WO2007033436A1 - Modulation of gene expression and agents useful for same - Google Patents

Modulation of gene expression and agents useful for same Download PDF

Info

Publication number
WO2007033436A1
WO2007033436A1 PCT/AU2006/001402 AU2006001402W WO2007033436A1 WO 2007033436 A1 WO2007033436 A1 WO 2007033436A1 AU 2006001402 W AU2006001402 W AU 2006001402W WO 2007033436 A1 WO2007033436 A1 WO 2007033436A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
cell
target gene
rna
species
Prior art date
Application number
PCT/AU2006/001402
Other languages
French (fr)
Inventor
Bernard Carroll
Original Assignee
The University Of Queensland
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2005905307A external-priority patent/AU2005905307A0/en
Application filed by The University Of Queensland filed Critical The University Of Queensland
Publication of WO2007033436A1 publication Critical patent/WO2007033436A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised

Definitions

  • the present invention relates generally to the field of gene expression and more particularly the modulation of gene expression by transcriptional and post-transcriptional gene silencing mechanisms. Even more particularly, the present invention provides agents and protocols for modulating gene expression and their use in manipulating phenotypes and traits.
  • Gene silencing is an important tool in molecular biology and genetic engineering. There is great potential to generate genetically modified plants and animals which exhibit altered phenotypes having commercially or therapeutically useful properties. Some success has already been achieved in generating genetically modified plants and animals. However, gene silencing, and in particular targeted gene silencing is not always consistently successful or effective.
  • RNA interference RNA interference
  • dsRNA double-stranded RNA
  • DCL DICER and DICER-like proteins
  • RISC small interfering RNA
  • PTGS post-transcriptional gene silencing
  • TLS transcriptional gene silencing
  • RNA-dependent RNA polymerases In plants, a new class of nuclear DNA-dependent RNA polymerase (Pol IV), as well as RNA-dependent RNA polymerases (RDRs) have also been shown to be important components of PTGS and/or methylation of transposons and repetitive DNA.
  • NRPDIa which encodes a large subunit of Pol IVa, is so far unique in that mutants show both partial loss of PTGS and TGS of certain transposons and repetitive sequences.
  • PTGS An interesting feature of PTGS in plants and worms is that it can be systemically transmitted throughout the organism.
  • dsRNA When dsRNA is expressed or injected in one tissue of the organism, PTGS spreads to other tissues.
  • the mobile signals are likely to be nucleic acids since systemic silencing is highly sequence-specific.
  • SID-I One gene has been identified in C. elegans that is required for systemic spreading of PTGS called SID-I which encodes a transmembrane protein involved in transport of dsRNA.
  • SID-I which encodes a transmembrane protein involved in transport of dsRNA.
  • the present invention provides an enhanced method of inhibiting expression of a target gene including a viral genome in a cell by subjecting the gene to both RNA-directed transcriptional gene silencing (TGS) and RNAi-mediated post-transcriptional gene silencing (PTGS).
  • TGS RNA-directed transcriptional gene silencing
  • PTGS RNAi-mediated post-transcriptional gene silencing
  • a "gene” in this context is any nucleotide sequence which is subject to transcription or potential transcription and includes all or part of a viral genome.
  • one or more components of either the TGS or PTGS pathway may be up-regulated or otherwise targeted to facilitate target gene silencing.
  • the method and agents of the present invention are useful in manipulating phenotypes and traits in plants and animals and can facilitate genetic therapy, maintenance and regeneration.
  • the essence of the instant invention lies in part in the ability to stimulate both TGS and PTGS via nuclear RNA signaling.
  • the RNA signal corresponds to an RNA silencing species comprising a single stranded (ss) or double stranded (ds) RNA molecule which may be DNA-derived or synthetic.
  • RNA silencing species include short or long ds-RNA molecules, hairpin species and partial hairpin species which comprise a strand having a nucleotide sequence capable of hybridizing or forming a complex with a DNA strand of the target gene.
  • the target gene in this instance refers to the actual target gene as well as introduced homologous target sequence.
  • RNA polymerase IV RNA polymerase IV
  • RDR2 RNA-dependent RNA polymerase 2
  • DCL3 DICER-like3
  • ARGONAUTE4 AGO4
  • RNA silencing species and the target gene (actual and/or homologous) or a transcript thereof lead to a synergistic effect in relation to inhibition of gene expression.
  • RNA silencing species may be produced in the same cell as the target gene or homologous target sequence or produced in a differenT-cell or introduced to a subject wherein it enters the cell carrying the target gene or homologous sequence.
  • local (same cell, i.e. intra-cell) or remote (long distance, i.e. inter-cell) RNA signaling forms part of the present invention.
  • RNAi is triggered by dsRNA which is processed by DICER and DICER-like proteins into small interfering RNA (siRNA). These small RNA guide an RNA-initiated silencing complex (RISC) to mediate PTGS of target transcript.
  • RISC RNA-initiated silencing complex
  • RNA silencing species may be generated in the same cell or a differenT-cell as the target gene. Consequently, short and long distance (i.e. cell autonomous and non-cell autonomous) RNA silencing is contemplated by the present invention.
  • one aspect of the present invention contemplates a method of inhibiting expression of a target gene in a cell said method comprising:
  • RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene
  • inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
  • step (ii) may occur first or simultaneous with step (i).
  • one or other of the step (i) or (ii) may occur through conventional breeding.
  • this aspect of the present invention covers both intra-cellular and intercellular RNA signalling.
  • the RNA silencing species may be generated in the same cell as the target gene or homologous target sequence or in a differenT-cell.
  • RNA transcript in part (ii) comprises at least 5 contiguous nucleotides homologous to the transcript of the actual target gene and is referred to as the "homologous target sequence".
  • “At least 5 nucleotides” means from about 5 nucleotides to the full length transcript. This term does not imply that the homologous target sequence represents the full length target gene RNA transcript although this may be the case.
  • target gene includes the actual target gene and an introduced or generated homologous sequence. In one embodiment, the 5' end of a gene transcript is targeted. In another embodiment, the 3' end is targeted. The former is useful for targeting gene families (including viral families) whilst the latter is useful for targeting specific members of a gene family or viral family.
  • a further homologous target (full or part length of a target gene) is required.
  • the transcriptional gene silencing is via an siRNA pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6.
  • the RNA silencing species is a DNA-derived RNA species. In another embodiment, it is a synthetic RNA. In still another embodiment, the RNA silencing species is generated in a cell which does not comprise the actual target gene or the homologous target sequence.
  • the present invention contemplates, therefore, a method for generating a genetically modified cell including a subject comprising said cell or a relative including progeny of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of: (a) a second DNA which generates an RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene;
  • RNA amplification or degradative pathway selected from Pol IV, RDR2, DCL3, AG04 and RDR6.
  • the present invention still further provides a method for altering the phenotype of a cell or a relative of said cell or a subject comprising said cell or a relative including progeny of said cells, said method comprising:
  • RNA transcript (a) introducing to said cell or its relative including progeny cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an RNA transcript is generated which is substantially homologous to at least 5 contiguous nucleotides of an RNA transcript of the target gene; and/or
  • RNA amplification or degradation pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
  • part (b) examples include contacting cells with chemicals, drugs, biological agents or other stimuli to increase gene copy number and/or rates of transcription.
  • Another aspect of the present invention provides a method for inhibiting expression of a target gene in a cell of a recipient said method comprising:
  • introducing genetic constructs into at least two subpopulations of the same population of cells or in two different populations of cells wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and is introduced into one population or subpopulation of cells and a second construct comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene is introduced into the other population or subpopulation of cells;
  • Still another aspect of the present invention provides a method of treatment of a recipient requiring silencing of expression of a target gene said method comprising introducing autologous cells from said recipient modified to generate a transcript of said target gene and introducing to said recipient a DNA-derived or synthetic RNA silencing species or an autologous cell modified to generate the DNA-derived RNA silencing species wherein upon entry of the RNA silencing species into the cells comprising a transcript of the target gene, expression of said target gene is inhibited by TGS and PTGS.
  • Yet another aspect of the present invention is directed to a phenotypic modifying kit for a subject comprising:
  • RNA silencing species specific for a target gene or cells capable of generating same (i) an RNA silencing species specific for a target gene or cells capable of generating same;
  • instructions for use comprising introducing into said subject the genetic construct or cells comprising same such that the subject establishes a population of said cells, introducing to said subject the RNA silencing species or cells comprising same and monitoring for gene silencing via a TGS pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6 and a PTGS pathway via RISC.
  • target gene refers to both the actual target gene (e.g. endogenous gene, onco gene, viral gene, pathogen gene etc.) or an introduced homologous gene sequence. It also refers to any viral genetic sequence which is transcribed as part of the infection, insertion, maintenance, assembly or release process. Hence, the term “gene” includes, therefore, a viral genetic sequence.
  • the "homologous” sequence may correspond to or encode from about 5 to about full length transcript of the target gene. If it is less than full length, then it includes from about 5 to about 10,000 nucleotides.
  • the present invention provides genetic constructs enabling the production of hairpin and sense strands directed to particular genes or their transcripts.
  • Figures Ia and b is a diagrammatic representation of a proposed model for nuclear reception of the RNA silencing signal.
  • Figure 2 is a schematic representation of the T-DNA regions of binary vectors used to produce target and silencer transgenic Arabidopsis lines,
  • pUQC214 was used to produce target plant lines expressing GFP.
  • pUQC218 was used to produce S2 silencer lines expressing a GF-specif ⁇ c dsRNA (RNAi) transgene and a functional, albeit silenced, GFP transgene.
  • pUQC252 was used to produce Sl silencer lines expressing the same GF-specific dsRNA (RNAi) transgene but without a GFP transgene.
  • pUQC1081 was used to produce the BAR S2 silencer line expressing ⁇ r-specific siRNAs.
  • LB T-DNA left border
  • RB T-DNA right border
  • 35S Cauliflower Mosaic Virus 35S promoter
  • ocs octopine synthase 3' terminator
  • BAR confers resistance to the herbicide phosphinothricin
  • NPTII confers resistance to kanamycin.
  • Figure 3 is a diagrammatic and photographic representation showing graft-transmissible mRNA silencing in wild-type Arabidopsis.
  • Reciprocal grafts involving DCL3 target scions and wild-type silenced rootstocks revealed that DCL3 was required for scion tissue to respond to mobile silencing signal. No silencing of GFP or its transcript was observed in mutant DCL3 scion.
  • Figure 5 is a pictorial representation showing that sense and hairpin transgenes act synergistically to induce RNAi-based resistance to potato virus Y in tobacco.
  • Figure 6 is a pictorial representation showing long-distance transmission of RNAi-based resistance to potato virus Y in tobacco requires a sense transgene.
  • Figure 7 is a graphical representation showing a homologous BAR sense transgene decreases the amount of double standard RNA produced by a BAR hairpin transgene (PX).001).
  • Figure 8 is diagrammatic representation showing predictions for enhanced RNAi against HIV, Hepatitis B, Hepatitis C and the deleterious endogenous genes.
  • Figure 9 is a photographic representation showing the dell 3 T-DNA insertion mutant, (a) Northern blot analysis of wild-type Columbia and dell 3 mutant, (b) Wild-type Columbia and del 13 mutant phenotypes.
  • Figure 10 is a representation of the alignment of P-specific 5' RACE products.
  • the bold, underlined G in italic represents the 400 th nucleotide of GFP and the final nucleotide of the GF-specific sequence that was used to construct the GF-specific dsRNA (RNAi) transgene.
  • RNAi GF-specific dsRNA
  • Sequence analysis often 5' RACE products showed that five started at 52 nucleotides, and the other five started at 37, 40, 49, 58 and 79 nucleotides, into the P sequence of GFP.
  • Figure 11 is a photographic representation showing the genes required for long-distance mRNA silencing, (a) Small RNA from WT S2 and dcll3 S2 plants probed with full-length GFP.
  • Figure 12 is a photographic representation of the molecular genetic analysis of graft- transmissible mRNA silencing, (a) Agarose gel electrophoresis of 5' RACE products from GFP-silenced target scions grafted onto S2 rootstocks. The white bracket indicates the region cloned and sequenced (see Figure 10). Lower panel represents the 5' RACE amplification of the miRl 71 -cleaved SCL6-IV transcript, (b) Target GFP transgene showing the regions used as probes for small RNA analysis, (c) Small RNA analysis of WT scions within the first 70 nucleotides of P.
  • Figures 13a and b are a schematic representation and photographic representations of plants expressing GFP under the p35S promoter and FG and GF under the pRCH promoter.
  • the construct is pUQC 10027 staining is shown 8 days, 17 days and 24 days after planting.
  • the present invention provides methods of genetically modifying cells, relatives including parents and progeny of these cells and subjects comprising some or all of these cells.
  • the genetic modification includes directly inhibiting expression of one or more target genes ("actual target gene") as well as indirectly modulating expression of a gene by inhibiting expression of another gene which encodes a regulator of expression of the first mentioned gene.
  • a "target gene” in this instance includes a viral genetic sequence. More particularly, the present invention enables effective inhibition of expression of a target gene in a cell via mechanisms of transcriptional and post-transcriptional gene silencing ("TGS" and "PTGS", respectively).
  • Reference to a "relative" of a cell includes a precursor, parent or progeny of a particular cell as well as a fusion between two or more relative cells or a relative and a non-relative cell.
  • the ability to modify gene expression enables phenotypes and traits to be modified in plants and animals and helps facilitate genetic therapy, maintenance and regeneration.
  • Inhibition of expression of a target gene is accomplished in a cell by:
  • RNA silencing species directed to the target gene and one or more of:
  • RNA transcript (a) introducing to said cell or its relative cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an RNA transcript ("homologous target sequence") is generated which is substantially homologous to at least 5 contiguous nucleotides of an RNA transcript of the actual target gene; and/or
  • RNA degradative pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
  • a “gene” in this context is any nucleotide sequence which is transcribed or capable of transcription and includes all or part of a viral genome.
  • one aspect of the present invention provides a method of inhibiting expression of a target gene in a cell said method comprising:
  • RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene
  • inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
  • the present invention contemplates, therefore, a method for generating a genetically modified cell including a subject comprising said cell or a relative of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of:
  • RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene
  • RNA silencing species DNA-derived or synthetic
  • an introduced nucleotide sequence which is homologous to a particular target gene or part thereof or a transcript thereof.
  • a homologous nucleotide sequence is not introduced but the copy number or level of expression of the actual target gene is increased such as by chemical or biological means.
  • the combination of RNA silencing species and homologous target sequence is, in a preferred embodiment, a synergistic combination.
  • FIG. Ia and b A proposed non-limiting model summarizing the molecular events in reception of RNA mediated signalling is shown in Figures Ia and b.
  • this model single stranded or double stranded RNA is introduced into the nuclei of cells where it hybridizes to the homologous transgene. This stimulates PolIV-DRD2-DCL3 activity on adjacent chromation to produce siRNA. AG04 in association with siRNA then directs partial cleavage of the target mRNA population in the nucleus.
  • decapped, polyadenylated target RNA is then exported from the nucleus and becomes a substrate for RDR6 to execute RNA silencing.
  • the present invention still further provides a method for altering the phenotype of a cell or a subject comprising said cell or a subject comprising said cell or a relative of said cell said method comprising:
  • RNA silencing species directed to the target gene comprising:
  • constructs are generated depending on whether a gene family (or virus family) is to be down-regulated or whether a single member of a gene family (or virus family) is to be inhibited.
  • a gene family or virus family
  • constructs are generated depending on whether a gene family (or virus family) is to be down-regulated or whether a single member of a gene family (or virus family) is to be inhibited.
  • the 5' end of an mRNA transcript is targeted with homologous dsRNA.
  • the 3' end is targeted with homologous dsRNA.
  • the method of the present invention enables selective inhibition of gene expression and indirect modulation of expression of other genes regulated by the first mentioned gene by TGS and PTGS.
  • the essence of the invention is in part the ability to stimulate both TGS and PTGS via nuclear RNA signaling.
  • the RNA signal corresponds to an RNA silencing species comprising a ds-RNA molecule which may be DNA-derived or synthetic.
  • RNA silencing species include short or long ds-RNA molecules, hairpin and partial hairpin species which comprise a strand having a nucleotide sequence capable of hybridizing or forming a complex with a DNA strand of the actual target gene or homologous target sequence.
  • the RNA silencing species may form a complex with either strand of the target gene. This leads to TGS via a pathway involving Pol IV, RDR2, DCL3, AGO4 and RDR6.
  • RNAi is triggered by dsRNA which is processed by DICER and DICER-like proteins into small interfering RNA (siRNA). These small RNA guide RISC to mediate PTGS of target transcripts.
  • subject and “recipient” are used interchangeably to refer to a multi-cellular (i.e. two or more cells) organism, plant or animal.
  • the “subject” may also be a target virus.
  • one aspect of the present invention contemplates a method of inhibiting expression of a target gene in a cell said method comprising:
  • RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene
  • inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
  • the TGS is via a RNA degradative pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6.
  • the RNA silencing species is a DNA-derived RNAi species. In another embodiment, it is a synthetic RNA. In still another embodiment, the RNA silencing species is generated in a cell which does not comprise the actual target gene or homologous target sequence.
  • Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and/or RNA (e.g. mRNA) product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay
  • RNA-mediated inhibition in a cell, cell line or whole organism gene expression is conveniently assayed by use of a reporter or drug resistance gene whose protein product is readily assayed.
  • Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS) 5 chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof.
  • AHAS acetohydroxyacid synthase
  • AP alkaline phosphatase
  • LacZ beta galactosidase
  • GUS beta glucuronidase 5 chloramphenicol acetyltransferase
  • GFP chloramphenicol acetyltransferase
  • GFP green fluorescent protein
  • HRP horseradish peroxidase
  • Luc nopaline synthase
  • OCS octopine
  • Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin.
  • a "target gene” is any nucleic acid sequence which undergoes transcriptional activity and includes an endogenous gene, transgene, a gene in an artificial chromosome, an oncogene and a gene on a pathogen.
  • a pathogen includes a microbial, viral, protozoan or other parasite.
  • An endogenous gene includes a gene normally expressed in a cell such as a gene encoding an enzyme of a biochemical pathway (e.g. in plants, the anthocyanin pathway).
  • the actual target gene is the gene whose expression is to be inhibited and the homologous target sequence is the additional copy of the target gene or part thereof which is introduced to a cell.
  • the cell with the target gene may be derived from or contained in any organism and may be the result of introducing a genetic construct into thaT-cell or a relative thereof.
  • the organism may be a plant, animal, protozoan, bacterium, virus or fungus.
  • Reference herein to a plant includes a monocotyledonous plant or a dicotyledonous plant and the plant may be generated from genetically transformed callus or tissue or it may be a progeny of the transformed plant or a cross between the transformed plant or its progeny and a non-transformed plant or a graft between a rootstock and a scion.
  • plant includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like.
  • plants of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. junce ⁇ ), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativ ⁇ ), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solarium tuberosum), peanuts (Arachis hypogaea), cotton
  • Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C cantalupensis), and musk melon (C. melo).
  • tomatoes Locopersicon esculentum
  • lettuce e.g., Lactuca sativa
  • green beans Phaseolus vulgaris
  • lima beans Phaseolus limensis
  • peas Lathyrus spp.
  • members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C cantalupensis), and musk melon (C. melo).
  • Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.
  • Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas- fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauc ⁇ ); redwood ⁇ Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsame ⁇ ); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). Plants of the present invention include crop plants (for example, cotton, corn, alfalfa,
  • Turfgrasses include, but are not limited to: annual bluegrass (Poa annu ⁇ ); annual ryegrass (Lolium multiflorum); Canada bluegrass (Poa compressa); Chewings fescue (Festuca rubra); colonial bentgrass (Agrostis tenuis); creeping bentgrass (Agrostis palustris); crested wheatgrass (Agropyron desertorum); fairway wheatgrass (Agropyron cristatum); hard fescue (Festuca longifolia); Kentucky bluegrass (Poa pratensis); orchardgrass (Dactylis glomerata); perennial ryegrass (Lolium perenne); red fescue (Festuca rubra); redtop (Agrostis alba); rough bluegrass (Poa trivialis); sheep fescue (Festuca ovina); smooth bromegrass (Bromus inermis); tall fescue (Festuca arundinacea); timothy (P
  • Augustine grass (Stenotaphrum secundatum); zoysia grass (Zoysia spp.); Bahia grass (Paspalum notatum); carpet grass (Axonopus affinis); centipede grass (Eremochloa ophiuroides); kikuyu grass (Pennisetum clandesinum); seashore paspalum (Paspalum vaginatum); blue gramma (Bouteloua gracilis); buffalo grass (Buchloe dactyloids); sideoats gramma (Bouteloua curtipendula).
  • Plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants.
  • Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, millet, etc.
  • Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, flax, castor, olive etc.
  • Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
  • Preferred plants contemplated herein include cotton, sweet corn, tomato, tobacco, piniento, potato, sunflower, citrus, plums, sorghum, leeks, soybean, alfalfa, beans, pidgeon peas, chick peas, artichokes, curcurbits, lettuce, Dianthus, geraniums, cape gooseberry, maize, flax and linseed, lupins, broad beans, garden peas, peanuts, canola, snapdragons, cherry, sunflower, pot marigolds, Helichrysum, wheat, barley, oats, triticale, carrots, onions, orchids, roses and petunias.
  • Animals may be vertebrates or invertebrates.
  • vertebrate animals examples include fish, mammal, cattle, goat, pig, sheep, rodent, hamster, mouse, rat, primate, and human; invertebrate animals include nematodes, other worms, drosophila, and other insects.
  • nematodes include those that infect animals (e.g., Ancylostoma, Ascaridia, Ascaris, Bunostomum, Caenorhabditis, Capillaria, Chabertia, Cooperia, Dictyocaulus, Haemonchus, Heterakis, Nematodirus, Oesophagostomum, Ostertagia, Oxyuris, Parascaris, Strongylus, Toxascaris, Trichuris, Trichostrongylus, Tfhchonema, Toxocara, Uncinaria) and those that infect plants (e.g., Bursaphalenchus, Criconemella, Diiylenchus, Ditylenchus, Globodera, Helicotylenchus, Heterodera, Longidorus, Melodoigyne, Nacobbus, Paratylenchus, Pratylenchus, Radopholus, Rotelynchus, Tylench
  • Preferred microbes include those used in agriculture or by industry, and those that are pathogenic for plants or animals.
  • Fungi include organisms in both the mold and yeast morphologies.
  • Pathogens also include viruses which infect plant or animal cells which include Acinetobacter phage 133, Aeromonas phage 40RR2.8t, Aeromonas phage 65, Aeromonas phage Aehl, Enter obacteria phage SV14, Enter obacteria phage T4, Pseudomonas phage
  • entomopoxvirus Chironomus plumosus entomopoxvirus, Goeldichironomus haloprasimus entomopoxvirus, Diachasmimorpha entomopoxvirus, African swine fever virus, Invertebrate iridescent virus 1, Invertebrate iridescent virus 6, Invertebrate iridescent virus 3, Ambystoma tigrinum virus, Bohle iridovirus, Epizootic haematopoietic necrosis virus, European catfish virus, Frog virus 3, Santee-Cooper ranavirus, Lymphocystis disease virus 1, Infectious spleen and kidney necrosis virus, Paramecium bursaria Chlorella virus 1, Paramecium bursaria Chlorella virus Al, Paramecium bursaria Chlorella virus ALIA, Paramecium bursaria Chlorella virus AL2A, Paramecium bursaria Chlorella virus BJ2
  • curvimaculatus bracovirus Chelonus texanus bracovirus, Cotesia congregata bracovirus, Cotesia flavipes bracovirus, Cotesia glomerata bracovirus, Cotesia hyphantriae bracovirus, Cotesia kariyai bracovirus, Cotesia marginiventris bracovirus, Cotesia melanoscela bracovirus, Cotesia rubecula bracovirus, Cotesia schaeferi bracovirus, Diolcogaster facetosa bracovirus, Glyptapanteles flavicoxis bracovirus, Glyptapanteles indiensis bracovirus, Glyptapanteles liparidis bracovirus, Hypomicrogaster canadensis bracovirus, Hypomicrogaster ectdytolophae bracovirus, Microplitis croceipes bracovirus, Microplitis demolitor bracovirus, Phanerotoma fla
  • viruses in terms of human therapeutic uses include HIV, the Hepatitis group of viruses, the Herpes group of viruses and a variety of retro or oncogenic viruses.
  • the cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like.
  • the cell may be a stem cell or a differentiated cell.
  • a "stem cell” includes any form of progenitor or precursor cell.
  • Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, masT- cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
  • RNA silencing species may be synthesized either in vivo or in vitro and is generally able to form a complex with either or both strands of the target sequence.
  • Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro.
  • a regulatory region e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation
  • a regulatory region e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation
  • RNA silencing species may be initiated by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age.
  • the RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus.
  • RNA may be chemically or enzymatically synthesized by manual or automated reactions.
  • the RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6).
  • the RNA silencing species may be purified prior to introduction into the cell.
  • the RNA silencing species can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
  • the RNA may be used with no or a minimum of purification to avoid losses due to sample processing.
  • the RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
  • the RNA silencing species is generally double stranded RNA and may be introduced to a subject (e.g. synthetic RNAi) or be encoded by a genetic construct introduced to a cell in vivo or ex vivo.
  • the RNA may be directly introduced into the cell (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing an organism in a solution containing the RNA.
  • Methods for oral introduction include direct mixing of the RNA with food of the organism, as well as engineered approaches in which a species that is used as food is engineered to express the RNA, then fed to the organism to be affected.
  • the RNA may be sprayed onto a plant or a plant may be genetically engineered to express the RNA in an amount sufficient to kill some or all of a pathogen known to infect or digest parts of the plant.
  • Physical methods of introducing nucleic acids for example, injection directly into the cell or extracellular injection into the organism, may also be used.
  • Vascular or extravascular circulation, the blood or lymph system, the phloem, the roots, and the cerebrospinal fluid are sites where the RNA may be introduced.
  • a transgenic organism that expresses the RNA silencing species from a recombinant construct may be produced by introducing the construct into a zygote, an embryonic stem cell, or another multipotenT-cell derived from the appropriate organism.
  • RNA Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment by particles covered by the RNA, soaking the cell or organism in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA.
  • a viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct.
  • Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate, and the like.
  • the RNA may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, promote annealing of the duplex strands, stabilize the annealed strands, or other-wise increase inhibition of the target gene.
  • the present invention further requires either introducing a DNA construct which generate a mRNA (homologous nucleotide sequence) which is substantially homologous to at least 10 contiguous nucleotides of the target gene.
  • This DNA construct is referred to herein as a "homologous target gene construct".
  • the homologous target gene construct generates a transcript which corresponds to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the target gene transcript.
  • the homologous target sequence does not correspond to a full length actual target gene transcript then it comprises at least 5 nucleotides to about 10,000 nucleotides such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
  • the present invention enables selective inhibition of a targe gene by a method which comprises introducing an RNA silencing species to a cell carrying a homologous nucleotide sequence.
  • the RNA silencing species may be DNA derived (e.g. an RNA silencing species construct) or it may be synthetic RNA.
  • the silencing RNA species is a hairpin or short dsRNA.
  • the RNA silencing species in DNA-derived it is produced in a cell remote from the cell carrying the homologous nucleotide sequence and/or the actual target gene.
  • the present invention provides a genetically modified subject comprising one population of cells which produce an RNA silencing species specific for a target gene and another population of cells which carry on expressible homologous nucleotide sequence.
  • RNA silencing species and homologous nucleotide sequence transcript may be generated from DNA operably linked to a constitutive, inducible, developmentally regulated or tissue specific promoter.
  • a homologous nucleotide sequence is not introduced and the copy number of the actual target gene and/or its level of expression may be enhanced. Promoters, chemicals, biological agents and culture conditions may be used to increase gene copy number or expression levels.
  • the present invention may be used in the treatment or prevention of disease in plants or animals.
  • the silencing RNA species and homologous nucleotide sequence may be introduced into a cancerous cell or tumor and thereby inhibit gene expression of the actual target gene required for maintenance of the carcinogenic/tumorigenic phenotype.
  • a target gene may be selected which is required for initiation or maintenance of the disease/pathology. Treatment would include amelioration of any symptom associated with the disease or clinical indication associated with the pathology.
  • a gene derived from any pathogen may be targeted for inhibition.
  • the gene could cause immunosuppression of the host directly or be essential for replication of the pathogen, transmission of the pathogen, or maintenance of the infection.
  • the RNA silencing species could be introduced in cells in vitro or ex vivo and then subsequently placed into an animal to affect therapy, or directly treated by in vivo administration.
  • a method of gene therapy can be envisioned.
  • cells at risk for infection by a pathogen or already infected cells, particularly human immunodeficiency virus (HIV) infections may be targeted for treatment by introduction of the RNA silencing species and/or the homologous nucleotide sequence.
  • the target gene might be a pathogen or host gene responsible for entry of a pathogen into its host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of an infection in the host, or assembly of the next generation of pathogen.
  • Methods of prophylaxis i.e., prevention or decreased risk of infection
  • reduction in the frequency or severity of symptoms associated with infection can also be envisioned.
  • the present invention provides, therefore, a method for inhibiting expression of a target gene in a cell of a recipient said method comprising:
  • introducing genetic constructs into at least two subpopulations of the same population of cells or in two different populations of cells wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and is introduced into one population or subpopulation of cells and a second construct comprising a DNA sequence which encodes a nucleotide sequence substantially homologous to a transcript of said target gene is introduced into the other population or subpopulation of cells;
  • one population of cells comprises both the RNA silencing species and the homologous target sequence and/or actual target gene.
  • Another aspect of the present invention contemplates a method of treatment of a recipient requiring silencing of expression of a target gene said method comprising introducing autologous cells from said recipient modified to generate a transcript of said target gene and introducing to said recipient a DNA-derived or synthetic RNA silencing species or an autologous cell modified to generate the DNA-derived RNA silencing species wherein upon entry of the RNA silencing species into the cells comprising a transcript of the target gene, expression of said target gene is inhibited by TGS and PTGS.
  • the present invention may be used for treatment or development of treatments for cancers of any type, including solid tumors and leukemias, including: apudoma, choristoma, branchioma, malignant carcinoid syndrome, carcinoid heart disease, carcinoma (e.g., Walker, basal cell, basosquamous, Brown-Pearce, ductal, Ehrlich tumor, in situ, Krebs 2, Merkel cell, mucinous, non-small cell lung, oaT-cell, papillary, scirrhous, bronchiolar, bronchogenic, squamous cell, and transitional cell), histiocytic disorders, leukemia (e.g., B cell, mixed cell, null cell, T-cell, T-cell chronic, HTLV-II-associated, lymphocytic acute, lymphocytic chronic, masT-cell, and myeloid), histiocytosis malignant, Hodgkin disease, immunoproliferative small, non-Hod
  • pests include, but are not limited to, insects, fungi, bacteria, nematodes, acarids, protozoan pathogens, animal-parasitic liver flukes, and the like.
  • Pests of particular interest are insect pests, particularly insect pests that cause significant damage to agricultural plants.
  • insect pests refers to insects and other similar pests such as, for example, those of the order Acari including, but not limited to, mites and ticks.
  • Insect pests of the present invention include, but are not limited to, insects of the order Lepidoptera, e.g.
  • the embodiments of the present invention may be effective against insect pests, including but not limited to insects selected from the orders Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, Coleoptera, etc., particularly Lepidoptera.
  • insects selected from the orders Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, Coleoptera, etc., particularly Lepidoptera.
  • Insect pests of the invention for the major crops include, but are not limited to: Maize: Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black cutworm; Helicoverpa zeae, corn earworm; Spodoptera frugiperda, fall armyworm; Diatraea grandiosella, southwestern corn borer; Elasmopalpus lignosellus, lesser cornstalk borer; Diatraea saccharalis, surgarcane borer; western corn rootworm, e.g., Diabrotica virgifera virgifera; northern corn rootworm, e.g., Diabrotica longicornis barberi; southern corn rootworm, e.g., Diabrotica undecimpunctata howardi; Melanotus spp., wireworms; Cyclocephala borealis, northern masked chafer (white grub); Cyclocephala immaculata, southern masked cha
  • embodiments of the present invention may be effective against Hemiptera such as Lygus hesperus, Lygus Hneolaris, Lygus pratensis, Lygus rugulipennis Popp, Lygus pahulinus, Calocoris norvegicus, Orthops compestris, Plesiocoris rugicollis, Cyrtopeltis modestus, Cyrtopeltis notatus, Spanagonicus albofasciatus, Diaphnocoris chlorinonis, Labopidico ⁇ a allii, Pseudatomoscelis seriatus, Adelphocoris rapidus, Poecilocapsus lineatus, Blissus leucopterus, Nysius ericae, Nysius raphanus, Euschistus servus, Nezara viridula, Eurygaster, Coreidae, Pyrrhocoridae, Tinidae, Blosto-
