WO2007016496A2 - Dipiperazinyl ketones and related analogues - Google Patents

Dipiperazinyl ketones and related analogues Download PDF

Info

Publication number
WO2007016496A2
WO2007016496A2 PCT/US2006/029761 US2006029761W WO2007016496A2 WO 2007016496 A2 WO2007016496 A2 WO 2007016496A2 US 2006029761 W US2006029761 W US 2006029761W WO 2007016496 A2 WO2007016496 A2 WO 2007016496A2
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
compound
salt
hydrate
alkoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2006/029761
Other languages
French (fr)
Other versions
WO2007016496A3 (en
Inventor
Linghong Xie
Joseph W. Ochterski
Yang Gao
Bingsong Han
Timothy M. Caldwell
Yuelian Xu
John M. Peterson
Ping Ge
Robert Ohliger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Neurogen Corp
Original Assignee
Neurogen Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Neurogen Corp filed Critical Neurogen Corp
Priority to EP06788999A priority Critical patent/EP1909797A4/en
Priority to AU2006275568A priority patent/AU2006275568A1/en
Priority to CA002606004A priority patent/CA2606004A1/en
Priority to JP2008525081A priority patent/JP2009506987A/en
Publication of WO2007016496A2 publication Critical patent/WO2007016496A2/en
Anticipated expiration legal-status Critical
Publication of WO2007016496A3 publication Critical patent/WO2007016496A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/06Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/06Antimigraine agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/22Anxiolytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/16Otologicals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/08Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon radicals, substituted by hetero atoms, attached to ring carbon atoms
    • C07D207/09Radicals substituted by nitrogen atoms, not forming part of a nitro radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/10Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D207/14Nitrogen atoms not forming part of a nitro radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/10Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms
    • C07D211/14Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/18Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D211/34Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/40Oxygen atoms
    • C07D211/44Oxygen atoms attached in position 4
    • C07D211/52Oxygen atoms attached in position 4 having an aryl radical as the second substituent in position 4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/56Nitrogen atoms
    • C07D211/58Nitrogen atoms attached in position 4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/60Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D211/62Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals attached in position 4
    • C07D211/64Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals attached in position 4 having an aryl radical as the second substituent in position 4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/68Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member
    • C07D211/72Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D213/00Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/72Nitrogen atoms
    • C07D213/74Amino or imino radicals substituted by hydrocarbon or substituted hydrocarbon radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D213/00Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/81Amides; Imides
    • C07D213/82Amides; Imides in position 3
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/48Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D217/00Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
    • C07D217/02Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D237/00Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings
    • C07D237/02Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings
    • C07D237/06Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D237/10Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D237/20Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D237/00Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings
    • C07D237/02Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings
    • C07D237/06Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D237/10Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D237/22Nitrogen and oxygen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D237/00Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings
    • C07D237/02Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings
    • C07D237/06Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D237/10Heterocyclic compounds containing 1,2-diazine or hydrogenated 1,2-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D237/24Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D239/00Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/46Two or more oxygen, sulphur or nitrogen atoms
    • C07D239/47One nitrogen atom and one oxygen or sulfur atom, e.g. cytosine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D241/00Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/06Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having one or two double bonds between ring members or between ring members and non-ring members
    • C07D241/08Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having one or two double bonds between ring members or between ring members and non-ring members with oxygen atoms directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D241/00Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/10Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
    • C07D241/14Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D241/20Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D243/00Heterocyclic compounds containing seven-membered rings having two nitrogen atoms as the only ring hetero atoms
    • C07D243/06Heterocyclic compounds containing seven-membered rings having two nitrogen atoms as the only ring hetero atoms having the nitrogen atoms in positions 1 and 4
    • C07D243/08Heterocyclic compounds containing seven-membered rings having two nitrogen atoms as the only ring hetero atoms having the nitrogen atoms in positions 1 and 4 not condensed with other rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D263/00Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/02Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
    • C07D263/30Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D263/32Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D271/00Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
    • C07D271/02Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
    • C07D271/061,2,4-Oxadiazoles; Hydrogenated 1,2,4-oxadiazoles
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/32Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D277/56Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/60Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
    • C07D277/62Benzothiazoles
    • C07D277/68Benzothiazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • C07D277/82Nitrogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D295/00Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/02Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms containing only hydrogen and carbon atoms in addition to the ring hetero elements
    • C07D295/027Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms containing only hydrogen and carbon atoms in addition to the ring hetero elements containing only one hetero ring
    • C07D295/033Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms containing only hydrogen and carbon atoms in addition to the ring hetero elements containing only one hetero ring with the ring nitrogen atoms directly attached to carbocyclic rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D295/00Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/16Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
    • C07D295/18Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carboxylic acids, or sulfur or nitrogen analogues thereof
    • C07D295/182Radicals derived from carboxylic acids
    • C07D295/185Radicals derived from carboxylic acids from aliphatic carboxylic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D295/00Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/16Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
    • C07D295/18Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carboxylic acids, or sulfur or nitrogen analogues thereof
    • C07D295/182Radicals derived from carboxylic acids
    • C07D295/192Radicals derived from carboxylic acids from aromatic carboxylic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D295/00Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/16Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
    • C07D295/20Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carbonic acid, or sulfur or nitrogen analogues thereof
    • C07D295/215Radicals derived from nitrogen analogues of carbonic acid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/62Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/68Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
    • C07D333/70Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/06Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/10Spiro-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/08Bridged systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D491/00Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/10Spiro-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D491/00Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/10Spiro-condensed systems
    • C07D491/107Spiro-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring

Definitions

  • This invention relates generally to dipiperazinyl ketones and related analogues, and to the use of such compounds for treating conditions responsive to histamine H3 receptor modulation.
  • the invention further relates to the use of such compounds as probes for the detection and localization of histamine H3 receptors.
  • G proteins coupled guanosine triphosphate-binding proteins
  • GPCRs G protein-coupled receptors
  • Histamine is a multifunctional chemical transmitter that signals through specific cell surface GPCRs.
  • Histamine receptor subtypes have been identified: Hl, H2, H3 and H4.
  • Histamine H3 receptor is a presynaptic GPCR that is found primarily in the central nervous system, although lower levels are also found in the peripheral nervous system.
  • Genes encoding the H3 receptor have been reported in various organisms, including humans (see Lovenberg et al. (1999) Molecular Pharmacology 55:1101-07), and alternative splicing of this gene appears to result in multiple isoforms.
  • the histamine H3 receptor is an auto- and hetero-receptor whose activation leads to''a (including histamine, acetylcholine, norepinephrine and glutamate) from neurons in the brain, and is involved in the regulation of processes such as sleep and wakefulness, feeding and memory.
  • the histamine H3 receptor may be constitutively active. Antagonists of histamine H3 receptor increase synthesis and release of cerebral histamine and other neurotransmitters, inducing an extended wakefulness, an improvement in cognitive processes, a reduction in food intake and a normalization of vestibular reflexes.
  • Such antagonists may find use as therapeutics for central nervous system disorders such as Alzheimer's disease, Parkinson's disease, schizophrenia, mood and attention alterations including attention deficit hyperactivity disorder and attention deficit disorder, memory and learning disorders, cognitive disorders (such as mild cognitive impairment and cognitive deficits in psychiatric pathologies), epilepsy, migraine, and disorders associated with the regulation of sleep and wakefulness, as well as in the treatment and prevention of conditions such as obesity, eating disorders, diabetes, vertigo, motion sickness and allergic rhinitis.
  • central nervous system disorders such as Alzheimer's disease, Parkinson's disease, schizophrenia, mood and attention alterations including attention deficit hyperactivity disorder and attention deficit disorder, memory and learning disorders, cognitive disorders (such as mild cognitive impairment and cognitive deficits in psychiatric pathologies), epilepsy, migraine, and disorders associated with the regulation of sleep and wakefulness, as well as in the treatment and prevention of conditions such as obesity, eating disorders, diabetes, vertigo, motion sickness and allergic rhinitis.
  • the histamine H3 receptor is an important target for new therapeutics for conditions responsive to H3 receptor modulation.
  • the present invention fulfills this need, and provides further related advantages.
  • the present invention provides dipiperazinyl ketones and related analogues of Formula I:
  • R 3 and R 4 are independently chosen from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, C 2 -C 6 alkyl ether and (C 3 -C 6 cycloalkyl)Co-C 2 alkyl, or R 3 and R 4 are taken together to form an optionally substituted 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and
  • R 5 is hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, C 2 -C 6 alkyl ether or (C 3 -C 6 cycloalkyl)Co-C 2 alkyl;
  • A is a 4- to 8-membered cycloalkyl or heterocycloalkyl group, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from (i) hydroxy, halogen, oxo, C 1 -Qalkyl, CpQalkoxy and C 1 -C 4 alkanoyl; (ii) groups that are taken together with a substituent of Re to from a spiro ring that is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C 1 -Qalkyl, (C 3 -C 8 cycloalkyl)
  • Ri is C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, mono- or di-(C 1 -C 6 alkyl)amino, (C 3 -C 8 cycloalkyl)C 0 - C 4 alkyl, (3- to 8-membered heterocycloalkyl)Co-C 4 alkyl, (6- to 10-membered aryl)C 0 -C 4 alkyl or (5- to 10-membered heteroaryl)Co-C 4 alkyl, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, aminocarbonyl, C 1 -C 6 alkyl, C 1 -C 8 alkenyl, C 1 -C 6 haloalkyl, C 1 -C 6 alkoxy, C 1 -C 6 haloal
  • each r is independently O, 1 or 2 and each R 2 is independently hydrogen, C 1 -C 6 alkyl, (C 3 -C 8 cycloalkyl)Co-C 2 alkyl, or taken together with a substituent of A to form an optionally substituted spiro ring; and E is absent or represents a C 1 -C 6 alkylene or C 1 -C 6 alkoxy (i.e., -O-( C 1 -C 6 alkylene)-) linker.
  • Zi and Z 2 are independently nitrogen or CR a , wherein each R 3 is independently chosen from hydrogen, hydroxy, halogen, C 1 -C 4 alkyl, C 1 -C 4 alkoxy and C 1 -C 4 alkanoyl;
  • Z 3 is nitrogen or CR b , wherein R b is absent or chosen from hydrogen, hydroxy, halogen, C 1 -C 4 alkyl, C 1 -C 4 alkoxy, C 1 -C 4 alkanoyl and groups that are taken together with R 2 or a substituent of R 6 to form a spiro ring that is optionally substituted and is preferably substituted with from O to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C 1 -C 4 alkyl, (C 3 - C 8 cycloalkyl)C 0 -C 2 alkyl, C 1 -C 4 haloalkyl, C 1 -C 4 alkoxy and substituents that are taken together to form a fused 5- to 7-membered ring; independently represent a single or double bond, such that: (i) if Z 3 is N, then s a single bond; and (ii) at least one of s a single
  • R 3 and R 4 are independently chosen from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, C 2 -C 6 alkyl ether and (C 3 -C 6 cycloalkyl)C 0 -C 2 alkyl, or R 3 and R 4 are taken together to form an optionally substituted 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and R 5 is hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, C 2 -C 6 alkyl ether or (C 3 -C 6 cycloalkyl)C 0 -C 2 alkyl; Each q is independently 0, 1 or 2; such that neither q is 0 if both Z 2 and Z 3 are N; m is 0, 1 or 2; Ri is C 3 -C 6 alkyl, C 3 -C 6 alkenyl, C 3 -C 6 alkynyl, (C 3 -C 8
  • R 5 is C 1 -C 8 alkyl, C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, C 1 -C 8 alkanoyl, C r C 8 alkoxycarbonyl, mono- or di-(Cr C 8 alkyl)amino, (C 3 -C] 0 carbocycle)-X-(Co-C 4 alkyl)- or (4- to 10-membered heterocycle)-X-(C 0 -
  • D represents C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, (C 3 -C 14 carbocycle)C 0 -C 2 alkyl or (4- to 14-membered heterocycle)C 0 -C 2 alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from:
  • each r is independently O, 1 or 2 and each R 2 is independently hydrogen, C 1 -C 6 alkyl, (C 3 - C8cycloalkyl)Co-C 2 alkyl, or taken together with R b to form an optionally substituted spiro ring; and E is absent or represents C 1 -Cgalkylene or C 1 -C 6 alkoxy; and
  • R 7 represents from O to 4 substituents independently chosen from C 1 -C 3 alkyl and groups that are taken together to form a C 1 -C 3 alkylene bridge.
  • variables are as described for Formula II; such that (i) Z 2 is not CR a if Zi and Z 3 are both nitrogen; (ii) at least one of Z 2 and Z 3 is nitrogen; and (ii) Re is not phenyl substituted with halogen.
  • R 8 and R9 are independently hydrogen, C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, (C 3 -C 8 cycloalkyl)C 0 - C 2 alkyl or (3- to 8-membered heterocycloalkyl)Co-C 2 alkyl, each of which is optionally substituted, and each of which is preferably substituted with from O to 4 substituents independently chosen from R x ; or R 8 and R 9 are taken together to form a 4- to 8-membered heterocycloalkyl that is optionally substituted and is preferably substituted with from O to 4 substituents independently chosen from R x ;
  • Each R x is independently oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C 1 -C 6 alkyl, C 1 -
  • dipiperazinyl ketones and related analogues provided herein are histamine H3 receptor modulators that exhibit a K; at a histamine H3 receptor, preferably a human H3 receptor, that is no greater than 4 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar, as determined using an assay for H3 receptor GTP binding.
  • compounds provided herein are labeled with a detectable marker (e.g., radiolabeled or fluorescein conjugated).
  • a detectable marker e.g., radiolabeled or fluorescein conjugated
  • the present invention further provides, within other aspects, pharmaceutical compositions comprising at least one dipiperazinyl ketone or related analogue provided herein in combination with a physiologically acceptable carrier or excipient.
  • W'ith ⁇ ''" ⁇ yWy'e ⁇ - "' a ⁇ ects;' 1 ' itifetilods are provided for modulating H3 activity, comprising contacting a cell (e.g., neuronal) expressing H3 receptor with at least one H3 receptor modulator as described herein. Such contact may occur in vivo or in vitro and is generally performed using a concentration of compound that is sufficient to alter H3 receptor GTP binding in vitro ⁇ e.g., using the assay provided in Example 7, herein).
  • methods for modulating H3 receptor activity, comprising contacting a cell (e.g., neuronal) expressing H3 receptor with at least one H3 receptor modulator as described herein. Such contact may occur in vivo or in vitro and is generally performed using a concentration of compound that is sufficient to alter H3 receptor GTP binding in vitro (e.g., using the assay provided in Example 7, herein).
  • a cell e.g., neuronal
  • H3 receptor modulator as described herein.
  • the present invention further provides methods for treating a condition responsive to H3 receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one H3 receptor modulator.
  • Such conditions include, for example, attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, cognitive disorders (including mild cognitive impairment), epilepsy, migraine, a sleep disorder, excessive daytime sleepiness, shift work disorder, narcolepsy, idiopathic hypersomnia, allergic rhinitis, vertigo, motion sickness, memory disorders such as Alzheimer's disease, Parkinson's disease, obesity, eating disorders and diabetes.
  • the present invention provides methods for determining the presence or absence of H3 receptor in a sample, comprising: (a) contacting a sample with a H3 receptor modulator as described herein under conditions that permit binding of the H3 receptor modulator to H3 receptor; and (b) detecting a level of the H3 modulator bound to H3 receptor.
  • the present invention also provides packaged pharmaceutical preparations, comprising: (a) a pharmaceutical composition as described herein in a container; and (b) instructions for using the composition to treat one or more conditions responsive to H3 receptor modulation, such as the conditions recited herein.
  • the present invention provides methods of preparing the compounds disclosed herein, including the intermediates.
  • the present invention provides dipiperazinyl ketones and related analogues. Such compounds may be used in vitro or in vivo, to modulate H3 receptor activity in a variety of contexts. TI R ⁇ T E 6W S 0 B / B9761
  • dipiperazinyl ketones and related analogues encompasses all compounds that satisfy one or more of Formulas I -VII, including any enantiomers, racemates and stereoisomers, and further including pharmaceutically acceptable salts, solvates (e.g., hydrates) and esters of such compounds.
  • a “pharmaceutically acceptable salt” of a compound recited herein is an acid or base salt that is suitable for use in contact with the tissues of human beings or animals without excessive toxicity or carcinogenicity, and preferably without irritation, allergic response, or other problem or complication.
  • Such salts include mineral and organic acid salts of basic residues such as amines, as well as alkali or organic salts of acidic residues such as carboxylic acids.
  • Specific pharmaceutically acceptable salts include, but are not limited to, salts of acids such as hydrochloric, phosphoric, hydrobromic, malic, glycolic, fumaric, sulfuric, sulfamic, sulfanilic, formic, toluenesulfonic, methanesulfonic, benzene sulfonic, camphorsulfonic, ethane disulfonic, 2-hydroxyethylsulfonic, nitric, benzoic, 2- acetoxybenzoic, citric, tartaric, lactic, stearic, salicylic, glutamic, ascorbic, pamoic, succinic, fumaric, maleic, propionic, hydroxymaleic, hydroiodic, phenylacetic, alkanoic such as acetic, HOOC-(CBk) n - COOH where n is 0-4, and the like.
  • acids such as hydrochloric, phosphoric, hydrobromic, malic
  • pharmaceutically acceptable cations include, but are not limited to sodium, potassium, calcium, aluminum, lithium and ammonium.
  • pharmaceutically acceptable salts for the compounds provided herein, including those listed by Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, p. 1418 (1985) or Remington: The Science and Practice of Pharmacy, 21 st ed., Lippincott Williams & Wilkins, Philadelphia, PA (2005).
  • a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, the use of nonaqueous media, such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile, is preferred.
  • nonaqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile, is preferred.
  • II'" « ⁇ » ⁇ ' it i Wi ⁇ l i 'be l 'appalf-ent l 't ⁇ iat elcPc' ⁇ mpound provided herein may, but need not, be formulated as a solvate (e.g., hydrate) or non-covalent complex.
  • prodrugs of the compounds of the recited Formulas are a compound that may not fully satisfy the structural requirements of the compounds provided herein, but is modified in vivo, following administration to a patient, to produce a compound a formula provided herein.
  • a prodrug may be an acylated derivative of a compound as provided herein.
  • Prodrugs include compounds wherein hydroxy, amine or sulfhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxy, amino, or sulfhydryl group, respectively.
  • prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups within the compounds provided herein.
  • Prodrugs of the compounds provided herein may be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved in vivo to yield the parent compounds.
  • alkyl refers to a straight or branched chain saturated aliphatic hydrocarbon.
  • Alkyl groups include, for example, groups having from 1 to 8 carbon atoms (Cp C 8 alkyl), from 1 to 6 carbon atoms (C 1 -C 6 alkyl) and from 1 to 4 carbon atoms (C 1 -C 4 alkyl), such as methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl and 3-methylpentyl.
  • Co-C 4 alkyl refers to a single covalent bond or a C 1 - C 4 alkyl group.
  • alkylene refers to a divalent alkyl group.
  • C 1 -C 4 alkylene is an alkylene group having from 1 to 4 carbon atoms.
  • Co-C 4 alkylene is a single covalent bond or an alkylene group having from 1 to 4 carbon atoms.
  • Alkenyl refers to straight or branched chain alkene groups. Alkenyl groups include, for example, C 2 -C 8 alkenyl, C 2 -C 6 alkenyl and C 2 -C 4 alkenyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively, such as ethenyl, allyl or isopropenyl.
  • Alkynyl refers to straight or branched chain alkyne groups, which have one or more unsaturated carbon-carbon bonds, at least one of which is a triple bond.
  • Alkynyl groups include C 2 -C 8 alkynyl, C 2 -C 6 alkynyl and C 2 -C 4 alkynyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively.
  • a “cycloalkyl” is a group that comprises one or more saturated and/or partially saturated rings in which all ring members are carbon, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, adamantyl, decahydro-naphthalenyl, octahydro-indenyl, and partially saturated variants of the foregoing, such as cyclohexenyl. Cycloalkyl groups do not comprise an aromatic ring or a heterocyclic ring.
  • a "(C 3 -C 8 cycloalkyl)Co-C 4 alkyl” is a C 3 -C 3 cycloalkyl group linked via a single covalent bond or a C 1 -C 4 alkylene group.
  • alkoxy as used herein, is meant an alkyl group attached via an oxygen bridge. Alkoxy groups include, for example, CpC 8 alkoxy and C 1 -C 4 alkoxy groups, which have from 1 to 8 or 1 to 4 carbon atoms, respectively.
  • alkoxy groups 3-methylpentoxy are specific alkoxy groups.
  • alkylthio refers to an alkyl group attached via a sulfur bridge.
  • Alkanoyl groups have the indicated number of carbon atoms, with the carbon of the keto group being included in the numbered carbon atoms.
  • Alkanoyl groups include, for example, C 2 -C 8 alkanoyl, C 2 - C 6 alkanoyl and C 2 -C 4 alkanoyl groups, which have from 2 to 8, from 2 to 6 or from 2 to 4 carbon atoms, respectively.
