembly, the sensor arm portion of the first and second oligonucleotide components form sensor arms of the MNAzyme, the substrate arm portion of the first and second oligonucleotide components form substrate arms of the Q MNAzyme, and the catalytic core portion of the first and second oligonucleotide components form a catalytic core of the MNAzyme; and wherein the sensor arms of the MNAzyme interact with an assembly facilitator so as to maintain the first and second oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of the S MNAzyme, said catalytic core capable of acting on at least one substrate, and wherein the substrate arms of the MNAzyme engage a substrate so that the catalytic core of the

MNAzyme can modify said substrate;

(c) altering said two or more oligonucleotide components such that the substrate arm portion and the catalytic core portion of the first and second oligonucleotide 0 components is constant, and the sensor arm portion of at least one of the first and second oligonucleotide components is adapted to recognize another of the plurality of assembly facilitators, and

(d) repeating the altering step for each of the plurality of assembly facilitators. - Z' l -

[ 00133 ] According to a thirteenth aspect of the present invention, there is provided a kit for detecting the presence of a plurality of targets comprising a plurality of oligonucleotide components designed to assemble a plurality of MNAzymes each corresponding to at least one of a plurality of targets, and at least one substrate. [ 00134 ] According to a fourteenth aspect of the present invention, there is provided a kit for assembling a plurality of MNAzymes comprising a plurality of assembly facilitators, a plurality of oligonucleotide components designed to assemble a plurality of MNAzymes each one corresponding to each of the plurality of assembly facilitators, and at least one substrate. [ 00135 ] According to a fifteenth aspect of the present invention, there is provided a kit for detecting a target comprising a plurality of oligonucleotide components designed to assemble an MNAzyme corresponding to the target, and a substrate.

BRIEF DESCRIPTION OF THE DRAWINGS [ 00136 ] A preferred embodiment of the present invention will now be described, by way of an example only, with reference to the accompanying drawings wherein:

[ 00137 ] Figure 1: Design for an MNAzyme: shown is a depiction of an exemplary design for an MNAzyme, wherein substrate arm portions (A) of partzymes A and B bind to a Reporter substrate, to which is attached a fluorescent tag (left) and a quencher (right). Catalytic core portions (C) are located between substrate arm portions (A) and sensor arm portions (B). Upon binding of sensor arm portions (B) to a Target, the Reporter substrate is cleaved at the MNAzyme Cleavage Site, thereby increasing fluorescence.

[ 00138 ] Figure 2: Strategies for MNAzyme mediated target detection: shown is a flow chart showing exemplary applications of methods for target detection using MNAzymes. MNAzymes can be used for (1) direct detection; (2) detecting amplicons generated, for example, by PCR, SDA, LAMP, RCA, TMA, 3SR or NASBA either during, or following, amplification; and (3) initiating a signal amplification cascade.

[ 00139 ] Figure 3: Method for detection of targets using an MNAzyme and anchored generic substrates: shown is a depiction of exemplary MNAzymes and a method for target detection using MNAzymes that cleave substrates tethered to a support. In this embodiment, the MNAzyme forms only in the presence of an assembly facilitator (target). When the MNAzyme cleaves the tethered substrate between a fluorophore and quencher, a signal is generated. As shown here, upon cleavage between fluorophore F and quencher Q, there is a resultant increase in fluorescence. In general, the method may be designed such that either fluorophore F or quencher Q may stay attached to the support once cleavage occurs. Panel (i): The support shown has only one substrate tethered to it. Panel (ii): There may be multiple substrates tethered in different positions. Each substrate can be cleaved only by an MNAzyme formed in the presence of a specific MNAzyme assembly facilitator molecule - here, Targets 1 and 2 facilitate the self- assembly of MNAzymes 1 and 2 respectively. Thus, in this example MNAzyme 1 only self-assembles in the presence of Target 1 and only cleaves Substrate 1. Similarly, MNAzyme 2 only self-assembles in the presence of Target 2 and only cleaves Substrate 2. The signal can be localised by positioning of the substrate on the surface, thus allowing specific detection of different assembly facilitators.

[ 00140 ] Figure 4: Exemplary methods for target detection: shown are examples of methods that use an MNAzyme to detect a target analyte (An), for example, including but not limited to a protein or small molecule. This example shows generation of a signal by MNAzyme cleavage of a substrate labelled with a fluorophore (F) and a quencher (Q). The general designs could be used in other formats, whereby the signal is generated by a modification other than cleavage and/or where the readout is not fluorescent, but, for example, is colourimetric, radioactive etc. Three general strategies are illustrated in this figure, (i) An aptamer for binding a target analyte is linked to one partzyme (an apta- partzyme). This molecule has self-complementarity, and cannot contribute to active MNAzyme assembly in the absence of target analyte. A second partzyme, a substrate and an assembly facilitator are also provided. When a specific target analyte binds to the aptamer domain, the complementary bases within the apta-partzyme separate, enabling the apta-partzyme to adopt a conformation whereby it can contribute to active MNAzyme assembly. The active MNAzyme can cleave the substrate and generate fluorescence, (ϋ) An aptamer for binding a target analyte is linked to an assembly facilitator. This molecule has self-complementarity, and cannot direct the partzymes to align and assemble an active MNAzyme in the absence of target analyte. Two partzymes and a substrate are also provided. When a specific target analyte binds to the aptamer domain, the complementary bases within the assembly facilitator separate, enabling the assembly facilitator to adopt a conformation whereby it can direct the assembly of active MNAzymes. The active MNAzyme can cleave the substrate and generate fluorescence. (in) Two apta-partzymes, each of which contains a portion of an aptamer, are incubated in - zy - the presence of a substrate. In the absence of target analyte, the two apta-partzymes cannot assemble to form an active MNAzyme. When a specific target analyte is present, and binds to both of the domains that contain a portion of the aptamer, the two apta- partzymes are brought into close proximity and can assemble into an active MNAzyme. The active MNAzyme can cleave the substrate and generate fluorescence.

[ 00141 ] Figure 5: PCR amplification of microRNAs and detection using

MNAzymes: shown is a depiction of an MNAzyme strategy for amplification and detection of short sequences such as micro-RNA (miR) species. The method uses a 3 ' primer that binds to the miR at the 3' end and which has an unrelated extension sequence (shown in dashed boxes) which may (parts (i) and (ii), Loop Primer, left), or may not (parts (iii) and (iv), Tagged primer, right), form a stem-loop structure at the 5' end. The 3 ' miR primer is extended in the presence of reverse transcriptase (parts (i) and (iii), followed by amplification via PCR using 5 'and 3' primers with miR specific sequence at the 3' ends and unrelated extension sequence at the 5' ends (parts (ii) and (iv)). The amplicons can be detected by MNAzymes, which hybridize to the amplicon, including the region between the 5' and 3' primers. A requirement for strict complementarity of the MNAzyme sensor arms and the target nucleic acid allows discrimination of closely related sequences. F: fluorophore; Q: quencher. [ 00142 ] Figure 6: MNAzyme detection coupled to enzyme mediated signal amplification: shown is a depiction of an MNAzyme for initiating a signal amplification cascade. In this embodiment MNAzymes trigger a downstream cascade of signal generation, wherein (from left to right, top panel) an MNAzyme forms only in the presence of a target and then releases an enzyme from a tethered position on a support. As shown in the bottom panel, the freed enzyme then cleaves a fluorescent substrate molecule. The fluorescent substrate is readily detected. F: fluorophore; Q: quencher.

[ 00143 ] Figure 7: Detection of analytes using MNAzymes and signal amplification: An MNAzyme can trigger a cascade generated using spatially separated DNAzymes. As shown in the sequentially numbered steps, an initial MNAzyme cleavage event, which occurs only in the presence of target, can cleave immobilized substrate, thereby releasing a first tethered DNAzyme A ("A") (steps 1-3). DNAzyme A, once freed, then cleaves and releases second tethered DNAzyme B ("B") (labeled with fluorophore) (steps 4-6) that, in turn, cleaves and releases additional DNAzyme A (steps 7-8), resulting in initiation of a cascade. Exponential signal amplification makes measurement facile as DNAzyme B with fluorophore is released in the ensuing cascade. F: fluorophore; Q: quencher.

[ 00144 ] Figure 8: MNAzyme design for RPLPO target: Panel (i): Exemplary sequences for designs 1 (upper panel) and 2 (lower panel) for MNAzymes; Panel (ii): Results of target-dependent cleavage of a reporter substrate by MNAzyme designs 1 (upper panel) and 2 (lower panel). N=A, G, C, T or any analogue; N'=any nucleotide complementary to N; (N or N')x=any number of nucleotides or analogues; K=A, G or AA; W=A or T; rN=any ribonucleotide and/or any number of ribonucleotides; *=wobble base. [ 00145 ] Figure 9: MNAzyme design for RPLPO target: Panel (i): Exemplary sequence for design 3 for an MNAzyme; Panel (ii): Results for target-dependent cleavage of a reporter substrate. Control reactions shown include no-target, hybridization control, two off-target controls and reactions containing either partzyme A or partzyme B oligonucleotides, but not both. N=A, G, C, T or any analogue; N'=any nucleotide complementary to N; (N or N')x =any number of nucleotides or analogues; K=A, G or AA; W=A or T; rN=any ribonucleotide and/or any number of ribonucleotides; *=wobble base.

[ 00146 ] Figure 10: MNAzyme design for RPLPO target: Panel (i): Exemplary sequence for design 4 for an MNAzyme; Panel (ii): The efficiency of target-dependent cleavage for designs 3 and 4. Results are shown for reactions containing the target RPLPO oligonucleotides, and controls lacking target. N=A, G, C, T or any analogue; N'=any nucleotide complementary to N; (N or N')x=any number of nucleotides or analogues; K=A, G or AA; W=A or T; rN=any ribonucleotide and/or any number of ribonucleotides; *=wobble base. [ 00147 ] Figure 11: Use of MNAzymes to discriminate between closely related sequences: Panel (i): DNA sequences, homologous to the hsa-miR-20 and related miR sequences, used as target sequence in the experiments in Figures 11 and 12 are illustrated. The differences in sequence between D-20 and related D-miRs are underlined. The vertical bold dashed line separates the regions of the oligonucleotides recognized by the two sensor arms. Panel (ii): Depicts exemplary sequences for an MNAzyme of design 4 for detection of miR-20. Panel (iϋ): Results for D-20 MNAzyme target-dependent cleavage of a reporter substrate. Control reactions shown: "off-target" oligonucleotides (D-17-5ρ, D-106a, D-106b, D-93), and "no-target" (dH2O) control reactions. - -

[ 00148 ] Figure 12: MgCl2 optimization of the MiR-20 MNAzyme system: Results obtained using an exemplary design 4 MNAzyme system for miR-20 detection. Target (D-20)-dependent cleavage of a reporter substrate. Control reactions containing "off target" sequences (D-17-5p5 D-106a, D-106b, D-93) or "no-target" (dH2O), are shown for reactions containing (i) 5 mM, (ii) 25 niM or (iii) 100 mM MgCl2, respectively.

[ 00149 ] Figure 13: MNAzyme design for RPLPO target: Panel (i): Exemplary sequences for designs 5 and 6 for MNAzymes. Panel (ii): Results for target-dependent cleavage of a reporter substrate using designs 5 and 6, and their "no-target" controls. N=A, G, C, T or any analogue; N'=any nucleotide complementary to N; (N or N')x=any number of nucleotides or analogues; R=A or G; Y=C or U; rN= ribonucleotide base.

[ 00150 ] Figure 14: Detection of PCR amplified RPLPO: Results for target- dependent cleavage of a reporter substrate and various control reactions by the design 4 MNAzyme system targeting the human RPLPO gene. RPLPO MNAzyme reaction contained either (i) control RPLPO oligonucleotides, (ii) RPLPO PCR amplicons (5μl) produced by amplification of human genomic DNA (100 ng) using primers complementary to the RPLPO gene, (iii) "no target" RPLPO PCR reactions which lack genomic DNA or (iv) unamplified human genomic DNA (500 ng).

[ 00151 ] Figure 15: Detection of amplified short (22mer) sequences: Panel (i):

Results for target-dependent cleavage of a reporter substrate by a design 4 MNAzyme system targeting the human miR-20 sequence. MiR-20 MNAzyme reactions were performed with either (i) 10 (1 E+12) copies of the control D-20Target oligonucleotide (not amplified); (ii) PCR amplicons (5μl) produced by amplification of 2 x 107 (2 E+7) copies of the D-20 target oligonucleotide using primers complementary to the miR-20 sequences; (iii)"no target" PCR reactions which lack D-20Target oligonucleotide; (iv) 10 (1 E+8) copies of D-20Target oligonucleotide (not amplified); and (v) an "off target" control D-17-5p Target (2 x 107 (2 E+7) copies amplified by PCR). Panel (U): Comparison of D-20Target sequence and off target sequence, D-17-5p. The D-17-5p oligonucleotide has one mismatch within the PCR primer binding region relative to the D- 20 Target sequence, and one mismatch within the region (located between the primers) that is interrogated by the sensor arms of the MNAzymes.

[ 00152 ] Figure 16: Detection of amplified miR-20 amplicons: Example of end point detection of amplicons using MNAzymes following PCR amplification. PCR was used to - - amplify mir-20 microRNA present in total RNA from human thymus cells, and detected using MNAzyme methodology. Amplified samples and controls are as shown.

[ 00153 ] Figure 17: Quantitative real time PCR analysis of RPLPO exon 5 by

MNAzyme design 6: Example of real-time detection and quantification using MNAzyme

5 methodology, wherein the RPLPO gene was detected using MNAzymes to monitor accumulation of exon 5 of RPLPO. Panel (i): MNAzyme design 6; Panel (ii): fluorescence signal indicating real time PCR for different template amounts as shown; Panel (iii): standard curve and quantitation of amplified material. Results show time- dependent increase in fluorescence for MNAzyme detection of human genomic DNA Q amplified via PCR. R2=0.995; slope =-3.698

[ 00154 ] Figure 18: Schematic representation of an exemplary multiplex analysis of multiple targets: Two or more targets can be simultaneously detected using two or more substrates, each specific for one MNAzyme. Substrates are preferably labeled with different fiuorophores. In this example, Target 1 can be detected by monitoring the s increase in FAM fluorescence and Target 2 can be detected by monitoring the increase in JOE fluorescence. Q: quencher; FAM, JOE: fiuorophores.

[ 00155 ] Figure 19: Single and multiplex detection of RPLPO and D-20 sequences: Detection of RPLPO was monitored using a JOE-labeled substrate and detection of D-20Target sequence was monitored using a FAM-labeled substrate. Panel Q (i): MNAzyme design 6 comprises partzymes for only one MNAzyme system, either for RPLPO (upper panel) or D-20 (lower panel); Panel (ii): MNAzyme design 6 contains partzymes for MNAzymes targeting both RPLPO and D-20.

[ 00156 ] Figure 20: MNAzyme detection of targets using an aptamer: One exemplary strategy for the detection of a target is depicted. In this strategy, an aptamer S sequence is incorporated at the end of a partzyme (apta-partzyme) in a configuration whereby an active MNAzyme is only formed in the presence of the target. The oligonucleotide components required for the MNAzyme detection strategy illustrated include: (a) a standard partzyme; (b) an apta-partzyme which is a partzyme with an aptamer incorporated into one of its ends; (c) an assembly facilitator which binds to both 0 the apta-partzyme and the partzyme enabling assembly of an active MNAzyme (in the presence of target); (d) a reporter probe substrate: and (e) an assembly inhibitor which hybridises to the apta-partzyme in a region which spans at least part of the aptamer sequence and part of the substrate binding arm of the partzyme sequence. In the absence - - of a target analyte (panel (i)), the assembly inhibitor binds to the apta-partzyme thus blocking binding (and cleavage) of the reporter probe substrate. In the presence of a target analyte (panel (U)), the target binds to the aptamer sequence of the apta-partzyme, preventing the binding of the assembly inhibitor and allowing the binding and cleavage of the reporter probe substrate. As such, MNAzymes can only form and cause fluorescent signal generation in the presence of target.

[ 00157 ] Figure 21: MNAzyme detection of small molecules using an aptamer: An example of use of MNAzymes for detection of targets, specifically ATP, is depicted. The strategy illustrated in Figure 20 was demonstrated using the example of detection of a small molecule, ATP. Panel (i) illustrates the sequences of the oligonucleotide components that were used for the detection of ATP. These comprise a partzyme, an aptapartzyme (which incorporates an aptamer for binding ATP), an aptamer/MNAzyme assembly inhibitor, a reporter substrate and an assembly facilitator. Panel (ii) SubBi-1- FB cleavage analysis shows the results obtained following incubation of the oligonucleotide components in the presence, or absence, of ATP and other nucleotides. An increase in fluorescence over time was observed in the presence of ATP, and dATP, but not in the presence of GTP or CTP. Further, no increase in fluorescence was observed in the absence of any target (water only control).

[ 00158 ] Figure 22: Detection of single base mismatches using MNAzymes: An example of use of MNAzymes for detection of single base mismatches is depicted. Panel (i) illustrates the sequences of the oligonucleotide components that were used for the detection of single base mismatches in a RPLPO exon 5 target sequence. The oligonucleotide illustrated comprised two partzymes (A5 and B6), which are based on MNAzyme design 7 (e.g. Example 20) , and a reporter substrate. The third base (X) in the partzyme B sensor arm is either matched or mismatched with the target sequence. When X = G the partzyme and target are fully matched. When X= C there is a mismatch between the sensor arm and the target RPLPO. Panel (ii) shows the results obtained following PCR amplification and real time detection in reactions containing a partzyme B which is either fully matched, or is mismatched, with respect to the RPLPO target. [ 00159 ] Figure 23: The MNAzyme strategy and results for SNP detection: The method uses a truncated partzyme B sensor arm which is fully matched to one version of the SNP, and stabiliser oligonucleotide which facilitates MNAzyme assembly in the presence of the fully-matched target. The requirement for strict complementarity of the - - partzyme B sensor arm and the target nucleic acid allows discrimination of closely related sequences. Panel (i): Fully matched 5-base sensor arm plus stabiliser oligonucleotide; Panel (H): Mismatched 5-base sensor arm plus stabiliser oligonucleotide; Panel (Ui): No stabiliser control; Panel (iv): No target control; Panel (v): Results of MNAzyme SNP detection with fully-matched target, mismatched target, no stabiliser control and no target control.

[ 00160 ] Figure 24: Adaptation of MNAzyme detection to yield a colour-change reaction: The method uses nanoscale gold particles with attached oligonucleotides, which, when linked by bridging oligonucleotides, form a blue aggregate (panel i). The bridging oligonucleotides incorporate a substrate sequence. In the presence of target (panel ii), the MNAzyme assembles and cleaves the substrate sequence, releasing individual gold particles, and resulting in a blue to red colour change which is visible to the naked eye.

[ 00161 ] Figure 25: Example of an MNAzyme cascade using tethered partzymes: MNAzymes can be used to initiate signal amplification cascades as illustrated in this diagram. The reaction contains the following elements: (i) partzymes for MNAzyme 1 which are free in solution; (ii) an assembly facilitator for MNAzymes 2 and 3 (which have the same sensor arms) which is either free in solution (as illustrated) or tethered to an insoluble support by substrate, Sub 1; (iii) partzymes for MNAzyme 2 which are tethered to an insoluble support by the substrate, Sub 1. Sub 1 can be cleaved by either MNAzyme 1 (in the presence of a target) or MNAzyme 3 (in the presence of an assembly facilitator), and cleavage results in the release of the partzymes for MNAzyme 2 into solution; (iv) partzymes for MNAzyme 3 which are tethered to an insoluble support by the substrate, Sub 2. Sub 2 can be cleaved by MNAzyme 2 (in the presence of assembly facilitator) and cleavage results in the release of the partzymes for MNAzyme 3 into solution; (v) Sub 2-FQ, which has the same sequence as Sub 2, but is free in solution and is dual labelled with a fluorophore (F) and a quencher (Q). Sub 2-FQ can be cleaved by MNAzyme 2 to generate a fluorescent signal. In the presence of the target, active MNAzyme 1 forms from partzymes that are free in solution. MNAzyme 1 cleaves its Sub 1 thus releasing partzymes for MNAzyme 2. Once free, these partzymes hybridize with the assembly facilitator and form MNAzyme 2, which cleaves free Sub 2-FQ (generating a fluorescent signal), or tethered Sub 2 (releasing partzymes for MNAzyme 3). Since MNAzyme 3 shares the same substrate arms as MNAzyme 1, it can also cleave tethered Subl, thus releasing more partzymes for MNAzyme 2. This results in a cascade of - - enzymatic generation of the components (partzymes) for more enzymes (MNAzymes) and a concomitant signal amplification cascade.

DEFINITIONS

[ 00162 ] Certain terms are used herein which shall have the meanings set forth as follows.

[ 00163 ] The term "comprising" means "including principally, but not necessarily solely". Furthermore, variations of the word "comprising", such as "comprise" and "comprises", have correspondingly varied meanings.

[ 00164 ] The terms "polynucleotide", "nucleic acid" and "oligonucleotide" may be used interchangeably and refer to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, or analogues, derivatives, variants, fragments or combinations thereof, including but not limited to DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, mRNA, tRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons thereof or any combination thereof. By way of non- limiting example, the source of a nucleic acid may be selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof.

[ 00165 ] The terms "oligonucleotide" and "primer" typically denote a segment of DNA or a DNA-containing nucleic acid molecule, or RNA or RNA-containing molecule, or a combination thereof. Examples of oligonucleotides include nucleic acid targets; substrates, for example, those which can be modified by an MNAzyme; primers such as those used for in vitro target amplification by methods such as PCR; and components of

MNAzymes. MNAzyme assembly facilitators, in certain embodiments, may comprise oligonucleotides as defined herein. Partzymes as used herein may also comprise oligonucleotides.

[ 00166 ] The terms "polynucleotide", "nucleic acid" and "oligonucleotide" include reference to any specified sequence as well as to the sequence complementary thereto, unless otherwise indicated. Oligonucleotides may comprise at least one addition or substitution, including but not limited to the group comprising 4-acetylcytidine, 5- (carboxyhydroxylmethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl thiouridine, dihydrouridine, 2'-O-methylpseudouridine, beta D-galactosylqueosine, 2'-O- methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1- - - methylpseudouridine, 1-methylguanosine, 1-niethylinosine, 2,2-dimethylguanosine, 2- methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6- methyladenosine, . 7-methylguanosine, 5-methylaminomethyluridine, 5- methoxyaminomethyl-2-thiouridine, beta D-mannosylmethyluridine, 5- methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6- isopentenyladenosine, N-((9-beta-ribofuranosyl-2-methylthiopurine-6~ yl)carbamoyl)threonine, N-((9-beta-ribofuranosylpurine-6-yl)N-methyl~ carbamoyl)threonine, uridine-5-oxyacetic acid methylester, uridine-5-oxyacetic acid (v), wybutoxosine, pseudouridine, queosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2- thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6- yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutosine, 3-(3-amino-3-carboxypropyl)uridine, beta D-arabinosyl uridine, beta D-arabinosyl thymidine.

[ 00167 ] The terms "catalytic nucleic acid molecule", "catalytic nucleic acid", "nucleic acid enzyme" and "catalytic nucleic acid sequence" are used herein interchangeably and shall mean a DNA molecule or DNA-containing molecule (also known in the art as a

"DNA enzyme", "deoxyribozyme" or "DNAzyme") or an RNA or RNA-containing molecule (also known in the art as a "RNA enzyme" or "ribozyme") or a combination thereof, being a DNA-RNA hybrid molecule, which may recognize a substrate and catalyze a modification of the substrate. The nucleotide residues in the catalytic nucleic acids may include the bases A, C, G, T, and U, as well as derivatives and analogues thereof.

[ 00168 ] The term "derivative" when used in relation to a nucleic acid or nucleotide of the present invention includes any functionally-equivalent nucleic acids or nucleotides, including any fusion molecules produced integrally (e.g., by recombinant means) or added post-synthesis (e.g., by chemical means). Such fusions may comprise oligonucleotides of the invention with RNA or DNA added thereto or conjugated to a polypeptide (e.g., puromycin or other polypeptide), a small molecule (e.g., psoralen) or an antibody. [ 00169 ] The term "analogue" when used in relation to a nucleic acid or nucleotide includes a compound having a physical structure that is related to a DNA or RNA molecule or residue, and may be capable of forming a hydrogen bond with a DNA or RNA residue or an analogue thereof (i.e., it is able to anneal with a DNA or RNA residue or an analogue thereof to form a base-pair), but such bonding is not so required for said compound to be encompassed within the term "analogue". Such analogues may possess different chemical and biological properties to the ribonucleotide or deoxyribonucleotide residue to which they are structurally related. Methylated, iodinated, brominated or biotinylated residues are examples of analogues. Active DNAzymes have been described which contain nucleotide analogues, including deoxyinosine, C-5-immidazole deoxyuridine, 3-(aminopropynyl)-7-deaza-dATP, 2'-O-methyl RNA, 2' O-methyl cap (Warashina et al., 1999; Cairns et al., 2003; Schubert et al., 2004; Sidorov et al., 2004). Other analogues are compatible with catalytic activity of DNAzymes. Alteration of a catalytic nucleic acid sequence, for example by substitution of one base for another, by substitution of an analogue for a base, or alteration of the sugar component or phosphodiester backbone, can be straight forward for the skilled artisan. For example, alterations can be made during synthesis, or by modification of specific bases after synthesis. Empirical testing of catalytic nucleic acids incorporating alterations such as base changes or base analogues allows for assessment of the impact of the altered sequences, or specific analogues, on catalytic activity. Analogues of the bases A, C, G, T and U are known in the art, and a subset is listed in Table 2.

Table 2: Examples of nucleotide analogues useful herein

Figure imgf000038_0001
- -

Figure imgf000039_0001

[ 00170 ] The term "fragment" when used in relation to a nucleic acid refers to a constituent of that nucleic acid. Typically the fragment possesses qualitative biological activity in common with the nucleic acid, although this does not necessarily have to be the case. Fragments of a nucleic acid do not necessarily need to encode polypeptides which retain biological activity. Rather, a nucleic acid fragment may, for example, be useful as a hybridization probe or PCR oligonucleotide. The fragment may be derived from a nucleic acid of the invention or alternatively may be synthesized by some other means, for example chemical synthesis. [ 00171 ] The term "variant" as used herein refers to substantially similar nucleic acid or polypeptide sequences. Generally, sequence variants possess qualitative biological activity in common. Further, such sequence variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity. Also included within the meaning of the term "variant" are homologues, which are typically a polypeptide or nucleic acid from a different species but sharing substantially the same biological function or activity as the corresponding polypeptide or nucleic acid disclosed herein.

[ 00172 ] The term "high stringency" as used herein refers to the conditions under which two nucleic acids may be hybridized, and may include, for example, the concentration of salts and/or detergents in a solution, the temperature of a solution that is used during the hybridization of the two nucleic acids and time period of the hybridization. Accordingly, the term "high stringency" as used herein refers to conditions in a solution that are conducive to hybridization of two nucleic acids only where such nucleic acids share a high degree of complementarity. The degree of complementarity may include, but not be limited to, a range of from about 50% to 99%. Thus, "high stringency" conditions may involve, but are not limited to, the use of a varying temperature and a buffer comprising various concentrations of detergents, salts, and divalent cations.

[ 00173 ] The terms "assembly facilitator molecule", "assembly facilitator", "MNAzyme assembly facilitator molecule", "facilitator" and "MNAzyme assembly facilitator" as used herein refer to entities that can facilitate the self-assembly of component partzymes to form a catalytically active MNAzyme. Li preferred embodiments an assembly facilitator is required for the self assembly of an MNAzyme. An assembly facilitator in some embodiments comprises a target such as a nucleic acid or non-nucleic acid analyte. Assembly facilitator molecules may comprise one or more regions or molecules that may pair with, or bind to, one or more oligonucleotide "partzymes," which constitute components or portions of an "MNAzyme". It is not required that the assembly facilitator interact with, pair with, or bind to each component - - partzyme or oligonucleotide provided that it interacts with, pairs with, or binds to, at least one of the component partzymes of an MN Azyme. As used herein, MNAzyme assembly facilitator molecules are intended to encompass the broadest range of constituents which can facilitate self-assembly of an MNAzyme. In some embodiments, an assembly facilitator may comprise a nucleic acid. In other embodiments, an assembly facilitator may comprise any cell or any portion thereof, for example, any eukaryotic or prokaryotic cell, a virus, prion, yeast or fungus, or any other molecule, for example, including but not limited to a protein, polypeptide, peptide or nucleic acid. In other embodiments, an assembly facilitator may comprise a virus, prion, yeast or fungus, or any other molecule, for example, including but not limited to glycoproteins, lipids, lipoproteins, entire organisms, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof.

[ 00174 ] The term "target" as used herein includes any natural or synthetic entity, constituent or analyte which is sought to be detected, identified or quantified by a particular MNAzyme(s). Targets therefore encompass the broadest range of detectable entities, constituents or analytes for which methods of sensitive detection, identification and/or quantification are desirable, hi some embodiments, a target comprises an assembly facilitator. Some exemplary targets include, but are not limited to, protein, polypeptide, peptide or nucleic acid, glycoproteins, lipids, lipoproteins, entire organisms, cells, viruses, bacteria, archaea, yeast, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof. Other targets are also contemplated for use herein. [ 00175 ] The terms "substrate", "substrate molecule" and "chemical substrate" as used herein include any molecule which is capable of being recognized, and acted upon or chemically modified by a catalytic molecule. In particular embodiments, a substrate may be recognized and modified by an enzyme. In other embodiments, a substrate may be recognized and modified by a catalytic nucleic acid molecule. The chemical modification of a substrate can be measured by the appearance of, or increase in, a product of the modification reaction, or by the disappearance of, or decrease in, a substrate of the modification reaction(s). A particular catalytic molecule may recognize one or more different substrate molecules provided each substrate molecule has at least a minimum structure which is recognizable for catalytic activity by the catalytic molecule. - -

[ 00176 ] A "reporter substrate", "reporter probe" or "reporter probe substrate" as used herein is a substrate that is particularly adapted to facilitate measurement of either the disappearance of a substrate or the appearance of a product in connection with a catalyzed reaction. Reporter substrates can be free in solution or bound (or "tethered"), for example, to a surface, or to another molecule. A reporter substrate can be labeled by any of a large variety of means including, for example, fluorophores (with or without one or more additional components, such as quenchers), radioactive labels, labeling with biotin (e.g. biotinylation) or chemiluminescent labels. Reporter substrates for catalytic nucleic acids may also include protein or nucleic acid enzymes, for example, covalently attached to their termini.

[ 00177 ] As used herein, "generic" or "universal" substrates are substrates, for example reporter substrates, that are recognized by and acted on catalytically by a plurality of MNAzymes, each of which can recognize a different target. The use of such substrates facilitates development of separate assays for detection, identification or quantification of a wide variety of targets using structurally-related MNAzymes all of which recognize a universal substrate. These universal substrates can each be independently labeled with one or more labels. In preferred embodiments, independently detectable labels are used to label one or more generic substrates to allow the creation of a convenient system for independently or simultaneously detecting a variety of targets using MNAzymes. [ 00178 ] As used herein, the terms "partzyme", "component partzyme" and "component oligonucleotide" refer to a DNA-containing or RNA-containing or DNA- RNA-containing oligonucleotide, two or more of which, only in the presence of a MNAzyme assembly facilitator molecule, can together form an "MNAzyme." In certain preferred embodiments, one or more component partzymes, and preferably at least two, may comprise three regions or domains: a "catalytic" domain, which forms part of the MNAzyme's catalytic core that catalyzes a chemical modification; a "sensor arm" domain, which may associate with and/or bind to an assembly facilitator (e.g. a target); and a "substrate arm" domain, which may associate with and/or bind to a substrate. A depiction of these regions or domains can be seen, for example, in Figure 1. A partzyme may comprise one or more molecules. Partzymes may comprise at least one additional component including but not limited to an aptamer, referred to herein as an "apta- partzyme." A partzyme may also include a substrate, as can be seen, for example, in Figure 25. - -

[ 00179 ] The term "MNAzyme" as used herein, refers to two or more oligonucleotide sequences (e.g. partzymes) which, only in the presence of MNAzyme assembly facilitator molecule (for example, a target), form an active nucleic acid enzyme that is capable of catalytically modifying a substrate. An exemplary MNAzyme comprising partzyme A and partzyme B is depicted in Figure 1. With reference to Figure 1, DNA partzymes A and B each bind to a target (e.g., through Watson-Crick base pairing with a nucleic acid target). The MNAzyme only forms when the sensor arms of partzymes A and B hybridize adjacent to each other on the target. The substrate arms of the MNAzyme engage the reporter substrate, the cleavage of which is catalyzed by the catalytic core of the MNAzyme, formed by the interaction of the catalytic domains of partzymes A and B. The MNAzyme cleaves the substrate between a fluorophore and a quencher dye pair, thus generating signal. Cleavage of a DNA/RNA chimera (reporter substrate) is exemplified in the drawing. The terms "multi-component nucleic acid enzyme" and "MNAzyme" are used herein interchangeably and comprise bipartite structures, composed of two molecules, or tripartite structures, composed of three nucleic acid molecules, or other multipartite structures, for example those formed by four or more nucleic acid molecules. An MNAzyme may also comprise a stabilizing oligonucleotide which provides stability of the MNAzyme by interacting with an assembly facilitator or substrate. It is apparent that formation of an MNAzyme requires the assembly of at least the partzyme components with the assembly facilitator, as well as the binding of a substrate, for catalytic activity to be detectable, and that the absence of any of these components will result in a lack of catalytic activity.

[ 00180 ] As used herein an "aptamer" may comprise a structure that has the ability to recognize one or more ligands. For example, the recognition may have a high degree of specificity due to higher level structure of the aptamer, such as, a 3 -dimensional binding domain or pocket. Aptamers may therefore bind protein, polypeptide, peptide or nucleic acid, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, entire organisms, small molecules, polymers, metal ions, metal salts, prions or any derivative, portion or combination thereof, or any other entity. Preferred aptamers herein may comprise short single- stranded DNA or RNA oligomers that can be isolated from complex libraries of synthetic nucleic acid by an iterative process of adsorption, recovery, and reamplification. Aptamers may therefore be generated against almost any target, ranging from small molecules such as amino acids, or antibiotics to protein and nucleic acid structures. - -

[ 00181 ] As used herein, the term "cascade" refers to any succession of processes or operations that occur in successive stages, wherein the occurrence of each stage is typically dependent on the occurrence of a preceding stage. A cascade may therefore include, but is not limited to, an enzymatic cascade or any other signal transduction cascade. In some embodiments, a cascade may comprise amplification of a signal resulting from catalytic activity of an MNAzyme. In preferred embodiments, such an amplification cascade may involve repeated and therefore cyclic amplification of a signal, wherein catalytic activity of a first MNAzyme makes available a required molecule for catalytic activity of a second MNAzyme, which in turn makes available a required molecule for catalytic activity of the first MNAzyme. In some embodiments, the required molecule may comprise a partzyme, an enzyme, an assembly facilitator, a substrate, a target, a portion or fragment thereof or a combination thereof. In some embodiments, a cascade may therefore involve production of a cumulative effect, and thus detect a target of low abundance by generating a signal to a level at which it may be detected. In other embodiments, more than two catalytic stages may be employed. The cascade may be linear. In a preferred embodiment, the cascade may be exponential.

[ 00182 ] As used herein, the terms "inhibitor" or "assembly inhibitor" include, but are not limited to, any protein, polypeptide, peptide or nucleic acid, RNA, DNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, entire organisms, small molecules, polymers, metal ions, metal salts, prions or any derivative, portion or combination thereof, or any other entity or molecule that interacts with one or more components of an MNAzyme as defined herein, or that interacts with a substrate or assembly facilitator, so as to prevent assembly of an MNAzyme. An "inhibitor" or "assembly inhibitor" need not be in physical proximity to an MNAzyme, but, by way of non-limiting example, may competitively bind a component part of an MNAzyme, substrate or assembly facilitator, thereby preventing such component part from being available for MNAzyme assembly. Such binding may include, for example, an inhibitory nucleic acid that is complementary to an oligonucleotide comprising a component part of an MNAzyme.