  • Pests of interest also include Araecerus fasciculatus, coffee bean weevil; Acanthoscelides obtectus, bean weevil; Bruchus rufmanus, broadbean weevil; Bruchus pisorum, pea weevil; Zabrotes subfasciatus, Mexican bean weevil; Diabrotica balteata, banded cucumber beetle; Cerotoma trifurcata, bean leaf beetle; Diabrotica virgifera, Mexican corn rootworm; Epitrix cucumeris, potato flea beetle; Chaetocnema conflnis, sweet potato flea beetle; Hypera postica, alfalfa weevil; Anthonomus quadrigibbus, apple curculio; Sternechus paludatus, bean stalk weevil; Hypera brunnipennis, Egyptian alfalfa weevil; Sitophilus granaries, granary weevil; Cr
  • Nematodes include parasitic nematodes such as root-knot, cyst, and lesion nematodes, including Heterodera spp., Meloidogyne spp., and Globodera spp.; particularly members of the cyst nematodes, including, but not limited to, Heterodera glycines (soybean cyst nematode); Heterodera schachtii (beet cyst nematode); Heterodera avenae (cereal cyst nematode); and Globodera rostochiensis and Globodera pallida (potato cyst nematodes).
  • Lesion nematodes include Pratylenchus spp.
  • the present invention is not limited to any type of target gene or nucleotide sequence.
  • target genes e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors; oncogenes (e.g., ABLl, BCLl, BCL2, BCL6, CBFA2, CBL, CSFlR, ERBA, ERBB, EBRB2, ETSl, ETSl, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS 5 LCK, LYN, MDM2, MLL, MYB, MYC, MYCLl , MYCN, NRAS, PIMl, PML, RET, SRC,
  • developmental genes e.g., adhesion molecules, cyclin kin
  • the target gene may encode an enzyme of a metabolic pathway such as an enzyme of the anthocyanin pathway.
  • a metabolic pathway such as an enzyme of the anthocyanin pathway. The latter is useful to alter the colour of flowers in plants.
  • the present invention further comprises a method for producing plants with reduced susceptibility to climatic injury, susceptibility to insect damage, susceptibility to infection by a pathogen, or altered fruit ripening characteristics.
  • the targeted gene may be an enzyme, a plant structural protein, a gene involved in pathogenesis, or an enzyme that is involved in the production of a non-proteinaceous part of the plant (i.e., a carbohydrate or lipid). If an expression construct is used to transcribe the RNA in a plant, transcription by a wound- or stress-inducible; tissue-specific (e.g., fruit, seed, anther, flower, leaf, root); or otherwise regulatable (e.g., infection, light, temperature, chemical) promoter may be used.
  • the effect may be enhanced: each activity will be affected and the effects may be magnified by targeting multiple different components. Metabolism may also be manipulated by inhibiting feedback control in the pathway or production of unwanted metabolic by-products.
  • the present invention may be used to reduce crop destruction by other plant pathogens such as arachnids, insects, nematodes, protozoans, bacteria, or fungi.
  • plant pathogens such as arachnids, insects, nematodes, protozoans, bacteria, or fungi.
  • Some such plants and their pathogens are listed in Index of plant Diseases in the United States (U.S. Dept. of Agriculture Handbook No. 165, 1960); Distribution of Plant-Parasitic Nematode Species in North America (Society of Nematologists, 1985); and Fungi on Plants and Plant Products in the United States (American Phytopathological Society, 1989). Insects with reduced ability to damage crops or improved ability to prevent other destructive insects from damaging crops may be produced.
  • nematodes are vectors of plant pathogens, and may be attacked by other beneficial nematodes which have no effect on plants. Inhibition of target gene activity could be used to delay or prevent entry into a particular developmental step (e.g., metamorphosis), if plant disease was associated with a particular stage of the pathogen's life cycle. Interactions between pathogens may also be modified by the invention to limit crop damage. For example, the ability of beneficial nematodes to attack their harmful prey may be enhanced by inhibition of behavior- controlling nematode genes according to the invention.
  • pathogens cause disease
  • some of the microbes interact with their plant host in a beneficial manner.
  • some bacteria are involved in symbiotic relationships that fix nitrogen and some fungi produce phytohormones.
  • Such beneficial interactions may be promoted by using the present invention to inhibit target gene activity in the plant and/or the microbe.
  • DNA derived RNA silencing species and homologous nucleotide sequence are generally derived by operably linking a DNA encoding same to a promoter.
  • the promoter may regulate the expression of the nucleotide sequence encoding the agent, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, or pathogens, or metal ions, amongst others.
  • the promoter is capable of regulating expression of a nucleic acid molecule in a plant cell, tissue or organ, at least during the period of time over which the nucleotide sequence encoding the agent is expressed therein.
  • Plant-operable promoters are particularly preferred for use in the constructs of the present invention.
  • suitable promoters include pCaMV 35S (Fang et al, PlanT-cell 7:141-150, 1989), PGELl (Hajdukiewicz et al, Plant MoI Biol 25:989-994, 1994), class III chitinase (Samac and Shah, PlanT-cell 5:1063-1072, 1991), pin2 (Keil et al, EMBO J 8: 1323-1330, 1989), PEP carboxylase (Pathirana et al, Plant J 12:293-304, 1997; MAP kinase (Schoenbeck et al, Molec Plant-Microbe Interact, 1999), MSV (Legavre et al, In: Vth International Congress of Plant Molecular Biology, Singapore, 1997), pltp (Hsu et al, Plant Sd 143:63-70, 1999), pmpi (C
  • the terms "in operable connection with” or “operably under the control” or “operably linked” or similar shall be taken to indicate that expression of the nucleic acid molecule is under the control of the promoter sequence with which it is spatially connected in a cell, tissue, organ or whole plant or animal subject.
  • a number of promoters can be used in the practice of the invention.
  • the promoters can be selected based on the desired outcome.
  • the nucleic acids can be combined with constitutive, tissue-preferred, inducible, or other promoters for expression in the host organism.
  • Suitable constitutive promoters for use in a plant hosT-cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No.
  • wound-inducible promoters are wound-inducible promoters.
  • Such wound- inducible promoters may respond to damage caused by insect feeding, and include potato proteinase inhibitor (pin II) gene (Ryan. Ann Rev Phytop ⁇ th 28:425-449, 1990; Duan et ⁇ l, Nature Biotechnology 14:494-49%, 1996); wunl and wun2, U.S. Pat. No.
  • pathogen-inducible promoters may be employed in the methods and nucleotide constructs of the present invention.
  • pathogen-inducible promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc.
  • PR proteins pathogenesis-related proteins
  • SAR proteins pathogenesis-related proteins
  • beta-l,3-glucanase chitinase, etc.
  • promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al, Plant MoI Biol 9:335-342, 1987; Matton et al, Molecular Plant-Microbe Interactions 2:325-331, 1989; Somsisch et al, Proc Natl Acad Sci USA 55:2427-2430, 1986; Somsisch et al, MoI Gen Genet 2:93-98, 1988; and Yang Proc Natl Acad Sd USA 93:14972-14977, 1996. See also, Chen et al, Plant J 10:955-966, 1996; Zhang et al, Proc Natl Acad Sci USA 91.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid.
  • promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al, Proc Natl Acad Sci USA ⁇ 5:10421- 10425, 1991 and McNellis et al, Plant J 14(2):247-257, 1998 and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al, MoI Gen Genet 227:229-237, 1991 and U.S. Pat Nos. 5,814,618 and 5,789,156).
  • steroid-responsive promoters see, for example, the glucocorticoid-inducible promoter in Schena et al, Proc Natl Acad Sci USA ⁇ 5:10421- 10425, 1991 and McNellis et al, Plant J 14(2):247-257, 1998
  • Tissue-preferred promoters can be utilized to target enhanced pesticidal protein expression within a particular plant tissue.
  • Tissue-preferred promoters include those discussed in Yamamoto et al, Plant J 12 (2) :255-265, 1997; Kawamata et al, PlanT-cell Physiol 38(7) :792-$03, 1997; Hansen et al, MoI Gen Genet 254(3) :337-343, 1997; Russell et al, Transgenic Res 6(2):157-168, 1997; Rinehart et al, Plant Physiol 772(3J:1331-1341, 1996; Van Camp et al, Plant Physiol 112(2): 525-535, 1996; Canevascini et al, Plant Physiol 112(2):5l3-524, 1996; Yamamoto et al, PlanT-cell Physiol 35 (5).
  • Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al, 1997 supra; Kwon et al, Plant Physiol 105:351-61, 1994; Yamamoto et al, 1994 supra; Gotor et al, Plant J 5:509-18, 1993; Orozco et al, 1993 supra and Matsuoka et al, 1993 supra.
  • Root-preferred or root-specific promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al, Plant MoI Biol 20(2) :207 '-218, 1992 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner PlanT-cell 3(1 ⁇ .1051-1061, 1991 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al, Plant MoI Biol 14(3) A33-443, 1990 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al, PlanT-cell 3(l):l l-22, 1991 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean).
  • VfENOD-GRP3 gene promoter Kuster et al, Plant MoI Biol 29(4) :159-112, 1995
  • rolb promoter Capana et al, Plant MoI Biol 25(4):6% 1-691, 1994. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179.
  • seed-specific promoters include both “seed-specific” promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as “seed- germinating” promoters (those promoters active during seed germination). See Thompson et al, BioEssays 10:108, 1989, herein incorporated by reference.
  • seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message); cZ19Bl (maize 19 kDa zein); and milps (myo-inositol-1 -phosphate synthase) (see U.S. Pat. No. 6,225,529).
  • Gamma-zein and Glob-1 are endosperm-specific promoters.
  • seed-specific promoters include, but are not limited to, bean ⁇ -phaseolin, napin, ⁇ -conglycinin, soybean lectin, cruciferin, and the like.
  • seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from endl and end2 genes are disclosed; herein incorporated by reference.
  • a promoter that has "preferred" expression in a particular tissue is expressed in that tissue to a greater degree than in at least one other plant tissue. Some tissue-preferred promoters show expression almost exclusively in the particular tissue.
  • weak promoters will be used.
  • the term "weak promoter” as used herein refers to a promoter that drives expression of a coding sequence at a low level. By low level expression at levels of about 1/1000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts is intended. Alternatively, it is recognized that the term “weak promoters” also encompasses promoters that drive expression in only a few cells and not in others to give a total low level of expression. Where a promoter drives expression at unacceptably high levels, portions of the promoter sequence can be deleted or modified to decrease expression levels.
  • Such weak constitutive promoters include, for example the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the core 35 S CaMV promoter, and the like.
  • Other constitutive promoters include, for example, those disclosed in U.S. Pat.
  • a range of promoters for use in animal cells is also known by the skilled artisan.
  • the construct preferably contains additional regulatory elements for efficient transcription, for example, a transcription termination (or terminators) sequence.
  • Terminator refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3 '-non-translated DNA sequences generally containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3 '-end of a primary transcript. Terminators active in plant cells are known and described in the literature. They may be isolated from bacteria, fungi, viruses, animals and/or plants or synthesized de novo.
  • the terminator may be any termination sequence which is operable in the cells, tissues or organs in which it is intended to be used.
  • terminators particularly suitable for use in the synthetic genes of the present invention include the SV40 polyadenylation signal, the HSV TK polyadenylation signal, the CYCl terminator, ADH terminator, SPA terminator,
  • NOS nopaline synthase
  • CaMV cauliflower mosaic virus
  • SSU Rubisco small subunit gene
  • SCSV gene sequence terminators, any r/r ⁇ -independent E. coli terminator, or the lacZ alpha terminator, amongst others.
  • the terminator is the SV40 polyadenylation signal or the HSV TK polyadenylation signal which are operable in animal cells, tissues and organs, octopine synthase (OCS) or nopaline synthase (NOS) terminator active in plant cells, tissue or organs, or the lacZ alpha terminator which is active in prokaryotic cells.
  • OCS octopine synthase
  • NOS nopaline synthase
  • lacZ alpha terminator which is active in prokaryotic cells.
  • the present invention contemplates constructs where the same promoter is used to generate the RNA silencing species and the homologous target sequence in the same construct; or where the same construct comprises two separate promoters; or where two constructs are employed each with the same promoter; and or where two constructs are used each with different promoters.
  • constructs described supra are capable of being modified further, for example, by the inclusion of marker nucleotide sequences encoding a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate detection of the synthetic gene in a cell, tissue or organ in which it is expressed.
  • the marker nucleotide sequences will be present in a translatable format and be expressed.
  • transport sequences may be included to direct one or more agents to particular plant organnelles.
  • the constructs of the present invention may be introduced to a suitable cell, tissue or organ without modification as linear DNA, optionally contained within a suitable carrier, such as a cell, virus particle or liposome, amongst others.
  • a suitable carrier such as a cell, virus particle or liposome, amongst others.
  • a nucleic acid is inserted into a suitable vector or episome molecule, such as a bacteriophage vector, viral vector or a plasmid, cosmid or artificial chromosome vector which is capable of being maintained and/or replicated and/or expressed in the hosT-cell, tissue or organ into which it is subsequently introduced.
  • a suitable vector or episome molecule such as a bacteriophage vector, viral vector or a plasmid, cosmid or artificial chromosome vector which is capable of being maintained and/or replicated and/or expressed in the hosT-cell, tissue or organ into which it is subsequently introduced.
  • an origin of replication or a selectable marker gene suitable for use in bacteria is physically-separated from those genetic sequences contained in the genetic construct which are intended to be expressed or transferred to a plant cell, or integrated into the genome of a plant cell or animal cell.
  • selectable marker gene includes any gene which confers a phenotype on a cell on which it is expressed to facilitate the identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention or a derivative thereof.
  • Suitable selectable marker genes contemplated herein include the ampicillin-resistance gene (Amp 1 ), tetracycline-resistance gene (Tc 1 ), bacterial kanamycin-resistance gene (Kan 1 ), the zeocin resistance gene (Zeocin is a drug of the bleomycin family which is trade mark of InVitrogen Corporation), the AURI-C gene which confers resistance to the antibiotic aureobasidin A, phosphinothricin-resistance gene, neomycin phosphotransferase gen (nptl ⁇ ), hygromycin-resistance gene, ⁇ -glucuronidase (GUS) gene, chloramphenicol acetyltransferase (CAT) gene, green fluorescent protein-encoding gene or the luciferase gene, amongst others.
  • Amicillin-resistance gene Amp 1
  • Tc 1 tetracycline-resistance
  • the selectable marker gene is the nptll gene or Kan r gene or green fluorescent protein (GFP)-encoding gene.
  • GFP green fluorescent protein
  • the present invention extends to all genetic constructs essentially as described herein, which include further genetic sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into the genome of a eukaryotic cell or organism.
  • Standard methods may be used to introduce the constructs into the cell, tissue or organ, for example, liposome-mediated transfection or transformation, transformation of cells with attenuated virus particles or bacterial cells, cell mating, transformation or transfection procedures known to those skilled in the art.
  • Additional means for introducing recombinant DNA into plant tissue or cells include, but are not limited to, transformation using CaCl 2 and variations thereof, direct DNA uptake into protoplasts, PEG-mediated uptake to protoplasts, microparticle bombardment, electroporation, microinjection of DNA, microparticle bombardment of tissue explant or cells, vacuum-infiltration of tissue with nucleic acid, or in the case of plants, T-DNA- mediated transfer from Agrobacterium to the plant tissue or direct DNA/RNA early into animal cell.
  • a microparticle is propelled into a cell to produce a transformed cell.
  • Any suitable ballistic cell transformation methodology and apparatus can be used in performing the present invention. Exemplary apparatus and procedures are disclosed by Stomp et al, (U.S. Patent No. 5,122,466) and Sanford and Wolf (U.S. Patent No. 4,945,050).
  • the genetic construct may incorporate a plasmid capable of replicating in the cell to be transformed.
  • microparticles suitable for use in such systems include 1 to 5 ⁇ m gold spheres.
  • the DNA construct may be deposited on the microparticle by any suitable technique, such as by precipitation.
  • the methods of the invention involve introducing a polypeptide or polynucleotide into a plant.
  • "Introducing" is intended to mean presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant.
  • the methods of the invention do not depend on a particular method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant.
  • Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.
  • “Stable transformation” is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof.
  • “Transient transformation” is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
  • Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al, Biotechniques 4:320-334, 1986), electroporation (Riggs et al, Proc Natl Acad Sci USA 55:5602-5606, 1986), Agrobacterium-mediated transformation (U.S. Pat. Nos.
  • the genetic constructs described herein are adapted for integration into the genome of a cell in which it is expressed.
  • certain additional genetic sequences may be required.
  • Agrobacterium tumefaciens Ti plasmid will generally be required.
  • the genetic constructs include human or mammalian or animal artifical chromosomes.
  • the present invention further extends to an isolated cell, tissue or organ comprising the constructs or parts thereof.
  • the present invention extends further to regenerated tissues, organs and whole organisms derived from the cells, tissues and organs and to propagules and progeny thereof as well as seeds and other reproductive material. Animal cell lines and maintained cultures are also contemplated by the present invention.
  • plants may be regenerated from transformed plant cells or tissues or organs on hormone-containing media and the regenerated plants may take a variety of forms, such as chimeras of transformed cells and non-transformed cells; clonal transformants (e.g. all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissue (e.g. a transformed rootstock grafted to an untransformed scion in citrus species).
  • Transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques.
  • first generation (or Tl) transformed plants may be selfed to give homozygous second generation (or T2) transformed plants, and the T2 plants further propagated through classical breeding techniques.
  • Another utility of the present invention is to assist in identifying gene function in an organism by inhibiting a target gene of previously unknown function. Instead of the time consuming and laborious isolation of mutants by traditional genetic screening, functional genomics would envision determining the function of uncharacterized genes by employing the invention to reduce the amount and/or alter the timing of target gene activity.
  • the invention could be used in determining potential targets for pharmaceutics, understanding normal and pathological events associated with development, determining signaling pathways responsible for postnatal development/aging, and the like.
  • the present invention may be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of an RNA species to test samples or subjects.
  • Preferred components are the dsRNA and a vehicle that promotes introduction of the dsRNA.
  • Such a kit may also include instructions to allow a user of the kit to practice the invention.
  • Yet another aspect of the present invention is directed to a phenotypic modifying kit for a subject comprising:
  • RNA silencing species specific for a target gene or cells capable of generating same (i) an RNA silencing species specific for a target gene or cells capable of generating same;
  • a genetic construct comprising a DNA sequence which encodes a mRNA transcript of said target gene or cells comprising same; and (iii) instructions for use comprising introducing into said subject the genetic construct or cells comprising same such that the subject establishes a population of said cells, introducing to said subject the RNA silencing species or cells comprising same and monitoring for gene silencing via a transcription silencing pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6 and a post-transcriptional gene silencing pathway via RISC.
  • the present invention provides a genetic composition comprising:
  • the present invention also provides a genetic composition comprising one or more constructs wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and a second construct which comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene.
  • the genetic construct comprises nucleotide sequences enabling the production of hairpin and sense RNA species directed to a target gene or its transcript.
  • the present invention provides a genetic composition comprising a genetic construct which encodes the central and 3' terminal regions of a target gene or its transcript separated by a spacer nucleotide sequence to enable a hairpin construct to be generated, said genetic construct further comprising a nucleotide sequence which encodes a RNA transcript corresponding to said target gene or its transcript.
  • this enables the generation of a genotype to enable screening for genes involved in modulating RNA silencing. This embodiment is disclosed in Example 8.
  • mammalian artificial chromosomes may be used to introduce the RNA silencing species or the homologous target sequence or both.
  • plant artificial chromosomes may be employed.
  • FIG. Ia A model summarizing the crucial molecular events in reception of the long-distance silencing of the GFP mRNA is presented in Figure Ia.
  • a mobile GF-specific signal is delivered into the shoot apex, where it stimulates the Pol IVa pathway in the nucleus to produce 24-nt siRNAs from adjacent P-specific DNA or RNA template. This process is also dependent on RDR6.
  • AGO4 in association with these 24-nt siRNAs, then mediates cleavage of some mRNA transcripts. These decapped transcripts, are then converted to dsRNA by RDR6, and then processed into 21-nt siRNAs by DCL4, or in its absence, into
  • 22-nt siRNAs by DCL2. These 21- or 22-nt siRNAs then direct silencing.
  • the nature of the mobile signal is proposed to be a large RNA that initiates mRNA silencing.
  • RNA silencing has long been thought to be an adaptive measure by which plants can protect themselves from viruses (Mlotshwa et al, supra 2002), but it has the potential to play other roles in systemic gene regulation.
  • the present invention identifies components of the longdistance mRNA silencing pathway, and shows the importance of cross-talk between gene silencing pathways in Arahidopsis.
  • the rdr ⁇ (sdel) and ago4 mutants used were as previously described (Dalmay et al, Cell 101:543-553, 2000; Ziberman et al, Science 299:116-119, 2003).
  • the rdr ⁇ and nrpdla (SaIk insertion line Salk_128428) mutants are available from the SaIk Institute Genome Analysis Laboratory (LaJolla, California, USA).
  • the rdr2 (SaIk insertion line Salk_059661) and dcl3 (SaIk insertion line Salk_005512; Figure 9) mutants were obtained from the SaIk Institute Genome Analysis Laboratory.
  • the dcl4 mutant was from the GABI-Kat collection (GABI160A04) [Xie et al, Proc. Natl. Acad. Sci. USA 102:12984- 12989, 2005].
  • rdr ⁇ , ago4, dcl3 and dcl4 homozygous lines were crossed to the wild-type target line to generate the respective mutant target lines, nrpdla and rdr2 target plants were generated by transformation with the binary vector pUQC214.
  • the primers used to genotype mutants are shown in Table 2, or are published elsewhere (Ziberman et al, supra 2003).
  • the GFP (S65T) coding region (Genbank accession no. U43284) was amplified and the 35S:GFP:ocs cassette was cloned into pUQC477, a modified version of the binary vector pNB96, obtained from (POSTECH, Pohang, Republic of Korea, to form the binary construct called pUQC214 ( Figure 2).
  • pUQC214 Figure 2
  • nucleotides nine to 400 of GFP (S65T) were amplified and cloned as an intron-splicible inverted repeat into pHannibal (Wesley et al, Plant J. 27:581-590, 2001).
  • This GF-specific RNAi transgene was then cloned into pUQC214 to produce the binary vector pUQC218, or into the modified version of ⁇ UQC477 to produce the binary vector pUQC251 ( Figure 2).
  • Binary vectors were introduced into Agrobacterium tumefaciens GV3101. Floral dip transformation of Arabidopsis (Clough & Bent, Plant J. 16:135-143, 1998) with pUQC 214 produced the GFP expressing target line and with pUQC251 and pUQC218 produced the GFP silencer lines Sl and S2, respectively.
  • Plants were viewed under blue light using a Dark Reader (Trademark) Spot Lamp (Clare Chemical Research) and photographed using a Canon EOS digital camera.
  • DNA probes were generated using the Megaprime DNA labeling kit (Amersham Biosciences). Prehybridization was carried out at 65 0 C in 0.5MNaHPO 4 (pH 7.2), 7% w/v SDS, 1 mM EDTA and lOmg/mL sheared salmon sperm DNA, and hybridization conditions were the same. After hybridization, the membrane was washed twice for 30 minutes at 65 0 C in ImM EDTA, 40 mM NaH 2 PO 4 (pH 7.2) and 5% w/v SDS.
  • the membrane was washed in 1 mM EDTA, 40 mM NaH 2 PO 4 (pH 7.2) and
  • Riboprobes were generated using the
  • GFPsiRNAl probe Ia
  • GFPsiRNA2 probe Ib
  • miR159 Table 2
  • RNA hybridizations were performed using Ambion ultrahyb or Ambion ultrahyb-oligo hybridization buffers (Ambion) and washed at low stringency with 2X SSC, 0.2% w/v SDS and at higher stringency with IX SSC, 0.1% w/v SDS. All blots were exposed to a Storage Phosphor Screen (Molecular Dynamics) and images analyzed with ImageQuant 5.1 (Molecular Dynamics). Detection of decapped 5' ends was performed using the First Choice RLM- RACE Kit (Ambion) [Llave et al, Science 297:2053-2056, 2002].
  • DCL3-F a GGCTTCAAGTGTTGGGAAAA
  • GfS'ClalKpnl GTATCGATGGTACCCAAGGGCGAGGAGCT
  • DCL3-R flanking the T-DNA insertion.
  • No fragment was amplified from alkali-treated template (S) of plants homozygous for the T-DNA insertion in DCL3.
  • the dcl3 T-DNA insertion allele was detected using primers specific for the NPTII sequence (APHAl and APHA2) in the SALK T-DNA.
  • a codominant PCR test for rdr ⁇ (sdel) involved Styl digestion of PCR products produced with the oligonucleotide primers SDEl-F and SDEl-R.
  • Genotyping of the dcU mutant was performed using the oligonucleotides DCL4-5'-8300F and DCL4-5'-9200R, flanking the T-DNA insertion. No fragment was amplified from plants homozygous for the T-DNA insertion in DCL4. The dcU T-DNA insertion allele was detected using DCL4-5'-8300F and a primer specific for the LB of the T-DNA called LB-pl61pw.
  • RNAi signalling a system of grafting Arabidopsis at the seedling stage was developed. Scions expressing a Green Florescent Protein (GFP) were grafted onto GFP-silenced rootstocks (Figure 3a), and GFP silencing and other molecular events were monitored in the scions as the seedlings developed.
  • the silencer rootstocks carried a hairpin transgene expressing dsRNA homologous to the first 408 bp of the GFP coding sequence with or without an intact GFP target gene (Figure 3a). The portion of GFP identical to the hairpin was referred to as GF, and the remaining 309 bp 3' portion of GFP was called the P sequence ( Figure 3 a).
  • RNAi was efficiently induced in both silencer genotypes (hairpin transgene with or without an intact GFP transgene).
  • siRNA was detected using a GF or P probe ( Figure 3c), and symmetric and asymmetric methylation was observed along the length of GFP ( Figures 3d and 3e).
  • the majority of the siRNA was in the 21 -nucleotide (nt) class but some 24-nt siRNA produced by was also detected ( Figure 3 c).
  • RNA silencing signal Figure 4a, Table 6
  • Induction of RNA silencing in wild-type scions was also dependent on RDR6 (SDEl) function (Table 6).
  • a predicted consequence of the mobile signal hybridizing to the GF portion of the transgene and stimulating Pol IV activity on flanking chromatin would be the production of nuclear siRNAs homologous to the P portion of GFP via the RDR2-DCL3 pathway.
  • the siRNAs could then in association with AGO4, direct cleavage of GFP mRNA in the nucleus and provide decapped mRNA substrate for amplification of dsRNA via the RDR6 pathway in the cytoplasm.
  • 5' RACE was performed on RNA extracted from GFP-silenced scions ( Figure 4d).
  • the size of 5' RACE products confirmed that cleavage of the polyadenylated mRNA occurred largely within the first 100 bp of the P sequence of GFP ( Figure 4d).
  • Ten 5' RACE products were cloned and sequenced and it was shown that five resulted from cleavage 63 bp into the 3'-P portion of GFP, and the other five were produced by cleavage events at 49, 52, 61, 69 and 90 bp into the 3-P sequence.
  • the first two nucleotides of the 5' RACE products were A or T and then C, suggesting not only is AGO4 capable of slicing mRNA but that it has a degree of sequence specificity.
  • a further predicted consequence of hybridization of the mobile RNA signal to the 5'-GF portion of GFP and Pol IV-RDR2-DCL3 activation would be synthesis of siRNA homologous to the 35S promoter driving the GFP transgene.
  • Linked to the 35S:GFP transgene in the target genotype is an additional 35S:BAR transgene that confers resistance to the herbicide Basta.
  • the siRNA homologous to the 35S promoter would, therefore, be expected to affect down-regulate transcription of 35S:BAR in silenced scions.
  • Northern and quantitative real time confirmed the hypothesis and demonstrated that the 35S:BAR gene was down-regulated in silenced target scions compared to ungrated target plants ( Figure 4e).
  • these additional nuclear events in silenced scions provide further strong support for nuclear reception of the long-distance signal and also implicate the signal in both transcriptional and post-transcriptional gene regulation.
  • Sense and hairpin transgenes act synergistically to induce RNAi-based resistance to
  • Figure 5 and Table 5 show that providing a homologous transgene that produces single- stranded RNA (a "sense” transgene), in addition to a homologous transgene producing double-stranded KNA (a "hairpin” transgene), enhances the frequency of RNAi-based resistance to Potato virus Y in tobacco (P ⁇ 0.007)
  • Table 3 shows the frequency of methylated cytosines in bisulfite-treated GFP DNA extracted from ungrafted and grafted Arabidopsis plants. The number of methylated cytosines out of the total number of tyosines analysed from nine or ten clones is listed (and as a percentage in brackets). All plants used were wild-type.
  • a CpGpG sites were counted as CpG and not CpNpG.
  • b H A, C, or T. ° "f nine, ten, nine and ten bisulfite-treated clones, respectively, were sequenced to generate the data.
  • RNAi-based resistance to Cumcumber moscia virus (CMV) from a tobacco rootstock requires a homologous transgene in the scion.
  • a homologous BAR sense transgene decreases the amount of double stranded RNA produced by a BAR hairpin transgene (P ⁇ 0.001)
  • Figure 8 shows a homologous transgene that produces single-stranded RNA 5 in addition to homologous double-stranded RNA, a homologous transgene producing double-stranded RNA or another homologous RNAi-inducing molecule, enhances induction and/or transmission of RNAi targeted against viruses and deleterious endogenous genes (e.g. oncogenes, Huntington's disease gene).
  • FIG. Ia and b A model summarizing the crucial molecular events in reception of the long-distance signal and the induction of RNA silencing in new tissue is presented in Figures Ia and b.
  • Single- stranded or dsRNA equal in size to the silencer dsRNA in the rootstock is delivered into the nuclei of cells in the shoot apex, where it hybridizes to the homologous transgene or its mRNA and stimulates Pol IV-DRD2-DCL3 activity on adjacent chromatin to produce siRNA.
  • AGO4 or another AGO in association with siRNA then directs partial cleavage of the GFP mRNA population in the nucleus. Decapped, polyadenylated GFP mRNA then becomes a substrate for RDR6 to execute RNA silencing.
  • the model also provides a plausible explanation for why RNA silencing is systemically transmitted to the target scion, whereas cytosine methylation of the transgene is not.
  • the silencer genotype where large amounts of dsRNA are expressed from the hairpin transgene in the nucleus, nuclear DCL and AGO activities would ensure RNA-directed methylation of the transgene.
  • the model predicts that the majority of systemically transmitted RNA silencing is executed in the cytoplasm thereby diluting its potential for mediating RNA-directed DNA methylation.
  • PVX-GFP is largely considered to be cytoplasmically-located RNA silencing, but viral system may generate higher levels siRNA that flood the nucleus to induce methylation of the PVX-GFP transgene.
  • RNAi dsRNA
  • P The remaining 317-nucleotide downstream GFP sequence is referred to as P.
  • 24-nt siRNA is not the long-distance signaling molecule.
  • Previous work implicating 24-nt siRNAs in systemic silencing was based on Agrobacterium infiltration of leaves (Hamilton et al, supra 2002) rather than grafting, and as such, it was not possible to distinguish a signal function for 24-nt siRNAs from a reception function in newly silenced tissue.
  • Silencer rootstocks in a number of other mutant del and rdr backgrounds were also unimpaired in their ability to generate a systemic silencing signal (Table 6).
  • Table 6 GFP silencing in grafted wild-type (WT) and mutant Arabidopsis plants.
  • a homozygous mutant F2 segregants were used from crosses between mutant and wild-type (WT) target lines b homozygous mutant T2 (scion) or Tl (rootstock) produced by transformation with the target or silencer transgenes; scion numbers represent data from two independent transgenic lines, and each rootstock represents an independent transgenic line c ago4 RNAi lines (expressing AGO4 dsRNA) confirmed results obtained with the ago4 mutant d most of these ago4 scions showed delayed silencing
  • DCL3 is known to play a role in silencing of transposons and repetitive DNA, but it has not been implicated in posttranscriptional gene silencing. Together with NRPDIa (Pol IVa) and RDR2, DCL3 is involved in the production of endogenous siRNA from AtSNl retroelements, 5S rDNA repeats, and from other less repetitive loci (Xie et al, supra 2004; Herr et al, Science 308:118-120, 2005).
  • a nuclear localized ARGONAUTE, AGO4 (Xie et al, supra 2004), also plays a role in some components of this pathway, including both the production of siRNA from, and the RNA-directed DNA methylation of, specific loci including the AtSNl retroelement (Ziberman et al, supra 2003).
  • a predicted consequence of the involvement of the Pol IVa-RDR2-DCL3-AGO4 pathway in the nuclear reception and initiation of silencing would be some level of transcriptional down-regulation due to chromatin compaction.
  • Transcriptional down-regulation has been shown to spread outside the initiating region to affect expression of adjacent genes (Finnegan et al, Plant J. 44:420-432, 2005).
  • Quantitative RT-PCR and northern analysis showed that transcription of the 35S:BAR gene, a selectable marker flanking 35S:GFP in the target line, was down-regulated in GFP-silenced scions compared to ungrafted control.
  • the 5' heterogeneity among P-specific RNAs can be explained by a population of siRNAs being responsible for the cleavage, in contrast to a single-sized 5' RACE product of the decapped Scarecrow6-like IV (SCL6- IV) transcript detected after cleavage facilitated by miR171 (Llave et al, supra 2002) ( Figure
  • 24-nt siRNAs were detected within the first 33 nucleotides of P (probe Ia, Figures 12b-c), and siRNAs detected by other P-specific probes (probes Ib and 2, representing nucleotides 36-70 and 73-317 of P, respectively) were almost exclusively 21-nt in size ( Figures 12b-d).
  • DCL4 has been shown to process dsRNA produced by RDR6 into 21-nt tr ⁇ r ⁇ -acting siRNAs (ta-siRNAs) (Xie et al, supra 2005). It is also required for short-distance, cell-to- cell spreading of silencing (Dunoyer et al, Nat. Genet. 57:1356-1360, 2005). However, when dcl4 mutant scions were grafted onto wild-type silencer rootstocks, a normal silencing phenotype was observed ( Figure 12e).
  • siRNA profiles of silenced dcU scions did nevertheless reveal a shift in the size of siRNAs from 21-nt to 22-nt along the entire P region (Figure 12f).
  • the change in siRNA size is in accordance with the previously reported redundant nature of DCL proteins in Arabidopsis (Gasciolli et al, Curr. Biol. 75:1494-1500, 2005).
  • DCL4 22-nt siRNAs can functionally substitute for 21-nt siRNAs in degrading homologous mRNA transcripts.
  • These classes of siRNAs have been recently demonstrated to act in the same hierarchical nature to confer resistance to RNA viruses (Deleris et al, Science 373:68-71, 2006).
  • a genotype is developed to screen for genes involved in long-distance mRNA silencing.
  • the genotype expresses a root-specific GF dsRNA as well as GFP in the shoot tissue.
  • GF refers to the 5' end of GFP transcript.
  • FP refers to the 3' end or central portion of
  • the genotype displays a phenotype similar to grafting a rootstock expressing GF dsRNA onto a scion expressing the GFP (see Figures 13a and b), but no grafting is required to create the phenotype.
  • This genotype can be mutated and used to screen for mutants that lack systemic silencing. A map-based cloning approach is then used to clone the mutated genes. Genes can be discovered which facilitate or modulate long-distance RNA signaling, virus resistance and plant development.
  • Table 7 provides the frequency of transmission of mRNA silencing rootstocks expressing dsRNA homologous to the GFP transcript. Scions expressing GFP were grafted onto rootstocks expressing dsRNA homologus to the 5' (GF), central (FP) or 3' terminal (3' ocs) portions of the GFP transcript. No transmission of silencing was observed when the 3' end of the GFP transcript (3 1 ocs) was targeted.