  • alkyl ether refers to a linear or branched ether substituent ⁇ i.e., an alkyl group that is substituted with an alkoxy group).
  • Alkyl ether groups include C 2 -C 8 alkyl ether, C 2 -C 6 alkyl ether and C 2 -C 4 alkyl ether, which have 2 to 8, 6 or 4 carbon atoms, respectively.
  • a C 2 alkyl ether has the structure -CH 2 -O-CH 3 .
  • Alkoxycarbonyl groups include, for example, C 1 -C 8 , C 1 -C 6 and Ci ⁇ alkoxycarbonyl groups, which have from 1 to 8, 6 or 4 carbon atoms, respectively, in the alkyl portion of the group ⁇ i.e., the carbon of the keto bridge is not included in the indicated number of carbon atoms).
  • Alkylamino refers to a secondary or tertiary amine having the general structure -NH-alkyl or -N(alkyl)(alkyl), wherein each alkyl may be the same or different.
  • groups include, for example, mono- and di-(C 1 -C 6 alkyl)amino groups, in which each alkyl may be the same or different and may contain from 1 to 6 carbon atoms, as well as mono- and di-(C 1 -C 4 alkyl)amino groups.
  • Alkylaminoalkyl refers to an alkylamino group linked via an alkylene group ⁇ i.e., a group having the general structure -alkyl-NH-alkyl or -alkyl-N(alkyl)(alkyl)) in which each alkyl is selected independently.
  • alkyl is selected independently.
  • groups include, for example, mono- and di-(C 1 -C 6 alkyl)aminoC 1 - C 6 alkyl and mono- and di-(C 1 -C e alkyl)aminoC 1 -C 4 alkyl, in which each alkyl may be the same or different.
  • “Mono- or di-(C 1 -C 6 alkyl)aminoC 0 -C 4 alkyl” refers to a mono- or di-(C 1 -C 6 alkyI)amino group linked via a direct bond or a C 1 -C 4 alkylene group.
  • halogen refers to fluorine, chlorine, bromine or iodine.
  • haloalkyl is an alkyl group that is substituted with 1 or more halogen atoms ⁇ e.g., "Cr C 4 haloalkyl” groups have from 1 to 4 carbon atoms).
  • haloalkyl groups include, but are not limited to, mono-, di- or tri-fluoromethyl; mono-, di- or tri-chloromethyl; mono-, di-, tri-, tetra- or penta-fluoroethyl; mono-, di-, tri-, tetra- or penta-chloroethyl; and 1,2,2,2-tetrafluoro-l- trifluoromethyl-ethyl.
  • Typical haloalkyl groups are trifluoromethyl and difluoromethyl.
  • haloalkoxy refers to a haloalkyl group as defined above attached via an oxygen bridge.
  • Cr C 4 haloalkoxy groups have 1 to 4 carbon atoms.
  • a dash (“-") that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -CONH 2 is attached through the carbon atom.
  • a “carbocycle” or “carbocyclic group” comprises at least one ring formed entirely by carbon- carbon bonds (referred to herein as a carbocyclic ring), and does not contain a heterocycle. Unless otherwise specified, each ring within a carbocycle may be independently saturated, partially saturated or aromatic, and is optionally substituted as indicated.
  • a carbocycle generally has from 1 to 3 fused, pendant or spiro rings; carbocycles within certain embodiments have one ring or two fused rings.
  • each ring contains from 3 to 8 ring members ⁇ i.e., C 3 -C 8 ); C 5 -C 7 rings are recited in certain embodiments.
  • Carbocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members.
  • Certain representative carbocycles are cycloalkyl as described above.
  • Other carbocycles are aryl ⁇ i.e., contain at least one aromatic carbocyclic ring, with or without one or more additional aromatic and/or cycloalkyl rings).
  • Such aryl carbocycles include, for example, phenyl, naphthyl ⁇ e.g., 1-naphthyl and 2-naphthyl), fluorenyl, indanyl and 1,2,3,4-tetrahydro-naphthyl.
  • carbocycles recited herein are (C 3 -Ciocarbocycle)Co-C 4 alkyl groups ⁇ i.e., groups in which a 3- to 10-membered carbocyclic group is linked via a single covalent bond or a C 1 -C 4 alkylene group).
  • groups include, for example, phenyl, indanyl and cycloalkyl groups such as hexyl and pentyl, as well as groups in which either of the foregoing is linked via C 1 -C 4 alkylene, preferably via C 1 -C 2 alkylene.
  • Phenyl groups linked via a single covalent bond or C 1 -C 2 alkylene group are designated phenylCo-C 2 alkyl ⁇ e.g., benzyl, 1-phenyl-ethyl and 2-phenyl-ethyl).
  • phenylC 0 - C 2 alkoxy refers to phenyl groups linked via an oxygen atom (phenoxy groups) or via a C 1 -C 2 alkoxy moiety, in which the point of attachment is the oxygen atom ⁇ e.g., benzyloxy).
  • a “heterocycle” or “heterocyclic group” has from 1 to 3 fused, pendant or spiro rings, at least one of which is a heterocyclic ring ⁇ i.e., one or more ring atoms is a heteroatom independently chosen from O, S and N, with the remaining ring atoms being carbon). Additional rings, if present, may be heterocyclic or carbocyclic. Typically, a heterocyclic ring comprises 1, 2, 3 or 4 each heterocyclic ring has 1 or 2 heteroatoms per ring.
  • Each heterocyclic ring generally contains from 3 to 8 ring members (rings having from 4 or 5 to 7 ring members are recited in certain embodiments) and heterocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members.
  • Certain heterocycles comprise a sulfur atom as a ring member; in certain embodiments, the sulfur atom is oxidized to SO or SO 2 .
  • Heterocycles may be optionally substituted with a variety of substituents, as indicated.
  • a heterocycle may be a heterocycloalkyl group ⁇ i.e., each ring is saturated or partially saturated) or a heteroaryl group ⁇ i.e., at least one ring within the group is aromatic), such as a 5- to 10-membered heteroaryl (which may be monocyclic or bicyclic) or a 6-membered heteroaryl ⁇ e.g., pyridyl or pyrimidyl).
  • N-linked heterocyclic groups are linked via a component nitrogen ring atom.
  • Heterocyclic groups include, for example, azepanyl, azocinyl, benzimidazolyl, benzimidazolinyl, benzisothiazolyl, benzisoxazolyl, benzofuranyl, benzothiofuranyl, benzoxazolyl, benzothiazolyl, benztetrazolyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolinyl, dihydrofuro[2,3-b]tetrahydrofuranyl, dihydroisoquinolinyl, dihydrotetrahydrofuranyl, 1 ,4-dioxa-8- aza-spiro[4.5]decyl, dithiazinyl, furanyl, furazanyl, imidazolinyl, imidazolidinyl, imidazolyl, indazolyl, indolenyl, indolinyl
  • heterocyclic groups are optionally linked via an alkylene moiety.
  • a "(4- to 14-membered heterocycle)Co-C 2 alkyl” is a heterocycle that contains from 4 to 14 ring members and is linked via a single covalent bond or a C r C 2 alkylene.
  • a (3- to 10-membered heterocycloalkyl)C 0 -C 4 alkyl is a heterocycloalkyl group having from 3 to 10 ring members linked via a single covalent bond or an alkylene group having from 1 to 4 carbon atoms.
  • “(5- to 10- membered heteroaryl)Co-C 4 alkyl” refers to a heteroaryl group linked via a direct bond or C 1 - C 4 alkylene group.
  • a “substituent,” as used herein, refers to a molecular moiety that is covalently bonded to an atom within a molecule of interest.
  • a “ring substituent” may be a moiety such as a halogen, alkyl group, haloalkyl group or other group discussed herein that is covalently bonded to an atom (preferably a carbon or nitrogen atom) that is a ring member.
  • substitution refers to replacing a hydrogen atom in a molecular structure with a substituent as described above, such that exceeded, and such that a chemically stable compound (i.e., a compound that can be isolated, characterized, and tested for biological activity) results from the substitution.
  • Groups that are "optionally substituted” are unsubstituted or are substituted by other than hydrogen at one or more available positions, typically 1, 2, 3, 4 or 5 positions, by one or more suitable groups (which may be the same or different).
  • Optional substitution is also indicated by the phrase
  • substituted with from 0 to X substituents where X is the maximum number of permissible substituents.
  • Certain optionally substituted groups are substituted with from 0 to 2, 3 or 4 independently selected substituents (i.e., are unsubstituted or substituted with up to the recited maximum number of substituents).
  • H3 receptor is used herein to refer to any histamine H3 subtype receptor, including human H3 receptor (see, e.g., U.S. Patent No. 6,136,559), H3 receptor found in other mammals and chimeric receptors retaining H3 function, including the chimeric H3 receptor provided herein as SEQ ID NO: 8.
  • a "H3 receptor modulator,” also referred to here'in as a “modulator,” is a compound that modulates H3 receptor GTP binding.
  • a H3 receptor modulator may be a H3 receptor agonist or antagonist.
  • a modulator binds with "high affinity" if the K; at H3 receptor is less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar.
  • a representative assay for evaluating an effect on H3 receptor GTP binding is provided in Example 7, herein.
  • IC 50 and “EC 5 O,” as used herein, refer to values obtained using the assay as described in Example 7.
  • a modulator is considered an "antagonist" if it detectably inhibits H3 receptor agonist- stimulated GTP binding (using, for example, the representative assay provided in Example 7); in general, such an antagonist inhibits such GTP binding with a IC 50 value of less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar.
  • H3 receptor antagonists include neutral antagonists and inverse agonists.
  • An "inverse agonist" of H3 receptor is a compound that reduces the GTP binding activity of
  • H3 receptor below its basal activity level in the absence of added agonist. Inverse agonists of H3 receptor may also inhibit the activity in the presence of agonist.
  • the basal activity of H3 receptor, as well as the reduction in H3 receptor GTP binding activity due to the presence of H3 receptor antagonist, may be determined using the assay of Example 7.
  • a "neutral antagonist" of H3 receptor is a compound that inhibits the activity of H3 receptor agonist, but does not significantly change the basal activity of the receptor (i.e., within the assay of Example 7 performed in the absence of agonist, H3 receptor activity is reduced by no more than 10%, preferably by no more than 5%, and more preferably by no more than 2%; most preferably, there is no detectable reduction in activity).
  • the basal activity is the level of GTP binding observed in the assay . .,., . , strictly irf ' thV absenee 1 W-Maed 'Kis ⁇ M ⁇ rfS 1 * any other agonist, and in the further absence of any test compound.
  • Neutral antagonists of H3 receptor may, but need not, inhibit the binding of agonist to H3 receptor.
  • H3 receptor agonist is a compound that elevates the activity of the receptor above the basal activity level of the receptor.
  • H3 receptor agonist activity may be identified using the representative assay provided in Example 7. In general, such an agonist has an EC 50 value of less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar within the assay provided in Example 7. If the GTP binding activity brought about by a test compound attains the same level to that of histamine, it is defined as a full agonist. If the level of GTP binding activity brought about by a test compound is above baseline but below the level attained by histamine, it is defined as a partial agonist. Preferred antagonist compounds provided herein do not elevate GTP binding activity under such conditions more than 10% above baseline, preferably not more than 5% above baseline, and most preferably not more than 2% above baseline.
  • a “therapeutically effective amount” is an amount that, upon administration to a patient, results in a discernible patient benefit (e.g., provides detectable relief from a condition being treated). Such relief may be detected using any appropriate criteria, including alleviation of one or more symptoms characteristic of the condition.
  • a therapeutically effective amount or dose generally results in a concentration of compound in a body fluid (such as blood, plasma, serum, CSF, synovial fluid, lymph, cellular interstitial fluid, tears or urine) that is sufficient to alter H3 receptor GTP binding in vitro.
  • a “patient” is any individual treated with a compound or pharmaceutically acceptable salt thereof provided herein.
  • Patients include humans, as well as other animals such as companion animals (e.g., dogs and cats) and livestock. Patients may be experiencing one or more symptoms of a condition responsive to H3 receptor modulation, or may be free of such symptom(s) (e.g., treatment may be prophylactic).
  • dipiperazinyl ketones and related analogues of Formulas I- VII including the pharmaceutically acceptable salts, solvates and esters of such compounds.
  • dipiperazinyl ketones and related analogues provided herein are H3 receptor modulators that may be used in a variety of contexts, including in the therapeutic treatment of human and animal patients as discussed below. H3 receptor modulators may also be used within in vitro assays (e.g., assays for receptor activity), and as probes for detection and localization of H3 receptor.
  • R 3 and R 4 are independently hydrogen or methyl; within further such compounds, W is CR 3 R 4 .
  • the variable "W" is NR 5 ; within certain such compounds R 5 is hydrogen or methyl.
  • R 2 and R 7 independently represent 0 substituents or 1 or 2 methyl substituents.
  • R 2 represents 0 substituents or 1 or 2 methyl substituents, and wherein R 7 represents two substituents that are taken together to form a C 1 -C 3 alkylene bridge.
  • R 1 is C 3 -C 6 alkyl, C 3 -C 6 alkenyl, or C 3 - C 7 cycloalkyl)Co-C 2 alkyl (e.g., cyclobutyl, cyclopentyl or cyclohexyl); in certain embodiments, Ri is isopropyl, cyclobutyl, cyclopentyl or cyclohexyl; in further embodiments, Ri is cyclobutyl, cyclopentyl or cyclohexyl.
  • variable "m" in Formulas II-VII is 0, 1 or 2; in certain embodiments, m is 1, resulting in a 6-membered, optionally substituted piperazine or piperidine ring.
  • each q is independently 0, 1 or 2. If each q is 0, the resulting ring is 4-membered; preferably no more than one of Z 2 and Z 3 is N in such cases, resulting in an azetidine ring. It will be apparent that both represent a single bond if both "q" variables are 0.
  • the resulting ring is 5-membered (e.g., cyclopentyl, pyrrolidinyl, imidazolidinyl, dihydropyrrolyl or dihydroimidazolyl). In certain embodiments, both represent a single bond. In further embodiments, exactly one of Z 2 and Z 3 is N (e.g., resulting in an optionally substituted pyrrolidine ring).
  • both q variables are 1, the resulting ring is 6-membered (e.g., cyclohexyl, piperidinyl, piperazinyl, tetrahydropyridinyl or tetrahydropyrazinyl). In certain embodiments, both represent a single bond.
  • one q is 1 and the other q is 0, 1 or 2.
  • the variables Zi (of Formulas II, III, V and VI) and Z 2 (of Formulas II-VII) are independently nitrogen or CR 3 .
  • Zj and Z 2 are independently N or CH.
  • W is NR 5
  • Z 2 is CR a .
  • Z 3 is CR b .
  • Z 2 is N and Z 3 is CR b .
  • the variable R 6 is C 1 -C 6 alkyl, C 1 - C 6 alkenyl, d-C 6 alkynyl, C 1 -C 6 aminoalkyl, C 1 -C 6 alkanoyl, C 1 -C 6 alkoxycarbonyl, mono- or di-(C 1 C 6 alkyl)aminoC 0 -C 4 alkyl, (C 3 -C 7 cycloalkyl)C 0 -C 4 alkyl, (3- to 7-membered heterocycloalkyl)C 0 -C 4 alkyl, phenylC 0 -C 4 alkyl, naphthylC 0 -C 4 alkyl or (5- to 10-
  • R 6 groups include, for example, C 1 -C 8 alkyl, C 2 -C 3 alkenyl, C 2 -C 8 alkynyl,
  • Re groups further satisfy the formula Y-(NRio) p -L-, wherein: Y is phenyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C 1 -C 4 alkyl, C 1 -C 4 alkoxy, C 1 - C 4 haloalkyl, C 1 -C 4 alkanoyl and phenyl, each of which is substituted with from 0 to 2 substituents independently chosen from C 1 -Qalkyl; p is 0 or 1; R ]0 is hydrogen, methyl or ethyl; and L is absent or C 1 -C 4 alkylene that is optionally substituted with oxo or phenyl.
  • R 6 is phenyl, piperazinyl, piperidinyl, pyridyl or cyclohexyl, each of which is substituted with a group of the formula D-X-E-.
  • Representative such groups include, for example, those in which D is a 5- or 6-membered heteroaryl (e.g., pyridyl or oxadiazolyl) that is unsubstituted or substituted with methyl;
  • X is absent, O, CO, SO 2 , OCH 2 or CH 2 O; and E is absent.
  • R 6 is phenyl substituted with D-X-E, wherein X and E are absent and D is 3-methyl- 1,2,4-oxadiazolyl, then R 6 is:
  • R 6 groups include those listed above, linked via a carbonyl, such as:
  • variable R 6 is phenyl that is fused to a 5- or 6-membered ring that is optionally substituted (e.g., unsubstituted or substituted with oxo).
  • R H is hydrogen or C 1 -C 4 alkyl; or R 13 is taken together with R 14 to form a 5- to 10-membered heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo and C 1 -C 4 alkyl.
  • spiro 4- to 7-membered heterocycloalkyl that is: (i) substituted with from 0 to 2 substituents independently chosen from: (a) oxo; and (b) C 1 -C 6 alkyl, C 1 -C 6 alkoxy, (C 3 - C 7 cycloalkyl)C 0 -C 2 alkyl, phenylC 0 -C 2 alkyl and (5-or 6-membered heterocycle)C 0 -C 2 alkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, C 1 - Qalkyl and C 1 -C 4 alkoxy; and (ii) optionally fused to phenyl or 6-membered heteroaryl.
  • P' further satisfy one of the following subformulas, in which the variables are as described above:
  • Rn and Ri 2 are independently chosen from C 1 -C 6 alkyl, (C 3 -C 8 cycloalkyl)Co-C 2 alkyl and phenylC 1 -C 4 alkyl, or Rn and Rj 2 are taken together to form a 5- to 7-membered heterocycloalkyl that is substituted with from 0 to 2 substituents independently chosen from C 1 -C 4 alkyl.
  • dipiperazinyl ketones and related analogues are H3 receptor modulators, as determined using an assay for H3 receptor GTP binding.
  • references herein to an "assay for H3 receptor GTP binding" are intended to refer to a standard in vitro GTP binding assay such as that provided in Example 7, which may be performed in the presence or absence of added agonist.
  • the assay is referred to as an "assay for H3 receptor agonist-stimulated GTP binding.”
  • a H3 receptor preparation is incubated with a H3 receptor agonist (e.g., histamine or an analogue thereof such as R-alpha-methyhistamine), labeled (e.g., 35 S) GTP and unlabeled test compound.
  • a H3 receptor agonist e.g., histamine or an analogue thereof such as R-alpha-methyhistamine
  • labeled e.g. 35 S
  • the H3 receptor used is preferably mammalian H3 receptor (e.g., human or rat H3 receptor or a chimeric human H3 receptor such as a receptor having the sequence provided in SEQ ID NO:8, and the receptor may be recombinantly expressed or naturally expressed.
  • the H3 receptor preparation may be, for example, a membrane preparation from cells that recombinantly express H3 receptor. Incubation with an H3 receptor modulator results in a decrease or increase in the amount of label bound to the H3 receptor preparation, relative to the amount of label bound in the absence of the compound. This decrease or increase may be used to determine whether the compound functions as an agonist or antagonist, and to determine the Kj at H3 receptor as described herein.
  • H3 receptor antagonists are preferred within certain embodiments.
  • the response is generally reduced by at least 20%, preferably at least 50% and more preferably at least 80%, as compared to cells that are contacted with the agonist in the absence of test compound.
  • the IC 50 for H3 receptor antagonists provided herein is preferably less than 4 m ⁇ &ttlar, than 50OnM, less than 100 nM, less than 50 nM or less than
  • H3 receptor antagonists provided herein exhibit no detectable agonist activity in an in vitro assay of H3 receptor agonism at a concentration of compound equal to the IC 50 . Certain such antagonists exhibit no detectable agonist activity an in vitro assay of H3 receptor agonism at a concentration of compound that is 100-fold higher than the IC 50 .
  • preferred H3 receptor modulators provided herein are non-sedating.
  • a dose of H3 receptor modulator that is twice the minimum therapeutically effective dose causes only transient ⁇ i.e., lasting for no more than 1 A the time that the therapeutic effect lasts) or preferably no statistically significant sedation in an animal model assay of sedation (using the method described by Fitzgerald et al. (1988) Toxicology 49(2-3):433-9).
  • a dose that is from 5 to 100 times the minimum therapeutically effective dose does not produce statistically significant sedation.
  • a H3 receptor modulator does not produce sedation at oral doses of less than 140 mg/kg (preferably less than 50 mg/kg, more preferably less than 30 mg/kg).