[ 00183 ] The following abbreviations are used herein and throughout the specification:

MNAzyme: multi-component nucleic acid enzyme, or multipartite nucleic acid enzyme; - -

DNAzyme'. deoxyribonucleic acid enzyme;

RNAzyme: ribonucleic acid enzyme, or ribozyme;

PCR: polymerase chain reaction;

SDA: strand displacement amplification; LAMP: loop-mediated isothermal amplification;

RCA: rolling circle amplification;

TMA: transcription-mediated amplification;

3SR: self-sustained sequence replication;

NASBA: nucleic acid sequence based amplification; (IH2O: deionized distilled water;

LNA: locked nucleic acid;

PNA: peptide nucleic acid; bDNA: branched DNA assay;

FCS: fluorescence correlation spectroscopy; TSA: tyramide signal amplification;

An: analyte or target;

F: fluorophore;

Q: quencher; miR: microRNA; N= A, C, T, G, or any analogue thereof;

N'= any nucleotide complementary to N, or able to base pair with N;

(N)x: any number of N;

(N ')x: any number of N';

W: A or T; K: A, G, or AA; rN: any ribonucleotide base;

(rN)x: any number of rN; rR: A or G; rY: C or U; M: A or C;

H: A, C, or T;

D: G, A, or T;

JOE or 6-JOE: 6-carboxy-4',5'-dichloro-2l,7'-dimethoxyfluorescein;

FAM or 6-FAM: 6-Carboxyfiuorescein. - -

BHQl: Black Hole Quencher 1

BHQ2: Black Hole Quencher 2

M-MLV RT (H-): Moloney Murine Leukemia Virus Reverse Transcriptase,

RNase H Minus shRNA: short hairpin RNA siRNA: short interfering RNA mRNA: messenger RNA tRNA: transfer RNA snoRNA: small nucleolar RNA stRNA: small temporal RNA smRNA: small modulatory RNA

/?re-microRNA: precursor microRNA j>π-microRNA: primary microRNA

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[ 00184 ] It is to be understood at the outset, that the figures and examples provided herein are to exemplify, and not to limit the invention and its various embodiments.

[ 00185 ] In accordance with the present invention, compositions, methods and kits are provided for the detection, identification and/or quantification of a target. The methods generally comprise the use of compositions comprising multi-component or multipartite nucleic acid enzymes which are preferably formed by multiple nucleic acid components that self assemble to form an active nucleic acid enzyme in the presence of an assembly facilitator. In preferred embodiments, the assembly facilitator is the target and therefore the multi-component nucleic acid enzymes form only in the presence of the target.

1. Compositions - MNAzynies

[ 00186 ] The Multi-component Nucleic Acid enzymes (also referred to herein equally as multipartite nucleic acid enzymes or "MNAzymes") are capable of self-assembling from two or more oligonucleotide components, also referred to herein as partzymes. The partzyme oligonucleotides self-assemble in the presence of an MNAzyme self assembly facilitator to form an MNAzyme. MNAzymes are therefore catalytically active nucleic acid enzymes. In some embodiments, the presence of an MNAzyme can be detected, and is indicative of the presence of a target, because the MNAzyme forms only in the presence of the target, wherein the target comprises the assembly facilitator. A wide variety of assays based on the basic principles outlined above are provided herein.

Compositions comprising oligonucleotides capable of forming MNAzymes, and MNAzymes of various sequences are also provided herein. In some embodiments at least one of the oligonucleotide components, assembly facilitator or substrate may also include/comprise an aptamer which is capable of binding to a target.

[ 00187 ] In preferred embodiments, the MNAzyme structures are based on one or more DNAzymes and/or ribozymes. More preferred are those MNAzyme structures which are based on a particular DNAzyme structure. Presently preferred structures are based on DNAzymes including the 10:23 and 8:17 DNAzymes. In various embodiments the MNAzymes comprise either or both ribonucleotide bases and deoxyribonucleotide bases. In more preferred embodiments, an MNAzyme structure is based at least in part on the structure of a DNAzyme. In other preferred embodiments, MNAzymes comprise at least some deoxyribonucleotide bases or analogues thereof. In more preferred embodiments, the catalytic core of an MNAzyme comprises one or more deoxyribonucleotide bases or analogues thereof. In still more preferred embodiments, one or more deoxyribonucleotide bases or analogues thereof are involved in the catalysis of a substrate. In other embodiments, at least one deoxyribonucleotide base, or its analogue, in the catalytic core improves catalytic activity. In yet other embodiments, there is a strict requirement for at least one deoxyribonucleotide base, or its analogue, in the catalytic core of the MNAzyme for catalysis to occur at a measurable rate, relative to that of a comparable MNAzyme without the deoxyribonucleotide base present.

[ 00188 ] As provided herein, MNAzymes may contain one or more substitutions such as analogues, derivatives, modified or altered bases, ribonucleotides, alterations of the sugar or phosphate backbone, various deletions, insertions, substitutions, duplications or other modifications, or any combination of these, well known to those skilled in the art. Such modifications, substitutions, deletions, insertions, etc may be made in the sensor and/or substrate arms and/or in the catalytic core portions, as demonstrated herein, such that the molecule retains catalytic activity. Substitutions and modifications to arms that bind the substrate or assembly facilitator may be well tolerated and in fact are the basis of allowing tailoring of the molecules to different substrates/assembly facilitators. For example, modification of the sensor arms will allow tailoring to different assembly facilitators, while modification of the substrate arms will allow tailoring to different substrates. [ 00189 ] Therefore, in certain preferred embodiments, the invention envisages

MNAzymes with catalytic activity that are comprised of deoxyribonucleotides or which are derived from such molecules by certain modifications/ substitutions etc. As a general rule, replacement of the whole molecule with, for example, ribonucleotides, will render 5 the molecule inactive because it relies for its activity on certain key deoxyribonucleotides. In a corresponding fashion, some ribonucleotides in a ribozyme may be substituted with deoxyribonucleotides but replacement of the whole molecule with, for example, deoxyribonucleotides, will render the molecule inactive.

[ 00190 ] The skilled artisan will appreciate that MNAzymes comprise either o deoxyribonucleotides or ribonucleotides, or even both. Those MNAzymes comprising at least one and more preferably, all, deoxyribonucleotide component oligonucleotides are presently preferred. Also preferred are those MNAzymes comprising at least one deoxyribonucleotide base, or its analogue, within the catalytic core of the MNAzyme.

Even more preferred are those embodiments where such a base is required for catalytic s activity.

[ 00191 ] The skilled artisan will also appreciate that multipartite DNAzymes have advantages over multipartite ribozymes, for example with respect to stability and ease of use. Thus, the multi-component MNAzymes provided herein can provide a presently preferred alternative to multi-component ribozymes, which are also provided in 0 accordance with various embodiments. It is also to be appreciated that in certain embodiments, MNAzymes offer advantages over uni-molecular nucleic acid enzymes, for example DNAzymes,, which can only recognize one substrate, whereas a single MNAzyme can recognize two molecules, namely an assembly facilitator (e.g. a target) and a substrate. For example, these properties of MNAzymes make them adaptable for S example, for detection of targets, including in situ, in vivo or in vitro detection.

2. Methods using MNAzymes for detecting, identifying or quantifying targets

[ 00192 ] The present invention provides various methods employing the use of one or more MNAzymes for the detection, identification or quantification of at least one target. In one embodiment, first and second oligonucleotide components self-assemble only 0 when contacted with a sample containing an assembly facilitator, said self-assembly of the catalytically active MNAzyme thereby indicating the presence of the assembly facilitator, wherein the assembly facilitator is the target. In other embodiments, such as for example those involving an aptamer, the assembly facilitator may not be the target, and thus may comprise only an element required for self-assembly of the MNAzyme.

[ 00193 ] Several of the various embodiments of the invention may be better understood by way of pictorial representations. Therefore, with reference to the figures, and in accordance with the compositions and methods herein, generally provided are MNAzyme-based methods that allow detection of at least one target using only nucleic acid enzymes (for example, Figures 1, 3, 4, 7 - 13, 20, 21, 24, 25) without any need for protein enzymes such as polymerases. Although the use of protein enzymes in conjunction with MNAzymes is not excluded herein, and in certain embodiments herein the inclusion of protein enzymes is permissible, or even preferred, the reaction conditions for methods that do not require protein enzymes are generally less restrictive and more readily optimized, for example for the efficiency of MNAzyme cleavage. The lack of requirement for protein enzymes also generally decreases the cost of reagents.

[ 00194 ] As further provided herein, some methods of employing MNAzymes for target detection do not require thermocycling and/or denaturation of a target. Isothermal methods are more flexible than methods requiring thermocycling and can also enable differentiation between targets comprising single stranded and double-stranded nucleic acid. Further, the lack of a need for thermocycling may make such methods easier and less expensive. Provided in accordance with the methods herein are simple, fast, cost effective, isothermal, and procedurally-flexible methods of detecting targets of interest in a sample, which may be synthetic or natural.

[ 00195 ] Certain of the examples provided herein demonstrate detection of a nucleic acid target by target-specific assembly of an MNAzyme leading to MNAzyme-mediated cleavage of, for example, a fluorescent reporter substrate. Furthermore, due to the nature of the MNAzyme molecule, reactions can be performed over a wide range of temperatures, subject only to the requirements for the assembly of MNAzyme and catalytic modification (e.g. cleavage) of the substrate utilized.

[ 00196 ] A basic example of a MNAzyme structure is depicted in Figure 1. The structure shown comprises partzyme A and partzyme B which have base-paired with an MNAzyme assembly facilitator molecule, shown here simply as Target. Partzymes A and B by interacting with Target, have allowed the catalytic core to come into close proximity and thereby form. The substrate arms of the MNAzyme have interacted with and base- paired with a substrate, here Reporter Substrate. Thus the MNAzyme has self-assembled and this process is facilitated through the presence of the MNAzyme assembly facilitator molecule Target. In the absence of Target, no MNAzyme will form. Modification (in this case, cleavage) of the substrate is catalyzed by the catalytic core of the MNAzyme at the MNAzyme Cleavage Site within the substrate denoted by the vertical arrow. The 5 substrate in this particular embodiment of the invention comprises a detectable portion having a detectable signal, for example fluorophore F, and a quencher portion having a quenching effect on the detectable signal F through the action of quencher Q. Upon cleavage at the MNAzyme Cleavage Site, there is a substantial increase in detectable signal, here fluorescence, which is readily detected or quantified. ic [ 00197 ] Figure 1 can further be understood to depict an example of a basic method of using MNAzymes to detect a target, which in some embodiments comprises an assembly facilitator. Strategy 1 (see Figure 2) uses MNAzymes adapted for detection of the targets including DNA, RNA and proteins. The reporter substrate can be either free in solution (Figure 1) or bound to a support (Figure 3). Signal can be generated by various means

15 such as separation of fluorophore F and quencher Q dye pairs (Figures 1 and 3).

[ 00198 ] More specifically, partzyme A and partzyme B are shown in Figure 1, each comprising a substrate arm portion, catalytic core portion, and a sensor arm portion. In the presence of a target, the sensor arm portions of partzyme A and partzyme B can begin to hybridize to, and base pair with complementary portions of the target, for example a

20 DNA or RNA sequence. Upon contacting the target in this fashion, the MNAzyme self- assembles forming a catalytic core which can modify a substrate which is bound by the substrate arms. Preferably the presence of the MNAzyme is detected through the detection or measurement of its catalytic activity. The substrate arms of the thus assembled MNAzyme can engage a substrate, for example the reporter substrate shown in

25 Figure 1, through the interaction of the complementary sequences on the substrate arms and the substrate. Once the substrate is so engaged with the substrate arms, the catalytic core can promote the modification (eg. cleavage) of the substrate, which can in turn be measured or detected, directly or indirectly.

[ 00199 ] With further reference to the figures, Figure 2 provides a stylized overview of 3C several example applications of an MNAzyme assay. Strategy 1 exemplifies a basic application of the MNAzyme assay as described above. An MNAzyme composed of two separate oligonucleotides with recognition sequences for both a target and a substrate forms when the oligonucleotides recognize and bind a target. The substrate, e.g. reporter substrate, is modified by the catalytic action of the MNAzyme and causes generation of a detectable signal, either directly (Strategy 1), during or after target amplification (Strategy 2) or via a signal cascade (Strategy 3). In some embodiments, both target and signal amplification occur simultaneously. [ 00200 ] One skilled in the art would recognise that MNAzymes can be used in strategies for detection, identification or quantification of assembly facilitators that cover a broad range of application areas. These areas include, but are not limited to, medical, veterinary, agricultural, food technology, imaging and bioterrorism applications.

[ 00201 ] It will also be readily apparent to a skilled artisan that MNAzymes can be used to detect, identify and/or quantify targets in solution. For example, strategies involving detecting, identifying and/or quantifying single targets using a single substrate are applicable to such detection. Li some embodiments this may involve the use of a generic substrate. Multiple targets can also be detected in solution using multiple

MNAzymes which modify a series of generic substrates, the modification of each substrate resulting in a distinctly detectable signal e.g. different fluorescence.

3. Methods using multiple MNAzymes

[ 00202 ] The skilled artisan will recognize that the various assays provided herein can generally be used to detect a single target per reaction or assay, or to detect multiple targets in a single reaction or assay. When detecting multiple targets, one or more MNAzymes can be used depending on the assay and what is to be detected. For example, a single MNAzyme may suffice where detecting multiple related structures, for example a group of sequences sharing a critical sequence (recognized by the MNAzyme) and varying only for example, in length, or in sequence outside of the critical sequence. Any sequence with the critical sequence could be detected. Multiple MNAzymes would be useful where detecting related sequences differing by as little as a single nucleotide or even where vastly different targets are being detected, and it desirable to know the presence or absence of each. Similarly, in some embodiments a single substrate will suffice, while in others a unique substrate is required to detect each of several targets, hi some cases, to multiplex the method requires the use of a distinct or unique detectable signal for each substrate to facilitate the design of the method. A distinct or unique detectable signal for each substrate may not be required when the substrates are affixed to a support or supports and can be distinguished by virtue of their localization on the support or supports. These design features will be readily understood by one skilled in the art. In some embodiments, the methods allow detection of a variety of different types of target in one reaction, eg a nucleic acid target and a protein.

4. Methods using target amplification

[ 00203 ] The skilled artisan will readily appreciate that the methods described herein may involve amplification of a target before, during or after MNAzyme catalytic activity. Such target amplification finds particular application in embodiments of the present invention where the amount of target being sought to be detected, identified or quantified is of such quantum so as to provide a signal that may otherwise not be detectable. Such amplification may comprise one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self- sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).

[ 00204 ] Strategy 2 (Figure 2) exemplifies the use of an MNAzyme adapted to monitor the accumulation of amplicons during, or following, in vitro amplification of nucleic acid targets. Techniques for in vitro amplification of nucleic acid sequences are known in the art. These include techniques mediated by a DNA polymerase, such as the polymerase chain reaction ("PCR") (see, for example, U.S. Patent No. 4,683,202; U.S. Patent No. 4,683,195; U.S. Patent No. 4,000,159; U.S. Patent No. 4,965,188; U.S. Patent No. 5,176,995) (Saiki et al., 1985; Chehab et al., 1987), strand displacement amplification ("SDA") (Walker et al., 1992), rolling circle amplification ("RCA") (Lizardi et al., 1998), reverse transcription polymerase chain reaction (RT-PCR) and loop-mediated isothermal amplification ("LAMP") (Notomi et al., 2000; Nagamine et al., 2002). Other target amplification techniques are mediated by an RNA polymerase, for example, transcription- mediated amplification ("TMA") (Jonas et al., 1993), self-sustained sequence replication ("3SR") (Fahy et al., 1991) and nucleic acid sequence replication based amplification ("NASBA") (Compton, 1991). [ 00205 ] The amplification products ("amplicons") produced by PCR, RT-PCR, SDA, RCA and LAMP are composed of DNA, whereas RNA amplicons are produced by TMA, 3SR and NASBA. [ 00206 ] With further reference to strategy 2 as exemplified in Figure 2, in one of its several aspects, the invention provides methods of using MNAzymes in conjunction with target amplification methods which include, for example, the aforementioned PCR, RT- PCR, SDA, RCA, LAMP, TMA, 3SR and NASBA. Examples 4, 5, 6, and 9 demonstrate the detection of PCR amplicons. In Examples 4, 5, 6, and 9, end point analysis following PCR facilitated rapid determination of the presence or absence of the target nucleic acids. Examples 8, 10, 11, 13, 14, 15, 16, 19, and 20 exemplify real time monitoring of PCR amplification, thus permitting quantification of the target nucleic acid. The accumulation of amplicons produced by PCR using either asymmetric or symmetric primer ratios can be monitored using MNAzymes.

[ 00207 ] As can be seen in Figure 2 (strategy 2) a target nucleic acid is amplified in accordance with a procedure for amplifying that nucleic acid (i.e. DNA or RNA). Preferably, standard methods of in vitro amplification are used. The amplicons generated during the amplification serve as targets for an MNAzyme, thus MNAzyme activity is indicative of the presence of the target. The skilled artisan will appreciate that such monitoring can be conducted in a single vessel under conditions that permit both the amplification and the MNAzyme assembly and catalytic activity, or the MNAzyme assay can be conducted subsequent to, or at time points throughout, the amplification, by removing samples at the end or during the course of the amplification reactions. [ 00208 ] It is also to be appreciated that methods or protocols that combine target amplification with catalytic nucleic acid activity may require specific reaction conditions. Preferably, reaction conditions are compatible with both polymerase activity (for amplification), and catalytic nucleic acid modification of a substrate (for detection). Protocols for determining conditions for concurrent catalytic activity and polymerase activity at high temperature, such as during PCR, have been described for DNAzymes (Impey et al., 2000). The influence of factors including DNAzyme arm length, buffer, temperature, divalent ion concentration and effects of additives was demonstrated in this paper. DNA enzymes are suited for use in combination with in vitro amplification strategies. For example, they are not irreversibly denatured by exposure to high temperatures during amplification.

5. Methods using insoluble and solid supports

[ 00209 ] It is also to be understood that generally the methods, whether multiplexed or not, are applicable in solution, or combined with an insoluble support or solid support on — S^ — which one or more of substrate, enzyme or portion thereof, MNAzyme assembly facilitator and/or target are bound, attached or tethered. Again the features of such assay systems will be generally understood by the skilled artisan provided with the methods and variations exemplified herein and the working examples. Thus, the invention is not to be considered limited to the literal teachings herein, but is capable of being modified and varied consistent with the principles and scope of the teachings provided herein and the knowledge in the art.

[ 00210 ] With reference to Figure 3, Panel (i), an exemplary method for detecting targets using an MNAzyme and a substrate anchored to a support is depicted. In this embodiment, the substrate is preferably a substrate as shown with a detectable portion comprising a detectable signal, for example a fluorophore, and a quencher portion which diminishes or eliminates the detectable signal while the detectable portion and the quencher portion of the substrate remain in close proximity, for example, until the substrate is modified eg. by cleavage. The substrate is attached to a support. Preferably the support is an insoluble material, or a matrix which retains the substrate and excludes it from freely moving in the bulk of the reaction mixture. Such supports are known in the art for immobilizing or localizing substrates, including nucleic acid targets. The skilled artisan will appreciate that the support can be selected from a wide variety of matrices, polymers, and the like in a variety of forms including beads convenient for use in microassays, as well as other materials compatible with the reaction conditions. In certain preferred embodiments, the support can be a plastic material, such as plastic beads or wafers, or that of the well or tube in which a particular assay is conducted.

[ 00211 ] The attachment of the substrate to the support is designed such that upon modification, e.g. by cleavage, of the substrate by the MNAzyme, either the detectable portion or the quencher portion, but not both, remains attached to the support, while the other is freed to move into the bulk of the reaction mixture, away from the portion remaining attached. Thus, in a cleavage example, the detectable signal vastly increases as the quencher portion and the detectable portion are separated upon cleavage. In the embodiment shown in Figure 3, Panel (i), the fluorophore-containing detectable portion remains attached after cleavage. This has the benefit of allowing localization of the signal on the support but in certain instances, the fluorophore/s may be released into solution. In a further embodiment where, for example, ligation occurs, the quencher may be ligated to a fluorophore thus decreasing the detectable signal. - -

[ 00212 ] With reference to Figure 3, Panel (ii), a multiplexed method comprising multiple MNAzyme components for making multiple MNAzymes (two shown) specific for different targets is shown. This embodiment encompasses a structure which comprises a substrate in a particular known position, e.g. a "chip", where multiple positions are available to bind numerous substrates, e.g. Substrate 1, Substrate 2. The detectable portion of each substrate can be traced to its position and is tethered at that location. For each MNAzyme, e.g. MNAzyme 1, MNAzyme 2, if the target, e.g. Target 1, Target 2, is present in, for example, a test solution, the MNAzyme corresponding to and specific for that target will self-assemble and be able to catalyze the cleavage of its corresponding substrate, resulting in the production of a signal at that location. The position of the detectable signal will thus identify which MNAzyme has cleaved its substrate, and thus which target(s) is present in the test solution. In this embodiment, the modification of the substrate results in an identifiable signal by virtue of its location. The substrate does not need an independently identifiable detection mechanism, eg, a different fluorophore, although persons skilled in the art would recognize that such contemplation is within the scope of the present invention.

[ 00213 ] Embodiments of the present invention encompassing an insoluble support in the form of a "chip", otherwise known as an array or microarray, typically comprise a plurality of substrates coupled, tethered or otherwise attached to the chip. In particular embodiments, the substrates comprise a nucleic acid. A plurality of nucleic acids may be positioned upon the chip by any suitable method known in the art, for example, by pipette, ink-jet printing, contact printing or photolithography. The chip may be comprised of at least one element, with each element comprising at least one nucleic acid. The at least one element may be comprised of a plurality of nucleic acids of the same sequence. The number of elements comprising a chip may be any number, and where a plurality of elements is positioned on a chip, the elements may be spaced apart at a uniform or a variable distance, or a combination thereof. In some embodiments, the elements may be positioned randomly, with the respective location of each element then determined. The size and shape of the elements will depend upon the particular application of the present invention, and different sized and shaped elements may be combined into a single chip. The surface of the chip may be substantially planar or may have features such as depressions or protuberances, and the elements may be positioned either into the depressions or onto the protuberances. Such depressions may provide a reservoir for solutions into which the elements are immersed, or such protuberances may facilitate - - drying of the elements. For example, elements may be placed in each well of a 96 well plate. In some embodiments, the chip may include unique identifiers such as indicia, radio frequency tags, integrated devices such as microprocessors, barcodes or other markings in order to identify each of the elements. The unique identifiers may additionally or alternatively comprise the depressions or protuberances on the surface of the array. Furthermore, the unique identifiers can provide for correct orientation or identification of the chip. The unique identifiers may be read directly by a data capture device or by an optical scanner or detector.

6. Reporter substrate systems used in the methods [ 00214 ] Also provided in accordance with the present invention are generic reporter substrate systems, which allow rapid assay development by allowing facile design changes to create new MNAzymes which recognize different targets. As discussed herein, the substrate arm portion and the catalytic core portion of the partzymes may remain unchanged, with changes only to the sensor arm portion of one or more partzymes required for new targets. Generic substrate sequences are provided and the same substrate can therefore be incorporated in assays for many different targets. Further, the same substrate can be incorporated into the methods in various embodiments herein, including assays where the substrate is free in solution or is tethered or attached to a support. A series of generic substrates can be used in a multiplex reaction allowing simultaneous detection of multiple targets.

[ 00215 ] MNAzyme strategies using generic substrates offer a major advantage over technologies such as TaqMan® or Beacons which require the design and use of probes specific for each new target.

7. Substrates used in the methods [ 00216 ] As described in more detail below, MNAzymes have an advantageous property in certain embodiments of being able to utilize a universal or generic substrate. Such a substrate is shown in Figure 1 in a presently preferred configuration wherein the substrate comprises both a detectable portion and a quencher portion. The quencher portion is adapted to diminish or eliminate a detectable signal from the detectable portion of the substrate until the substrate is cleaved by the MNAzyme. For example, the quencher portion may comprise "Black Hole Quencher 1" (BHQl) or "Black Hole Quencher 2" (BHQ2). [ 00217 ] Thus, the MNAzyme cleaves the substrate between the detectable portion and the quencher portion allowing the two portions to separate in solution, thereby allowing the detectable signal to appear or increase as the quencher portion is distanced from, or effectively removed from the local environment of the detectable portion. [ 00218 ] The use of the generic or universal substrate is enabled through the design of the MNAzyme' s component partzymes. By altering only the sensor arms of the partzymes, but by leaving the substrate arms unchanged, a large variety of MNAzymes specific for each of a plurality of targets can be designed all of which utilize a universal substrate for detection. The skilled artisan will appreciate the advantages that this offers in terms of eliminating the need for customized or unique substrates for each target. Each new target requires only one or more changes in one or more of the sensor arm portions; the substrate arm portion and the catalytic core portion can remain constant. Thus, a single reporter substrate can be used for a single target using an MNAzyme, and multiple targets in a series of assays using altered MNAzymes. A plurality of reporter substrates allows multiplexing to detect multiple targets in a single assay using multiple MNAzymes, one for each target. Such multiplexed methods of using MNAzymes are readily accomplished in solution (Figure 18) or with attachment to a support system (Figure 3). It is contemplated herein that multiplexed assays can thus be accomplished in systems involving attaching one or more of the substrate, or the MNAzyme partzymes or assembly facilitator, or additional enzyme activities, to a support as described herein.

[ 00219 ] Further, the substrates may incorporate additional entities such as labeled nucleic acids, nanoparticles, microparticles, proteins, antibodies, RNA, DNA, nucleic acid analogues, proteins, glycoproteins, lipoproteins, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, or any combination thereof. For instance, the nanoparticles may be gold nanoparticles, wherein these gold nanoparticles are associated with a plurality of targets, such as nucleic acids.

[ 00220 ] Substrates can be modified by an MNAzyme thereby providing a detectable effect. In the detection process, the substrate modification by an MNAzyme may involve, for example, cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds. As a consequence of substrate modification by an MNAzyme, a detectable effect is generated and the magnitude of the effect may therefore be indicative of the quantity of the target sought to be measured. The detectable effect may be detected by a variety of methods, including fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof. [ 00221 ] Several groups have reported detection of nucleic acid targets, and other analytes with colourimetric readouts (Elghanian et at, 1997, Mirkin et al, 1996, and Liu and Lu, 2004). The strategy involves preparation of batches of gold nanoparticles, each of which has a distinct DNA oligonucleotide sequence attached to its surface. Gold particles can then be aggregated by the addition of a "bridging oligonucleotide", which has complementarity with the sequences that are attached to the gold particles. Particle aggregation results in a concomitant change in colour from red to blue (Mirkin et al, 1996). More recent work has shown that the inclusion of a DNAzyme substrate sequence within the bridging oligonucleotide can provide a mechanism for reversing the aggregation of the gold particles (Liu and Lu, 2004). Activation of the DNAzymes, and subsequent cleavage of the substrate/bridging oligonucleotide, resulted in the dissociation of the gold particles and a change in colour from blue to red.

[ 00222 ] A simple lead detector based on the above concept was devised which functioned by exploiting the dependence of a specific DNAzyme on lead for its catalytic activity. The DNAzyme was designed to cleave a bridging oligonucleotide used to aggregate gold particles (Liu and Lu, 2004). Similarly, an aptazyme containing an aptamer specific for adenosine, and a DNAzyme capable of cleaving a bridging oligonucleotide only in the presence of adenosine, allowed detection of adenosine in a colourimetric format.

8. Optimization of the methods [ 00223 ] The skilled artisan will readily understand that the methods described herein may be optimized using a variety of experiemental parameters in order to optimize the detection, identification and/or quantification of a target. The particular experimental parameters that are optimized, and the level of such optimization, will depend upon the particular method being employed and the particular target being sought to be detected, identified and/or quantified. Such parameters include, but are not limited to, time, temperature, concentration of salts, detergents, cations and other reagents including but not limited to dimethylsulfoxide (DMSO), and length, complementarity, GC content and melting point (Tm) of nucleic acids. [ 00224 ] In some embodiments, for example those methods involving detection of sequence variation and/or detection of methylated DNA, the experimental parameters, and preferably including the temperature at which the method is performed, may be optimized so as to discriminate between binding of an MNAzyme component nucleic acid to a target nucleic acid that does or does not comprise a sequence variation or a methylated nucleotide, respectively. The temperature at which such methods may be performed may be in the range of about 2O0C to about 960C, about 2O0C to about 750C, 2O0C to about 6O0C or about 20 to about 550C,

[ 00225 ] In one preferred embodiment, optimized reactions for practicing the methods of using MNAzymes are provided herein. In such optimized reactions, catalytic activity is increased by up to 10, 20, or 30 % above unoptimized reactions. More preferred reaction conditions improve catalytic activity by at least 35%, or 40%, and preferably up to 50% or more. In still more preferred embodiments, optimized reactions have an increase of catalytic activity of more than 50%, and up to 66%, 75% or even 100%. In yet more preferred embodiments, a fully optimized reaction method will offer 100, 200 or even 300% or more increase in catalytic activity. Other preferred reaction conditions can improve the catalytic activity by up to 1000% or more over methods practiced with unoptimized reaction conditions. A highly preferred reaction condition for optimizing the methods provided herein is the inclusion of certain divalent cations. The catalytic activity of most nucleic acid enzymes may be influenced in a concentration-dependent fashion by the concentration of divalent cations. Preferred optimized reactions are optimized for one or more OfBa2+, Sr2+, Mg2+, Ca2+, Ni2+, Co2+, Mn2+, Zn2+, and Pb2+.

9. Methods using aptamers

[ 00226 ] Persons skilled in the art will readily appreciate that the methods described herein may be performed with aptamers, wherein said aptamers may facilitate the detection, identification and/or quantification of targets including targets other than nucleic acids.

[ 00227 ] With reference to Figures 4 and 20, a method of using MNAzymes to detect targets, including non-nucleic acid entities is exemplified. This method uses aptamers which may comprise a nucleic acid or protein, polypeptide, or peptide or combination thereof that has the ability to recognize one or more ligands. Aptamers may bind, for example, proteins, polypeptides, peptides or nucleic acids, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, entire organisms, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof, or any other entity (Lee et al., 2004).

[ 00228 ] Preferred aptamers herein may comprise short single-stranded DNA or RNA oligomers or peptides that can be isolated from complex libraries of synthetic nucleic acids or peptides by an iterative process of adsorption, recovery, and reamplification.

Aptamers may therefore be generated against almost any target, ranging from small molecules such as amino acids or antibiotics, to protein and nucleic acid structures. In preferred embodiments, aptamers include, for example, nucleic acid binding molecules which are preferably generated by evolution and selection techniques. Preferably, aptamers may comprise DNA or RNA molecules, or a combination of both, including but not limited to the nucleotide analogues as per, for example, Table 2 above.

[ 00229 ] Strategies for combining the use of aptamers with MNAzymes are illustrated in Figures 4 and 20. With reference to Figure 4 panel (i), the nucleic acid oligonucleotides required for this MNAzyme detection strategy may include; (a) a standard partzyme; (b) an apta-partzyme which is a partzyme that incorporates an aptamer (bold sequence) as well as a complementary sequence capable of forming a hairpin and therefore inhibiting MNAzyme assembly; (c) an assembly facilitator which can bind to both the apta- partzyme and the partzyme, thus enabling assembly of an active MNAzyme; and (d) a substrate. In the absence of a target analyte (An), the apta-partzyme adopts a hairpin structure which inhibits assembly of an active MNAzyme. In the presence of target analyte, the target analyte binds to the aptamer domain of the apta-partzyme, thus disrupting the hairpin structure and allowing the apta-partzyme to participate in assembly of an active MNAzyme. The active MNAzyme can then modify a substrate causing, for example, fluorescent signal generation.

[ 00230 ] With reference to Figure 4 panel (ii), the nucleic acid oligonucleotides required for this MNAzyme detection strategy may include; (a) two standard partzymes; (b) an assembly facilitator that incorporates an aptamer (bold sequence) as well as complementary inhibitor sequence capable of forming a hairpin structure; and (c) a substrate. In the absence of a target analyte, the assembly facilitator adopts a hairpin structure which inhibits the ability of this component to direct the assembly of active MNAzymes. In the presence of target analyte, the target analyte binds to the aptamer domain of the assembly facilitator, thus disrupting the hairpin structure and allowing the - - component to direct the assembly of an active MNAzyme. The active MNAzyme can then modify a substrate causing, for example, fluorescent signal generation.

[ 00231 ] One skilled in the art will appreciate that the aptamer may be incorporated into either end of the assembly facilitator molecule or molecules. Further it will be appreciated that multiple aptamers could be incorporated into one or more of the partzyme oligonucleotide components. The assembly facilitator in the strategies illustrated in Figure 4 panels (i) and (ii) can comprise DNA, RNA, LNA, PNA or a sequence containing one or more nucleotide base analogues. In other embodiments, the target An is a nucleic acid. In such embodiments, a sequence complementary to the target nucleic acid replaces the bold aptamer sequence in Figure 4.

[ 00232 ] With reference to Figure 4 panel (iii), the nucleic acid oligonucleotides required for this MNAzyme detection strategy may include two apta-partzymes, each of which contains a portion of an aptamer. In the absence of a target analyte, active MNAzymes cannot assemble. In the presence of target analyte, the target analyte serves as the assembly facilitator bringing the oligonucleotide components together thus directing the assembly of an active MNAzyme. The active MNAzyme can then modify a substrate causing, for example, fluorescent signal generation.

[ 00233 ] A related strategy, which combines aptamer binding and MNAzyme assembly, is illustrated in Figure 20. In this strategy, an aptamer sequence is incorporated at the end of a partzyme (apta-partzyme) in a configuration whereby an active MNAzyme is only formed in the presence of the target analyte. The oligonucleotide components required for the MNAzyme detection strategy illustrated include; (a) a standard partzyme; (b) an apta-partzyme which is a partzyme with an aptamer incorporated into one of its ends; (c) an assembly facilitator which binds to both the apta-partzyme and the partzyme enabling assembly of an active MNAzyme (in the presence of target); (d) a reporter probe substrate; and (e) an assembly inhibitor which hybridises to the apta-partzyme in a region which spans at least part of the aptamer sequence and part of the substrate binding arm of the partzyme sequence. In the absence of a target (left hand panel), the assembly inhibitor binds to the apta-partzyme thus blocking binding (and cleavage) of the reporter probe substrate. In the presence of a target (right hand panel), the target binds to the aptamer sequence of the apta-partzyme, preventing the binding of the assembly inhibitor and allowing the binding and cleavage of the reporter probe substrate. As such, an active - -

MNAzyme can only form and cause fluorescent signal generation in the presence of target.

[ 00234 ] Further, it will be appreciated by one skilled in the art that the strategy as illustrated in Figure 20 is similar to that illustrated in Figure 4 panel (i), with the difference being that the complementary inhibitor sequence, which prevents active MNAzyme formation, is either incorporated into an oligonucleotide partzyme component (Figure 4 panel (i)) or into a separate molecule (Figure 20). As such, an inhibitor sequence can be a separate molecule or can be incorporated into one of the components that participate in the MNAzyme complex. [ 00235 ] It will also be appreciated by one skilled in the art that one or more aptamers could be incorporated into any of the oligonucleotide components, including the partzymes, the assembly facilitator or the substrate. Further the aptarner could be incorporated into either end of any one of these oligonucleotides.

[ 00236 ] The invention may be better understood by reference to examples 18 and 21 where the aptamer/MNAzyme strategy is used to detect a small molecule (ATP) and a protein (Taq polymerase) respectively.

10. Methods for detection, identification and quantification ofmicroRNA

[ 00237 ] The skilled artisan will understand that the detection, identification and/or quantification ofmicroRNA represents a particular embodiment of the methods described herein. With reference to Figure 5, a strategy for amplification of short nucleic acid sequences (e.g. microRNAs (miRs)) and detection of amplicons using MNAzymes is exemplified.

[ 00238 ] Detection of short nucleic acid sequences such as microRNAs (miRs) requires additional strategies primarily due to the small size of these targets. MiRs are non-coding RNA molecules of approximately 22 nucleotides in length. They can be detected by cloning or northern blot analysis, but these methods are laborious and require larger amounts of total RNA than techniques such as RT-PCR. The small size of miRs provides insufficient sequence to accommodate two PCR primers of standard design. Further, even if miR amplification is accomplished, it is difficult to distinguish genuine amplicons from primer-dimers using either size (ascertained by electrophoresis), or fluorescence from the intercalation of non-specific dyes, such as Sybr Green or Ethidium Bromide. This limitation could be overcome by probing the miR amplicons with internal hybridization probes such as TaqMan® or Beacon probes, however, again the small size of the amplicons prohibits use of probes of standard designs.