Abstract

The present invention relates generally to the field of gene expression, and particularly to the modulation of gene expression by a combination of double-stranded RNA and single-stranded sense RNA molecules targeted to the same gene. The invention also provides use of the methods for modulating gene expression in manipulating phenotypes and traits

Description

MODULATION OF GENE EXPRESSION AND AGENTS
USEFUL FOR SAME
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates generally to the field of gene expression and more particularly the modulation of gene expression by transcriptional and post-transcriptional gene silencing mechanisms. Even more particularly, the present invention provides agents and protocols for modulating gene expression and their use in manipulating phenotypes and traits.
DESCRIPTION OF THE PRIOR ART
Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in any country.
Gene silencing is an important tool in molecular biology and genetic engineering. There is great potential to generate genetically modified plants and animals which exhibit altered phenotypes having commercially or therapeutically useful properties. Some success has already been achieved in generating genetically modified plants and animals. However, gene silencing, and in particular targeted gene silencing is not always consistently successful or effective.
In eukaryotic organisms, gene silencing via RNA interference (RNAi) is triggered by double-stranded RNA (dsRNA) and requires members of a relatively conserved set of gene products. dsRNA is processed by DICER and DICER-like (DCL) proteins into small interfering RNA (siRNA), 20-25 nucleotides in length. These small RNA then guide an RNA-initiated silencing complex (RISC) to mediate post-transcriptional gene silencing (PTGS) of niRNA and RNA viruses, or transcriptional gene silencing (TGS) of transposons and repetitive DNA. Key and perhaps autonomous components of RISCs are members of the ARGONAUTE family of proteins. In plants, a new class of nuclear DNA- dependent RNA polymerase (Pol IV), as well as RNA-dependent RNA polymerases (RDRs) have also been shown to be important components of PTGS and/or methylation of transposons and repetitive DNA. NRPDIa, which encodes a large subunit of Pol IVa, is so far unique in that mutants show both partial loss of PTGS and TGS of certain transposons and repetitive sequences.
An intriguing feature of PTGS in plants and worms is that it can be systemically transmitted throughout the organism. When dsRNA is expressed or injected in one tissue of the organism, PTGS spreads to other tissues. The mobile signals are likely to be nucleic acids since systemic silencing is highly sequence-specific. One gene has been identified in C. elegans that is required for systemic spreading of PTGS called SID-I which encodes a transmembrane protein involved in transport of dsRNA. However, there is no SID-I gene in Arabidopsis and no other genes required for long-distance transmission of PTGS have yet been identified in plants.
Given the importance of gene silencing in the genetic manipulation of cells and viral genomes, there is a need to improve targeted gene silencing techniques.
SUMMARY OF THE INVENTION
The present invention provides an enhanced method of inhibiting expression of a target gene including a viral genome in a cell by subjecting the gene to both RNA-directed transcriptional gene silencing (TGS) and RNAi-mediated post-transcriptional gene silencing (PTGS). A "gene" in this context is any nucleotide sequence which is subject to transcription or potential transcription and includes all or part of a viral genome. In addition, or in the alternative, one or more components of either the TGS or PTGS pathway may be up-regulated or otherwise targeted to facilitate target gene silencing. The method and agents of the present invention are useful in manipulating phenotypes and traits in plants and animals and can facilitate genetic therapy, maintenance and regeneration.
The essence of the instant invention lies in part in the ability to stimulate both TGS and PTGS via nuclear RNA signaling. The RNA signal corresponds to an RNA silencing species comprising a single stranded (ss) or double stranded (ds) RNA molecule which may be DNA-derived or synthetic. Examples of RNA silencing species include short or long ds-RNA molecules, hairpin species and partial hairpin species which comprise a strand having a nucleotide sequence capable of hybridizing or forming a complex with a DNA strand of the target gene. The target gene in this instance refers to the actual target gene as well as introduced homologous target sequence. This leads to transcriptional gene silencing via a pathway involving RNA polymerase IV (Pol IV), RNA-dependent RNA polymerase 2 (RDR2), DICER-like3 (DCL3), ARGONAUTE4 (AGO4) and RDR6.
Although not intending to limit the present invention to any theory or mode of action, it is proposed in a preferred embodiment that the RNA silencing species and the target gene (actual and/or homologous) or a transcript thereof lead to a synergistic effect in relation to inhibition of gene expression.
In addition, the RNA silencing species may be produced in the same cell as the target gene or homologous target sequence or produced in a differenT-cell or introduced to a subject wherein it enters the cell carrying the target gene or homologous sequence. Hence, local (same cell, i.e. intra-cell) or remote (long distance, i.e. inter-cell) RNA signaling forms part of the present invention.
RNAi is triggered by dsRNA which is processed by DICER and DICER-like proteins into small interfering RNA (siRNA). These small RNA guide an RNA-initiated silencing complex (RISC) to mediate PTGS of target transcript.
As indicated above, the RNA silencing species may be generated in the same cell or a differenT-cell as the target gene. Consequently, short and long distance (i.e. cell autonomous and non-cell autonomous) RNA silencing is contemplated by the present invention.
Accordingly, one aspect of the present invention contemplates a method of inhibiting expression of a target gene in a cell said method comprising:
(i) introducing into or generating in said cell or parent or relative including progeny of said cell an RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene;
(ii) generating in said cell or a relative including progeny of said cell a transcript corresponding to all or part of the coding strand or other transcribed portion of said target gene;
wherein inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
The present invention is not to be construed as being limited to any particular order of steps (i) and (ii). Hence, step (ii) may occur first or simultaneous with step (i). In addition, one or other of the step (i) or (ii) may occur through conventional breeding. As indicated above, this aspect of the present invention covers both intra-cellular and intercellular RNA signalling. In other words, the RNA silencing species may be generated in the same cell as the target gene or homologous target sequence or in a differenT-cell.
The RNA transcript in part (ii) comprises at least 5 contiguous nucleotides homologous to the transcript of the actual target gene and is referred to as the "homologous target sequence". "At least 5 nucleotides" means from about 5 nucleotides to the full length transcript. This term does not imply that the homologous target sequence represents the full length target gene RNA transcript although this may be the case. The term "target gene" includes the actual target gene and an introduced or generated homologous sequence. In one embodiment, the 5' end of a gene transcript is targeted. In another embodiment, the 3' end is targeted. The former is useful for targeting gene families (including viral families) whilst the latter is useful for targeting specific members of a gene family or viral family.
In addition to the target gene, a further homologous target (full or part length of a target gene) is required.
Preferably, the transcriptional gene silencing is via an siRNA pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6.
In one embodiment, the RNA silencing species is a DNA-derived RNA species. In another embodiment, it is a synthetic RNA. In still another embodiment, the RNA silencing species is generated in a cell which does not comprise the actual target gene or the homologous target sequence.
The present invention contemplates, therefore, a method for generating a genetically modified cell including a subject comprising said cell or a relative including progeny of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of: (a) a second DNA which generates an RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene;
(b) a modification increasing copy number and/or expression levels of said target gene; and/or
(c) an elevated component of an RNA amplification or degradative pathway selected from Pol IV, RDR2, DCL3, AG04 and RDR6.
The present invention still further provides a method for altering the phenotype of a cell or a relative of said cell or a subject comprising said cell or a relative including progeny of said cells, said method comprising:
(i) introducing to a cell or a relative of the cell carrying the target gene or to which the target gene may subsequently be introduced an RNA silencing species directed to the target gene;
and one or more of:
(a) introducing to said cell or its relative including progeny cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an RNA transcript is generated which is substantially homologous to at least 5 contiguous nucleotides of an RNA transcript of the target gene; and/or
(b) increasing the copy number and/or level of expression of the target gene; and/or
(c) increasing the level of a component of an RNA amplification or degradation pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
Examples of part (b) include contacting cells with chemicals, drugs, biological agents or other stimuli to increase gene copy number and/or rates of transcription.
Another aspect of the present invention provides a method for inhibiting expression of a target gene in a cell of a recipient said method comprising:
(i) isolating one or more populations of cells from said recipient;
(ii) introducing genetic constructs into at least two subpopulations of the same population of cells or in two different populations of cells, wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and is introduced into one population or subpopulation of cells and a second construct comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene is introduced into the other population or subpopulation of cells; and
(iii) returning said population or subpopulation of cells to the recipient wherein inhibition of expression of the target gene carrying the second construct occurs by TGS and PTGS via RNA signaling from the RNA silencing species.
Still another aspect of the present invention provides a method of treatment of a recipient requiring silencing of expression of a target gene said method comprising introducing autologous cells from said recipient modified to generate a transcript of said target gene and introducing to said recipient a DNA-derived or synthetic RNA silencing species or an autologous cell modified to generate the DNA-derived RNA silencing species wherein upon entry of the RNA silencing species into the cells comprising a transcript of the target gene, expression of said target gene is inhibited by TGS and PTGS.
Even yet another aspect of the present invention is directed to a phenotypic modifying kit for a subject comprising:
(i) an RNA silencing species specific for a target gene or cells capable of generating same;
(ii) a genetic construct comprising a DNA sequence which encodes a RNA transcript of said target gene or cells comprising same; and
(iii) instructions for use comprising introducing into said subject the genetic construct or cells comprising same such that the subject establishes a population of said cells, introducing to said subject the RNA silencing species or cells comprising same and monitoring for gene silencing via a TGS pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6 and a PTGS pathway via RISC.
Genetic modified plants or animals are also contemplated herein in which a target gene is down-regulated or has the potential to be down-regulated. A "target gene" refers to both the actual target gene (e.g. endogenous gene, onco gene, viral gene, pathogen gene etc.) or an introduced homologous gene sequence. It also refers to any viral genetic sequence which is transcribed as part of the infection, insertion, maintenance, assembly or release process. Hence, the term "gene" includes, therefore, a viral genetic sequence. The "homologous" sequence may correspond to or encode from about 5 to about full length transcript of the target gene. If it is less than full length, then it includes from about 5 to about 10,000 nucleotides.
Genetic constructs capable of generating the RNA silencing species and the homologous target sequence also form part of the subject invention.
In particular, the present invention provides genetic constructs enabling the production of hairpin and sense strands directed to particular genes or their transcripts.
A list of abbreviations used throughout the subject specification are provided in Table 1. Table 1 Abbreviations
Figure imgf000010_0001
BRIEF DESCRIPTION OF THE FIGURES
Figures Ia and b is a diagrammatic representation of a proposed model for nuclear reception of the RNA silencing signal.
Figure 2 is a schematic representation of the T-DNA regions of binary vectors used to produce target and silencer transgenic Arabidopsis lines, (a) pUQC214 was used to produce target plant lines expressing GFP. (b) pUQC218 was used to produce S2 silencer lines expressing a GF-specifϊc dsRNA (RNAi) transgene and a functional, albeit silenced, GFP transgene. (c) pUQC252 was used to produce Sl silencer lines expressing the same GF-specific dsRNA (RNAi) transgene but without a GFP transgene. (d) pUQC1081 was used to produce the BAR S2 silencer line expressing όαr-specific siRNAs. LB, T-DNA left border; RB, T-DNA right border; 35S, Cauliflower Mosaic Virus 35S promoter; ocs, octopine synthase 3' terminator; BAR, confers resistance to the herbicide phosphinothricin; NPTII, confers resistance to kanamycin.
Figure 3 is a diagrammatic and photographic representation showing graft-transmissible mRNA silencing in wild-type Arabidopsis. (a) Schematic representation of seedling grafting and the transgene constructs used to produce the target and silencer (Sl and S2) plant lines, (b) Phenotypes of the wild-type (WT) target and S2 silencer plant lines, (c) Phenotype of WT target scions grafted onto S2 rootstocks at 18 and 23 days after grafting, (d) Bisulphite sequencing showing percent cytosine methylation in WT S2 plants and in WT target scions grafted onto WT S2 rootstocks. (e) Southern analysis of HpaII digested DNA. High molecular weight fragments in WT S2 are indicative of methylated DNA, whereas unmethylated fragments (531 bp) were predominantly seen in WT target and WT target scions. M, size marker; H, HpaII sites in the schematic representation of GFP. (f) Small RNA from silencers (Sl and S2), and from target scions grafted onto Sl and S2 rootstocks, probed with the GF and P sequences. Figures 4a to e are representations demonstrating graft-transmissibility of the mobile signal from silenced rootstocks to reduce RNA silencing on target GFP. Reciprocal grafts involving DCL3 target scions and wild-type silenced rootstocks revealed that DCL3 was required for scion tissue to respond to mobile silencing signal. No silencing of GFP or its transcript was observed in mutant DCL3 scion.
Figure 5 is a pictorial representation showing that sense and hairpin transgenes act synergistically to induce RNAi-based resistance to potato virus Y in tobacco.
Figure 6 is a pictorial representation showing long-distance transmission of RNAi-based resistance to potato virus Y in tobacco requires a sense transgene.
Figure 7 is a graphical representation showing a homologous BAR sense transgene decreases the amount of double standard RNA produced by a BAR hairpin transgene (PX).001).
Figure 8 is diagrammatic representation showing predictions for enhanced RNAi against HIV, Hepatitis B, Hepatitis C and the deleterious endogenous genes.
Figure 9 is a photographic representation showing the dell 3 T-DNA insertion mutant, (a) Northern blot analysis of wild-type Columbia and dell 3 mutant, (b) Wild-type Columbia and del 13 mutant phenotypes.
Figure 10 is a representation of the alignment of P-specific 5' RACE products. The bold, underlined G in italic represents the 400th nucleotide of GFP and the final nucleotide of the GF-specific sequence that was used to construct the GF-specific dsRNA (RNAi) transgene. Sequence analysis often 5' RACE products showed that five started at 52 nucleotides, and the other five started at 37, 40, 49, 58 and 79 nucleotides, into the P sequence of GFP. Figure 11 is a photographic representation showing the genes required for long-distance mRNA silencing, (a) Small RNA from WT S2 and dcll3 S2 plants probed with full-length GFP. (b) Phenotypes of WT target scions grafted onto WT S2 and dell 3 S2 rootstocks. (c) Phenotypes of dell 3, nrpdla, rdr2, rdrό and ago4 target scions grated onto WT S2 rootstocks. Some ago4 scions showed delayed silencing, (d) Northern analysis of GFP mRNA levels in various grafted and non-grafted plants.
Figure 12 is a photographic representation of the molecular genetic analysis of graft- transmissible mRNA silencing, (a) Agarose gel electrophoresis of 5' RACE products from GFP-silenced target scions grafted onto S2 rootstocks. The white bracket indicates the region cloned and sequenced (see Figure 10). Lower panel represents the 5' RACE amplification of the miRl 71 -cleaved SCL6-IV transcript, (b) Target GFP transgene showing the regions used as probes for small RNA analysis, (c) Small RNA analysis of WT scions within the first 70 nucleotides of P. (d) Small RNA analysis of mutant scions grafted onto WT S2 rootstocks. (e) Phenotype and northern blot of dcl4 target scions grafted onto WT S2 rootstocks. (f) Small RNA analysis of dcU target scions grafted onto WT S2 rootstocks.
Figures 13a and b are a schematic representation and photographic representations of plants expressing GFP under the p35S promoter and FG and GF under the pRCH promoter. The construct is pUQC 10027 staining is shown 8 days, 17 days and 24 days after planting.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
The present invention provides methods of genetically modifying cells, relatives including parents and progeny of these cells and subjects comprising some or all of these cells. The genetic modification includes directly inhibiting expression of one or more target genes ("actual target gene") as well as indirectly modulating expression of a gene by inhibiting expression of another gene which encodes a regulator of expression of the first mentioned gene. A "target gene" in this instance includes a viral genetic sequence. More particularly, the present invention enables effective inhibition of expression of a target gene in a cell via mechanisms of transcriptional and post-transcriptional gene silencing ("TGS" and "PTGS", respectively). Reference to a "relative" of a cell includes a precursor, parent or progeny of a particular cell as well as a fusion between two or more relative cells or a relative and a non-relative cell. The ability to modify gene expression enables phenotypes and traits to be modified in plants and animals and helps facilitate genetic therapy, maintenance and regeneration.
Inhibition of expression of a target gene is accomplished in a cell by:
(i) introducing to a cell or a relative of the cell carrying the target gene or to which the target gene may subsequently be introduced, an RNA silencing species directed to the target gene; and one or more of:
(a) introducing to said cell or its relative cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an RNA transcript ("homologous target sequence") is generated which is substantially homologous to at least 5 contiguous nucleotides of an RNA transcript of the actual target gene; and/or
(b) increasing the copy number and/or level of expression of the actual target gene; and/or
(c) increasing the level of a component of an RNA degradative pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
A "gene" in this context is any nucleotide sequence which is transcribed or capable of transcription and includes all or part of a viral genome.
Accordingly, one aspect of the present invention provides a method of inhibiting expression of a target gene in a cell said method comprising:
(i) introducing into or generating in said cell or parent or relative including progeny of said cell an RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene;
(ii) generating in said cell or a relative including progeny of said cell a transcript corresponding to all or part of the coding strand or other transcribed portion of said target gene;
wherein inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
The present invention contemplates, therefore, a method for generating a genetically modified cell including a subject comprising said cell or a relative of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of:
(a) a second DNA which generates RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene;
(b) a modification increasing copy number and/or expression levels of said target gene; and/or
(c) an elevated component of an RNA degradative pathway selected from Pol
IV, RDR2, DCL3, AGO4 and RDR6. The essence of the subject invention is the use of an RNA silencing species (DNA-derived or synthetic) in combination with an introduced nucleotide sequence which is homologous to a particular target gene or part thereof or a transcript thereof. In an alternative, a homologous nucleotide sequence is not introduced but the copy number or level of expression of the actual target gene is increased such as by chemical or biological means. The combination of RNA silencing species and homologous target sequence is, in a preferred embodiment, a synergistic combination.
A proposed non-limiting model summarizing the molecular events in reception of RNA mediated signalling is shown in Figures Ia and b. In this model, single stranded or double stranded RNA is introduced into the nuclei of cells where it hybridizes to the homologous transgene. This stimulates PolIV-DRD2-DCL3 activity on adjacent chromation to produce siRNA. AG04 in association with siRNA then directs partial cleavage of the target mRNA population in the nucleus. In one particular embodiment, decapped, polyadenylated target RNA is then exported from the nucleus and becomes a substrate for RDR6 to execute RNA silencing.
The present invention still further provides a method for altering the phenotype of a cell or a subject comprising said cell or a subject comprising said cell or a relative of said cell said method comprising:
(i) introducing to a cell or a relative of the cell carrying the target gene or to which the target gene may subsequently be introduced an RNA silencing species directed to the target gene; and one or more of:
(a) introducing to said cell or its relative cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an mRNA transcript is generated which is substantially homologous to at least 5 contiguous nucleotides of an mRNA transcript of the target gene; and/or (b) increasing the copy number and/or level of expression of the target gene; and/or
(c) increasing the level of a component of an RNA amplification and degradation pathway selected from Pol IV, RDR2, DCL3, AG04 and RDR6.
In a preferred embodiment, constructs are generated depending on whether a gene family (or virus family) is to be down-regulated or whether a single member of a gene family (or virus family) is to be inhibited. In the case of the former, the 5' end of an mRNA transcript is targeted with homologous dsRNA. In the case of the latter, the 3' end is targeted with homologous dsRNA.
The method of the present invention enables selective inhibition of gene expression and indirect modulation of expression of other genes regulated by the first mentioned gene by TGS and PTGS.
The essence of the invention is in part the ability to stimulate both TGS and PTGS via nuclear RNA signaling. The RNA signal corresponds to an RNA silencing species comprising a ds-RNA molecule which may be DNA-derived or synthetic. Examples of RNA silencing species include short or long ds-RNA molecules, hairpin and partial hairpin species which comprise a strand having a nucleotide sequence capable of hybridizing or forming a complex with a DNA strand of the actual target gene or homologous target sequence. The RNA silencing species may form a complex with either strand of the target gene. This leads to TGS via a pathway involving Pol IV, RDR2, DCL3, AGO4 and RDR6.
RNAi is triggered by dsRNA which is processed by DICER and DICER-like proteins into small interfering RNA (siRNA). These small RNA guide RISC to mediate PTGS of target transcripts.
The terms "subject" and "recipient" are used interchangeably to refer to a multi-cellular (i.e. two or more cells) organism, plant or animal. The "subject" may also be a target virus.
Accordingly, one aspect of the present invention contemplates a method of inhibiting expression of a target gene in a cell said method comprising:
(i) introducing into or generating in said cell or parent or relative of said cell an RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene;
(ii) generating in said cell or a parent of said cell an RNA transcript corresponding to a transcribed portion of said target gene,
wherein inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
As indicated above, the TGS is via a RNA degradative pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6.
In one embodiment, the RNA silencing species is a DNA-derived RNAi species. In another embodiment, it is a synthetic RNA. In still another embodiment, the RNA silencing species is generated in a cell which does not comprise the actual target gene or homologous target sequence.
Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and/or RNA (e.g. mRNA) product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay
(ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS). For RNA-mediated inhibition in a cell, cell line or whole organism, gene expression is conveniently assayed by use of a reporter or drug resistance gene whose protein product is readily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS)5 chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin.
A "target gene" is any nucleic acid sequence which undergoes transcriptional activity and includes an endogenous gene, transgene, a gene in an artificial chromosome, an oncogene and a gene on a pathogen. A pathogen includes a microbial, viral, protozoan or other parasite. An endogenous gene includes a gene normally expressed in a cell such as a gene encoding an enzyme of a biochemical pathway (e.g. in plants, the anthocyanin pathway). The actual target gene is the gene whose expression is to be inhibited and the homologous target sequence is the additional copy of the target gene or part thereof which is introduced to a cell.
The cell with the target gene may be derived from or contained in any organism and may be the result of introducing a genetic construct into thaT-cell or a relative thereof. As indicated above, the organism may be a plant, animal, protozoan, bacterium, virus or fungus.
Reference herein to a plant includes a monocotyledonous plant or a dicotyledonous plant and the plant may be generated from genetically transformed callus or tissue or it may be a progeny of the transformed plant or a cross between the transformed plant or its progeny and a non-transformed plant or a graft between a rootstock and a scion. As used herein, the term "plant" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like.
Examples of plants of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. junceά), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativά), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solarium tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassaya (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), cotton pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Per sea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidental), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.
Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas- fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glaucά); redwood {Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsameά); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). Plants of the present invention include crop plants (for example, cotton, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), such as corn and soybean plants.
Turfgrasses include, but are not limited to: annual bluegrass (Poa annuά); annual ryegrass (Lolium multiflorum); Canada bluegrass (Poa compressa); Chewings fescue (Festuca rubra); colonial bentgrass (Agrostis tenuis); creeping bentgrass (Agrostis palustris); crested wheatgrass (Agropyron desertorum); fairway wheatgrass (Agropyron cristatum); hard fescue (Festuca longifolia); Kentucky bluegrass (Poa pratensis); orchardgrass (Dactylis glomerata); perennial ryegrass (Lolium perenne); red fescue (Festuca rubra); redtop (Agrostis alba); rough bluegrass (Poa trivialis); sheep fescue (Festuca ovina); smooth bromegrass (Bromus inermis); tall fescue (Festuca arundinacea); timothy (Phleum pratense); velvet bentgrass (Agrostis canina); weeping alkaligrass (Puccinellia distans); western wheatgrass (Agropyron smithii); Bermuda grass (Cynodon spp.); St. Augustine grass (Stenotaphrum secundatum); zoysia grass (Zoysia spp.); Bahia grass (Paspalum notatum); carpet grass (Axonopus affinis); centipede grass (Eremochloa ophiuroides); kikuyu grass (Pennisetum clandesinum); seashore paspalum (Paspalum vaginatum); blue gramma (Bouteloua gracilis); buffalo grass (Buchloe dactyloids); sideoats gramma (Bouteloua curtipendula).
Plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, millet, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, flax, castor, olive etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
Preferred plants contemplated herein include cotton, sweet corn, tomato, tobacco, piniento, potato, sunflower, citrus, plums, sorghum, leeks, soybean, alfalfa, beans, pidgeon peas, chick peas, artichokes, curcurbits, lettuce, Dianthus, geraniums, cape gooseberry, maize, flax and linseed, lupins, broad beans, garden peas, peanuts, canola, snapdragons, cherry, sunflower, pot marigolds, Helichrysum, wheat, barley, oats, triticale, carrots, onions, orchids, roses and petunias.
Animals may be vertebrates or invertebrates.
Examples of vertebrate animals include fish, mammal, cattle, goat, pig, sheep, rodent, hamster, mouse, rat, primate, and human; invertebrate animals include nematodes, other worms, drosophila, and other insects. Representative generae of nematodes include those that infect animals (e.g., Ancylostoma, Ascaridia, Ascaris, Bunostomum, Caenorhabditis, Capillaria, Chabertia, Cooperia, Dictyocaulus, Haemonchus, Heterakis, Nematodirus, Oesophagostomum, Ostertagia, Oxyuris, Parascaris, Strongylus, Toxascaris, Trichuris, Trichostrongylus, Tfhchonema, Toxocara, Uncinaria) and those that infect plants (e.g., Bursaphalenchus, Criconemella, Diiylenchus, Ditylenchus, Globodera, Helicotylenchus, Heterodera, Longidorus, Melodoigyne, Nacobbus, Paratylenchus, Pratylenchus, Radopholus, Rotelynchus, Tylenchus, and Xiphinema). Representative orders of insects include Coleoptera, Diptera, Lepidoptera, and Homoptera.
Preferred microbes include those used in agriculture or by industry, and those that are pathogenic for plants or animals. Fungi include organisms in both the mold and yeast morphologies.
Pathogens also include viruses which infect plant or animal cells which include Acinetobacter phage 133, Aeromonas phage 40RR2.8t, Aeromonas phage 65, Aeromonas phage Aehl, Enter obacteria phage SV14, Enter obacteria phage T4, Pseudomonas phage
42, Vibrio phage nt-1, Aeromonas phage 43, Enterobacteria phage Pl, Enter obacteria phage P2, Haemophilus phage HPl, Enterobacteria phage Mu, Bacillus phage SPOl,
Halobacterium phage øH, Enterobacteria phage HK022, Enterobacteria phage HK97, Enterobacteria phage λ, Enterobacteria phage Tl, Enterobacteria phage T5, Vibrio phage