  • H3 receptor modulators provided herein may be evaluated for certain pharmacological properties including, but not limited to, oral bioavailability (preferred compounds are orally bioavailable to an extent allowing for therapeutically effective concentrations of the compound to be achieved at oral doses of less than 140 mg/kg, preferably less than 50 mg/kg, more preferably less than 30 mg/kg, even more preferably less than 10 mg/kg, and still more preferably less than 1 mg/kg), toxicity (a preferred H3 receptor modulator is nontoxic when a therapeutically effective amount is administered to a subject), side effects (a preferred H3 receptor modulator produces side effects comparable to placebo when a therapeutically effective amount of the compound is administered to a subject), serum protein binding and in vitro and in vivo half-life (a preferred H3 receptor modulator exhibits an in vivo half-life allowing for Q.I.D.
  • oral bioavailability preferred compounds are orally bioavailable to an extent allowing for therapeutically effective concentrations of the compound to be achieved at oral doses of less than 140 mg/kg
  • T.I.D. dosing preferably T.I.D. dosing, more preferably B.I.D. dosing, and most preferably once-a-day dosing).
  • differential penetration of the blood brain barrier may be desirable for certain H3 receptor modulators.
  • Routine assays that are well known in the art may be used to assess these properties, and identify superior compounds for a particular use.
  • assays used to predict bioavailability include transport across human intestinal cell monolayers, including Caco-2 cell monolayers.
  • Penetration of the blood brain barrier of a compound in humans may be predicted from the brain levels of the compound in laboratory animals given the compound (e.g., intravenously).
  • Serum protein binding may be predicted from albumin binding assays or whole serum binding assays.
  • Compound half-life is inversely proportional to the frequency of dosage of a compound. In vitro half-lives of compounds may be predicted from assays of microsomal half-life as described within Example 9, herein.
  • nontoxic compounds are nontoxic.
  • the term "nontoxic” as used herein shall be understood in a relative sense and is intended to refer to any substance that has been approved by the United States Food and Drug Administration (“FDA”) for administration to mammals (preferably humans) or, in keeping with established criteria, is susceptible ⁇ iktration to mammals (preferably humans).
  • FDA United States Food and Drug Administration
  • a highly preferred nontoxic compound generally satisfies one or more of the following criteria: (1) does not substantially inhibit cellular ATP production; (2) does not significantly prolong heart QT intervals; (3) does not cause substantial liver enlargement, and/or (4) does not cause substantial release of liver enzymes.
  • a compound that does not substantially inhibit cellular ATP production is a compound that satisfies the criteria set forth in Example 10, herein.
  • cells treated as described in Example 10 with 100 ⁇ M of such a compound exhibit ATP levels that are at least 50% of the ATP levels detected in untreated cells.
  • such cells exhibit ATP levels that are at least 80% of the ATP levels detected in untreated cells.
  • a compound that does not significantly prolong heart QT intervals is a compound that does not result in a statistically significant prolongation of heart QT intervals (as determined by electrocardiography) in guinea pigs, minipigs or dogs upon administration of a dose that yields a serum concentration equal to the EC 50 or IC50 for the compound.
  • a dose of 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally does not result in a statistically significant prolongation of heart QT intervals.
  • statically significant is meant results varying from control at the p ⁇ 0.1 level or more preferably at the p ⁇ 0.05 level of significance as measured using a standard parametric assay of statistical significance such as a student's T test.
  • a compound does not cause substantial liver enlargement if daily treatment of laboratory rodents (e.g., mice or rats) for 5-10 days with a dose that yields a serum concentration equal to the EC 50 or IC 50 for the compound results in an increase in liver to body weight ratio that is no more than 100% over matched controls. In more highly preferred embodiments, such doses do not cause liver enlargement of more than 75% or 50% over matched controls. If non-rodent mammals (e.g., dogs) are used, such doses should not result in an increase of liver to body weight ratio of more than 50%, preferably not more than 25%, and more preferably not more than 10% over matched untreated controls. Preferred doses within such assays include 0.01, 0.05. 0.1, 0.5, 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally.
  • a compound does not promote substantial release of liver enzymes if administration of twice the minimum dose that yields a serum concentration equal to the EC 50 or IC 50 for the compound does not elevate serum levels of ALT, LDH or AST in laboratory rodents by more than 100% over matched mock-treated controls. In more highly preferred embodiments, such doses do not elevate such serum levels by more than 75% or 50% over matched controls.
  • a H3 receptor modulator does not promote substantial release of liver enzymes if, in an in vitro hepatocyte assay, concentrations (in culture media or other such solutions that are contacted and incubated with hepatocytes in vitro) that are equal to the EC 50 or IC 50 for the compound do not cause detectable release of any such liver enzymes into culture medium above baseline levels seen in media from matched mock-treated control cells. In more highly preferred embodiments, there is no detectable ,, administrat, f , , .
  • certain preferred compounds do not inhibit or induce microsomal cytochrome P450 enzyme activities, such as CYP1A2 activity, CYP2A6 activity, CYP2C9 activity, CYP2C19 activity, CYP2D6 activity, CYP2E1 activity or CYP3A4 activity at a concentration equal to the EC 50 or IC 50 for the compound.
  • microsomal cytochrome P450 enzyme activities such as CYP1A2 activity, CYP2A6 activity, CYP2C9 activity, CYP2C19 activity, CYP2D6 activity, CYP2E1 activity or CYP3A4 activity at a concentration equal to the EC 50 or IC 50 for the compound.
  • Certain preferred compounds are not clastogenic (e.g., as determined using a mouse erythrocyte precursor cell micronucleus assay, an Ames micronucleus assay, a spiral micronucleus assay or the like) at a concentration equal the EC 50 or IC 50 for the compound.
  • certain preferred H3 receptor modulators do not induce sister chromatid exchange (e.g., in Chinese hamster ovary cells) at such concentrations.
  • H3 receptor modulators provided herein may be isotopically-labeled or radiolabeled.
  • compounds may have one or more atoms replaced by an atom of the same element having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes that can be present in the compounds provided herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 35 S, 18 F and 36 Cl.
  • substitution with heavy isotopes such as deuterium (i.e., 2 H) can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances.
  • Conversion of 8 to N-substituted 4-piperidinyl acetate 9 may be achieved by well established protocols based on the nature of the R 6 group.
  • R 6 is an aryl or heteroaryl group
  • compound 9 may be prepared via the reaction of 8 and an aryl or heteroaryl halide under standard nucleophilic substitution conditions (in presence of potassium carbonate in DMSO) or under standard palladium coupling conditions.
  • Re acyl
  • compound 9 may be prepared from the amidation of 8 with a carboxylic acid or an acyl chloride.
  • the corresponding carboxylic acid 10 may be achieved via the hydrolysis of compound 9 in the presence of lithium hydroxide.
  • Amidation of 10 with amine 2 and an appropriate coupling reagent such as BOP furnishes compound 11.
  • Compounds of formula 30 may be prepared in accordance with Scheme 6.
  • Amine 5 reacts with 2-bromo-l-(4-pyridinyl)-l-ethanone hydrobromide in the presence of potassium carbonate to give compound 28, which is hydrogenated with H 2 and a catalyst such as platinum oxide to furnish compound 29.
  • the R 2 -substituted amino- l-piperidin-4-yl-ethanone 30 is obtained by reductive amination of 29 with an appropriate ketone (or aldehyde) and sodium triacetoxyborohydride.
  • R 3 , R 4 , Re, R 7 , X, Y, and m are as defined above.
  • Cyclization of compound 34 with Pd catalyst and deprotection of the resulting compound 35 provides the desired compound 36, which is hydrogenated to give compound 37.
  • Spiro cyclic amine 37 is reacted with ⁇ -halo-carboxamide 3 in the presence of a base such as potassium carbonate to produce compound 38, which is treated with Pd catalyst to produce compound 39.
  • Treatment of 47 with aryl halide in the presence of CuI and K3PO 4 provides 48 and alkylation of 47 with an alkyl halide in the presence of a base such as cesium carbonate produces 49.
  • Compound 50 is prepared by reacting 45 and 2 in the presence of p-nitrophenyl chloroformate essentially as described by Yoon et al. (1996) Org. Proc. Int. 28(2): 173-177.
  • V, W, Y and Z are independently N or CR 60 Scheme 1 QB
  • Schemes 1OA and 1OB illustrate the synthesis of compounds 58 and 60.
  • compound 60 is used as a key intermediate for modification as illustrated in the following Schemes.
  • Reaction of 3 and 55 in the presence of a base such as potassium carbonate affords 56.
  • Deprotection of 56 and the amidation of the resulting compound 57 with a carboxylic acid or carboxylic acid chloride give 58.
  • the reaction of 57 with 59 such as dichloropyridazine, dihalopyridine, dihalobenzene, dihalopyrazine or other mono halo substituted aryl intermediates provides 60.
  • 60 may be prepared by the reaction of 61 and 3 in the presence of a base such as potassium carbonate.
  • Scheme 11 illustrates the synthesis of compounds 62-67.
  • 60 is converted to 62 by a palladium-catalyzed coupling reaction, such as Suzuki coupling, Negishi coupling or Stille coupling.
  • Compound 60 undergoes nucleophilic substitution or palladium-catalyzed coupling reaction with an appropriate sodium alkoxide or amine to afford 63 or 64.
  • Conversion of 60 to nitrile 65 is achieved by the reaction with Zn(CN) 2 under Negishi reaction conditions.
  • Hydrolysis of 65 provides acid 66, which is further transformed to amide 67 upon coupling with an appropriate amine in the presence of a coupling reagent such as BOP,
  • Scheme 12 illustrates the synthesis of compounds 71-76.
  • the reaction of 57 with 69 e.g., dichloropyridazine, dihalopyridine, dihalobenzene, dihalopyrazine or other mono halo substituted aryl intermediate
  • 70 may be prepared by the reaction of 68 and 3 in the presence of a base such as potassium carbonate.
  • Compound 70 is converted to 71 by palladium- catalyzed coupling, such as Suzuki coupling, Negishi coupling or Stille coupling.
  • Compound 70 undergoes nucleophilic substitution or palladium-catalyzed coupling reaction with an appropriate sodium alkoxide or amine to afford 72 or 73.
  • a compound provided herein may contain one or more asymmetric carbon atoms, so that the compound can exist in different stereoisomer ⁇ forms.
  • Such forms can be, for example, racemates or optically active forms.
  • All stereoisomers are encompassed by the present invention. Nonetheless, it may be desirable to obtain single enantiomers (i.e., optically active forms).
  • Standard methods for preparing single enantiomers include asymmetric synthesis and resolution of the racemates. Resolution of the racemates can be accomplished, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography using, for example a chiral HPLC column.
  • Compounds may be radiolabeled by carrying out their synthesis using precursors comprising at least one atom that is a radioisotope.
  • Each radioisotope is preferably carbon (e.g., 14 C), hydrogen (e.g., 3 H), sulfur (e.g., 35 S) or iodine (e.g., 125 I).
  • Tritium labeled compounds may also be prepared catalytically via platinum-catalyzed exchange in tritiated acetic acid, acid-catalyzed exchange in tritiated trifluoroacetic acid, or heterogeneous-catalyzed exchange with tritium gas using the compound as substrate.
  • certain precursors may be subjected to tritium-halogen exchange with tritium gas, tritium gas reduction of unsaturated bonds, or reduction using sodium borotritide, as appropriate.
  • Preparation of radiolabeled compounds may be conveniently performed by a radioisotope supplier specializing in custom synthesis of radiolabeled probe compounds.
  • compositions comprising one or more dipiperazinyl ketone or related analogue provided herein, together with at least one physiologically acceptable carrier or excipient.
  • Pharmaceutical compositions may comprise, for example, water, buffers (e.g., neutral buffered saline or phosphate buffered saline), ethanol, mineral oil, vegetable oil, dimethylsulfoxide, carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, adjuvants, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione and/or preservatives.
  • Preferred pharmaceutical compositions are formulated for oral delivery to humans or other animals (e.g., companion animals such as dogs or cats).
  • other active ingredients may (but need not) be included in the pharmaceutical compositions provided herein.
  • compositions may be formulated for any appropriate manner of administration, including, for example, inhalation (e.g., nasal or oral), topical, oral, nasal, rectal or parenteral administration.
  • parenteral as used herein includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, spinal, intracranial, intrathecal and intraperitoneal injection, as well as any similar injection or infusion technique.
  • compositions in a form suitable for oral use are preferred. Such forms include, for example, tablets, tiwwies, lozenges; 1 dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • compositions of the present invention may be formulated as a lyophilizate.
  • compositions intended for oral use may further comprise one or more components such as sweetening agents, flavoring agents, coloring agents and/or preserving agents in order to provide appealing and palatable preparations.
  • Tablets contain the active ingredient in admixture with physiologically acceptable excipients that are suitable for the manufacture of tablets.
  • excipients include, for example, inert diluents to increase the bulk weight of the material to be tableted ⁇ e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate), granulating and disintegrating agents that modify the disintegration rate in the environment of use (e.g., corn starch, starch derivatives, alginic acid and salts of carboxymethylcellulose), binding agents that impart cohesive qualities to the powdered material(s) (e.g., starch, gelatin, acacia and sugars such as sucrose, glucose, dextrose and lactose) and lubricating agents (e.g., magnesium stearate, calcium stearate, stearic acid or talc). Tablets may be formed using standard techniques, including dry granulation, direct compression and wet granulation. The tablets may be uncoated or they may be coated by known techniques.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil).
  • an inert solid diluent e.g., calcium carbonate, calcium phosphate or kaolin
  • an oil medium e.g., peanut oil, liquid paraffin or olive oil
  • Aqueous suspensions comprise the active material(s) in admixture with one or more suitable excipients, such as suspending agents (e.g., sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); and dispersing or wetting agents (e.g., naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate).
  • suspending agents e.g
  • Aqueous suspensions may also comprise one or more preservatives, such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • Oily suspensions may be formulated by suspending the active ingredients in a vegetable oil (e.g., arachis oil, olive oil, sesame oil or coconut oil) or in a mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents and/or flavoring agents may be added to provide palatable oral preparations.
  • Such suspensions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives.
  • a dispersing or wetting agent and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweetening, flavoring and coloring agents, may also be present.
  • compositions may also be formulated as oil-in-water emulsions.
  • the oily phase may be a vegetable oil (e.g., olive oil or arachis oil), ja mineral oil (e.g., liquid paraffin) or a mixture thereof.
  • Suitable emulsifying agents include naturally-occurring gums (e.g., gum acacia or gum tragacanth), naturally-occurring phosphatides (e.g., soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol), anhydrides (e.g., sorbitan monoleate) and condensation products of partial esters derived from fatty acids and hexitol with ethylene oxide (e.g., polyoxyethylene sorbitan monoleate).
  • An emulsion may also comprise one or more sweetening and/or flavoring agents.
  • Syrups and elixirs may be formulated with sweetening agents, such as glycerol, propylene glycol, sorbitol or sucrose.
  • sweetening agents such as glycerol, propylene glycol, sorbitol or sucrose.
  • Such fo ⁇ nulations may also comprise one or more demulcents, preservatives, flavoring agents and/or coloring agents.
  • a pharmaceutical composition may be prepared as a sterile injectable aqueous or oleaginous suspension.
  • the active ingredient(s), depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle.
  • Such a composition may be formulated according to the known art using suitable dispersing, wetting agents and/or suspending agents such as those mentioned above.
  • suitable dispersing, wetting agents and/or suspending agents such as those mentioned above.
  • the acceptable vehicles and solvents that may be employed are water, 1,3-butanediol, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils may be employed as a solvent or suspending medium.
  • any bland fixed oil may be employed, including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectable compositions, and adjuvants such as local anesthetics, preservatives and/or buffering agents can be dissolved in the vehicle.
  • compositions may also be prepared in the form of suppositories (e.g., for rectal administration).
  • Such compositions can be prepared by mixing the drug with a suitable non- irritating excipient that is solid at ordinary temperatures but liquid at the body temperature and will therefore melt in the body to release the drug.
  • suitable excipients include, for example, cocoa butter and polyethylene glycols.
  • compositions for inhalation typically can be provided in the form of a solution, suspension or emulsion that can be administered as a dry powder or in the form of an aerosol using a conventional propellant (e.g., dichlorodifluoromethane or trichlorofluoromethane).
  • a conventional propellant e.g., dichlorodifluoromethane or trichlorofluoromethane.
  • Pharmaceutical compositions may be formulated for release at a pre-determined rate.
  • Instantaneous release may be achieved, for example, via sublingual administration (i.e., administration by mouth in such a way that the active ingredient(s) are rapidly absorbed via the blood vJssfe unM4fe yrigue ' MtKir-'tl ⁇ -lia the digestive tract).
  • Controlled release formulations i.e., formulations such as a capsule, tablet or coated tablet that slows and/or delays release of active ingredient(s) following administration
  • a controlled release formulation comprises a matrix and/or coating that delays disintegration and absorption in the gastrointestinal tract (or implantation site) and thereby provides a delayed action or a sustained action over a longer period.
  • One type of controlled-release formulation is a sustained-release formulation, in which at least one active ingredient is continuously released over a period of time at a constant rate.
  • the therapeutic agent is released at such a rate that blood (e.g., plasma) concentrations are maintained within the therapeutic range, but below toxic levels, over a period of time that is at least 4 hours, preferably at least 8 hours, and more preferably at least 12 hours.
  • Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site.
  • Carriers for use within such fo ⁇ nulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of modulator release.
  • the amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.
  • Controlled release may be achieved by combining the active ingredient(s) with a matrix material that itself alters release rate and/or through the use of a controlled-release coating.
  • the release rate can be varied using methods well known in the art, including (a) varying the thickness or composition of coating, (b) altering the amount or manner of addition of plasticizer in a coating, (c) including additional ingredients, such as release-modifying agents, (d) altering the composition, particle size or particle shape of the matrix, and (e) providing one or more passageways through the coating.
  • the amount of modulator contained within a sustained release formulation depends upon, for example, the method of administration (e.g., the site of implantation), the rate and expected duration of release and the nature of the condition to be treated or prevented.
  • the matrix material which itself may or may not serve a controlled-release function, is generally any material that supports the active ingredient(s).
  • a time delay material such as glyceryl monosterate or glyceryl distearate may be employed.
  • Active ingredient(s) may be combined with matrix material prior to formation of the dosage form (e.g., a tablet).
  • active ingredient(s) may be coated on the surface of a particle, granule, sphere, microsphere, bead or pellet that comprises the matrix material. Such coating may be achieved by conventional means, such as by dissolving the active ingredient(s) in water or other suitable solvent and spraying.
  • additional ingredients are added prior to coating (e.g., to assist binding of the active ingredient(s) to the matrix material or to color the solution).
  • the matrix may then be coated with a barrier agent prior to application of controlled-release coating.
  • Multiple coated matrix units may, if desired, be encapsulated to generate the final dosage form.
  • release is achieved through the use of a controlled release coating (i.e., a coating that permits release of active ingredient(s) at a controlled rate in aqueous medium).
  • the controlled release coating should be a strong, continuous film that is smooth, capable of supporting pigments and other additives, non-toxic, inert and tack-free.
  • Coatings that regulate release of the modulator include pH-independent coatings, pH-dependent coatings (which may be used to release modulator in the stomach) and enteric coatings (which allow the formulation to pass intact through the stomach and into the small intestine, where the coating dissolves and the contents are absorbed by the body). It will be apparent that multiple coatings may be employed (e.g., to allow release of a portion of the dose in the stomach and a portion further along the gastrointestinal tract). For example, a portion of active ingredient(s) may be coated over an enteric coating, and thereby released in the stomach, while the remainder of active ingredient(s) in the matrix core is protected by the enteric coating and released further down the GI tract.
  • pH dependent coatings include, for example, shellac, cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropylmethylcellulose phthalate, methacrylic acid ester copolymers and zein.
  • the coating is a hydrophobic material, preferably used in an amount effective to slow the hydration of the gelling agent following administration.
  • Suitable hydrophobic materials include alkyl celluloses (e.g., ethylcellulose or carboxymethylcellulose), cellulose ethers, cellulose esters, acrylic polymers (e.g., poly(acrylic acid), poly(methacrylic acid), acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxy ethyl methacrylates, cyanoethyl methacrylate, methacrylic acid alkamide copolymer, poly(methyl methacrylate), polyacrylamide, ammonio methacrylate copolymers, aminoalkyl methacrylate copolymer, poly(methacrylic acid anhydride) and glycidyl methacrylate copolymers) and mixtures of the foregoing.
  • alkyl celluloses e.g., ethylcellulose or carboxymethylcellulose
  • cellulose ethers e.g., ethylcellulose or carboxymethylcellulose
  • Representative aqueous dispersions of ethylcellulose include, for example, AQUACOAT® (FMC Corp., Philadelphia, PA) and SURELEASE® (Colorcon, Inc., West Point, PA), both of which can be applied to the substrate according to the manufacturer's instructions.
  • Representative acrylic polymers include, for example, the various EUDRAGIT® (Rohm America, Piscataway, NJ) polymers, which may be used singly or in combination depending on the desired release profile, according to the manufacturer's instructions.