[ 00239 ] A modified TaqMan® RT-PCR method (Chen et al, 2005) for miR analysis initiates reverse transcription using 3' primers which have miR specific 3' termini and additional unrelated sequences at their 5' termini which can form stem-loops. The cDNA generated is amplified using these 3' primers and 5' primers, which also have miR specific 3' termini and additional unrelated sequences at their 5' termini. The amplification is monitored in real time using TaqMan® probes that bind to both miR sequences and unrelated sequences introduced by the primers. However, due to the primer design, and the size and positioning of the TaqMan® probe there is a still the likelihood that specific miRs may not be distinguished from closely related sequences.

[ 00240 ] As shown in Figure 5, the method employed here preferably employs a 3' primer that binds to a miR at its 3 ' end and has an extension sequence, unrelated to the miR, which may, or may not, form a stem-loop at the 5' end. As Figure 5 depicts, the unrelated sequence of the primer may create a loop structure (Figure 5, left-hand side) or may merely create a tag structure (Figure 5, right-hand side). La either example, the 3' miR primer is extended in the presence of reverse transcriptase, followed by PCR amplification using 5' and 3' primers with miR-specific sequence at the 3' end with unrelated extension sequence at the 5' ends. The amplicons are readily detected by MNAzymes, which recognize and hybridize to the amplicon including the region between the 5' and 3' primers. The strict requirement for complementarity between the MNAzyme sensor arm and the target nucleic acid allows discrimination of even closely related sequences. Example 5 and Example 10 in the Examples below demonstrates the results of using MNAzymes to detect amplicons generated by amplification of short nucleic acid sequences (see also strategy 2 in Figure 2, above). Further, the example 5 demonstrates the capacity of methods using MNAzymes to distinguish between two sequences having only a single nucleotide difference. This provides a major advantage in that, even when the amplification process is unable to discriminate between closely related sequences, the MNAzymes allow discrimination between minor sequence variation in the resulting amplicons.

11. Methods using cascades

[ 00241 ] Persons skilled in the art will appreciate that the methods described herein may be used to perform a cascade as herein defined. Particular embodiments of performing such methods as disclosed herein include, but are not limited to (1) use of an MNAzyme to cleave a substrate only in the presence of a target, wherein said substrate is then made available for involvement in a second event such as generation of a detectable signal, as depicted in Figure 6 wherein cleavage of a substrate makes available an enzyme that may then cleave an anchor, thereby resulting in fluorescent tag dissociating from a quencher; or (2) use of an MNAzyme to cleave a substrate only in the presence of a target, wherein said substrate is then made available for involvement in a second event, wherein performance of said second event in turn makes available a further substrate for involvement in any number of subsequent events, such that a subsequent event makes available a substrate for involvement in the performance of an earlier event, thereby creating a cyclic cascade, such as depicted in Figures 7 and 25, wherein such cyclic cascades may be employed to amplify a signal, for example, in applications where the low abundance of a target may not otherwise provide for a signal that is detectable.

[ 00242 ] A detectable effect amplification cascade may comprise one or more of a ribozyme/ligase cascade, a circular nucleic acid enzyme cascade, a protein enzyme cascade, or one or more enzymes attached to a support, or any combination thereof.

[ 00243 ] With reference to Figure 2, strategy 3 shows an overview of a method of using an MNAzyme to amplify a signal through the use of a signal cascade. This is discussed in more detail with reference to Figures 6, 7 and 25. [ 00244 ] Figure 6 depicts an exemplary method of MNAzyme detection of target coupled with enzyme mediated signal amplification. As discussed above, the invention provides for methods of using MNAzyme detection wherein a target is amplified as well as methods wherein a signal generated is amplified. In some embodiments, combining MNAzyme technology with signal amplification strategies provides an alternative to MNAzyme assays combined with target amplification, although in some instances both target amplification and signal amplification can be used together. Preferred methods of amplifying signals involve cascade mechanisms, which as the skilled artisan will appreciate are often involved in amplifying signals in biological systems.

[ 00245 ] Several examples of amplification cascades, which use catalytic nucleic acids, are known in the art and are contemplated for use herein. Ligation cascades (Paul and Joyce, 2004) use a first ribozyme (A) which ligates two RNA containing oligonucleotides to form a second ribozyme (B). Ribozyme (B) then ligates two other RNA containing oligonucleotides to form a new first ribozyme (A), thus triggering a cascade reaction. [ 00246 ] A second amplification cascade suitable for use herein uses circularized DNAzyme/substrate molecules (Levy and Ellington, 2003). A DNAzyme (A) is inactive when circular, but becomes activated by linearization by a second DNAzyme (B), which cleaves the circular DNAzyme (A). Active linear DNAzyme (A) then cleaves circular DNAzyme (B) molecules thus linearizing and activating them. The two DNAzyrnes capable of cleaving/linearizing each other result in a cascade of catalytic nucleic acid activity.

[ 00247 ] Persons of skill in the art will understand that other approaches are available - for example combining the use of DNAzymes with the versatility of aptamers and/or with the catalytic power of traditional protein enzymes (see e.g. Zhang et al., 2005). Zhang's method results in the release of a protein enzyme that can, in turn, catalyze the formation of detectable molecules thereby generating and amplifying signal. Zhang's approach allows sensitive detection, but it is expensive as it requires highly customized molecules for each assay. Methods for coupling of peptides to nucleic acids are known in the art (see e.g. Cheng et al., 1993), as are methods for attaching DNA to support structures. For example, Asher (PCT/US96/02380) described tethering an enzyme (ribozyme) to an insoluble support, which upon release, cleaved a substrate thereby initiating amplification of a signal using two spatially separated ribozymes.

[ 00248 ] Other examples of signal amplification for in vitro methods are known in the art, and yet other strategies for amplifying signals can be created using techniques similar to those that have proven successful. For example, the branched DNA assay (bDNA) (Urdea, 1993) amplifies a signal by employing a secondary reporter molecule (e.g. alkaline phosphatase) attached to labeled probes mediating the reaction. Fluorescence correlation spectroscopy (FCS) employs electronic amplification of the signal (Eigen and Rigler, 1994). Tyramide signal amplification (TSA) (Bobrow et al., 1989; Adams, 1992; Raap et al., 1995; van Gijlswijk et al., 1997), uses horseradish peroxidase to convert tyramiside to its active form, which binds to tyrosine residues in proteins. TSA is used for various applications of cell immunochemistry. The Invader assay (Hall et al., 2000) employs two oligonucleotides that bind to a target sequence in a manner that allows for nuclease cleavage leading to greater than 1000 cleavage events per target molecule over time, and the cleavage reaction can be coupled to a fluorescent probe. However, there are limitations to the known signal amplification methods. For example, the bDNA assay is not as sensitive as the target amplification methods. [ 00249 ] Thus, with further attention to Figure 6, depicted is an example of a method employing an enzyme released by MNAzymes as part of a signal amplification strategy. The signal can be generated, for example, by enzyme cleavage of a substrate between a fluorophore moiety and a quencher moiety, thus allowing a signal to be generated. Enzymes contemplated for use herein include, but are not limited to, DNAzymes, MNAzymes, ribozymes, and protein enzymes with measurable activity, such as proteases, restriction endonucleases and other hydrolytic enzymes. Preferred targets are nucleic acid sequences including, but not limited to, human, animal, plant, viral, bacterial DNA or RNA. Other preferred targets may include, prion, yeast or fungus, or any other molecule, for example, including but not limited to glycoproteins, lipids, lipoproteins, entire organisms, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof.

[ 00250 ] As can be seen in Figure 6, an exemplary enzyme, herein designated "Enzyme" is attached to a first insoluble support, through a cleavable molecule, preferably a nucleic acid. As shown in the example in Figure 6, the cleavable molecule acting as the attachment for the enzyme "Enzyme" is a generic or universal MNAzyme substrate. Also attached to an insoluble support not in contact with the first insoluble support is a "Cleavable anchor" substrate for the enzyme "Enzyme". "Enzyme" is any enzyme with a detectable activity, for example an MNAzyme, DNAzyme, ribozyme, or protein enzyme as described above. In preferred embodiments, MNAzymes or DNAzymes are particularly useful. In the presence of the oligonucleotide components, or partzymes, that self assemble to form an MNAzyme capable of cleaving the universal or generic substrate, and in the presence of the target for the MNAzyme, the MNAzyme forms and catalytically cleaves "Enzyme" from the support, thereby freeing it and allowing it to access the "Cleavable anchor" substrate and cleave it. Cleavage of "Cleavable anchor" releases the fluorophore from the attached substrate. The fluorophore is readily detected and measured.

[ 00251 ] The physical separation of an immobilized or attached enzyme from its substrate, which is preferably also immobilized or attached to a support, is sometimes referred to herein as "spatial separation." One or more enzymes can be "spatially separated" from their respective substrates, and from each other. A signal amplification cascade can result, particularly where the cleavage of the substrate for the first enzyme releases the second enzyme, which in turn releases more first enzyme when the substrate for the second enzyme is cleaved (see Figure 7).

[ 00252 ] In preferred embodiments, the substrate for the enzyme "Enzyme" is a bifunctional substrate as shown, comprising both a quencher portion and detectable portion. Particularly preferred are embodiments wherein the substrate for enzyme "Enzyme" is a molecule with no detectable signal while in the uncleaved substrate, and whose detectable signal increases by one to many orders of magnitude upon cleavage.

[ 00253 ] With reference now to Figure 7, an example of an assay using MNAzymes and a signal amplification using two "spatially-separated" enzymes is shown. A signal amplification cascade can also be generated using such "spatially separated" DNAzymes as described above. An initial MNAzyme cleavage event cleaves an immobilized tethered substrate, thereby releasing DNAzyme A. DNAzyme A then migrates to a second sequence where a second DNAzyme B is tethered. DNAzyme A releases DNAzyme B that, in turn, releases more of DNAzyme A. A cascade is initiated that results in signal amplification. In various embodiments, the target can be nucleic acid sequences including, but not limited to, human, viral, bacterial DNA or RNA; or the target can be proteins, viruses, prions, antibodies, whole cells or small molecules.

[ 00254 ] In particular, it can be seen from the example in Figure 7 that DNAzyme A is attached to a support through a first universal MNAzyme substrate or generic substrate, which is also cleaved by DNAzyme B. DNAzyme B is attached to an insoluble support through a second generic substrate that is a substrate for DNAzyme A. Both DNAzymes are retained such that their respective substrates are inaccessible to them. In the presence of the partzymes that self assemble to form an MNAzyme that cleaves the universal substrate, and in the further presence of the target, the MNAzyme is formed and cleaves the universal MNAzyme substrate retaining DNAzyme A, thereby releasing DNAzyme A. DNAzyme A can now migrate to the second generic substrate. Upon cleavage of the second generic substrate by DNAzyme A, DNAzyme B is released along with its attached detectable signal, shown here as a fluorophore F. Fluorophore F is now detectable as it separates from a retained quencher portion Q. Freed DNAzyme B, now able to access its substrate does so, cleaving it (the first generic substrate) and thereby releasing additional DNAzyme A, which in turn releases more DNAzyme B and detectable signal F. Thus, a powerful signal amplification cascade is established, with exponentially increasing amounts of detectable signal F. [ 00255 ] An example of an MNAzyme cascade using tethered partzymes can be better understood by reference to Figure 25. MNAzymes can be used to initiate signal amplification cascades as illustrated in this diagram. The reaction contains the following elements; (i) partzymes for MNAzyme 1 which are free in solution; (ii) an assembly facilitator for MNAzymes 2 and 3 (which have the same sensor arms) which is either free in solution (as illustrated) or tethered to an insoluble support by substrate, Sub 1; (iii) partzymes for MNAzyme 2 which are tethered to an insoluble support by the substrate, Sub 1. Sub 1 can be cleaved by either MNAzyme 1 (in the presence of a target analyte) or MNAzyme 3 (in the presence of an assembly facilitator), and cleavage results in the release of the partzymes for MNAzyme 2 into solution; (iv) partzymes for MNAzyme 3 which are tethered to an insoluble support by the substrate, Sub 2. Sub 2 can be cleaved by MNAzyme 2 (in the presence of assembly facilitator) and cleavage results in the release of the partzymes for MNAzyme 3 into solution; (v) Sub 2-FQ, which has the same sequence as Sub 2, but is free in solution and is dual labelled with a fluorophore (F) and a quencher (Q). Sub 2-FQ can be cleaved by MNAzyme 2 to generate a fluorescent signal.

[ 00256 ] In the presence of the target analyte, active MNAzyme 1 forms from partzymes that are free in solution. MNAzyme 1 cleaves its Sub 1 thus releasing partzymes for MNAzyme 2. Once free, these partzymes hybridize with the assembly facilitator and form MNAzyme 2, which cleaves free Sub 2-FQ (generating a fluorescent signal), or tethered Sub 2 (releasing partzymes for MNAzyme 3). Since MNAzyme 3 shares the same substrate arms as MNAzyme 1, it can also cleave tethered Subl, thus releasing more partzymes for MNAzyme 2. This results in a cascade of enzymatic generation of the components (partzymes) for more enzymes (MNAzymes) and a concomitant signal amplification cascade. 12. Methods for the detection, identification and quantification of methylated nucleic acid

[ 00257 ] MNAzyme mediated signal generation allows discrimination between fully matched nucleic acid sequences and those containing mismatches. This capacity enables MNAzymes to be used for the detection, identification and quantification of methylated nucleic acid.

[ 00258 ] Alterations in methylation pattern occur frequently in association with diseases such as cancer, diabetes, autoimmune diseases, and psychiatric disorders. The vast majority of protocols currently used for methylation analysis begin with bisulphite modification of genomic DNA. Bisulphite modification converts unmethylated, but not methylated, cytidines to undines. If the bisulphite modified nucleic acid is then amplified, for example by PCR, the uridines are replaced with thymidines and the methylated cytidine is replaced by cytidine. The modified amplicons can be analysed by various methods that allow discrimination of the sequences containing T (in positions originally containing unmethylated C) and C (in positions originally containing methylated C).

[ 00259 ] The capacity for MNAzymes to discriminate between closely related sequence variants makes this technology well suited for discriminating between bisulphite modified sequences which were originally either methylated or unmethylated. The approach may be better understood by reference to example 11.

[ 00260 ] Further, MNAzymes can provide a new approach allowing the direct analysis of methylated and unmethylated DNA without the need for bisulphite modification. This provides a significant advantage because bisulphite modification is laborious, time consuming and destructive to the nucleic acid to be analysed. [ 00261 ] The use of a stabiliser arm with a partzyme that has a truncated sensor arm has been used to demonstrate the capacity of MNAzymes to detect single nucleotide polymorphisms present in assembly facilitators (Example 22). Under the experimental conditions used in that example, a partzyme with a truncated (five base) sensor arm was functional at a temperature well above its expected melting temperature. Systems with stabiliser arms, and partzymes that have truncated sensor arms, are very sensitive to small changes in the target, and are amenable to use at highly stringent temperatures. This detection strategy can be further extended to discriminate directly between targets, which are either methylated or unmethylated at specific cytosine residues, without the need for prior bisulphite modification. [ 00262 ] The presence of 5-methylcytosine(s) increases the melting temperature of DNA by 1.3 0C per methylated base, relative to unmethylated cytosine(s). When partzymes, a stabiliser arm, and a substrate are incubated at a temperature, which is suitable for hybridization and active MNAzyme assembly in the presence of a methylated target, but which is too high for MNAzyme assembly in the presence of an unmethylated target, a signal would be generated only in the presence of the methylated target. This provides a new strategy for direct analysis of methylation patterns that can provide a method for detection of methylation bases as markers of cancer and other diseases. [ 00263 ] Skilled artisans will therefore readily appreciate and understand that the optimization of experimental parameters including temperature as herein disclosed is contemplated as being within the scope of the methods of the present invention, and that such optimization finds particular application in the performance of methods relating to s detection of methylated DNA either directly or after bisulphite modification.

13. Methods for the detection and identification of nucleic acid sequence variants

[ 00264 ] The present invention further provides for methods for the detection and identification of sequence variants on the basis that MNAzyme mediated signal generation allows discrimination between fully matched nucleic acid sequences and those o containing mismatches.

[ 00265 ] Sequence variations capable of detection by the methods of the present invention include, but are not limited to, additions, deletions, substitutions, conversions, duplications, translocations, frame-shift sequence variants, nonsense sequence variants, or any combination thereof. 5 [ 00266 ] The methods may be applied in any situation in which it is desirable to detect and/or identify a nucleic acid sequence variation, including but not limited to diagnosis of diseases or predispositions thereto, identification of polymorphisms, or assessment of nucleic acid replication fidelity. In addition, larger alterations such as translocations associated with various cancer types, which result in fusion transcripts, may also be 0 detected. These occur frequently in association with leukaemia. For example, PML/RARa fusion transcripts are associated with acute promyelocytic leukaemia and bcr/abl fusion transcripts are associated with chronic granulocytic leukaemia.

[ 00267 ] MNAzyme-mediated target detection can occur via Watson-Crick base recognition of the partzyme sensor arms and the assembly facilitator. The requirement for 5 complementarity can be exploited to detect small sequence variations, including but not limited to, single base mismatches between the partzyme sensor arm and the assembly facilitator. The capacity for discrimination of sequence variants may be better understood by reference to examples 5, 19 and 22.

[ 00268 ] Those examples all demonstrate the capacity of MNAzymes to discriminate 0 between situations where the sensor arm and assembly facilitator are fully matched, and situations where there is at least a single base mismatch or polymorphism. - -

[ 00269 ] The capacity to discriminate single base mismatches is dependent on several factors including (a) the stringency of the reaction conditions, which can be influenced by many factors including temperature, salt concentration, cation concentration, (b) the type of mismatch, (c) the position of the mismatch within the partzyme arm, and (d) the length of the partzyme arm. Depending on the application, the stringency of the reaction can be tailored to be either intolerant, or tolerant, to some degree of mismatch between the sensor arm and the assembly facilitator. Stringent conditions allow discrimination of closely related sequence variants, such as a single nucleotide difference. Lower stringency conditions may not discriminate between assembly facilitators with closely related sequences. Therefore, this could be exploited to detect simultaneously a group of closely related sequences in a single reaction with a single MNAzyme.

[ 00270 ] The discrimination of single nucleotide polymorphisms can be extended by the use of partzymes with truncated sensor arms (Figure 23 and Example 22). Truncated sensor arms can be stabilised by a stabiliser oligonucleotide component, which although a separate molecule, can be considered as a second component of the truncated partzyme, to which it binds adjacently.

14. MNAzymes for detection, identification and/or quantification of bacteria and viruses

[ 00271 ] The present invention encompasses methods for the detection of bacteria, viruses or any other microorganism, for example, through design of MNAzyme sensor arms that are adapted to hybridize to any molecule such as a nucleic acid that is unique to the microorganism that is sought to be detected, identified and/or quantified. Additionally or alternatively, a class of microorganism may be detected, for example, including but not limited to Gram positive or Gram negative bacteria. Further variations of the methods that are within the scope of contemplation of the person skilled in the art include, but are not limited to, use of an aptamer adapted to bind a protein, small molecule, cell, cellular component or cellular product such as a toxin that is unique to the microorganism that is sought to be detected, identified and/or quantified.

[ 00272 ] Bacteria and viruses contain DNA and/or RNA which can provide a template for their rapid and sensitive identification, detection and/or quantification using

MNAyzme technology. Sequence variation between bacterial and viral species and strains can be used to allow sensitive discrimination between individual species and strains. Multiplex MNAzyme approaches are particularly preferred for the simultaneous detection and/or discrimination of multiple bacterial or viral species, strains or isolates.

[ 00273 ] Alternatively, regions of sequence similarity across bacterial or viral species and strains can be used to identify the presence or absence of any of a group of individual species and strains in a single MNAzyme assay. This latter approach is exemplified in Example 15 where a conserved region found in bacterial ribosomal 16S sequence was used as the basis of an assay to replace the bacterial test of a Gram stain for a rapid release test for sterility and/or mycoplasma contamination.

[ 00274 ] Example 16, which illustrates the use of MNAzymes for the detection and quantification of HIV-I viral RNA, demonstrates the use of MNAzymes as a sensitive tool for viral detection and quantification.

15. Kits

[ 00275 ] The present invention also provides kits for practising the methods disclosed herein. Typically, kits for carrying out the methods of the present invention contain all the necessary reagents to carry out the method. For example, in one embodiment a kit may comprise a first container containing at least a first and second oligonucleotide component comprising a first and second partzyme, and a second container comprising a substrate, wherein self-assembly of the first and second partzymes, and the substrate, into an MNAzyme requires association of an assembly facilitator present in a test sample. Accordingly, in such embodiment, the first and second partzymes, and the substrate, may be applied to the test sample in order to determine the presence of the assembly facilitator, wherein the assembly facilitator comprises the target.

[ 00276 ] Typically, the kits of the present invention will also comprise one or more other containers, containing for example, wash reagents, and/or other reagents as required in the performance of the methods of the invention.

[ 00277 ] In the context of the present invention, a compartmentalised kit includes any kit in which reagents are contained in separate containers, and may include small glass containers, plastic containers or strips of plastic or paper. Such containers may allow the efficient transfer of reagents from one compartment to another compartment whilst avoiding cross-contamination of the samples and reagents, and the addition of agents or solutions of each container from one compartment to another in a quantitative fashion. Such kits may also include a container which will accept the test sample, a container which contains the reagents used in the assay, containers which contain wash reagents, and containers which contain a detection reagent. Typically, a kit of the present invention will also include instructions for using the kit components to conduct the appropriate methods. Kits and methods of the invention may be used in conjunction with automated analysis equipment and systems, for example, including but not limited to, real time PCR machines.

[ 00278 ] For application to detection, identification or quantitation of different targets, a single kit of the invention may be applicable, or alternatively different kits, for example containing reagents specific for each target, may be required. Methods and kits of the present invention find application in any circumstance in which it is desirable to detect, identify or quantitate any entity.

[ 00279 ] The present invention will now be further described in greater detail by reference to the following specific examples, which should not be construed as in any way limiting the scope of the invention.

EXAMPLES

[ 00280 ] In the following examples, several MNAzyme designs, based on splitting the catalytic core of either the 10:23 or the 8:17 DNAzyme, were adapted for a variety of target nucleic acids and substrates (Table 3). These target substrate systems have been tested under a variety of reaction conditions and have proven robust. [ 00281 ] Example MNAzyme designs and specific partzymes used in the following examples are listed in Table 3. The partzymes are named such that the name (e.g. RO4A1/1) incorporates the reference to the target domain (e.g. RO4 for RPLPO exon 4), the domain required for MNAzyme catalytic activity (e.g. Al) and the substrate domain (e.g. 1 for SubBi-1).

Table 3: Exemplary MNAzy tries and substrates. Specific partzymes used in working examples

Figure imgf000074_0001
Table 3 (continued): Exemplary MNAzymes and substrates. Specific partzymes used in working examples

MNAzyme Designs Partzymes Specific Partzymes Examples (Catalytic core) A and B Targets (Figures) Substrates

RO5A4/3-P: RO5B5/3-P 13 RPLPO exon 5 (RO5) SubBi-3-Q6B2 (3)

RO5A4/3-P: RO5B5/3-P 9 RPLPO exon 5 (RO5) (19) SubBi-3-JB (3)

RO5A4/4-P: RO5B5/4-P 14 RPLPO exon 5 (R05) SubBi-4-JB (4)

RO5A4/2-P: RO5B5(16)/2-P 20 RPLPO exon 5 (R05) SubBi-2-FB (2)

RO5A4/2-P: RO5B5/2-P 24 RPLPO exon 5 (R05) SubBi-2 (2) miR20A4/2: miR20B5/2 9 miR-20 (19)

SubBi-2-FB (2)

PCR7aA4/2-P: PCR7aB5/2-P 10

Let-7a

SυbBi-2-FB (2)

BaA4/2-P: BaB5/2-P 13 B-actin SubBi-2-JB (2)

BaA4/7-P: BaB5/7-P 14 B-actin SubBi-7-FB (7)

BCRA4/6-P: BCRB5/6-P 13 and 14

BCR

SubBi-6-TRB2 (6)

HPRTA4/7-P: HPRTB5/7-P 13

HPRT

SubBi-7-FB (7)

HPRTA4/2-P: HPRTB5/2-P 14

HPRT

SubBi-2-A350B (2)

RO4A4/3-P: RO4B5/3-P 14 RPLPO exon 4 (R04) SubBi-3-Q6B2 (3)

RO4A4/3-5b: RO4B5/3-3b 24 RPLPO exon 4 (RO4) SubBi-3-FB (3)

Ne£A4/6-P: NefB5/6-P 16 HIV-I Nef SubBi-6-TRB2 (6)

XdA4/2-P: XdB5/2-P 22

Xd (23)

SubBi-2-FB (2)

7 A5:B6 pl6A5/3-P: pl6B6/3-P 11 (10:23) pl6

SubBi-3-FB (3) Table 3 (continued): Exemplary MNAzymes and substrates. Specific partzymes used in working examples

MNAzyme Designs Partzymes Specific Partzymes Examples (Catalytic core) A and B Targets (Figures) Substrates

16S1A5/2-P: 16S1B6/2-P 15 Bacterial ribosomal 16 S SubBi-2-FB (2)

RO5A5/2(22)-P:RO5B6/2(l IG)-P 19 RPLPO exoα 5 (RO5) (22) SubBi-2-FB (2)

RO5A5/2(22)-P:RO5B6/2(l IC)-P 19 RPLPO exon 5 (R05) (22) SubBi-2-FB (2)

RO5A5/2(22)-P: RO5B6(16)/2-P 20 RPLPO exon 5 (R05) SubBi-2-FB (2)

RO4A5/2: RO4B6/2 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2-G14A: RO4B6/2 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2-A12T: RO4B6/2 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2-A11T: RO4B6/2 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2-A9T: RO4B6/2 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2: RO4B6/2-C7A 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5/2: RO4B6/2-T4C 17 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5(18)/2-P: RO4B6 (19)/2-P 23 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5(18)/2-rA9-P: RO4B6 (19)/2-P 23

RPLPO exon 4 (R04)

SubBi-2-FB (2)

RO4A5(18)/2-rG14-P: RO4B6 (19)/2-P 23

RPLPO exon 4 (RO4)

SubBi-2-FB (2)

RO4rA5(18)/2: RO4B6 (19)/2-P 23 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4A5(18)/2-P: RO4rB6(19)/2 23 RPLPO exon 4 (R04) SubBi-2-FB (2)

RO4rA5(18)/2: RO4ΓB6(19)/2 23 RPLPO exon 4 (R04) SubBi-2-FB (2) Table 3 (continued): Exemplary MNAzymes and substrates. Specific partzymes used in working examples

Figure imgf000077_0001

Example 1: Application of MNAzymes to the direct detection of a target nucleic acid fliuman RPLPO sequence).

1.1. Partzyme Oligonucleotides [ 00282 ] Four designs for MNAzymes (Figures 8-10) based on the 8:17 DNAzyme were tested. Those skilled in the art will appreciate that the sensor arm (target binding) sequences designated by "N" may be replaced by target-specific sequences for any known nucleic acid target (Figures 8-10). The substrate arm sequences, which bind the reporter substrate, can be generic and used for many targets. Those skilled in the art will appreciate that the substrate sequences designated by "N'" in Figures 8-10 may be replaced by DNA, RNA or DNA/RNA chimeric sequences and those designated by "r" may be replaced by other and/or a different number of ribonucleotide sequences.

[ 00283 ] In the experiments conducted to measure the catalytic activity of the RPLPO MNAzymes described in Figures 8-10, the A and B oligonucleotide partzymes were designed to target exon 4 of the RPLPO gene. The sequences of the A and B partzymes are listed below from 5' to 3' where the bases underlined form at least part of the active catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate. SEQ ID NO:1: Partzyme Al RO4A1/1:

GCTGGTCATCCAGCACGGTCGAAATAGTGAGT SEQ ID NO: 2: Partzyme A2 RO4A2/1:

GCTGGTCATCCAGCAGCGGTCGAAATAGTGAGT SEQ ID NO: 3: Partzyme Bl RO4B1/1:

CATCTCTTCTCCGTCGAAGTGTTCGACAATGGC

SEQ ID NO: 4: Partzyme B2 RO4B2/1: CATCTCTTCTCCGGTGTTCGACAATGGC

SEQ ID NO: 5: Partzyme B3 RO4B3/1:

CATCTCTTCTCCGAGCGTGTTCGACAATGGC

1.2. Reporter Substrate

[ 00284 ] MNAzyme activity is monitored by cleavage of a dual labelled nucleic acid reporter substrate. The substrate sequence is a chimeric sequence containing both RNA and DNA bases which has been used previously as an 8:17 DNAzyme substrate (Li et al., 2000). In the current example, the reporter substrate is designated SubBi-1-FB and has internal labels, namely 6-carboxyfluorescein ("6-FAM") attached to a nucleotide 5' to the RNA base, and a Black Hole Quencher 1 ("BHQl") moiety attached to a nucleotide 3' to the RNA base. Cleavage of SubBi-1-FB by MNAzymes was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength). The labelled sequence of SubBi-1-FB is as follows, 5' to 3', with the underlined bases indicating the position of the 6-FAM and BHQl moieties. The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 6 : SubBi -1-FB :

ACTCACTATaGGAAGAGATG

1.3. Control MNAzyme Sequence

[ 00285 ] The hybridization control (inactive MNAzyme) was inactivated by mutating a single base in the Al oligonucleotide that is essential for formation of the catalytic core. Although both the reporter substrate and target sequences can still bind to the MNAzymes, the substrate cannot be cleaved due to the modification in the catalytic core of the MNAzyme. The binding of the reporter substrate to the partzyme molecules could in itself generate a measure of fluorescence due to conformational change of the reporter substrate upon hybridisation. A control that uses a mutated Al partzyme molecule

(RO4Almut) was included and designated the Hybridisation Control. The mutated MNAzyme sequence is illustrated below and the position of the G base that was changed to a T is underlined.

SEQ ID NO: 7: Mutant Partzyme A

R04Almut/1 :GCTGGTCATCCAGCACGGTCTAAATAGTGAGT

1.4. Target io [ 00286 ] The target sequence for this example was an oligonucleotide, RO4/1 Target, which has the same sequence as a section of exon 4 of the human RPLPO gene. The sequence of RO4/1 Target is as follows, written 5' to 3'.

SEQ ID NO: 8 R04/lTarget: I5 GCCATTGTCGAACACCTGCTGGATGACCAGC

[ 00287 ] To ensure a signal cannot be detected when an incorrect target sequence is present the "off-target" effect was determined by using 3 μg of lambda DNA (PROMEGA) or a synthetic negative control oligonucleotide of unrelated sequence 20 (RO4/lmutTarget).

SEQ ID NO: 9 R04/lmutTarget :

CGACCATTAGGTCGTCCACAAGCTGTTACCG

1.5. Reaction Components

25 [ 00288 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. AU reactions were conducted at 4O0C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a

30 total of 10 minutes. All reactions in Table 4 contained the bulk mix of 1 μM SubBi-1-FB in Tris HCl (pH 9.0 at 25°C) and 25 mM MgCl2. Table 4: Reaction components for the detection of a nucleic acid

Figure imgf000080_0001

[ 00289 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) utilised during an experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in that well to allow comparisons between wells.

1.6. Results: detection of cleavage ofSubBi-1-FB reporter substrate

[ 00290 ] Design 1 and 2 MNAzymes showed little evidence of target-dependent cleavage of the reporter substrate under the conditions of this experiment (Figure 8). The fluorescence was similar for reactions with, and without, target RPLPO oligonucleotide target. The addition of target RPLPO oligonucleotide resulted in an increase of fluorescence for design 3 (Figure 9 and 10) and design 4 (Figure 10). This is consistent with the formation of active MNAzymes in the presence of target nucleic acid resulting in cleavage of the reporter substrate between the fluorophore and quencher dye pair causing an increase in fluorescence. The fluorescence of the no-target controls was lower than that in the target-containing reactions and none of the control reactions showed an increase in fluorescence over time (Figures 8-10). This demonstrates that the increase in fluorescence produced in target-containing reactions is due to target-dependent assembly of a catalytically active MNAzyme that then cleaved the reporter substrate. The cleavage efficiency of design 4 was greater than design 3 for the RPLPO system (Figure 10).

[ 00291 ] The off-target, hybridization, Partzyme A only and Partzyme B only control reactions are shown for design 3 (Figure 9). The fluorescence levels of these controls were either lower than or similar to that of the no-target reactions. None of the control reactions showed an increase in fluorescence over time. These results further demonstrate that cleavage of the reporter substrate is dependent on the presence of both the Partzyme A and the Partzyme B oligonucleotides that are required for assembly of an active MNAzyme, as well as the target nucleic acid sequence.

Example 2: MNAzymes for detection ofmiR-20 or short DNA sequences homologous to miR-20.

2.1. Partzyme Oligonucleotides

[ 00292 ] Detection using MNAzymes can also be used for the analysis of miRs. In this example, the MNAzyme only forms when the correct miR sequence is present. This MNAzyme can distinguish between related miR sequences e.g. hsa-miR-20 and hsa-miR- 93. [ 00293 ] In the experiments conducted to measure the catalytic activity of the MNAzyme described in Figure 11, the A and B partzyme oligonucleotides were designed to target hsa-miR-20. The sequences of the partzymes A and B oligonucleotides are listed below from 5' to 3'. In the following sequences, the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate. SEQ ID NO: 10: Partzyme A2 : miR20A2/1 : TACCTGCACTACGGTCGAAATΛGTGΛGT

SEQ ID NO: 11: Partzyme B3 : miR20B3/1 : CATCTCTTCTCCGAGCTAA.GCACTTTA

2.2. Reporter Substrate

[ 00294 ] MNAzyme activity is monitored by cleavage of a dual labelled nucleic acid reporter substrate. The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Changes in fluorescence due to cleavage of SubBi-1-FB at the ribonucleotide between the FAM and BHQl were monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength).

SEQ ID NO: 6: SubBi-1-FB: ACTCACTATaGGAAGAGATG

2.3. Target

[ 00295 ] The target sequence for this example was a DNA oligonucleotide, D-20, which has sequence which is homologous to the RNA hsa-miR-20 species (Figure 11 (i)). The sequence of D-20Target is as follows, written 5' to 3'.

SEQ ID NO: 12: D-20Target: TAAAGTGCTTATAGTGCAGGTA

2.4. Control Sequences

[ 00296 ] Any assay developed to detect microRNAs must specifically distinguish the desired miR sequence e.g. hsa-miR-20 from related sequences such as hsa-miR-17-5p, which may differ from the target miR by one or more bases (Figure 1 l(i)). The hsa-miR- 20 related "off-target" 17-5p, 93, 106a and 106b miR oligonucleotides were also synthesized as DNA and are written 5' to 3' below.

SEQ ID NO: 13: D-17-5pTarget : CAAAGTGCTTACAGTGCAGGTAGT

SEQ ID NO: 14: D-93Target: AAAGTGCTGTTCGTGCAGGTAG SEQ ID NO: 15: D-106aTarget : AAAAGTGCTTACAGTGCAGGTAGC SEQ ID NO: 16: D-106bTarget :

TAAAGTGCTGACAGTGCAGAT 2.5. Reaction Conditions

[ 00297 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 40°C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a total of 4 minutes. All reactions in Table 5 contained the bulk mix consisting of 1 μM SubBi-1-FB, Tris HCl (pH 9.0 at 25°C) and 25 mM MgCl2. Table 5: Components of reactions for the detection of a nucleic acid target as shown in

Figure 11

Figure imgf000083_0001
[ 00298 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in each well to allow between well comparisons.

[ 00299 ] The target-containing, "no-target" and "off-target" reactions were also performed in the presence of 5 mM and 100 mM MgCl2 concentrations and compared to 25 HiM MgCl2 (Figure 12).

2.6. Results: Detection of cleavage ofSubBi-1-FB reporter substrate

[ 00300 ] The partzyme A and B oligonucleotides of the MNAzyme assemble into a catalytically active MNAzyme to cleave the reporter substrate only in the presence of the target sequence. In this example the off-target controls have as little as two mismatched bases with the sensor arms (miR-20 target binding sequence). The "off-target" D-17-5p has two mismatched bases, only one of which occurs in the most discriminatory region located in the middle of the miR-20 sequence. The cleavage reaction containing the target sequence D-20 gave a 26-fold increase in signal compared to the no-target control (Figure 11 (iii)). This compares with the off-target controls, D-17-5p and D- 106a, which give a 3.5-fold increase in signal compared to the no-target control, and D-93 and D- 106b which give no increase in signal compared to the no-target control (Figure 11 (iii)). Thus, differentiation of D-20 from related sequences demonstrates the capacity of the MNAzyme system to discriminate sequences that differ by only a few bases. Previous studies using uni-molecular DNAzymes have demonstrated that DNAzymes have the capacity to distinguish single base mutations (Impey et al., 2000). MNAzymes also allow discrimination of single base changes (see example 5 below).