149 (type IV), Mycobacteria phage D29, Mycobacterium phage L5, Lactococcus phage bIL67, Lactococcus phage c2, Methanobacterium phage ψMl, Streptomyces bacteriophage øfC31, Enter obacteria phage N15, Enterobacteria phage T7, Kluyvera phage Kvpl, Pseudomonad phage gh-1, Enterobacteria phage P22, Bacillus phage ø29, Kurthia phage 6, Streptococcus phage Cp-I, Enterobacteria phage N4, Bacillus phage AP 50, Bacillus phage Bam35, Bacillus phage øNSll, Enterobacteria phage PRDl, Thermus phage P37-14, Pseudoalteromonas phage PM2, Acholeplasma phage L2, Thermoproteus tenax virus 1, Sulfolobus islandicus filamentous virus, Acidianus filamentous virus 1, Sulfolobus islandicus rod-shaped virus 1, Sulfolobus islandicus rod- shaped virus 2, Sulfolobus spindle-shaped virus 1, His 1 virus, Sulfolobus newzealandicus droplet-shaped virus, Camelpox virus, Cowpox virus, Ectromelia virus, Monkeypox virus, Raccoonpox virus, Taterapox virus, Vaccinia virus, Variola virus, Volepox virus, Bovine papular stomatitis virus, Orf virus, Parapoxvirus of red deer in New Zealand, Pseudocowpox virus, Squirrel parapoxvirus, Canarypox virus, Fowlpox virus, Juncopox virus, Mynάhpox virus, Pigeonpox virus, Psittacinepox virus, Quailpox virus, Sparrowpox virus, Starlingpox virus, Turkeypox virus, Goatpox virus, Lumpy skin disease virus, Sheeppox virus, Hare fibroma virus, Myxoma virus, Rabbit fibroma virus, Squirrel fibroma virus, Swinepox virus, Molluscum contagiosum virus, Tanapox virus, Yaba monkey tumor virus, Anomala cuprea entomopoxvirus, Aphodius tasmaniae entomopoxvirus, Demodema boranensis entomopoxvirus, Dermolepida albohirtum entomopoxvirus, Figulus subleavis entomopoxvirus, Geotrupes sylvaticus entomopoxvirus, Melolontha melolontha entomopoxvirus, Acrobasis zelleri entomopoxvirus 'L', Amsacta moorei entomopoxvirus 'L', Arphia conspersa entomopoxvirus 1O', Choristoneura biennis entomopoxvirus 'L', Choristoneura conflicta entomopoxvirus 'L', Choristoneura diver suma entomopoxvirus 'L', Choristoneura fumiferana entomopoxvirus 'L ', Chorizagrotis auxiliars entomopoxvirus 'L', Heliothis armigera entomopoxvirus 'L', Locusta migratoria entomopoxvirus 1O', Oedaleus senigalensis entomopoxvirus 1O', Operophtera brumata entomopoxvirus 'L', Schistocera gregaria entomopoxvirus 1O', Aedes aegypti entomopoxvirus, Camptochironomus tentans entomopoxvirus, Chironomus attenuatus entomopoxvirus, Chironomus luridus. entomopoxvirus, Chironomus plumosus entomopoxvirus, Goeldichironomus haloprasimus entomopoxvirus, Diachasmimorpha entomopoxvirus, African swine fever virus, Invertebrate iridescent virus 1, Invertebrate iridescent virus 6, Invertebrate iridescent virus 3, Ambystoma tigrinum virus, Bohle iridovirus, Epizootic haematopoietic necrosis virus, European catfish virus, Frog virus 3, Santee-Cooper ranavirus, Lymphocystis disease virus 1, Infectious spleen and kidney necrosis virus, Paramecium bursaria Chlorella virus 1, Paramecium bursaria Chlorella virus Al, Paramecium bursaria Chlorella virus ALIA, Paramecium bursaria Chlorella virus AL2A, Paramecium bursaria Chlorella virus BJ2C, Paramecium bursaria Chlorella virus CA4A, Paramecium bursaria Chlorella virus CA4B, Paramecium bursaria Chlorella virus IL3A, Paramecium bursaria Chlorella virus NClA, Paramecium bursaria Chlorella virus NE8A, Paramecium bursaria Chlorella virus NY2A, Paramecium bursaria Chlorella virus NYsI, Paramecium bursaria Chlorella virus SClA, Paramecium bursaria Chlorella virus XY6E, Paramecium bursaria Chlorella virus XZ3A, Paramecium bursaria Chlorella virus XZ4A, Paramecium bursaria Chlorella virus XZ4C, Hydra viridis Chlorella virus 1, Emiliania huxleyi virus 86, Micromonas pusilla virus SPl, Chysochromulina brevifilum virus PWl, Ectocarpus fasciculatus virus a, Ectocarpus siliculosus virus 1, Ectocarpus siliculosus virus a, Feldmannia irregularis virus a, Feldmannia species virus, Feldmannia species virus a, Hincksia hinckiae virus a, Myriotrichia clavaeformis virus a, Pilayella littoralis virus 1, Heterosigma akashiwo virus 01, Aureococcus anophagefference virus, Chrysochromulina ericina virus 01B, Heterocapsa circularisquama virus 01, Phaeocystis pouchetii virus 01, Pyramimonas orientalis virus 01B, Adoxophyes honmai , Agrotis ipsilon multiple nucleopolyhedrovirus, Anticarsia gemmatalis multiple nucleopolyhedrovirus, Autographa californica multiple nucleopolyhedrovirus, Bombyx mori nucleopolyhedrovirus, Buzura suppressaria nucleopolyhedrovirus, Choristoneura fumiferana DEF multiple nucleopolyhedrovirus, Choristoneura fumiferana multiple nucleopolyhedrovirus, Choristoneura rosaceana nucleopolyhedrovirus, Culex nigripalpus nucleopolyhedrovirus, Ecotropis obliqua nucleopolyhedrovirus, Epiphyas postvittana nucleopolyhedrovirus, Helicoverpa armigera nucleopolyhedrovirus, Helicoverpa zea single nucleopolyhedrovirus, Lymantria dispar multiple nucleopolyhedrovirus, Mamestra brassicae multiple nucleopolyhedrovirus, Mamestra configurata A, Mamestra configurata B, Neodiprion lecontii nucleopolyhedrovirus, Neodiprion sertifer nucleopolyhedrovirus, Orgyia pseudotsugata multiple nucleopolyhedrovirus, Spodoptera exigua multiple nucleopolyhedrovirus, Spodoptera frugiperda multiple nucleopolyhedrovirus, Spodoptera littoralis nucleopolyhedrovirus, Spodoptera litura nucleopolyhedrovirus, Thysanoplusia orichalcea nucleopolyhedrovirus, Trichoplusia ni single nucleopolyhedrovirus, Wiseana signata nucleopolyhedrovirus, Adoxophyes orana granulovirus, Artogeia rapae granulovirus, Choristoneura fumiferana granulovirus, Cryptophlebia leucotreta granulovirus, Cydia pomonella granulovirus, Harrisina brillians granulovirus, Helicoverpa armigera granulovirus, Lacanobia oleracea granulovirus, Phthorimaea operculella granulovirus, Plodia interpunctella granulovirus, Plutella xylostella granulovirus, Pseudalatia unipuncta granulovirus, Trichoplusia ni , Xestia c-nigrum granulovirus, White spot syndrome virus 1, Ateline herpesvirus 1, Bovine herpesvirus 2, Cercopithecine herpesvirus 1, Cercopithecine herpesvirus 2, Cercopithecine herpesvirus 16, Human herpesvirus 1, Human herpesvirus 2, Macropodid herpesvirus 1, Macropodid herpesvirus 2, Saimiriine herpesvirus 1, Bovine herpesvirus 1, Bovine herpesvirus 5, Bubaline herpesvirus 1, Canid herpesvirus 1, Caprine herpesvirus 1, Cercopithecine herpesvirus 9, Cervid herpesvirus 1, Cervid herpesvirus 2, Equid herpesvirus 1, Equid herpesvirus 3, Equid herpesvirus 4, Equid herpesvirus 8, Equid herpesvirus 9, Felid herpesvirus 1, Human herpesvirus 3, Phocid herpesvirus 1, Suid herpesvirus 1, Gallid herpesvirus 2, Gallid herpesvirus 3, Meleagrid herpesvirus 1, Gallid herpesvirus 1, Psittacid herpesvirus 1, Cercopithecine herpesvirus 5, Cercopithecine herpesvirus 8, Human herpesvirus 5, Pongine herpesvirus 4, Murid herpesvirus 1, Murid herpesvirus 2, Human herpesvirus 6, Human herpesvirus 7, Caviid herpesvirus 2, Tupaiid herpesvirus 1, Callitrichine herpesvirus 3, Circopithecine herpesvirus 12 Cercopithecine herpesvirus 14, Cercopithecine herpesvirus 15, Human herpesvirus 4, Pongine herpesvirus 1, Pongine herpesvirus 2, Pongine herpesvirus 3, Alcelaphine herpesvirus 1, Alcelaphine herpesvirus 2, Ateline herpesvirus 2, Bovine herpesvirus 4, Cercopithecine herpesvirus 17, Equid herpesvirus 2, Equid herpesvirus 5, Equid herpesvirus 7, Hippotragine herpesvirus 1, Human herpesvirus 8, Murid herpesvirus 4, Mustelid herpesvirus 1, Ovine herpesvirus 2, Saimiriine herpesvirus 2, Callitrichine herpesvirus 1, Ictalurid herpesvirus 1, Bovine adenovirus A, Bovine adenovirus B, Bovine adenovirus C, Canine adenovirus, Equine adenovirus A, Equine adenovirus B, Human adenovirus A, Human adenovirus B, Human adenovirus C, Human adenovirus D, Human adenovirus E, Human adenovirus F, Murine adenovirus A, Ovine adenovirus A, Ovine adenovirus B, Porcine adenovirus A, Porcine adenovirus B, Porcine adenovirus C, Tree shrew adenovirus, Fowl adenovirus A, Fowl adenovirus B, Fowl adenovirus C, Fowl adenovirus D, Fowl adenovirus E, Goose adenovirus, AtadenovirusBovine adenovirus D, AtadenovirusDuck adenovirus A, Atadenovirus Ovine adenovirus D, AtadenovirusPossum adenovirus, Frog adenovirus, Turkey adenovirus A, Rhizidiomyces virus, African green monkey polyomavirus, Baboon polyomavirus 2, BK Bovine polyomavirus, Budgerigar fledgling disease polyomavirus, Hamster polyomavirus, Human polyomavirus, JC polyomavirus, Murine pneumotropic virus, Murine Rabbit kidney vacuolating virus Simian virus 12, Simian virus 40, Human papillomavirus — 2, Human papillomavirus — 6, Human papillomavirus — 7, Human papillomavirus — 10, Human papillomavirus — 16, Human papillomavirus — 18, Human papillomavirus — 26, Human papillomavirus — 32, Human papillomavirus — 34, Human papillomavirus — 53, Human papillomavirus - 54, Human papillomavirus - 61, Human papillomavirus - 71, Human papillomavirus - cand90, Rhesus monkey papillomavirus - 1, Human papillomavirus - 5, Human papillomavirus - 9, Human papillomavirus - 49, Human papillomavirus - cand92, Human papillomavirus - cand96, Human papillomavirus - 4, Human papillomavirus - 48, Human papillomavirus - 50, Human papillomavirus - 60, Human papillomavirus - 88, Bovine papillomavirus - 1, Deer papillomavirus, European elk papillomavirus, Ovine papillomavirus — 1, Bovine papillomavirus - 5, Equine papillomavirus - 1, Fringilla coelebs papillomavirus, Psittacus erithacus timneh papillomavirus, Mastomys natalensis papillomavirus, Cottontail rabbit papillomavirus, Rabbit oral papillomavirus, Canine oral papillomavirus, Feline papillomavirus, Human papillomavirus — 1, Human papillomavirus — 63, Human papillomavirus - 41, Bovine papillomavirus - 3, Phocoena spinipinnis papillomavirus, Hamster oral papillomavirus, Apanteles crassicornis bracovirus, Apanteles fumiferanae bracovirus, Ascogaster argentifrons bracovirus, Ascogaster quadridentata bracovirus, Cardiochiles nigriceps bracovirus, Chelonus altitudinis bracovirus, Chelonus blackburni bracovirus, Chelonus inanitus bracovirus, Chelonus insularis bracovirus, Chelonus nr. curvimaculatus bracovirus Chelonus texanus bracovirus, Cotesia congregata bracovirus, Cotesia flavipes bracovirus, Cotesia glomerata bracovirus, Cotesia hyphantriae bracovirus, Cotesia kariyai bracovirus, Cotesia marginiventris bracovirus, Cotesia melanoscela bracovirus, Cotesia rubecula bracovirus, Cotesia schaeferi bracovirus, Diolcogaster facetosa bracovirus, Glyptapanteles flavicoxis bracovirus, Glyptapanteles indiensis bracovirus, Glyptapanteles liparidis bracovirus, Hypomicrogaster canadensis bracovirus, Hypomicrogaster ectdytolophae bracovirus, Microplitis croceipes bracovirus, Microplitis demolitor bracovirus, Phanerotoma flavitestacea bracovirus, Pholetesor ornigis bracovirus, Protapanteles paleacritae bracovirus, Tranosema rostrale bracovirus, Campoletis aprilis ichnovirus, Campoletis flavicincta ichnovirus, Campoletis sonorensis ichnovirus, Casinaria arjuna ichnovirus, Casinaria forcipata ichnovirus, Casinaria infesta ichnovirus, Diadegma acronyctae ichnovirus, Diadegma interruptum ichnovirus, Diadegma terebrans ichnovirus, Enytus montanus ichnovirus, Eriborus terebrans ichnovirus, Glypta fumiferanae ichnovirus, Hyposoter annulipes ichnovirus, Hyposoter exiguae ichnovirus, Hyposoter fugitivus ichnovirus, Hyposoter lymantriae ichnovirus, Hyposoter pilosulus ichnovirus, Hyposoter rivalis ichnovirus, Olesicampe benefactor ichnovirus, Olesicampe geniculatae ichnovirus, Synetaeris tenuifemur ichnovirus, Diadromus pulchellus ascovirus 4a, Heliothis virescens ascovirus 3a, Spodoptera frugiperda ascovirus Ia, Trichoplusia ni ascovirus 2a, Acanthamoeba polyphaga mimivirus, Enterobacteria phage AE2, Enterobacteria phage C-2, Enterobacteria phage dA, Enterobacteria phage Ec9, Enterobacteria phage fl, Enterobacteria phage fd, Enterobacteria phage HR, Enterobacteria phage 12-2, Enterobacteria phage IfI, Enterobacteria phage IKe, Enterobacteria phage Ml 3 Enterobacteria phage PR64FS, Enterobacteria phage SF, Enterobacteria phage tf-1, Enterobacteria phage X, Enterobacteria phage X-2, Enterobacteria phage ZJ/2, Vibrio phage 493, Vibrio phage CTX, Vibrio phage fsl, Vibrio phage fs2, Vibrio phage v6, Vibrio phage VfI 2, Vibrio phage Vβ3, Vibrio phage VSK, Pseudomonas phage PfI, Pseudomonas phage Pf2, Pseudomonas phage Pβ, Xanthomonas phage Cfl6, Xanthomonas phage CfIc, Xanthomonas phage CfIt, Xanthomonas phage Cfltv, Xanthomonas phage Lf, Xanthomonas phage Xf Xanthomonas phage Xfo, Xanthomonas phage Xfv, Acholeplasma phage MV-L51, Spiroplasma phage 1-aa, Spiroplasma phage 1-C74, Spiroplasma phage 1-KC3, Spiroplasma phage 1-R8A2B, Spiroplasma phage 1-S102, Spiroplasma phage 1- T78, Enterobacteria phage a.3, Enterobacteria phage øXl 74, Enterobacteria phage G4, Enterobacteria phage øK, Enterobacteria phage St-I, Chlamydia phage 1, Chlamydia phage 2, Chlamydia pneumoniae phage CPAR39, Guinea pig Chlamydia phage, Bdello Bdellovibrio phage MAC 1, Bdello Bdellovibrio phage øMH2K, Spiro Spiroplasma phage 4, Bean yellow dwarf virus, Chloris striate mosaic virus, Digitaria streak virus, Maize streak virus, Miscanthus streak virus, Panicum streak virus, Sugarcane streak Egypt virus, Sugarcane streak Reunion virus, Sugarcane streak virus, Tobacco yellow dwarf virus, Wheat dwarf virus, Beet curly top virus, Beet mild curly top virus, Beet severe curly top virus, Horseradish curly top virus, Tomato pseudo-curly top virus, Abutilon mosaic virus, African cassava mosaic virus, Ageratum enation virus, Ageratum yellow vein China virus, Ageratum yellow vein Sri Lanka virus, Ageratum yellow vein Taiwan virus, Ageratum yellow vein virus, Bean calico mosaic virus, Bean dwarf mosaic virus, Bean golden mosaic virus, Bean golden yellow mosaic virus, Bhendi yellow vein mosaic virus, Cabbage leaf curl virus, Chayote yellow mosaic virus, Chilli leaf curl virus, Chino del tomate virus, Cotton leaf crumple virus, Cotton leaf curl Alabad virus, Cotton leaf curl Gezira virus, Cotton leaf curl Kokhran virus, Cotton leaf curl Multan virus, Cotton leaf curl Rajasthan virus, Cowpea golden mosaic virus, Croton yellow vein mosaic virus, Cucurbit leaf curl virus, Dicliptera yellow mottle virus, Dolichos yellow mosaic virus, East African cassava mosaic Cameroon virus, East African cassava mosaic Malawi virus, East African cassava mosaic virus, East African cassava mosaic Zanzibar virus, Eupatorium leaf curl virus, Eupatorium yellow vein virus, Hollyhock leaf crumple virus, Honeysuckle yellow vein mosaic virus, Honeysuckle yellow vein virus, Indian cassava mosaic virus, ϊpomoea yellow vein virus Loofa yellow mosaic virus, Macroptilium mosaic Puerto Rico virus, Macroptilium yellow mosaic Florida virus, Macroptilium yellow mosaic virus ,,MaIv astrum yellow vein virus, Melon chlorotic leaf curl virus, Mungbean yellow mosaic India virus, Mungbean yellow mosaic virus, Okra yellow vein mosaic virus, Papaya leaf curl China virus, Papaya leaf curl Guandong virus, Papaya leaf curl virus, Pepper golden mosaic virus, Pepper huasteco yellow vein virus, Pepper leaf curl Bangladesh virus, Pepper leaf curl virus, Potato yellow mosaic Panama virus, Potato yellow mosaic Trinidad virus, Potato yellow mosaic virus, Rhynchosia golden mosaic virus, Sida golden mosaic Costa Rica virus, Sida golden mosaic Florida virus, Sida golden mosaic Honduras virus, Sida golden mosaic virus, Sida golden yellow vein virus, Sida mottle virus, Sida yellow mosaic virus, Sida yellow vein virus, South African cassava mosaic virus, Soybean crinkle leaf virus, Squash leaf curl China virus, Squash leaf curl Philippines virus, Squash leaf curl virus, Squash leaf curl Yunnan virus, Squash mild leaf curl virus, Squash yellow mild mottle virus, Sri Lankan cassava mosaic virus, Stachytarpheta leaf curl virus, Sweet potato leaf curl Georgia virus, Sweet potato leaf curl virus, Tobacco curly shoot virus, Tobacco leaf curl Japan virus, Tobacco leaf curl Kochi virus, Tobacco leaf curl Yunnan virus, Tobacco leaf curl Zimbabwe virus, Tomato chino La Paz virus, Tomato chlorotic mottle virus, Tomato curly stunt virus, Tomato golden mosaic virus, Tomato golden mottle virus, Tomato leaf curl Bangalore virus, Tomato leaf curl Bangladesh virus, Tomato leaf curl China virus, Tomato leaf curl Gujarat virus, Tomato leaf curl Indonesia virus, Tomato leaf curl Iran virus, Tomato leaf curl Karnataka virus, Tomato leaf curl Laos virus, Tomato leaf curl Malaysia virus, Tomato leaf curl New Delhi virus, Tomato leaf curl Philippines virus, Tomato leaf curl Sri Lanka virus, Tomato leaf curl Sudan virus, Tomato leaf curl Taiwan virus, Tomato leaf curl Vietnam virus, Tomato leaf curl virus, Tomato mosaic Havana virus, Tomato mottle Taino virus, Tomato mottle virus, Tomato rugose mosaic virus, Tomato severe leaf curl virus, Tomato severe rugose virus, Tomato yellow leaf curl China virus, Tomato yellow leaf curl Iran virus, Tomato yellow leaf curl Kanchanaburi virus, Tomato yellow leaf curl Malaga virus, Tomato yellow leaf curl Sardinia virus, Tomato yellow leaf curl Thailand virus, Tomato yellow leaf curl virus, Watermelon chlorotic stunt virus, Beak and feather disease virus, Canary Goose Pigeon Porcine -I Porcine -2, Chicken anemia virus, Torque teno virus, Faba bean necrotic yellows virus, Milk vetch dwarf virus, Subterranean clover stunt virus, Banana bunchy top virus, Coconut foliar decay virus, Chicken parvovirus, Feline panleukopenia virus, H-I parvovirus, HB parvovirus, Kilham rat virus Lapine parvovirus, LuIII virus, Minute virus of mice, Mouse parvovirus 1, Porcine parvovirus, RT parvovirus, Tumor virus X, Human parvovirus B 19, Pig-tailed macaque parvovirus, Rhesus macaque parvovirus, Simian parvovirus, Adeno- associated virus 1, Adeno-associated virus-2, Adeno-associated virus 3, Adeno-associated virus 4,, Adeno-associated virus 5, Avian adeno-associated virus, Bovine adeno-associated virus, Canine adeno-associated virus, Duck Equine adeno-associated virus, Goose Ovine adeno-associated virus, Aleutian mink disease virus, Bovine parvovirus, Canine minute virus, Galleria mellonella densovirus, Junonia coenia densovirus, Bombyx mori densovirus, Aedes aegypti densovirus, Aedes albopictus densovirus, Periplaneta fuliginosa densovirus, Ground squirrel hepatitis virus, Hepatitis B virus, Woodchuck hepatitis virus, Woolly monkey hepatitis B virus, Duck hepatitis B virus, Heron hepatitis B virus, Carnation etched ring virus, Cauliflower mosaic virus, Dahlia mosaic virus, Figwort mosaic virus, Horseradish latent virus, Mirabilis mosaic virus, Strawberry vein banding virus, Thistle mottle virus, Petunia vein clearing virus, Blueberry red ringspot virus, Peanut chlorotic streak virus, Soybean chlorotic mottle virus, Cassava vein mosaic virus, Tobacco vein clearing virus, Aglaonema bacilliform virus, Banana streak GF virus, Banana streak Mysore virus, Banana streak OL virus, Cacao swollen shoot virus, Canna yellow mottle virus, Citrus mosaic virus, Commelina yellow mottle virus, Dioscorea bacilliform virus, Gooseberry vein banding associated virus, Kalanchoe top-spotting virus, Piper yellow mottle virus, Rubus yellow net virus, Schefflera ringspot virus, Sugarcane bacilliform IM virus, Sugarcane bacilliform Mor virus, Taro bacilliform virus, Rice tungro bacilliform virus, Gooseberry vein banding virus Spirea yellow leafspot virus, Arabidopsis thaliana Artl virus, Arabidopsis thaliana AtREl virus, Arabidopsis thaliana Evelknievel virus, Arabidopsis thaliana TaI virus, Brassica oleracea Melmoth virus, Cajanus cajan Panzee virus, Glycine max Tgmr virus, Hordeum vulgare BARE-I virus, Nicotiana tάbacum Tntl virus, Nicotiana tabacum Ttol virus, Oryza australiensis RIREl virus, Oryza longistaminata Retrofit virus, Physarum polycephalum TpI virus, Saccharomyces cerevisiae TyI virus, Saccharomyces cerevisiae Ty2 virus, Saccharomyces cerevisiae Ty4 virus, Solanum tuberosum Tstl virus, Triticum aestivum WIS-2 virus, Zea mays Hopscotch virus, Zea mays Sto-4 virus, Aedes aegypti Mosqcopia virus, Candida albicans Teal virus, Candida albicans Tca5 virus, Drosophila melanogaster 1731 virus, Drosophila melanogaster copia virus, Saccharomyces cerevisiae Ty5 virus, Volvox carteri Lueckenbuesser virus, Volvox carteri Osser virus, Arabidopsis thaliana Endovir virus, Glycine max SIREl virus, Lycopersicon esculentum ToRTLl virus, Zea mays Opie-2 virus, Zea mays Prem-2 virus, Phaseolus vulgaris Tpv2-6 virus, Arabidopsis thaliana Athila virus, Arabidopsis thaliana Tat4 virus, Bombyx mori Mag virus, Caenorhabditis elegans Cerl virus, Cladosporium fulvum T-I virus, Dictyostelium discoideum Skipper virus, Drosophila buzzatii Osvaldo virus, Drosophila melanogaster Blastopia virus, Drosophila melanogaster Mdgl virus, Drosophila melanogaster Mdg3 virus, Drosophila melanogaster Micropia virus, Drosophila melanogaster 412 virus, Drosophila virilis Ulysses virus, Fusarium oxysporum Skippy virus, Lilium henryi Dell virus, Saccharomyces cerevisiae Ty3 virus, Schizosaccharomyces pombe TfI virus, Schizosaccharomyces pombe Tf2 virus, Takifugu rubripes Sushi virus, Tribolium castaneum Woot virus, Tripneustis gratilla SURL virus, Ceratitis capitata Yoyo virus, Drosophila ananassae Tom virus, Drosophila melanogaster Gypsy virus, Drosophila melanogaster Ideflx virus, Drosophila melanogaster Tirant virus, Drosophila melanogaster Zam virus Drosophila melanogaster 17.6 virus, Drosophila melanogaster 297 virus, Drosophila virilis TvI virus, Tήchoplusia ni TED virus, Anopheles gambiae Moose virus, Ascaris lumbricoides Tas virus, Bombyx mori Pao virus, Caenorha' bditis elegans Cerl3 virus, Drosophila melanogaster Bel virus, Drosophila melanogaster Roo virus, Drosophila simulans Ninja virus, Fugu rubripes Suzu virus, Avian carcinoma Mill Hill virus 2, Avian leukosis virus, Avian myeloblastosis virus, Avian myelocytomatosis virus, 29 Avian sarcoma virus CTlO, Fujinami sarcoma virus, Rous sarcoma virus,, UR2 sarcoma virus, Y73 sarcoma virus, Jaagsiekte sheep retrovirus, Langur virus, Mason-Pflzer monkey virus, Mouse mammary tumor virus, Squirrel monkey retrovirus, Chick syncytial virus, Feline leukemia virus, Finkel-Biskis-Jinkins murine sarcoma virus, Gardner-Arnstein feline sarcoma virus, Gibbon ape leukemia virus, Guinea pig type-C oncovirus, Hardy-Zuckerman feline sarcoma virus, Harvey murine sarcoma virus, Kirsten murine sarcoma virus, Moloney murine sarcoma virus, Murine leukemia virus, Porcine type-C oncovirus, Reticuloendotheliosis virus, Snyder-Theilen feline sarcoma virus, Trager duck spleen necrosis virus, Viper retrovirus, Woolly monkey sarcoma virus, Bovine leukemia virus, Primate T-lymphotropic virus, 1 Primate T- lymphotropic virus 2, Primate T-lymphotropic virus 3, Walleye dermal sarcoma virus, Walleye epidermal hyperplasia virus 1, Walleye epidermal hyperplasia virus 2, Bovine immunodeficiency virus, Caprine arthritis encephalitis virus, Equine infectious anemia virus, Feline immunodeficiency virus, Human immunodeficiency virus 1, Human immunodeficiency virus 2, Puma , Simian immunodeficiency virus, Visna/maedi virus, African green monkey simian foamy virus, Bovine foamy virus, Equine foamy virus, Feline foamy virus, Macaque simian foamy virus, Simian foamy virus, Pseudomonas phage 06, Avian orthoreovirus, Baboon orthoreovirus, Mammalian orthoreovirus, Nelson Bay orthoreovirus, Reptilian orthoreovirus, African horse sickness virus, Bluetongue virus, Changuinola virus, Chenuda virus, Chobar Gorge virus, Corriparta virus, Epizootic hemorrhagic disease virus, Equine encephalosis virus, Eubenangee virus, Great Island virus, Ieri virus, Lebombo virus, Orungo virus, Palyam virus, Peruvian horse sickness virus, St Cr oix river virus, Umatilla virus, Wad Medani virus, Wallal virus, Warrego virus, Wongorr virus, Rotavirus A, Rotavirus B, Rotavirus C, Rotavirus D, Rotavirus E, Colorado tick fever virus, Eyach virus, Banna virus, Kadipiro virus, Liao ning virus, Aquareovirus A, Aquareovirus B, Aquareovirus C, Aquareovirus D, Aquareovirus E, Aquareovirus F, Idnoreovirus — 1, Idnoreovirus — 2, Idnoreovirus — 3, Idnoreovirus — 4, Idnoreovirus — 5, Cypovirus 1, Cypovirus 2, Cypovirus 3, Cypovirus 4, Cypovirus 5, Cypovirus 6, Cypovirus 7, Cypovirus 8, Cypovirus 9, Cypovirus 10, Cypovirus 11, Cypovirus 12, Cypovirus 13, Cypovirus 14, Cypovirus 15, Cypovirus 16 Fiji disease virus, Garlic dwarf virus, Maize rough dwarf virus, MaI de Rio Cuarto virus, Nilaparvata lugens reovirus, Oat sterile dwarf virus, P angola stunt virus, Rice black streaked dwarf virus, Rice dwarf virus, Rice gall dwarf virus, Wound tumor virus, Echinochloa ragged stunt virus, Rice ragged stunt virus, Mycoreovirus 1, Mycoreovirus 2, Mycoreovirus 3, Infectious pancreatic necrosis virus, Tellina virus, Yellowtail ascites virus, Infectious bursal disease virus, Drosophila X virus, Helminthosporium victoriae virus 190S, Saccharomyces cerevisiae virus L-A, Saccharomyces cerevisiae virus L-BC (La), Ustilago maydis virus Hl, Giardia lamblia virus, Leishmania RNA virus 1 - 1, Leishmania RNA virus 1 - 2, Leishmania RNA virus 1 - 3, Leishmania RNA virus 1 - 4, Leishmania RNA virus 1 - 5, Leishmania RNA virus 1 - 6, Leishmania RNA virus 1 - 7, Leishmania RNA virus 1 - 8, Leishmania RNA virus 1 - 9, Leishmania RNA virus 1 - 10, Leishmania RNA virus 1 - 11, Leishmania RNA virus 1 - 12, Leishmania RNA virus 2 - 1, Agaricus bisporus virus 4, Aspergillus ochraceous virus, Atkinsonella hypoxylon virus, Discula destructiva virus 1 Discula destructiva virus 2 Fusarium poae virus 1, Fusarium solani virus 1, Gaeumannomyces graminis virus 019/6-A, Gaeumannomyces graminis virus Tl-A, Gremmeniella abietina RNA virus MSl, Helicobasidium mompa virus, Heterobasidion annosum virus, Penicillium stoloniferum virus S, Rhizoctonia solani virus 717, Alfalfa cryptic virus 1, Beet cryptic virus 1, Beet cryptic virus 2, Beet cryptic virus 3, Carnation cryptic virus 1, Carrot temperate virus 1, Carrot temperate virus 3, Carrot temperate virus 4, Hop trefoil cryptic virus 1, Hop trefoil cryptic virus 3, Radish yellow edge virus, Ryegrass cryptic virus, Spinach temperate virus, Vicia cryptic virus, White clover cryptic virus 1, White clover cryptic virus 3, Carrot temperate virus 2, Hop trefoil cryptic virus 2, Red clover cryptic virus 2, WJiHe clover cryptic virus 2, Helminthosporium victoriae 145S virus, Penicillium brevicompactum virus, Penicillium chrysogenum virus, Penicillium cyaneo-fulvum virus, Cryphonectria 1, Cryphonectria 2, Cryphonectria 3, Cryphonectria 4, Oryza ruβpogon endornavirus, Oryza sativa endornavirus, Phaseolus vulgaris endornavirus, Vicia faba endornavirus, Borna disease virus, Carajas virus, Chandipura virus, Cocal virus, Isfahan virus, Maraba virus, Piry virus, Vesicular stomatitis Alagoas virus, Vesicular stomatitis Indiana virus, Vesicular stomatitis New Jersey virus, Australian bat lyssavirus, Duvenhage virus, European bat lyssavirus 1, European bat lyssavirus 2, Lagos bat virus, Mokola virus, Rabies virus, Adelaide River virus, Berrimah virus, Bovine ephemeral fever virus, Hirame rhabdovirus, Infectious hematopoietic necrosis virus, Snakehead virus, Viral hemorrhagic septicemia virus, Barley yellow striate mosaic virus, Broccoli necrotic yellows virus, Festuca leaf streak virus, Lettuce necrotic yellows virus Northern cereal mosaic virus, Sonchus virus, Strawberry crinkle virus, Wheat American striate mosaic virus, Datura yellow vein virus, Eggplant mottled dwarf virus Maize mosaic virus, Potato yellow dwarf virus, Rice yellow stunt virus, Sonchus yellow net virus, Sowthistle yellow vein virus, Lake Victoria marburgvirus, Cote d'lvoire ebolavirus, Reston ebolavirus, Sudan ebolavirus, Zaire ebolavirus, Human parainfluenza virus 2, Human parainfluenza virus 4, Mapuera virus, Mumps virus, Porcine rubulavirus, Simian virus 5, Simian virus 41, Avian paramyxovirus 2, Avian paramyxovirus 3, Avian paramyxovirus 4, Avian paramyxovirus 5, Avian paramyxovirus 6, Avian paramyxovirus 7, Avian paramyxovirus 8, Avian paramyxovirus 9, Newcastle disease virus Bovine parainfluenza virus 3, Human parainfluenza virus 1, Human parainfluenza virus 3, Sendai virus, Simian virus 10, Hendra virus, Nipah virus, Canine distemper virus, Cetacean morbillivirus virus, Measles virus, Peste-des-petits-ruminants virus, Phocine distemper virus, Rinderpest virus Bovine respiratory syncytial virus, Human respiratory syncytial virus, Murine pneumonia virus, Avian metapneumovirus Human metapneumovirus, Lettuce big-vein associated virus, Citrus psorosis virus, Lettuce ring necrosis virus, Mirqβore lettuce virus, Ranunculus white mottle virus, Tulip mild mottle mosaic virus, Influenza A virus, Influenza B virus, Influenza C virus, Dhori virus, Thogoto virus, Infectious salmon anemia virus, Acara virus, Akabane virus, Alajuela virus, Anopheles A virus, Anopheles B virus, Bakau virus, Batama virus, Benevides virus, Bertioga virus, Bimiti virus, Botambi virus, Bunyamwera virus, Bushbush virus, Bwamba virus, California encephalitis virus, Capim virus, Caraparu virus, Catu virus, Estero Real virus, Gamboa virus, Guajara virus, Guama virus, Guaroa virus, Kaeng Khoi virus, Kaikalur virus, Kairi virus, Koongol virus, M'Poko virus, Madrid virus, Main Drain virus, Manzanilla virus, Marituba virus, Minatitlan virus, Nyando virus, Olifantsvlei virus, Oriboca virus, Oropouche virus, Patois virus, Sathuperi virus, Shamonda virus, Shuni virus, Simbu virus, Tacaiuma virus, Tete virus, Thimiri virus, Timboteua virus, Turlock virus, Wyeomyia virus, Zegla virus, Andes virus, Bayou virus, Black Creek Canal virus, Cano Delgadito virus, Dobrava virus, El Mow Canyon virus, Hantaan virus, IsIa Vista virus, Khabarovsk virus, Laguna Negra virus, Muleshoe virus, New York virus, Prospect Hill virus, Puumala virus, Rio Mamore virus, Rio Segundo virus, Seoul virus, Sin Nombre virus, Thailand virus, Thottapalayam virus, Topografov virus, Tula virus, Crimean-Congo hemorrhagic fever virus, Dera Ghazi Khan virus, Dugbe virus, Hughes virus, Qalyub virus, Sakhalin virus, Thiafora virus, Bujaru virus, Chandiru virus, Chilibre virus, Frijoles virus, Punta Toro virus, Rift Valley fever virus, Saleheb ad virus, Sandfly fever Naples virus, Uukuniemi virus, Groundnut bud necrosis virus, Groundnut ringspot virus, Groundnut yellow spot virus, Impatiens necrotic spot virus, Tomato chlorotic spot virus, Tomato spotted wilt virus, Watermelon silver mottle virus, Zucchini lethal chlorosis virus, Echinochloa hoja blanca virus, Maize stripe virus, Rice grassy stunt virus, Rice hoja blanca virus, Rice stripe virus, Urochloa hoja blanca virus, Allpaahuayo virus Amapari virus, Bear Canyon virus, Cupixi virus Flexal virus, Guanarito virus, Ippy virus, Junin virus, Lassa virus, Latino virus, Lymphocytic choriomeningitis virus, Machupo virus, Mobala virus, Mopeia virus, Oliveros virus, Parana virus, Pichinde virus, Pirital virus, Sabiά virus, Tacaribe virus, Tamiami virus, Whitewater Arroyo virus, Hepatitis delta virus, Enterobacteria phage MS2, Enter obacteria phage BZ13, Enterobacteria phage Fl, Enterobacteria phage Qβ, Saccharomyces 2OS RNA narnavirus, Saccharomyces 23S RNA narnavirus, Cryphonectria mitovirus 1, Ophiostoma mitovirus 3a, Ophiostoma mitovirus 4, Ophiostoma mitovirus 5, Ophiostoma mitovirus 6, Bovine enterovirus, Human enterovirus A, Human enterovirus B, Human enterovirus C, Human enterovirus D, Poliovirus, Porcine enterovirus A, Porcine enterovirus B, Simian enterovirus A, Human rhinovirus A, Human rhinovirus B, Encephalomyocarditis virus, Theilovirus, Equine rhinitis A virus, Foot-and-mouth disease virus, Hepatitis A virus, Human par echovirus, Ljungan virus, Equine rhinitis B virus, Aichi virus, Bovine kobuvirus, Porcine teschovirus, Infectious flacherie virus, Perina nuda virus, Sacbrood virus, Aphid lethal paralysis virus, Black queen cell virus, Cricket paralysis virus, Drosophila C virus, Himetobi P virus, Plautia stall intestine virus, Rhopalosiphum padi virus, Triatoma virus, Acute bee paralysis virus, Taura syndrome virus, Heterosigma akashiwo RNA virus, Dandelion yellow mosaic virus, Parsnip yellow fleck virus, Anthriscus yellows virus, Maize chlorotic dwarf virus, Rice tungro spherical virus, Satsuma dwarf virus, Strawberry latent ringspot virus, Strawberry mottle virus, Apple latent spherical virus, Cherry rasp leaf virus, Andean potato mottle virus, Bean pod mottle virus, Bean rugose mosaic virus, Broad bean stain virus, Broad bean true mosaic virus, Cowpea mosaic virus, Cowpea severe mosaic virus, Glycine mosaic virus, Pea green mottle virus, Pea mild mosaic virus, Quail pea mosaic virus, Radish mosaic virus, Red clover mottle virus, Squash mosaic virus, Ullucus virus C, Broad bean wilt virus 1, Broad bean wilt virus 2, Lamium mild mosaic virus, Apricot latent ringspot virus, Arabis mosaic virus, Arracacha virus A, Artichoke Aegean ringspot virus, Artichoke Italian latent virus, Artichoke yellow ringspot virus, Beet ringspot virus, Blackcurrant reversion virus, Blueberry leaf mottle virus, Cassava American latent virus, Cassava green mottle virus, Cherry leaf roll virus, Chicory yellow mottle virus, Cocoa necrosis virus, Crimson clover latent virus, Cycas necrotic stunt virus, Grapevine Bulgarian latent virus, Grapevine chrome mosaic virus, Grapevine fanleaf virus, Grapevine Tunisian ringspot virus, Hibiscus latent ringspot virus, Lucerne Australian latent virus, Mulberry ringspot virus, Myrobalan latent ringspot virus, Olive latent ringspot virus, Peach rosette mosaic virus, Potato black ringspot virus, Potato virus, U Raspberry ringspot virus, Tobacco ringspot virus, Tomato black ring virus, Tomato ringspot virus, Alpinia mosaic virus, Alstroemeria mosaic virus, Amaranihus leaf mottle virus, Apium virus Y, Araujia mosaic virus, Artichoke latent virus, Asparagus virus 1, Banana bract mosaic virus, Bean common mosaic necrosis virus, Bean common mosaic virus, Bean yellow mosaic virus, Beet mosaic virus, Bidens mottle virus, Calanthe mild mosaic virus, Carnation vein mottle virus, Carrot thin leaf virus, Carrot virus Y, Celery mosaic virus, Ceratobium mosaic virus, Chilli veinal mottle virus, Clitoria virus Y, Clover yellow vein virus, Cocksfoot streak virus, Colombian datura virus, Commelina mosaic virus, Cowpea aphid-borne mosaic virus, Cowpea green vein banding virus, Cypripedium virus Y, Dasheen mosaic virus, Datura shoestring virus, Diuris virus Y, Endive necrotic mosaic virus, Freesia mosaic virus, Gloriosa stripe mosaic virus, Groundnut eyespot virus, Guinea grass mosaic virus, Helenium virus Y, Henbane mosaic virus, Hibbertia virus Y, Hippeastrum mosaic virus, Hyacinth mosaic virus, Iris fulva mosaic virus, Iris mild mosaic virus, Iris severe mosaic virus, Japanese yam mosaic virus, Johnsongrass mosaic virus, Kalanchoe mosaic virus, Konjac mosaic virus, Leek yellow stripe virus, Lettuce mosaic virus, Lily mottle virus, Lycoris mild mottle virus, Maize dwarf mosaic virus, Moroccan watermelon mosaic virus, Narcissus degeneration virus, Narcissus late season yellows virus, Narcissus yellow stripe virus, Nerine yellow stripe virus, Nothoscordum mosaic virus, Onion yellow dwarf virus, Ornithogalum mosaic virus, Ornithogalum virus 2, Ornithogalum virus 3, Papaya leaf distortion mosaic virus, Papaya ringspot virus, Parsnip mosaic virus, Passion fruit woodiness virus, Pea seed- borne mosaic virus, Peanut mottle virus, Pepper mottle virus, Pepper severe mosaic virus, Pepper veinal mottle virus, Pepper yellow mosaic virus, Peru tomato mosaic virus, Pleione virus Y, Plum pox virus, Pokeweed mosaic virus, Potato virus A, Potato virus V, Potato virus Y, Rhopalanthe virus Y, Sarcochilus virus Y, Scallion mosaic virus, Shallot yellow stripe virus, Sorghum mosaic virus, Soybean mosaic virus, Sugarcane mosaic virus, Sunflower mosaic virus, Sweet potato feathery mottle virus, Sweet potato latent virus, Sweet potato mild speckling virus, Sweet potato virus G, Telfairia mosaic virus, Tobacco etch virus, Tobacco vein banding mosaic virus, Tobacco vein mottling virus, Tropaeolum mosaic virus, Tuberose mild mosaic virus, Tulip breaking virus, Tulip mosaic virus, Turnip mosaic virus, Watermelon leaf mottle virus, Watermelon mosaic virus, Wild potato mosaic virus, Wisteria vein mosaic virus, Yam mild mosaic virus, Yam mosaic virus, Zantedeschia mosaic virus, Zea mosaic virus, Zucchini yellow fleck virus, Zucchini yellow mosaic virus, Cassava brown streak virus Cucumber vein yellowing virus, Sweet potato mild mottle virus, Cardamom mosaic virus, Madura mosaic virus, Narcissus latent virus, Agropyron mosaic virus, Hordeum mosaic virus, Ryegrass mosaic virus, Brome streak virus, Oat necrotic mottle virus, Wheat streak mosaic virus, Barley mild mosaic virus, Barley yellow mosaic virus, Oat mosaic virus, Rice necrosis mosaic virus, Wheat spindle streak mosaic virus, Wheat yellow mosaic virus, Spartina mottle virus, Sugarcane streak mosaic virus, Tomato mild mottle virus, European brown hare syndrome virus, Rabbit hemorrhagic disease virus, Norwalk virus, Sapporo virus, Feline calicivirus, Vesicular exanthema of swine virus, Hepatitis E virus, Chicken astrovirus Duck astrovirus Turkey astrovirus, Bovine astrovirus, Feline astrovirus, Human astrovirus, Mink astrovirus, Ovine astrovirus, Porcine astrovirus, Black beetle virus, Boolarra virus, Flock House virus, Nodamura virus, Pariacoto virus, Barfin flounder nervous necrosis virus, Redspotted grouper nervous necrosis virus, Striped jack nervous necrosis virus, Tiger puffer nervous necrosis virus, Antheraea