  • Suitable plasticizers for alkyl celluloses include, for example, dibutyl sebacate, diethyl phthalate, triethyl citrate, tributyl citrate and triacetin.
  • Suitable plasticizers for acrylic polymers include, for example, citric acid esters such as triethyl citrate and tributyl citrate, dibutyl phthalate, polyethylene glycols, propylene glycol, diethyl phthalate, castor oil and triacetin.
  • Controlled-release coatings are generally applied using conventional techniques, such as by spraying in the form of an aqueous dispersion.
  • the coating may comprise pores or channels to facilitate release of active ingredient. Pores and channels may be generated by well known memoas; 1 lnclli ⁇ udig't ⁇ Padd ⁇ i ⁇ 'df Sfealiic or inorganic material that is dissolved, extracted or leached from the coating in the environment of use.
  • pore-forming materials include hydrophilic polymers, such as hydroxyalkylcelluloses (e.g., hydroxypropylmethylcellulose), cellulose ethers, synthetic water-soluble polymers (e.g., polyvinylpyrrolidone, cross-linked polyvinylpyrrolidone and polyethylene oxide), water-soluble polydextrose, saccharides and polysaccharides and alkali metal salts.
  • a controlled release coating may include one or more orifices, which may be formed my methods such as those described in US Patent Nos. 3,845,770; 4,034,758; 4,077,407; 4,088,864; 4,783,337 and 5,071,607.
  • Controlled-release may also be achieved through the use of transdermal patches, using conventional technology (see, e.g., US Patent No. 4,668,232). Further examples of controlled release formulations, and components thereof, may be found, for example, in US Patent Nos. 5,524,060; 4,572,833; 4,587,117; 4,606,909; 4,610,870; 4,684,516; 4,777,049; 4,994,276; 4,996,058; 5,128,143; 5,202,128; 5,376,384; 5,384,133; 5,445,829; 5,510,119; 5,618,560; 5,643,604; 5,891,474; 5,958,456; 6,039,980; 6,143,353; 6,126,969; 6,156,342; 6,197,347; 6,387,394; 6,399,096; 6,437,000; 6,447,796; 6,475,493; 6,491,950; 6,524,615; 6,838,094; 6,
  • a compound provided herein may be conveniently added to food or drinking water (e.g., for administration to non-human animals including companion animals (such as dogs and cats) and livestock).
  • Animal feed and drinking water compositions may be formulated so that the animal takes in an appropriate quantity of the composition along with its diet. It may also be convenient to present the composition as a premix for addition to feed or drinking water.
  • Dosage forms providing dosage levels ranging from about 0.1 mg to about 140 mg per kilogram of body weight per day are preferred (about 0.5 mg to about 7 g per human patient per day).
  • the amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.
  • Dosage unit forms generally contain between from about 0.1 mg to about 2 g, preferably 0.5 mg to 1 g, and more preferably 1 mg to 500 mg, of an active ingredient.
  • Optimal dose for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed; the age, body weight, general health, sex and diet of the patient; the time and route of administration; the rate of excretion; any simultaneous treatment, such as a drug combination; and the type and severity of the particular disease undergoing treatment. Optimal dosages may be established using routine testing and procedures that are well known in the art.
  • compositions may be packaged for , treating conditions responsive to H3 receptor modulation, including those specifically recited herein.
  • Packaged pharmaceutical , , - , ;l , ,,,.,,,,, whatsoever ; strictly ,,., preparations WflpVfsP a 1 donta'lribr ⁇ lofding one or more dosage units comprising a therapeutically effective amount of at least one H3 receptor modulator as described herein and instructions (e.g., labeling) indicating that the contained composition is to be used for treating a condition responsive to H3 receptor modulation in the patient.
  • instructions e.g., labeling
  • H3 receptor modulators provided herein may be used to alter activity and/or activation of H3 receptors in a variety of contexts, both in vitro and in vivo.
  • H3 receptor modulators may be used to inhibit or enhance (preferably to inhibit) H3 receptor activity in vitro or in vivo.
  • such methods comprise the step of contacting a H3 receptor with one or more H3 receptor modulators provided herein, in aqueous solution and under conditions otherwise suitable for binding of the modulator(s) to H3 receptor.
  • the H3 receptor modulator(s) are generally present at a concentration that is sufficient to alter H3 receptor GTP binding activity in vitro (using the assay provided in Example 7).
  • the H3 receptor may be present in solution or suspension (e.g., in an isolated membrane or cell preparation), or in a cultured or isolated cell.
  • the H3 receptor is present in a patient (e.g., expressed by a neuronal cell), and the aqueous solution is a body fluid.
  • one or more H3 receptor modulators are administered to a patient in an amount such that each H3 receptor modulator is present in at least one body fluid of the patient at a therapeutically effective concentration that is 1 micromolar or less; preferably 500 nanomolar or less; more preferably 100 nanomolar or less, 50 nanomolar or less, 20 nanomolar or less, or 10 nanomolar or less.
  • such compounds may be administered at a dose that is less than 20 mg/kg body weight, preferably less than 5 mg/kg and, in some instances, less than 1 mg/kg.
  • modulation of H3 receptor activity may be assessed by detecting an alteration of a symptom (e.g., memory or attention) in a patient being treated with one or more H3 receptor modulators provided herein.
  • the present invention further provides methods for treating conditions responsive to H3 receptor modulation.
  • treatment encompasses both disease-modifying treatment and symptomatic treatment, either of which may be prophylactic (i.e., before the onset of symptoms, in order to prevent, delay or reduce the severity of symptoms) or therapeutic (i.e., after the onset of symptoms, in order to reduce the severity and/or duration of symptoms).
  • a condition is "responsive to H3 receptor modulation” if it is characterized by inappropriate activity of H3 receptor, regardless of the amount of H3 receptor ligand present locally, and/or if modulation of H3 receptor activity results in alleviation of the condition or a symptom thereof.
  • Such conditions may be diagnosed and monitored using criteria that have been established in the art.
  • Patients may include humans, domesticated companion animals and livestock, with dosages as described above.
  • Conditions that are responsive to H3 receptor modulation include, for example: C ⁇ rM ⁇ v ⁇ sd ' ul'kl ''ffis ⁇ rtes, "lhciudi ⁇ g 11 atherosclerosis, hypertension, myocardial infarction, coronary heart disease and stroke; Cancer (e.g., endometrial, breast, prostate and colon cancer, cutaneous carcinoma, medullary thyroid carcinoma and melanoma); Metabolic disorders including impaired glucose tolerance, dyslipidaemia, and diabetes (e.g., non- insulin dependent diabetes mellitus); Immune conditions and disorders including osteoarthritis, allergy (e.g., allergic rhinitis), and inflammation;
  • Respiratory conditions including nasal congestion, upper airway allergic response, asthma and chronic obstructive pulmonary disease
  • Disorders associated with the regulation of sleep and wakefulness, or arousal and vigilance including excessive daytime sleepiness (EDS), shift work disorder, narcolepsy, jet lag, and sleep disorders such as primary insomnia, idiopathic hypersomnia, circadian rhythm sleep disorder, dyssomnia NOS, parasomnias including nightmare disorder, sleep terror disorder, sleep disorders secondary to depression, anxiety and/or other mental disorders and substance-induced sleep disorder;
  • EDS excessive daytime sleepiness
  • narcolepsy narcolepsy
  • jet lag and sleep disorders
  • sleep disorders such as primary insomnia, idiopathic hypersomnia, circadian rhythm sleep disorder, dyssomnia NOS, parasomnias including nightmare disorder, sleep terror disorder, sleep disorders secondary to depression, anxiety and/or other mental disorders and substance-induced sleep disorder;
  • Eating disorders e.g., bulimia, binge eating and anorexia
  • Digestive system and gastrointestinal disorders including gallbladder disease, ulcer, hyper- and hypo- motility of the gastrointestinal tract and irritable bowel syndrome;
  • CNS disorders including hyper- and hypo-activity of the central nervous system, migraine, epilepsy, seizures, convulsions, mood disorders, attention deficit disorder, attention deficit hyperactivity disorder, bipolar disorder, depression, manic disorders, obsessive compulsive disorder, schizophrenia, migraine, vertigo, motion sickness, dementia, cognitive deficit (e.g., in psychiatric disorder, such as mild cognitive impairment), learning deficit, memory deficit (e.g., age-related memory dysfunction), multiple sclerosis, Parkinson's disease, Alzheimer's disease and other neurodegenerative disorders, addiction (e.g., resulting from drug abuse), neurogenic inflammation and Tourette's syndrome;
  • cognitive deficit e.g., in psychiatric disorder, such as mild cognitive impairment
  • learning deficit e.g., age-related memory dysfunction
  • multiple sclerosis e.g., Parkinson's disease, Alzheimer's disease and other neurodegenerative disorders
  • addiction e.g., resulting from drug abuse
  • neurogenic inflammation e.g., resulting from drug abuse
  • Vestibular dysunction e.g., Meniere's disease, dizziness and motion sickness
  • Pain e.g., inflammatory pain or neuropathic pain
  • itch e.g., inflammatory pain or neuropathic pain
  • Septic shock e.g., Septic shock
  • Glaucoma e.g., Septic shock, and Glaucoma.
  • H3 receptor modulators may further be used to enhance a patient's cognitive ability.
  • compounds provided herein are used to treat Alzheimer's disease
  • Parkinson's disease schizophrenia, mood and attention alterations including attention deficit hyperactivity disorder and attention deficit disorder, memory and learning disorders, cognitive disorders (such as mild cognitive impairment and cognitive deficits in psychiatric pathologies), epilepsy, migraine, and disorders associated with the regulation of sleep and wakefulness, as well as , . , among in ll "fflb"ti l fea;t ⁇ lle!ht :;il dn ⁇ l
  • Treatment regimens may vaiy depending on the compound used and the particular condition to be treated. However, for treatment of most disorders, a frequency of administration of 4 times daily or less is preferred. In general, a dosage regimen of 2 times daily is more preferred, with once a day dosing particularly preferred. It will be understood, however, that the specific dose level and treatment regimen for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy. In general, the use of the minimum dose sufficient to provide effective therapy is preferred. Patients may generally be monitored for therapeutic effectiveness using medical or veterinary criteria suitable for the condition being treated or prevented.
  • H3 receptor modulators provided herein may be used within combination therapy for the treatment of conditions that are responsive to H3 receptor modulation, as described above.
  • a H3 receptor modulator is administered to a patient along with a second therapeutic agent that is not a H3 receptor modulator.
  • the H3 receptor modulator and second therapeutic agent may be present in the same pharmaceutical composition, or may be administered separately in either order. It will be apparent that additional therapeutic agents may, but need not, also be administered.
  • Second therapeutic agents suitable for use in such combination therapy include, for example, antiobesity agents, antidiabetics, antihypertensive agents, antidepressants, antipsychotic agents and anti-inflammatory agents.
  • the second therapeutic agent is a compound for the treatment of attention deficit disorder or attention deficit hyperactivity disorder, an antipsychotic agent or an anti-obesity agent.
  • Histamine Hl receptor modulators represent one class of second therapeutic agents.
  • Hl receptor modulators may be used, for example, in the treatment of Alzheimer's disease, inflammatory diseases and allergic conditions.
  • Representative Hl receptor antagonists include, for example, loratadine (CLARITINTM), desloratadine (CLARINEXTM), fexofenadine (ALLEGRATM) and cetirizine (ZYRTECTM).
  • Hl receptor antagonists include ebastine, mizolastine, acrivastine, astemizole, azatadine, azelastine, brompheniramine, chlorpheniramine, clemastine, cyproheptadine, dexchlorpheniramine, diphenhydramine, hydroxyzine, levocabastine, promethazine and tripelenamine.
  • Antiobesity therapeutic agents for use in combination therapy include, for example, leptin, leptin receptor agonists, melanin concentrating hormone (MCH) receptor antagonists, melanocortin receptor 3 (MC3) agonists, melanocortin receptor 4 (MC4) agonists, melanocyte stimulating hormone (MSH) agonists, cocaine and amphetamine regulated transcript (CART) agonists, dipeptidyl aminopeptidase inhibitors, a growth hormone secretagogue, beta-3 adrenergic agonists, 5HT-2 Yi or Y 5 antagonists, tumor necrosis factor (TNF) agonists, galanin antagonists, urocortin agonists, cholecystokinin (CCK) agonists, GLP-I agonists, serotonin (5HT) agonists, bombesin agonists, CBl antagonists such as rimonabant, growth hormone, growth factors such as prolactin or placental lactogen
  • Representative such agents include, for example, sibutramine, dexfenfluramine, dextroamphetamine, amphetamine, orlistat, mazindol, phentermine, phendimetrazine, diethylpropion, fluoxetine, bupropion, topiramate and ecopipam.
  • Antihypertensive therapeutic agents for use in combination therapy include, for example, beta-blockers such as alprenolol, atenolol, timolol, pindolol, propranolol and metoprolol, angiotensin converting enzyme (ACE) inhibitors such as benazepril, captopril, enalapril, fosinopril, lisinopril, quinapril and ramipril, calcium channel blockers such as nifedipine, felodipine, nicardipine, isradipine, nimodipine, diltiazem and verapamil, alpha-blockers such as doxazosin, urapidil, prazosin and terazosin, and angiotensin receptor blockers such as losartan.
  • beta-blockers such as alprenolol, atenolol, timolol, pind
  • CNS-active agents for use in combination therapy include, but are not limited to the following: for anxiety, depression, mood disorders or schizophrenia - serotonin receptor ⁇ e.g., 5- HTi A ) agonists and antagonists, neurokinin receptor antagonists, GABAergic agents, and corticotropin releasing factor receptor (CRFi) antagonists; for sleep disorders - melatonin receptor agonists; and for neurodegenerative disorders - such as Alzheimer's dementia, nicotinic agonists, muscarinic agents, acetylcholinesterase inhibitors and dopamine receptor agonists.
  • schizophrenia - serotonin receptor ⁇ e.g., 5- HTi A
  • neurokinin receptor antagonists e.g., GABAergic agents, and corticotropin releasing factor receptor (CRFi) antagonists
  • sleep disorders - melatonin receptor agonists a neurodegenerative disorders - such as Alzheimer's dementia, nicotinic agonists, muscarin
  • such combination therapy may include a selective serotonin reuptake inhibitor (SSRI) or a non-selective serotonin, dopamine and/or norepinephrine reuptake inhibitor.
  • SSRI selective serotonin reuptake inhibitor
  • agents include, for example, fluoxetine, sertraline, paroxetine, amitriptyline, seroxat and citalopram.
  • representative agents for use in combination therapy include GABAergic agents.
  • therapeutic agents suitable for combination therapy include, for example, agents that modify cholinergic transmission (e.g., 5-HT ⁇ antagonists), Ml muscarinic agonists, M2 muscarinic antagonists and acetylcholinesterase inhibitors.
  • agents that modify cholinergic transmission e.g., 5-HT ⁇ antagonists
  • Ml muscarinic agonists e.g., Ml muscarinic agonists
  • M2 muscarinic antagonists e.g., acetylcholinesterase inhibitors.
  • Suitable doses for H3 receptor modulator within such combination therapy are generally as described above. Doses and methods of administration of other therapeutic agents can be found, for example, in the manufacturer's instructions in the Physician's Desk Reference.
  • the dosage of second therapeutic agent in a combination or combination treatment method is less than the maximum dose advised by the manufacturer for administration of the second therapeutic agent without combination administration of a H3 receptor modulator. More preferably this dosage is less than 3 A, even more preferably less than 1 A, and highly preferably, less than VA of the maximum dose, while most preferably the dose is less than 10% of the maximum dose advised by the manufacturer for the second therapeutic agent when administered without combination administration of a H3 receptor modulator. It will be apparent that the dosage amount of H3 receptor modulator component(s) of the combination needed to achieve the desired effect may similarly be affected by the dosage amount and potency of the other therapeutic component(s) of the combination.
  • the combination administration of a H3 receptor modulator with other therapeutic agent(s) is accomplished by packaging one or more H3 receptor modulators and one or more other therapeutic agents in the same package, either in separate containers within the package or in the same contained as a mixture of one or more H3 receptor modulators and one or more other therapeutic agents.
  • Preferred mixtures are formulated for oral administration (e.g., as pills, capsules, tablets or the like).
  • the package comprises a label bearing indicia indicating that the one or more H3 receptor modulators and one or more other therapeutic agents are to be taken together for the treatment of attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, a cognitive disorder (such as mild cognitive impairment), epilepsy, migraine, narcolepsy, allergic rhinitis, vertigo, motion sickness, a memory disorder such as Alzheimer's disease, Parkinson's disease, obesity, an eating disorder or diabetes.
  • a cognitive disorder such as mild cognitive impairment
  • epilepsy migraine, narcolepsy, allergic rhinitis, vertigo, motion sickness
  • a memory disorder such as Alzheimer's disease, Parkinson's disease, obesity, an eating disorder or diabetes.
  • the present invention provides a variety of non-pharmaceutical in vitro and in vivo uses for the compounds provided herein.
  • such compounds may be labeled and used as probes for the detection and localization of H3 receptor (in samples such as cell preparations or tissue sections, preparations or fractions thereof).
  • compounds provided herein that comprise a suitable reactive group such as an aryl carbonyl, nitro or azide group may be used in photoaffinity labeling studies of receptor binding sites.
  • compounds provided herein may be used as positive controls in assays for receptor activity, as standards for determining the ability of a candidate agent to bind to H3 receptor, or as radiotracers for positron emission tomography (PET) imaging or for single photon emission computerized tomography (SPECT).
  • PET positron emission tomography
  • SPECT single photon emission computerized tomography
  • Such methods can be used to characterize H3 receptors in living subjects.
  • a H3 receptor modulator may be labeled using any of a variety of well known techniques (e.g., radiolabeled with a radionuclide such as tritium, as described herein), and incubated with a sample for a suitable incubation time (e.g., determined by first assaying a time course of binding).
  • unbound compound is removed (e.g., by washing), and bound compound detected using any method suitable for the label employed (e.g., autoradiography or scintillation counting for radiolabeled cciii$ ⁇ unds '' ; "spBfilWse l bfi ⁇ d ⁇ ;;; 'mii'tihioliI l iay be used to detect luminescent groups and fluorescent groups).
  • a matched sample containing labeled compound and a greater (e.g., 10-fold greater) amount of unlabeled compound may be processed in the same manner. A greater amount of detectable label remaining in the test sample than in the control indicates the presence of H3 receptor in the sample.
  • Detection assays including receptor autoradiography (receptor mapping) of H3 receptor in cultured cells or tissue samples may be performed as described by Kuhar in sections 8.1.1 to 8.1.9 of Current Protocols in Pharmacology (1998) John Wiley & Sons, New York.
  • modulators may be linked to the interior surface of a tissue culture plate or other support, for use as affinity ligands for immobilizing and thereby isolating, H3 receptors (e.g., isolating receptor-expressing cells) in vitro.
  • a modulator linked to a fluorescent marker such as fluorescein, is contacted with the cells, which are then analyzed (or isolated) by fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • H3 receptor modulators provided herein may further be used within assays for the identification of other agents that bind to H3 receptor.
  • assays are standard competition binding assays, in which bound, labeled H3 receptor modulator is displaced by a test compound.
  • such assays are performed by: (a) contacting H3 receptor with a radiolabeled H3 receptor modulator as described herein, under conditions that permit binding of the H3 receptor modulator to H3 receptor, thereby generating bound, labeled H3 receptor modulator; (b) detecting a signal that corresponds to the amount of bound, labeled H3 receptor modulator in the absence of test agent; (c) contacting the bound, labeled H3 receptor modulator with a test agent; (d) detecting a signal that corresponds to the amount of bound labeled H3 receptor modulator in the presence of test agent; and (e) detecting a decrease in signal detected in step (d), as compared to the signal detected in step (b), and therefrom identifying an agent that binds to H3 receptor.
  • the following Examples are offered by way of illustration and not by way of limitation.
  • Method 1 or Method 2 in positive ion mode using a Micromass Time-of-Flight LCT (Waters Corp.; Milford, MA), equipped with a Waters 600 pump (Waters Corp.; Milford, MA), Waters 996 photodiode array detector (Waters Corp.; Milford, MA), and a Gilson 215 autosampler (Gilson, Inc.; Middleton, WI).
  • sample volume of 1 microliter is injected onto a 50x4.6mm Chromolith SpeedROD RP- 18e column (Merck KGaA, Darmstadt, Germany), and eluted using a 2- phase linear gradient at a flow rate of 6 ml/min.
  • Sample is detected using total absorbance count over the 220-340nm UV range.
  • the elution conditions are: Mobile Phase A - 95% water, 5% MeOH with 0.05% TFA; Mobile Phase B - 5% water, 95% MeOH with 0.025% TFA.
  • the following gradient is used: 0-0.5 min 10-100%B, hold at 100%B to 1.2 min, return to 10%B at 1.21 min. Inject to inject cycle is 2.15 min.