[ 00301 ] The "partzyme A only" and "partzyme B only" controls had a similar fluorescence to that of the background fluorescence (data not shown).

[ 00302 ] The use of protein enzymes requires other reagents in the reaction to be at concentrations that are optimal for protein enzyme activity. For example, the concentration of the metal ion cofactor that aids a DNAzyme in cleaving the reporter substrate is kept at a minimum in protocols that utilize enzymes like polymerases. Direct detection using MNAzymes does not require any protein enzymes and therefore reaction conditions can be optimized for rapid substrate cleavage. In these reactions the metal ion cofactor e.g. Mg2+ can be increased to optimize the MNAzyme catalytic rate. Figure 12 shows how the concentration OfMgCl2 can be increased to levels that cannot normally be tolerated in target detection protocols. At high MgCl2 (10OmM) the catalytic efficiency of the MNAzyme is higher. Furthermore, when detecting D-20Target an increase in the MgCl2 did not affect the specificity of the reaction, since D-20Target is still clearly distinguishable from the related sequences D-17-5p, Target D-106aTarget, D-93Target and D-106bTarget.

Example 3: MNAzymes (designs 5 and 6) for direct detection of a nucleic acid target 3.1. Partzyme Oligonucleotides

[ 00303 ] The designs 5 and 6 for MNAzymes, based on the 10:23 DNAzyme, were tested for catalytic activity (Figure 13). Those skilled in the art will appreciate that the sensor arm (target binding) sequences designated by "N" may be replaced by target- specific sequences for any known nucleic acid target. The substrate arm sequences, which bind the reporter substrate, can be generic and used for many targets. Those skilled in the art will appreciate that the substrate sequences designated by "N" in Figure 13 may be replaced by DNA, RNA or DNA/RNA chimeric sequences. [ 00304 ] In the experiments conducted to measure the catalytic activity of the RPLPO MNAzymes described in Figure 13, the A and B oligonucleotide partzymes were designed to target exon 5 of the RPLPO gene. The sequences of the A and B partzymes are listed below from 5' to 3' where the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate. Sequences which are neither underlined, bolded, or italicized in SEQ ID NO: 17 and SEQ ID NO: 18 preferably form a stem structure such as that depicted in Figure 13 (see e.g., Design 5).

SEQ ID NO: 17 partzyme A3 RO5A3/2:

CAAACGAGTCCTGGCCTTGTCCGCACAACGAGAGGAaACCTT

SEQ ID NO: 18 partzyme B4 RO5B4/2:

TGCCCAGGGAGGCTAGCTGCGGTGGAGACGGATTACACCTTC SEQ ID NO: 19 partzyme A4 RO5A4/2:

CAAACGAGTCCTGGCCTTGTCTACAACGAGAGGA^ACCTT

SEQ ID NO: 20 partzyme B5 RO5B5/2:

ΓGCCCAGGGAGGCTAGCTGTGGAGACGGATTACACCTTC

3.2. Reporter Substrate

[ 00305 ] The reporter substrate for this example is SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end labelled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 21 SubBi-2-FB : AAGGTTTCCTCguCCCTGGGCA

3.3. Target Sequences

[ 00306 ] The target sequence for this example was a synthetic oligonucleotide RO5/1 Target with the sequence, 5' to 3', as below. This target sequence has the same sequence as a section of the RPLPO gene, exon 5.

SEQ ID NO: 22 RO5/lTarget: GAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTG

3.4. Reaction Components

[ 00307 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme.

Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. AU reactions were conducted at 55°C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a total of 5 minutes. All reactions in Table 6 contained 1 μM SubBi-2-FB, Tris HCl (pH 9.0 at 25°C) and 25 mM MgCl2. Table 6: Components of reactions for detection of a nucleic acid target as shown in

Figure 13

Figure imgf000087_0001

5 [ 00308 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in that well to allow between well comparisons. o 3.5. Results: Detection and cleavage of substrate

[ 00309 ] The target-containing reactions, with the MNAzymes of designs 5 and 6, showed an increase in fluorescence over time compared to the no-target control (Figure 13ii), upper and lower panels, respectively. This demonstrates that the partzyme oligonucleotides assemble into a catalytically active MNAzyme and cleave the reporter s substrate only in the presence of the target sequence. The no-target controls did not show an increase in fluorescence indicating that no cleavage was occurring. The cleavage rate for design 6 was considerably faster than design 5.

Example 4: Detection of amplicons from in vitro PCR amplification of a nucleic acid 0 sequence using MNAzymes

4.1. Partzyme Oligonucleotides

[ 00310 ] MNAzymes can also be used to detect amplicons from in vitro amplified nucleic acid sequence. For this example, detection of amplicons is performed as a two- step process but may also be performed in a single reaction. In this instance, the S oligonucleotides used to detect the amplicons were based on design 4 using oligonucleotides RO4A2/1 and RO4B3/1 (Figure 10), which detects the human RPLPO gene. The A and B partzyme oligonucleotides are listed below. In the following sequences, the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate.

SEQ ID NO: 2 Partzyme A2 RO4A2/1:

GCTGGTCATCCAGCAGCGGTCGAAATAGTGAGT

SEQ ID NO: 5 Partzyme B3 RO4B3/1:

CΛTCTCTTCTCCGAGCGTGTTCGACAATGGC

4.2. Reporter substrate [ 00311 ] The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Cleavage of SubBi-1-FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength).

SEQ ID NO: 6 SubBi-1-FB: ACTCACTATaGGAAGAGATG

4.3. Primers for amplification of human RPLPO gene by PCR [ 00312 ] The target sequence for this example was generated by in vitro PCR amplification of sequence from exon 4 of the RPLPO gene from human genomic DNA extracted from the K562 (PROMEGA) cell line, using the PCR primers listed below.

SEQ ID NO: 23 Primer 5RO4/3 : CAAGACTGGAGACAAAGTG

SEQ ID NO: 24 Primer 3RO4/2: GCAGAGTTTCCTCTGTGATA 4.4. Control Target Oligonucleotide

[ 00313 ] An oligonucleotide was synthesised and used as a positive control for RPLPO sequence. The control oligonucleotide was not amplified by PCR in these experiments.

SEQ ID NO : 8 R04/lTarget : 5 GCCATTGTCGAACACCTGCTGGATGACCAGC

4.5. Reaction components: PCR amplification of the RPLPO gene

[ 00314 ] PCR amplification of the RPLPO gene was performed in total reaction volume of 25 μL. All amplification reactions were conducted in a GeneAmp® PCR o System 9700 thermocycler (Applied Biosystems). The cycling parameters were 95°C for 7 minutes, 10 cycles of 95°C for 5 seconds and 65°C for 30 seconds (with a I0C decrease in temperature per cycle), and finally 50 cycles of 950C for 5 seconds and 55°C for 30 seconds. AU reactions contained 40 nM 5R04/3 and 200 nM of 3RO4/2, 3 mM MgCl2, 200 μM of each dNTP, Ix Immobuffer (Bioline) and 1 unit of Immolase (Bioline) with or 5 without 500 ng of K562 human genomic DNA (PROMEGA).

4.6. Reaction Components: Detection of target sequence

[ 00315 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Q Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 4O0C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a total of 10 minutes. AU reactions in Table 7 contained the bulk mix of 1 μM SubBi-1-FB, Tris HCl (pH 9.0 at 25°C) and 25 mM MgCl2. Concentrations of oligonucleotide 5 Partzymes A and B are 1 μM. Table 7: Reaction components for the detection of RPLPO DNA amplicons following in vitro PCR. The MNAzyme systems used Design 4 (RO4A2/1:RO4B3/1)

Figure imgf000090_0001

[ 00316 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in that well to allow between well comparisons.

4.7. Results: detection of cleavage ofSubBi-1-FB reporter substrate

[ 00317 ] The MNAzyme design 4 for the detection of RPLPO, exon 4, showed an increase in fluorescence over time when the target RPLPO sequence was amplified from human genomic DNA by PCR (Figure 14). The increase in fluorescence seen for RPLPO amplicons was similar to that seen for 1012 copies of the positive control RO4/1 Target oligonucleotides. The fluorescence of the no-target controls was lower than that in the target-containing reactions and none of the negative control reactions showed an increase in fluorescence over time. This demonstrates that the increase in fluorescence produced in target-containing reactions is due to target-dependent assembly of a catalytically active MNAzyme, that then cleaved the reporter substrate.

Example 5: Use of MNAzymes for detection of amplicons produced by in vitro PCR amplification of short nucleic acid sequences.

5.1. Partzyme Oligonucleotides

[ 00318 ] MNAzymes can be used to detect amplicons from in vitro amplified nucleic acid sequence. In this example amplification and detection are performed in a three-step process (Figure 5) but reverse transcription, PCR amplification and detection could also be performed concurrently in a single reaction tube. For this example the oligonucleotides used to detect the amplicons used design 4, miR partzyme A and B oligonucleotides (Figure 11), which are designed to detect hsa-miR-20. The MNAzyme partzyme oligonucleotides are listed below such that the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate.

SEQ ID NO: 10 Partzyme A2 miR20A2/l:

TACCTGCACTACGGTCGAAATAGTGAGT 0 SEQ ID NO: 11 Partzyme B3 miR20B3/l: CATCTCTTCTCCGAGCTAAGCACTTTA

5.2. Reporter Substrate

[ 00319 ] The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to s 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Cleavage of SubBi-1-FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength).

0 SEQ ID NO : 6 SubBi -1-FB :

ACTCACTATaGGAAGAGATG

5.3. PCR primers for amplification of 22 mer D-20 oligonucleotide target sequences

[ 00320 ] The target sequence for this example was generated by in vitro amplification S of the D-20 oligonucleotide using the oligonucleotides PCR primers listed below

SEQ ID NO: 25 Primer 5miR20/l:

ACGTGACGCTAAAGTGCT SEQ ID NO: 26 Primer 3miR20/Ll: CGTCCGAATGACGTACCTGCAC

SEQ ID NO: 27 Primer 3miR20/Pl: CGAATGACGTACCTGCAC

5.4. Target sequences and controls

[ 00321 ] The DNA sequence (D-20Target) with homology to miR-20 was used as template for demonstrating amplification and detection of a short sequence using PCR and MNAzymes.

SEQ ID NO: 12 D-20Target: TAAAGTGCTTATAGTGCAGGTA

[ 00322 ] Furthermore, to ensure that any closely related "off-target" sequences erroneously amplified can not be detected with the miR-20 system, the control target DNA oligonucleotide D-17-5pTarget was also tested with the miR-20 partzyme A and B oligonucleotide system.

SEQ ID NO: 13 D-17-5pTarget :

CAAAGTGCTTACAGTGCAGGTAGT

5.5 Reaction Components: Amplification of target sequence

[ 00323 ] Amplification of the target sequence was performed in a total reaction volume of 25 μL. AU amplification reactions were conducted in a GeneAmp® PCR System 9700 thermocycler (Applied Biosystems). The cycling parameters for steps 1 and 2 (reverse transcription and PCR) were 42°C for 30 minutes, 95°C for 7 minutes, 10 cycles of 95°C for 5 seconds and 30°C for 30 seconds (plus 20C per cycle), and finally 50 cycles of 95°C for 5 seconds and 5O0C for 30 seconds. The reactions initially only contained 10 nM 3miR20/Ll, after 420C for 30 minutes the reaction was paused and 30 nM 3miR20/Pl and 200 nM of 5miR20/l were added. All other reagents listed were in the initial reaction mix, 3 mM MgCl2, 200 μM of each dNTP, 1 x Immobuffer (Bioline) and 1 unit of Immolase (Bioline) and either a) 108 copies of D-20Target, b) no target (dH2O) or c) 108 copies of off target DNA (D-17-5ρTarget).

5.6. Reaction Components: Detection of target sequence

[ 00324 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 4O0C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a total of 10 minutes. AU reactions in Table 8 contained the bulk mix of 1 μM SubBi-1-FB, Tris HCl (pH 9.0 at 250C) and 25 mM MgCl2. Concentrations of partzyme A and B were 1 μM.

Table 8: Reaction components for the detection of in vitro amplified short (20-25mer) nucleic acid sequences. The MNAzyme system used Design 4 (miR20A2/l:miR20B3/l).

Figure imgf000093_0001

[ 00325 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence. This value was then subtracted from all other reactions performed in that well to allow between well comparisons. 5.7. Results: detection of cleavage ofSubBi-1-FB reporter substrate

[ 00326 ] The MNAzyme design 4 for the detection of miR-20, showed an increase in fluorescence over time when the target sequence used was D-20Target amplified via PCR (Figure 15(i)). [ 00327 ] The fluorescence of the no-target control was lower than that in the target- containing reactions, and none of the negative control reactions showed an increase in fluorescence over time. This demonstrates that the increase in fluorescence produced in target-containing reactions is due to target-dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. [ 00328 ] The off target control (D-17-5p) in this example was also amplified with the miR-20 primers since it only has one mismatch in the terminal position within the regions that hybridize with the miR-20 primers. Amplification of both D-20Target and D- 17- 5pTarget was confirmed by electrophoresis. Since both amplicons incorporate the primer sequences at their termini, they now only differ by a single base in the middle of the amplicons. The MNAzyme successfully discriminated between the D-20 and D-17-5p amplicons. This discrimination is a result of the single nucleotide difference in the D-20 and D-17-5p amplicons in the region that lies between the primers as illustrated in Figure 15(ii). The MNAzyme requires the four bases between the primers to be present (thus allowing discrimination between primer dimer and genuine amplicons) and those four bases must be exact with no substitutions tolerated. This example illustrates the capacity for MNAzymes to discriminate between closely related sequences including those which differ by only a single nucleotide polymorphism.

Example 6: Use of MNAzymes for detection ofmicroRNΛ amplicons produced by in vitro PCR amplification of total RNA

6,1. Partzyme Oligonucleotides

[ 00329 ] MNAzymes can be used to detect amplicons from in vitro amplified nucleic acid sequences. In this example amplification and detection are performed in a two-step process (Figure 5) where reverse transcription and PCR amplification occur in a first tube, followed by MNAzyme mediated detection in a second tube. For this example the oligonucleotides used to detect the amplicons were design 4, miR partzyme A and B oligonucleotides (Figure 11), which are designed to detect hsa-miR-20. The MNAzyme partzyme oligonucleotides are listed below such that the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, and bases in italics hybridize to the substrate.

SEQ ID NO: 10 Partzyme A2 miR20A2/l:

TACCTGCACTACGGTCGAAATAGTGAGT SEQ ID WO: 11 Partzyme B3 miR20B3/l: CATCTCTTCTCCGAGCTAAGCACTTTA

6.2. Reporter Substrate

[ 00330 ] The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Cleavage of SubBi-1-FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength).

SEQ ID NO: β SubBi-1-FB: ACTCACTATaGGAAGAGATG

6.3. PCR primers for amplification of hsa-miR-20

[ 00331 ] The target sequence for this example was generated by in vitro amplification of human thymus total RNA (Ambion) using the oligonucleotide PCR primers listed below.

SEQ ID NO: 25 Primer 5miR20/l:

ACGTGACGCTAAAGTGCT

SEQ ID NO: 26 Primer 3miR20/Ll: CGTCCGAATGACGTACCTGCAC 6.4. Target sequences and controls

[ 00332 ] Human thymus total RNA (Ambion) was used as template for amplification of miR-20 and amplicons were subsequently detected using MNAzymes (section 6.6).

[ 00333 ] The RNA sequence (R-20Target) with homology to miR-20 was used as a positive control for demonstrating amplification of short sequences, followed by detection of resultant amplicons using MNAzymes.

SEQ ID NO: 28 R-20Target: uaaagugcuuauagugcaggua

6.5. Reaction Components: Amplification of target sequence

[ 00334 ] Reverse transcription and PCR amplification of the target sequence was performed in total reaction volume of 25 μL. All amplification reactions were conducted in a GeneAmp® PCR System 9700 thermocycler (Applied Biosystems). The cycling parameters were 4O0C for 30 minutes, 950C for 7 minutes, 10 cycles of 950C for 5 seconds and 3O0C for 30 seconds (with a 2°C increase in temperature per cycle), and finally 50 cycles of 95°C for 5 seconds and 50°C for 30 seconds. The reactions contained 40 nM 3miR20/Ll and 200 nM of 5miR20/l, 3 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 30 units of MMLV(-H) Reverse Transcriptase (Promega), 1 x Immobuffer (Bioline) and 0.5 units of Immolase (Bioline) and either a) 1 μg of total RNA, b) no target (dH2O) or c) 1014 copies (5 μM) of R-20Target Oligonucleotide.

6.6. Reaction Components: Detection of target sequence

[ 00335 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme.

Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 400C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 30 seconds for a total of 5 minutes. All reactions in Table 9 contained the bulk mix of 1 μM SubBi-1-FB, 1 μM partzyme A, 1 μM partzyme B, 50 mM Tris HCl (pH 9.0 at 25°C), 25 mM MgCl2 and target (as indicated in Table 9). Table 9: Reaction components for the detection of in vitro amplified total RNA. The MNAzyme system used Design 4 (miR20A2/l:miR20B3/l).

Figure imgf000097_0001

[ 00336 ] The background level of fluorescence was measured for each reaction well on the SmartCycler® System thermocycler (Cepheid). This value was then subtracted from all other reactions performed in that well to allow comparison between wells.

6.7. Results: detection of cleavage ofSubBi-1-FB reporter substrate [ 00337 ] The MNAzyme design 4 for the detection of miR-20, showed an increase in fluorescence over time when the target sequence used was total RNA amplified via PCR (Figure 16).

[ 00338 ] The fluorescence of the no-RNA target control was lower than that in the RNA target-containing reactions, and none of the negative control reactions showed an increase in fluorescence over time. This demonstrates that the increase in fluorescence produced in target-containing reactions is due to PCR amplified target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. While this experiment was performed in two steps (reverse transcription/PCR then MNAzyme end point detection), all steps could be performed concurrently in a single reaction tube allowing the reaction to be monitored in real time. Example 7: Target detection by MNAzytnes coupled to a nucleic acid signal cascade.

7.1. MNAzyme initiated signal amplification cascades

[ 00339 ] It is possible to lower the limit of detection of nucleic acids by coupling MNAzyme detection to a signal amplification cascade reaction, as illustrated in Figure 7. 5 MNAzymes also allow a highly specific triggering mechanism for initiation of a cascade.

7.2. Spatially separated DNAzyme Cascade

[ 00340 ] DNAzymes can be tethered to a support using a variety of methods including attachment to plastic wafers coated with streptavidin that allow attachment of biotin ic labeled DNAzymes. The sequences used for attachment can also serve as generic MNAzyme/DNAzyrne substrates. Targets (e.g. nucleic acid sequences) can be detected following hybridization to partzyme sequences allowing the formation of active MNAzymes. The MNAzymes can then cleave tethered generic substrates thus releasing DNAzyme A. DNAzyme A can then migrate to a second generic sequence on a second

15 solid surface where DNAzyme B is tethered. DNAzyme A can cleave the second generic sequence thus releasing DNAzyme B. Cleavage of this substrate between fluorophore/quencher dye pairs can result in increased fluorescence. The released DNAzyme B can in turn cleave more of the first substrate thus releasing more of DNAzyme A and initiating a signal cascade which results in signal amplification (Figure

20 7).

[ 00341 ] This example describes one mechanism for generating a signal cascade using spatially separated DNAzymes, however, other methods exist which would also allow signal amplification using catalytic nucleic acids. The skilled artisan will appreciate that any such method should be fully functional herewith, provided that by some means of

25 attachment or physical separation, a substrate is kept "inaccessible" to an enzyme that would act on it. Other examples of nucleic acid signal amplification which could be coupled to MNAzyme initiated reactions include, but are not limited to, ligation cascades (Paul and Joyce, 2004) and circular DNAzyme cascades (Levy and Ellington, 2003), each of which involve the base principle of maintaining a "separation" of an enzyme from its

30 substrate, whereupon when the enzyme and substrate come into contact such that catalytic activity can result, directly or indirectly an amplified signal, or signal cascade results. Example 8: Use of MNAzymes for the quantitation of a nucleic acid target

8.1. Partzyme Oligonucleotides

[ 00342 ] MNAzymes can be used to monitor amplification of target nucleic acids in real time using in vitro target amplification methods such as PCR. Further, real time

5 monitoring allows the amount of target initially present in the reaction to be quantified. In this example amplification and detection are performed in a one-step process, wherein PCR amplification and MNAzyme-mediated detection occur simultaneously in a single tube. Partzyme oligonucleotides A and B used design 6 with sensor arms complementary to exon 5 of the human RPLPO gene (Figure 17(i)). The partzyme oligonucleotides are io listed below with the "-P" indicating 3 ' phosphorylation of the oligonucleotide.

SEQ ID NO: 29 Partzyme A4 RO5A4/3-P:

CAAACGAGTCCTGGCCTTGTCTACAACGAGGrTGrGCT1G-P

SEQ ID NO: 30 Partzyme B5 RO5B5/3-P: I5 CGGTTGGTGAGGCTAGCTGTGGAGACGGATTACACCTTC-P

8.2. Reporter Substrate

[ 00343 ] The reporter substrate for this example is SubBi-3 with the sequence, 5' to 3', as below. In the current example, SubBi-3 -FB was end-labelled with a 6-FAM moiety at 20 the 5' end and a BHQl moiety at the 3' end. Cleavage of SubBi-3 -FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

25 SEQ ID NO: 31 SubBi-3-FB: CAGCACAACCguCACCAACCG

30 8.3. PCR primers for amplification of RPLPO exon 5

[ 00344 ] The target sequence for this example was generated by in vitro amplification of human genomic DNA using the oligonucleotide PCR primers listed below.

5 SEQ ID NO: 32 Primer 5RO5/1:

CATTCTATCATCAACGGGTA SEQ ID NO: 33 Primer 3RO5/1: CAAAGGCAGATGGATCAG

o 8.4. Target sequence

[ 00345 ] Human genomic DNA extracted from the K562 cell line (Promega) was used as template for amplification of RPLPO gene.

8.5. Reaction Components: Amplification and quantitation of target sequence s [ 00346 ] Real time amplification and quantitation of the target sequence was performed in a total reaction volume of 25 μL. AU reactions were conducted in an ABI7700 thermocycler (Applied Biosystems). The cycling parameters were, 95°C for 7 minutes, 10 cycles of 95°C for 5 seconds and 60°C for 30 seconds (with a 1°C decrease in temperature per cycle), and finally 50 cycles of 950C for 5 seconds and 50°C for 30 0 seconds. The reactions contained 40 nM 5RO5/1 and 200 nM of 3RO5/1, 20OnM RO5A4/3-P and 20OnM RO5B5/3-P, 200 nM SubBi-3-FB, 10 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 1 x ROX reference (Invitrogen), 1 x hnmobuffer (Bioline), 0.25 units of Immolase (Bioline) and either genomic DNA template (20,000 pg, 4000 pg, 800 pg, 160 pg, 32ρg, and 6.4pg) or no target (dH2O). S

8.6. Results: Amplification of target and cleavage of SubBi-3-FB reporter substrate

[ 00347 ] The MNAzyme design 6 for the real time detection and quantification of RPLPO exon 5, showed an increase in fluorescence over time when the target sequence used was human genomic DNA amplified via PCR (Figure 17(U)). [ 00348 ] The fluorescence of the no-DNA target control was lower than that in the

DNA target-containing reactions and did not increase during the reaction. This demonstrates that the increase in fluorescence produced in target-containing reactions is due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. A standard curve was generated by plotting the log of the DNA concentrations against the threshold cycle resulting in a linear plot with a correlation coefficient of 0.995. In the reaction containing 6.4pg of genomic DNA, approximately 10 copies of the target would be present. This example demonstrates the high sensitivity of this approach. [ 00349 ] While this experiment used asymmetric primer ratios subsequent experiments using real time PCR (data not shown) demonstrated that MNAzyme detection was also compatible with PCR using symmetric primer ratios.

Example 9: Multiplex reaction using multiple MNAzymes targeting multiple targets simultaneously.

9.1. Partzyme Oligonucleotides

[ 00350 ] Multiple targets can be simultaneously detected in one multiplexed reaction that comprises multiple unique MNAzymes. Each MNAzyme has sensor arms specific for one target and substrate arms specific for a unique member of a series of generic substrates, each one of which is labeled with a different fluorophore (Figure 18). In the following example, MNAzymes were designed to detect two different targets, namely RPLPO and D-20 sequences. It will be appreciated that any number of targets can be used in accordance with the method. The sequences of the partzymes A and B are listed below from 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate.

SEQ ID NO: 29 Partzyme A4 RO5A4/3-P:

CAAACGAGTCCTGGCCTTGTCTACAACGAGGTTGTGCTG-P SEQ ID NO: 30 Partzyme B5 RO5B5/3-P:

CGGTTGGTGAGGCTAGCTGTGGAGACGGATTACACCTTC-P SEQ ID NO: 34 Partzyme A4 miR20A4/2:

TACCTGCACTAACAACGAGAGGAAACCΓΓ

SEQ ID NO: 35 Partzyme B5 miR20B5/2: TGCCCAGGGAGGCTAGCTTAAGCACTTTA

9.2. Reporter Substrates

[ 00351 ] The two reporter substrates used in this example were SubBi-2 and SubBi-3 with the sequences, 5' to 3', as below. In the current example, SubBi-2 was end labeled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. SubBi-3 was end labeled with a 6-JOE moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-3-JB.

[ 00352 ] Cleavage of SubBi-2-FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength) and the cleavage of SubBi-3-JB was monitored at 548 nm (JOE emission wavelength) with excitation at 520 nm (JOE excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO: 21 SubBi-2-FB: AAGGTTTCCTCguCCCTGGGCA SEQ ID NO: 36 SubBi-3-JB: CAGCACAACCguCACCAACCG

9.3. Target Sequences

[ 00353 ] The target sequences for this example were synthetic oligonucleotides RO5/lTarget and D-20Target with the sequences, 5' to 3', as below. The RO5/lTarget sequence has the same sequence as a section of the RPLPO gene, exon 5 and the D- 20Target sequence is a DNA homolog of the RNA hsa-miR-20.

SEQ ID NO: 22 RO5/lTarget:

GAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTG SEQ ID NO: 12 D-20Target: TAAAGTGCTTATAGTGCAGGTA

9.4. Reaction Conditions

[ 00354 ] Detection of the target sequences was measured by monitoring the increase in fluorescent signal caused by cleavage of the reporter substrates by the catalytically active MNAzymes. Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 55°C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every 7 seconds for a total of 5 minutes. All reactions in Table 10 contained PCRII buffer (Applied Biosystems) and 25 mM MgCl2.

Table 10: Components of reactions for the simultaneous detection of two different nucleic acid targets.

Figure imgf000103_0001

[ 00355 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in that well to allow between well comparisons.

9.5. Results: Detection and cleavage of substrate

Singleplex reactions containing target D-20 or RPLPO showed an increase in fluorescence over time compared to the no-target control (Figure 19 (i)). This demonstrates that the partzymes assemble into a catalytically active MNAzyme and cleave the reporter substrate only in the presence of the target sequence. The "no-target" (dH2O) controls did not increase in fluorescence indicating that no cleavage occurred in the absence of target. The multiplex reaction for the simultaneous detection of RPLPO and D-20 (Figure 19 (ii)) produced similar results for each target as those observed in the singleplex reactions for each target. No increase in fluorescence was observed in the "no > target" control reaction. These results demonstrate simultaneous detection of multiple targets in a single reaction without loss of specificity.

Example 10: Use of MNAzymes for the quantification of amplicons produced by in vitro amplification ofmicroRNA. 10.1. Partzyme Oligonucleotides

[ 00356 ] MNAzymes can be used to monitor amplification of target nucleic acids in real time using in vitro target amplification methods such as RTPCR. Further, real time monitoring allows the amount of target initially present in the reaction to be quantified. In this example, amplification and detection are performed in a two-step process, wherein s the first step involves production of cDNA via reverse transcription, and then PCR amplification and MNAzyme-mediated detection of the cDNA occur simultaneously in the second step. Partzyme oligonucleotides A and B used design 6 with sensor arms complementary to human microRNA hsa-let-7a. The partzyme oligonucleotides are listed below with the "-P" indicating 3' phosphorylation of the oligonucleotide. In the following 0 sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate.

SEQ ID NO: 37 Partzyme A4 PCR7aA4/2-P: S GACCGTGAGGTAGTAACAACGAGAGGAAACCTT-P

SEQ ID NO: 38 Partzyme B5 PCR7aB5/2-P: TGCCCAGGGAGGCTAGCTGGTTGTATAGTTGTC-P

10.2. Reporter Substrate 0 [ 00357 ] The reporter substrate for this example is SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end-labelled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 516 nm (FAM emission wavelength) with excitation at 492 nm (FAM excitation wavelength). In the following sequence the lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO: 21 SubBi-2-FB: AAGGTTTCCTCguCCCTGGGCA

10.3. Target sequences

[ 00358 ] The standard curve for this example was generated by a two-step RTPCR of a synthetic RNA oligonucleotide R-let7a, which has sequence homologous to the RNA hsa- let-7a species. The sequence of R-let7a, written 5' to 3, 'is as follows.

SEQ ID NO : 39 R-let7a : ugagguaguagguuguauaguu

[ 00359 ] Samples of human total RNA from colon cells (Ambion), K.562 leukaemic cells, HeLa cervical cancer cells (Ambion) and spleen cells (Clontech) were amplified and analysed for the abundance of hsa-let-7a.

10.4. PCR primers for amplification of hsa-let-7 a

[ 00360 ] The following primers were used for the amplification of hsa-let-7a. The primer 31et7a was used for reverse transcription and the primers 51et7a and 3PCR7a were used for PCR amplification.

SEQ ID NO: 40 Primer 31et7a:

AGCGAAGCTGAGACAACTATACAA SEQ ID NO: 41 Primer 51et7a:

CGACGTGACCGTGAGGTAG SEQ ID NO: 42 Primer 3PCR7a: CATGGCACAAGCGAAGCTGA

10.5. Reaction Components: Reverse transcription of target sequence

[ 00361 ] Reverse transcription of the target sequence was performed in a total reaction volume of 25 μL. Reactions were incubated on a 2720 Thermal Cycler (Applied

Biosystems) for 20 minutes at 2O0C, followed by 20 minutes at 3O0C and then 20 minutes at 4O0C. The reactions contained 10 nM 31et7a, 5 mM MgCl2, 300 μM of each dNTP, 20 units Rnasin (Promega), 1 x hnmobuffer (Bioline), 100 units of M-MLV RT(H-) and 5 μL of either R-let7a (6 x 1011 copies) or human total RNA from normal colon (0.1 μg), K562 (0.1 μg), HeLa (0.2 μg) or spleen (0.2 μg ). A control reaction contained all reagents as above but lacked RNA target instead containing 5 μL of dH2O only.

10.6. Reaction Components: Amplification and quantification of target sequence

[ 00362 ] Real time amplification and quantification of the target sequence was performed in total reaction volume of 25 μL. All reactions were conducted on a Mx3005P™ QPCR System (Stratagene). The cycling parameters were, 950C for 7 minutes, 10 cycles of 95°C for 15 seconds and 400C for 30 seconds (with a 1°C increase in temperature per cycle), and finally 50 cycles of 950C for 15 seconds and 500C for 30 seconds. The reactions contained 200 nM 3PCR7a and 40 nM of 51et7a, 40OnM PCR7aA4/2-P and 40OnM PCR7aB5/2-P, 200 nM SubBi-2-FB, 10 mM MgCl2, 200 μM of each dNTP, 20 units Rnasin (Promega), 1 x Immobuffer (Bioline), 1 unit of Immolase (Bioline) and 5 μL of either R-let7a cDNA (containing 5 x 108, 5 x 107, 5 x 106, 5 x 105, 5 x 104 copies) or human total RNA template (normal colon, 0.5 μg; K562, 0.5 μg; HeLa, 1 μg; spleen, 1 μg) or no target (dH2O).

10.7. Results: Amplification of target and cleavage of SubBi-2-FB reporter substrate

[ 00363 ] The MNAzyme for the real time detection and quantification of hsa-let-7a showed an increase in fluorescence over time when the target sequence used was cDNA generated from synthetic RNA oligonucleotide or human total RNA. There was no signal detected for the no-target control reaction (Table 11). This demonstrates that the increase in fluorescence produced in target-containing reactions was due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. A standard curve was generated by plotting the log of the initial RNA concentrations against the threshold cycle, resulting in a linear plot with a correlation coefficient of 0.999. Four human total RNA samples were also amplified and the amount of hsa-let-7a in each was estimated by extrapolating from the standard curve (Table 11).

Table 11: Results of reactions for the amplification and detection ofhsa-let-7a amplicons.

Figure imgf000107_0001

[ 00364 ] This example demonstrates the ability of MNAzymes to detect and quantify amplicons generated by RTPCR amplification of human microRNA species. MicroRNA are difficult to amplify and detect due to their small size of around 22 bases. MNAzymes are suitable for this application.

Example 11: Use of MNAzymes to detect DNA methylation

11.1. Partzyme Oligonucleotides

[ 00365 ] It is shown in example 19 that real time PCR and MNAzyme mediated signal generation allows discrimination between fully matched nucleic acid sequences and those containing mismatches with C opposite C. This capacity enables MNAzymes to be used for analysis of methylation status of cells. Alterations in methylation pattern occur frequently in association with cancer. The majority of protocols for methylation analysis begin with bisulphite modification of genomic DNA which converts unmethylated, but not methylated, cytidines to uridines. PCR amplification of the modified DNA then replaces the uridines with thymidines and various methods can be used to distinguish the sequences containing T (originally unmethylated C) and C (originally methylated C). In the following example, an MNAzyme was used to determine the methylation status of specific CpG doublets in the promoter region of the pi 6 gene in bisulphite modified DNA.

[ 00366 ] In this example, the partzymes were designed to match the sequence produced following bisulphite modification of a methylated pi 6 gene. The sequences of the partzymes are listed below (5' to 3'). In the following sequences, the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridise with the bisulphite modified target and bases in italics hybridise to the substrate. The "-P" indicates 3' phosphorylation of the oligonucleotide.

SEQ ID NO: 43 Partzyme A5 pl6A5/3-P:

GCCCCCGCCTCCAACTACAACGAGGTTGTGCTG-P

SEQ ID NO: 44 Partzyme B6 pl6Bβ/3-P: CGGTTGGTGAGGCTAGCAACGCCCGCACCTC-P

11.2. Reporter substrate

[ 00367 ] The reporter substrate used in this example was SubBi-3. In the current example, SubBi-3 was end labeled with a 6-FAM moiety at the 5' end, a BHQl moiety at the 3' end and designated SubBi-3 -FB. Cleavage of SubBi-3 -FB was monitored at 530 nm (FAM emission wavelength) with excitation at 485 nm (FAM excitation wavelength). The sequence of SubBi-3-FB is shown below (5' to 3'); the lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 31 SubBi-3 -FB : CAGCACAACCguCACCAACCG X KJo

11.3. PCR primers for amplification of bisulphite modified pl6

[ 00368 ] In this example, the PCR primers were designed to match the bisulphite- modified target, which was originally methylated. The target sequence for this example was generated by in vitro amplification of bisulphite modified human genomic DNA using the oligonucleotide PCR primers listed below (5' to 3').

SEQ ID NO: 45 Primer 5pl6:

GTTGGTTACGGTCGCGGTTC SEQ ID NO: 46 Primer 3plβ: CCGACCGTAACTATTCGATACG

11.4. Target sequences and controls.

[ 00369 ] Human genomic DNA extracted from the K562 cell line was used as negative control genomic DNA containing an unmethylated pi 6 gene promoter. Universal CpG methylated genomic DNA (Chemicon) was used as a control for a methylated pi 6 gene promoter. Genomic DNA was bisulphite modified overnight using the MethylEasy kit (Human Genetic Signatures), according to the manufacturer's instructions. Methylated DNA and unmethylated DNA were then serially diluted to yield samples containing varying proportions of DNA methylated at the pi 6 gene promoter namely; 100 %, 20 %, 4 %, 0.8 %, 0.16 % and 0.032 %. Nuclease-free dH20 was used in place of genomic DNA as a no-target control.