eucalypti virus, Darna trima virus, Dasychira pudibunda virus, Euprosterna elaeasa virus, Nudaurelia capensis b virus, Philosamia cynthia x ricini virus, Providence virus, Pseudoplusia includens virus, Thosea asigna virus, Trichoplusia ni virus, Helicoverpa armigera stunt virus, Nudaurelia capensis ω virus, Blueberry shoestring virus, Cocksfoot mottle virus, Lucerne transient streak virus, Rice yellow mottle virus, Ryegrass mottle virus, Sesbania mosaic virus, Solanum nodiflorum mottle virus, Southern bean mosaic virus, Southern cowpea mosaic virus, Sowbane mosaic virus, Subterranean clover mottle virus, Turnip rosette virus, Velvet tobacco mottle virus, Barley yellow dwarf virus - MAV, Barley yellow dwarf virus - PAS, Barley yellow dwarf virus - PAV, Bean leafroll virus, Soybean dwarf virus, Beet chlorosis virus, Beet mild yellowing virus, Beet western yellows virus, Cereal yellow dwarf virus — RPS, Cereal yellow dwarf virus - RPV, Cucurbit aphid-borne yellows virus, Potato leafroll virus, Sugarcane yellow leaf virus, Turnip yellows virus, Pea enation mosaic virus- 1, Barley yellow dwarf virus - GPV, Barley yellow dwarf virus - RMV, Barley yellow dwarf virus - SGV, Carrot red leaf virus, Chickpea stunt disease associated virus, Groundnut rosette assistor virus, Indonesian soybean dwarf virus, Sweet potato leaf speckling virus, Tobacco necrotic dwarf virus, Tobacco vein distorting virus, Carrot mottle mimic virus, Carrot mottle virus, Groundnut rosette virus, Lettuce speckles mottle virus, Pea enation mosaic virus-2, Tobacco bushy top virus, Tobacco mottle virus, Carnation ringspot virus, Red clover necrotic mosaic virus, Sweet clover necrotic mosaic virus, Artichoke mottled crinkle virus, Carnation Italian ringspot virus, Cucumber Bulgarian virus, Cucumber necrosis virus, Cymbidium ringspot virus, Eggplant mottled crinkle virus, Grapevine Algerian latent virus, Lato river virus, Moroccan pepper virus, Neckar river virus, Pear latent virus, Pelargonium leaf curl virus, Petunia asteroid mosaic virus, Sitke waterborne virus, Tomato bushy stunt virus, Cucumber leaf spot virus, Pothos latent virus, Oat chlorotic stunt virus, Ahlum waterborne virus, Bean mild mosaic virus, Cardamine chlorotic fleck virus, Carnation mottle virus, Cowpea mottle virus, Cucumber soil-borne virus, Galinsoga mosaic virus, Hibiscus chlorotic ringspot virus, Japanese iris necrotic ring virus, Melon necrotic spot virus, Pelargonium flower break virus, Saguaro cactus virus, Turnip crinkle virus, Weddel waterborne virus, Beet black scorch virus, Chenopodium necrosis virus, Leek white stripe virus, Olive latent virus 1, Tobacco necrosis virus A, Tobacco necrosis virus D, Panicum mosaic virus, Maize chlorotic mottle virus, Bovine coronavirus, Canine coronavirus, Feline coronavirus, Human coronavirus 229E, Human coronavirus OC43, Human enteric coronavirus, Infectious bronchitis virus, Murine hepatitis virus, Pheasant coronavirus, Porcine epidemic diarrhea virus, Porcine hemagglutinating encephalomyelitis virus, Puffinosis coronavirus, Rat coronavirus, Severe acute respiratory syndrome coronavirus, Transmissible gastroenteritis virus, Turkey coronavirus, Bovine torovirus, Equine torovirus, Human torovirus, Porcine torovirus, Equine arteritis virus, Lactate dehydrogenase-elevating virus, Porcine respiratory and reproductive syndrome virus, Simian hemorrhagic fever virus, Gill-associated virus, Apoi virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bukalasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Hheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Kokobera virus, Koutango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, Sal Vieja virus, San Perlita virus, Saumarez Reef virus, Sepik virus, St. Louis encephalitis virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, Zika virus, Border disease virus, Bovine viral diarrhea virus I, Bovine viral diarrhea virus 2, Classical swine fever virus, Hepatitis C virus, Aura virus, Barmah Forest virus, Bebaru virus, Cabassou virus, Chikungunya virus, Eastern equine encephalitis virus, Everglades virus, Fort Morgan virus, Getah virus, Highlands J virus, Mayaro virus, Middelburg virus, Mosso das Pedras virus (78V353I), Mucambo virus, Ndumu virus, O'nyong-nyong virus, Pixuna virus, Rio Negro virus, Ross River virus, Salmon pancreas disease virus, Semliki Forest virus, Sindbis virus, Southern elephant seal virus, Tonate virus Trocara virus, Una virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus, Whataroa virus, Rubella virus, Cucumber fruit mottle mosaic virus, Cucumber green mottle mosaic virus, Frangipani mosaic virus, Hibiscus latent Fort Pierce virus, Hibiscus latent Singapore virus, Kyuri green mottle mosaic virus, Obuda pepper virus, Odontoglossum ringspot virus, Paprika mild mottle virus, Pepper mild mottle virus, Ribgrass mosaic virus, Sammons 's Opuntia virus, Sunn-hemp mosaic virus, Tobacco latent virus, Tobacco mild green mosaic virus, Tobacco mosaic virus, Tomato mosaic virus, Turnip vein-clearing virus, Ullucus mild mottle virus, Wasabi mottle virus, Youcai mosaic virus, Zucchini green mottle mosaic virus, Pea early-browning virus, Pepper ringspot virus, Tobacco rattle virus, Anthoxanthum latent blanching virus, Barley stripe mosaic virus, Lychnis ringspot virus, Poa semilatent virus, Chinese wheat mosaic virus, Oat golden stripe virus, Soil- borne cereal mosaic virus, Soil-borne wheat mosaic virus, Sorghum chlorotic spot virus, Beet soil-borne virus, Beet virus Q, Broad bean necrosis virus, Potato mop-top virus, Indian peanut clump virus, Peanut clump virus, Beet necrotic yellow vein virus, Beet soil- borne mosaic virus, Alfalfa mosaic virus, Broad bean mottle virus, Brome mosaic virus, Cowpea chlorotic mottle virus, Melandrium yellow fleck virus, Spring beauty latent virus, Cucumber mosaic virus, Peanut stunt virus, Tomato aspermy virus, American plum line pattern virus, Apple mosaic virus, Asparagus virus 2, Blueberry shock virus, Citrus leaf rugose virus, Citrus variagatϊon virus, Elm mottle virus, Fragaria chiloensis latent virus, Humulus japonicus latent virus, Lilac ring mottle virus, Parietaria mottle virus, Prune dwarf virus, Prunus necrotic ringspot virus, Spinach latent virus, Tobacco streak virus, Tulare apple mosaic virus, Olive latent virus 2, Cassava virus C, Epirus cherry virus, Ourmia melon virus, Raspberry bushy dwarf virus, Andean potato latent virus, Belladonna mottle virus, Cacao yellow mosaic virus, Calopogonium yellow vein virus, Chayote mosaic virus, Clitoria yellow vein virus, Desmodium yellow mottle virus, Dulcamara mottle virus, Eggplant mosaic virus, Erysimum latent virus, Kennedya yellow mosaic virus, Melon rugose mosaic virus, Okra mosaic virus, Ononis yellow mosaic virus, Passion fruit yellow mosaic virus, Peanut yellow mosaic virus, Petunia vein banding virus, Physalis mottle virus, Plantago mottle virus, Scrophularia mottle virus, Turnip yellow mosaic virus, Voandzeia necrotic mosaic virus, Wild cucumber mosaic virus, Bermuda grass etched-line virus, Maize rayado fino virus, Oat blue dwarf virus, Grapevine fleck virus, Beet yellow stunt virus, Beet yellows virus, Burdock yellows virus, Carnation necrotic fleck virus, Carrot yellow leaf virus, Citrus tristeza virus, Grapevine leafroll-associated virus 2, Sweet potato chlorotic stunt virus, Wheat yellow leaf virus, Grapevine leafroll-associated virus 1, Grapevine leafroll-associated virus 3, Grapevine leafroll-associated virus 5, Little cherry virus 2, Pineapple mealybug wilt-associated virus 1, Pineapple mealybug wilt-associated virus 2, Abutilon yellows virus, Beet pseudoyellows virus, Cucurbit yellow stunting disorder virus, Lettuce chlorosis virus, Lettuce infectious yellows virus, Sweet potato chlorotic spot virus, Tomato chlorosis virus, Tomato infectious chlorosis virus, Alternanthera mosaic virus, Asparagus virus 3, Bamboo mosaic virus, Cactus virus X, Cassava common mosaic virus, Cassava virus X, Clover yellow mosaic virus, Commelina virus X Cymbidium mosaic virus, Daphne virus X, Foxtail mosaic virus, Hosta virus X, Hydrangea ringspot virus, Lily virus X, Narcissus mosaic virus, Nerine virus X, Papaya mosaic virus, Pepino mosaic virus, Plantago asiatica mosaic virus, Plantago severe mottle virus, Plantain virus X, Potato aucuba mosaic virus, Potato virus X, Scallion virus X, Strawberry mild yellow edge virus, Tamus red mosaic virus, Tulip virus X, White clover mosaic virus, Indian citrus ringspot virus, Garlic mite-borne filamentous virus, Garlic virus A, Garlic virus B, Garlic virus C, Garlic virus D, Garlic virus X, Shallot virus X, Aconitum latent virus, American hop latent virus, Blueberry scorch virus, Cactus virus 2, Caper latent virus, Carnation latent virus, Chrysanthemum virus B, Cole latent virus, Cowpea mild mottle virus, Dandelion latent virus, Elderberry symptomless virus, Garlic common latent virus, Helenium virus S, Honeysuckle latent virus, Hop latent virus, Hop mosaic virus, Hydrangea latent virus, Kalanchoe latent virus, Lilac mottle virus, Lily symptomless virus, Mulberry latent virus, Muskmelon vein necrosis virus, Narcissus common latent virus, Nerine latent virus, Passiflora latent virus, Pea streak virus, Poplar mosaic virus, Potato latent virus, Potato virus M, Potato virus S, Red clover vein mosaic virus, Shallot latent virus, Sint-Jem's onion latent virus, Strawberry pseudo mild yellow edge virus, Verbena latent virus, Apple stem pitting virus, Apricot latent virus, Rupestris stem pitting-associated virus, Apple stem grooving virus, Cherry virus A, Lilac chlorotic leafspot virus, Grapevine virus A, Grapevine virus B, Grapevine virus D, Heracleum latent virus, Apple chlorotic leaf spot virus, Cherry mottle leaf virus, Grapevine berry inner necrosis virus, Peach mosaic virus, Potato vims T, Banana mild mosaic virus, Citrus leaf blotch virus, Sugarcane striate mosaic-associated virus, Mushroom bacilliform virus, Hawaiian rubus leaf curl virus, Pigeonpea sterility mosaic virus, Chrysanthemum stunt viroid, Citrus exocortis viroid, Columnea latent viroid, Iresine viroid 1, Mexican papita viroid, Potato spindle tuber viroid, Tomato apical stunt viroid, Tomato chlorotic dwarf viroid, Tomato planta macho viroid, Hop stunt viroid, Citrus viroid IV, Coconut cadang- cadang viroid, Coconut tinangaja viroid, Hop latent viroid, Apple dimple fruit viroid, Apple scar skin viroid, Australian grapevine viroid, Citrus bent leaf viroid, Citrus viroid III, Grapevine yellow speckle viroid 1, Grapevine yellow speckle viroid 2, Pear blister canker viroid, Coleus blumei viroid 1, Coleus blumei viroid 2, Coleus blumei viroid 3, Avocado sunblotch viroid, Chrysanthemum chlorotic mottle viroid, Peach latent mosaic viroid.
Particularly important viruses in terms of human therapeutic uses include HIV, the Hepatitis group of viruses, the Herpes group of viruses and a variety of retro or oncogenic viruses.
The cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell may be a stem cell or a differentiated cell. A "stem cell" includes any form of progenitor or precursor cell. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, masT- cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
The RNA silencing species may be synthesized either in vivo or in vitro and is generally able to form a complex with either or both strands of the target sequence. Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region (e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation) may be used to transcribe the RNA strand (or strands). Expression of the transgene encoding the RNA silencing species may be initiated by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age. The RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus. RNA may be chemically or enzymatically synthesized by manual or automated reactions. The RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). The use and production of an expression construct are known in the art (see WO 97/32016; U.S. Pat. Nos. 5,593,874, 5,698,425, 5,712,135, 5,789,214, and 5,804,693; and the references cited therein). If synthesized chemically or by in vitro enzymatic synthesis, the RNA silencing species may be purified prior to introduction into the cell. For example, the RNA silencing species can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no or a minimum of purification to avoid losses due to sample processing. The RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
The RNA silencing species is generally double stranded RNA and may be introduced to a subject (e.g. synthetic RNAi) or be encoded by a genetic construct introduced to a cell in vivo or ex vivo. Hence, the RNA may be directly introduced into the cell (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing an organism in a solution containing the RNA. Methods for oral introduction include direct mixing of the RNA with food of the organism, as well as engineered approaches in which a species that is used as food is engineered to express the RNA, then fed to the organism to be affected. For example, the RNA may be sprayed onto a plant or a plant may be genetically engineered to express the RNA in an amount sufficient to kill some or all of a pathogen known to infect or digest parts of the plant. Physical methods of introducing nucleic acids, for example, injection directly into the cell or extracellular injection into the organism, may also be used. Vascular or extravascular circulation, the blood or lymph system, the phloem, the roots, and the cerebrospinal fluid are sites where the RNA may be introduced. A transgenic organism that expresses the RNA silencing species from a recombinant construct may be produced by introducing the construct into a zygote, an embryonic stem cell, or another multipotenT-cell derived from the appropriate organism.
Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment by particles covered by the RNA, soaking the cell or organism in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA. A viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct. Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate, and the like. Thus the RNA may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, promote annealing of the duplex strands, stabilize the annealed strands, or other-wise increase inhibition of the target gene.
Notwithstanding the presence of an actual target gene in a cell or pathogen, the present invention further requires either introducing a DNA construct which generate a mRNA (homologous nucleotide sequence) which is substantially homologous to at least 10 contiguous nucleotides of the target gene. This DNA construct is referred to herein as a "homologous target gene construct". Preferably, the homologous target gene construct generates a transcript which corresponds to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the target gene transcript.
In one embodiment, if the homologous target sequence does not correspond to a full length actual target gene transcript then it comprises at least 5 nucleotides to about 10,000 nucleotides such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1500, 1510, 1520, 1530, 1540, 1550, 1560, 1570, 1580, 1590, 1600, 1610, 1620, 1630, 1640, 1650, 1660, 1670, 1680, 1690, 1700, 1710, 1720, 1730, 1740, 1750, 1760, 1770, 1780, 1790, 1800, 1810, 1820, 1830, 1840, 1850, 1860, 1870, 1880, 1890, 1900, 1910, 1920, 1930, 1940, 1950, 1960, 1970, 1980, 1990, 2000, 2010, 2020, 2030, 2040, 2050, 2060, 2070, 2080, 2090, 2100, 2110, 2120, 2130, 2140, 2150, 2160, 2170, 2180, 2190, 2200, 2210, 2220, 2230, 2240, 2250, 2260, 2270, 2280, 2290, 2300, 2310, 2320, 2330, 2340, 2350, 2360, 2370, 2380, 2390, 2400, 2410, 2420, 2430, 2440, 2450, 2460, 2470, 2480, 2490, 2500, 2510, 2520, 2530, 2540, 2550, 2560, 2570, 2580, 2590, 2600, 2610, 2620, 2630, 2640, 2650, 2660, 2670, 2680, 2690, 2700, 2710, 2720, 2730, 2740, 2750, 2760, 2770, 2780, 2790, 2800, 2810, 2820, 2830, 2840, 2850, 2860, 2870, 2880, 2890, 2900, 2910, 2920, 2930, 2940, 2950, 2960, 2970, 2980, 2990, 3000, 4000, 4010, 4020, 4030, 4040, 4050, 4060, 4070, 4080, 4090, 4100, 4110, 4120, 4130, 4140, 4150, 4160, 4170, 4180, 4190, 4200, 4210, 4220, 4230, 4240, 4250, 4260, 4270, 4280, 4290, 4300, 4310, 4320, 4330, 4340, 4350, 4360, 4370, 4380, 4390, 4400, 4410, 4420, 4430, 4440, 4450, 4460, 4470, 4480, 4490, 4500, 4510, 4520, 4530, 4540, 4550, 4560, 4570, 4580, 4590, 4600, 4610, 4620, 4630, 4640, 4650, 4660, 4670, 4680, 4690, 4700, 4710, 4720, 4730, 4740, 4750, 4760, 4770, 4780, 4790, 4800, 4810, 4820, 4830, 4840, 4850, 4860, 4870, 4880, 4890, 4900, 4910, 4920, 4930, 4940, 4950, 4960, 4970, 4980, 4990, 5000..5010, 5020, 5030, 5050, 5050, 5060, 5070, 5080, 5090, 5100, 5110, 5120, 5130, 5150, 5150, 5160, 5170, 5180, 5190, 5200, 5210, 5220, 5230, 5240, 5250, 5260, 5270, 5280, 5290, 5300, 5310, 5320, 5330, 5350, 5350, 5360, 5370, 5380, 5390, 5500, 5410, 5420, 5430, 5450, 5450, 5460, 5470, 5480, 5490, 5500, 5510, 5520, 5530, 5540, 5550, 5560, 5570, 5580, 5590, 5600, 5610, 5620, 5630, 5640, 5650, 5660, 5670, 5680, 5690, 5700, 5710, 5720, 5730, 5740, 5750, 5760, 5770, 5780, 5790, 5800, 5810, 5820, 5830, 5840, 5850, 5860, 5870, 5880, 5890, 5900, 5910, 5920, 5930, 5940, 5950, 5960, 5970, 5980, 5990, 6000, 6010, 6020, 6030, 6040, 6050, 6060, 6070, 6080, 6090, 6100, 6110, 6120, 6130, 6140, 6150, 6160, 6170, 6180, 6190, 6200, 6210, 6220, 6230, 6240, 6250, 6260, 6270, 6280, 6290, 6300, 6310, 6320, 6330, 6340, 6350, 6360, 6370, 6380, 6390, 6400, 6410, 6420, 6430, 6440, 6450, 6460, 6470, 6480, 6490, 6500, 4510, 6520, 4530, 6540, 6550, 6560, 6570, 6580, 6590, 6600, 6610, 6620, 6630, 6640, 6650, 6660, 6670, 6680, 6690, 6700, 6710, 6720, 6730, 6740, 6750, 6760, 6770, 6780, 6790, 6800, 6810, 6820, 6830, 6840, 6850, 6860, 6870, 6880, 6890, 6900, 6910, 6920, 6930, 6940, 6950, 6960, 6970, 6980, 6990, 7000, 7010, 7020, 7030, 7040, 7050, 7060, 7070, 7080, 7090, 7100, 7110, 7120, 7130, 7140, 7150, 7160, 7170, 7180, 7190, 7200, 7210, 7220, 7230, 7240, 7250, 7260, 7270, 7280, 7290, 7300, 7310, 7320, 7330, 7340, 7350, 7360, 7370, 7380, 7390, 7400, 7410, 7420, 7430, 7440, 7450, 7460, 7470, 7480, 7490, 7500, 7510, 7520, 7530, 7540, 7550, 7560, 7570, 7580, 7590, 7600, 7610, 7620, 7630, 7640, 7650, 7660, 7670, 7680, 7690, 7700, 7710, 7720, 7730, 7740, 7750, 7760, 7770, 7780, 7790, 7800, 7810, 7820, 7830, 7840, 7850, 7860, 7870, 7880, 7890, 7900, 7910, 7920, 7930, 7940, 7950, 7960, 7970, 7980, 7990, 8000, 8010, 8020, 8030, 8040, 8050, 8060, 8070, 8080, 8090, 8100, 8110, 8120, 8130, 8140, 8150, 8160, 8170, 8180, 8190, 8200, 8210, 8220, 8230, 8240, 8250, 8260, 8270, 8280, 8290, 8300, 8310, 8320, 8330, 8340, 8350, 8360, 8370, 8380, 8390, 8400, 8410, 8420, 8430, 8440, 8450, 8460, 8470, 8480, 8490, 8500, 8510, 8520, 8530, 8540, 8550, 8560, 8570, 8580, 8590, 8600, 8610, 8620, 8630, 8640, 8650, 8660, 8670, 8680, 8690, 8700, 8710, 8720, 8730, 8740, 8750, 8760, 8770, 8780, 8790, 8800, 8810, 8820, 8830, 8840, 8850, 8860, 8870, 8880, 8890, 8900, 8910, 8920, 8930, 8940, 8950, 8960, 8970, 8980, 8990, 9000, 9010, 9020, 9030, 9040, 9050, 9060, 9070, 9080, 9090, 9100, 9110, 9120, 9130, 9140, 9150, 9160, 9170, 9180, 9190, 9200, 9210, 9220, 9230, 9240, 9250, 9260, 9270, 9280, 9290, 9300, 9310, 9320, 9330, 9340, 9350, 9360, 9370, 9380, 9390, 9400, 9410, 9420, 9430, 9440, 9450, 9460, 9470, 9480, 9490, 9500, 9510, 9520, 9530, 9540, 9550, 9560, 9570, 9580, 9590, 9600, 9610, 9620, 9630, 9640, 9650, 9660, 9670, 9680, 9690, 9700, 9710, 9720, 9730, 9740, 9750, 9760, 9770, 9780, 9790, 9800, 9810, 9820, 9830, 9840, 9850, 9860, 9870, 9880, 9890, 9900, 9910, 9920, 9930, 9940, 9950, 9960, 9970, 9980, 9990 and 10000. One or more nucleotide mutations (e.g. insertions, substitutions, additions or deletions) or other modifications may be introduced to prevent translation of the transcript into an active protein product.
Hence, the present invention enables selective inhibition of a targe gene by a method which comprises introducing an RNA silencing species to a cell carrying a homologous nucleotide sequence. As indicted above, the RNA silencing species may be DNA derived (e.g. an RNA silencing species construct) or it may be synthetic RNA. In a preferred embodiment, the silencing RNA species is a hairpin or short dsRNA. Generally, in a higher subject, when the RNA silencing species in DNA-derived, it is produced in a cell remote from the cell carrying the homologous nucleotide sequence and/or the actual target gene.
Accordingly, the present invention provides a genetically modified subject comprising one population of cells which produce an RNA silencing species specific for a target gene and another population of cells which carry on expressible homologous nucleotide sequence.
The RNA silencing species and homologous nucleotide sequence transcript may be generated from DNA operably linked to a constitutive, inducible, developmentally regulated or tissue specific promoter.
Alternatively, or in addition, a homologous nucleotide sequence is not introduced and the copy number of the actual target gene and/or its level of expression may be enhanced. Promoters, chemicals, biological agents and culture conditions may be used to increase gene copy number or expression levels.
The present invention may be used in the treatment or prevention of disease in plants or animals. For example, the silencing RNA species and homologous nucleotide sequence may be introduced into a cancerous cell or tumor and thereby inhibit gene expression of the actual target gene required for maintenance of the carcinogenic/tumorigenic phenotype. To prevent a disease or other pathology, a target gene may be selected which is required for initiation or maintenance of the disease/pathology. Treatment would include amelioration of any symptom associated with the disease or clinical indication associated with the pathology.
A gene derived from any pathogen may be targeted for inhibition. For example, the gene could cause immunosuppression of the host directly or be essential for replication of the pathogen, transmission of the pathogen, or maintenance of the infection. The RNA silencing species could be introduced in cells in vitro or ex vivo and then subsequently placed into an animal to affect therapy, or directly treated by in vivo administration. A method of gene therapy can be envisioned. For example, cells at risk for infection by a pathogen or already infected cells, particularly human immunodeficiency virus (HIV) infections, may be targeted for treatment by introduction of the RNA silencing species and/or the homologous nucleotide sequence. The target gene might be a pathogen or host gene responsible for entry of a pathogen into its host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of an infection in the host, or assembly of the next generation of pathogen. Methods of prophylaxis (i.e., prevention or decreased risk of infection), as well as reduction in the frequency or severity of symptoms associated with infection, can also be envisioned.
The present invention provides, therefore, a method for inhibiting expression of a target gene in a cell of a recipient said method comprising:
(i) isolating one or more populations of cells from said recipient;
(ii) introducing genetic constructs into at least two subpopulations of the same population of cells or in two different populations of cells, wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and is introduced into one population or subpopulation of cells and a second construct comprising a DNA sequence which encodes a nucleotide sequence substantially homologous to a transcript of said target gene is introduced into the other population or subpopulation of cells; and
(iii) returning said population or subpopulation of cells to the recipient wherein inhibition of expression of the target gene carrying the second construct occurs in TGS and PTGS via RNA signaling from the RNA silencing species.
In an alternative embodiment, one population of cells comprises both the RNA silencing species and the homologous target sequence and/or actual target gene.
Another aspect of the present invention contemplates a method of treatment of a recipient requiring silencing of expression of a target gene said method comprising introducing autologous cells from said recipient modified to generate a transcript of said target gene and introducing to said recipient a DNA-derived or synthetic RNA silencing species or an autologous cell modified to generate the DNA-derived RNA silencing species wherein upon entry of the RNA silencing species into the cells comprising a transcript of the target gene, expression of said target gene is inhibited by TGS and PTGS.
The present invention may be used for treatment or development of treatments for cancers of any type, including solid tumors and leukemias, including: apudoma, choristoma, branchioma, malignant carcinoid syndrome, carcinoid heart disease, carcinoma (e.g., Walker, basal cell, basosquamous, Brown-Pearce, ductal, Ehrlich tumor, in situ, Krebs 2, Merkel cell, mucinous, non-small cell lung, oaT-cell, papillary, scirrhous, bronchiolar, bronchogenic, squamous cell, and transitional cell), histiocytic disorders, leukemia (e.g., B cell, mixed cell, null cell, T-cell, T-cell chronic, HTLV-II-associated, lymphocytic acute, lymphocytic chronic, masT-cell, and myeloid), histiocytosis malignant, Hodgkin disease, immunoproliferative small, non-Hodgkin lymphoma, plasmacytoma, reticuloendotheliosis, melanoma, chondroblastoma, chondroma, chondrosarcoma, fibroma, fibrosarcoma, gianT- cell tumors, histiocytoma, lipoma, liposarcoma, mesothelioma, myxoma, myxosarcoma, osteoma, osteosarcoma, Ewing sarcoma, synovioma, adenofibroma, adenolymphoma, carcinosarcoma, chordoma, cranio-pharyngioma, dysgerminoma, hamartoma, mesenchymoma, mesonephroma, myosarcoma, ameloblastoma, cementoma, odontoma, teratoma, thymoma, trophoblastic tumor, adenocarcinoma, adenoma, cholangioma, cholesteatoma, cylindroma, cystadenocarcinoma, cystadenoma, granulosa cell tumor, gynandroblastoma, hepatoma, hidradenoma, isleT-cell tumor, Leydig cell tumor, papilloma, Sertoli cell tumor, theca cell tumor, leiomyoma, leiomyosarcoma, myoblastoma, myoma, myosarcoma, rhabdomyoma, rhabdomyosarcoma, ependymoma, ganglioneuroma, glioma, medulloblastoma, meningioma, neurilemmoma, neuroblastoma, neuroepithelioma, neurofibroma, neuroma, paraganglioma, paraganglioma nonchromaffin, angiokeratoma, angiolymphoid hyperplasia with eosinophilia, angioma sclerosing, angiomatosis, glomangioma, hemangioendothelioma, hemangioma, hemangiopericytoma, hemangiosarcoma, lymphangioma, lymphangiomyoma, lymphangiosarcoma, pinealoma, carcinosarcoma, chondrosarcoma, cystosarcoma phyllodes, fibrosarcoma, hemangiosarcoma, leiomyosarcoma, leukosarcoma, liposarcoma, lymphangiosarcoma, myosarcoma, myxosarcoma, ovarian carcinoma, rhabdomyosarcoma, sarcoma (e.g., Ewing, experimental, Kaposi, and masT-cell), neoplasms (e.g., bone, breast, digestive system, colorectal, liver, pancreatic, pituitary, testicular, orbital, head and neck, central nervous system, acoustic, pelvic, respiratory tract, and urogenital), neurofibromatosis, and cervical dysplasia, and for treatment of other conditions in which cells have become immortalized or transformed. The invention could be used in combination with other treatment modalities, such as chemotherapy, cryotherapy, hyperthermia, radiation therapy, and the like.
As indicated above, the present invention may be effective against a variety of pests. For purposes of the present invention, pests include, but are not limited to, insects, fungi, bacteria, nematodes, acarids, protozoan pathogens, animal-parasitic liver flukes, and the like. Pests of particular interest are insect pests, particularly insect pests that cause significant damage to agricultural plants. The term "insect pests" as used herein refers to insects and other similar pests such as, for example, those of the order Acari including, but not limited to, mites and ticks. Insect pests of the present invention include, but are not limited to, insects of the order Lepidoptera, e.g. Achoroia grisella, Acleris gloverana, Acleris variana, Adoxophyes orana, Agrotis ipsilon, Alabama argillacea, Alsophila pometaria, Amyelois transitella, Anagasta kuehniella, Anarsia lineatella, Anisota senatoria, Antheraea pernyi, Anticarsia gemmatalis, Archips sp., Argyrotaenia sp., Athetis mindara, Bombyx mori, Bucculatrix thurberiella, Cadra cautella, Choristoneura sp., Cochylls hospes, Colias eurytheme, Corcyra cephalonica, Cydia latiferreanus, Cydia pomonella, Datana integerrima, Dendrolimus sibericus, Desmiafeneralis, Diaphania hyalinata, Diaphania nitidalis, Diatraea grandiosella, Diatraea saccharalis, Ennomos subsignaria, Eoreuma loftini, Esphestia elutella, Erannis tilaria, Estigmene acrea, Eulia salubricola, Eupocoellia ambiguella, Eupoeciϊia ambiguella, Euproctis chrysorrhoea, Euxoa messoria, Galleria mellonella, Grapholita molesta, Harrisina americana, Helicoverpa subflexa, Helicoverpa zea, Heliothis virescens, Hemileuca oliviae, Homoeosoma electellum, Hyphantia cunea, Keiferia lycopersicella, Lambdina fiscellaria fiscellaria, Lambdina fiscellaria lugubrosa, Leucoma salicis, Lobesia botrana, Loxostege sticticalis, Lymantria dispar, Macalla thyrisalis, Malacosoma sp., Mamestra brassicae, Mamestra configurata, Manduca quinquemaculata, Manduca sexta, Maruca testulalis, Melanchra picta, Operophtera brumata, Orgyia sp., Ostrinia nubilalis, Paleacrita vernata, Papilio cresphontes, Pectinophora gossypiella, Phryganidia californica, Phyllonorycter blancardella, Pieris napi, Pieris rapae, Plathypena scabra, Platynota flouendana, Platynota stultana, Platyptilia carduidactyla, Plodia interpunctella, Plutella xylostella, Pontia protodice, Pseudaletia unipuncta, Pseudoplasia includens, Sabulodes aegrotata, Schizura concinna, Sitotroga cerealella, Spilonta ocellana, Spodoptera sp., Thaurnstopoea pityocampa, Tinsola bisselliella, Trichoplusia hi, Udea rubigalis, Xylomyges curiails, and Yponomeuta padella.
Also, the embodiments of the present invention may be effective against insect pests, including but not limited to insects selected from the orders Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, Coleoptera, etc., particularly Lepidoptera. Insect pests of the invention for the major crops include, but are not limited to: Maize: Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black cutworm; Helicoverpa zeae, corn earworm; Spodoptera frugiperda, fall armyworm; Diatraea grandiosella, southwestern corn borer; Elasmopalpus lignosellus, lesser cornstalk borer; Diatraea saccharalis, surgarcane borer; western corn rootworm, e.g., Diabrotica virgifera virgifera; northern corn rootworm, e.g., Diabrotica longicornis barberi; southern corn rootworm, e.g., Diabrotica undecimpunctata howardi; Melanotus spp., wireworms; Cyclocephala borealis, northern masked chafer (white grub); Cyclocephala immaculata, southern masked chafer (white grub); Popillia japonica, Japanese beetle; Chaetocnema pulicaria, corn flea beetle; Sphenophorus maidis, maize billbug; Rhopalosiphum maidis, corn leaf aphid; Anuraphis maidiradicis, corn root aphid; Blissus leucopterus leucopterus, chinch bug; Melanoplus femurrubrum, redlegged grasshopper; Melanoplus sanguinipes, migratory grasshopper; Hylemya platura, seedcorn maggot; Agromyza parvicornis, corn blotch leafminer; Anaphothrips obscrurus, grass thrips; Solenopsis milesta, thief ant; Tetranychus urticae, two spotted spider mite; Sorghum: Chilo partellus, sorghum borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Elasmopalpus lignosellus, leser cornstalk borer; Feltia subterranea, granulate cutworm; Phyllophaga crinita, white grub; Eleodes, Conoderus, and Aeolus spp., wireworms; Oulema melanopus, cereal leaf beetle; Chaetocnema pulicaria, corn flea beetle; Sphenophorus maidis, maize billbug; Rhopalosiphum maidis; corn leaf aphid; Sipha flava, yellow sugarcane aphid; chinch bug, e.g., Blissus leucopterus leucopterus; Contarinia sorghicola, sorghum midge; Tetranychus cinnabarinus, carmine spider mite; Tetranychus urticae, two-spotted spider mite; Wheat: Pseudaletia unipunctata, army worm; Spodoptera frugiperda, fall armyworm; Elasmopalpus lignosellus, lesser cornstalk borer; Agrotis orthogonia, pale western cutworm; Elasmopalpus lignosellus, lesser cornstalk borer; Oulema melanopus, cereal leaf beetle; Hypera punctata, clover leaf weevil; southern corn rootworm, e.g., Diabrotica undecimpunctata howardi; Russian wheat aphid; Schizaphis graminum, greenbug; Macrosiphum avenae, English grain aphid; Melanoplus femurrubrum, redlegged grasshopper; Melanoplus differentialis, differential grasshopper; Melanoplus sanguinipes, migratory grasshopper; Mayetiola destructor, Hessian fly; Sitodiplosis mosellana, wheat midge; Meromyza americana, wheat stem maggot; Hylemya coarctata, wheat bulb fly; Frankliniella fusca, tobacco thrips; Cephus cinctus, wheat stem sawfly; Aceria tulipae, wheat curl mite; Sunflower: Cylindrocupturus adspersus, sunflower stem weevil; Smicronyx fulus, red sunflower seed weevil; Smicronyx sordidus, gray sunflower seed weevil; Suleima helianthana, sunflower bud moth; Homoeosoma electellum, sunflower moth; Zygogramma exclamationis, sunflower beetle; Bothyrus gibbosus, carrot beetle; Neolasioptera murtfeldtiana, sunflower seed midge; Cotton: Heliothis virescens, tobacco budworm; Helicoverpa zea, cotton bollworm; Spodoptera exigua, beet armyworm; Pectinophora gossypiella, pink bollworm; boll weevil, e.g., Anthonomus grandis; Aphis gossypii, cotton aphid; Pseudatomoscelis seriatus, cotton fleahopper; Trialeurodes abutilonea, bandedwinged whitefly; Lygus lineolaris, tarnished plant bug; Melanoplus femurrubrum, redlegged grasshopper; Melanoplus differ entialis, differential grasshopper; Thrips tabaci, onion thrips; Franklinkiella fusca, tobacco thrips; Tetranychus cinnabarinus, carmine spider mite; Tetranychus urticae, two-spotted spider mite; Rice: Diatraea saccharalis, sugarcane borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus oryzophilus, rice water weevil; Sitophilus oryzae, rice weevil; Nephotettix nigropictus, rice leafhoper; chinch bug, e.g., Blissus leucopterus leucopterus; Acrosternum hilare, green stink bug; Soybean: Pseudoplusia includens, soybean looper; Anticarsia gemmatalis, velvetbean caterpillar; Plathypena scabra, green cloverworm; Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black cutworm; Spodoptera exigua, beet armyworm; Heliothis virescens, tobacco budworm; Helicoverpa zea, cotton bollworm; Epϊlachna varivestis, Mexican bean beetle; Myzus persicae, green peach aphid; Empoasca fabae, potato leafhopper; Acrosternum hilare, green stink bug; Melanoplus femurrubrum, redlegged grasshopper; Melanoplus differ entialis, differential grasshopper; Hylemya platura, seedcorn maggot; Sericothrips variabilis, soybean thrips; Thrips tabaci, onion thrips; Tetranychus turkestani, strawberry spider mite; Tetranychus urticae, two-spotted spider mite; Barley: Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black cutworm; Schizaphis graminum, greenbug; chinch bug, e.g., Blissus leucopterus leucopterus; Acrosternum hilare, green stink bug; Euschistus servus, brown stink bug; Jylemya platura, seedcorn maggot; Mayetiola destructor, Hessian fly; Petrobia latens, brown wheat mite; Oil Seed Rape: Vrevicoryne brassicae, cabbage aphid; Phyllotreta cruciferae, crucifer flea beetle; Phyllotreta striolata, striped flea beetle; Phyllotreta nemorum, striped turnip flea beetle; Meligethes aeneus, rapeseed beetle; and the pollen beetles Meligethes rufimanus, Meligethes nigrescens, Meligethes canadianus, and Meligethes viridescens; Potato: Leptinotarsa decemlineata, Colorado potato beetle. Furthermore, embodiments of the present invention may be effective against Hemiptera such as Lygus hesperus, Lygus Hneolaris, Lygus pratensis, Lygus rugulipennis Popp, Lygus pahulinus, Calocoris norvegicus, Orthops compestris, Plesiocoris rugicollis, Cyrtopeltis modestus, Cyrtopeltis notatus, Spanagonicus albofasciatus, Diaphnocoris chlorinonis, Labopidicoϊa allii, Pseudatomoscelis seriatus, Adelphocoris rapidus, Poecilocapsus lineatus, Blissus leucopterus, Nysius ericae, Nysius raphanus, Euschistus servus, Nezara viridula, Eurygaster, Coreidae, Pyrrhocoridae, Tinidae, Blostomatidae, Reduviidae, and Cimicidae. Pests of interest also include Araecerus fasciculatus, coffee bean weevil; Acanthoscelides obtectus, bean weevil; Bruchus rufmanus, broadbean weevil; Bruchus pisorum, pea weevil; Zabrotes subfasciatus, Mexican bean weevil; Diabrotica balteata, banded cucumber beetle; Cerotoma trifurcata, bean leaf beetle; Diabrotica virgifera, Mexican corn rootworm; Epitrix cucumeris, potato flea beetle; Chaetocnema conflnis, sweet potato flea beetle; Hypera postica, alfalfa weevil; Anthonomus quadrigibbus, apple curculio; Sternechus paludatus, bean stalk weevil; Hypera brunnipennis, Egyptian alfalfa weevil; Sitophilus granaries, granary weevil; Craponius inaequalis, grape curculio; Sitophilus zeamais, maize weevil; Conotrachelus nenuphar, plum curculio; Euscepes postfaciatus, West Indian sweet potato weevil; Maladera castanea, Asiatic garden beetle; Rhizotrogus majalis, European chafer; Macrodactylus subspinosus, rose chafer; Tribolium confusum, confused flour beetle; Tenebrio obscurus, dark mealworm; Tribolium castaneum, red flour beetle; Tenebrio molitor, yellow mealworm.