  • sample volume of 1 microliter is injected onto a 30x4.6mm
  • step 2 The intermediate obtained from step 2 is reacted with l-(chloroacetyl)-4-cyclobutylpiperazine as in Example ID, step 3 to give the title compound.
  • step 3 The intermediate obtained from step 1 is reacted with l-(chloroacetyl)-4-cyclobutylpiperazine as in example ID, step 3 to give the title compound.
  • Step 7 Preparation of l'-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]-l-methylspiro[indole-3,4'- piperidin]-2( 1 H)-one
  • Chimeric H3 receptor cDNA from human H3 receptor is generated from three cDNA fragments: (1) a human H3 receptor cDNA 5' fragment; (2) a human H3 receptor cDNA 3' fragment; and (3) a rat Ga 12 cDNA fragment, each containing appropriate, overlapping linker sequences.
  • the human H3 receptor cDNA 5' fragment is generated from an adult human brain cDNA Library (INVITROGEN, Carlsbad, CA) by PCR using the primers TGAGCCTGCGGGGCCATGGAG (forward, SEQ ID NO:1) and
  • PCR is performed using the Advantage-GC cDNA PCR kit (BD BIOSCIENCES CLONTECH, Palo Alto, CA) in 25 ⁇ l reactions containing: 5 ⁇ l GC melt, 5 ⁇ l 5X PCR reaction buffer, 0.5 ⁇ l dNTP Mix (10 mM each), 10 pmol each forward and reverse primers, 0.5 ⁇ l Advantage GC cDNA Polymerase Mix and l ⁇ l undiluted ' ⁇ brMitions for touchdown PCR thermal cycling are 94 0 C for 2 min then, over 10 cycles: 94 0 C for 30 seconds, 60 0 C to 55 0 C in 0.5 0 C intervals for 1 min and 68°C for 1 min, then over 20 cycles: 94 0 C for 30 seconds, 55 0 C for 1 min and 68 0 C for 1 min.
  • the human H3 receptor cDNA 5' fragment is initially cloned into the vector pcDNA3.1/V5
  • the human H3 receptor cDNA 3' fragment is generated from the Human Brain Library by
  • GCAGTGCTCTAGAGAGCTGTGG reverse, SEQ ID NO:4 and conditions as described for the human H3 receptor cDNA 5' fragment.
  • the human H3 receptor cDNA 3' fragment is initially cloned into the vector pcDNA3. l/V5His TOPO TA (INVITROGEN).
  • the rat Ga 12 cDNA fragment is generated from a rat G ⁇ j 2 -containing vector (Jones and Reed (1987) J. Biol. Chem. 262(29): 14241-49, which is hereby incorporated by reference for its description of the rat GoCj 2 -containing vector) by PCR using the primers CTCTCTAGAGCACTGCTGGAAGATGGGCTGCACCGTGAGCGC (forward, SEQ ID NO:5) and TCAGAAGAGGCCACAGTCCTTCAG (reverse, SEQ ID NO:6) and conditions as described for the human H3 receptor cDNA 5' fragment.
  • the rat G ⁇ ; 2 cDNA fragment is initially cloned into the vector pcDNA3.1/V5His TOPO TA (INVITROGEN).
  • Each cDNA fragment is excised from the pcDNA3.1/V5His TOPO TA vector using the restriction enzymes Kpnl and Notl.
  • the human H3 receptor cDNA 5' fragment is further treated with the restriction enzyme ApaLI.
  • the human H3 receptor cDNA 3' fragment is further treated with the restriction enzymes ApaLI and Xbal.
  • the rat Gocj 2 cDNA fragment is further treated with the restriction enzyme Xbal. All three individual cDNA fragments are ligated and subcloned together into the Kpnl/Notl site of the baculoviral expression vector pBacPAK 9 (BD BIOSCIENCES
  • the chimeric human H3 receptor-rat G ⁇ j 2 baculoviral expression vector is co-transfected along with BACULOGOLD DNA (BD PHARMINGEN, San Diego, CA) into S/9 cells.
  • the S/9 cell culture supernatant is harvested three days post-transfection.
  • the recombinant virus-containing supernatant is serially diluted in Hink's TNM-FH insect medium (JRH Biosciences, Kansas City, KS) supplemented Grace's salts and with 4.1 mM L-GIn, 3.3 g/L LAH, 3.3 g/L ultraf ⁇ ltered yeastolate and
  • insect medium 10% heat-inactivated fetal bovine serum
  • plaque assayed for recombinant plaques After four days, recombinant plaques are selected and harvested into 1 ml of insect medium for amplification. Each 1 ml volume of recombinant baculovirus (at passage 0) is used S/9 cells in 5 ml of insect medium. After five days of incubation at 27 0 C, supernatant medium is harvested from each of the T25 infections for use as passage 1 inoculum.
  • Two of seven recombinant baculoviral clones are chosen for a second round of amplification, using 1 ml of passage 1 stock to infect 1 x 10 s cells in 100 ml of insect medium divided into two Tl 75 flasks. Forty-eight hours post infection, passage 2 medium from each 100 ml prep is harvested and plaque assayed to determine virus titer. The cell pellets from the second round of amplification are assayed by affinity binding as described below to verify recombinant receptor expression. A third round of amplification is then initiated using a multiplicity of infection of 0.1 to infect a liter of S/9 cells. Forty hours post-infection, the supernatant medium is harvested to yield passage 3 baculoviral stock.
  • Radioligand ranges from 0.40 - 40 nM [ 3 H]-N- (a)methylhistamine (Perkin Elmer, Boston, MA) and assay buffer contains 50 mM Tris, 1 mM CaCl 2 , 5 mM MgCl 2 , 0.1% BSA, 0.1 mM bacitracin, and 100 KIU/ml aprotinin, pH 7.4.
  • Filtration is carried out using GF/C WHATMAN filters (presoaked in 1.0% polyethyeneimine for 2 hr prior to use). Filters are washed three times with 5 ml cold assay buffer without BSA, bacitracin, or aprotinin and air dried for 12-16 hr. Radioactivity retained on filters is measured on a beta scintillation counter. Titer of the passage 3 baculoviral stock is determined by plaque assay and a multiplicity of infection, incubation time course, binding assay experiment is carried out to determine conditions for optimal receptor expression.
  • a multiplicity of infection of 0.5 and a 72-hr incubation period are preferred infection parameters for chimeric human H3 receptor-rat GCS B expression in up to 1 -liter S/9 cell infection cultures.
  • Log-phase S/9 cells (INVITROGEN), are infected with one or more stocks of recombinant baculovirus followed by culturing in insect medium at 27 0 C.
  • Infections are carried out with virus directing the expression of human H3 receptor-rat G ⁇ i2 in combination with three G-protein subunit- expression virus stocks: 1) rat G ⁇ ; 2 G-protein-encoding virus stock (BIOSIGNAL #V5J008), 2) bovine ⁇ l G-protein-encoding virus stock (BIOSIGNAL #V5H012), and 3) human ⁇ 2 G-protein- encoding virus stock (BIOSIGNAL #V6B003), which may be obtained from BIOSIGNAL Inc., Montreal.
  • the infections are conveniently carried out at a multiplicity of infection of 0.5:1.0:0.5:0.5.
  • an aliquot of cell suspension is analyzed for viability by trypan blue dye exclusion. If no blue is detected by visual inspection, the S/9 cells are harvested via centrifugation (3000 rpm / 10 min / 4°C). i::!l lB ./ E «i 76 :IL EXAMPLE S
  • S/9 cell pellets obtained as described in Example 5 are resuspended in homogenization buffer (10 mM HEPES, 250 raM sucrose, 0.5 ⁇ g/ml leupeptin, 2 ⁇ g/ml Aprotinin, 200 ⁇ M PMSF, and 2.5 mM EDTA, pH 7.4) and homogenized using a POLYTRON PT10-35 homogenizer (KINEMATICA AG, Lucerne, Switzerland; setting 5 for 30 seconds). The homogenate is centrifuged (536 x g/ 10 min at 4 0 C) to pellet the nuclei and unbroken cells.
  • homogenization buffer 10 mM HEPES, 250 raM sucrose, 0.5 ⁇ g/ml leupeptin, 2 ⁇ g/ml Aprotinin, 200 ⁇ M PMSF, and 2.5 mM EDTA, pH 7.4
  • POLYTRON PT10-35 homogenizer KINEMATICA AG, Lucerne, Switzerland; setting 5 for 30
  • the supernatant containing the membranes is decanted to a clean centrifuge tube, centrifuged (48,000 x g/ 30 min, 4 0 C) and the resulting pellet resuspended in 30 ml homogenization buffer. This centrifugation and resuspension step is repeated twice. The final pellet is resuspended in ice cold Dulbecco's PBS containing 5 mM EDTA and stored in frozen aliquots at -8O 0 C until used for radioligand binding or functional response assays.
  • the protein concentration of the resulting membrane preparation (hereinafter termed "P2 membranes”) is conveniently measured using a Bradford protein assay (BIO-RAD LABORATORIES, Hercules, CA). By this measure, a 1-liter culture of cells typically yields 100-150 mg of total membrane protein.
  • This Example illustrates a representative assay for evaluating agonist-stimulated GTP- gamma 35 S binding ("GTP binding") activity.
  • GTP binding activity can be used to identify H3 antagonists and to differentiate neutral antagonist compounds from those that possess inverse agonist activity.
  • This agonist-stimulated GTP binding activity can also be used to detect partial agonism mediated by antagonist compounds.
  • a compound analyzed in this assay is referred to herein as a "test compound.”
  • baculoviral stocks one directing the expression of the chimeric human H3 receptor and three directing the expression of each of the three subunits of a heterotrimeric G-protein
  • P2 membranes are prepared as described above, and agonist-stimulated GTP binding on the P2 membranes is assessed using histamine (Sigma Chemical Co., St. Louis, MO) as agonist in order to ascertain that the receptor/G-protein-alpha-beta- gamma combination(s) yield a functional response as measured by GTP binding.
  • P2 membranes are resuspended by Dounce homogenization (tight pestle) in GTP binding assay buffer (50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl 2 , 2 mM EGTA, 1 mg/ml BSA, 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 ⁇ M GDP) and added to assay tubes at a concentration of 35 ⁇ g protein/reaction tube.
  • GTP binding assay buffer 50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl 2 , 2 mM EGTA, 1 mg/ml BSA, 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 ⁇ M GDP
  • Neutral antagonists are antagonists that are substantially free of inherent agonist activity, and include those test compounds that reduce the histamine-stimulated GTP binding activity towards, but not below, baseline levels.
  • inverse agonists reduce the GTP binding activity of the receptor-containing membranes below baseline. The elevation of GTP binding activity above baseline by a compound in the absence of added histamine in this assay demonstrates agonist activity.
  • this assay is performed in the absence of added histamine, and EC 50 values are determined by analogous calculations, where the EC 50 is the concentration of test compound producing a 50% response.
  • This Example illustrates a representative screening assay for evaluating inhibition of histamine-stimulated GTP-gamma 35 S binding.
  • GTP binding activity can be used to identify H3 antagonists and inverse agonists.
  • a compound analyzed in this assay is referred to herein as a "test compound,” and the initial identification of antagonists and inverse agonists is performed using a test compound concentration of 4 ⁇ M.
  • P2 membranes are prepared as described above, and are resuspended by Dounce homogenization (tight pestle) in GTP binding assay buffer (50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl 2 , 2 mM EGTA, 1 mg/ml BSA 3 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 ⁇ M GDP) and added to assay tubes at a concentration of 35 ⁇ g protein/reaction tube.
  • GTP binding assay buffer 50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl 2 , 2 mM EGTA, 1 mg/ml BSA 3 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 ⁇ M GDP
  • Non-radiolabeled test compounds are added to separate reactions at a concentration of 4 ⁇ M along with 1 ⁇ M histamine (agonist). Reactions are initiated by the addition of 125 pM GTP-gamma 35 S with a final assay volume of 0.20 ml.
  • reaction After a 60-min incubation at room temperature, reactions are terminated by vacuum filtration over GF/C filters (pre-soaked in 50 mM Tris pH 7.4, 12OmM NaCl plus 0.1% BSA) followed by washing with ice-cold buffer (50 mM Tris pH 7.4, 12OmM NaCl).
  • the amount of receptor-bound (and thereby membrane-bound) GTP-gamma 35 S is determined by measuring the bound radioactivity, preferably by liquid scintillation spectrometry of the washed filters.
  • Non-specific binding is determined using 10 uM GTP-gammaS and typically represents less than 5 percent of total binding. After subtraction of non-specific binding, data is expressed as percent inhibition of 1 ⁇ M histamine signal.
  • Neutral antagonists are those test compounds that reduce the histamine-stimulated GTP binding activity towards, but not below, baseline levels. In contrast, in the absence of added histamine, inverse agonists reduce the GTP binding activity of the receptor-containing membranes below baseline. Any test compound that elevates GTP binding activity above baseline in the absence of added histamine in this assay is defined as having agonist activity.
  • This Example illustrates the evaluation of compound half-life values (t I/2 values) using a representative liver microsomal half-life assay. Pooled human liver microsomes are obtained from XENOTECH LLC (Kansas City, KS).
  • liver microsomes may also be obtained from IN VITRO TECHNOLOGIES (Baltimore, MD) or TISSUE TRANSFORMATION TECHNOLOGIES (Edison, NJ).
  • Six test reactions are prepared, each containing 25 ⁇ l microsomes, 5 ⁇ l of a 100 ⁇ M solution of test compound, and 399 ⁇ l 0.1 M phosphate buffer (19 mL 0.1 M NaH 2 PO 4 , 81 mL 0.1 M Na 2 HPO 4 , adjusted to pH 7.4 with H 3 PO 4 ).
  • a seventh reaction is prepared as a positive control containing 25 ⁇ l microsomes, 399 ⁇ l 0.1 M phosphate buffer, and 5 ⁇ l of a 100 ⁇ M solution of a compound with known metabolic properties (e.g., diazepam or clozapine). Reactions are preincubated at 39°C for 10 min.
  • a compound with known metabolic properties e.g., diazepam or clozapine
  • CoFactor Mixture is prepared by diluting 16.2 mg NADP and 45.4 mg Glucose-6-phosphate in 4 mL 100 mM MgCl 2 .
  • Glucose-6-phosphate dehydrogenase solution is prepared by diluting 214.3 ⁇ l glucose-6-phosphate dehydrogenase suspension (ROCHE MOLECULAR BIOCHEMICALS; water. 71 ⁇ l Starting Reaction Mixture (3 mL CoFactor
  • Preferred compounds provided herein exhibit in vitro ti /2 values of greater than 10 min and less than 4 hr, preferably between 30 min and 1 hr, in human liver microsomes.
  • MDCK Toxicity Assay This Example illustrates the evaluation of compound toxicity using a Madin Darby canine kidney (MDCK) cell cytotoxicity assay.
  • test compound 1 ⁇ L is added to each well of a clear bottom 96-well plate (PACKARD, Meriden, CT) to give final concentration of compound in the assay of 10 micromolar, 100 micromolar or 200 micromolar. Solvent without test compound is added to control wells.
  • MDCK cells ATCC no. CCL-34 (American Type Culture Collection, Manassas, VA), are maintained in sterile conditions following the instructions in the ATCC production information sheet. Confluent MDCK cells are trypsinized, harvested, and diluted to a concentration of 0.1 x 10 6 cells/ml with warm (37°C) medium (VITACELL Minimum Essential Medium Eagle, ATCC catalog # 30- 2003).
  • ATP-LITE-M Luminescent ATP detection kit is generally used according to the manufacturer's instructions to measure ATP production in treated and untreated MDCK cells. PACKARD ATP LITE-M reagents are allowed to equilibrate to rt. Once equilibrated, the lyophilized substrate solution is reconstituted in 5.5 mL of substrate buffer solution (from kit). Lyophilized ATP standard solution is reconstituted in deionized water to give a 10 mM stock. For the five control wells, 10 ⁇ L of serially consider 1 to each of the standard curve control wells to yield a final concentration in each subsequent well of 200 nM, 100 nM, 50 nM, 25 nM and 12.5 nM.
  • PACKARD substrate solution 50 ⁇ L is added to all wells, which are then covered, and the plates are shaken at approximately 700 rpm on a suitable shaker for 2 min.
  • a white PACKARD sticker is attached to the bottom of each plate and samples are dark adapted by wrapping plates in foil and placing in the dark for 10 min.
  • Luminescence is then measured at 22°C using a luminescence counter (e.g., PACKARD TOPCOUNT Microplate Scintillation and Luminescence Counter or TECAN SPECTRAFLUOR PLUS), and ATP levels calculated from the standard curve. ATP levels in cells treated with test compound(s) are compared to the levels determined for untreated cells.
  • a luminescence counter e.g., PACKARD TOPCOUNT Microplate Scintillation and Luminescence Counter or TECAN SPECTRAFLUOR PLUS
  • Cells treated with 10 ⁇ M of a preferred test compound exhibit ATP levels that are at least 80%, preferably at least 90%, of the untreated cells.
  • ATP levels that are at least 50%, preferably at least 80%, of the ATP levels detected in untreated cells.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Pain & Pain Management (AREA)
  • Psychology (AREA)
  • Psychiatry (AREA)
  • Endocrinology (AREA)
  • Emergency Medicine (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Heterocyclic Compounds That Contain Two Or More Ring Oxygen Atoms (AREA)
  • Heterocyclic Compounds Containing Sulfur Atoms (AREA)
  • Thiazole And Isothizaole Compounds (AREA)
  • Pyridine Compounds (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Nitrogen And Oxygen As The Only Ring Hetero Atoms (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Other In-Based Heterocyclic Compounds (AREA)
  • Furan Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

Dipiperazinyl ketones and related analogues are provided, as are methods for their preparation and use. Such compounds may generally be used to modulate ligand binding to histamine H3 receptors in vivo or in vitro, and are particularly useful in the treatment of a variety of disorders in humans, domesticated companion animals and livestock animals. Pharmaceutical compositions and therapeutic methods are provided, as are methods for using such ligands for detecting histamine H3 receptors (e.g., receptor localization studies).

Description

DIPIPERAZINYL KETONES AND RELATED ANALOGUES
FIELD OF THE INVENTION
This invention relates generally to dipiperazinyl ketones and related analogues, and to the use of such compounds for treating conditions responsive to histamine H3 receptor modulation. The invention further relates to the use of such compounds as probes for the detection and localization of histamine H3 receptors.
DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO: 1 human H3 receptor 5' fragment forward primer
SEQ ID NO:2 human H3 receptor 5' fragment reverse primer SEQ ID NO: 3 human H3 receptor 3' fragment forward primer
SEQ ID NO:4 human H3receptor 3' fragment reverse primer
SEQ ID NO: 5 rat Ga12 forward primer
SEQ ID NO: 6 rat Gα,j2 reverse primer
SEQ ID NO: 7 chimeric human H3 receptor - rat GcCj2 cDNA sequence SEQ ID NO: 8 chimeric human H3 receptor - rat Gotø polypeptide sequence
BACKGROUND OF THE INVENTION
Hormones and neurotransmitters regulate a wide variety of biological functions, often via specific receptor proteins located on the surface of living cells. Many of these receptors carry out intracellular signaling via the activation of coupled guanosine triphosphate-binding proteins (G proteins); such receptors are collectively called G protein-coupled receptors or GPCRs. The important role of GPCRs in the regulation of cell and organ function has attracted attention to these receptors as targets for new pharmaceutical agents.
Histamine is a multifunctional chemical transmitter that signals through specific cell surface GPCRs. To date, four histamine receptor subtypes have been identified: Hl, H2, H3 and H4. Histamine H3 receptor is a presynaptic GPCR that is found primarily in the central nervous system, although lower levels are also found in the peripheral nervous system. Genes encoding the H3 receptor have been reported in various organisms, including humans (see Lovenberg et al. (1999) Molecular Pharmacology 55:1101-07), and alternative splicing of this gene appears to result in multiple isoforms. The histamine H3 receptor is an auto- and hetero-receptor whose activation leads to''a
Figure imgf000003_0001
(including histamine, acetylcholine, norepinephrine and glutamate) from neurons in the brain, and is involved in the regulation of processes such as sleep and wakefulness, feeding and memory. In certain systems, the histamine H3 receptor may be constitutively active. Antagonists of histamine H3 receptor increase synthesis and release of cerebral histamine and other neurotransmitters, inducing an extended wakefulness, an improvement in cognitive processes, a reduction in food intake and a normalization of vestibular reflexes. Such antagonists may find use as therapeutics for central nervous system disorders such as Alzheimer's disease, Parkinson's disease, schizophrenia, mood and attention alterations including attention deficit hyperactivity disorder and attention deficit disorder, memory and learning disorders, cognitive disorders (such as mild cognitive impairment and cognitive deficits in psychiatric pathologies), epilepsy, migraine, and disorders associated with the regulation of sleep and wakefulness, as well as in the treatment and prevention of conditions such as obesity, eating disorders, diabetes, vertigo, motion sickness and allergic rhinitis.