11.5. Reaction Components: Amplification and quantification of target sequence

[ 00370 ] Real time amplification and quantification of the target sequence was performed in a total reaction volume of 25 μl. All reactions were conducted on a

Stratagene MX3005p QPCR System. The cycling parameters were 95°C for 7 minutes, 10 cycles of 950C for 15 seconds and 560C for 30 seconds, and finally 50 cycles of 95°C for

15 seconds and 52°C for 30 seconds. The reactions contained 200 nM 5pl6 and 40 nM of

3ρl6, 200 nM pl6A5/3-P and 200 nM pl6B6/3-P, 200 nM SubBi-3-FB, 7.5 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 1 x rmmobuffer (Bioline), 1 unit of

Immolase (Bioline) and either 150 ng of bisulphite-modified genomic DNA (containing 100 %, 20 %, 4 %, 0.8 %, 0.16 % or 0.032 % methylated DNA) or dH2O only (no target control reaction). All reactions were performed in duplicate.

11.6. Results: Detection of methylation by an MNAzyme

[ 00371 ] The methylation-speciflc MNAzyme showed an increase in fluorescence over time when the target sample contained 100% down to 0.16 % methylated DNA (Table 12). In contrast, when the target sample contained 0.032 % and 0 % methylated DNA, the reaction showed a low level of fluorescence, similar to that seen in the no target control, and the fluorescence did not increase over time. As the percentage of methylated target decreased, the Ct of the reaction increased and a standard curve was plotted with an R value of 0.996. The experimental results are summarised in table 12 below.

Table 12. Use ofMNAzymes to detect ONA methylation in bisulphite modified genomic DNA samples.

Figure imgf000110_0001

[ 00372 ] The methylated pl6-specifϊc primers and MNAzyme were able to discriminate between a methylated and unmethylated target under the conditions used in this example. Further, the system allowed the detection of 0.16 % methylated target in a background of unmethylated target. 100% efficiency in a PCR reaction implies a doubling at each cycle. The observed efficiency in this experiment of 133% indicates that there is both target amplification (by PCR) and amplicon detection amplified by the catalytic activity of the MNAzyme. Example 12: MNAzymes that assemble from partzymes which have sensor arms that form hairpin structures.

[ 00373 ] The structure of partzymes, which are capable of assembling into active MNAzymes, is flexible. This example demonstrates additional structures which are compatible with MNAzyme activity.

12.1. Partzyme Oligonucleotides

[ 00374 ] Detection using MNAzymes can also be performed when the sensor arm region of partzyme A, or partzyme B, or both partzyme A and B, is followed by an arbitrary hairpin sequence. In the following experiments, the partzymes A and B were designed to target the sequence of a human microRNA, hsa-miR-143. The sequences of the partzyme A and partzyme B oligonucleotides are listed below from 5' to 3'. In the following sequences, the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target, bases in italics hybridize to the substrate and bases that are plain text form the hairpin.

SEQ ID NO: 142 Partzyme A2 miRl43 A2/1:

TGAGCTACAGTCGGTCGAAATAGTGAGT

SEQ ID NO: 143 Partzyme B3 miRl43 B3/1: CATCTCTTCTCCGAGCGCTTCATCTCA

SEQ ID NO: 144 Partzyme A2 miRl43 A2H/1:

GGCACTAACGTGCCTGAGCTACAGTCGGTCGAAATAGTGAGT

SEQ ID NO: 145 Partzyme B3 rαiRl43 B3H/1:

CATCTCTTCTCCGAGCGCTTCATCTCACGACGATAACGTCG 12.2. Reporter Substrate

[ 00375 ] MNAzyme activity was monitored by cleavage of a dual-labelled nucleic acid reporter substrate. The reporter substrate for this example was SubBi-1-FB with the sequence, 5' to 3', as written below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Changes in fluorescence due to cleavage of SubBi-1-FB at the deoxyribonucleotide between the FAM and BHQl were monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength).

SEQ ID NO: 6 SubBi-1-FB: ACTCACTATaGGAAGAGATG

12.3. Target

[ 00376 ] The target sequence for this example was a DNA oligonucleotide, D- 143Target, which has sequence homologous to the human microRNA, hsa-miR-143. The sequence of D-143Target was as follows, written 5' to 3'.

SEQ ID NO: 146 D-143Target : TGAGATGAAGCACTGTAGCTCA

12.4 Reaction Conditions

[ 00377 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. All reactions were conducted at 40°C in a SmartCycler® System thermocycler (Cepheid). Fluorescence for each reaction was read every seven seconds for a total of 10 minutes. All reactions in Table 13 contained the bulk mix consisting of 1 μM SubBi-1-FB, 10 mM Tris HCl (pH 9.0 at 25°C) and 25 raM MgCl2.

Table 13: Components of reactions for the detection of a nucleic acid target

Figure imgf000112_0001
[ 00378 ] Each reaction well on the SmartCycler® System thermocycler (Cepheid) used during the experiment was first tested for its background level of fluorescence, as this is known to vary between wells. This was measured by reading the fluorescence of the bulk mix alone. This value was then subtracted from all other reactions performed in each well to allow between well comparisons.

12.5. Results: Detection of cleavage ofSubBi-1-FB reporter substrate

[ 00379 ] The various combinations of designs of the partzymes A and B were all capable of being assembled into active MNAzymes. These cleaved the reporter substrate, as evidenced by an increase in fluorescence, only in the presence of the target sequence. In this example, the sensor arms of the partzymes had been extended with sequence that formed a hairpin. Reactions, which contained one partzyme with a hairpin (either partzyme A or partzyme B), or where both partzymes (A and B) contained hairpins, gave similar fluorescent signals as that seen when partzymes which lacked hairpins were used. No increase in signal was observed in any of the control reactions lacking target.

[ 00380 ] The design of partzymes containing hairpins provides a strategy suitable for detection of short sequences such as microRNA. The DNA oligonucleotide detected in this experiment was only 22 bases. This sequence was detected using partzymes, which either do, or do not, contain hairpins. The hairpin design provides a more stable structure and provides further flexibility in the design of partzymes known to be compatible with MNAzyme assembly and catalytic activity.

Example 13: Use of MNAzymes for the simultaneous quantification of four nucleic acid sequences via real time RTPCR 13.1. Partzyme Oligonucleotides for a quadruplex RTPCR assay

[ 00381 ] Multiple targets can be simultaneously amplified in real time using in vitro target amplification methods such as RTPCR. Further, the amplification of the targets can be simultaneously monitored in real time in one multiplexed reaction that comprises multiple unique MNAzymes. Each MNAzyme has sensor arms specific for one target and substrate arms specific for a unique member of a series of generic substrates, each one of which is labeled with a different fluorophore (Figure 18). In this example, MNAzymes were designed to detect four different targets, namely human BCR, RPLPO, β-actin and HPRT transcripts. It will be appreciated that any number of targets can be used in accordance with the method. The sequences of the partzymes A and B for each target are listed below from 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with 5 the target and bases in italics hybridize to the substrate.

SEQ ID NO: 51 Partzyme A4 BaA4/2-P:

AGATCAAGATCATTGCTCCACAACGAGAGGAaACCTT-P

SEQ ID NO: 52 Partzyme B5 BaB5/2-P: C TGCCCAGGGAGGCTAGCTTCCTGAGCGCAAGTACTC-P

SEQ ID NO: 29 Partzyme A4 RO5A4/3-P:

CAAACGAGTCCTGGCCTTGTCTACAACGAGGTTGTGCTG-P

SEQ ID NO: 30 Partzyme B5 RO5B5/3-P:

CGGTTGGTGAGGCTAGCTGTGGAGACGGATTACACCTTC-P s SEQ ID NO: 55 Partzyme A4 BCRA4/6-P:

AGTTCAAATCTGTACTGCACCACAACGAGAGGCGTGAT-P

SEQ ID NO: 56 Partzyme B5 BCRB5/6-P:

CTGGGAGGAAGGCTAGCTCTGGAGGTGGATTCCTTTGG-P

SEQ ID NO: 57 Partzyme A4 HPRTA4/7-P: Q ACTGAATAGAAATAGTGATAGATACAACGAGTGCCATGTTAA-P

SEQ ID NO: 58 Partzyme B5 HPRTB5/7-P:

TATCACAGCCAAGGCTAGCTCCATTCCTATGACTGTAGATT-P

13.2. Reporter Substrates 5 [ 00382 ] For this example, four different reporter substrates, each one labeled with a different fluorophore, were used. The sequences of the substrates are written 5' to 3' below. In the current example, SubBi-2 was end-labeled with a 6- JOE moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2- JB. Cleavage of SubBi-2-JB was monitored at 555 nm with excitation at 535 nm. SubBi-3 was end- 0 labeled with a Quasar 670 moiety at the 5' end and a BHQ2 moiety at the 3' end and was designated SubBi-3 -Q6B2. Cleavage of SubBi-3 -Q6B2 was monitored at 665 nm with excitation at 635 nm. SubBi-6 was end-labeled with Texas Red moiety at the 5' end and a

BHQ2 moiety at the 3' end and was designated SubBi-6-TRB2. Cleavage of SubBi-6- TRB2 was monitored at 610 nm with excitation at 585 nm. The fourth substrate, SubBi-7, was end-labeled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and 5 was designated SubBi-7-FB. Cleavage of SubBi-7-FB was monitored at 516 nm with excitation at 492 nm. The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO: 59 SubBi-2-JB: 10 AAGGTTTCCTCguCCCTGGGCA

SEQ ID NO: 60 SubBi-3-QβB2 :

CAGCACAACCguCACCAACCG SEQ ID NO: 61 SubBi-6-TRB2 :

ATCACGCCTCguTCCTCCCAG I5 SEQ ID NO: 62 SubBi-7-FB:

TTAACATGGCACguTGGCTGTGATA

13.3. Target sequences and PCR primers for amplification of the four ampHcons

[ 00383 ] Human total RNA extracted from K562 leukaemic cells was used as template 20 for in vitro amplification of all four of the target transcripts. The amplicons were generated by RTPCR using the oligonucleotide PCR primers listed below.

SEQ ID NO: 32 5' Primer 5RO5/1:

CATTCTATCATCAACGGGTA 2S SEQ ID NO: 33 3' Primer 3RO5/1:

CAAAGGCAGATGGATCAG SEQ ID NO: 63 5' Primer 5Bactin:

CATTGCCGACAGGATGCAGA SEQ ID NO: 64 3' Primer 3Bactin: GAGCCGCCGATCCACACG

SEQ ID NO: 65 5' Primer 5BCR14 :

CACTCAGCCACTGGATTTAA SEQ ID NO: 66 3' Primer 3BCR15/6: GCGCGTCTTTGCTTTATTC

SEQ ID NO: 67 5' Primer 5HPRT/5:

CTTTGCTGACCTGCTGGATTA SEQ ID NO: 68 3' Primer 3HPRT/8:

CCTGTTGACTGGTCATTACAA

13.4. Reaction Components: Amplification and quantification of target sequence

[ 00384 ] Real time amplification and quantification of the target sequences was performed in total reaction volume of 25 μL. All reactions were conducted on an Mx3005P™ QPCR System (Stratagene). The cycling parameters were, 50°C for 30 minutes, 950C for 7 minutes, 10 cycles of 95°C for 15 seconds and 650C for 30 seconds (with a 1°C decrease in temperature per cycle), and finally 40 cycles of 950C for 15 seconds and 540C for 30 seconds. The reactions contained 40 nM of each 5' primer and 200 nM of each 3 ' primer, 200 nM of each A partzyme and 200 nM of each B partzyme, 200 nM of each substrate, 10 niM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 20 units M-MLV RT (H-), 1 x Irnmobuffer (Bioline), 1.5 units of Immolase (Bioline) and either total RNA template (100 ng, 20 ng, 4 ng, 800 pg, 160 pg or 32 pg) or no target (dH2O).

Table 14: Components of reactions for the simultaneous detection of four different nucleic acid targets.

Figure imgf000117_0001

13.5. Results: Simultaneous amplification of four different target sequences and detection via cleavage of four different reporter substrates

[ 00385 ] The four MNAzymes used for the real time detection and quantification of β- actin, RPLPO, BCR, and HPRT transcripts showed an increase in fluorescence over time when the target sequence used was human total RNA amplified via RTPCR (Table 15). The fluorescence of the no-RNA target control for all four reactions was lower than that in the RNA target-containing reactions and did not increase during the reaction (Table 15). This demonstrates that the increase in fluorescence produced in target-containing reactions was due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate.

[ 00386 ] Standard curves were generated for all four targets by plotting the log of the RNA concentrations against the threshold cycle resulting in a linear plot. The threshold (Ct) of each standard is shown in Table 15. The Ct values shown in the table are an average of the results for duplicate reactions. The correlation coefficient (R2), slope and reaction efficiency for each target are also shown in Table 15. Table 15: Results of reactions for the simultaneous amplification and detection of four different nucleic acid targets

Figure imgf000118_0001

[ 00387 ] The MNAzyme RTPCR reaction in this example allowed simultaneous detection and generation of standard curves for the quantification of four targets in a single multiplex reaction which included four generic substrates. These generic substrates are suitable for monitoring other combinations of four targets in a single reaction.

Example 14: Use of MNAzymes for the simultaneous quantification of five nucleic acid sequences in a real time multiplex RTPCR.

14.1. Partzyme Oligonucleotides for quintuplex RTPCR assay

[ 00388 ] Multiple targets can be simultaneously amplified in real time using in vitro target amplification methods such as RTPCR. Further, the amplification of the targets can be simultaneously monitored in real time in one multiplexed reaction that comprises multiple unique MNAzymes. Each MNAzyme has sensor arms specific for one target and substrate arms specific for a unique member of a series of generic substrates, each one of which is labeled with a different fluorophore (Figure 18). In this example, MNAzymes were designed to detect five different targets, namely BCR, RPLPO exon 4, β-actin, RPLPO exon 5 and HPRT mRNA sequences. It will be appreciated that any number of targets can be used in accordance with the method. The sequences of the partzymes A and B are listed below from 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate.

SEQ ID NO: 69 Partzyme A4 BaA4/7-P: AGATCAAGATCATTGCTCCACAACGAGTGCCATGTTAA-P

SEQ ID NO: 70 Partzyme B5 BaB5/7-P:

TATCACAGCCAAGGCTAGCTTCCTGAGCGCAAGTACTC-P

SEQ ID NO: 71 Partzyme A4 RO5A4/4-P:

CAAACGAGTCCTGGCCTTGTCTACAACGAGTGCGCCATG-P SEQ ID NO: 72 Partzyme B5 RO5B5/4-P:

TACTTCTCCCAAGGCTAGCTGTGGAGACGGATTACACCTTC-P

SEQ ID NO: 55 Partzyme A4 BCRA4/6-P:

AGTTCAAATCTGTACTGCACCACAACGAGAGGCGTGAT-P

SEQ ID NO: 56 Partzyme B5 BCRB5/6-P: CTGGGAGGAAGGCTAGCTCTGGAGGTGGATTCCTTTGG-P

SEQ ID NO: 75 Partzyme A4 HPRTA4/2-P:

ACTGAATAGAAATAGTGATAGATACAACGAGAGGAAACCTT-P

SEQ ID NO: 76 Partzyme B5 HPRTB5/2-P:

TGCCCAGGGAGGCTAGCTCCATTCCTATGACTGTAGATT-P SEQ ID NO: 77 Partzyme A4 RO4A4/3-P:

GCTGGTCATCCAGCAGACAACGAGGTTGTGCTG-P

SEQ ID NO: 78 Partzyme B5 RO4B5/3-P

CGGTTGGTGAGGCTAGCTGTGTTCGACAATGGC-P

14.2. Reporter Substrates

[ 00389 ] For this example, five different reporter substrates were used, each of which was labeled with one of five different flurophores. The substrate sequences are written 5' to 3'. In the current example, SubBi-2 was end-labeled with a Alexa 350 moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-A350B. Cleavage of SubBi-2-A350B was monitored at 440 ran with excitation at 350 nm. SubBi-3 was end- labeled with a Quasar 670 moiety at the 5' end and a BHQ2 moiety at the 3' end and was designated SubBi-3-Q6B2. Cleavage of SubBi-3-Q6B2 was monitored at 665 ran with excitation at 635 nm. SubBi-6 was end-labeled with a Texas Red moiety at the 5' end and a BHQ2 moiety at the 3' end and was designated SubBi-6-TRB2. Cleavage of SubBi-6- TRB2 was monitored at 610 nm with excitation at 585 nm. SubBi-7 was end-labeled with

5 a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-7-FB. Cleavage of SubBi-7-FB was monitored at 516 nm with excitation at 492 nm. SubBi-4 was end-labeled with a 6- JOE moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-4-JB. Cleavage of SubBi-4- JB was monitored at 555 nm with excitation at 535 nm. The lower case bases represent RNA and the upper

I0 case bases represent DNA.

SEQ ID NO : 79 SubBi-2-A350B :

AAGGTTTCCTCguCCCTGGGCA SEQ ID NO : 60 SubBi-3 -Q6B2 : I5 CAGCACAACCguCACCAACCG

SEQ ID NO : 61 SubBi- 6-TRB2 :

ATCACGCCTCguTCCTCCCAG SEQ ID NO : 62 SubBi-7-FB :

TTAACATGGCACguTGGCTGTGATA 20 SEQ ID NO : 83 SubBi-4-JB :

CATGGCGCACguTGGGAGAAGTA

14.3. Target sequences and PCR primers for amplification of the five mRNA target sequences.

25 [ 00390 ] Human total RNA extracted from K562 cells was used as template for in vitro amplification of all five targets. The amplicons were generated by in vitro amplification using the oligonucleotide PCR primers listed below.

SEQ ID NO: 32 5' Primer 5RO5/1: 30 CATTCTATCATCAACGGGTA SEQ ID NO: 33 3' Primer 3RO5/1:

CAAAGGCAGATGGATCAG SEQ ID NO: 63 5' Primer 5Bactin:

CATTGCCGACAGGATGCAGA SEQ ID NO: 64 3' Primer 3Bactin:

GAGCCGCCGATCCACACG SEQ ID NO: 65 5' Primer 5BCR14 :

CACTCAGCCACTGGATTTAA SEQ ID NO: 66 3' Primer 3BCR15/6: GCGCGTCTTTGCTTTATTC

SEQ ID NO: 67 5' Primer 5HPRT/5:

CTTTGCTGACCTGCTGGATTA SEQ ID NO: 68 3' Primer 3HPRT/8:

CCTGTTGACTGGTCATTACAA SEQ ID NO: 84 5' Primer 5R04/3:

CAAGACTGGAGACAAAGTG SEQ ID NO: 85 3' Primer 3R04/2:

GCAGAGTTTCCTCTGTGATA

14.4. Reaction Components: Amplification and quantification of target sequence

[ 00391 ] Real time amplification and quantification of the target sequences was performed in a total reaction volume of 25 μL. AU reactions were conducted on a Mx3005P™ QPCR System (Stratagene). The cycling parameters were, 50°C for 30 minutes, 95°C for 7 minutes, 10 cycles of 95°C for 15 seconds and 65°C for 30 seconds (with a I0C decrease in temperature per cycle), and finally 40 cycles of 950C for 15 seconds and 54°C for 30 seconds. The reactions contained 40 nM of 5Bactin, 5BCR14, 5HPRT/5 and 80 nM 5RO4/3, 5RO5/1 and 200 nM 3Bactin, 3BCR15/6, 3HPRT/8 and 400 nM 3RO4/2 and 3RO5/1. There was 200 nM of each A partzyme and B partzyme for βactin, BCR, RPLPO exon 4 and HPRT and 400 nM of each A partzyme and B partzyme for RPLPO exon 5. There was 200 nM of SubBi-2-A350B, SubBi-3-Q6B2, SubBi-6-

TRB2 and SubBi-7-FB, and 400 nM of SubBi-4-JB. Also there was 10 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 20 units M-MLV RT (H-) (Promega), 1 x Immobuffer (Bioline), 2 units of Immolase (Bioline) and 5 μl of either total RNA template (100ng, 20 ng, 4 ng, 800 pg, or 160 pg) or no target (dH2O).

Table 16: Components of reactions for the simultaneous detection of five different nucleic acid targets

Figure imgf000122_0001

14.5. Results: Simultaneous amplification of five different target sequences and detection via cleavage of five different reporter substrates

[ 00392 ] The five MNAzymes used for the real time detection and quantification of RNA sequences within RPLPO exon 4, BCR, β-actin, RPLPO exon 5 and HPRT showed an increase in fluorescence over time when the target sequence used was human total RNA amplified by RTPCR (Table 17). The fluorescence of the no-RNA target control for all five reactions was lower than that in the RNA target-containing reactions and did not increase during the reaction (Table 17). This demonstrates that the increase in fluorescence produced in target-containing reactions was due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. [ 00393 ] Standard curves were generated for all five targets by plotting the log of the

RNA concentrations against the threshold cycle, resulting in a linear plot. The threshold (Ct) of each standard is shown in Table 17. The Ct values are the average of the duplicate reactions. The correlation coefficient (R2), slope and reaction efficiency for each target are also shown in Table 17.

Table 17: Results of reactions for the simultaneous amplification and detection of five different nucleic acid targets

Figure imgf000123_0001

[ 00394 ] The MNAzyme RTPCR reaction in this example allowed simultaneous detection and generation of standard curves for the quantification of five targets in a single multiplex reaction which included five generic substrates. These generic substrates are suitable for monitoring other combinations of five targets in a single reaction.

Example 15: Use of MNAzymes for the quantification ofrihosomal 16S in bacteria

[ 00395 ] To replace the bacterial test of a Gram stain, MNAzymes can be used for a rapid release test for sterility and/or mycoplasma contamination based on conserved nucleic acid sequences found in bacterial species. MNAzymes can be used to monitor amplification of target bacterial nucleic acids in real time using in vitro target amplification methods such as RTPCR. In this example, a conserved region found in bacterial ribosomal 16S sequence is used, wherein reverse transcription, PCR amplification and MNAzyme-mediated detection occur simultaneously in the one tube. [ 00396 ] A system was designed to target a region of the ribosomal 16S sequence which is common to several bacterial species including Staphylococcus capitis, Staphylococcus epidermidis, Staphylococcus warneri, Staphylococcus aureus, Bacillus subtilis, Streptococcus pyogenes, Clostridium sporogenes, Acinetobacter woffii, Propionibacterium acnes, Pseudomonas aeruginosa and Pseudomonas fluorescens.

15.1. Partzyme Oligonucleotides

[ 00397 ] Partzyme oligonucleotides A and B used design 7 with sensor arms complementary to a conserved region amongst bacterial species. The partzyme oligonucleotides are listed below with the "-P" indicating 3' phosphorylation of the oligonucleotide. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate

SEQ ID NO: 86 Partzyme A5 16S1A5/2-P:

GGTTGTCGTCAGCTCGTGTACAACGAGAGGAaACCTT-P

SEQ ID NO: 87 Partzyme B6 16S1B6/2-P:

TGCCCAGGGAGGCTAGCTCGTGAGATGTTGGGTTAAG-P

15.2. Reporter Substrate

[ 00398 ] The reporter substrate for this example is SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end-labeled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 516 nm (FAM emission wavelength) with excitation at 492 nm (FAM excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 21 SubBi-2 -FB : AAGGTTTCCTCguCCCTGGGCA 15.3. PCR primers for amplification of ribosomal 16S in bacteria

[ 00399 ] The target sequence for this example was generated by in vitro amplification of Bacillus Subtilis using the oligonucleotide PCR primers listed below.

SEQ ID NO: 88 5' Primer 516S1-1:

TGGTGCATGGTTGTCGTC

SEQ ID NO: 89 3' Primer 316S1-1: TTGCGCTCGTTGCGGGA

15.4. Target sequence and control

[ 00400 ] Bacterial ribosomal RNA was extracted from Bacillus Subtilis cells and was used as template for amplification of the 16S region. Nuclease free dH2θ was used in place of RNA as a no target control.

15.5. Reaction Components: Amplification and quantification of target sequence

[ 00401 ] Real time amplification and quantification of the target sequence was performed in a total reaction volume of 25 μL. All reactions were conducted on a Mx3005p QPCR system (Stratagene). The cycling parameters were, 50° C for 30 minutes, 95° C for 7 minutes, 10 cycles of 95° C for 15 seconds and 65° C for 30 seconds (with a 1° C decrease in temperature per cycle), and finally 40 cycles of 95° C for 5 seconds and 55° C for 30 seconds. The reactions contained 40 nM 516S1-1 and 200 nM of 316S1-1, 200 nM 16S1A5/2-P and 200 nM 16S1B672-P, 200 nM SubBi-2-FB, 7.5 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 1 x Immobuffer (Bioline), 1 unit of Immolase (Bioline) and either RNA template (500 ng, 50 ng, 5 ng or 500 pg) or no target CdH2O).

15.6. Results: Amplification of target and cleavage of SubBi-2-FB reporter substrate

[ 00402 ] The MNAzyme for the real time detection and quantification of bacterial ribosomal 16S, showed an increase in fluorescence over time when the target sequence used was bacterial RNA amplified by RTPCR. The fluorescence of the no-template control was lower than that in the RNA containing reactions and did not increase during the reaction. This demonstrates that the increase in fluorescence produced in target- containing reactions is due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. A standard curve was generated by plotting the log of the RNA concentrations against the threshold cycle resulting in a linear plot with a correlation coefficient of 0.992.

Table 18: Results of reactions for the amplification and detection of bacterial ribosomal

16S amplicons

Figure imgf000126_0001

[ 00403 ] This example demonstrates the ability of MNAzymes to detect and quantify amplicons generated by RTPCR amplification of bacterial ribosomal 16S RNA. The MNAzymes used in this example target a region of bacterial 16S which is 100% conserved between Staphylococcus capitis, Staphylococcus epidermidis, Staphylococcus warneri, Staphylococcus aureus, Bacillus subtilis, Streptococcus pyogenes, Clostridium sporogenes, Acinetobacter woffii, Propionibacterium acnes, Pseudomonas aeruginosa and Pseudomonas fluorescens. As such a single MNAzyme and reporter substrate could be used to screen a sample for the presence of any of the above bacteria. Detection of a signal (eg FAM) would be indicative of the presence of one or more of these bacterial species in the sample.

Example 16: Use of MNAzymes for the detection and quantification of viral RNA via single-tube RT-PCR

[ 00404 ] MNAzymes can be used to monitor amplification of target nucleic acids in real time using in vitro target amplification methods such as RTPCR. Further, real time monitoring allows the amount of target initially present in the reaction to be quantified. This example illustrates the use of MNAzyme for the detection and quantification of HIV viral RNA. Reverse transcription, PCR amplification and MNAzyme detection were performed in a one-tube reaction.

16.1. Partzyme Oligonucleotidse [ 00405 ] Partzymes were designed to specifically target the Nef gene of HIV-I. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The "-P" indicates 3' phosphorylation of the oligonucleotide.

SEQ ID NO: 90 Partzyme A4 NefA4/6-P:

GAAGAGGCCAATAAAGGAGAGACAACGAGAGGCGTGAT-P

SEQ ID NO: 91 Partzyme B5 NefB5/6-P:

CTGGGAGGA2IGGCTAGCTAACACCAGCTTGTTACACC- P

16.2. Reporter Substrate

[ 00406 ] The reporter substrate for this example is SubBi-6 with the sequence, 5' to 3', as below. In the current example, SubBi-6 was end-labelled with a Texas Red moiety at the 5' end and a BHQ2 moiety at the 3' end and was designated SubBi-6-TRB2. Cleavage of SubBi-6-TRB2 was monitored at 610 nm (Texas Red emission wavelength) with excitation at 585 nm (Texas Red excitation wavelength). In the following sequence the lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO: 61 SubBi-6-TRB2 : ATCACGCCTCguTCCTCCCAG

16.3. Target sequences

[ 00407 ] The standard curve in this experiment was generated by RTPCR amplification of HIV-I viral RNA. A QIAGEN Ultrasens Virus Kit HIV-I was used to isolate viral RNA from medium collected from human CEMT4 cells infected with HIV-I. Nuclease- free (NF) water was used in place of viral RNA as a no target control. 16.4. PCR primers for amplification of the HIV-I Nef transcripts.

[ 00408 ] The following primers were used for amplification of HIV-I Nef transcripts. The 3 ' primer, Nef/3PCR, was used for reverse transcription and then this primer and the s 5 ' primer Nef/5PCR facilitated PCR amplification.

SEQ ID NO: 92 Primer Nef/3PCR:

CAGGGTCATCCATTCCATGCAG SEQ ID NO: 93 Primer Nef/5PCR: 0 GCTAGTACCAGTTGAGCCAG

16.5. Reaction Components: Amplification and quantification of target sequence

[ 00409 ] Real time amplification and quantification of the target sequence was performed in a total reaction volume of 25 μL. All reactions were conducted on an s Mx3005p QPCR System (Stratagene). The cycling parameters were, 50° C for 30 minutes, 95° C for 7 minutes, 10 cycles of 95° C for 15 seconds and 65° C for 30 seconds (with a 1° C decrease in temperature per cycle), and finally 50 cycles of 95° C for 15 seconds and 55° C for 30 seconds. The reactions contained 200 nM of the 3' primer Nef/3PCR and 40 nM of the 5' primer Nef/5PCR, 20OnM of partzyme NefA4/6-P and 0 20OnM of partzyme NefB5/6-P, 200 nM SubBi-6-TRB2, 10 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 1 x Immobuffer (Bioline), 0.5 unit of Immolase (Bioline), 10 units MMLV RT (H-) and 5 μL of either total RNA template (containing 45,000 pg, 4,500 pg, 450 pg, 45 pg, 4.5 pg, or 0.45 pg) or no target (water only).

S 16.6. Results: Amplification of target and cleavage of SubBi-6-TRB2 reporter substrate

[ 00410 ] The MNAzyme for the real time detection and quantification of HIV-I Nef transcripts showed an increase in fluorescence over time when the target sequence used was HΓV-1 viral RNA amplified via RTPCR. There was no increase in signal for the control reaction lacking target (water only). This demonstrates that the increase in 0 fluorescence produced in target containing reactions was due to target dependent assembly of catalytically active MNAzymes that then cleaved the reporter substrate. [ 00411 ] A standard curve was generated by plotting the log of the quantity of RNA template in each reaction against the threshold cycle (Ct) resulting in a linear plot. The Ct of each standard, together with the correlation coefficient (R2), slope and reaction efficiency are shown in Table 19.

Table 19: Results of the amplification and detection of HIV Nef transcripts

Figure imgf000129_0001

[ 00412 ] This example demonstrates the capacity of MNAzymes to be used for detection and quantification of viral sequences, including HIV-I. Q

Example 17: Sequence requirements of the catalytic activity of MNAzymes. 17.1. Partzyme Oligonucleotides

[ 00413 ] The catalytic core of the 10:23 DNAzyme as originally discovered comprises 15 nucleotides (Santoro & Joyce, 1997). Later studies of the critical bases within the 5 catalytic core have shown that certain specific base substitutions significantly decrease catalytic activity, while others are well tolerated (Zaborowska et at).

[ 00414 ] In this example, a series of partzymes were designed and tested to investigate tolerance of the MNAzyme catalytic core to sequence variation within the partial cores of the two partzymes. The unmodified partzymes A and B for the MNAzyme detecting the Q human RPLPO gene were used as the control and were compared to various mutated partzyme sequences wherein a single base substitution had been made in the partial catalytic core region. Partzyme oligonucleotides used to detect the target were based on design 7 (see Example 20) and are listed below, 5' to 3'. hi the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, the bases 5 which are underlined, italicized and bold are mutated compared to control (unmutated) partial core sequences, the bases in bold hybridize with the target and the bases in italics hybridize to the substrate.

SEQ ID NO: 94 partzyme A5 RO4A5/2: 5 GGGCTGGTCATCCAGCAGTACAACGAGAGGAAACCTT

SEQ ID NO: 95 partzyme A5 RO4A5/2-G14A:

GGGCTGGTCATCCAGCAGTACAACAAGAGGAAACCTT

SEQ ID NO: 96 partzyme A5 RO4A5/2-A9T:

GGGCTGGTCATCCAGCAGTTCAACGAGAGGAAACCTT io SEQ ID NO: 97 partzyme A5 RO4A5/2-A12T:

GGGCTGGTCATCCAGCAGTACATCGAGAGGAAACCTT1

SEQ ID NO: 98 partzyme A5 RO4A5/2-A11T:

GGGCTGGTCATCCAGCAGTACTACGAGAGGAAACCTT

SEQ ID NO: 99 partzyme B6 RO4B6/2: I5 TGCCCAGGGAGGCTAGCGTGTTCGACAATGGCAGCA

SEQ ID NO: 100 partzyme B6 RO4B6/2-C7A: TGCCCAGGGAGGCTAGAGTGTTCGACAATGGCAGCA

SEQ ID NO: 101 partzyme Bβ RO4B6/2-T4C: TGCCCAGGGAGGCCAGCGTGTTCGACAATGGCAGCA

20

17.2. Reporter Substrate

[ 00415 ] The reporter substrate for this example is SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end-labelled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. Cleavage of 25 SubBi-2-FB was monitored at 530 nm (FAM emission wavelength) with excitation at 485 nm (FAM excitation wavelength). In the following sequence the lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 21 SubBi-2-FB : 30 AAGGTTTCCTCguCCCTGGGCA 17.3. Target sequence

[ 00416 ] A synthetic DNA oligonucleotide was used as the target template in this experiment. The sequence of the target is shown below, 5' to 3'.

SEQ ID NO: 102 RO4/2Target:

ATGCTGCCATTGTCGAACACCTGCTGGATGACCAGCCCAA

17.4. Reaction conditions [ 00417 ] Analysis of the catalytic activity of various partzyme pairs was performed using a SmartCycler System thermocycler (Cepheid). Reactions were initiated by the addition of substrate and the total volume of all reactions was 25 μL. Each reaction contained 1 x PCR Buffer II (Applied Biosystems), 10 mM MgCl2, 0.2 μM of SubBi- 2FB, 2 μM of RO4/2Target and a pair of A and B partzymes each at 2 μM. The partzyme pairs in each reaction were as in Table 20 below.

Table 20: Components of reactions for detection of a nucleic acid target

Figure imgf000131_0001

[ 00418 ] Reactions were incubated at 54°C for 20 minutes and fluorescent data was collected at 12 second intervals. Since the starting fluorescence can vary for individual wells on the SmartCycler System thermocycler, the initial fluorescence value was subtracted from the fluorescence at each time point for each reaction to allow comparison between reactions in different wells. The averages of replicate reactions, containing either a mutated partzyme A or a mutated partzyme B, were then expressed as a percentage of the fluorescence for control replicates.

17.5. Results: Detection of cleavage ofSubBi-2-FB reporter substrate.

[ 00419 ] Cleavage of the substrate by the various partzyme pairs was measured by the change in fluorescence over time. The normalized fluorescent values for each reaction were then expressed as a percentage of the fluorescence observed in control reactions at the equivalent time point (Table 21).

Table 21: Cleavage activity of various partzyme sequence variants (* this example) and comparison to the activity of variant 10:23 DNAzymes (** Zaborowska).

Figure imgf000132_0001

[ 00420 ] The experiment shows that various substitutions within the partial catalytic core of either partzyme A or B were compatible with active MNAzyme formation. In contrast other substitutions were not well tolerated and produced structures with little or no catalytic activity. When results obtained using MNAzymes were compared with those reported for the equivalent substitution within the 10:23 DNAzyme catalytic core (Zaborowska et al), a similar pattern was observed (Table 21) above. For example, substitution of A for G at position 14 (G14A) within partzyme A5 or within the 10:23 core, resulted in > 90% loss of cleavage activity. In contrast, substitution of T for A at position 12 (A12T) within partzyme A, or within the 10:23 core, resulted in molecules which retained approximately 80% cleavage activity compared to the control sequences.

[ 00421 ] As such, information in the literature about other sequence substitutions, which are compatible with DNAzyme activity (for example 10:23 DNAzyme or 8:17 DNAzymes), could predict the catalytic activity expected when the same sequence variation is introduced into one of the partzymes. Further, one skilled in the art could use empirical testing to identify additional partzyme partial catalytic core sequence variants, which are compatible with active MNAzyme formation.