Nematodes include parasitic nematodes such as root-knot, cyst, and lesion nematodes, including Heterodera spp., Meloidogyne spp., and Globodera spp.; particularly members of the cyst nematodes, including, but not limited to, Heterodera glycines (soybean cyst nematode); Heterodera schachtii (beet cyst nematode); Heterodera avenae (cereal cyst nematode); and Globodera rostochiensis and Globodera pallida (potato cyst nematodes). Lesion nematodes include Pratylenchus spp.
As disclosed herein, the present invention is not limited to any type of target gene or nucleotide sequence. But the following classes of possible target genes are listed for illustrative purposes: developmental genes (e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors); oncogenes (e.g., ABLl, BCLl, BCL2, BCL6, CBFA2, CBL, CSFlR, ERBA, ERBB, EBRB2, ETSl, ETSl, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS5 LCK, LYN, MDM2, MLL, MYB, MYC, MYCLl , MYCN, NRAS, PIMl, PML, RET, SRC, TALI, TCL3, and YES); tumor suppressor genes (e.g., APC, BRCAl, BRCA2, MADH4, MCC, NFl, NF2, RBl, TP53, and WTl); and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADP- glucose pyrophorylases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextrinases, DNA and RNA polymerases, galactosidases, glucanases, glucose oxidases, granule-bound starch synthases, GTPases, helicases, hemicellulases, integrases, inulinases, invertases, isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes, nopaline synthases, octopine synthases, pectinesterases, peroxidases, phosphatases, phospholipases, phosphorylases, phytases, plant growth regulator synthases, polygalacturonases, proteinases and peptidases, pullanases, recombinases, reverse transcriptases, RUBISCOs, topoisomerases, and xylanases).
In addition, the target gene may encode an enzyme of a metabolic pathway such as an enzyme of the anthocyanin pathway. The latter is useful to alter the colour of flowers in plants.
The present invention further comprises a method for producing plants with reduced susceptibility to climatic injury, susceptibility to insect damage, susceptibility to infection by a pathogen, or altered fruit ripening characteristics. The targeted gene may be an enzyme, a plant structural protein, a gene involved in pathogenesis, or an enzyme that is involved in the production of a non-proteinaceous part of the plant (i.e., a carbohydrate or lipid). If an expression construct is used to transcribe the RNA in a plant, transcription by a wound- or stress-inducible; tissue-specific (e.g., fruit, seed, anther, flower, leaf, root); or otherwise regulatable (e.g., infection, light, temperature, chemical) promoter may be used. By inhibiting enzymes at one or more points in a metabolic pathway or genes involved in pathogenesis, the effect may be enhanced: each activity will be affected and the effects may be magnified by targeting multiple different components. Metabolism may also be manipulated by inhibiting feedback control in the pathway or production of unwanted metabolic by-products.
The present invention may be used to reduce crop destruction by other plant pathogens such as arachnids, insects, nematodes, protozoans, bacteria, or fungi. Some such plants and their pathogens are listed in Index of plant Diseases in the United States (U.S. Dept. of Agriculture Handbook No. 165, 1960); Distribution of Plant-Parasitic Nematode Species in North America (Society of Nematologists, 1985); and Fungi on Plants and Plant Products in the United States (American Phytopathological Society, 1989). Insects with reduced ability to damage crops or improved ability to prevent other destructive insects from damaging crops may be produced. Furthermore, some nematodes are vectors of plant pathogens, and may be attacked by other beneficial nematodes which have no effect on plants. Inhibition of target gene activity could be used to delay or prevent entry into a particular developmental step (e.g., metamorphosis), if plant disease was associated with a particular stage of the pathogen's life cycle. Interactions between pathogens may also be modified by the invention to limit crop damage. For example, the ability of beneficial nematodes to attack their harmful prey may be enhanced by inhibition of behavior- controlling nematode genes according to the invention.
Although pathogens cause disease, some of the microbes interact with their plant host in a beneficial manner. For example, some bacteria are involved in symbiotic relationships that fix nitrogen and some fungi produce phytohormones. Such beneficial interactions may be promoted by using the present invention to inhibit target gene activity in the plant and/or the microbe.
As far as DNA derived RNA silencing species and homologous nucleotide sequence is concerned, these are generally derived by operably linking a DNA encoding same to a promoter. The promoter may regulate the expression of the nucleotide sequence encoding the agent, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, or pathogens, or metal ions, amongst others.
Preferably, the promoter is capable of regulating expression of a nucleic acid molecule in a plant cell, tissue or organ, at least during the period of time over which the nucleotide sequence encoding the agent is expressed therein.
Plant-operable promoters are particularly preferred for use in the constructs of the present invention. Examples of suitable promoters include pCaMV 35S (Fang et al, PlanT-cell 7:141-150, 1989), PGELl (Hajdukiewicz et al, Plant MoI Biol 25:989-994, 1994), class III chitinase (Samac and Shah, PlanT-cell 5:1063-1072, 1991), pin2 (Keil et al, EMBO J 8: 1323-1330, 1989), PEP carboxylase (Pathirana et al, Plant J 12:293-304, 1997; MAP kinase (Schoenbeck et al, Molec Plant-Microbe Interact, 1999), MSV (Legavre et al, In: Vth International Congress of Plant Molecular Biology, Singapore, 1997), pltp (Hsu et al, Plant Sd 143:63-70, 1999), pmpi (Cordero et al, In: General Meeting of the International Program on Rice Biotechnology of the Rockefeller Foundation, Malacca, Malaysia, 1997) or glutamin synthase (Pujade-Renaud et al, Plant Physiol Biochem 35:85-93, 1997).
In the present context, the terms "in operable connection with" or "operably under the control" or "operably linked" or similar shall be taken to indicate that expression of the nucleic acid molecule is under the control of the promoter sequence with which it is spatially connected in a cell, tissue, organ or whole plant or animal subject.
A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, inducible, or other promoters for expression in the host organism. Suitable constitutive promoters for use in a plant hosT-cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al, Nature 375:810-812, 1985); rice actin McElroy et al, PlanT-cell 2:163-171, 1990); ubiquitin (Christensen et al, Plant MoI Biol 12:619-632, 1989 and Christensen et at, Plant MoI Biol 18:675-689, 1992); pEMU (Last et al, Theor Appl Genet 52:581-588, 1991); MAS (Velten et al, EMBO J 3:2723-2730, 1984); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.
Depending on the desired outcome, it may be beneficial to express the gene from an inducible promoter. Of particular interest for regulating the expression of the nucleotide sequences of the present invention in plants are wound-inducible promoters. Such wound- inducible promoters, may respond to damage caused by insect feeding, and include potato proteinase inhibitor (pin II) gene (Ryan. Ann Rev Phytopαth 28:425-449, 1990; Duan et αl, Nature Biotechnology 14:494-49%, 1996); wunl and wun2, U.S. Pat. No. 5,428,148; winl and win2 (Stanford et al, MoI Gen Genet 215:200-208, 1989); systemin (McGurl et al, Science 225:1570-1573, 1992); WIPl (Rohmeier et al, Plant MoI Biol 22:783-792, 1993; Eckelkamp et al, FEBS Letters 323:73-76, 1993); MPI gene (Corderok et al, Plant J 6(2):141Λ50, 1994); and the like, herein incorporated by reference.
Additionally, pathogen-inducible promoters may be employed in the methods and nucleotide constructs of the present invention. Such pathogen-inducible promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc.
See, for example, Redolfi et al, Meth J Plant Pathol 59:245-254, 1983; Uknes et al,
PlanT-cell 4:645-656, 1992; and Van Loon Plant MoI Virol 4:111-116, 1985. See also WO 99/43819.
Of interest are promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al, Plant MoI Biol 9:335-342, 1987; Matton et al, Molecular Plant-Microbe Interactions 2:325-331, 1989; Somsisch et al, Proc Natl Acad Sci USA 55:2427-2430, 1986; Somsisch et al, MoI Gen Genet 2:93-98, 1988; and Yang Proc Natl Acad Sd USA 93:14972-14977, 1996. See also, Chen et al, Plant J 10:955-966, 1996; Zhang et al, Proc Natl Acad Sci USA 91. -2507-2511, 1994; Warner et al, Plant J 3:191-201, 1993; Siebertz et al, PlanT-cell 1:961-968, 1989; U.S. Pat. No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium monϊliforme (see, for example, Cordero et al, Physiol MoI Plant Path 47:189- 200, 1992).
Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al, Proc Natl Acad Sci USA §5:10421- 10425, 1991 and McNellis et al, Plant J 14(2):247-257, 1998 and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al, MoI Gen Genet 227:229-237, 1991 and U.S. Pat Nos. 5,814,618 and 5,789,156).
Tissue-preferred promoters can be utilized to target enhanced pesticidal protein expression within a particular plant tissue. Tissue-preferred promoters include those discussed in Yamamoto et al, Plant J 12 (2) :255-265, 1997; Kawamata et al, PlanT-cell Physiol 38(7) :792-$03, 1997; Hansen et al, MoI Gen Genet 254(3) :337-343, 1997; Russell et al, Transgenic Res 6(2):157-168, 1997; Rinehart et al, Plant Physiol 772(3J:1331-1341, 1996; Van Camp et al, Plant Physiol 112(2): 525-535, 1996; Canevascini et al, Plant Physiol 112(2):5l3-524, 1996; Yamamoto et al, PlanT-cell Physiol 35 (5). -773-778, 1994; Lam Results Probl Cell Differ 20:181-196, 1994; Orozco et al, Plant MoI Biol 23(6):l l29- 1138, 1993; Matsuoka et al, Proc Natl Acad Sci USA 90(20) :9586-9590, 1993 and Guevara-Garcia et al, Plant J 4(3):495-505, 1993. Such promoters can be modified, if necessary, for weak expression.
Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al, 1997 supra; Kwon et al, Plant Physiol 105:351-61, 1994; Yamamoto et al, 1994 supra; Gotor et al, Plant J 5:509-18, 1993; Orozco et al, 1993 supra and Matsuoka et al, 1993 supra.
Root-preferred or root-specific promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al, Plant MoI Biol 20(2) :207 '-218, 1992 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner PlanT-cell 3(1 φ.1051-1061, 1991 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al, Plant MoI Biol 14(3) A33-443, 1990 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al, PlanT-cell 3(l):l l-22, 1991 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al, PlanT-cell 2(7):633-641, 1990, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a β-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Promoters of rolC and rolD root-inducing genes of Agrobacterium rhizogenes may also be used. Teeri et al, EMBO J 8(2) :343-35Q, 1989) describe gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR21 gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene. The TRl' gene fused to nptll (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al, Plant MoI Biol 29(4) :159-112, 1995); and rolb promoter (Capana et al, Plant MoI Biol 25(4):6% 1-691, 1994. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179.
"Seed-preferred" promoters include both "seed-specific" promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as "seed- germinating" promoters (those promoters active during seed germination). See Thompson et al, BioEssays 10:108, 1989, herein incorporated by reference. Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message); cZ19Bl (maize 19 kDa zein); and milps (myo-inositol-1 -phosphate synthase) (see U.S. Pat. No. 6,225,529). Gamma-zein and Glob-1 are endosperm-specific promoters. For dicots, seed- specific promoters include, but are not limited to, bean β-phaseolin, napin, β-conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from endl and end2 genes are disclosed; herein incorporated by reference. A promoter that has "preferred" expression in a particular tissue is expressed in that tissue to a greater degree than in at least one other plant tissue. Some tissue-preferred promoters show expression almost exclusively in the particular tissue.
Where low level expression is desired, weak promoters will be used. Generally, the term "weak promoter" as used herein refers to a promoter that drives expression of a coding sequence at a low level. By low level expression at levels of about 1/1000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts is intended. Alternatively, it is recognized that the term "weak promoters" also encompasses promoters that drive expression in only a few cells and not in others to give a total low level of expression. Where a promoter drives expression at unacceptably high levels, portions of the promoter sequence can be deleted or modified to decrease expression levels.
Such weak constitutive promoters include, for example the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like. Other constitutive promoters include, for example, those disclosed in U.S. Pat.
Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.
A range of promoters for use in animal cells is also known by the skilled artisan.
The construct preferably contains additional regulatory elements for efficient transcription, for example, a transcription termination (or terminators) sequence.
The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3 '-non-translated DNA sequences generally containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3 '-end of a primary transcript. Terminators active in plant cells are known and described in the literature. They may be isolated from bacteria, fungi, viruses, animals and/or plants or synthesized de novo.
As with promoter sequences, the terminator may be any termination sequence which is operable in the cells, tissues or organs in which it is intended to be used.
Again in relation to plants, examples of terminators particularly suitable for use in the synthetic genes of the present invention include the SV40 polyadenylation signal, the HSV TK polyadenylation signal, the CYCl terminator, ADH terminator, SPA terminator,
■ nopaline synthase (NOS) gene terminator of Agrobacterium tumefaciens, the terminator of the cauliflower mosaic virus (CaMV) 35S gene, the zein gene terminator from Zea mays, the Rubisco small subunit gene (SSU) gene terminator sequences, subclover stunt virus
(SCSV) gene sequence terminators, any r/rø-independent E. coli terminator, or the lacZ alpha terminator, amongst others.
In a particularly preferred embodiment, the terminator is the SV40 polyadenylation signal or the HSV TK polyadenylation signal which are operable in animal cells, tissues and organs, octopine synthase (OCS) or nopaline synthase (NOS) terminator active in plant cells, tissue or organs, or the lacZ alpha terminator which is active in prokaryotic cells. Those skilled in the art will be aware of additional terminator sequences which may be suitable for use in performing the subject invention. Such sequences may readily be used without any undue experimentation.
Hence, the present invention contemplates constructs where the same promoter is used to generate the RNA silencing species and the homologous target sequence in the same construct; or where the same construct comprises two separate promoters; or where two constructs are employed each with the same promoter; and or where two constructs are used each with different promoters.
Means for introducing (i.e. transfecting or transforming) cells with the constructs are well- known to those skilled in the art.
The constructs described supra are capable of being modified further, for example, by the inclusion of marker nucleotide sequences encoding a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate detection of the synthetic gene in a cell, tissue or organ in which it is expressed. According to this embodiment, the marker nucleotide sequences will be present in a translatable format and be expressed. In addition, transport sequences may be included to direct one or more agents to particular plant organnelles.
Those skilled in the art will be aware of how to produce the constructs described herein and of the requirements for obtaining the expression thereof, when so desired, in a specific cell or cell-type under the conditions desired. In particular, it will be known to those skilled in the art that the genetic manipulations required to perform the present invention may require the propagation of a genetic construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell or a plant cell or an animal cell.
The constructs of the present invention may be introduced to a suitable cell, tissue or organ without modification as linear DNA, optionally contained within a suitable carrier, such as a cell, virus particle or liposome, amongst others. To produce a genetic construct, a nucleic acid is inserted into a suitable vector or episome molecule, such as a bacteriophage vector, viral vector or a plasmid, cosmid or artificial chromosome vector which is capable of being maintained and/or replicated and/or expressed in the hosT-cell, tissue or organ into which it is subsequently introduced.
Usually, an origin of replication or a selectable marker gene suitable for use in bacteria is physically-separated from those genetic sequences contained in the genetic construct which are intended to be expressed or transferred to a plant cell, or integrated into the genome of a plant cell or animal cell.
As used herein, the term "selectable marker gene" includes any gene which confers a phenotype on a cell on which it is expressed to facilitate the identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention or a derivative thereof.
Suitable selectable marker genes contemplated herein include the ampicillin-resistance gene (Amp1), tetracycline-resistance gene (Tc1), bacterial kanamycin-resistance gene (Kan1), the zeocin resistance gene (Zeocin is a drug of the bleomycin family which is trade mark of InVitrogen Corporation), the AURI-C gene which confers resistance to the antibiotic aureobasidin A, phosphinothricin-resistance gene, neomycin phosphotransferase gen (nptlϊ), hygromycin-resistance gene, β-glucuronidase (GUS) gene, chloramphenicol acetyltransferase (CAT) gene, green fluorescent protein-encoding gene or the luciferase gene, amongst others.
Preferably, the selectable marker gene is the nptll gene or Kanr gene or green fluorescent protein (GFP)-encoding gene.
Those skilled in the art will be aware of other selectable marker genes useful in the performance of the present invention and the subject invention is not limited by the nature of the selectable marker gene. The present invention extends to all genetic constructs essentially as described herein, which include further genetic sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into the genome of a eukaryotic cell or organism.
Standard methods may be used to introduce the constructs into the cell, tissue or organ, for example, liposome-mediated transfection or transformation, transformation of cells with attenuated virus particles or bacterial cells, cell mating, transformation or transfection procedures known to those skilled in the art.
Additional means for introducing recombinant DNA into plant tissue or cells include, but are not limited to, transformation using CaCl2 and variations thereof, direct DNA uptake into protoplasts, PEG-mediated uptake to protoplasts, microparticle bombardment, electroporation, microinjection of DNA, microparticle bombardment of tissue explant or cells, vacuum-infiltration of tissue with nucleic acid, or in the case of plants, T-DNA- mediated transfer from Agrobacterium to the plant tissue or direct DNA/RNA early into animal cell.
For microparticle bombardment of cells, a microparticle is propelled into a cell to produce a transformed cell. Any suitable ballistic cell transformation methodology and apparatus can be used in performing the present invention. Exemplary apparatus and procedures are disclosed by Stomp et al, (U.S. Patent No. 5,122,466) and Sanford and Wolf (U.S. Patent No. 4,945,050). When using ballistic transformation procedures, the genetic construct may incorporate a plasmid capable of replicating in the cell to be transformed.
Examples of microparticles suitable for use in such systems include 1 to 5 μm gold spheres. The DNA construct may be deposited on the microparticle by any suitable technique, such as by precipitation.
The methods of the invention involve introducing a polypeptide or polynucleotide into a plant. "Introducing" is intended to mean presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.
"Stable transformation" is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. "Transient transformation" is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al, Biotechniques 4:320-334, 1986), electroporation (Riggs et al, Proc Natl Acad Sci USA 55:5602-5606, 1986), Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,563,055 and 5,981,840), direct gene transfer (Paszkowski et al, EMBO J 3:2111- 2722, 1984), and ballistic particle acceleration (see, for example, U.S. Pat. Nos. 4,945,050; 5,879,918; 5,886,244; and 5,932,782; Tomes et al, PlanT-cell, Tissue, and Organ Culture: Fundamental Methods, 1995 and McCabe et al, Biotechnology (5:923-926, 1988); and Led transformation (WO 00/28058). For potato transformation see Tu et al, Plant Molecular Biology 57:829-838, 1998 and Chong et al, Transgenic Research 9:11-1%, 2000. Additional transformation procedures can be found in Weissinger et al, Ann Rev Genet 22:421-411, 1988; Sanford et al, Particulate Science and Technology 5:27-37, 1987 (onion); Christou et al, Plant Physiol 87:611-614, 1988 (soybean); McCabe et al, 1988 supra (soybean); Finer and McMullen In Vitro Cell Dev Biol 27P: 175-182, 1991 (soybean); Singh et al, Theor Appl Genet 96:319-324, 1998 (soybean); Datta et al, Biotechnology 8:736-740, 1990 (rice); Klein et al, Proc Natl Acad Sd USA §5:4305-4309, 1988 (maize); Klein et al, Biotechnology 6:559-563, 1988 (maize); U.S. Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein et al, Plant Physiol 91. -440-444, 1988 (maize); Fromm et al, Biotechnology 8:833-839, 1990 (maize); Hooykaas-Van Slogteren et al, Nature (London) 311:763-764, 1984; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al, Proc Natl Acad Sd USA 84: 5345-5349, 1987 (Liliaceae); De Wet et al, The Experimental Manipulation of Ovule Tissues, 197-209, 1985 (pollen); Kaeppler et al, PlanT-cell Reports 9:415-418, 1990 and Kaeppler et al, Theor Appl Genet 84:560-566, 1992 (whisker- mediated transformation); DΗalluin et al, PlanT-cell 4:1495-1505, 1992 (electroporation); Li et al, PlanT-cell Reports 22:250-255, 1993 and Christou and Ford Annals of Botany 75:407-413, 1995 (rice); Osjoda et al, Nature Biotechnology 7-^:745-750, 1996 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.
In a further embodiment of the present invention, the genetic constructs described herein are adapted for integration into the genome of a cell in which it is expressed. Those skilled in the art will be aware that, in order to achieve integration of a genetic sequence or genetic construct into the genome of a hosT-cell, certain additional genetic sequences may be required. In the case of plants, left and right border sequences from the T-DNA of the
Agrobacterium tumefaciens Ti plasmid will generally be required. As far as animal cells are concerned, the genetic constructs include human or mammalian or animal artifical chromosomes.
The present invention further extends to an isolated cell, tissue or organ comprising the constructs or parts thereof. The present invention extends further to regenerated tissues, organs and whole organisms derived from the cells, tissues and organs and to propagules and progeny thereof as well as seeds and other reproductive material. Animal cell lines and maintained cultures are also contemplated by the present invention.
For example, plants may be regenerated from transformed plant cells or tissues or organs on hormone-containing media and the regenerated plants may take a variety of forms, such as chimeras of transformed cells and non-transformed cells; clonal transformants (e.g. all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissue (e.g. a transformed rootstock grafted to an untransformed scion in citrus species). Transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, first generation (or Tl) transformed plants may be selfed to give homozygous second generation (or T2) transformed plants, and the T2 plants further propagated through classical breeding techniques.
Another utility of the present invention is to assist in identifying gene function in an organism by inhibiting a target gene of previously unknown function. Instead of the time consuming and laborious isolation of mutants by traditional genetic screening, functional genomics would envision determining the function of uncharacterized genes by employing the invention to reduce the amount and/or alter the timing of target gene activity. The invention could be used in determining potential targets for pharmaceutics, understanding normal and pathological events associated with development, determining signaling pathways responsible for postnatal development/aging, and the like.
The present invention may be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of an RNA species to test samples or subjects. Preferred components are the dsRNA and a vehicle that promotes introduction of the dsRNA. Such a kit may also include instructions to allow a user of the kit to practice the invention.
Even yet another aspect of the present invention is directed to a phenotypic modifying kit for a subject comprising:
(i) an RNA silencing species specific for a target gene or cells capable of generating same;
(ii) a genetic construct comprising a DNA sequence which encodes a mRNA transcript of said target gene or cells comprising same; and (iii) instructions for use comprising introducing into said subject the genetic construct or cells comprising same such that the subject establishes a population of said cells, introducing to said subject the RNA silencing species or cells comprising same and monitoring for gene silencing via a transcription silencing pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6 and a post-transcriptional gene silencing pathway via RISC.
In particular, the present invention provides a genetic composition comprising:
(i) an RNA silencing species specific for a target gene or cells capable of generating same; and
(ii) a genetic construct comprising a DNA sequence which encodes a RNA transcript of said target gene or cells comprising same.
The present invention also provides a genetic composition comprising one or more constructs wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and a second construct which comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene.
In a particular preferred embodiment, the genetic construct comprises nucleotide sequences enabling the production of hairpin and sense RNA species directed to a target gene or its transcript. In this regard, the present invention provides a genetic composition comprising a genetic construct which encodes the central and 3' terminal regions of a target gene or its transcript separated by a spacer nucleotide sequence to enable a hairpin construct to be generated, said genetic construct further comprising a nucleotide sequence which encodes a RNA transcript corresponding to said target gene or its transcript.
In one embodiment this enables the generation of a genotype to enable screening for genes involved in modulating RNA silencing. This embodiment is disclosed in Example 8.
In terms of therapeutic protocols for plants and animals the use of artificial chromosomes is contemplated by the present invention. For example, in mammalian including human subjects, mammalian artificial chromosomes may be used to introduce the RNA silencing species or the homologous target sequence or both. Similarly, in plants, plant artificial chromosomes may be employed.
A model summarizing the crucial molecular events in reception of the long-distance silencing of the GFP mRNA is presented in Figure Ia. A mobile GF-specific signal is delivered into the shoot apex, where it stimulates the Pol IVa pathway in the nucleus to produce 24-nt siRNAs from adjacent P-specific DNA or RNA template. This process is also dependent on RDR6. AGO4, in association with these 24-nt siRNAs, then mediates cleavage of some mRNA transcripts. These decapped transcripts, are then converted to dsRNA by RDR6, and then processed into 21-nt siRNAs by DCL4, or in its absence, into
22-nt siRNAs by DCL2. These 21- or 22-nt siRNAs then direct silencing. The nature of the mobile signal is proposed to be a large RNA that initiates mRNA silencing.
The biochemical pathway identified in accordance with the present invention has broad biological significance. Translocated RNA has been shown to direct key developmental processes such as leaf development (Kim et al, Science 293:287-289, 2001), and the transition from vegetative to reproductive development in plants (Huang et al, Science 309:1694-1696, 2005). From a silencing perspective, long-distance movement of RNA silencing has long been thought to be an adaptive measure by which plants can protect themselves from viruses (Mlotshwa et al, supra 2002), but it has the potential to play other roles in systemic gene regulation. The present invention identifies components of the longdistance mRNA silencing pathway, and shows the importance of cross-talk between gene silencing pathways in Arahidopsis.
This model presented in Figure Ia is proposed solely to assist in understanding one proposed mechanism and is not intended to be limiting to any aspects of the present invention.
The present invention is further described by the following non-limiting Examples.
In these Examples the following materials and methods are employed.
Plant material
The rdrβ (sdel) and ago4 mutants used were as previously described (Dalmay et al, Cell 101:543-553, 2000; Ziberman et al, Science 299:116-119, 2003). The rdrβ and nrpdla (SaIk insertion line Salk_128428) mutants are available from the SaIk Institute Genome Analysis Laboratory (LaJolla, California, USA). The rdr2 (SaIk insertion line Salk_059661) and dcl3 (SaIk insertion line Salk_005512; Figure 9) mutants were obtained from the SaIk Institute Genome Analysis Laboratory. The dcl4 mutant was from the GABI-Kat collection (GABI160A04) [Xie et al, Proc. Natl. Acad. Sci. USA 102:12984- 12989, 2005]. rdrβ, ago4, dcl3 and dcl4 homozygous lines were crossed to the wild-type target line to generate the respective mutant target lines, nrpdla and rdr2 target plants were generated by transformation with the binary vector pUQC214. The primers used to genotype mutants are shown in Table 2, or are published elsewhere (Ziberman et al, supra 2003).
PIasmid construction and transformation
The GFP (S65T) coding region (Genbank accession no. U43284) was amplified and the 35S:GFP:ocs cassette was cloned into pUQC477, a modified version of the binary vector pNB96, obtained from (POSTECH, Pohang, Republic of Korea, to form the binary construct called pUQC214 (Figure 2). For the GF-specific RNAi transgene, nucleotides nine to 400 of GFP (S65T) were amplified and cloned as an intron-splicible inverted repeat into pHannibal (Wesley et al, Plant J. 27:581-590, 2001). This GF-specific RNAi transgene was then cloned into pUQC214 to produce the binary vector pUQC218, or into the modified version of ρUQC477 to produce the binary vector pUQC251 (Figure 2). Binary vectors were introduced into Agrobacterium tumefaciens GV3101. Floral dip transformation of Arabidopsis (Clough & Bent, Plant J. 16:135-143, 1998) with pUQC 214 produced the GFP expressing target line and with pUQC251 and pUQC218 produced the GFP silencer lines Sl and S2, respectively.