Accordingly, the histamine H3 receptor is an important target for new therapeutics for conditions responsive to H3 receptor modulation. The present invention fulfills this need, and provides further related advantages.
SUMMARY OF THE INVENTION
The present invention provides dipiperazinyl ketones and related analogues of Formula I:
R6 - A - Q - B - Ri Formula I and pharmaceutically acceptable salts, solvates (e.g., hydrates) and esters of such compounds. Within Formula I:
Q is C(=O), C(-OH), N(R5)CC=O), N(R5)C(R3)(R4)C(=O), C(R3)(R4)CC=O), C(R3XR4)CHC-OH), CC=O)OC(R3)CR4)CC=O) or C(=O)OC(R3)(R4)C(-OH) wherein:
R3 and R4 are independently chosen from hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether and (C3-C6cycloalkyl)Co-C2alkyl, or R3 and R4 are taken together to form an optionally substituted 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and
R5 is hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether or (C3-C6cycloalkyl)Co-C2alkyl; A is a 4- to 8-membered cycloalkyl or heterocycloalkyl group, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from (i) hydroxy, halogen, oxo, C1-Qalkyl, CpQalkoxy and C1-C4alkanoyl; (ii) groups that are taken together with a substituent of Re to from a spiro ring that is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-Qalkyl, (C3-C8cycloalkyl)C0-C2alkyl, C1-C4haloalkyl, C1-C4alkoxy and substituents that are taken together to form a fused 5- to 7-membered ring; and (iii) and groups that are taken together to form a CrC3alkylene bridge; (a) a 5- to 7-membered heterocycloalkyl group that comprises at least one nitrogen atom and is optionally substituted, each of which heterocycloalkyl is preferably substituted with from 0 to 4 substituents independently chosen from C1-C4alkyl, C1-C4alkoxy, hydroxy, cyano, and groups that are taken together to form a C1-C3alkylene bridge; or
(b) mono- or di-(C1-C6alkyl)aminoC0-C6alkyl;
Ri is C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, mono- or di-(C1-C6alkyl)amino, (C3-C8cycloalkyl)C0- C4alkyl, (3- to 8-membered heterocycloalkyl)Co-C4alkyl, (6- to 10-membered aryl)C0-C4alkyl or (5- to 10-membered heteroaryl)Co-C4alkyl, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, aminocarbonyl, C1-C6alkyl, C1-C8alkenyl, C1-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkanoyl, mono- or di-(C1- C6alkyl)amino, mono- or di^C1-C6alkyOaminocarbonyl, C3-C7cycloalkyl, 3- to 7-membered heterocycloalkyl, phenyl and 5- or 6-membered heteroaryl; and R6 is C1-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, C1-C8alkanoyl, C1-C8alkoxycarbonyl, mono- or di-(Cr C8alkyl)amino, (C3-C iocarbocycle)-X-(Co-C4alky I)- or (4- to 10-membered heterocycle)-X-(C0- C4alkyl)-, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from: (i) oxo, halogen, cyano, hydroxy, amino, nitro and aminocarbonyl; and (ii) groups of the formula: D-X-E-, wherein : D represents C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, (C3-Ci4carbocycle)C0-C2alkyl or (4- to 14- membered heterocycle)Co-C2alkyl, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 6 substituents independently chosen from:
(a) halogen, cyano, hydroxy, nitro, amino, oxo, aminocarbonyl, aminosulfonyl and -COOH;
(b) C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C,-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkoxycarbonyl, C1-C6alkanoyloxy, Cr C6alkylsulfonyl, mono- or di-(C1-C6alkyl)aminoCo-C4alkyl, phenylCo-C2alkyl and phenylC0-C2alkoxy;
(c) groups that are taken together to form a fused 5- to 7-membered ring or a fused 8- to 10- membered bicyclic group; and (d) groups that are taken together with a substituent of A to form an optionally substituted spiro ring; each of which (b)-(d) is further substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, C1-C4alkyl, C1-C4haloalkyl, C1-C4alkoxy C1- C4haloalkoxy and phenyl; Ea
Figure imgf000005_0002
or
Figure imgf000005_0003
, wherein each r is independently O, 1 or 2 and each R2 is independently hydrogen, C1-C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl, or taken together with a substituent of A to form an optionally substituted spiro ring; and E is absent or represents a C1-C6alkylene or C1-C6alkoxy (i.e., -O-( C1-C6alkylene)-) linker.
Certain dipiperazinyl ketones and related analogues provided herein satisfy Formula II, III, rv, V, VI or VII:
Figure imgf000005_0001
Within Formulas II and V:
Zi and Z2 are independently nitrogen or CRa, wherein each R3 is independently chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy and C1-C4alkanoyl;
Z3 is nitrogen or CRb, wherein Rb is absent or chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl and groups that are taken together with R2 or a substituent of R6 to form a spiro ring that is optionally substituted and is preferably substituted with from O to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, (C3- C8cycloalkyl)C0-C2alkyl, C1-C4haloalkyl, C1-C4alkoxy and substituents that are taken together to form a fused 5- to 7-membered ring; independently represent a single or double bond, such that:
Figure imgf000005_0004
(i) if Z3 is N, then
Figure imgf000006_0001
s a single bond; and (ii) at least one of
Figure imgf000006_0002
s a single bond;
W is CR3R4, NR5, (X=O)CR3R4 or CC=O)OCR3R4, wherein:
R3 and R4 are independently chosen from hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether and (C3-C6cycloalkyl)C0-C2alkyl, or R3 and R4 are taken together to form an optionally substituted 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and R5 is hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether or (C3-C6cycloalkyl)C0-C2alkyl; Each q is independently 0, 1 or 2; such that neither q is 0 if both Z2 and Z3 are N; m is 0, 1 or 2; Ri is C3-C6alkyl, C3-C6alkenyl, C3-C6alkynyl, (C3-C8cycloalkyl)C0-C2alkyl or (3- to 8-membered heterocycloalkyl)Co-C2alkyl, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C1-C6alkyl, C1-C6alkenyl, C1-C6haloalkyl, C1- C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkanoyl, mono- or (Ii-(C1- C6alkyl)amino, mono- or di-(C1-C6alkyl)aminocarbonyl, C3-C7cycloalkyl and 3- to 7-membered heterocycloalkyl; such that Ri does not comprise a -COOH group; R2 represents from 0 to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-C3alkylene bridge;
R5 is C1-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, C1-C8alkanoyl, CrC8alkoxycarbonyl, mono- or di-(Cr C8alkyl)amino, (C3-C] 0carbocycle)-X-(Co-C4alkyl)- or (4- to 10-membered heterocycle)-X-(C0-
C4alkyl)-, each of which is optionally substituted, and each of which is preferably substituted with from 0 to 4 substituents independently chosen from:
(i) oxo, halogen, cyano, hydroxy, amino, nitro, aminosulfonyl and aminocarbonyl; and (ii) groups of the formula D-X-E- wherein:
D represents C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, (C3-C14carbocycle)C0-C2alkyl or (4- to 14-membered heterocycle)C0-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from:
(a) halogen, cyano, hydroxy, nitro, amino, oxo, aminocarbonyl, aminosulfonyl and - COOH;
(b) C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6haloalkyl, C1-C6alkoxy, C1- C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkoxycarbonyl, Cr C6alkanoyloxy, C1-C6alkylsulfonyl, mono- or di-(C1-C6alkyl)aminoCo-C4alkyl, phenylC0-C2alkyl and phenylC0-C2alkoxy; (c) groups that are taken together to form a fused 5- to 7-membered ring or a fused 8- to
10-membered bicyclic group; and (d) groups that are taken together with Rb to form an optionally substituted spiro ring; each of which (b)-(d) is further substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, C1-C^aloalkyl, Cp C4alkoxy, C1-C4haloalkoxy and phenyl; Each X is independently absent, O, CH2O, OCH2, C(=0), CH2C(=O), OCC=O), CH20C(=0),
C(=0)0, S(O)1, N(R2), C(=O)N(RZ), N(RZ)C(=O), N(Rz)S(O)r or S(O)1-N(R2), wherein each r is independently O, 1 or 2 and each R2 is independently hydrogen, C1-C6alkyl, (C3- C8cycloalkyl)Co-C2alkyl, or taken together with Rb to form an optionally substituted spiro ring; and E is absent or represents C1-Cgalkylene or C1-C6alkoxy; and
R7 represents from O to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-C3alkylene bridge.
Within Formulas III and VI, variables are as described for Formula II; such that (i) Z2 is not CRa if Zi and Z3 are both nitrogen; (ii) at least one of Z2 and Z3 is nitrogen; and (ii) Re is not phenyl substituted with halogen.
Within Formulas IV and VII:
R8 and R9 are independently hydrogen, C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, (C3-C8cycloalkyl)C0- C2alkyl or (3- to 8-membered heterocycloalkyl)Co-C2alkyl, each of which is optionally substituted, and each of which is preferably substituted with from O to 4 substituents independently chosen from Rx; or R8 and R9 are taken together to form a 4- to 8-membered heterocycloalkyl that is optionally substituted and is preferably substituted with from O to 4 substituents independently chosen from Rx;
Each Rx is independently oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C1-C6alkyl, C1-
C6alkenyl, C1-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, Cr C6alkanoyl, mono- or di-(C1-C6alkyl)amino, mono- or di-(C1-C6alkyl)aminocarbonyl, C3-
C7cycloalkyl, 3- to 7-membered heterocycloalkyl, phenyl and 5- or 6-membered heteroaryl; and the remaining variables are as described for Formula II.
Within certain aspects, dipiperazinyl ketones and related analogues provided herein are histamine H3 receptor modulators that exhibit a K; at a histamine H3 receptor, preferably a human H3 receptor, that is no greater than 4 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar, as determined using an assay for H3 receptor GTP binding.
Within certain aspects, compounds provided herein are labeled with a detectable marker (e.g., radiolabeled or fluorescein conjugated).
The present invention further provides, within other aspects, pharmaceutical compositions comprising at least one dipiperazinyl ketone or related analogue provided herein in combination with a physiologically acceptable carrier or excipient. W'ithϊπ ''"ϊyWy'eϊ- "' aφects;'1' itifetilods are provided for modulating H3 activity, comprising contacting a cell (e.g., neuronal) expressing H3 receptor with at least one H3 receptor modulator as described herein. Such contact may occur in vivo or in vitro and is generally performed using a concentration of compound that is sufficient to alter H3 receptor GTP binding in vitro {e.g., using the assay provided in Example 7, herein).
Within further aspects, methods are provided for modulating H3 receptor activity, comprising contacting a cell (e.g., neuronal) expressing H3 receptor with at least one H3 receptor modulator as described herein. Such contact may occur in vivo or in vitro and is generally performed using a concentration of compound that is sufficient to alter H3 receptor GTP binding in vitro (e.g., using the assay provided in Example 7, herein).
The present invention further provides methods for treating a condition responsive to H3 receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one H3 receptor modulator. Such conditions include, for example, attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, cognitive disorders (including mild cognitive impairment), epilepsy, migraine, a sleep disorder, excessive daytime sleepiness, shift work disorder, narcolepsy, idiopathic hypersomnia, allergic rhinitis, vertigo, motion sickness, memory disorders such as Alzheimer's disease, Parkinson's disease, obesity, eating disorders and diabetes.
Within further aspects, the present invention provides methods for determining the presence or absence of H3 receptor in a sample, comprising: (a) contacting a sample with a H3 receptor modulator as described herein under conditions that permit binding of the H3 receptor modulator to H3 receptor; and (b) detecting a level of the H3 modulator bound to H3 receptor.
The present invention also provides packaged pharmaceutical preparations, comprising: (a) a pharmaceutical composition as described herein in a container; and (b) instructions for using the composition to treat one or more conditions responsive to H3 receptor modulation, such as the conditions recited herein.
In yet another aspect, the present invention provides methods of preparing the compounds disclosed herein, including the intermediates.
These and other aspects of the present invention will become apparent upon reference to the following detailed description.
DETAILED DESCRIPTION
As noted above, the present invention provides dipiperazinyl ketones and related analogues. Such compounds may be used in vitro or in vivo, to modulate H3 receptor activity in a variety of contexts. TIR^TE6W S 0 B / B9761
Compounds are generally described herein using standard nomenclature. For compounds having asymmetric centers, it should be understood that (unless otherwise specified) all of the optical isomers and mixtures thereof are encompassed. In addition, compounds with carbon-carbon double bonds may occur in Z- and E- forms, with all isomeric forms of the compounds being included in the present invention unless otherwise specified. Where a compound exists in various tautomeric forms, a recited compound is not limited to any one specific tautomer, but rather is intended to encompass all tautomeric forms. Certain compounds are described herein using a general formula that includes variables (e.g., Z1, R1, W). Unless otherwise specified, each variable within such a formula is defined independently of any other variable, and any variable that occurs more than one time in a formula is defined independently at each occurrence.
The phrase "dipiperazinyl ketones and related analogues," as used herein, encompasses all compounds that satisfy one or more of Formulas I -VII, including any enantiomers, racemates and stereoisomers, and further including pharmaceutically acceptable salts, solvates (e.g., hydrates) and esters of such compounds.
A "pharmaceutically acceptable salt" of a compound recited herein is an acid or base salt that is suitable for use in contact with the tissues of human beings or animals without excessive toxicity or carcinogenicity, and preferably without irritation, allergic response, or other problem or complication. Such salts include mineral and organic acid salts of basic residues such as amines, as well as alkali or organic salts of acidic residues such as carboxylic acids. Specific pharmaceutically acceptable salts include, but are not limited to, salts of acids such as hydrochloric, phosphoric, hydrobromic, malic, glycolic, fumaric, sulfuric, sulfamic, sulfanilic, formic, toluenesulfonic, methanesulfonic, benzene sulfonic, camphorsulfonic, ethane disulfonic, 2-hydroxyethylsulfonic, nitric, benzoic, 2- acetoxybenzoic, citric, tartaric, lactic, stearic, salicylic, glutamic, ascorbic, pamoic, succinic, fumaric, maleic, propionic, hydroxymaleic, hydroiodic, phenylacetic, alkanoic such as acetic, HOOC-(CBk)n- COOH where n is 0-4, and the like. Similarly, pharmaceutically acceptable cations include, but are not limited to sodium, potassium, calcium, aluminum, lithium and ammonium. Those of ordinary skill in the art will recognize further pharmaceutically acceptable salts for the compounds provided herein, including those listed by Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, p. 1418 (1985) or Remington: The Science and Practice of Pharmacy, 21st ed., Lippincott Williams & Wilkins, Philadelphia, PA (2005). In general, a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, the use of nonaqueous media, such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile, is preferred. II'" «■»■' itiWiτli'bel'appalf-entl'tϊiat elcPc'σmpound provided herein may, but need not, be formulated as a solvate (e.g., hydrate) or non-covalent complex. In addition, the various crystal forms and polymorphs are within the scope of the present invention. Also provided herein are prodrugs of the compounds of the recited Formulas. A "prodrug" is a compound that may not fully satisfy the structural requirements of the compounds provided herein, but is modified in vivo, following administration to a patient, to produce a compound a formula provided herein. For example, a prodrug may be an acylated derivative of a compound as provided herein. Prodrugs include compounds wherein hydroxy, amine or sulfhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxy, amino, or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups within the compounds provided herein. Prodrugs of the compounds provided herein may be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved in vivo to yield the parent compounds.
As used herein, the term "alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon. Alkyl groups include, for example, groups having from 1 to 8 carbon atoms (Cp C8alkyl), from 1 to 6 carbon atoms (C1-C6alkyl) and from 1 to 4 carbon atoms (C1-C4alkyl), such as methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl and 3-methylpentyl. "Co-C4alkyl" refers to a single covalent bond or a C1- C4alkyl group. The term "alkylene" refers to a divalent alkyl group. C1-C4alkylene is an alkylene group having from 1 to 4 carbon atoms. Co-C4alkylene is a single covalent bond or an alkylene group having from 1 to 4 carbon atoms.
"Alkenyl" refers to straight or branched chain alkene groups. Alkenyl groups include, for example, C2-C8alkenyl, C2-C6alkenyl and C2-C4alkenyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively, such as ethenyl, allyl or isopropenyl. "Alkynyl" refers to straight or branched chain alkyne groups, which have one or more unsaturated carbon-carbon bonds, at least one of which is a triple bond. Alkynyl groups include C2-C8alkynyl, C2-C6alkynyl and C2-C4alkynyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively.
A "cycloalkyl" is a group that comprises one or more saturated and/or partially saturated rings in which all ring members are carbon, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, adamantyl, decahydro-naphthalenyl, octahydro-indenyl, and partially saturated variants of the foregoing, such as cyclohexenyl. Cycloalkyl groups do not comprise an aromatic ring or a heterocyclic ring. A "(C3-C8cycloalkyl)Co-C4alkyl" is a C3-C3cycloalkyl group linked via a single covalent bond or a C1-C4alkylene group. By "alkoxy," as used herein, is meant an alkyl group attached via an oxygen bridge. Alkoxy groups include, for example, CpC8alkoxy and C1-C4alkoxy groups, which have from 1 to 8 or 1 to 4 carbon atoms, respectively. Methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert- butoxy, n-pentoxy, 2-pentoxy, 3-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexoxy, 3-hexoxy, and
3-methylpentoxy are specific alkoxy groups. Similarly, "alkylthio" refers to an alkyl group attached via a sulfur bridge.
The term "oxo," as used herein, refers to a keto (C=O) group. An oxo group that is a substituent of a nonaromatic carbon atom results in a conversion Of-CH2- to -C(=O)-.
The term "alkanoyl" refers to an acyl group {e.g., -(C=O)-alkyl), in which carbon atoms are in a linear or branched alkyl arrangement and where attachment is through the carbon of the keto group. Alkanoyl groups have the indicated number of carbon atoms, with the carbon of the keto group being included in the numbered carbon atoms. For example a C2alkanoyl group is an acetyl group having the formula -(C=O)CHs. Alkanoyl groups include, for example, C2-C8alkanoyl, C2- C6alkanoyl and C2-C4alkanoyl groups, which have from 2 to 8, from 2 to 6 or from 2 to 4 carbon atoms, respectively. "Cialkanoyl" refers to -(C=O)H, which (along with C2-C8alkanoyl) is encompassed by the term "CpCsalkanoyl."
Similarly, "alkyl ether" refers to a linear or branched ether substituent {i.e., an alkyl group that is substituted with an alkoxy group). Alkyl ether groups include C2-C8alkyl ether, C2-C6alkyl ether and C2-C4alkyl ether, which have 2 to 8, 6 or 4 carbon atoms, respectively. A C2 alkyl ether has the structure -CH2-O-CH3.
The term "alkoxycarbonyl" refers to an alkoxy group attached through a keto (-(C=O)-) bridge {i.e., a group having the general structure -C(=O)-O-alkyl). Alkoxycarbonyl groups include, for example, C1-C8, C1-C6 and Ci ^alkoxycarbonyl groups, which have from 1 to 8, 6 or 4 carbon atoms, respectively, in the alkyl portion of the group {i.e., the carbon of the keto bridge is not included in the indicated number of carbon atoms). "Cialkoxycarbonyl" refers to -C(=O)-O-CH3; C3alkoxycarbonyl indicates -C(=O)-O-(CH2)2CH3 or -C(=O)-O-(CH)(CH3)2.
"Alkylamino" refers to a secondary or tertiary amine having the general structure -NH-alkyl or -N(alkyl)(alkyl), wherein each alkyl may be the same or different. Such groups include, for example, mono- and di-(C1-C6alkyl)amino groups, in which each alkyl may be the same or different and may contain from 1 to 6 carbon atoms, as well as mono- and di-(C1-C4alkyl)amino groups.
"Alkylaminoalkyl" refers to an alkylamino group linked via an alkylene group {i.e., a group having the general structure -alkyl-NH-alkyl or -alkyl-N(alkyl)(alkyl)) in which each alkyl is selected independently. Such groups include, for example, mono- and di-(C1-C6alkyl)aminoC1- C6alkyl and mono- and di-(C1-Cealkyl)aminoC1-C4alkyl, in which each alkyl may be the same or different. "Mono- or di-(C1-C6alkyl)aminoC0-C4alkyl" refers to a mono- or di-(C1-C6alkyI)amino group linked via a direct bond or a C1-C4alkylene group. The following are representative alkylaminoalkyl groups:
Figure imgf000011_0001
Figure imgf000012_0001
to an amide group {i.e., -(C=O)NH2). The term "mono- or di-(C1-C6alkyl)aminocarbonyl" refers to groups of the formula -(C=O)-N(R)2, in which the carbonyl is the point of attachment, one R is C1-C6alkyl and the other R is hydrogen or an independently chosen C1-C6alkyl. The term "halogen" refers to fluorine, chlorine, bromine or iodine.