Example 18: Application of MNAzymes to detect targets including small molecules such as adenosine 5 '-triphosphate

[ 00422 ] Aptamers are single-stranded DNA or RNA molecules evolved in vitro from large pools of random-sequence oligonucleotides for their capacity to bind targets with high affinity and specificity. Aptamers have been selected for their ability to specifically bind to many types of targets including proteins, carbohydrates, lipids, nucleotides, whole cells and viruses. In this example, an aptamer sequence was incorporated at the end of a partzyme (apta-partzyme) in a configuration whereby an active MNAzyme was only formed in the presence of the target. There are several ways of achieving this goal, including the strategies outlined in Figure 4 and the strategy used in the following example which is illustrated in Figure 20.

[ 00423 ] The nucleic acid oligonucleotides required for the MNAzyme detection strategy illustrated in Figure 20 include; a standard partzyme; a) an apta-partzyme which is a partzyme with an aptamer incorporated into one of its ends; b) an assembly facilitator which is an oligonucleotide which binds to both the apta-partzyme and the partzyme enabling assembly of an active MNAzyme; c) a reporter probe substrate; and d) an inhibitor oligonucleotide which hybridises to the apta-partzyme in a region which spans at least part of the aptamer sequence and part of the substrate binding arm of the partzyme sequence. [ 00424 ] In the absence of a target that binds to the aptamer (left hand panel Figure 20), the inhibitor oligonucleotide binds to the apta-partzyme thus blocking binding (and cleavage) of the reporter probe substrate. In the presence of a target that binds to the aptamer (right hand panel Figure 20), the target binds to the aptamer sequence of the apta- partzyme, preventing the binding of the inhibitor oligonucleotide and allowing binding and cleavage of the reporter probe substrate. As such, MNAzymes can only form and cause fluorescent signal generation in the presence of target.

[ 00425 ] The strategy was demonstrated using detection of a small molecule, ATP. The 27 nucleotide long aptamer sequence used in this example has been previously reported as being highly specific for binding of ATP and dATP (Achenbach, 2005; Huizenga and Szostak, 1995).

18.1. Partzyme oligonucleotides, assembly and inhibitory oligonucleotides

[ 00426 ] In this example the ATP aptamer sequence was placed adjacent to the substrate arm of apta-partzyme A (Figure 20). The sensor arms of apta-partzyme A and partzyme B were designed to bind an assembly facilitator. The sequences of apta- partzyme AtpA2/l and partzyme Atp B3/1 (Figure 21) are shown below (5' to 3')- In the following sequences the bases in bold hybridize with the assembly facilitator, based underlined form part of the catalytic core of the assembled MNAzyme, and bases in italics hybridize to the substrate. In addition, bases in plain text in partzyme AtpA2/l indicate DNA aptamer sequences that bind to ATP or dATP.

SEQ ID NO: 103 Apta-Partzyme A2 AtpA2/l:

AACGTACACTGCACGCGGTCGAAATAGΓGAGΓACCTGGGGGAGTATTGCGGA

GGAAGGT SEQ ID NO: 104 Partzyme B3 AtpB3/l: CATCTCTTCTCCGAGCGTCTGTACCGTGTAC [ 00427 ] The sequence of the assembly facilitator is shown below (5' to 3 ')•"

SEQ ID NO: 105 Assembly facilitator AtpC/1: GTACACGGTACAGACCGTGCAGTGTACGTT

[ 00428 ] The sequence of the inhibitor oligonucleotide is shown below (5' to 3 ').

SEQ ID NO: 106 Inhibitor AtpR/1 : CCAGGTACTCACTATTT

18.2. Reporter substrate

[ 00429 ] MNAzyme activity was monitored by cleavage of a dual-labelled nucleic acid reporter substrate. The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Changes in fluorescence due to cleavage of SubBi-1-FB at the ribonucleotide between the FAM and BHQl were monitored at 520 run (FAM emission wavelength) with excitation at 490 nm (FAM excitation wavelength).

SEQ ID NO : 6 SubBi- 1-FB :

ACTCACTATaGGAAGAGATG

18.3. Targets

[ 00430 ] The target molecules for this example were adenosine 5 '-triphosphate (ATP) and deoxyadenosine 5 '-triphosphate (dATP). Guanosine 5 '-triphosphate (GTP) and cytosine 5 '-triphosphate (CTP) were used as negative controls. All molecules were purchased from Bioline. Nuclease-free water was used as a no target control. 18.4. Reaction Conditions

[ 00431 ] Detection of the target was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 50 μL. Prior to substrate injection, all reactions were pre-incubated at 60 °C for 5 minutes (to reduce secondary structure). Reactions were conducted at 47 0C on a FLUOstar OPTIMA (BMG Biotech). Fluorescence for each reaction was read every 3 seconds for a total of 10 minutes. Each reaction contained a final concentration of 200 nM AtpA2/l, 200 nM AtpB3/l, 200 nM AtpC/1, 200 nM AtpR/1, 200 nM SubBi-1-FB, 25 mM MgCl2, 50 mM Tris HCl pH 7.5 and 2 mM of either ATP, dATP, GTP, CTP or no target (water).

18.5. Results : Detection and cleavage of SubBi-1-FB reporter substrate

[ 00432 ] In the absence of ATP or dATP a low level of fluorescence was seen which did not increase over time, demonstrating that the inhibitor oligonucleotide was able to prevent the assembly of an active MNAzyme (Figure 21). In the presence of ATP or dATP, the fluorescent signal was higher and it increased over time. This indicates that the inhibitor oligonucleotide was displaced by dATP and ATP and an active MNAzyme was formed. Assembly of the MNAzyme was target-dependent as the fluorescent signal in the presence of GTP and CTP was the same as in the absence of ATP or dATP i.e. in the no analyte water control. This example demonstrates that MNAzymes can be coupled to aptamers for the detection of targets which include both nucleic acid and non-nucleic acid targets, in an approach that is highly specific for the target.

[ 00433 ] One skilled in the art will recognise that the design of this strategy can be flexible. The aptamer can be incorporated into either end (5' or 3') of either of the two partzymes containing partial catalytic core sequences. As such, the inhibitor oligonucleotide can bind to the aptamer region and to either the substrate arm (that binds the reporter substrate) or the sensor arm (that binds the assembly facilitator). In the former design (Figure 20; this example), the inhibitor blocks binding of the reporter substrate. In the latter design, the inhibitor would prevent binding of the assembly facilitator with the partzymes and therefore would prevent active MNAzyme formation.

[ 00434 ] The literature contains sequences for a large number of aptamers capable of detecting many types of targets. These include proteins, carbohydrates, lipids, prions, nucleotides, whole cells and viruses. Aptamers to all these types of targets could be linked to partzymes to detect a very diverse range of molecules. Reaction conditions (buffer, temperature, divalent cation concentration etc), which are compatible with both binding of targets to aptamers (or apta-partzymes) and cleavage of a reporter substrate by

5 an MNAzyme, can be determined by empirical testing. Further, since aptamers are evolved in vitro under reaction conditions selected by the investigator it would possible to tailor molecular evolution to allow development of aptamers to any desired target that will bind under conditions compatible with MNAzyme cleavage. As MNAzymes are active over a very broad range of conditions, one skilled in the art could easily determine o conditions compatible with MNAzyme cleavage.

Example 19: Use of MNAzymes for detection of single base mismatches

[ 00435 ] MNAzymes can be used to detect and quantify target nucleic acids in real time using in vitro target amplification methods such as PCR. MNAzymes can also be s used to generate qualitative results, for example by detecting changes in nucleic acid sequences. MNAzyme-mediated target detection can occur via Watson-Crick base recognition of the sensor arms and the target sequence. In this example, MNAzymes are used to detect a single base mismatch by exploiting this requirement for complementarity between the partzyme sensor arm and the target nucleic acid sequence. 0

19.1. Partzyme Oligonucleotides

[ 00436 ] Partzyme oligonucleotides were designed to be either fully complementary to the target sequence, or mismatched with respect to the target sequence (Figure 22(i)). The sequences of the fully matched partzyme A (RO5A5/2(22)-P), the fully matched S partzyme B (RO5B6/2(1 IG)-P) and the mismatched partzyme B (RO5B6/2(1 IC)-P) are listed below (5' to 3'). In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. The mismatched base in partzyme RO5B6/2(1 IC)-P is bold and underlined. The "-P" indicates 3' phosphorylation of the 0 oligonucleotide.

SEQ ID NO: 107 Partzyme A5 RO5A5/2 (22) -P: CAAACGAGTCCTGGCCTTGTCTTACAACGAGAGGAAACCTΓ-P

SEQ ID NO: 108 Partzyme B6 RO5B6/2 (llG) -P:

TGCCCAGGGAGGCTAGCGTGGAGACGGA-P SEQ ID NO: 109 Partzyme B6 RO5B6/2 (HC) -P: i TGCCCAGGGAGGCTAGCGTCGAGACGGA-P

19.2. Reporter substrate

[ 00437 ] The reporter substrate used in this example was SubBi-2. In the current example, SubBi-2 was end labeled with a 6-FAM moiety at the 5' end, a BHQl moiety at io the 3' end and designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 530 nm (FAM emission wavelength) with excitation at 485 nm (FAM excitation wavelength). The sequence of SubBi-2-FB is listed below (5' to 3'); the lower case bases represent RNA and the upper case bases represent DNA.

I5 SEQ ID NO : 21 SubBi -2 -FB :

AAGGTTTCCTCguCCCTGGGCA

19.3. PCR primers for amplification of RPLPO exon 5

[ 00438 ] The target sequence for this example was generated by in vitro amplification 20 of human genomic DNA using the oligonucleotide PCR primers listed below (5' to 3 ')•

SEQ ID NO: 32 Primer 5RO5/1:

CATTCTATCATCAACGGGTA SEQ ID NO: 110 Primer 3RO5/2: 25 AGCAGCCACAAAGGCAGA

19.4. Target sequences and controls [ 00439 ] Human genomic DNA extracted from the human K562 cell line was used as template for amplification of the RPLPO gene. Nuclease-free (NF) water was used in place of genomic DNA as a no target control.

19.5. Reaction Components: Amplification and detection of target sequence

[ 00440 ] Real time amplification and detection of the target sequence was performed in a total reaction volume of 25 μl. All reactions were conducted on an ABI 7700 thermocycler (Applied Biosystems). The cycling parameters were 95° C for 7 minutes, 10 cycles of 95° C for 15 seconds and 65° C for 30 seconds (with a I0C decrease in temperature per cycle), and finally 50 cycles of 95° C for 15 seconds and 47° C for 30 seconds. The reactions contained 40 nM 5RO5/1, 200 nM of 3RO5/2, 200 nM RO5A5/2(22)-P and 200 nM RO5B6/2(1 IG)-P or 200 nM RO5B6/2(1 IC)-P, 200 nM SubBi-2-FB, 10 mM MgCl2, 200 μM of each dNTP, 10 units Rnasin (Promega), 1 x ROX reference (Invitrogen), 1 x Immobuffer (Bioline), 1 unit of Immolase (Bioline) and either 100 ng genomic DNA template or NF-water.

19.6. Results: Single base mismatch detection using an MNAzyme

[ 00441 ] The MNAzyme comprising the fully matched sensor arm B showed an increase in fluorescence over time when the target sequence used was human genomic DNA amplified via PCR (Figure 22(ii)). In contrast, the MNAzyme containing the mismatched sensor arm B showed a low level of fluorescence with the genomic target, similar to that seen in the no target control, and the fluorescence did not increase over time. Thus, the single mismatch, three bases from the partzyme A and B junction was sufficient to prevent the formation of the active MNAzyme. [ 00442 ] This example demonstrates that MNAzymes can be used to detect single base mismatches between the target and sensor arms. Since MNAzymes are capable of detecting alterations as small as single base changes, it would be obvious to one skilled in the art that MNAzymes could also be used to discriminate sequence differing by small deletions or small insertions. Li addition, larger alterations such as translocations associated with various cancer types, which result in fusion transcripts, could also be detected. These occur frequently in association with leukaemia, for example PML/RARa fusion transcripts are associated with acute promyelocyte leukaemia and bcr/abl fusion transcripts are associated with chronic granulocytic leukaemia.

[ 00443 ] While this example shows that single mismatches can be sufficient to prevent assembly of active MNAzyme, additional experiments demonstrated that not all single s base mismatches completely disrupt MNAzyme assembly under all conditions. The capacity to discriminate single base mismatches depends on several factors including a) the stringency of the reaction conditions, which can be influenced by many factors including temperature, salt concentration, cation concentration, b) the type of mismatch, for example G/T mismatches versus C/C, c) the position of the mismatch within the o partzyme aπn, and d) the length of the partyzyme arm.

[ 00444 ] Additional strategies can be used to increase the capacity of the MNAzyme to detectable single base polymorphisms. These include, for example, use of a truncated partzyme sensor arm as demonstrated in example 22.

s Example 20: Testing MNAzyme activity from a series of partzyme pairs which contain variant partial catalytic core sequences derived from the 10:23 catalytic core

[ 00445 ] Multi-component nucleic acid enzymes (MNAzymes) can be made which incorporate partial sequences from a variety of in vitro evolved DNAzymes. Active MNAzymes, based on partial sequences from the 8:17 and 10:23 DNAzymes, have been 0 demonstrated. Further, several alternative partzyme designs based on the 8:17 and 10:23 DNAzymes have been shown to either have (Examples 1, 3, Figures 9, 10 and 13), or lack (Example 1, Figure 8), activity. This example further extends these studies and identifies both active and inactive partzyme sequences based on partial catalytic core sequences from the 10:23 DNAzyme. Further, the example provides a general protocol for the steps 5 necessary to identify the optimal place(s) to split a catalytic core sequence such that, when the partial catalytic core sequences are incorporated into partzymes, functional active MNAzymes are generated.

20.1. Partzyme Oligonucleotides 0 The method in this example was used to investigate which positions within the 10:23 catalytic core sequence are suitable for splitting into partial catalytic core sequences which, upon incorporation into partzymes, result in functionally active MNAzymes. The 10:23 sequence was split at various points and then the two partial sequences were incorporated into a series of partzyme pairs which were designed to cleave a substrate in the presence of target (human RPLPO gene). The partial catalytic cores for each partzyme pair which were tested are shown in Table 22 with reference to the complete catalytic core sequence of the 10:23 DNAzyme (Santoro and Joyce, 1997).

Table 22: Bases and position in the 10:23 DNAzyme and in a series of variant partzyme pairs where the bases at positions 1 to 15 of the core have been distributed differently between two partzymes A and B.

Figure imgf000142_0001

All sequences are written 5' to 3'. The MNAzyme design and partzyme nomenclature is continued from the series in Table 3 and extended in this table to identify the location of the split within the core. For example, Design 6 is a 10:23 derived MNAzyme with partzyme A4 and partzyme B5 design (A4:B5), where the core has been split between T at position 8 and A at position 9 (T8-A9). [ 00446 ] In this experiment the series of partzyme pairs were all synthesized with sensor arms designed to hybridise to exon 5 of the human RPLPO gene, and with substrate arms directed against the substrate, SubBi-2. The partzyme pairs used in this experiment were synthesized by Sigma-Proligo and their sequences are listed below (5' to 3'). The bases underlined form part of the catalytic core of the assembled MNAzyrne, bases in bold hybridise with the nucleic acid target and bases in italics hybridise to the substrate. The "-P" indicates 3' phosphorylation of the oligonucleotide.

RPLPOPartzvmePairA4:B5SEO ID NO: 147 RO5A4/2-P CAAACGAGTCCTGGCCTTGTCTACAACGAGAGGAAACCTT -P

SEQ ID NO: 112 RO5B5 (16) /2-P

TGCCCAGGGAGGCTAGCTGTGGAGACGGATTACA -P

RPLPO Partzvme Pair A5:B6

SEQ ID NO: 107 RO5A5/2 (22 ) -P

CAAACGAGTCCTGGCCTTGTCTTACAACGAGAGGAAACCTT -P SEQ ID NO: 114 RO5B6 (16 ) /2-P

TGCCCAGGGAGGCTAGCGTGGAGACGGATTACA -P

RPLPOPartzvmePairA6:B7

SEQ ID NO: 115 RO5A6 (22 ) /2-P

CAAACGAGTCCTGGCCTTGTCTACGAGAGGAAACCTT -P SEQ ID NO: 116 RO5B7 (16) /2-P

TGCCCAGGGAGGCTAGCTACAGTGGAGACGGATTACA -P

RPLPO Partzvme Pair A7:B8 SEQ ID NO: 117 RO5A7 (22) /2-P

CAAACGAGTCCTGGCCTTGTCTCAACGAGAGGAAACCTT -P SEQ ID NO: 118 RO5B8 (16) /2-P

TGCCCAGGGAGGCTAGCTAGTGGAGACGGATTACA -P

RPLPO Partzvme Pair A8:B9

SEQ ID NO: 119 RO5A8 (22 ) /2-P

CAAACGAGTCCTGGCCTTGTCTCTACAACGAGAGGAAACCTT -P SEQ ID NO: 120 RO5B9 (16) /2-P

TGCCCAGGGAGGCTAGGTGGAGACGGATTACA -P

RPLPO PartzvmePairA9:B10

SEQ ID NO: 121 RO5A9 (22 ) /2-P

CAAACGAGTCCTGGCCTTGTCTGCTACAACGAGAGGAAACCTT -P SEQ ID NO: 122 RO5B10 (16) /2-P

TGCCCAGGGAGGCTAGTGGAGACGGATTACA -P

20.2. Reporter Substrate

[ 00447 ] The reporter substrate for this example is SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end-labelled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2 -FB. Cleavage of SubBi-2 -FB was monitored at 530nm (FAM emission wavelength) with excitation at 485nm (FAM excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 21 SubBi-2 -FB AAGGTTTCCTCguCCCTGGGCA

20.3. PCR Primers for the amplification ofexon 5 of the human RPLPO gene.

[ 00448 ] The sequences of the primers are shown, 5' to 3', below.

SEQ ID NO: 123 5' Primer 5RO5/2

GCTACCCAACTGTTGCATC SEQ ID NO: 110 3' Primer 3RO5/2

AGCAGCCACAAAGGCAGA

20.4. Target template

[ 00449 ] Human genomic DNA extracted from K562 cells was used as template in the PCR reaction.

20.5. Reaction conditions

[ 00450 ] Real time amplification of the target sequence and detection of catalytic activity of the partzyme pairs was conducted in a 25 μL reaction cycled on an ABI 7700 thermocycler (Applied Biosystems). The cycling parameters were 95° C for 7 minutes, 10 cycles of 95° C for 15 seconds and 65° C for 30 seconds (with a 1° C decrease in temperature per cycle), and finally 50 cycles of 95° C for 15 seconds and 50° C for 30 seconds. Each reaction contained 0.04 μM 5RO5/1 and 0.2 μM of 3RO5/2,10 mM MgCl2, 50 μM each dNTP (dATP, dCTP, dGTP, dTTP),lx Immobuffer (Bioline), 0.2 μM SubBi-2-FB,lx Rox reference dye (Invitrogen), lOUnits of Rnasin (Progema) and 1 Unit of Immolase Polymerase (Bioline) and 100 ng of genomic DNA. In addition each reaction contained a pair of partzymes 0.2 μM of partzyme A and 0.2 μM of partzyme B (RPLPO Partzyme Pair A4:B5 or A5:B6 or A6:B7 or A7:B8 or A8:B9 or A9:B10). 20.6. Results

[ 00451 ] Using a real time MNAzyme-PCR method, catalytic activity was detected from three of the six RPLPO partzyme pairs. Partzyme pair A4:B5 and A5:B6 showed high levels of catalytic activity, allowing detection of target in < 22 cycles (Table 23). The A7:B8 partzyme pair was also active, although less active than A4:B5 and A5:B6. No catalytic activity was detected from partzyme pairs A6:B7, A8:B9 or A9:B10 under the conditions of this experiment.

Table 23: Threshold Cycle (Ct) values obtained using various partzyme pairs

Figure imgf000146_0001
The Ct values are averaged from triplicate reactions, when the threshold florescence level was set at 0.2 and the baseline background fluorescence was subtracted between cycles 1 and 14.

Example 21: Application of MNAzymes to detect protein targets.

[ 00452 ] As demonstrated in example 18, MNAzymes can be used to detect targets by incorporating aptamer sequences onto the end of a partzyme (apta-partzyme). In this example, the same MNAzyme detection strategy (Figure 20) was used to detect the protein Tag polymerase using a 46 nucleotide long aptamer sequence which has been reported to bind Taq polymerase with high specificity (Yakimovich, 2003). The assembly facilitator and partzyme B oligonucleotide were the same as those used in the example 18 where ATP was detected using an MNAzyme. 21.1. Partzyme oligonucleotides, assembly and inhibitory oligonucleotides

[ 00453 ] In this example the Taq polymerase aptamer sequence was placed adjacent to the substrate arm of apta-partzyme A (Figure 20). The sensor arms of apta-partzyme A and partzyme B were designed to bind an assembly facilitator. The sequences of apta- 5 partzyme TaqA2/l and partzyme AtpB3/l are shown below (5' to 3')- In the following sequences the bases in bold hybridize with the assembly facilitator, based underlined form part of the catalytic core of the assembled MNAzyme, and bases in italics hybridize to the substrate. In addition, bases in plain text in apta-partzyme A2 TaqA2/l indicate DNA aptamer sequences that bind to Taq polymerase.

10

SEQ ID NO: 124 Apta-Partzyme A2 TaqA2/l:

AACGTACACTGCACGCGGTCGAAATAGTGAGroCGGTCGGCTCGGGGCATTC TTAGCGTTTTGCCCCGAGCCGACCGC

SEQ ID NO: 104 Partzyme B3 AtpB3/l: l5 CΛTCTCTTCTCCGAGCGTCTGTACCGTGTAC

[ 00454 ] The sequence of the assembly facilitator is shown below (5' to 3'):

SEQ ID NO: 105 Assembly facilitator AtpC/1: 2Q GTACACGGTACAGACCGTGCAGTGTACGTT

[ 00455 ] The sequence of the inhibitor oligonucleotide is shown below (5' to 3').

SEQ ID NO: 125 Inhibitor TaqR/1: 25 TGCCCCGAGCCGACCGAACTCACTATTT

21.2. Reporter substrate

[ 00456 ] MNAzyme activity is monitored by cleavage of a dual-labelled nucleic acid reporter substrate. The reporter substrate for this example is SubBi-1-FB with the sequence, 5' to 3', as below. The lower case bases represent RNA and the upper case bases represent DNA. The underlined bases indicate the position of a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end. Changes in fluorescence due to cleavage of SubBi-1-FB at the ribonucleotide between the FAM and BHQl were monitored at 520 s nm (FAM emission wavelength) with excitation at 490 nm (FAM excitation wavelength).

SEQ ID NO : 6 SubBi-1-FB :

ACTCACTATaGGAAGAGATG

o 21.3. Target

[ 00457 ] The target molecule in this example was Taq DNA Polymerase (Amersham Biosciences) and Klenow polymerase (Amersham Biosciences) was used as a negative control. Nuclease-free water was used as a "no target" control.

5 21.4. Reaction Conditions

[ 00458 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 50 μL. Reactions were conducted at 40 0C on a FLUOstar OPTIMA (BMG Biotech). 0 Fluorescence for each reaction was read every 6 seconds for a total of 15 minutes. Each reaction contained a final concentration of 200 nM TaqA2/l, 200 nM AtpB3/l, 200 nM AtpC/1, 200 nM TaqR/1, 200 nM SubBi-1-FB, 25 mM MgCl2, 25 niM Tris HCl pH 6.8 and either 5 Units of Taq DNA polymerase or 5 Units of Klenow polymerase or no protein (water only). 5

21.5. Results : Detection and cleavage of SubBi-1-FB reporter substrate

[ 00459 ] In the absence of Taq polymerase a low level of fluorescence was seen which only increased slightly over time, demonstrating that the inhibitor oligonucleotide was able to prevent the assembly of an active MNAzyme. In the presence of Taq polymerase, 0 the fluorescent signal was higher and increased over time. This indicates that the inhibitor oligonucleotide was displaced by Taq polymerase and an active MNAzyme was formed. Assembly of the MNAzyme was target-dependent as the fluorescent signal in the presence of Klenow polymerase was similar to the signal in the absence of Taq polymerase ie. in the "no target" water control. This is consistent with the observations of Yakimovich et al (2003) who showed that the Taq polymerase aptamer sequence is i specific for Taq polymerase and does not bind Klenow. This MNAzyme example above demonstrates that MNAzymes can be coupled to aptamers for the detection of specific proteins.

Example 22: Detection of a single nucleotide polymorphism (SNP) using a truncated partzyme and a stabiliser oligonucleotides

[ 00460 ] MNAzyme-mediated target detection can occur via Watson-Crick base recognition of the partzyme sensor arms and the target sequence. In example 19, this requirement for complementarity was used to detect a single base mismatch between the partzyme sensor arm and the target nucleic acid sequence. In the following example, the requirement for complementarity was again exploited to detect a single nucleotide polymorphism (SNP) using a strategy that used a partzyme with a truncated sensor arm, which can be stabilised by a stabiliser oligonucleotide. The MNAzyme detection strategy used in this example is illustrated in Figure 23 and the required oligonucleotides are described below: a) standard partzyme; b) a partzyme with a truncated sensor arm (eg 5 bases) which is designed to fully match one form of the SNP but not the other; c) a stabiliser oligonucleotide (eg 15 bases), which hybridizes to the target adjacent to the truncated sensor arm of the partzyme. The stabiliser is designed to facilitate MNAzyme assembly when the 5 nucleotide sensor arm is hybridized to the target; and d) a reporter probe substrate.

22.1. Partzyme oligonucleotides and stabiliser oligonucleotide [ 00461 ] In this example, the sensor arm of partzyme B was designed to be only 5 nucleotides long and to discriminate a SNP occurring in the target oligonucleotide. The sensor aπn of partzyme B was designed to hybridize to the "T' form of the SNP but not the "C" form of the SNP. The sequences of partzymes A and B and the stabiliser oligonucleotide are shown below (5' to 3'). In the following sequences the bases in bold hybridize with the target, bases underlined form part of the catalytic core of the assembled MNAzyme, and bases in italics hybridize to the substrate. The "-P" indicates 3' phosphorylation of the oligonucleotide.

SEQ ID NO: 126 Partzyme A4 XdA4/2-P:

ACTGGATGTCCATCTGTCTGACAACGAGAGGAAACCTr-P SEQ ID NO: 127 Partzyme B5 XdB5/2-P:

ΓGCCCAGGGAGGCTAGCTTATAC-p

SEQ ID NO: 128 Stabiliser XdF/2-P: CTTCGTGAGGGTGAG-P

22.2. Reporter substrate

[ 00462 ] The reporter substrate used in this example was SubBi-2. In the current example, SubBi-2 was end-labelled with a 6-FAM moiety at the 5' end, a BHQl moiety at the 3' end and designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 520 nm (FAM emission wavelength) with excitation at 490 run (FAM excitation wavelength). The sequence of SubBi-2-FB is listed below (5' to 3'); the lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 21 SubBi-2-FB :

AAGGTTTCCTCguCCCTGGGCA

22.3. Target

[ 00463 ] The target molecules for this example were synthetic oligonucleotides derived from the Xd gene. One of the targets corresponded to the "T" form of the SNP

(XdC/2(52)) and was fully matched with the partzyme B sensor arm. The other target corresponded to the "C" form of the SNP and was mismatched to the partzyme B sensor arm. Synthetic oligonucleotides were ordered from Sigma-Proligo and nuclease-free water was used in place of target as a "no target" control. The sequences of both targets are listed below (5' to 3') with the SNP underlined.

SEQ ID NO: 129 Target XdC/2(52):

TGCCCCCTCACCCTCACGAAGGTATACAGACAGATGGACATCCAGTTGGTGA SEQ ID NO: 130 Target (mismatch) XdC/2(lM52):

TGCCCCCTCACCCTCACGAAGGCATACAGACAGATGGACATCCAGTTGGTGA

22.4. Reaction Conditions

[ 00464 ] Detection of the target sequence was measured by an increase in fluorescent signal caused by cleavage of the reporter substrate by the catalytically active MNAzyme. Reactions were initiated by the addition of substrate and the total volume of all reactions was 50 μL. Reactions were conducted at 55°C on a FLUOstar OPTIMA (BMG Biotech). Fluorescence for each reaction was read every 2 seconds for a total of 5 minutes. All reactions contained 200 nM XdA4/2-P, 200 nM XdB5/2-P, Ix PCR Buffer II (Applied Biosystem) and 25 mM MgCl2. hi addition, the reaction contained oligonucleotides listed in Table 24

Table 24. Additional reagents in MNAzyme reactions.

Figure imgf000151_0001

22.5. Results : Detection and cleavage ofSubBi-2-FB reporter substrate

[ 00465 ] The MNAzyme showed an increase in fluorescence over time when the fully matched SNP template was used (Reaction A: Figure 23). In contrast, when the template was mismatched (contained an SNP), the fluorescent signal did not increase over time (Reaction B: Figure 23). Similarly, there was no increase in fluorescence in the absence of target oligonucleotide (Reaction D: Figure 23). The presence of the stabiliser oligonucleotide was shown to be essential for stabilising the MNAzyme complex. A reaction containing all reaction components including fully matched target, but which lacked the stabiliser oligonucleotide, gave no increase in fluorescence over time (Reaction C: Figure 23). As such, 5 bases of the sensor arm was insufficient to form a stable s MNAzyme complex but the presence of a stabiliser oligonucleotide could compensate for the short length of the partzyme sensor arm (5 bases) and allow stable MNAzyme formation under stringent temperature conditions (550C in this example). The stabiliser oligonucleotide can be considered a third partzyme in this system, as it is required for stable MNAzyme formation. o [ 00466 ] This example demonstrates that MNAzymes can be used to discriminate - between two targets that differ by as little as a SNP. Further, it demonstrates the application of partzymes with truncated sensor arms, and their use in combination with stabiliser oligonucleotides.

s Example 23: Catalytic activity of MNAzymes with ribonucleotide substitutions.

[ 00467 ] Unlike ribozymes, DNAzymes have not been found to occur in nature. DNAzymes are evolved in vitro from large oligonucleotide libraries. The substitution of certain deoxyribonucleotides for certain ribonucleotides in known ribozymes has been attempted under certain conditions (McCaIl et al., 1992). Ribozymes that have been fully 0 converted into DNA have no activity due to the conformational differences of RNA and DNA (Perreault et al., 1990). These studies demonstrate that RNA enzymes cannot be modified into working DNA enzymes by merely replacing ribonucleotides with deoxyribonucleotides. Experiments were performed to investigate the tolerance of MNAzymes to substitution of ribonucleotides for deoxyribonucleotides. 5

23.1. Partzyme Oligonucleotides

[ 00468 ] In this example, various partzymes were synthesized where one or more deoxyribonucleotides were replaced with ribonucleotides within the regions that constitute the partial catalytic core. Partzymes were synthesized which either had a single 0 ribonucleotide substitution, or which had the entire partial catalytic core region replaced with ribonucleotides. Partzyme oligonucleotides A and B had sensor arms complementary to a region of exon 4 of the human RPLPO gene. The partzyme oligonucleotides are listed below, 5' to 3'. In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, the bases in bold hybridize to the target and bases in italics hybridize to the substrate. Bases in lower case represent RNA bases which have replaced DNA bases.

SEQ ID NO: 131 partzyme A (Control) RO4A5 (18) /2-P

GGGCTGGTCATCCAGCAGTACAACGAGAGGAAACCTT-P SEQ ID NO: 132 partzyme B (Control) RO4B6 (19)/2-P

TGCCCAGGGAGGCTAGCGTGTTCGACAATGGCAGCA-P o SEQ ID NO: 133 Partzyme A (ribo-14g) : RO4A5 (18) /2-rGl4-P

GGGCTGGTCATCCAGCAGTACAACgAGAGGAAACCTT-P SEQ ID NO: 134 Partzyme A (ribo-9a) : RO4A5 (18) /2-rA9-P

GGGCTGGTCATCCAGCAGTaCAACGAGAGGAAACCTT-P SEQ ID NO: 135 Partzyme A (ribo x 8): RO4rA5(18)/2 s GGGCTGGTCATCCAGCAGuacaacgaGAGGAAACCTT

SEQ ID NO: 136 Partzyme B (ribo x 7): RO4rB6(19)/2

TGCCCAGGGAggcuagcGTGTTCGACAATGGCAGCA

23.2. Reporter Substrate 0 [ 00469 ] The reporter substrate for this example was SubBi-2 with the sequence, 5' to 3', as below. In the current example, SubBi-2 was end-labelled with a 6-FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-2-FB. Cleavage of SubBi-2-FB was monitored at 530 nm (FAM emission wavelength) with excitation at 485 nm (FAM excitation wavelength). In the following sequence the lower case bases s represent RNA and the upper case bases represent DNA.

SEQ ID NO: 21 SubBi-2-FB: AAGGTTTCCTCguCCCTGGGCA 23.3. Target sequence

[ 00470 ] A synthetic DNA oligonucleotide was used as the target template in this experiment. The sequence of the target is shown below, 5' to 3'.

SEQ ID NO: 8 R04/lTarget

GCCATTGTCGAACACCTGCTGGATGACCAGC

23.4. Reaction conditions

[ 00471 ] Analysis of the catalytic activity of various partzyme pairs was performed using a SmartCycler System thermocycler (Cepheid). The total reaction volumes were 25 μL and each reaction contained 1 X PCR Buffer II (Applied Biosystems), 10 mM MgCl2, 0.2 μM of SubBi-2-FB, 2 μM of RO4/1 Target and a pair of A and B partzymes each at 2 μM. The partzyme pairs in each reaction were as in Table 24.

Table 24: Partzymes in various reactions.

Figure imgf000154_0001

[ 00472 ] Reactions were incubated at 54° C for 20 minutes and fluorescent data was collected at 12 second intervals. Since the starting fluorescence can vary for individual wells on the SmartCycler System thermocycler, the initial fluorescence value was subtracted from the fluorescence at each time point for each reaction to allow comparison between reactions in different wells. 23.5. Results: Catalytic activity ofMNAzymes with ribonucleotide substitutions within the partzyme partial catalytic core sequences.

[ 00473 ] Catalytic cleavage of the substrate by MNAzymes composed of the various partzyme pairs was monitored as a change in fluorescence over time (Table 25). Table 25: Results obtained using various partzyme combinations.

Figure imgf000155_0001

[ 00474 ] The experiment shows that some ribonucleotide substitutions within the partial catalytic core of the partzymes are compatible with active MNAzyme formation. While the single substitution (partzyme A (ribo 14g)) had similar activity as the all DNA partzymes under these conditions, an alternative single substitution (partzyme A (ribo9a)), while still compatible with active MNAzyme formation, cleaved the substrate at a slower rate than the control. The MNAzyme did not tolerate substitution of all nucleotides in the partial catalytic core domain of either partzyme A and/or partzyme B.

Example 24: Activation of an MNAzyme by release of a tethered partzymes as a mechanism to initiate a signal amplification cascade.

24.1. MNAzyme mediated signal amplification cascades

[ 00475 ] MNAzymes can be used to initiate signal amplification cascades. One strategy for such a signal amplification cascade is illustrated in Figure 25. In the presence of the target, active MNAzyme 1 forms from partzymes which are free in solution. MNAzyme 1 cleaves its tethered substrate, Subl, thus releasing partzyme components for MNAzyme 2. Once free, these partzymes hybridize with the assembly facilitator and form MNAzyme 2 which cleaves substrate Sub 2. Dual labeled Sub 2, which is free in solution, is cleaved by MNAzyme 2 and fluorescent signal is generated. In addition, MNAzyme 2 cleaves tethered Sub 2 releasing partzymes, which have the same sensor arms as MNAzyme 2 and when hybridized to the assembly facilitator, form MNAzyme 3. (The assembly facilitator can either be tethered or can be free in solution). Since MNAzyme 3 shares the same substrate arms as MNAzyme 1, it can also cleave tethered Subl, thus releasing more partzyme components for MNAzyme 2. This results in a cascade of enzymatic generation > of the components (partzymes) for more enzymes (MNAzymes) and concomitant signal amplification.

24.2. Activation of tethered MNAzyme capable of cleaving fluorescently labeled substrate [ 00476 ] This example demonstrates the first step of the signal amplification cascade as illustrated in Figure 25. In this initiating step, target binds to partzymes, which are free in solution, and forms active MNAzyme 1. MNAzyme 1 cleaves its tethered substrate, Sub 1, thus releasing partzyme components for MNAzyme 2. Once free, these partzymes hybridize with the assembly facilitator and form MNAzyme 2. Dual labeled Sub 2 -FQ (specifically SubBi-3-FB in this example), which is free in solution, is cleaved by MNAzyme 2 and fluorescent signal is generated.