Grafting of Arabidopsis Grafting was performed using the butt grafting method described by Turnbull et al, Plant J. 52:255-263, 2002, with some modifications. Plant material was grown on MS media with the plates orientated vertically. The procedure was carried out in a 90mm petri dish containing two pieces of moist Whatman no.l filter paper (Whatman) under a single 0.45 μm Millipore nitrocellulose filter (Millipore). Scions were produced by using number 15 scalpel blade within about a millimeter of the apex of the seedling. When necessary, one cotyledon was removed to orientate the scion as close to the membrane as possible. Rootstocks were generated by cutting the seedlings in the same way. Grafts were aligned using a dissecting microscope, and plates were sealed with parafilm and orientated vertically at 210C for 7 days. Grafted plants were then transferred to soil and grown under long-day length at 210C.
GFP imaging
Plants were viewed under blue light using a Dark Reader (Trademark) Spot Lamp (Clare Chemical Research) and photographed using a Canon EOS digital camera.
RNA extraction and analysis
Total RNA was isolated using TRIZOL (Trademark) reagent (Life Technologies) and used for high and low molecular weight RNA blot analysis as well as reverse transcriptase PCR analysis. Enrichment for low molecular weight RNA was performed as previously described (Mitter et al, MoUc. Pl. Microb. Inter. 16:936-944, 2003). For large RNA northern blots, 10-20 μg of RNA was separated on a 1.5% w/v formaldehyde agarose gel and blotted onto Hybond-N+ nylon membrane as described by Sambrook et al, Molecular cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Springs Harbor, 1989). DNA probes were generated using the Megaprime DNA labeling kit (Amersham Biosciences). Prehybridization was carried out at 650C in 0.5MNaHPO4 (pH 7.2), 7% w/v SDS, 1 mM EDTA and lOmg/mL sheared salmon sperm DNA, and hybridization conditions were the same. After hybridization, the membrane was washed twice for 30 minutes at 650C in ImM EDTA, 40 mM NaH2PO4 (pH 7.2) and 5% w/v SDS.
If necessary, the membrane was washed in 1 mM EDTA, 40 mM NaH2PO4 (pH 7.2) and
1% w/v SDS. Small RNAs were separated on 15% w/v polyacrylamide and transferred to nylon membrane as previously described (Mitter et al, supra 2003). GF- and P-specific
DNA or riboprobes were used to detect siRNA. Riboprobes were generated using the
Riboprobe Combination System - SP6/T7 kit (Promega). Oligonucletide probes,
GFPsiRNAl (probe Ia), GFPsiRNA2 (probe Ib) and miR159 (Table 2) were labeled with
P using T4 polynucleotide kinase (New England Biolabs). Small RNA hybridizations were performed using Ambion ultrahyb or Ambion ultrahyb-oligo hybridization buffers (Ambion) and washed at low stringency with 2X SSC, 0.2% w/v SDS and at higher stringency with IX SSC, 0.1% w/v SDS. All blots were exposed to a Storage Phosphor Screen (Molecular Dynamics) and images analyzed with ImageQuant 5.1 (Molecular Dynamics). Detection of decapped 5' ends was performed using the First Choice RLM- RACE Kit (Ambion) [Llave et al, Science 297:2053-2056, 2002]. Primary PCR was performed using the RLMRACE outer primer and a gene-specific primer (OCS-R), and nested PCR was performed using the primers RLM-RACE inner and GFPs65TBamHI (Table 3). Amplification of the SCL-IV decapped RNA was performed as previously described (Llave et al, supra 2002).
DNA extraction and analysis
DNA extractions were performed as described previously (Carroll et al, Genetics 139:407- 420, 1995). Bisulfite sequencing was performed as described by Jacobsen et al, Curr. Biol 70:179-186, 2000), using the primers GFPbis-F and GFPbis-R, and AtSNlbisF2 and AtSNlbisRl (Table 2). Southern blotting was performed with approximately 3 μg of DNA digested with Hpall. Digested DNA was separated on a 1.4% w/v agarose gel and blotted to a nylon membrane in 1OX SSC. Prehybridization, hybridization, probe labeling and washes were carried as previously mentioned for northern blots. Table 2
DNA oligonucleotides used in this study
DCL3-Fa GGCTTCAAGTGTTGGGAAAA
DCL3-Ra GTTGCACACCATTGAGCATT
APHAl* CTATGACTGGGCACAACAGACAATCGGCTGC
APHA2a ATACCGTAAAGCACGAGGAAGCGG
SDEl -Fb ATATCGAGTGCTCATATCTCC
SDE1-Rb TTGGAGAGCTCAACTTCTGG
DCL4-5'8300Fc GCAGGTTCTTGGTGACTTGGTAGAATCC
DCL4-5'9200Rc CAGGTGGCCTGGTCCTTCCTCTTCAC
LB-pl61pwc CGCTGCGGACATCTACATTTTTG
GFPs65tNcol ATCCATGGTGAGCAAGGGCGA
GFPs65tBamHI GGGGATCCTTTACTTGTACAGCTCGTCCAT
GfS'ClalKpnl GTATCGATGGTACCCAAGGGCGAGGAGCT
GF3'BamHIEcoRI CAGGATCCGAATTCCCTCCTTGAAGTCGAT
BAR5'ClalKpnI GGATCGATGGTACCATGAGCCCAGAACGACGCCC
BAR3'BaMHIEcoRI GGGGATCCGAATTCTGTGCCTCCAGGGACTTCAG
OCS-R GGTAAGGATCTGAGCTACACATGCTCAGG
RLM-Race outer GCTGATGGCGATGAATGAACACTG
RLM-Race inner CGCGGATCCGAACACTGCGTTGCTGGCTTTGATG
GFP330-F GGACGGCAACATCCTGGGG
GFPjunc-F GGGCACAAGCTGGAGTACAACTA
GFPjunc-R TTCTTCTGCTTGTCGGCCAT
GFPsiRNAl GCAACATCCTGGGGCACAAGCTGGAGTACA
GFPsiRNA2 TACAACAGCCACAACGTCTATATCATGGCCGACAA
GFP250-F AGAAGAACGGCATCAAGGTG
GFPbisFl TYTTYTTYAAGGAYGAYGGYAAYTAYAAGA
GFPbisRl TTACTTRTACARCTCRTCCATRCCRARART
aGenotyping of the dcl3 mutant was performed using the oligonucleotides DCL3-F and
DCL3-R, flanking the T-DNA insertion. No fragment was amplified from alkali-treated template (S) of plants homozygous for the T-DNA insertion in DCL3. The dcl3 T-DNA insertion allele was detected using primers specific for the NPTII sequence (APHAl and APHA2) in the SALK T-DNA.
bA codominant PCR test for rdrό (sdel) involved Styl digestion of PCR products produced with the oligonucleotide primers SDEl-F and SDEl-R.
cGenotyping of the dcU mutant was performed using the oligonucleotides DCL4-5'-8300F and DCL4-5'-9200R, flanking the T-DNA insertion. No fragment was amplified from plants homozygous for the T-DNA insertion in DCL4. The dcU T-DNA insertion allele was detected using DCL4-5'-8300F and a primer specific for the LB of the T-DNA called LB-pl61pw.
EXAMPLE 1
Long distance RNA signalling
To investigate long-distance RNAi signalling, a system of grafting Arabidopsis at the seedling stage was developed. Scions expressing a Green Florescent Protein (GFP) were grafted onto GFP-silenced rootstocks (Figure 3a), and GFP silencing and other molecular events were monitored in the scions as the seedlings developed. The silencer rootstocks carried a hairpin transgene expressing dsRNA homologous to the first 408 bp of the GFP coding sequence with or without an intact GFP target gene (Figure 3a). The portion of GFP identical to the hairpin was referred to as GF, and the remaining 309 bp 3' portion of GFP was called the P sequence (Figure 3 a). RNAi was efficiently induced in both silencer genotypes (hairpin transgene with or without an intact GFP transgene). In the silencer with an intact GFP transgene, siRNA was detected using a GF or P probe (Figure 3c), and symmetric and asymmetric methylation was observed along the length of GFP (Figures 3d and 3e). The majority of the siRNA was in the 21 -nucleotide (nt) class but some 24-nt siRNA produced by was also detected (Figure 3 c).
Grafting of seedlings demonstrated graft-transmissibility of the mobile signal from silenced rootstocks to induce RNA silencing of the target GFP in scions (Figures 3 a and
3b). Interestingly, once the graft was established, PTGS was only initiated in newly formed leaf tissue and did not spread into older leaf tissue of scions (Figure 3b). Investigation of graft transmissibility of the signal and induction of silencing led to a surprising result in terms of siRNAs status of GFP silenced tissue in the scion. siRNAs were detected corresponding to the P sequence and but not to homologous sequence to the GF sequence, irrespective of whether or not the rootstock silencer carried an intact GFP in addition to the hairpin transgene (Figure 3 c). The presence or absence of intact GFP in the rootstock silencer did not make any difference to long distance RNA silencing or the class or nature of siRNAs detected in the target scion Furthermore, only 21-nt siRNAs were detected in silenced scion tissue (Figure 3c, P probe). There was no symmetric or asymmetric cytosine methylation of the target transgene in silenced scions (Figures 3d to 3e). After establishing the grafting system on wild-type seedlings (Figure 3), experiments were conducted with target scions and silenced rootstocks in various mutant backgrounds. It was hypothesized the members of DCL, AGO and RDR were strong candidates for involvement in long-distance RNAi silencing. Nuclear-localized DCL3 is responsible for 24-nt siRNAs (Xie PLOS; Figure 4a) and this larger class of siRNAs had been earlier correlated with the sending of a PTGS signal in the presence of viral suppressors of PTGS. dcl3 silencer rootstocks lacking 24-nt siRNAs (Figure 4a) efficiently transmitted the silencing signal to wild-type target scions, thus ruling out 24-ny siRNAs as a long-distance RNA silencing signal. Surprisingly, however, reciprocal grafts involving dclS target scions and wild-type silencer rootstocks and revealed that DCL3 was required for scion tissue to respond to the mobile silencing signal (Figure 4a). No silencing of GFP or its transcript was observed in the mutant dcl3 scion (Figures 4a to 4b).
Given that NRPDIa, RDR2, DCL3 and AG04 are in the same transcriptional silencing pathway, nrdpla, rdr2 or ago4 target scions were grafted to wild-type silencer rootstocks and found that these three genes were also required for scions to respond to the longdistance RNA silencing signal (Figure 4a, Table 6). No decrease in GFP mRNA levels (Figure 4b) or florescence (Figure 4a) was seen in these mutant scions. Induction of RNA silencing in wild-type scions was also dependent on RDR6 (SDEl) function (Table 6). When rdrό target scions were grafted on wild-type silencer shoots, no GFP silencing or accumulation of siRNA was observed in the scions (Table 6). These results coupled with the previous observations of absence of GF siRNAs and presence of only 21nt siRNAs homologous to the P sequence (Figure 3f), and lack of cytosine methylation (Figures 3d to 3e) in the silenced scions, strongly indicate that the long-distance RNA silencing signal is received in the nucleus by the NRPDla-RDR2-DCL3-AGO4 pathway, but that RNA silencing is largely executed by RDR6 and downstream DICER-like and ARGONAUTE- like activities in the cytoplasm.
In view of nuclear-localized proteins being involved in scions responding to the GF hairpin-derived silencing signal from rootstocks, and the scion response involving accumulation of siRNA homologous to the P but not GF portion of GFP, it indicated that the mobile signal might is a large RNA molecule delivered to the nucleus where it hybridizes to the GFP transgene and stimulates Pol IV to produce RNA from flanking chromatin. To test this, nested RT-PCR on RNA from non-transformed scions grafted to silencer rootstocks was performed, and a large RNA species equal in size to the silencer dsRNA were detected (Figure 4d).
A predicted consequence of the mobile signal hybridizing to the GF portion of the transgene and stimulating Pol IV activity on flanking chromatin would be the production of nuclear siRNAs homologous to the P portion of GFP via the RDR2-DCL3 pathway. The siRNAs could then in association with AGO4, direct cleavage of GFP mRNA in the nucleus and provide decapped mRNA substrate for amplification of dsRNA via the RDR6 pathway in the cytoplasm. To test these hypotheses, 5' RACE was performed on RNA extracted from GFP-silenced scions (Figure 4d). The size of 5' RACE products confirmed that cleavage of the polyadenylated mRNA occurred largely within the first 100 bp of the P sequence of GFP (Figure 4d). Ten 5' RACE products were cloned and sequenced and it was shown that five resulted from cleavage 63 bp into the 3'-P portion of GFP, and the other five were produced by cleavage events at 49, 52, 61, 69 and 90 bp into the 3-P sequence. The first two nucleotides of the 5' RACE products were A or T and then C, suggesting not only is AGO4 capable of slicing mRNA but that it has a degree of sequence specificity.
None of the genes discovered to be required in the reception and induction of RNA silencing in the scions is required for sending the silencing signal from rootstocks. The role of several other candidate genes in transmitting or responding to the silencing were investigated, however none of these was shown to be required for either process (Table 6).
A further predicted consequence of hybridization of the mobile RNA signal to the 5'-GF portion of GFP and Pol IV-RDR2-DCL3 activation would be synthesis of siRNA homologous to the 35S promoter driving the GFP transgene. Linked to the 35S:GFP transgene in the target genotype is an additional 35S:BAR transgene that confers resistance to the herbicide Basta. The siRNA homologous to the 35S promoter would, therefore, be expected to affect down-regulate transcription of 35S:BAR in silenced scions. Northern and quantitative real time confirmed the hypothesis and demonstrated that the 35S:BAR gene was down-regulated in silenced target scions compared to ungrated target plants (Figure 4e). Clearly, these additional nuclear events in silenced scions provide further strong support for nuclear reception of the long-distance signal and also implicate the signal in both transcriptional and post-transcriptional gene regulation.
Table 4 Gene - Required for endogenous siRNA production
Figure imgf000079_0001
EXAMPLE 2
Sense and hairpin transgenes act synergistically to induce RNAi-based resistance to
Potato virus Yin tobacco
Figure 5 and Table 5 show that providing a homologous transgene that produces single- stranded RNA (a "sense" transgene), in addition to a homologous transgene producing double-stranded KNA (a "hairpin" transgene), enhances the frequency of RNAi-based resistance to Potato virus Y in tobacco (P < 0.007)
Table 5
Figure imgf000080_0001
Table 3 shows the frequency of methylated cytosines in bisulfite-treated GFP DNA extracted from ungrafted and grafted Arabidopsis plants. The number of methylated cytosines out of the total number of tyosines analysed from nine or ten clones is listed (and as a percentage in brackets). All plants used were wild-type.
Table 3: Frequency of methylated cytosines GF (99 nucleotides containing 9 CpGs, 6 CpNpGs and 14 CpHpHs): DNA source CpGa CpNpG CpHpHb
S2 silencer0 72/81 (89%) 22/54 (41%) 21/126 (17%)
Silenced sciond 0/90 (0%) 0/60 (0%) 0/140 (0%)
P (267 nucleotides contining 22 CpGs, 23 CpNpGs and 49 (CpHpHs): DNA source CpGa CpNpG CpHpHb
S2 silencer0 166/198 (85%) 107/207 (51%) 14/441 (3%)
Silenced sciond 3/220 (1%) 0/230 (0%) 1/490 (0%)
aCpGpG sites were counted as CpG and not CpNpG. bH=A, C, or T. °"fnine, ten, nine and ten bisulfite-treated clones, respectively, were sequenced to generate the data.
EXAMPLE 3
Long-distance transmission of RNAi-based resistance to Potato virus Yin tobacco requires a sense transgene
Long-distance transmission of RNAi-based resistance to Cumcumber moscia virus (CMV) from a tobacco rootstock requires a homologous transgene in the scion.
The results in Figure 6 shown that a homologous transgene in the scion is required for the transmission of PVY and CMV resistance from the rootstock to a scion.
Immunity in the rootstock genotype was conferred by a homologous transgene producing double-stranded RNA (a "hairpin" transgene). EXAMPLE 4
A homologous BAR sense transgene decreases the amount of double stranded RNA produced by a BAR hairpin transgene (P < 0.001)
The results in Figure 7 show that when the homologous target sequence encodes BAR there is a decrease in the amount of double stranded RNA produced by a BAR HairpiN
EXAMPLE 5
Predictions for enhanced RNAi against HIV, Hepatitis B, Hepatitis C and deleterious endogenous genes
Figure 8 shows a homologous transgene that produces single-stranded RNA5 in addition to homologous double-stranded RNA, a homologous transgene producing double-stranded RNA or another homologous RNAi-inducing molecule, enhances induction and/or transmission of RNAi targeted against viruses and deleterious endogenous genes (e.g. oncogenes, Huntington's disease gene).
EXAMPLE 6 Nuclear reception of RNA silencing signal
A model summarizing the crucial molecular events in reception of the long-distance signal and the induction of RNA silencing in new tissue is presented in Figures Ia and b. Single- stranded or dsRNA equal in size to the silencer dsRNA in the rootstock is delivered into the nuclei of cells in the shoot apex, where it hybridizes to the homologous transgene or its mRNA and stimulates Pol IV-DRD2-DCL3 activity on adjacent chromatin to produce siRNA. AGO4 (or another AGO) in association with siRNA then directs partial cleavage of the GFP mRNA population in the nucleus. Decapped, polyadenylated GFP mRNA then becomes a substrate for RDR6 to execute RNA silencing.
The model also provides a plausible explanation for why RNA silencing is systemically transmitted to the target scion, whereas cytosine methylation of the transgene is not. In the silencer genotype where large amounts of dsRNA are expressed from the hairpin transgene in the nucleus, nuclear DCL and AGO activities would ensure RNA-directed methylation of the transgene. In contrast, the model predicts that the majority of systemically transmitted RNA silencing is executed in the cytoplasm thereby diluting its potential for mediating RNA-directed DNA methylation. PVX-GFP is largely considered to be cytoplasmically-located RNA silencing, but viral system may generate higher levels siRNA that flood the nucleus to induce methylation of the PVX-GFP transgene.
EXAMPLE 7 Long-distance mRNA silencing
A system of grafting Arabidopsis seedlings (Turnbull et al, supra 2002) was adapted to further investigate long-distance transmission of mRNA silencing. Scions of a transgenic plant line, expressing high levels of a target GFP, were grafted onto rootstocks of two silencer plant lines, Sl and S2 (Figure 3). Sl expressed a dsRNA (RNAi) transgene, while S2 expressed the same RNAi transgene and a functional, albeit silenced, GFP transgen. The RNAi transgene is homologous to nucleotides nine to 400 of the GFP coding sequence, referred to as GF. The remaining 317-nucleotide downstream GFP sequence is referred to as P.
When wild-type target scions (expressing GFP) were grafted onto wild-type Sl or S2 rootstocks, GFP silencing was only induced in newly formed leaves and did not spread into older tissue. This phenorype distinguishes the signaling pathway from short-distance, cell- to-cell spreading of silencing (Himber et al, EMBO J. 22:4523-4533, 2003). There was no cytosine methylation of the GFP transgene in silenced scion, confirming earlier reports in tobacco (Mallory et al, Plant J. 35:82-92, 2003). As expected, high levels of GF-specific siRNAs were detected in both S 1 and S2 lines, and P-specifϊc siRNAs were also detected in S2 plants (Mallory et al, Plant J. 35:82-92, 2003). In the silenced scions, however, only P-specific siRNAs could be detected and no GF specific siRNAs, irrespective of the silencer rootstock used. The fact that Sl lacked P-specific siRNAs, but when used as a rootstock induced only P-specific siRNAs in the scion, demonstrates that silencing in the scion is initiated outside of the sequence homologous to the dsRNA expressed in the rootstock.
To test candidate genes for their potential involvement in long-distance niRNA silencing, we combined GFP-expressing scions and silenced rootstocks in various mutant backgrounds. Nuclear-localized DCL3 is known to generate 24-nt siRNAs (Xie et al, PLoS Biology 2:642-652, 2004), and these have been correlated with systemic silencing in tobacco (Hamilton et al, EMBO J. 27:4671-4679, 2002). However, the dcl3 S2 rootstocks, which lack 24-nt siRNAs (Figure Ha), efficiently transmitted the silencing signal to wild- type scions (Figure l ib). This clearly shows that in the proposed system, 24-nt siRNA is not the long-distance signaling molecule. Previous work implicating 24-nt siRNAs in systemic silencing was based on Agrobacterium infiltration of leaves (Hamilton et al, supra 2002) rather than grafting, and as such, it was not possible to distinguish a signal function for 24-nt siRNAs from a reception function in newly silenced tissue. Silencer rootstocks in a number of other mutant del and rdr backgrounds were also unimpaired in their ability to generate a systemic silencing signal (Table 6). However, reciprocal grafts, involving dcl3 scions expressing GFP and wild-type silencer rootstocks, revealed that while DCL3 was not required for production of the mobile silencing signal, it was essential for the scion response (Figure l ie). No reduction in GFP fluorescence or transcript levels was observed in dcl3 scions (Figure 1 lc-d).
Table 6: GFP silencing in grafted wild-type (WT) and mutant Arabidopsis plants.
Figure imgf000085_0001
a homozygous mutant F2 segregants were used from crosses between mutant and wild-type (WT) target lines b homozygous mutant T2 (scion) or Tl (rootstock) produced by transformation with the target or silencer transgenes; scion numbers represent data from two independent transgenic lines, and each rootstock represents an independent transgenic line c ago4 RNAi lines (expressing AGO4 dsRNA) confirmed results obtained with the ago4 mutant d most of these ago4 scions showed delayed silencing
DCL3 is known to play a role in silencing of transposons and repetitive DNA, but it has not been implicated in posttranscriptional gene silencing. Together with NRPDIa (Pol IVa) and RDR2, DCL3 is involved in the production of endogenous siRNA from AtSNl retroelements, 5S rDNA repeats, and from other less repetitive loci (Xie et al, supra 2004; Herr et al, Science 308:118-120, 2005). A nuclear localized ARGONAUTE, AGO4 (Xie et al, supra 2004), also plays a role in some components of this pathway, including both the production of siRNA from, and the RNA-directed DNA methylation of, specific loci including the AtSNl retroelement (Ziberman et al, supra 2003).
Since Pol IVa, RDR2, DCL3 and AGO4 are in the same transcriptional silencing pathway, we decided to graft nrpdla (pol Wa), rdr2, and ago4 mutant scions onto silencer rootstocks. We found that Pol FVa and RDR2 were also required for scions to respond to the long-distance silencing signal (Figure l ie, Table 6). When ago4 was used as a scion, five out of 13 showed no silencing and most of the remaining eight displayed a delayed onset of silencing (Figure l ie, Table 6), confirming work with the AGO4 homologue in tobacco (Jones et al, Plant Physiol. 141:598-606, 2006). With the exception of ago4 grafts that showed delayed silencing, no decrease in florescence (Figure l ie) or GFP transcript levels (Figure l id) was observed in mutant scions, indicating that the long-distance silencing signal is recognized in the nucleus by the Pol IVa-RDR2-DCL3-AGO4 pathway. Induction of silencing in scions was also dependent on RDR6 function (Figures l lc-d, Table 6) [Schwach et al, Plant Physiol. 755:1842-1852, 2005]..
A predicted consequence of the involvement of the Pol IVa-RDR2-DCL3-AGO4 pathway in the nuclear reception and initiation of silencing would be some level of transcriptional down-regulation due to chromatin compaction. Transcriptional down-regulation has been shown to spread outside the initiating region to affect expression of adjacent genes (Finnegan et al, Plant J. 44:420-432, 2005). Quantitative RT-PCR and northern analysis showed that transcription of the 35S:BAR gene, a selectable marker flanking 35S:GFP in the target line, was down-regulated in GFP-silenced scions compared to ungrafted control. No iL4i?-specifϊc siRNAs were detected in silenced scions indicating that the decrease in BAR transcript level was not due to mRNA silencing. In the cases when GFP silencing occurred in ago4 scions, however, the BAR transcript level remained unchanged. The subtle nature of the transcriptional down-regulation is reflected in the lack of both DNA methylation and detectable histone modification. Transcriptional down-regulation is not a mandatory requirement for reception of mRNA silencing, but these results provide further support for nuclear involvement the process.
The presence of only P -specific siRNAs in silenced scions suggests that the initiation of silencing via the Pol IVa-RDR2-DCL3-AGO4 pathway could result in the production of a decapped RNA substrate for the amplification of P-specific dsRNA (Gazzani et al, supra
2004; Allen et al, Cell 121, 207-221, 2005; Yoshikawa et al, Gen. Dev. 19:2164-2175,
2005). In an effort to identify such P-specific RNA, 5' RACE was performed on RNA extracted from silenced scions (Figure 12a). The size of 5' RACE products confirmed the presence of P-specific polyadenylated RNA, with 5' ends mapping between 37 and 79 nucleotides into the P region (Figure 10). The first two nucleotides of 5' RACE products were A or T, followed by C, suggesting that the mechanism producing these RNA had a degree of sequence specificity (Figure 10). The 5' heterogeneity among P-specific RNAs can be explained by a population of siRNAs being responsible for the cleavage, in contrast to a single-sized 5' RACE product of the decapped Scarecrow6-like IV (SCL6- IV) transcript detected after cleavage facilitated by miR171 (Llave et al, supra 2002) (Figure
12a).
In order to correlate the decapped RNA with specific 24-nt siRNA species, we decided to perform a more detailed analysis of the siRNA species within the P region. The majority of
24-nt siRNAs were detected within the first 33 nucleotides of P (probe Ia, Figures 12b-c), and siRNAs detected by other P-specific probes (probes Ib and 2, representing nucleotides 36-70 and 73-317 of P, respectively) were almost exclusively 21-nt in size (Figures 12b-d). The correlation between the presence of 24-nt siRNAs and the start of P-specific decapped RNAs, combined with dependence of silencing on Pol IVa, RDR2 and DCL3, indicates that the 24-nt siRNAs were responsible for guiding the production of these P-specific RNAs. There was no P-specific siRNAs in non-silenced mutant scions (Figure 12d). The lack of any siRNAs in rdrό scions suggests that not only does RDR6 generate dsRNA from the decapped RNA (Gazzani et al, supra 2004), but it also plays an earlier role in the initial perception of the signal.
DCL4 has been shown to process dsRNA produced by RDR6 into 21-nt trørø-acting siRNAs (ta-siRNAs) (Xie et al, supra 2005). It is also required for short-distance, cell-to- cell spreading of silencing (Dunoyer et al, Nat. Genet. 57:1356-1360, 2005). However, when dcl4 mutant scions were grafted onto wild-type silencer rootstocks, a normal silencing phenotype was observed (Figure 12e). The siRNA profiles of silenced dcU scions did nevertheless reveal a shift in the size of siRNAs from 21-nt to 22-nt along the entire P region (Figure 12f). The change in siRNA size is in accordance with the previously reported redundant nature of DCL proteins in Arabidopsis (Gasciolli et al, Curr. Biol. 75:1494-1500, 2005). However, these results also demonstrate that in the absence of DCL4, 22-nt siRNAs can functionally substitute for 21-nt siRNAs in degrading homologous mRNA transcripts. These classes of siRNAs have been recently demonstrated to act in the same hierarchical nature to confer resistance to RNA viruses (Deleris et al, Science 373:68-71, 2006).
EXAMPLE 8 Genoteype screening assay
A genotype is developed to screen for genes involved in long-distance mRNA silencing. The genotype expresses a root-specific GF dsRNA as well as GFP in the shoot tissue. The
"GF" refers to the 5' end of GFP transcript. "FP" refers to the 3' end or central portion of
GFP transcript. The genotype displays a phenotype similar to grafting a rootstock expressing GF dsRNA onto a scion expressing the GFP (see Figures 13a and b), but no grafting is required to create the phenotype. This genotype can be mutated and used to screen for mutants that lack systemic silencing. A map-based cloning approach is then used to clone the mutated genes. Genes can be discovered which facilitate or modulate long-distance RNA signaling, virus resistance and plant development.
EXAMPLE 9 Transmission of mRNA silencing
Table 7 provides the frequency of transmission of mRNA silencing rootstocks expressing dsRNA homologous to the GFP transcript. Scions expressing GFP were grafted onto rootstocks expressing dsRNA homologus to the 5' (GF), central (FP) or 3' terminal (3' ocs) portions of the GFP transcript. No transmission of silencing was observed when the 3' end of the GFP transcript (31 ocs) was targeted.
Figure imgf000089_0001
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
BIBLIOGRAPHY
Allen et al, Cell 121, 207-221, 2005
Bogusz et α/, PlanT-cell 2(7). -633 -6415 1990
Bytebier et al, Proc Natl Acad Sci USA §4:5345-5349, 1987
Canevascini et al, Plant Physiol 112 (2): 513-524, 1996
Capana et al, Plant MoI Biol 25(4): 681-691, 1994
Carroll et al, Genetics 139:407-420, 1995
Chen et al, Plant J 10:955-966, 1996
Chong et al, Transgenic Research 9:11-1%, 2000
Christensen et al, Plant MoI Biol 12:619-632, 1989
Christensen et al, Plant MoI Biol 18:675-689, 1992
Christou et α/, Plant Physiol 87:611-614, 1988
Christou and Ford Annals of Botany 75:407-413, 1995
Clough & Bent, Pfø«tJ. 25:735-743, 1998
Cordero et al, Physiol MoI Plant Path 41:189-200, 1992 Cordero et al, In: General Meeting of the International Program on Rice Biotechnology of the Rockefeller Foundation, Malacca, Malaysia, 1997
Corderok et al, Plant J 6(2) /141-150, 1994
Crossway et al, Biotechniques 4:320-334, 1986
Dalmay et al, Cell 101:543-553, 2000
Datta et al, Biotechnology 8:136-1 '40, 1990
De Wet et al, The Experimental Manipulation of Ovule Tissues, 197-209, 1985
Deleris et al, Science 323:68-71, 2006
DΗalluin et al, PlanT-cell 4Λ495-Ϊ505, 1992
Distribution of Plant-Parasitic Nematode Species in North America, Society of Nematologists, 1985
Duan et al, Nature Biotechnology 14:494-498, 1996
Dunoyer et al, Nat. Genet. 37:1356-1360, 2005
Eckelkamp et al, FEBS Letters 323:13-16, 1993
Finer and McMullen /« Vitro Cell Dev Biol 27PΛ1 '5-182, 1991
Finnegan et al, Plant J. 44:420-432, 2005
Fromm et α/, Biotechnology 8:833-839, 1990 Fungi on Plants and Plant Products in the United States, American Phytopathological Society, 1989
Gasciolli et al, Curr. Biol. 75:1494-1500, 2005
Gatz et al, MoI Gen Genet 227:229-237, 1991
Gazzani et al, Science 505:1046-1048, 2004
Gotor et al, Plant J 5:509-18, 1993
Guevara-Garcia et al, Plant J 4(3) :495-505, 1993
Hajdukiewicz et al, Plant MoI Biol 25:989-994, 1994
Hamilton et al, EMBO J. 21:4671-4679, 2002
Hansen et al, MoI Gen Genet 254(3) :337-343, 1997
Herr et al, Science 308: 118-120, 2005
Himber et al, EMBO J. 22:4523-4533, 2003
Hire et al, Plant MoI Biol 20(2) :207 -218, 1992
Hooykaas-Van Slogteren et al, Nature (London) 311:763-764, 1984
Hsu et al, Plant Sci 143:63-70, 1999 Huang et al, Science 309:1694-1696, 2005 Jacobsen et άl, Curr. Biol 70:179-186, 2000
Jones et al, Plant Physiol 141:598-606, 2006
Kaeppler et al, PlanT-cell Reports 9:415-418, 1990
Kaeppler et al, Theor Appl Genet 84:560-566, 1992
Kawamata et al, PlanT-cell Physiol 38(7). -792-803, 1997
Keil et α/, £M5OJS:1323-1330, 1989
Keller and Baumgartner PlanT-cell J(7φ;1051-1061, 1991
Kim et al, Science 293:287-289, 2001
Klein et al, Proc Natl Acad Sci USA §5/4305-4309, 1988
Klein et al, Plant Physiol 91.-440-444, 1988
Klein et al, Biotechnology 6:559-563, 1988
Kuster et al, Plant MoI Biol 29(4) :759-772, 1995
Kwon et al, Plant Physiol 105:357-67, 1994
Lam Results Probl Cell Differ 20: 181 -196, 1994
Last et al, Theor Appl Genet 81:581-588, 1991
Legavre et al, In: Vth International Congress of Plant Molecular Biology, Singapore, 1997 Li et al, PlanT-cell Reports /2:250-255, 1993
Llave et al, Science 297:2053-2056, 2002
McCabe et al, Biotechnology 6:923-926, 1988
McElroy et al, PlanT-cell 2:163-171, 1990
McGurl et al, Science 225:1570-1573, 1992
McNellis et al, Plant J 14(2) :241 -251, 1998
Mallory et al, Plant J. 35:82-92, 2003
Marineau et al, Plant MoI Biol P.-335-342, 1987
Matsuoka et α/, Proc Natl Acad Sci USA 90(20) .9586-9590, 1993
Matton et al, Molecular Plant-Microbe Interactions 2:325-331, 1989
Miao et al, PlanT-cell 3(l):\ \-22, 1991
Mitter et al, Molec. Pl. Microb. Inter. 16:936-944, 2003
Odell et al, Nature 3i3:810-812, 1985
Orozco et al, Plant MoI Biol 23(6):l l29-l 138, 1993
Osjoda et al, Nature Biotechnology 14:145-150, 1996 Paszkowski et α/, EMBO J 3:2117-2722, 1984
Pathirana et al, Plant J 12:293-304, 1997
Pujade-Renaud et al, Plant Physiol Biochem 35;85-93, 1997
Redolfi et al, Meth J Plant Pathol SP/245-254, 1983
Riggs et al, Proc Natl Acad Sd USA S3.-5602-5606, 1986
Rinehart et α/, Plant Physiol 112(3) :\33l-\34\, 1996
Rohmeier et al, Plant MoI Biol 22:783-792, 1993
RyanΛrø? Rev Phytopath 2S/425-449, 1990
Russell et al, Transgenic Res 6(2):157-168, 1997
Samac and Shah, PlanT-cell 3: 1063-1072, 1991
Sambrook et al, Molecular cloning — A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Springs Harbor, 1989
Sanford et al, Particulate Science and Technology 5:21-31, 1987
Sanger et al, Plant MoI Biol ;^3j:433-443, 1990
Schena et α/, Proc Natl Acad Sci USA 88: 10421-10425, 1991
Schoenbeck et al, Molec Plant-Microbe Interact, 1999 Schwach et al, Plant Physiol. 755:1842-1852, 2005
Siebertz et al, PlanT-cell 1:961-968, 1989
Singh et al, Theor Appl Genet 96:319-324, 1998
Somsisch et α/, Proc Natl Acad Sci USA 53:2427-2430, 1986
Somsisch et al, MoI Gen Genet 2:93-98, 1988
Stanford et al, MoI Gen Genet 215:200-208, 1989
Teeri et al, EMBO J 8(2) :343-350, 1989
Thompson et al, BioEssays 10:108, 1989
Tomes et al, PlanT-cell, Tissue, and Organ Culture: Fundamental Methods, 1995
Tu et al, Plant Molecular Biology 37:829-838, 1998
Turnbull et al, Plant J. 32:255-263, 2002
U.S. Dept. of Agriculture Handbook No. 165, 1960
U.S. Pat. No. 5,240,855
U.S. Pat. No. 5,322,783
U.S. Pat. No. 5,324,646 U.S. Pat. No. 4,945,050
U.S. Pat. No. 5,023,179
U.S. Pat. No. 5,110,732
U.S. Pat. No. 5,268,463
U.S. Pat. No. 5,399,680
U.S. Pat. No. 5,401,836
U.S. Pat. No. 5,459,252
U.S. Pat. No. 5,466,785
U.S. Pat. No. 5,563,055
U.S. Pat. No. 5,569,597
U.S. Pat. No. 5,593,874
U.S. Pat. No. 5,604,121
U.S. Pat. No. 5,608,142
U.S. Pat. No. 5,608,144
U.S. Pat. No. 5,608,149
U.S. Pat. No. 5,633,363 U.S. Pat. No. 5,659,026
U.S. Pat. No. 5,698,425
U.S. Pat. No. 5,712,135
U.S. Pat. No. 5,736,369
U.S. Pat. No. 5,750,386
U.S. Pat. No. 5,789,156
U.S. Pat. No. 5,789,214
U.S. Pat. No. 5,804,693
U.S. Pat. No. 5,814,618
U.S. Pat. No. 5,837,876
U.S. Pat. No. 5,879,918
U.S. Pat. No. 5,886,244
U.S. Pat. No. 5,932,782
U.S. Pat. No. 5,981,840
U.S. Pat. No. 6,072,050 U.S. Pat. No. 6,177,611
Uknes et al, PlanT-cell 4:645-656, 1992
Van Camp et al, Plant Physiol 112(2) :525-535, 1996
Van Loon Plant MoI Virol 4:111-116, 1985
Velten et β/, EMBO J 3:2723-2730, 1984
WO 97/32016
WO 99/43838
WO 00/12733
WO 00/28058
Warner et al, Plant J 3:191-201, 1993
Weissinger et al, Ann Rev Genet 22:421-477, 1988
Yamamoto et al, PlanT-cell Physiol 35^:773-778, 1994
Yamamoto et al, Plant J 12(2) :255-265, 1997
Yang Proc Natl Acad Sci USA 93:H912-H911, 1996
Yoshikawa et α/, Gen. Dev. 19:2164-2175, 2005
Wesley et al, Plant J. 27:581-590, 2001 Xie et al, PLoS Biology 2:642-652, 2004
Xie et al, Proc. Natl. Acad. Sci. USA 702:12984-12989, 2005
Zhang et al, Proc Natl Acad Sci USA 91 /2507-2511, 1994
Ziberman et al, Science 299:716-719, 2003