A "haloalkyl" is an alkyl group that is substituted with 1 or more halogen atoms {e.g., "Cr C4haloalkyl" groups have from 1 to 4 carbon atoms). Examples of haloalkyl groups include, but are not limited to, mono-, di- or tri-fluoromethyl; mono-, di- or tri-chloromethyl; mono-, di-, tri-, tetra- or penta-fluoroethyl; mono-, di-, tri-, tetra- or penta-chloroethyl; and 1,2,2,2-tetrafluoro-l- trifluoromethyl-ethyl. Typical haloalkyl groups are trifluoromethyl and difluoromethyl. The term "haloalkoxy" refers to a haloalkyl group as defined above attached via an oxygen bridge. "Cr C4haloalkoxy" groups have 1 to 4 carbon atoms.
A dash ("-") that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -CONH2 is attached through the carbon atom. A "carbocycle" or "carbocyclic group" comprises at least one ring formed entirely by carbon- carbon bonds (referred to herein as a carbocyclic ring), and does not contain a heterocycle. Unless otherwise specified, each ring within a carbocycle may be independently saturated, partially saturated or aromatic, and is optionally substituted as indicated. A carbocycle generally has from 1 to 3 fused, pendant or spiro rings; carbocycles within certain embodiments have one ring or two fused rings. Typically, each ring contains from 3 to 8 ring members {i.e., C3-C8); C5-C7 rings are recited in certain embodiments. Carbocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Certain representative carbocycles are cycloalkyl as described above. Other carbocycles are aryl {i.e., contain at least one aromatic carbocyclic ring, with or without one or more additional aromatic and/or cycloalkyl rings). Such aryl carbocycles include, for example, phenyl, naphthyl {e.g., 1-naphthyl and 2-naphthyl), fluorenyl, indanyl and 1,2,3,4-tetrahydro-naphthyl.
Certain carbocycles recited herein are (C3-Ciocarbocycle)Co-C4alkyl groups {i.e., groups in which a 3- to 10-membered carbocyclic group is linked via a single covalent bond or a C1-C4alkylene group). Such groups include, for example, phenyl, indanyl and cycloalkyl groups such as hexyl and pentyl, as well as groups in which either of the foregoing is linked via C1-C4alkylene, preferably via C1-C2alkylene. Phenyl groups linked via a single covalent bond or C1-C2alkylene group are designated phenylCo-C2alkyl {e.g., benzyl, 1-phenyl-ethyl and 2-phenyl-ethyl). The term "phenylC0- C2alkoxy" refers to phenyl groups linked via an oxygen atom (phenoxy groups) or via a C1-C2alkoxy moiety, in which the point of attachment is the oxygen atom {e.g., benzyloxy).
A "heterocycle" or "heterocyclic group" has from 1 to 3 fused, pendant or spiro rings, at least one of which is a heterocyclic ring {i.e., one or more ring atoms is a heteroatom independently chosen from O, S and N, with the remaining ring atoms being carbon). Additional rings, if present, may be heterocyclic or carbocyclic. Typically, a heterocyclic ring comprises 1, 2, 3 or 4
Figure imgf000013_0001
each heterocyclic ring has 1 or 2 heteroatoms per ring.
Each heterocyclic ring generally contains from 3 to 8 ring members (rings having from 4 or 5 to 7 ring members are recited in certain embodiments) and heterocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Certain heterocycles comprise a sulfur atom as a ring member; in certain embodiments, the sulfur atom is oxidized to SO or SO2. Heterocycles may be optionally substituted with a variety of substituents, as indicated. Unless otherwise specified, a heterocycle may be a heterocycloalkyl group {i.e., each ring is saturated or partially saturated) or a heteroaryl group {i.e., at least one ring within the group is aromatic), such as a 5- to 10-membered heteroaryl (which may be monocyclic or bicyclic) or a 6-membered heteroaryl {e.g., pyridyl or pyrimidyl). N-linked heterocyclic groups are linked via a component nitrogen ring atom.
Heterocyclic groups include, for example, azepanyl, azocinyl, benzimidazolyl, benzimidazolinyl, benzisothiazolyl, benzisoxazolyl, benzofuranyl, benzothiofuranyl, benzoxazolyl, benzothiazolyl, benztetrazolyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolinyl, dihydrofuro[2,3-b]tetrahydrofuranyl, dihydroisoquinolinyl, dihydrotetrahydrofuranyl, 1 ,4-dioxa-8- aza-spiro[4.5]decyl, dithiazinyl, furanyl, furazanyl, imidazolinyl, imidazolidinyl, imidazolyl, indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, isobenzofuranyl, isochromanyl, isoindazolyl, isoindolinyl, isoindolyl, isothiazolyl, isoxazolyl, isoquinolinyl, morpholinyl, naphthyridinyl, octahydroisoquinolinyl, oxadiazolyl, oxazolidinyl, oxazolyl, phthalazinyl, piperazinyl, piperidinyl, piperidinyl, piperidonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridoimidazolyl, pyridooxazolyl, pyridothiazolyl, pyridyl, pyrimidyl, pyrrolidinyl, pyrrolidonyl, pyrrolinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, quinuclidinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, thiadiazinyl, thiadiazolyl, thiazolyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thienyl, thiophenyl, thiomorpholinyl and variants thereof in which the sulfur atom is oxidized, triazinyl, and any of the foregoing that are substituted with from 1 to 4 substituents as described above.
Certain heterocyclic groups are optionally linked via an alkylene moiety. For example, a "(4- to 14-membered heterocycle)Co-C2alkyl" is a heterocycle that contains from 4 to 14 ring members and is linked via a single covalent bond or a CrC2alkylene. A (3- to 10-membered heterocycloalkyl)C0-C4alkyl is a heterocycloalkyl group having from 3 to 10 ring members linked via a single covalent bond or an alkylene group having from 1 to 4 carbon atoms. Similarly, "(5- to 10- membered heteroaryl)Co-C4alkyl" refers to a heteroaryl group linked via a direct bond or C1- C4alkylene group.
A "substituent," as used herein, refers to a molecular moiety that is covalently bonded to an atom within a molecule of interest. For example, a "ring substituent" may be a moiety such as a halogen, alkyl group, haloalkyl group or other group discussed herein that is covalently bonded to an atom (preferably a carbon or nitrogen atom) that is a ring member. The term "substitution" refers to replacing a hydrogen atom in a molecular structure with a substituent as described above, such that
Figure imgf000014_0001
exceeded, and such that a chemically stable compound (i.e., a compound that can be isolated, characterized, and tested for biological activity) results from the substitution.
Groups that are "optionally substituted" are unsubstituted or are substituted by other than hydrogen at one or more available positions, typically 1, 2, 3, 4 or 5 positions, by one or more suitable groups (which may be the same or different). Optional substitution is also indicated by the phrase
"substituted with from 0 to X substituents," where X is the maximum number of permissible substituents. Certain optionally substituted groups are substituted with from 0 to 2, 3 or 4 independently selected substituents (i.e., are unsubstituted or substituted with up to the recited maximum number of substituents).
Unless otherwise indicated, the term "H3 receptor" is used herein to refer to any histamine H3 subtype receptor, including human H3 receptor (see, e.g., U.S. Patent No. 6,136,559), H3 receptor found in other mammals and chimeric receptors retaining H3 function, including the chimeric H3 receptor provided herein as SEQ ID NO: 8. A "H3 receptor modulator," also referred to here'in as a "modulator," is a compound that modulates H3 receptor GTP binding. A H3 receptor modulator may be a H3 receptor agonist or antagonist. A modulator binds with "high affinity" if the K; at H3 receptor is less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar. A representative assay for evaluating an effect on H3 receptor GTP binding is provided in Example 7, herein.
Unless otherwise specified, the terms "IC50" and "EC5O," as used herein, refer to values obtained using the assay as described in Example 7.
A modulator is considered an "antagonist" if it detectably inhibits H3 receptor agonist- stimulated GTP binding (using, for example, the representative assay provided in Example 7); in general, such an antagonist inhibits such GTP binding with a IC50 value of less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar. H3 receptor antagonists include neutral antagonists and inverse agonists.
An "inverse agonist" of H3 receptor is a compound that reduces the GTP binding activity of
H3 receptor below its basal activity level in the absence of added agonist. Inverse agonists of H3 receptor may also inhibit the activity in the presence of agonist. The basal activity of H3 receptor, as well as the reduction in H3 receptor GTP binding activity due to the presence of H3 receptor antagonist, may be determined using the assay of Example 7.
A "neutral antagonist" of H3 receptor is a compound that inhibits the activity of H3 receptor agonist, but does not significantly change the basal activity of the receptor (i.e., within the assay of Example 7 performed in the absence of agonist, H3 receptor activity is reduced by no more than 10%, preferably by no more than 5%, and more preferably by no more than 2%; most preferably, there is no detectable reduction in activity). The basal activity is the level of GTP binding observed in the assay . .,., .,„ irf'thV absenee1 W-Maed 'KisϊMϊrfS1 * any other agonist, and in the further absence of any test compound. Neutral antagonists of H3 receptor may, but need not, inhibit the binding of agonist to H3 receptor.
As used herein a "H3 receptor agonist" is a compound that elevates the activity of the receptor above the basal activity level of the receptor. H3 receptor agonist activity may be identified using the representative assay provided in Example 7. In general, such an agonist has an EC50 value of less than 4 micromolar, preferably less than 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar within the assay provided in Example 7. If the GTP binding activity brought about by a test compound attains the same level to that of histamine, it is defined as a full agonist. If the level of GTP binding activity brought about by a test compound is above baseline but below the level attained by histamine, it is defined as a partial agonist. Preferred antagonist compounds provided herein do not elevate GTP binding activity under such conditions more than 10% above baseline, preferably not more than 5% above baseline, and most preferably not more than 2% above baseline.
A "therapeutically effective amount" (or dose) is an amount that, upon administration to a patient, results in a discernible patient benefit (e.g., provides detectable relief from a condition being treated). Such relief may be detected using any appropriate criteria, including alleviation of one or more symptoms characteristic of the condition. A therapeutically effective amount or dose generally results in a concentration of compound in a body fluid (such as blood, plasma, serum, CSF, synovial fluid, lymph, cellular interstitial fluid, tears or urine) that is sufficient to alter H3 receptor GTP binding in vitro.
A "patient" is any individual treated with a compound or pharmaceutically acceptable salt thereof provided herein. Patients include humans, as well as other animals such as companion animals (e.g., dogs and cats) and livestock. Patients may be experiencing one or more symptoms of a condition responsive to H3 receptor modulation, or may be free of such symptom(s) (e.g., treatment may be prophylactic).
DlPIPERAZINYL KETONES AND RELATED ANALOGUES
As noted above, the present invention provides dipiperazinyl ketones and related analogues of Formulas I- VII, including the pharmaceutically acceptable salts, solvates and esters of such compounds. Within certain aspects, dipiperazinyl ketones and related analogues provided herein are H3 receptor modulators that may be used in a variety of contexts, including in the therapeutic treatment of human and animal patients as discussed below. H3 receptor modulators may also be used within in vitro assays (e.g., assays for receptor activity), and as probes for detection and localization of H3 receptor.
The variable "W," which appears in Formulas II, IV, V and VII, is CR3R4, C^O)CR3R4 or C(=O)OCR3R4 within certain embodiments. Within certain such compounds, R3 and R4 are independently hydrogen or methyl; within further such compounds, W is CR3R4. In other embodiments, the variable "W" is NR5; within certain such compounds R5 is hydrogen or methyl.
Within certain embodiments of Formulas II- VII, the variables R2 and R7 independently represent 0 substituents or 1 or 2 methyl substituents. Within other embodiments of Formulas H-VII5 R2 represents 0 substituents or 1 or 2 methyl substituents, and wherein R7 represents two substituents that are taken together to form a C1-C3alkylene bridge.
Within certain embodiments of Formulas I- VII, R1 is C3-C6alkyl, C3-C6alkenyl, or C3- C7cycloalkyl)Co-C2alkyl (e.g., cyclobutyl, cyclopentyl or cyclohexyl); in certain embodiments, Ri is isopropyl, cyclobutyl, cyclopentyl or cyclohexyl; in further embodiments, Ri is cyclobutyl, cyclopentyl or cyclohexyl.
The variable "m" in Formulas II-VII is 0, 1 or 2; in certain embodiments, m is 1, resulting in a 6-membered, optionally substituted piperazine or piperidine ring.
Within the Formulas provided herein, as noted above, each q is independently 0, 1 or 2. If each q is 0, the resulting ring is 4-membered; preferably no more than one of Z2 and Z3 is N in such cases, resulting in an azetidine ring. It will be apparent that both represent a single
Figure imgf000016_0002
bond if both "q" variables are 0.
If one q is 0 and the other is 1, the resulting ring is 5-membered (e.g., cyclopentyl, pyrrolidinyl, imidazolidinyl, dihydropyrrolyl or dihydroimidazolyl). In certain embodiments, both
Figure imgf000016_0003
represent a single bond. In further embodiments, exactly one of Z2 and Z3 is N (e.g., resulting in an optionally substituted pyrrolidine ring).
If both q variables are 1, the resulting ring is 6-membered (e.g., cyclohexyl, piperidinyl, piperazinyl, tetrahydropyridinyl or tetrahydropyrazinyl). In certain embodiments, both
Figure imgf000016_0004
represent a single bond.
Within certain embodiments of Formulas II-VII, one q is 1 and the other q is 0, 1 or 2. As noted above, the variables Zi (of Formulas II, III, V and VI) and Z2 (of Formulas II-VII) are independently nitrogen or CR3. In certain embodiments, Zj and Z2 are independently N or CH. In further embodiments, if W is NR5, then Z2 is CRa.
Within certain dipiperazinyl ketones and related analogues of Formulas II-VII, Z3 is N. Certain such compounds of Formula II further satisfy Formula VIII:
Figure imgf000016_0001
Certain compounds of Formula VIII further satisfy one or more of Formulas IX-XI:
Figure imgf000017_0001
Certain compounds of Formula III in which Z3 is N further satisfy Formula XII:
Figure imgf000017_0003
Certain compounds of Formula XII further satisfy one or more of Formulas XIII-XV:
Figure imgf000017_0002
Within other dipiperazinyl ketones and related analogues of Formulas II- VII, Z3 is CRb. Within certain such compounds, Z2 is N and Z3 is CRb. Within certain dipiperazinyl ketones and related analogues, the variable R6 is C1-C6alkyl, C1- C6alkenyl, d-C6alkynyl, C1-C6aminoalkyl, C1-C6alkanoyl, C1-C6alkoxycarbonyl, mono- or di-(C1 C6alkyl)aminoC0-C4alkyl, (C3-C7cycloalkyl)C0-C4alkyl, (3- to 7-membered heterocycloalkyl)C0-C4alkyl, phenylC0-C4alkyl, naphthylC0-C4alkyl or (5- to 10-membered heteroaryl)Co-C4alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from: (i) oxo, halogen, cyano, hydroxy, amino, nitro aminosulfonyl and aminocarbonyl; and (ii) C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C1 C6haloalkyl, C1-C6alkylthio, C1-C6alkoxy, C1-C6haloalkoxy, C1-Cgalkanoyl, mono- or di-(C1- C6alkyl)aminoC0-C2alkyl, mono- or di-(C1-C6alkyl)aminocarbonylCo-C2alkyl, (C3-C7cycloalkyl)Co- C2alkyl, (3- to 10-membered heterocycloalkyl)C0-C2alkyl, phenylCo-C2alkyl, phenylC0-C2alkoxy, phenylCo-C2alkylthio, naphthylC0-C2alkyl and (5- or 6-membered heteroaryl)C0-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, C1-C4alkyl, C2-C4alkenyl, C1-C4haloalkyl, C1-C4alkoxy, C1-C4haloalkoxy, C1-C4alkyl ether, C1-C4alkoxycarbonyl, mono- or di-(C1-C4alkyl)amino, phenylCo-C2alkyl and phenylCo-C2alkoxy.
Representative such R6 groups include, for example, C1-C8alkyl, C2-C3alkenyl, C2-C8alkynyl,
(C3-C7cycloalkyl)C0-C2alkyl, C2-C8alkyl ether, and mono- or di-(C1-C8alkyl)aminoCo-C4alkyl, each of which is substituted with from 0 to 2 oxo substituents.
Other such R6 groups have the formula Y-(C=0)t-(NRio)p-L- , wherein: Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1-C6alkyl, (C3- C8cycloalkyl)C0-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1-C6hydroxyalkyl, Cr .,„, „„„ m „ ,,„ ,
CpiKylthiό, iB^β'fiyyaό'ylFC'FGyllKylulfonyl, mono- or di-(C1-C6alkyl)aminoC0-C4alkyl, mono- or di-
(C1-C6alkyl)aminocarbonylCo-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1- C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1-C4haloalkoxy, Ct-C4alkylthio, phenyl and phenoxy; t is 0 or 1; p is 0 or 1; R10 is hydrogen, methyl or ethyl; and L is absent or C1-C4alkylene that is optionally substituted with oxo or phenyl.
Certain such Re groups further satisfy the formula Y-(NRio)p-L-, wherein: Y is phenyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1-C4alkyl, C1-C4alkoxy, C1- C4haloalkyl, C1-C4alkanoyl and phenyl, each of which is substituted with from 0 to 2 substituents independently chosen from C1-Qalkyl; p is 0 or 1; R]0 is hydrogen, methyl or ethyl; and L is absent or C1-C4alkylene that is optionally substituted with oxo or phenyl.
Certain such R6 groups further satisfy the formula Y-C(=O)t-, wherein: Y is phenyl, naphthyl or a 5- to 10-membered heteroaryl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, CpC6alkyl, (C3- C8cycloalkyl)Co-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1-Cohydroxyalkyl, C1- C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(C1-C6alkyl)aminoCo-C4alkyl, mono- or di- (C1-C6alkyl)aminocarbonylC0-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1- C4alkyl, C1-C4alkoxy, C1-Gjhaloalkyl, C1-Qhaloalkoxy, C1-C4alkylthio, phenyl and phenoxy; and t is 0 or 1.
Other such R6 groups include phenylCo-C3alkyl, pyridylC0-C3alkyl, pyrimidylC0-C3alkyl, pyridazinylCo-C3alkyl, and N-linked (5- to 7-membered heterocycloalkyl)Co-C3alkyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1- C4alkoxy, C1-C4alkanoyl, C1-C4haloalkyl and phenyl-(C=O)s- wherein s is 0 or 1. Representative such R6 groups include phenyl, pyridyl, pyridazinyl and pyrimidyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-Qalkyl, C1-C4alkoxy, C1-C4alkanoyl, C1- C4haloalkyl and phenyl-(C=O)s-.
Within further embodiments, R6 is phenyl, piperazinyl, piperidinyl, pyridyl or cyclohexyl, each of which is substituted with a group of the formula D-X-E-. Representative such groups include, for example, those in which D is a 5- or 6-membered heteroaryl (e.g., pyridyl or oxadiazolyl) that is unsubstituted or substituted with methyl; X is absent, O, CO, SO2, OCH2 or CH2O; and E is absent. For example, if R6 is phenyl substituted with D-X-E, wherein X and E are absent and D is 3-methyl- 1,2,4-oxadiazolyl, then R6 is:
^N \=/ Other such R6 groups include those listed above, linked via a carbonyl, such as:
Figure imgf000019_0001
Within further dipiperazinyl ketones and related analogues, the variable R6 is phenyl that is fused to a 5- or 6-membered ring that is optionally substituted (e.g., unsubstituted or substituted with oxo).
Certain dipiperazinyl ketones and related analogues of Formula II in which Z3 is CRb further satisfy Formula XVI:
Formula XVI
Figure imgf000019_0002
wherein:
R13 is a group of the formula Y-C(=O)-, wherein Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, C1-C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1- C6haloalkoxy, C1-C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, phenylC1- C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- C^aloalkoxy, Ci -C4alkylthio, phenyl and phenoxy; and
RH is hydrogen or C1-C4alkyl; or R13 is taken together with R14 to form a 5- to 10-membered heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo and C1-C4alkyl.