24.3. Partzyme oligonucleotides

[ 00477 ] In the following sequences the bases underlined form part of the catalytic core of the assembled MNAzyme, bases in bold hybridize with the target and bases in italics hybridize to the substrate. Bases that are both in italic and underlined represent the substrate sequences that are coupled to partzymes to be tethered. The "-P" indicates phosphorylation of the oligonucleotide and the "(Biotin)" indicates biotinylation of the oligonucleotide. The lower case bases represent RNA and the upper case bases represent DNA. All sequences listed below are written 5 ' to 3 ' .

[ 00478 ] The free in solution MNAzyme 1 partzymes were designed to specifically bind to exon 5 of the human RPLPO gene and the tethered MNAzyme 2 partzymes were designed to hybridize to the assembly facilitator.

SEQ ID NO: 147 Partzyme A4 RO5A4/2-P:

CAAACGAGTCCTGGCCTTGTCTACAACGAGAGGAAACCΓT -p SEQ ID NO: 148 Partzyme B5 RO5B5/2-P:

TGCCCAGGGAGGCTAGCTGTGGAGACGGATTACACCTTC -p

SEQ ID NO: 138 Tethered Substrate 1/Partzyme A4 RO4A4/3- 5b: (BiOtin)AAAAAAAAGGTTTCCTCffuCCCTGGGCΛGCTGGTCATCCAGCAG

ACAACGAGGTTGTGCTG

SEQ ID NO: 139 Tethered Substrate 1/Partzyme B5 RO4B5/3- 3b:

CGGTTGGTGAGGCTAGCTGTGTTCGACAATGGCAAGGTTTCCTCguCCCTGG GCAAAAAAA (Biotin)

24.4. Reporter substrate

[ 00479 ] The reporter substrate (Sub 2; Figure 25) for this example is SubBi-3 with the sequence, 5' to 3', as below. In the current example, SubBi-3 was end-labelled with a 6- FAM moiety at the 5' end and a BHQl moiety at the 3' end and was designated SubBi-3 - FB. Cleavage of SubBi-3-FB was monitored at 516 nm (FAM emission wavelength) with excitation at 492 nm (FAM excitation wavelength). The lower case bases represent RNA and the upper case bases represent DNA.

SEQ ID NO : 31 SubBi-3 -FB :

CAGCACAACCguCACCAACCG

24.5. Synthetic target and Facilitator sequences

[ 00480 ] In the following sequences, "(Biotin)" indicates biotinylation of the oligonucleotide.

SEQ ID NO: 140 Assembly facilitator RO4/2-3b:

GCCATTGTCGAACACCTGCTGGATGACCAGC-(Biotin) SEQ ID NO: 141 RPLPO 5 synthetic target (RO5): _ _

GAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTG

24.6. Tethering of biotinylated partzymes to streptavidin-coated micro-titer plate

[ 00481 ] Tethering of biotinylated partzymes and assembly facilitator was conducted at room temperature in a total reaction volume of 100 μl. The binding mix contained 200 nM of partzyme RO4A4/3-5b, 20OnM of partzyme RQ4B5/3-3b and 20OnM of the assembly facilitator RO4/2-3b in Amressco PBS solution (without Ca+ and Mg+).

Binding mix (100 μl) was aliquoted into each well of streptavidin coated micro-titer plate

(Roche Diagnostics). Binding time was 30 minutes, followed by 3 washes using PBS, each with 15 minutes incubation before wash-off.

24.7. Cleavage of tethered MNAzyme and detection of cleaved fluorescently labeled substrate

[ 00482 ] Cleavage of fluorescently labeled substrate, SubBi-3-FB was monitored isothermally at 55°C for 4 minutes on the FluoStar Optima fluorometer (BMG LabTech) in a total reaction volume of 100 μL. Reactions contained 200 nM of partzyme RO5A4/2-

P, 200 nM of the partzyme RO5B5/2-P, 200 nM of substrate SubBi-3-FB, 25 mM MgCl2,

Ix PCR Buffer II (Applied Biosystems) and 200 nM of synthetic RO5 target. Nuclease- free water was used instead of synthetic RO5 target for the "no target" controls. Reaction was initiated with addition of the substrate SubBi-3-FB.

24.8. Results: Change in level of fluorescence in the presence of RO 5 target versus "no target" control

[ 00483 ] There is an increase in fluorescence in the presence of the RO5 target compared with reactions lacking target (water control). The change in fluorescence after 4 minutes was around 36,000 units in the presence of target, compared with < 1,000 units for the no target control. This demonstrates the ability of MNAzyme 1 (made up of partzymes RO5A4/2-P and RO5B5/2-P) to cleave the tethered substrate and release the partzymes that make up MNAzyme 2. Further more, it demonstrates that once released, the partzymes can form an active MNAzyme complex with the assembly facilitator that is capable of substrate cleavage leading to signal generation. Example 25: Direct discrimination between methylated cytosines and cytosines in DNA.

[ 00484 ] The use of a stabiliser arm with a partzyme that has truncated sensor arms was used to demonstrate the capacity of MNAzymes to detect single nucleotide polymorphisms (SNPs) present in target assembly facilitators (example 22). Under the experimental condition used in that example, a five base sensor arm was used as a probe for SNPs at 550C, well above its expected melting temperature. Systems with stabiliser arms, and partzymes that have truncated sensor arms, are very sensitive to small changes in the target. This detection strategy can be further extended to directly discriminate between targets, which are either methylated or unmethylated at specific cytosine residues, without the need for prior bisulphite modification (see example 11).

[ 00485 ] The presence of 5-methylcytosine(s) increases the melting temperature of DNA by 1.3 0C per methylated base, relative to unmethylated cytosine(s). Thus, a partzyme with, for example, a five nucleotide long sensor arm would be able to bind a target containing three 5-methylcytosines at a temperature almost 40C higher than it would be able to bind an unmethylated target of the same sequence.

[ 00486 ] When partzymes, a stabiliser arm, and a substrate are incubated at a temperature, which is suitable for hybridization and MNAzyme formation in the presence of a methylated target, but which is too high for MNAzyme formation in the presence of an unmethylated target, a signal would be generated only in the presence of the methylated target.

[ 00487 ] This provides a new strategy for analysis of methylation patterns which can provide a method for detection of methylation bases as markers of cancer and other diseases.

Example 26: Use of MNAzymes to induce a colour change in response to a target

[ 00488 ] A strategy for using MNAzymes in a colourimetric format is illustrated in Figure 24. In this approach, an MNAzyme substrate would be incorporated into a bridging oligonucleotide. The bridging oligonucleotide has complementarity to oligonucleotides attached to gold particles. If no assembly facilitator were present, the bridging oligonucleotide would remain intact and the gold particles would aggregate turning the reaction blue. If an assembly facilitator, for example a target nucleic acid, were present then active MNAzymes would assemble from partzymes present in solution, and cleave the substrate (and hence the bridging oligonucleotide). This would lead to dispersal of the gold particle aggregates which in turn would cause in a change in colour from blue to red. [ 00489 ] This MNAzyme strategy provides a system that incorporates several generic components, and as such, it provides a method that can be rapidly adapted for any new target. This provides an advantage over other systems using DNAzymes and gold particles which require more complex molecules, hi this MNAzyme strategy, the MNAzyme substrate and gold particles with attached oligonucleotides could be generic and used for analysis of any nucleic acid target. New analytical systems would merely require the synthesis of new partzymes with sensor arms complementary to the new target. Furthermore, the colourimetric reaction can also be used in conjunction with MNAzyme systems sensitive to activation by nucleic acids, proteins or other targets.

REFERENCES

Patents and Patent Publications: PCT International Publication No. WO 99/45146

PCT International Publication No. IB99/00848

PCT International Publication No. WO 99/50452

PCT International Publication No. WO 00/58505

PCT Application PCT/US96/02380 ("Asher") U.S. Patent No. 4,683,202

U.S. Patent No. 4,683,195

U.S. Patent No. 4,000,159

U.S. Patent No. 5,176,995

U.S. Patent No. 4,965,188 U.S. Patent No. 6,140,055

U.S. Patent No. 6,201,113

Other References:

Achenbach, J., Nutiu, R. and Li, Y. (2005) Structure-switching allosteric deoxyribozymes. Analytica Chimica Acta. 534(1): 41-51.

Adams, J. (1992) Biotin amplification of biotin and horseradish peroxidase signals in histochemical stains. J Histochem Cytochem. Oct;40(10): 1457-63. Bobrow, M., Harris, T., Shaughnessy, K. and Litt, G. (1989) Catalyzed reporter deposition, a novel method of signal amplification. Application to immunoassays. J Immunol Methods. Dec 20(125(1-2)): 279-85.

Breaker, R. (1997) DNA enzymes. Nat Biotech. 15: 427-431.

Breaker, R.R. and Joyce, G.F. (1994) A DNA enzyme that cleaves RNA. Chem Biol.

Dec;l(4): 223-9.

Brown, A., Li, J., Pavot, C. and Lu, Y. (2003) A lead-dependent DNAzyme with a two- step mechanism. Biochem. Jun 17;42(23): 7152-61.

Cairns, M., King, A. and Sun, L. (2000) Nucleic acid mutation analysis using catalytic DNA. Nucl Acids Res. 28(3): e9. Cairns, M., King, A. and Sun, L. (2003) Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. Nucl Acids Res. Jun 1;31(11): 2883-9.

Carmi, N., Shultz, L. A. and Breaker, R.R. (1996) In vitro selection of self-cleaving DNAs. Chem Biol. 3(12): 1039-46.

Chehab, F.F., Doherty, M., Cai, S.P., Kan, Y. W., Cooper, S. and Rubin, E.M. (1987) Detection of sickle cell anaemia and thalassaemias [letter] [published erratum appears in Nature 1987 Oct 22-28;329(6141):678]. Nature. 329(6137): 293-4. Chen, C, Ridzon, D., Broomer, A., Zhou, H., Barbisn, M., Lao, K. and Livak, K. (2005) MicroRNA quantitation by looped RT-PCR. AACR. poster.

Cheng, S., Merlino, G.T. and Pastan (1993) A versatile method for coupling of proteins to DNA:synthesis of a2-macroglobin-DNA conjugates. Nucleic Acid Research: 11, 659-669.

Compton, J. (1991) Nucleic acid sequence-based amplification. Nature. 350(6313): 91-2. Cruz, R.P., Withers, J.B. and Li, Y. (2004) Dinucleotide junction cleavage versatility of

8-17 deoxyribozyme. Chem Biol. Jan;l 1(1): 57-67. Cuenoud, B. and Szostak, J.W. (1995) A DNA metalloenzyme with DNA ligase activity.

Nature. 375(6532): 611-4.

Eigen, M. and Rigler, R. (1994) Sorting single molecules: application to diagnostics and evolutionary biotechnology. Proc Natl Acad Sci U S A. 91(13): 5740-7.

Elghanian, R., Storhoff, J., Mucic, R., Letsinger, R. and Mirkin, C. (1997) Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science. 277: 1078-1079.

Fahy, E., Kwoh, D. and Gingeras, T. (1991) Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR

Methods Appl. Aug;l(l): 25-33.

Hall, J.G., Eis, P.S., Law, S.M., Reynaldo, L.P., Prudent, J.R., Marshall, D.J., Allawi,

H.T., Mast, A.L., Dahlberg, J.E., Kwiatkowski, R. W., de Arruda, M., Neri, B.P. and

Lyamichev, V.I. (2000) From the Cover: Sensitive detection of DNA polymorphisms by the serial invasive signal amplification reaction. Proc Natl Acad

Sci USA. 97(15): 8272-8277. Haseloff, J. and Gerlach, W.L. (1988) Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. Aug 18; 334(6183): 585-91. Huizenga, D. and Szostak, J. (1995) A DNA aptamer that binds adenosine and ATP. Biochemistry. 34: 656-665 Illangasekare, M., Sanchez, G., Nickles, T. and Yarus, M. (1995) Aminoacyl-RNA synthesis catalyzed by an RNA. Science. 267(5198): 643-7. Impey, H., Applegate, T., Haughton, M., Fυery, C, King, J. and Todd, A. (2000) Factors that influence deoxyribozyme cleavage during polymerase chain reaction. Anal Biochem. Nov 15; 286(2): 300-3.

Jonas, V., Alden, M., Curry, J., Kamisango, K., Knott, C, Lankford, R., Wolfe, J. and

Moore, D. (1993) Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by amplification of rRNA. Journal of Clinical

Microbiology. 31 : 2410-2416. Kuwabara, T., Warashina, M., Nakayama, A., Ohkawa, J. and Taira, K. (1999) tRNAVal- heterodimeric maxizymes with high potential as geneinactivating agents:

Simultaneous cleavage at two sites in HW-I tat mRNA in cultured cells. Proc Natl

Acad Sci USA. 96(5): 1886-1891.

Kuwabara, T., Warashina, M. and Taira, K. (2000) Allosterically controllable maxizymes cleave mRNA with high efficiency and specificity. TIBTECH. Nov (18): 462-468.

Lee, J.F., Hesselberth, J.R., Meyers, L.A. and Ellington, A.D. (2004) Aptamer Database.

Nucl Acids Res. 32(90001): D95-100. Levy, M. and Ellington, A. (2003) Exponential growth by cross-catalytic cleavage of deoxyribozymogens. Proc Natl Acad Sci USA. 100(11): 6416-21. Li, J., Zheng, W., Kwon, A.H. and Lu, Y. (2000) In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. Nucl Acids Res.

28(2): 481-488. Li, Y. and Sen, D. (1996) A catalytic DNA for porphyrin metallation [letter]. Nat Struct

Biol. 3(9): 743-7. Liu, J. and Lu, Y. (2004) Adenosine-dependent assembly of aptazyme-functionalized gold nanoparticles and its application as a colorimetric biosensor. Analytical

Chemistry. 76: 1627-1632. Lizardi, P., Huang, X., Zhu, Z., Bray- Ward, P., Thomas, D. and Ward, D. (1998)

Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. JuI; 19(3): 225-32.

Lohse, P. A. and Szostak, J. W. (1996) Ribozyme-catalysed amino-acid transfer reactions.

Nature. 381(6581): 442-4. McCaIl, M., Hendry, P. and Jennings, P. (1992) Minimal Sequence Requirements for

Ribozyme Activity. Proc Natl Acad Sci USA. 89(13): 5710-5714. Mirkin, C, Letsinger, R., Mucic, R. and Storhoff, J. (1996) A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature. 382: 607-

609.

Nagamine, K., Kuzuhara, Y. and Notomi, T. (2002) Isolation of Single-Stranded DNA s from Loop-Mediated Isothermal Amplification Products. Biochemical and

Biophysical Research Communications. 290(4): 1195-1198. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and

Hase, T. (2000) Loop-mediated isothermal amplification of DNA. Nucl Acids Res.

Jun 15;28(12): E63. o Oshima, K., Kawasaki, H., Soda, Y., Tani, K., Asano, S. and Taira, K. (2003) Maxizymes and Small Hairpin-Type RNAs That Are Driven by a tRNA Promoter Specifically

Cleave a Chimeric Gene Associated with Leukemia in Vitro and in Vivo. Cancer

Res. 63(20): 6809-6814.

Paul, N. and Joyce, G. (2004) Minimal self-replicating systems. Current Opinion in s Chemical Biology. 8(6): 634-639.

Perreault, J., Labuda, D., Usman, N., Yang, J. and Cedergren, R. (1991) Relationship between 2'-hydroxyls and magnesium binding in the hammerhead RNA domain: a model for ribozyme catalysis. Biochemistry. 30(16): 4020-5.

Perreault, J., Wu, T., Cousineau, B., Ogilvie, K. and Cedergren, R. (1990) Mixed 0 deoxyribo- and ribo-oligonucleotides with catalytic activity. Nature. 344(6266):

565-7. Perriman, R., Delves, A. and Gerlach, W.L. (1992) Extended target-site specificity for a hammerhead ribozyme. Gene. 113(2): 157-63.

Raap, A., van de Corput, M., Vervenne, R., van Gijlswijk, R., Tanke, H. and Wiegant, J. S (1995) Ultra-sensitive FISH using peroxidase-mediated deposition of biotin- or fluorochrorne tyramides. Hum MoI Genet. Apr;4(4): 529-34. Raillard, S.A. and Joyce, G.F. (1996) Targeting sites within HIV-I cDNA with a DNA- cleaving ribozyme. Biochemistry. 35(36): 11693-701.

Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, 0 N. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230(4732):

1350-4. Santoro, S. and Joyce, G. (1997) A general purpose RNA cleaving DNA enzyme. Proc

Natl Acad Sci U S A. 94: 4262-4266. Santoro, S.W. and Joyce, G.F. (1998) Mechanism and utility of an RNA-cleaving DNA enzyme. Biochem. 37(38): 13330-42. Schubert, S., Furste, J., Werk, D., Grunert, H., Zeichhardt, H., Erdmann, V. and Kurreck,

J. (2004) Gaming target access for deoxyribozymes. J MoI Biol. May 28;339(2): 355-63.

Sidorov, A., Grasby, J. and Williams, D. (2004) Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities. Nucl Acids Res. Mar 5;32(4): 1591-601.

Silverman, S. (2004) Breaking up is easy to do (if you're a DNA enzyme that cleaves RNA). Chem Biol. Jan; 11(1): 7-8.

Tarasow, T.M., Tarasow, S. L. and Eaton, B.E. (1997) RNA-catalysed carbon-carbon bond formation. Nature. 389(6646): 54-7. Todd, A. V., Fuery, C.J., Impey, H.L., Applegate, T.L. and Haughton, M.A. (2000)

DzyNA-PCR: use of DNAzymes to detect and quantify nucleic acid sequences in a real-time fluorescent format. Clin Chem. May;46(5): 625 -630.

Urdea, M. (1993) Synthesis and characterization of branched DNA (bDNA) for direct and quantitative detection of CMV, HBV, HCV and HIV. Clin Chem. 39: 725-726. van Gijlswijk, R., Zijlmans, H., Wiegant, J., Bobrow, M., Erickson, T., Adler, K., Tanke,

H. and Raap, A. (1997) Fluorochrome-labeled tyramides: use in immunocytochemistry and fluorescence in situ hybridization. J Histochem

Cytochem. Mar;45(3): 375-82. Walker, G.T., Fraiser, M.S., Schram, J.L., Little, M.C., Nadeau, J.G. and Malinowski,

D.P. (1992) Strand displacement amplification— an isothermal, in vitro DNA amplification technique. Nucl Acids Res. 20(7): 1691-6. Warashina, M., Kuwabara, T., Nakamatsu, Y. and Taira, K. (1999) Extremely high and specific activity of DNA enzymes in cells with a Philadelphia chromosome. Chem

Biol. Apr;6(6): 237-50. Yakimovich, O., Alekseev, Y., Maksimenko, A., Voronina, O. and Lunin, V. (2003)

Influence of DNA aptamer structure on the specificity of binding to Tag DNA polymerase. Biochemistry (Moscow). 68(2): 228-235.

Zaborowska, Z., Furste, J., Erdmann, V. and Kurreck, J. (2002) Sequence requirements in the catalytic core of the "10-23" DNA enzyme. J Biol Chem. 277(43): 240617-22. Zhang, S., Scharadin, N., Purohit, P. and Chasin, L. (2005) Aptamer-based multiplexed amplified real-time biochemical detector. Indiana Biosensor Symposium. Poster.

Claims

1. A composition comprising at least two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an MNAzyrne assembly facilitator to form a catalytically active multi-component nucleic acid enzyme (MNAzyme), wherein each of said at least first and said second oligonucleotide components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion; wherein upon self-assembly, the sensor arm portion of said first and second oligonucleotide components act as sensor arms of the MNAzyme, the substrate arm portion of the first and second oligonucleotide components act as substrate arms of the
MNAzyme, and the catalytic core portion of the first and second oligonucleotide components act as a catalytic core of the MNAzyme; and wherein the sensor arms of the MNAzyme interact with said MNAzyme assembly facilitator so as to maintain the first and second oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of the MNAzyme, said catalytic core capable of modifying at least one substrate, and wherein said substrate arms of said MNAzyme engage a substrate so that said catalytic core of said MNAzyme can modify said substrate. 2. The composition of claim 1 wherein at least one of said oligonucleotide components, assembly facilitator or substrate is comprised of DNA or an analogue thereof.
3. The composition of claim 1 or 2 wherein said assembly facilitator is a target to be identified, detected or quantitated. 4. The composition of claim 3 wherein said target is a nucleic acid.
5. The composition of claim 4 wherein said nucleic acid is selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, tRNA, mRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons, or any combination thereof.
6. The composition of claim 5 wherein said ribosomal RNA is 16S ribosomal RNA.
7. The composition of any one of claims 4-6, wherein the source of the nucleic acid is selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof.
8. The composition of any one of claims 4-6, wherein said nucleic acid is amplified. 9. The composition of claim 8 wherein said amplification comprises one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop- mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).
10. The composition of any one of claims 1-9, further comprising at least a third oligonucleotide component which acts to stabilise at least one of said substrate arm portions or sensor arm portions.
11. The composition of any one of claims 1-10 wherein at least one of said assembly facilitator, said oligonucleotide components or substrate or a combination thereof is comprised of more than one molecule.
12. The composition of any one of claims 1-11, wherein the catalytic core portions of the first oligonucleotide component are selected from the group comprising SEQ ID NOs 149 - 153, 155 - 157, 159 and 161, and the catalytic core portions of the second oligonucleotide component are selected from the group comprising SEQ ID NOs 166 - 170 and 172.
13. The composition of any one of claims 1-12, further comprising at least one inhibitor of said self assembly of said MNAzyme.
14. The composition of any one of claims 1-13 wherein at least one of said oligonucleotide components or assembly facilitator or substrate or a combination thereof further comprises at least one aptamer or portion thereof.
15. The composition of claim 14 wherein said aptamer or portion thereof is comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or combination thereof. 16. The composition of any one of claims 1-15 further comprising at least one inhibitor of said self assembly of said MNAzyme.
17. The composition of any one of claims 1-16 wherein at least one of said first or said second oligonucleotide components or said assembly facilitator or said substrate further ^
— 167 — comprises at least one portion of self complementary sequence capable of forming a hairpin structure.
18. The composition of claim 17 wherein said hairpin structure inhibits self assembly of said MNAzyme. 19. The composition of claim 18 wherein said inhibition of self assembly is removed upon contact of an aptamer with a target.
20. The composition of any one of claims 14-19 wherein said aptamer, or portion thereof, binds a target selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof.
21. The composition of any one of claims 1-20 wherein said substrate is a nucleic acid or a protein.
22. The composition of claim 21 wherein said nucleic acid comprises at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof.
23. The composition of claim 21 wherein said protein comprises at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof.
24. The composition of any one of claims 1-23, wherein said substrate further comprises at least one nanoparticle or microparticle, or combination thereof.
25. The composition of any one of claims 1-24, wherein said substrate arms engage said substrate through complementary base pairing.
26. The composition of any one of claims 1-25 wherein said substrate is attached to an insoluble support or free in solution. 27. The composition of any one of claims 1-26, wherein said substrate comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.
28. The composition of any one of claims 1-27 wherein said modification of said substrate by said MNAzyme provides a detectable effect.
29. The composition of any one of claims 1-28 wherein said modification of said substrate is selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds, or any combination thereof.
30. The composition of claim 27, 28 or 29 wherein said detectable effect is detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.
31. The composition of any one of claims 27-30 wherein said detectable effect is measured and wherein the magnitude of said measurement is indicative of the quantity of a target. 32. The composition of any one of claims 1-31 wherein at least one of said oligonucleotide components, said assembly facilitator or said substrate is selected from the group comprising DNA, RNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, or a combination thereof.
33. The composition of any one of claims 1-32 wherein said assembly facilitator and said substrate are nucleic acids that are completely or partially complementary to at least part of said first or second oligonucleotide components.
34. The composition of any one of claims 1-34 wherein at least one of said oligonucleotide components, said assembly facilitator or said substrate comprises at least one nucleotide substitution or addition selected from the group comprising 4- acetylcytidine, 5-(carboxyhydroxylmethyl)uridine, 2'-O-methylcytidine, 5- carboxymethylaminomethyl thiouridine, dihydrouridine, 2'-O-methylpseudouridine, beta D-galactosylqueosine, 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1- methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2- dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3 -methyl cytidine, 5- methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, beta- D-mannosylmethyluridine, 5- methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6- isopentenyladenosine, N-((9-beta-ribofuranosyl-2-methylthiopurine-6- yl)carbamoyl)threonine, N-((9-beta-ribofuranosylpurine-6-yl)N-methyl- carbamoyl)threonine, uridine-5-oxyacetic acid methylester, uridine-5-oxyacetic acid (v), wybutoxosine, pseudouridine, queosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2- thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6- yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutosine, 3-(3-amino-3-carboxypropyl)uridine, beta D-arabinosyl uridine, beta D-arabinosyl thymidine.
35. The composition of any one of claims 1-34 further comprising at least a third oligonucleotide component and a fourth oligonucleotide component that self-assemble in the presence of at least one additional assembly facilitator to form at least one additional catalytically active MNAzyme, wherein each of said at least third and fourth oligonucleotide components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion; wherein upon self-assembly of at least a third oligonucleotide component and a fourth oligonucleotide component, the sensor arm portion of said at least third and said at least fourth oligonucleotide components form sensor arms of said at least one additional catalytically active MNAzyme, the substrate arm portion of said at least third and said at least fourth oligonucleotide components form substrate arms of said at least one additional catalytically active MNAzyme, and the catalytic core portion of said at least third and said at least fourth oligonucleotide components form a catalytic core of said at least one additional catalytically active MNAzyme; and wherein the sensor anus of said at least one additional MNAzyme interact with said at least one additional assembly facilitator so as to maintain said at least third and said at least fourth oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of said at least one additional MNAzyme, said catalytic core capable of acting on at least one additional substrate, and wherein the substrate arms of said at least one additional MNAzyme engage at least one additional substrate so that the catalytic core of said at least one additional MNAzyme can act on said at least one additional substrate. 36. The composition of claim 35 wherein each of the additional substrates are the same, different or a combination thereof. 37. A method for detecting the presence of at least one assembly facilitator comprising
(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an assembly facilitator to form at least one catalytically active multi- component nucleic acid enzyme (MNAzyme);
(b) contacting the two or more oligonucleotide components with a sample putatively containing the assembly facilitator under conditions permitting: (1) the self-assembly of said at least one catalytically active MNAzyme, and
(2) the catalytic activity of said MNAzyme; and
(c) determining the presence of the catalytic activity of said at least one MNAzyme, 5 wherein the presence of the catalytic activity is indicative of the presence of said at least one assembly facilitator.
38. The method of claim 37 wherein the self assembly of the MNAzyme requires contact of the assembly facilitator with one or both of said first and second oligonucleotide components. I0 39. The method of claim 37 or 38 further comprising providing at least a third oligonucleotide component that contacts at least a portion of either or both of the first and second oligonucleotide components to self-assemble the MNAzyme.
40. The method of claim 39 wherein said third oligonucleotide component is comprised of more than molecule.
15 41. A method for detecting the presence of at least one assembly facilitator comprising (a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of at least a first assembly facilitator to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme); 20 (b) providing at least a first substrate, said first substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect;
(c) contacting said two or more oligonucleotide components with a sample putatively containing said at least first assembly facilitator under conditions permitting: 25 (1) the self-assembly of said at least first MNAzyme, and
(2) the catalytic activity of said at least first MNAzyme; and
(d) detecting said detectable effect.
42. The method of any one of claims 37-41 wherein at least one of said oligonucleotide components, assembly facilitator or substrate is comprised of DNA or an analogue
30 thereof.
43. The method of any one of claims 37-41 wherein said assembly facilitator is a target to be identified, detected or quantified.
44. The method of claim 43 wherein said target is a nucleic acid.
45. The method of claim 44 wherein said nucleic acid is selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, tRNA, mRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs5 ribosomal RNA, derivatives thereof, amplicons, or any combination s thereof.
46. The method of claim 45 wherein said ribosomal RNA is 16S ribosomal RNA.
47. The method of any one of claims 44 -46 wherein the source of the nucleic acid is selected from the group comprising synthetic, mammalian, human, animal, plant, fungal, bacterial, viral, archael or any combination thereof. o 48. The method of any one of claims 37-47 further comprising a step of amplifying the nucleic acid.
49. The method of claim 48 wherein the step of amplifying comprises one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop- mediated isothermal amplification (LAMP), rolling circle amplification (RCA), s transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).
50. The method of any one of claims 37-49 wherein at least one of said assembly facilitator, said first or second oligonucleotide components or substrate or combination 0 thereof is comprised of more than one molecule.
51. The method of claim 48 further comprising detecting said detectable effect during or after said amplification.
52. The method of any one of claims 37-51 wherein said detectable effect is indicative of the presence of said assembly facilitator. 5 53. The method of any one of claims 37-52 wherein said detectable effect is quantitatively or qualitatively measured.
54. The method of any one of claims 37-53 wherein said substrate is a nucleic acid or a protein.
55. The method of claim 54 wherein said nucleic acid comprises at least one of a 0 labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof.
56. The method of claim 54 wherein said protein comprises at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof.
57. The method of any one of claims 37-56 wherein said substrate further comprises at least one of a nanoparticle or microparticle or combination thereof.
58. The method of any one of claims 54-57 wherein said substrate is a nucleic acid and wherein said substrate arms engage said substrate through complementary base pairing.
5 59. The method of any one of claims 37-58 wherein the substrate comprises a detectable portion and a quencher portion, wherein upon modification of the substrate by the MNAzyme, a detectable effect provided by the detectable portion is increased or decreased.
60. The method of any one of claims 37-59 wherein said substrate is attached to an o insoluble support or free in solution.
61. The method of any one of claims 37-60 wherein said detectable effect is detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, s electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.
62. The method of any one of claims 37-61 further comprising amplifying the detectable effect by use of a detectable effect amplification cascade.
63. The method of claim 62 wherein the detectable effect amplification cascade 0 comprises one or more of a ribozyme/ligase cascade, a circular nucleic acid enzyme cascade, a protein enzyme cascade, or one or more enzymes attached to a support, or any combination thereof.
64. The method of any one of claims 37-63 wherein said modification of said substrate is selected from the group comprising cleavage, ligation, porphyrin metallation, formation s of carbon-carbon bonds, ester bonds or amide bonds.
65. The method of any one of claims 37-64 further comprising providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional assembly facilitator to form at least one additional catalytically active 0 MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified only by the additional MNAzyme, wherein said modification provides said additional detectable effect.
66. The method of claim 76 wherein said at least one additional detectable effect is independently detectable.
67. The method of claim 65 or 66 wherein at least one of each additional substrate is attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.
68. The method of any one of claims 65-67 wherein one additional substrate is attached to at least one insoluble support so that a detectable effect is produced when that substrate is modified by its respective MNAzyme. 69. A method for detecting the presence of at least one target comprising
(a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and at least a second oligonucleotide component are capable of self-assembly in the presence of said target to form a catalytically active multi- component nucleic acid enzyme (MNAzyme); and wherein at least one of said first and said second oligonucleotide components further comprises at least one aptamer portion;
(b) contacting said oligonucleotide components with a sample putatively containing said at least one target under conditions permitting:
(1) binding of said target to said aptamer portions and
(2) catalytic activity of the MNAzyme; and (c) determining the presence of the catalytic activity of the MNAzyme, wherein the presence of the catalytic activity is indicative of the presence of said target.
70. The method of claim 69 wherein said target is to be identified, detected or quantified.
71. A method for detecting the presence of at least one target comprising (a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component are capable of self- assembly in the presence of at least one assembly facilitator and said at least one target to form at least one catalytically active multi-component nucleic acid enzyme (MNAzyme); and wherein at least one of said first or said second oligonucleotide components or said at least one assembly facilitator further comprises at least one aptamer or portion thereof and wherein said target is capable of binding said at least one aptamer or portion thereof; (b) providing at least one inhibitor of said self assembly of said MNAzyme (c) contacting said oligonucleotide components, assembly facilitator and said inhibitor with a sample putatively containing said at least one target under conditions permitting:
(1) binding of said target to said at least one aptamer or portion thereof and s (2) catalytic activity of said at least one MNAzyrne; and
(3) removal of said inhibition of said self assembly of said catalytically active MNAzyme; and
(d) determining the presence of the catalytic activity of said MNAzyme, wherein the presence of said catalytic activity is indicative of the presence of said target. o 72 The method of claim 71 wherein said aptamer or portion thereof is comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or combination thereof.
73. The method of any one of claims 69-72 further comprising providing a substrate that can be modified by said MNAzyme to provide a detectable effect. s 74. The method of claim 73 wherein said modification is selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon-carbon bonds, ester bonds or amide bonds.
75. The method of claim 73 wherein said substrate is not modified by said first or second oligonucleotide components individually or by both said first and second 0 oligonucleotide components in the absence of said assembly facilitator and said target.
76. A method for detecting the presence of at least one target comprising
(a) providing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component are capable of self- assembly in the presence of at least a first assembly facilitator and said at least a first 5 target to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme);
(b) providing at least a first substrate, said first substrate capable of being modified by said at least first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect; 0 (c) wherein at least one of said first or said second oligonucleotide components or said at least a first assembly facilitator or said at least a first substrate further comprises an aptamer and wherein said target is capable of binding at least a portion of said aptamer, providing at least a first inhibitor which is capable of inhibiting said self-assembly of said catalytically active MNAzyme in the absence of said target; (d) contacting said oligonucleotide components, said assembly facilitator, said substrate, and said inhibitor with a sample putatively containing said target under conditions permitting:
(1) binding of said target to said aptamer and
5 (2) removal of said inhibition of said self assembly of said catalytically active MNAzyrne
(3) catalytic activity of the MNAzyme; and
(e) determining the presence of said detectable effect thereby detecting the presence of said target. Q 77. The method of any one of claims 69-76 wherein at least one of said oligonucleotide components or assembly facilitator is comprised of DNA or an analogue thereof.
78. The method of any one of claims 69-77 wherein said aptamer, or portion thereof, binds a target selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, s pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions or any derivatives, portions or combinations thereof.
79. The method of any one of claims 69-78 wherein at least one of said oligonucleotide components, assembly facilitator, substrate, or inhibitor is attached to an insoluble support. 0 80. The method of any one of claims 71-79 wherein at least one of said oligonucleotide components, assembly facilitator, aptamer or aptamer portion further comprises said inhibitor.
81. The method of any one of claims 69-80 wherein said aptamer or portion thereof is comprised of at least one of nucleic acid, peptide, polypeptide or protein or a derivative or 5 combination thereof.
82. The method of any one of claims 71-81 wherein at least one of said first or said second oligonucleotide components, assembly facilitator or substrate further comprises a portion of self complementary sequence capable of forming a hairpin structure.
83. The method of claim 82 wherein said hairpin structure inhibits self assembly of said Q catalytically active MNAzyme.
84. The method of claim 83 wherein said inhibition of self assembly of said catalytically active MNAzyme is removed upon contact of said aptamer or aptamer portion with the target.
85. The method of any one of claims 71-84 wherein said inhibitor is capable of binding at least one of the group comprising said aptamer or portion thereof.
86. The method of any one of claims 71-85 wherein said inhibitor is selected from the group comprising RNA, DNA, nucleic acid analogues, peptide nucleic acids, locked nucleic acids, peptide-nucleic acid chimeras, or a combination thereof.
87. The method of any one of claims 73-86 wherein said substrate is a nucleic acid or a protein.
88. The method of claim 87 wherein said nucleic acid comprises at least one of a labeled nucleic acid, RNA, DNA, nucleic acid analogue, peptide nucleic acid, locked nucleic acid, peptide-nucleic acid chimera, or any combination thereof.
89. The method of claim 87 wherein said protein comprises at least one of an antibody, polypeptide, glycoprotein, lipoprotein, or any combination thereof.
90. The method of any one of claims 73-89 wherein said substrate further comprises at least one nanoparticle or microparticle or combination thereof. 91. The method of any one of claims 73-90 wherein said detectable effect is quantitatively or qualitatively measured.
92. The method of any one of claims 73-91 wherein said detectable effect is detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.
93. The method of any one of claims 73-92 wherein said substrate comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.
94. The method of any one of claims 73-93 wherein said modification is selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon- carbon bonds, ester bonds or amide bonds. 95. The method of any one of claims 71-94 further comprising providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional assembly facilitator and at least one additional target to form at least one additional catalytically active MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified by the additional MNAzyme, wherein said modification provides an additional detectable effect; and wherein at least one of said third or fourth oligonucleotide components or said 5 additional assembly facilitator or said additional substrate further comprises at least one additional aptamer which binds said at least one additional target; wherein at least one additional inhibitor molecule contacts a portion of said additional aptamer, thereby inhibiting said self-assembly of said catalytically active additional MNAzyme in the absence of said additional target; and ic wherein said at least one additional assembly facilitator contacts at least a portion of said additional oligonucleotide components.
96. The method of claim 95 wherein said at least one additional detectable effect is independently detectable.
97. The method of claim 95 or 96 wherein each of the additional substrates are the is same, different or a combination thereof.
98. The method of any one of claims 95-97 wherein at least one of each additional substrate is attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.
20 99. A method for detecting the presence of at least one nucleic acid sequence variant comprising
(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of a sequence variant of a nucleic acid to form a catalytically active multi-
25 component nucleic acid enzyme (MNAzyme);
(b) providing at least one substrate, said substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides a detectable effect;
(c) contacting the two or more oligonucleotide components with a sample putatively 30 containing said sequence variant under conditions permitting:
(1) the self-assembly of said catalytically active MNAzyme, and
(2) the catalytic activity of said MNAzyme; and
(d) determining the presence of said detectable effect thereby detecting the presence of said at least one sequence variant.
100. The method of claim 99 wherein the sequence variant is selected from the group comprising single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, deletions, duplications, translocations, frameshift sequence variants, nonsense sequence variants, or any combination thereof. 101. The method of claim 99 or 100 wherein said sequence variant is present in DNA or RNA.
102. The method of any one of claims 99-101 wherein either or both of said first oligonucleotide component and said second oligonucleotide components are comprised of more than one molecule. 103. The method of any one of claims 99-102 wherein said sample containing said sequence variant is selected from the group comprising bisulfite modified methylated or non-methylated DNA, bisulfite modified methylated or non-methylated RNA, at least one amplicon of bisulfite modified methylated or non-methylated DNA, at least one amplicon of bisulfite modified methylated or non-methylated RNA or a combination thereof. 104. The method of any one of claims 99-103 wherein the self assembly of the multi- component nucleic acid enzyme requires contact of at least a portion of either or both of the first and second oligonucleotide components with the nucleic acid which comprises said sequence variant.
105. The method of any one of claims 99-104 further comprising a step of amplifying the nucleic acid containing said sequence variant.
106. The method of claim 105 wherein the step of amplifying comprises one or more of: polymerase chain reaction (PCR), strand displacement amplification (SDA), loop- mediated isothermal amplification (LAMP), rolling circle amplification (RCA), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence based amplification (NASBA), or reverse transcription polymerase chain reaction (RT-PCR).
107. The method of claim 105 or 106 further comprising determination of the presence of said nucleic acid sequence variant during or after said amplification.
108. The method of any one of claims 99-107 wherein said detectable effect is detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.
109. The method of any one of claims 99-108 wherein said substrate comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased. 110. The method of any one of claims 99-109 wherein said substrate is attached to an insoluble support or free in solution.
111. The method of any one of claims 99-110 wherein said modification is selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon- carbon bonds, ester bonds or amide bonds. 112. The method of any one of claims 99- 111 further comprising
(a) providing at least a third oligonucleotide component and at least a fourth oligonucleotide component that self assemble in the presence of at least one additional nucleic acid sequence variant to form at least one additional catalytically active multi- component nucleic acid enzyme (MNAzyme); (b) contacting said at least third and at least fourth oligonucleotide components with a sample putatively containing at least one additional nucleic acid sequence variant in the presence of at least one additional substrate capable of being modified by said at least one additional MNAzyme, wherein said modification of said at least one additional substrate provides at least one additional detectable effect under conditions permitting: (1) the self-assembly of at least one MNAzyme, and
(2) the catalytic activity of at least one MNAzyme; and
(c) detecting said at least one additional detectable effect, thereby detecting the presence of said at least one additional sequence variant.
113. The method of claim 112 wherein said at least one additional detectable effect is independently detectable.
114. The method of claim 112 or 113 wherein each of the additional substrates are the same, different or a combination thereof.
115. The method of any one of claims 112-114 wherein at least one of each additional substrate is attached to an insoluble support so that only one of a detectable portion and a quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.
116. A method for detecting the presence of a sequence variant of a nucleic acid comprising (a) providing two or more oligonucleotide components comprising at least a first oligonucleotide component and a second oligonucleotide component capable of self assembly in the presence of a nucleic acid to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme); (b) contacting the two or more oligonucleotide components with a sample putatively containing the nucleic acid, in the presence of at least a first substrate modifiable by said at least a first MNAzyme, wherein the substrate comprises a detectable portion capable of providing at least a first detectable effect upon modification of the substrate by said at least a first MNAzyme under conditions permitting: (1) the self-assembly of the MNAzyme, and
(2) the catalytic activity of the MNAzyme; and
(c) wherein the absence of the catalytic activity is indicative of the presence of a sequence variant in said nucleic acid.
117. A method for detecting the presence of at least one methylated nucleic acid comprising
(a) providing two or more oligonucleotide components, wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of methylated nucleic acid to form at least one catalytically active multi- component nucleic acid enzyme (MNAzyme); (b) providing at least a first substrate, said first substrate capable of being modified by said first MNAzyme, wherein said modification of said substrate by said MNAzyme provides at least a first detectable effect;
(c) contacting the two or more oligonucleotide components with a sample putatively containing the methylated nucleic acid under conditions permitting: (1) the self-assembly of the catalytically active MNAzyme, and
(2) the catalytic activity of the MNAzyme; and
(d) determining the presence of said at least one detectable effect thereby detecting the presence of said at least one methylated nucleic acid.
118. The method of claim 117 wherein said conditions further comprise a temperature that facilitates hybridization of said MNAzyme with said methylated nucleic acid but not with unmethylated nucleic acid.
119. The method of claim 117 or 118 further comprising amplifying the detectable effect by use of a detectable effect amplification cascade.
120. The method of claim 119 wherein the detectable effect amplification cascade comprises one or more of a ribozyme/ligase cascade, a circular nucleic acid enzyme cascade, a protein enzyme cascade, or one or more enzymes attached to a support, or any combination thereof. 121. The method of any one of claims 117-120 wherein the source of said methylated nucleic acid is selected from the group comprising synthetic, mammalian, human, animal acid, plant, fungal, bacterial, viral, archael or any combination thereof. 122. The method of any one of claims 117-121 wherein the methylated nucleic acid is selected from the group comprising methylated RNA or methylated DNA. 123. The method of any one of claims 117-122 wherein the self assembly of the multi- component nucleic acid enzyme requires contact of the methylated nucleic acid with one or both of the first and second oligonucleotide components.
124. The method of any one of claims 117-123 further comprising providing an insoluble support having at least one of said substrate or said first or second oligonucleotide components, or a combination thereof attached thereto.
125. The method of any one of claims 117-124 wherein said detectable effect is detected by fluorescence spectroscopy, surface plasmon resonance, mass spectroscopy, NMR, electron spin resonance, polarization fluorescence spectroscopy, circular dichroism, immunoassay, chromatography, radiometry, photometry, scintigraphy, electronic methods, UV, visible light or infra red spectroscopy, enzymatic methods or any combination thereof.
126. The method of any one of claims 117-125 wherein said substrate comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.
127. The method of any one of claims 117-126 wherein said modification is selected from the group comprising cleavage, ligation, porphyrin metallation, formation of carbon- carbon bonds, ester bonds or amide bonds.
128. The method of any one of claims 117-127 further comprising providing at least a third and fourth oligonucleotide component, wherein said at least third and at least fourth oligonucleotide component are capable of self assembling in the presence of at least one additional methylated nucleic acid to form at least one additional catalytically active MNAzyme, and wherein at least one additional substrate is present in the sample, said additional substrate is capable of being modified by said additional MNAzyme, wherein said modification provides said additional detectable effect.
129. The method of claim 128 wherein said at least one additional detectable effect is independently detectable.
130. The method of claim 128 or 129 wherein each of the additional substrates are the same, different or a combination thereof.
131. The method of any one of claims 128-130 wherein at least one of said additional substrate is attached to an insoluble support so that only one of an additional detectable portion and an additional quencher portion of the additional substrate remain attached to the support when said additional substrate is modified by said additional MNAzyme.
132. A method for detecting at least one assembly facilitator using an amplification cascade comprising
(a) providing two or more oligonucleotide components comprising at least a first oligonucleotide component and at least a second oligonucleotide component that self assemble in the presence of at least a first assembly facilitator to form at least a first catalytically active multi-component nucleic acid enzyme (MNAzyme);
(b) providing an insoluble support having at least a first substrate attached thereto, said first substrate is capable of being modified by said MNAzyme, wherein said first substrate comprises at least a third molecule comprising at least a first catalytically active enzyme that is released upon modification of said first substrate by said first MNAzyme;
(c) contacting said two or more oligonucleotide components with a sample putatively containing said assembly facilitator, in the presence of said insoluble support having said first substrate attached thereto under conditions permitting: (1) the self-assembly of said MNAzyme, and
(2) the catalytic activity of said MNAzyme; and
(d) providing an insoluble support having at least a second substrate attached thereto, said second substrate cleavable by said first catalytically active enzyme wherein said second substrate comprises at least a fourth molecule comprising at least a detectable moiety which is released upon modification of said second substrate by said first enzyme; and
(e) wherein said first catalytically active enzyme modifies a plurality of said second substrate thereby releasing a plurality of detectable moieties (f) wherein said detectable moieties are detectable after modification of said second substrate by said first catalytically active enzyme, and;
(g) wherein detection of said detectable moieties is indicative of the presence of said assembly facilitator. 133. The method of claim 132 wherein said detectable moieties further comprise an additional second catalytically active enzyme capable of modifying said first substrate thereby releasing additional catalytically active enzyme.
134. The method of claim 133 wherein at least one of said first or said second catalytically active enzyme is selected from the group comprising MNAzymes, DNAzymes, ribozymes, hydrolytic enzymes, restriction endonucleases, exonucleases, proteases, proteinases, hydrolases, lyticases, peptidases, dipeptidases, esterases, caspases, cathepsisns, desulfhydrases, amidases, glycosidases.
135. The method of any one of claims 132 -134 wherein said assembly facilitator is a target to be identified, detected or quantified. 136. A method for detecting a target using an MNAzyme mediated signal amplification cascade comprising
(a) providing a first oligonucleotide component and a second oligonucleotide component that self assemble in the presence of said target to form a first catalytically active multi-component nucleic acid enzyme (MNAzyme); (b) providing an insoluble support having a first and a second substrate attached thereto, said first and second substrates are capable of being modified by said first MNAzyme, wherein said first and second substrates comprise at least a third and a fourth oligonucleotide component respectively, capable of forming a second catalytically active MNAzyme, wherein said third and fourth oligonucleotide components are released upon modification of said first and second substrates by said first MNAzyme;
(c) providing said insoluble support having a third and a fourth substrate attached thereto, said third and fourth substrates are capable of being modified by said second MNAzyme, wherein said third and fourth substrates comprise at least a fifth and a sixth oligonucleotide component respectively, capable of forming a third catalytically active MNAzyme, wherein said fifth and said sixth oligonucleotide components are released upon modification of said third and fourth substrates by said second MNAzyme, and;
(d) providing an assembly facilitator capable of facilitating the assembly of said second and said third MNAzyme, and; (e) providing a fifth substrate which is capable of being modified by said second
MNAzyme to provide a detectable effect;
(f) contacting said first and second oligonucleotide components with a sample putatively containing said target, in the presence of said assembly facilitator, and in the presence of said insoluble support having said first, second, third and fourth substrates attached thereto under conditions permitting:
(1) self-assembly of said first, second and third, MNAzymes, and
(2) catalytic activity of said first, second and third, MNAzymes; and
(g) wherein said third MNAzyme modifies said first and second substrates thereby further providing said second MNAzyme wherein said second MNAzyme further modifies at least one of said third, fourth and fifth substrates thereby further providing said third MNAzyme thereby further providing said detectable effect, and;
(h) wherein detection of said detectable effect is indicative of the presence of said target. 137. The method of claim 136 wherein said target is to be identified, detected or quantified.
138. The method of claim 136 or 137 wherein said fifth substrate is the same as or different to any one of said first, second, third or fourth substrates.
139. The method of any one of claims 132-138 wherein said target is selected from the group comprising nucleic acids, proteins, glycoproteins, lipids, lipoproteins, cells, viruses, bacteria, archaea, fungi, antibodies, metabolites, pathogens, toxins, contaminants, poisons, small molecules, polymers, metal ions, metal salts, prions, nucleic acids or any derivatives, portions or combinations thereof.
140. The method of claim 139 wherein said nucleic acid is selected from the group comprising DNA, methylated DNA, alkylated DNA, RNA, methylated RNA, microRNA, siRNA, shRNA, mRNA, tRNA, snoRNA, stRNA, smRNA, pre- and pri-microRNA, other non-coding RNAs, ribosomal RNA, derivatives thereof, amplicons thereof or any combination thereof.
141. The method of any one of claims 136-140 wherein each of said first, second, third or fourth substrates are present on the same solid support or different solid supports or any combination thereof.
142. The method of any one of claims 136-141 wherein said modification of at least one of said first, second, third or fourth substrates further provides a detectable effect.
143. A method for making a plurality of multi-component nucleic acid enzymes
(MNAzymes) that each recognize at least one assembly facilitator and modify a substrate, the method comprising:
(a) providing a plurality of assembly facilitators to be identified, detected or quantified,
(b) designing two or more oligonucleotide components wherein at least a first oligonucleotide component and a second oligonucleotide component self-assemble in the presence of an assembly facilitator to form a catalytically active multi-component nucleic acid enzyme (MNAzyme), wherein each of the at least first and second oligonucleotide o components comprise a substrate arm portion, a catalytic core portion, and a sensor arm portion, wherein upon self-assembly, the sensor arm portion of the first and second oligonucleotide components form sensor arms of the MNAzyme, the substrate arm portion of the first and second oligonucleotide components form substrate arms of the s MNAzyme, and the catalytic core portion of the first and second oligonucleotide components form a catalytic core of the MNAzyme; and wherein the sensor arms of the MNAzyme interact with an assembly facilitator so as to maintain the first and second oligonucleotide components in proximity for association of their respective catalytic core portions to form the catalytic core of the 0 MNAzyme, said catalytic core capable of acting on at least one substrate, and wherein the substrate arms of the MNAzyme engage a substrate so that the catalytic core of the
MNAzyme can modify said substrate;
(c) altering said two or more oligonucleotide components such that the substrate arm portion and the catalytic core portion of the first and second oligonucleotide s components is constant, and the sensor arm portion of at least one of the first and second oligonucleotide components is adapted to recognize another of the plurality of assembly facilitators, and
(d) repeating the altering step for each of the plurality of assembly facilitators.
144. A kit for detecting the presence of a plurality of targets comprising a plurality of o oligonucleotide components designed to assemble a plurality of MNAzymes each corresponding to at least one of a plurality of targets, and at least one substrate.
145. A kit for assembling a plurality of MNAzymes comprising a plurality of assembly facilitators, a plurality of oligonucleotide components designed to assemble a plurality of MNAzymes each one corresponding to each of the plurality of assembly facilitators, and at least one substrate.
146. A kit for detecting a target comprising a plurality of oligonucleotide components designed to assemble an MNAzyme corresponding to the target, and a substrate.
PCT/AU2006/001473 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use WO2007041774A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US72456705 true 2005-10-07 2005-10-07
US60/724,567 2005-10-07
US72629105 true 2005-10-13 2005-10-13
US60/726,291 2005-10-13