Claims

CLAIMS:
1. A method of inhibiting expression of a target gene in a cell said method comprising:
(i) introducing into or generating in said cell or parent or relative including progeny of said cell an RNA silencing species comprising a nucleotide sequence substantially homologous to all or part of a strand of said target gene;
(ii) generating in said cell or a relative including progeny of said cell a transcript corresponding to all or part of the coding strand or other transcribed portion of said target gene;
wherein inhibition of expression of the target gene occurs via transcriptional and post- transcriptional gene silencing.
2. The method of Claim 1 wherein the cell is a vertebrate or invertebrate animal cell.
3. The method of Claim 2 wherein the cell is a plant cell.
4. The method of Claim 1 or 2 or 3 wherein steps (i) and (ii) occur in the reverse order.
5. The method of Claim 1 or 2 or 3 wherein steps (i) and (ii) occur substantially simultaneously.
6. The method of Claim 1 wherein the RNA silencing species is synthetic.
7. The method of Claim 1 wherein the RNA silencing species is DNA derived.
8. The method of Claim 7 wherein the DNA encoding the RNA silencing species is generated in a cell or cell type different to the cell carrying the target gene or homologous target sequence.
9. The method of Claim 7 wherein the DNA encoding the RNA silencing species is generated in the same cell as the cell carrying the target gene or homologous target sequence.
10. The method of Claim 1 wherein the RNA silencing species is directed to the 5' end of the target gene or its transcript.
11. The method of Claim 1 wherein the RNA silencing species is directed to the 3' end of the target gene or its transcript.
12. The method of Claim 1 or 10 wherein the transcript in part (ii) is directed to the 5' end of the mRNA encoded by the target gene.
13. The method of Claim 1 or 11 wherein the transcript in part (ii) is directed to the 3' end of the mRNA encoded by the target gene.
14. The method of Claim 1 wherein the transcriptional gene silencing occurs via an siRNA pathway comprising PoIIV, RDR2, DCL3, AG04 and RDR6.
15. A method for generating a genetically modified cell including a subject comprising said cell or a relative including progeny of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of:
(a) a second DNA which generates an RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene;
(b) a modification increasing copy number and/or expression levels of said target gene; and/or
(c) an elevated component of an RNA amplification or degradative pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
16. The method of Claim 15 wherein the cell is a vertebrate or invertebrate animal cell.
17. The method of Claim 15 wherein the cell is a plant cell.
18. The method of Claim 15 wherein steps (a), (b) and (c) occur in any order or two or more steps occur simultaneously.
19. The method of Claim 15 wherein the RNA silencing species is synthetic.
20. The method of Claim 15 wherein the RNA silencing species is DNA derived.
21. The method of Claim 20 wherein the DNA encoding the RNA silencing species is generated in a cell or cell type different to the cell carrying the target gene or homologous target sequence.
22. The method of Claim 20 wherein the DNA encoding the RNA silencing species is generated in the same cell as the cell carrying the target gene or homologous target sequence.
23. The method of Claim 12 wherein the RNA silencing species is directed to the 5' end of the target gene or its transcript.
24. The method of Claim 13 wherein the RNA silencing species is directed to the 3' end of the target gene or its transcript.
25. The method of Claim 12 or 23 wherein the second DNA encodes RNA directed to the 5' end of the mRNA encoded by the target gene.
26. The method of Claim 13 or 24 wherein the second DNA encodes RNA directed to the 3' end of the mRNA encoded by the target gene.
27. A method for altering the phenotype of a cell or a relative of said cell or a subject comprising said cell or a relative including progeny of said cells, said method comprising:
(i) introducing to a cell or a relative of the cell carrying the target gene or to which the target gene may subsequently be introduced an RNA silencing species directed to the target gene;
and one or more of:
(a) introducing to said cell or its relative including progeny cell a DNA construct comprising a nucleotide sequence operably linked to a promoter such that an RNA transcript is generated which is substantially homologous to at least 5 contiguous nucleotides of an RNA transcript of the target gene; and/or
(b) increasing the copy number and/or level of expression of the target gene; and/or
(c) increasing the level of a component of an RNA amplification or degradation pathway selected from Pol IV, RDR2, DCL3, AG04 and RDR6.
28. A method for generating a genetically modified cell including a subject comprising said cell or a relative including progeny of said cell, said cell comprising a first DNA which generates an RNA silencing species and one or more of:
(a) a second DNA which generates an RNA transcript comprising at least 5 contiguous nucleotides of a transcript of a target gene;
(b) a modification increasing copy number and/or expression levels of said target gene; and/or
(c) an elevated component of an RNA amplification or degradative pathway selected from Pol IV, RDR2, DCL3, AGO4 and RDR6.
29. The method of Claims 28 wherein the cell is a vertebrate or invertebrate animal cell.
30. The method of Claim 28 wherein the cell is a plant cell.
31. The method of Claim 28 wherein steps (a), (b) and (c) occur in any order or two or more steps occur simultaneously.
32. The method of Claim 28 wherein the RNA silencing species is synthetic.
33. The method of Claim 28 wherein the RNA silencing species is DNA derived.
34. The method of Claim 28 wherein the DNA encoding the RNA silencing species is generated in a cell or cell type different to the cell carrying the target gene or homologous target sequence.
35. The method of Claim 28 wherein the DNA encoding the RNA silencing species is generated in the same cell as the cell carrying the target gene or homologous target sequence.
36. The method of Claim 27 or 28 wherein the RNA silencing species is directed to the 5' end of the target gene or its transcript.
37. The method of Claim 27 or 28 wherein the RNA silencing species is directed to the 3' end of the target gene or its transcript.
38. The method of Claim 27 or 28 or 36 wherein the second DNA encodes an RNA directed to the 5' end of the niRNA encoded by the target gene.
39. The method of Claim 27 or 28 or 37 wherein the second DNA encodes an RNA directed to the 3' end of the mRNA encoded by the target gene.
40. A method for inhibiting expression of a target gene in a cell of a recipient said method comprising:
(i) isolating one or more populations of cells from said recipient;
(ii) introducing genetic constructs into at least two subpopulations of the same population of cells or in two different populations of cells, wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and is introduced into one population or subpopulation of cells and a second construct comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene is introduced into the other population or subpopulation of cells; and
(iii) returning said population or subpopulation of cells to the recipient wherein inhibition of expression of the target gene carrying the second construct occurs by TGS and PTGS via RNA signaling from the RNA silencing species.
41. A method of treatment of a recipient requiring silencing of expression of a target gene said method comprising introducing autologous cells from said recipient modified to generate a transcript of said target gene and introducing to said recipient a DNA-derived or synthetic RNA silencing species or an autologous cell modified to generate the DNA- derived RNA silencing species wherein upon entry of the RNA silencing species into the cells comprising a transcript of the target gene, expression of said target gene is inhibited by TGS and PTGS.
42. A phenotypic modifying kit for a subject comprising:
(i) an RNA silencing species specific for a target gene or cells capable of generating same;
(ii) a genetic construct comprising a DNA sequence which encodes a RNA transcript of said target gene or cells comprising same; and
(iii) instructions for use comprising introducing into said subject the genetic construct or cells comprising same such that the subject establishes a population of said cells, introducing to said subject the RNA silencing species or cells comprising same and monitoring for gene silencing via a TGS pathway comprising Pol IV, RDR2, DCL3, AGO4 and RDR6 and a PTGS pathway via RISC.
43. A genetic composition comprising:
(i) an RNA silencing species specific for a target gene or cells capable of generating same; and
(ii) a genetic construct comprising a DNA sequence which encodes a RNA transcript of said target gene or cells comprising same.
44. A genetic composition comprising one or more constructs wherein a first construct encodes an RNA silencing species and comprises a nucleotide sequence substantially homologous to a strand of a target gene and a second construct which comprises DNA which encodes a nucleotide sequence substantially homologous to a transcript of said target gene.
45. A genetic composition comprising a genetic construct which encodes the central and 3' terminal regions of a target gene or its transcript separated by a spacer nucleotide sequence to enable a hairpin construct to be generated, said genetic construct further comprising a nucleotide sequence which encodes a RNA transcript corresponding to said target gene or its transcript.
PCT/AU2006/001402 2005-09-26 2006-09-26 Modulation of gene expression and agents useful for same WO2007033436A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2005905307A AU2005905307A0 (en) 2005-09-26 Modulation of gene expression and agents useful for same
AU2005905307 2005-09-26

Publications (1)

Publication Number Publication Date
WO2007033436A1 true WO2007033436A1 (en) 2007-03-29

Family

ID=37888471

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2006/001402 WO2007033436A1 (en) 2005-09-26 2006-09-26 Modulation of gene expression and agents useful for same

Country Status (1)

Country Link
WO (1) WO2007033436A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009021288A1 (en) * 2007-08-14 2009-02-19 Commonwealth Scientific And Industrial Research Organisation Improved gene silencing methods
EP2853598A1 (en) * 2013-09-25 2015-04-01 Board of Regents of the University of Nebraska Methods and compositions for obtaining useful plant traits
CN107090020A (en) * 2017-06-09 2017-08-25 福建省平潭县水产良种实验有限公司 Study on lectin from edible fungi and its application in phaeocystis growth is suppressed
US10058044B2 (en) 2013-11-07 2018-08-28 Nutech Ventures Methods and compositions for obtaining useful plant traits
US10344340B2 (en) 2011-05-02 2019-07-09 Nutech Ventures Plants with useful traits and related methods
US10364438B1 (en) 2014-04-16 2019-07-30 Nutech Ventures Methods and compositions for obtaining useful plant traits
CN110885797A (en) * 2018-08-20 2020-03-17 山东农业大学 Weak-toxicity vaccine for resisting cucumber mosaic virus, preparation method and application thereof
CN112063750A (en) * 2020-08-17 2020-12-11 河海大学 LAMP (Loop-mediated isothermal amplification) detection primer group of mandarin perch rhabdovirus, application of LAMP detection primer group and detection kit
EP3662067A4 (en) * 2017-08-03 2021-04-14 Plantform Corporation Transient silencing of argonaute1 and argonaute4 to increase recombinant protein expression in plants
CN113621620A (en) * 2021-08-17 2021-11-09 安徽农业大学 Gene with function of regulating and controlling immunity of plutella xylostella and preparation method and application thereof
CN114480734A (en) * 2022-01-11 2022-05-13 福建省亚热带植物研究所 Specific primer for detecting passionflower latent virus and application thereof
CN114940978A (en) * 2022-04-08 2022-08-26 广西大学 Construction method of recombinant porcine reproductive and respiratory syndrome virus for expressing Getavirus E2 protein
CN115819543A (en) * 2022-11-29 2023-03-21 华南师范大学 Application of transcription factor Tbx20 promoter region G4 regulatory element in pest control
US11716996B2 (en) 2018-07-18 2023-08-08 Plantarcbio Ltd. Compositions and methods for mitigating pest infestation with Rhynchophorus ferrugineus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HERR A.J.: "Silence is green", BIOCHEM. SOC. TRANSACT., vol. 32, no. 6, 2004, pages 946 - 951, XP003010582 *
HIMBER C. ET AL.: "Transitivity-dependent and -independent cell-to-cell movement of RNA silencing", EMBO JOURNAL, vol. 22, no. 17, 2003, pages 4523 - 4533, XP003010583 *
KLAHRE U. ET AL.: "High molecular weight RNAs and small interfering RNAs induce systemic posttranscriptional gene silencing in plants", PROC. NATL. ACAD. SCI., USA, vol. 99, no. 18, 2002, pages 11981 - 11986, XP002248496 *
VAUCHERET H. ET AL.: "Transcriptional gene silencing in plants: targets, inducers and regulators", TRENDS IN GENETICS, vol. 17, no. 1, 2001, pages 29 - 35, XP004314061 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2008286701B2 (en) * 2007-08-14 2015-02-12 Commonwealth Scientific And Industrial Research Organisation Improved gene silencing methods
WO2009021288A1 (en) * 2007-08-14 2009-02-19 Commonwealth Scientific And Industrial Research Organisation Improved gene silencing methods
US9885038B2 (en) 2007-08-14 2018-02-06 Commonwealth Scientific & Industrial Research Organisation Gene silencing methods
US10344340B2 (en) 2011-05-02 2019-07-09 Nutech Ventures Plants with useful traits and related methods
US10920286B2 (en) 2011-05-02 2021-02-16 Nutech Ventures Plants with useful traits and related methods
US10767188B2 (en) 2013-09-25 2020-09-08 Nutech Ventures Methods and compositions for obtaining useful plant traits
EP2853598A1 (en) * 2013-09-25 2015-04-01 Board of Regents of the University of Nebraska Methods and compositions for obtaining useful plant traits
US10058044B2 (en) 2013-11-07 2018-08-28 Nutech Ventures Methods and compositions for obtaining useful plant traits
US10364438B1 (en) 2014-04-16 2019-07-30 Nutech Ventures Methods and compositions for obtaining useful plant traits
CN107090020A (en) * 2017-06-09 2017-08-25 福建省平潭县水产良种实验有限公司 Study on lectin from edible fungi and its application in phaeocystis growth is suppressed
EP3662067A4 (en) * 2017-08-03 2021-04-14 Plantform Corporation Transient silencing of argonaute1 and argonaute4 to increase recombinant protein expression in plants
US11802289B2 (en) 2017-08-03 2023-10-31 Plantform Corporation Transient silencing of ARGONAUTE1 and ARGONAUTE4 to increase recombinant protein expression in plants
US11716996B2 (en) 2018-07-18 2023-08-08 Plantarcbio Ltd. Compositions and methods for mitigating pest infestation with Rhynchophorus ferrugineus
CN110885797A (en) * 2018-08-20 2020-03-17 山东农业大学 Weak-toxicity vaccine for resisting cucumber mosaic virus, preparation method and application thereof
CN112063750A (en) * 2020-08-17 2020-12-11 河海大学 LAMP (Loop-mediated isothermal amplification) detection primer group of mandarin perch rhabdovirus, application of LAMP detection primer group and detection kit
CN113621620A (en) * 2021-08-17 2021-11-09 安徽农业大学 Gene with function of regulating and controlling immunity of plutella xylostella and preparation method and application thereof
CN114480734A (en) * 2022-01-11 2022-05-13 福建省亚热带植物研究所 Specific primer for detecting passionflower latent virus and application thereof
CN114940978A (en) * 2022-04-08 2022-08-26 广西大学 Construction method of recombinant porcine reproductive and respiratory syndrome virus for expressing Getavirus E2 protein
CN114940978B (en) * 2022-04-08 2023-12-29 广西大学 Construction method of recombinant porcine reproductive and respiratory syndrome virus expressing Gatavirus E2 protein
CN115819543A (en) * 2022-11-29 2023-03-21 华南师范大学 Application of transcription factor Tbx20 promoter region G4 regulatory element in pest control

Similar Documents

Publication Publication Date Title
WO2007033436A1 (en) Modulation of gene expression and agents useful for same
Joga et al. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: what we know so far
Voinnet Non-cell autonomous RNA silencing
AU2009206127B2 (en) Compositions and methods for the suppression of target polynucleotides from Lygus
ES2692383T3 (en) Compositions and methods to fight insect pests
US20120157512A1 (en) Preventing and Curing Beneficial Insect Diseases Via Plant Transcribed Molecules
US20130205453A1 (en) Compositions and Methods for the Suppression of Target Polynucleotides
JP2008522585A (en) MicroRNA
BRPI0611681A2 (en) isolated nucleic acid molecules, methods for protecting a plant from an insect pest, transformed plants, isolated insect protoxin, composition, method for impacting an insect pest, isolated polypeptide showing proteolytic activity
CN101257792A (en) Management of plant pathogens
Yan et al. The mobile small RNAs: Important messengers for long-distance communication in plants
CN103747671A (en) Small interfering RNA with target-specific seed sequences
US10550400B2 (en) Methods to monitor post-translational gene silencing activity in plant tissues/cell types relevant for pathogen entry, propagation or replication
US20160168587A1 (en) Methods and Compositions for Plant Pest Control
Das Dangol et al. Utilizing RNA-based approaches to understand plant-insect interactions
Ricaño-Rodríguez et al. The extraordinary nature of RNA interference in understanding gene downregulation mechanism in plants
AU2018201526B2 (en) RNA production in higher plants
ES2368499T3 (en) SEQUENCES OF RECOGNITION OF SPECIFIC PROTEASE OF INSECTS.
Burke RNAi Targeting of Manduca sexta Using Chloroplast-Encoded Long dsRNA
US20140275213A1 (en) Methods and Compositions for Plant Pest Control
WO2016040876A1 (en) Methods and compositions for plant pest control
Shamandi Functional analysis of plant RNaseIII enzymes
WO2012112518A1 (en) Interfering rnas that promote root growth

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06790273

Country of ref document: EP

Kind code of ref document: A1