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
KR20087010332A KR101379621B1 (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
AT06790343T AT516369T (en) 2005-10-07 2006-10-06 Nucleic acid enzymes with several components and methods of use thereof
EP20060790343 EP1948822B1 (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
AU2006302729A AU2006302729B2 (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
CN 200680045926 CN101341260B (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
NZ56740306A NZ567403A (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
CA 2625263 CA2625263C (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
DK06790343T DK1948822T3 (en) 2005-10-07 2006-10-06 The multicomponent nukleinsyreenzymer and methods for their use
JP2008533829A JP5665272B2 (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use
BRPI0616466A2 BRPI0616466A2 (en) 2005-10-07 2006-10-06 Composition acid enzymes nucleic multicomponent (mnazima), methods for detecting the presence of at least one combination of a facilitator, a target, a variant of the nucleic acid sequence, to detect the presence of at least one methylated nucleic acid and detecting at least one enhancer combination using an amplification cascade, methods for manufacturing a plurality of multi-component nucleic acid enzymes (mnazima), and using at least one oligonucleotide
IL19050108A IL190501A (en) 2005-10-07 2008-03-27 Multicomponent nucleic acid enzymes and methods for their use
HK08111179A HK1116836A1 (en) 2005-10-07 2008-10-09 Multicomponent nucleic acid enzymes and methods for their use
AU2011202017A AU2011202017B2 (en) 2005-10-07 2011-05-03 Multicomponent nucleic acid enzymes and methods for their use

Publications (1)

Publication Number Publication Date
WO2007041774A1 true true WO2007041774A1 (en) 2007-04-19

Family

ID=37942211

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2006/001473 WO2007041774A1 (en) 2005-10-07 2006-10-06 Multicomponent nucleic acid enzymes and methods for their use

Country Status (9)

Country Link
US (2) US8394946B2 (en)
EP (2) EP2385141B1 (en)
JP (1) JP5665272B2 (en)
KR (1) KR101379621B1 (en)
CN (1) CN103789311A (en)
CA (1) CA2625263C (en)
DK (2) DK2385141T3 (en)
ES (1) ES2431076T3 (en)
WO (1) WO2007041774A1 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008040095A1 (en) * 2006-10-06 2008-04-10 Johnson & Johnson Research Pty Limited Molecular switches and methods for their use
WO2008122084A1 (en) * 2007-04-05 2008-10-16 Johnson & Johnson Research Pty Limited Nucleic acid enzymes and complexes and methods for their use
WO2008054834A3 (en) * 2006-02-03 2009-04-09 Dmitry Kolpashcikov Binary deoxyribozyme probes for nucleic acid analysis
WO2010101951A1 (en) 2009-03-02 2010-09-10 Alnylam Pharmaceuticals, Inc. Nucleic acid chemical modifications
WO2011123621A2 (en) 2010-04-01 2011-10-06 Alnylam Pharmaceuticals Inc. 2' and 5' modified monomers and oligonucleotides
EP2385119A1 (en) * 2007-04-06 2011-11-09 Virco BVBA Respiratory syncytial virus (RSV) viral load detection assay
WO2012065231A1 (en) * 2010-11-19 2012-05-24 Speedx Pty Ltd Signal amplification
WO2012095303A1 (en) * 2011-01-10 2012-07-19 Noxxon Pharma Ag Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
EP2504453A2 (en) * 2009-11-23 2012-10-03 Becton, Dickinson and Company Assay method for target nucleic acid by signal amplification using probe hybridization and restriction
WO2012135845A1 (en) 2011-04-01 2012-10-04 Qiagen Gene expression signature for wnt/b-catenin signaling pathway and use thereof
US8394946B2 (en) 2005-10-07 2013-03-12 Speedx Pty Ltd Multicomponent nucleic acid enzymes and methods for their use
WO2013033792A1 (en) 2011-09-09 2013-03-14 Speedx Pty Ltd Nucleic acid enzyme substrates
US8673551B2 (en) 2005-12-07 2014-03-18 Speedx Pty Ltd. Methods, plasmid vectors and primers for assessing HIV viral fitness
US9051606B2 (en) 2010-09-10 2015-06-09 Qiagen Gaithersburg, Inc. Methods and compositions for nucleic acid detection
US20160083785A1 (en) * 2012-06-18 2016-03-24 Speedx Pty Ltd Target detection and signal amplification
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
EP3372691A1 (en) * 2017-03-06 2018-09-12 Technische Universität Braunschweig Arrangement for detecting and amplifying a signal based on a single target molecule and method for detecting and amplifying a signal based on a single target molecule
EP3305913A4 (en) * 2015-05-29 2018-10-31 Toppan Printing Co., Ltd. Nucleic acid detection method, nucleic acid quantitative determination method, nucleic acid base sequence identification method, nucleic acid mutation or polymorphism identification method, nucleic acid detection kit, and reaction chip

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2255599C (en) 1996-04-25 2006-09-05 Bioarray Solutions, Llc Light-controlled electrokinetic assembly of particles near surfaces
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
ES2259666T3 (en) 2000-06-21 2006-10-16 Bioarray Solutions Ltd molecular analysis of multiple analytes using series of random particles with specificity application.
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
US7041453B2 (en) * 2002-08-22 2006-05-09 Bioarray Solutions Ltd. Molecular constructs and methods of use for detection of biochemical reactions
US7526114B2 (en) 2002-11-15 2009-04-28 Bioarray Solutions Ltd. Analysis, secure access to, and transmission of array images
US7927796B2 (en) 2003-09-18 2011-04-19 Bioarray Solutions, Ltd. Number coding for identification of subtypes of coded types of solid phase carriers
ES2533876T3 (en) 2003-10-29 2015-04-15 Bioarray Solutions Ltd Multiplexed analysis of nucleic acids by fragmentation dsDNA
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
US8486629B2 (en) 2005-06-01 2013-07-16 Bioarray Solutions, Ltd. Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation
WO2007115242A3 (en) * 2006-03-31 2009-04-16 Univ Columbia Binary probes for fluorescent analysis of nucleic acids
KR100896987B1 (en) * 2007-03-14 2009-05-14 한국과학기술연구원 Detection method for target protein using aptamer and the detection kit
US8043810B2 (en) * 2007-05-02 2011-10-25 Eagle Eye Research, Inc. Analyte detection using autocatalytic chain reactions
US8551768B2 (en) 2008-11-21 2013-10-08 The Trustees Of Columbia University In The City Of New York Split DNA enzyme for visual single nucleotide polymorphism typing
US8853134B2 (en) 2009-01-28 2014-10-07 The Trustees Of Columbia University In The City Of New York Microarrays of binary nucleic acid probes for detecting nucleic acid analytes
US8859266B2 (en) * 2010-04-28 2014-10-14 University Of Central Florida Research Foundation, Inc. Binary probe system for sensitive detection of target analytes
CA2810928A1 (en) 2010-09-22 2012-03-29 Alios Biopharma, Inc. Substituted nucleotide analogs
KR20140139497A (en) * 2012-02-20 2014-12-05 스피디엑스 피티와이 리미티드 Detection of nucleic acids
CN104321333A (en) 2012-03-21 2015-01-28 沃泰克斯药物股份有限公司 Solid forms of a thiophosphoramidate nucleotide prodrug
US9012427B2 (en) 2012-03-22 2015-04-21 Alios Biopharma, Inc. Pharmaceutical combinations comprising a thionucleotide analog
US9476090B2 (en) 2013-05-21 2016-10-25 Stc.Unm Signal propagation biomolecules, devices and methods
US10036056B2 (en) * 2013-06-12 2018-07-31 The Governing Council Of The University Of Toronto Catalytic nucleic acid and gold nanoparticles for detection of biomolecules
WO2017195137A1 (en) * 2016-05-10 2017-11-16 Nicolas Arab Compositions and methods for identifying, quantifying, and/or characterizing an analyte

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589332A (en) * 1992-12-04 1996-12-31 Innovir Laboratories, Inc. Ribozyme amplified diagnostics
WO1999050452A1 (en) 1998-03-27 1999-10-07 Johnson & Johnson Research Pty. Limited Catalytic nucleic acid-based diagnostic methods
WO2000058505A1 (en) 1999-03-26 2000-10-05 Artus Gesellschaft für molekularbiologische Diagnostik und Entwicklung mbH Detection of nucleic acid amplified products
WO2003089650A2 (en) 2001-11-05 2003-10-30 Sirna Therapeutics, Inc. Allosteric nucleic acid sensor molecules
WO2005073405A2 (en) 2004-01-29 2005-08-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Catalytic polynucleotide and its use for determination of analytes

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4000159A (en) 1974-06-28 1976-12-28 Phillips Petroleum Company Preparation of n,n-disubstituted thioamides
US5176995A (en) 1985-03-28 1993-01-05 Hoffmann-La Roche Inc. Detection of viruses by amplification and hybridization
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5424413A (en) 1992-01-22 1995-06-13 Gen-Probe Incorporated Branched nucleic acid probes
US5807718A (en) 1994-12-02 1998-09-15 The Scripps Research Institute Enzymatic DNA molecules
US5545729A (en) 1994-12-22 1996-08-13 Hybridon, Inc. Stabilized ribozyme analogs
US7141665B1 (en) 1998-04-29 2006-11-28 The Scripps Research Institute Enzymatic DNA molecules
EP2275546A3 (en) 1997-04-29 2013-06-05 The Scripps Research Institute Enzymatic DNA molecules
US6140055A (en) 1998-03-05 2000-10-31 Johnson & Johnson Research Pty Limited Zymogenic nucleic acid detection methods and related kits
WO1999046388A1 (en) 1998-03-12 1999-09-16 Taisho Pharmaceutical Co., Ltd. Nucleic acid enzyme showing allosteric rna-cleaving activity on target rna
DE19811618C1 (en) * 1998-03-17 2000-08-31 Andreas Jenne Ribozyme encoding DNA and an oligonucleotide substrate containing composition and method for measuring transcription rates
JP2003525631A (en) 2000-03-06 2003-09-02 リボザイム・ファーマシューティカルズ・インコーポレーテッド Nucleic acid sensor molecule
JP3595843B2 (en) 2000-10-13 2004-12-02 独立行政法人産業技術総合研究所 Enzymatic nucleic acid to obtain a cleavage activity against other specific target rna by recognizing Rna molecule
WO2005051174A3 (en) 2003-11-21 2007-03-08 Lawrence Chasin Nucleic acid aptamer-based compositions and methods
US7553945B2 (en) 2005-08-03 2009-06-30 Bowling Green State University RNA complexes and methods of their production
CA2625263C (en) 2005-10-07 2016-12-13 Johnson & Johnson Research Pty Limited Multicomponent nucleic acid enzymes and methods for their use
US20120101267A1 (en) 2005-10-07 2012-04-26 Alison Velyian Todd Multicomponent nucleic acid enzymes with cleavage, ligase or other activity and methods for their use
WO2008054834A9 (en) 2006-02-03 2009-07-09 Dmitry Kolpashcikov Binary deoxyribozyme probes for nucleic acid analysis
JP5688507B2 (en) 2006-10-06 2015-03-25 スピーデクス ピーティーワイ リミテッド Methods for molecular switches and their uses
EP2385119B1 (en) 2007-04-06 2015-11-11 Janssen Diagnostics BVBA Respiratory syncytial virus (RSV) viral load detection assay
WO2009022125A8 (en) 2007-08-13 2009-07-16 Karen Faulds Identification of nucleic acid sequences
US20110207132A1 (en) 2008-08-04 2011-08-25 University Of Maryland Probes and methods for detecting analytes
US9602380B2 (en) 2014-03-28 2017-03-21 Futurewei Technologies, Inc. Context-aware dynamic policy selection for load balancing behavior

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589332A (en) * 1992-12-04 1996-12-31 Innovir Laboratories, Inc. Ribozyme amplified diagnostics
WO1999050452A1 (en) 1998-03-27 1999-10-07 Johnson & Johnson Research Pty. Limited Catalytic nucleic acid-based diagnostic methods
WO2000058505A1 (en) 1999-03-26 2000-10-05 Artus Gesellschaft für molekularbiologische Diagnostik und Entwicklung mbH Detection of nucleic acid amplified products
WO2003089650A2 (en) 2001-11-05 2003-10-30 Sirna Therapeutics, Inc. Allosteric nucleic acid sensor molecules
WO2005073405A2 (en) 2004-01-29 2005-08-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Catalytic polynucleotide and its use for determination of analytes

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
HAYDEN E.J. ET AL: "Self-Assembly of a Group I Intron from Inactive Oligonucleotide Fragments (abstract, Introduction)", N. CHEMISTRY & BIOLOGY, vol. 13, no. 8, 2006, pages 909 - 918, XP003011772 *
KOSSEN, K. ET AL., CHEMISTRY & BIOLOGY, vol. 11, 2004, pages 807 - 815
KOSSEN, K. ET AL., RNA, vol. 9, 2003, pages 1058 - 1072
See also references of EP1948822A4 *
XIAO Y. ET AL: "Lighting Up Biochemiluminescence by the Surface Self-Assembly of DNA-Hemin Complexes", CHEMBIOCHEM, vol. 5, no. 3, 2004, pages 374 - 379, XP003011771 *
XIAO, Y. ET AL., CHEM. BIOCHEM, vol. 5, no. 3, 2004, pages 374 - 379

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8945836B2 (en) 2005-10-07 2015-02-03 Speedx Pty Ltd Multicomponent nucleic acid enzymes and methods for their use
US8394946B2 (en) 2005-10-07 2013-03-12 Speedx Pty Ltd Multicomponent nucleic acid enzymes and methods for their use
US8673551B2 (en) 2005-12-07 2014-03-18 Speedx Pty Ltd. Methods, plasmid vectors and primers for assessing HIV viral fitness
WO2008054834A3 (en) * 2006-02-03 2009-04-09 Dmitry Kolpashcikov Binary deoxyribozyme probes for nucleic acid analysis
US8354227B2 (en) 2006-02-03 2013-01-15 Columbia University In The City Of New York Binary deoxyribozyme probes for nucleic acid analysis
US9127311B2 (en) 2006-10-06 2015-09-08 Speedx Pty Ltd Molecular switches and methods for their use
CN101600808B (en) 2006-10-06 2014-07-09 强生研究有限公司 Molecular switches and methods for their use
WO2008040095A1 (en) * 2006-10-06 2008-04-10 Johnson & Johnson Research Pty Limited Molecular switches and methods for their use
CN101802216B (en) * 2007-04-05 2014-12-10 斯比戴克斯私人有限公司 Nucleic acid enzymes and complexes and methods for their use
US8962238B2 (en) 2007-04-05 2015-02-24 SpeedDx Pty Ltd Nucleic acid enzymes and complexes and methods for their use
WO2008122084A1 (en) * 2007-04-05 2008-10-16 Johnson & Johnson Research Pty Limited Nucleic acid enzymes and complexes and methods for their use
EP2385119A1 (en) * 2007-04-06 2011-11-09 Virco BVBA Respiratory syncytial virus (RSV) viral load detection assay
US8409803B2 (en) 2007-04-06 2013-04-02 Speedx Pty Ltd. Respiratory syncytial virus (RSV) viral load detection assay
WO2010101951A1 (en) 2009-03-02 2010-09-10 Alnylam Pharmaceuticals, Inc. Nucleic acid chemical modifications
EP2669290A1 (en) 2009-03-02 2013-12-04 Alnylam Pharmaceuticals Inc. Nucleic Acid Chemical Modifications
US8916349B2 (en) 2009-11-23 2014-12-23 Becton, Dickinson And Company Assay method for target nucleic acid by signal amplification using probe hybridization and restriction
EP2504453A4 (en) * 2009-11-23 2013-07-17 Becton Dickinson Co Assay method for target nucleic acid by signal amplification using probe hybridization and restriction
EP2504453A2 (en) * 2009-11-23 2012-10-03 Becton, Dickinson and Company Assay method for target nucleic acid by signal amplification using probe hybridization and restriction
WO2011123621A2 (en) 2010-04-01 2011-10-06 Alnylam Pharmaceuticals Inc. 2' and 5' modified monomers and oligonucleotides
US9051606B2 (en) 2010-09-10 2015-06-09 Qiagen Gaithersburg, Inc. Methods and compositions for nucleic acid detection
US9862990B2 (en) 2010-11-19 2018-01-09 Speedx Pty Ltd Signal amplification
EP2640852A4 (en) * 2010-11-19 2014-05-14 Speedx Pty Ltd Signal amplification
WO2012065231A1 (en) * 2010-11-19 2012-05-24 Speedx Pty Ltd Signal amplification
EP2640852A1 (en) * 2010-11-19 2013-09-25 Speedx Pty Ltd Signal amplification
WO2012095303A1 (en) * 2011-01-10 2012-07-19 Noxxon Pharma Ag Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
WO2012135845A1 (en) 2011-04-01 2012-10-04 Qiagen Gene expression signature for wnt/b-catenin signaling pathway and use thereof
WO2013033792A1 (en) 2011-09-09 2013-03-14 Speedx Pty Ltd Nucleic acid enzyme substrates
RU2650806C2 (en) * 2011-09-09 2018-04-17 Спидкс Пти Лтд Substrates of nucleic acids with enzymatic activity
US20160083785A1 (en) * 2012-06-18 2016-03-24 Speedx Pty Ltd Target detection and signal amplification
US9725757B2 (en) * 2012-06-18 2017-08-08 Speedx Pty Ltd Target detection and signal amplification
EP3305913A4 (en) * 2015-05-29 2018-10-31 Toppan Printing Co., Ltd. Nucleic acid detection method, nucleic acid quantitative determination method, nucleic acid base sequence identification method, nucleic acid mutation or polymorphism identification method, nucleic acid detection kit, and reaction chip
EP3372691A1 (en) * 2017-03-06 2018-09-12 Technische Universität Braunschweig Arrangement for detecting and amplifying a signal based on a single target molecule and method for detecting and amplifying a signal based on a single target molecule

Also Published As

Publication number Publication date Type
DK2385141T3 (en) 2013-10-28 grant
CA2625263C (en) 2016-12-13 grant
KR101379621B1 (en) 2014-04-11 grant
US8394946B2 (en) 2013-03-12 grant
JP5665272B2 (en) 2015-02-04 grant
EP1948822B1 (en) 2011-07-13 grant
JP2009509551A (en) 2009-03-12 application
ES2431076T3 (en) 2013-11-25 grant
KR20080071130A (en) 2008-08-01 application
US20070231810A1 (en) 2007-10-04 application
EP1948822A1 (en) 2008-07-30 application
EP2385141B1 (en) 2013-08-07 grant
CN103789311A (en) 2014-05-14 application
EP2385141A1 (en) 2011-11-09 application
CA2625263A1 (en) 2007-04-19 application
EP1948822A4 (en) 2009-10-28 application
US8945836B2 (en) 2015-02-03 grant
US20130123480A1 (en) 2013-05-16 application
DK1948822T3 (en) 2011-10-17 grant

Similar Documents

Publication Publication Date Title
Li et al. Rational, modular adaptation of enzyme-free DNA circuits to multiple detection methods
Carmi et al. In vitro selection of self-cleaving DNAs
US5589332A (en) Ribozyme amplified diagnostics
US7005261B1 (en) Method for detecting nucleic acid target sequences involving in vitro transcription from an RNA polymerase promoter
US20070048758A1 (en) Improved primer-based amplification methods
US6593091B2 (en) Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer
US7435561B2 (en) Methods for multiplexing recombinase polymerase amplification
Asseline Development and applications of fluorescent oligonucleotides
Wang et al. Molecular engineering of DNA: molecular beacons
US6326174B1 (en) Enzymatic DNA molecules
Sidorov et al. Sequence‐specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities
US6140055A (en) Zymogenic nucleic acid detection methods and related kits
US20050074788A1 (en) Detection of small nucleic acids
US20050227257A1 (en) Double stranded linear nucleic acid probe and uses thereof
WO2003033732A2 (en) Real-time detection of dna amplification products
WO2000058505A1 (en) Detection of nucleic acid amplified products
US6815164B2 (en) Methods and probes for detection and/or quantification of nucleic acid sequences
Yang et al. Synthesis and investigation of deoxyribonucleic acid/locked nucleic acid chimeric molecular beacons
US20080194416A1 (en) Detection of mature small rna molecules
WO2012096523A2 (en) Detection of target nucleic acid sequences by pto cleavage and extension assay
WO1998049346A1 (en) Enzymatic dna molecules
US20060240462A1 (en) Methods for amplification and detection of nucleic acids
WO2000071562A1 (en) High specificity primers, amplification methods and kits
Kolpashchikov A binary deoxyribozyme for nucleic acid analysis
Lin et al. Backbone-modified molecular beacons for highly sensitive and selective detection of microRNAs based on duplex specific nuclease signal amplification

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2008533829

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: MX/a/2008/004039

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 190501

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2006790343

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2625263

Country of ref document: CA

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006302729

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 567403

Country of ref document: NZ

WWP Wipo information: published in national office

Ref document number: 2006302729

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2270/CHENP/2008

Country of ref document: IN

WWP Wipo information: published in national office

Ref document number: 2006790343

Country of ref document: EP

ENP Entry into the national phase in:

Ref document number: PI0616466

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20080328