Within other dipiperazinyl ketones and related analogues in which Z3 is CRb, Rb is taken together with a substituent of R6 to form an optionally substituted 4- to 7-membered ring. In such compounds, Z3 provides the common carbon atom in the spirocyclic rings so formed. Certain such compounds of Formula II further satisfy Formula XVII:
Formula XVII
Figure imgf000019_0003
wherei
Figure imgf000019_0004
represents a spiro 4- to 7-membered heterocycloalkyl that is: (i) substituted with from 0 to 2 substituents independently chosen from: (a) oxo; and (b) C1-C6alkyl, C1-C6alkoxy, (C3- C7cycloalkyl)C0-C2alkyl, phenylC0-C2alkyl and (5-or 6-membered heterocycle)C0-C2alkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, C1- Qalkyl and C1-C4alkoxy; and (ii) optionally fused to phenyl or 6-membered heteroaryl. P'
Figure imgf000020_0001
further satisfy one of the following subformulas, in which the variables are as described above:
Figure imgf000020_0002
Formula II-a Formula II-b Formula II-c
Figure imgf000020_0003
Formula II-d Formula II-e Formula II-f
Figure imgf000020_0004
Formula II-g Formula II-h Formula II-i
Figure imgf000020_0005
Formula II-j Formula II-k Formula II-l
Figure imgf000020_0006
Formula II-m Formula II-n Formula II-o
Figure imgf000020_0007
Formula II-p Formula II-q Formula II-r
Figure imgf000020_0008
Formula II-s Formula II-t Formula II-u
Figure imgf000020_0009
Formula II-v Formula II-w Formula II-x
Figure imgf000020_0010
Formula II-y Formula II-z Formula II-aa
Figure imgf000021_0001
Figure imgf000022_0001
Formula Il-fff Formula II-ggg Formula II-hhh
Figure imgf000022_0002
Formula II-iii Formula II-jjj
Figure imgf000022_0003
Formula II-kkk
Similarly, certain compounds of Formula V satisfy a subformula generated by replacing the C=O in the above Formula II subformulas with a CH-OH. Such subformulas are referred to as formulas V-a to V-kkk, respectively.
Certain dipiperazinyl ketones and related analogues of Formula III further satisfy one of the following subformulas:
Figure imgf000022_0004
Formula III-a Formula III-b Formula III-c
Figure imgf000022_0005
Formula III-d Formula III-e Formula Ill-f
Figure imgf000022_0006
Formula III-g Formula Ill-h Formula Ill-i
Figure imgf000022_0007
Formula III-j Formula III-k Formula IH-I
Figure imgf000023_0001
Formula III-m Formula III-n Formula III-o
Figure imgf000023_0002
Formula III-p Formula III-q Formula III-r
Figure imgf000023_0003
Formula III-s Formula III-t Formula III-u
Figure imgf000023_0004
Formula III-v Formula III-w Formula III-x
Figure imgf000023_0005
Formula III-y Formula III-z Formula III-aa
Figure imgf000023_0006
Formula III-bb Formula III-cc Formula III-dd
Figure imgf000023_0007
Formula III-ee
Similarly, certain dipiperazinyl ketones and related analogues of Formula VI satisfy a subformula generated by replacing the C=O in the above Formula III subformulas with a CH-OH. Such subformulas are referred to herein as Formulas VI-a to VI-ee, respectively.
Certain dipiperazinyl ketones and related analogues of Formula IV further satisfy one of the following subformulas:
Figure imgf000023_0008
Formula IV-a FoiTnula rV-b Formula FV-c
Figure imgf000024_0001
, , „
P1Ji;;;;; n ./ u a O b / d! y / 1 1 i Rs
"- F>ormula IV-eσe 'Rβ
Where present, Rn and Ri2 are independently chosen from C1-C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl and phenylC1-C4alkyl, or Rn and Rj2 are taken together to form a 5- to 7-membered heterocycloalkyl that is substituted with from 0 to 2 substituents independently chosen from C1-C4alkyl.
Similarly, certain dipiperazinyl ketones and related analogues of Formula VII satisfy one of the subformulas generated by replacing the C=O in the above Formula IV subformulas with a CH- OH. Such subformulas are referred to herein as Formulas VII-a to VII-ee, respectively.
Representative compounds provided herein include, but are not limited to, those specifically described in Examples 1-3. It will be apparent that the specific compounds recited herein are representative only, and are not intended to limit the scope of the present invention. Further, as noted above, all compounds of the present invention may be present as a free acid or base or as a pharmaceutically acceptable salt, solvate or ester.
In certain aspects, dipiperazinyl ketones and related analogues provided are H3 receptor modulators, as determined using an assay for H3 receptor GTP binding. References herein to an "assay for H3 receptor GTP binding" are intended to refer to a standard in vitro GTP binding assay such as that provided in Example 7, which may be performed in the presence or absence of added agonist. If performed in the presence of added agonist, the assay is referred to as an "assay for H3 receptor agonist-stimulated GTP binding." Briefly, to assess H3 receptor agonist-stimulated GTP binding, a H3 receptor preparation is incubated with a H3 receptor agonist (e.g., histamine or an analogue thereof such as R-alpha-methyhistamine), labeled (e.g., 35S) GTP and unlabeled test compound. The H3 receptor used is preferably mammalian H3 receptor (e.g., human or rat H3 receptor or a chimeric human H3 receptor such as a receptor having the sequence provided in SEQ ID NO:8, and the receptor may be recombinantly expressed or naturally expressed. The H3 receptor preparation may be, for example, a membrane preparation from cells that recombinantly express H3 receptor. Incubation with an H3 receptor modulator results in a decrease or increase in the amount of label bound to the H3 receptor preparation, relative to the amount of label bound in the absence of the compound. This decrease or increase may be used to determine whether the compound functions as an agonist or antagonist, and to determine the Kj at H3 receptor as described herein.
As noted above, compounds that are H3 receptor antagonists are preferred within certain embodiments. When agonist-contacted cells are contacted with a compound that is a H3 receptor antagonist, the response is generally reduced by at least 20%, preferably at least 50% and more preferably at least 80%, as compared to cells that are contacted with the agonist in the absence of test compound. The IC50 for H3 receptor antagonists provided herein is preferably less than 4 mϊ&ttlar,
Figure imgf000026_0001
than 50OnM, less than 100 nM, less than 50 nM or less than
10 nM. In certain embodiments, H3 receptor antagonists provided herein exhibit no detectable agonist activity in an in vitro assay of H3 receptor agonism at a concentration of compound equal to the IC50. Certain such antagonists exhibit no detectable agonist activity an in vitro assay of H3 receptor agonism at a concentration of compound that is 100-fold higher than the IC50.
In certain embodiments, preferred H3 receptor modulators provided herein are non-sedating. In other words, a dose of H3 receptor modulator that is twice the minimum therapeutically effective dose causes only transient {i.e., lasting for no more than 1A the time that the therapeutic effect lasts) or preferably no statistically significant sedation in an animal model assay of sedation (using the method described by Fitzgerald et al. (1988) Toxicology 49(2-3):433-9). Preferably, a dose that is from 5 to 100 times the minimum therapeutically effective dose does not produce statistically significant sedation. More preferably, a H3 receptor modulator does not produce sedation at oral doses of less than 140 mg/kg (preferably less than 50 mg/kg, more preferably less than 30 mg/kg).
If desired, H3 receptor modulators provided herein may be evaluated for certain pharmacological properties including, but not limited to, oral bioavailability (preferred compounds are orally bioavailable to an extent allowing for therapeutically effective concentrations of the compound to be achieved at oral doses of less than 140 mg/kg, preferably less than 50 mg/kg, more preferably less than 30 mg/kg, even more preferably less than 10 mg/kg, and still more preferably less than 1 mg/kg), toxicity (a preferred H3 receptor modulator is nontoxic when a therapeutically effective amount is administered to a subject), side effects (a preferred H3 receptor modulator produces side effects comparable to placebo when a therapeutically effective amount of the compound is administered to a subject), serum protein binding and in vitro and in vivo half-life (a preferred H3 receptor modulator exhibits an in vivo half-life allowing for Q.I.D. dosing, preferably T.I.D. dosing, more preferably B.I.D. dosing, and most preferably once-a-day dosing). In addition, differential penetration of the blood brain barrier may be desirable for certain H3 receptor modulators. Routine assays that are well known in the art may be used to assess these properties, and identify superior compounds for a particular use. For example, assays used to predict bioavailability include transport across human intestinal cell monolayers, including Caco-2 cell monolayers. Penetration of the blood brain barrier of a compound in humans may be predicted from the brain levels of the compound in laboratory animals given the compound (e.g., intravenously). Serum protein binding may be predicted from albumin binding assays or whole serum binding assays. Compound half-life is inversely proportional to the frequency of dosage of a compound. In vitro half-lives of compounds may be predicted from assays of microsomal half-life as described within Example 9, herein.
As noted above, preferred compounds provided herein are nontoxic. In general, the term "nontoxic" as used herein shall be understood in a relative sense and is intended to refer to any substance that has been approved by the United States Food and Drug Administration ("FDA") for administration to mammals (preferably humans) or, in keeping with established criteria, is susceptible
Figure imgf000027_0001
λiktration to mammals (preferably humans). In addition, a highly preferred nontoxic compound generally satisfies one or more of the following criteria: (1) does not substantially inhibit cellular ATP production; (2) does not significantly prolong heart QT intervals; (3) does not cause substantial liver enlargement, and/or (4) does not cause substantial release of liver enzymes.
As used herein, a compound that does not substantially inhibit cellular ATP production is a compound that satisfies the criteria set forth in Example 10, herein. In other words, cells treated as described in Example 10 with 100 μM of such a compound exhibit ATP levels that are at least 50% of the ATP levels detected in untreated cells. In more highly preferred embodiments, such cells exhibit ATP levels that are at least 80% of the ATP levels detected in untreated cells.
A compound that does not significantly prolong heart QT intervals is a compound that does not result in a statistically significant prolongation of heart QT intervals (as determined by electrocardiography) in guinea pigs, minipigs or dogs upon administration of a dose that yields a serum concentration equal to the EC50 or IC50 for the compound. In certain preferred embodiments, a dose of 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally does not result in a statistically significant prolongation of heart QT intervals. By "statistically significant" is meant results varying from control at the p<0.1 level or more preferably at the p<0.05 level of significance as measured using a standard parametric assay of statistical significance such as a student's T test.
A compound does not cause substantial liver enlargement if daily treatment of laboratory rodents (e.g., mice or rats) for 5-10 days with a dose that yields a serum concentration equal to the EC50 or IC50 for the compound results in an increase in liver to body weight ratio that is no more than 100% over matched controls. In more highly preferred embodiments, such doses do not cause liver enlargement of more than 75% or 50% over matched controls. If non-rodent mammals (e.g., dogs) are used, such doses should not result in an increase of liver to body weight ratio of more than 50%, preferably not more than 25%, and more preferably not more than 10% over matched untreated controls. Preferred doses within such assays include 0.01, 0.05. 0.1, 0.5, 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally.
Similarly, a compound does not promote substantial release of liver enzymes if administration of twice the minimum dose that yields a serum concentration equal to the EC50 or IC50 for the compound does not elevate serum levels of ALT, LDH or AST in laboratory rodents by more than 100% over matched mock-treated controls. In more highly preferred embodiments, such doses do not elevate such serum levels by more than 75% or 50% over matched controls. Alternatively, a H3 receptor modulator does not promote substantial release of liver enzymes if, in an in vitro hepatocyte assay, concentrations (in culture media or other such solutions that are contacted and incubated with hepatocytes in vitro) that are equal to the EC50 or IC50 for the compound do not cause detectable release of any such liver enzymes into culture medium above baseline levels seen in media from matched mock-treated control cells. In more highly preferred embodiments, there is no detectable ,,„, f, ,. , „„,„ ,,, „,, rAedlse (!ifWy'oFyuifch;ilfve!l"Onlyine^fflto culture medium above baseline levels when such compound concentrations are five-fold, and preferably ten-fold the EC50 or IC50 for the compound.
In other embodiments, certain preferred compounds do not inhibit or induce microsomal cytochrome P450 enzyme activities, such as CYP1A2 activity, CYP2A6 activity, CYP2C9 activity, CYP2C19 activity, CYP2D6 activity, CYP2E1 activity or CYP3A4 activity at a concentration equal to the EC50 or IC50 for the compound.
Certain preferred compounds are not clastogenic (e.g., as determined using a mouse erythrocyte precursor cell micronucleus assay, an Ames micronucleus assay, a spiral micronucleus assay or the like) at a concentration equal the EC50 or IC50 for the compound. In other embodiments, certain preferred H3 receptor modulators do not induce sister chromatid exchange (e.g., in Chinese hamster ovary cells) at such concentrations.
For detection purposes, as discussed in more detail below, H3 receptor modulators provided herein may be isotopically-labeled or radiolabeled. For example, compounds may have one or more atoms replaced by an atom of the same element having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be present in the compounds provided herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as 2H, 3H, 11C, 13C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F and 36Cl. In addition, substitution with heavy isotopes such as deuterium (i.e., 2H) can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances.
PREPARATION OF DIPIPERAZINYL KETONES AND RELATED ANALOGUES
Compounds provided herein may generally be prepared using standard synthetic methods.
Starting materials are commercially available from suppliers such as Sigma-Aldrich Corp. (St. Louis,
MO), or may be synthesized from commercially available precursors using established protocols. By way of example, a synthetic route similar to that shown in any of the following Schemes may be used, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Each variable in the following schemes refers to any group consistent with the description of the compounds provided herein.
Certain definitions used in the following Schemes and elsewhere herein are: Bu butyl
BOP benzotriazol- 1 -yl-oxy-tris(dimethylamino)phosphonium hexafluorophosphate
CBz benzyloxycarbonyl
CDCl3 deuterated chloroform
CDI N,N'-carbonyldiimidazole δ chemical shift
DCM dichloromethane DMC 2-chloro-1,3-dimethylimidazolinium chloride
DIEA N,N-diisopropylethylamine
DMAP dimethylaminopyridine
DMSO dimethylsulfoxide
Et2O diethyl ether
EtOAc ethyl acetate
EtOH ethanol
1HNMR proton nuclear magnetic resonance
HPLC high pressure liquid chromatography hr hour(s)
Hz hertz
LCMS liquid chromatography/mass spectrometry
MeI methyl iodide
MS mass spectrometry
(M+l) mass + 1
MeOH methanol min minute(s)
NBS N-bromosuccinimide n-BuLi n-butyl lithium
P(t-Bu)3HBF4 tri-t-butylphosphonium tetrafluoroborate
Pd2(dba)3 tris(dibenzylideneacetone)dipalladium(0)
Pd(PPh3)4 tetrakis(triphenylphosphine)palladium(0)
PG protective group
PTLC preparative thin layer chromatography
It room temperature
TEA triethylamine
THF tetrahydrofuran
TLC thin layer chromatography
Xantphos 4,5-bis(diphenylphosphino)-9,9-dimethyl-xanthene
Scheme 1
Figure imgf000030_0001
Compounds of formula 6 may be prepared in accordance with Scheme 1. Cyclic amine 2 is reacted with α-bromo-acyl bromide or α-chloro-acyl chloride 1 in the presence of a base such as sodium bicarbonate to afford α-halo-carboxamide 3, which is treated with amine 5 in the presence of a base such as potassium carbonate to produce 6.
Figure imgf000030_0002
Compounds of formula 11 may be prepared in accordance with Scheme 2. Hydrogenation of 4-ρyridylacetate 7 in the presence of a catalyst such as platinum oxide affords 4-piperinyl acetate 8.
Conversion of 8 to N-substituted 4-piperidinyl acetate 9 may be achieved by well established protocols based on the nature of the R6 group. For example, when R6 is an aryl or heteroaryl group, compound 9 may be prepared via the reaction of 8 and an aryl or heteroaryl halide under standard nucleophilic substitution conditions (in presence of potassium carbonate in DMSO) or under standard palladium coupling conditions. In the case of Re = acyl, compound 9 may be prepared from the amidation of 8 with a carboxylic acid or an acyl chloride. The corresponding carboxylic acid 10 may be achieved via the hydrolysis of compound 9 in the presence of lithium hydroxide. Amidation of 10 with amine 2 and an appropriate coupling reagent such as BOP furnishes compound 11.
Figure imgf000031_0001
Compounds of formulas 15 and 18 may be prepared in accordance with Scheme 3 using CDI as the reagent, essentially as described by Batey et al. (1998) Tetrahedron Lett. 39:6267-70. Alternatively, when R5 is H, compound 15 may be prepared from the reaction of 12 and 2 in the presence of /7-nitrophenyl chloroformate essentially as described by Yoon et al. (1996) Org. Prep.
Proc. Int. 28(2): 173-77. P C: T/ US Oi IB ,/ 12 '37 B L Scheme 4
Figure imgf000032_0001
Compounds of formulas 20 and 21 may be prepared in accordance with Scheme 4 from the amidation of an amine 12 or 5 with a carboxylic acid 19.
Figure imgf000032_0002
Compounds of formula 25 and 26 may be prepared in accordance with Scheme 5. Bis-(4- pyridyl) ketone 22 is synthesized essentially as described by Wakselman (1977) J. Org. Chem. 42(3):564, which is hydrogenated to di-piperidin-4-yl-methanone 23 in the presence of a catalyst such as platinum oxide. Reductive animation of 23 with one equivalent of ketone (aldehyde) and sodium triacetoxyborohydride provides mono-N-alkylated product 24, which may be alkylated, arylated, or acylated to the desired ketone 25 via well established synthetic protocols, depending on the nature of R6. Reduction of ketone 25 with a reducing agent such as sodium borohydride produces the alcohol 26. Scheme 6
Figure imgf000033_0001
Compounds of formula 30 may be prepared in accordance with Scheme 6. Amine 5 reacts with 2-bromo-l-(4-pyridinyl)-l-ethanone hydrobromide in the presence of potassium carbonate to give compound 28, which is hydrogenated with H2 and a catalyst such as platinum oxide to furnish compound 29. The R2-substituted amino- l-piperidin-4-yl-ethanone 30 is obtained by reductive amination of 29 with an appropriate ketone (or aldehyde) and sodium triacetoxyborohydride.
Scheme 7
Figure imgf000033_0002
39 Compounds of formula 39 may be prepared in accordance with Scheme 7 wherein R, R1, R2,
R3, R4, Re, R7, X, Y, and m are as defined above. Condensation of compound 31 with amine 32, is followed by reaction with acid chloride 33 to give compound 34. Cyclization of compound 34 with Pd catalyst and deprotection of the resulting compound 35 provides the desired compound 36, which is hydrogenated to give compound 37. Spiro cyclic amine 37 is reacted with α-halo-carboxamide 3 in the presence of a base such as potassium carbonate to produce compound 38, which is treated with Pd catalyst to produce compound 39.
Scheme 8
Figure imgf000034_0001
Compounds of formula 48, 49 and 50 may be prepared in accordance with Scheme 8. Treatment of l-(/ert-butoxycarbonyl)piperidine-4-carboxylic acid 40 with thionyl chloride is followed by the reaction with 41 to give 42. Alkylation of 42 with benzyl bromide and cyclization of the resulting compound 43 affords 44. Deprotection with 4N HCl and then lithium in liquid ammonia gives 46, which is reacted with α-halo-carboxamide 3 in the presence of a base such as potassium carbonate to produce 47. Treatment of 47 with aryl halide in the presence of CuI and K3PO4 provides 48 and alkylation of 47 with an alkyl halide in the presence of a base such as cesium carbonate produces 49. Compound 50 is prepared by reacting 45 and 2 in the presence of p-nitrophenyl chloroformate essentially as described by Yoon et al. (1996) Org. Proc. Int. 28(2): 173-177.
Figure imgf000035_0001
Figure imgf000035_0002
Compounds of formula 54 may be prepared in accordance with Scheme 9. The reaction of diamine 51 and 3 in the presence of a base such as potassium carbonate affords 52. Deprotection of 52 and amidation of the resulting compound 53 with a carboxylic acid or carboxylic acid chloride gives 54.
Scheme 1OA
Figure imgf000035_0003
V-W
Y=Z 59
Figure imgf000035_0004
V, W, Y and Z are independently N or CR 60 Scheme 1 QB
Figure imgf000036_0001
Schemes 1OA and 1OB illustrate the synthesis of compounds 58 and 60. When X is a halogen, compound 60 is used as a key intermediate for modification as illustrated in the following Schemes. Reaction of 3 and 55 in the presence of a base such as potassium carbonate affords 56. Deprotection of 56 and the amidation of the resulting compound 57 with a carboxylic acid or carboxylic acid chloride give 58. The reaction of 57 with 59 such as dichloropyridazine, dihalopyridine, dihalobenzene, dihalopyrazine or other mono halo substituted aryl intermediates provides 60. Alternatively, 60 may be prepared by the reaction of 61 and 3 in the presence of a base such as potassium carbonate.
Scheme 11
Figure imgf000036_0002
Scheme 11 illustrates the synthesis of compounds 62-67. 60 is converted to 62 by a palladium-catalyzed coupling reaction, such as Suzuki coupling, Negishi coupling or Stille coupling. Compound 60 undergoes nucleophilic substitution or palladium-catalyzed coupling reaction with an appropriate sodium alkoxide or amine to afford 63 or 64. Conversion of 60 to nitrile 65 is achieved by the reaction with Zn(CN)2 under Negishi reaction conditions. Hydrolysis of 65 provides acid 66, which is further transformed to amide 67 upon coupling with an appropriate amine in the presence of a coupling reagent such as BOP,
Scheme 12
Figure imgf000037_0001
Scheme 12 illustrates the synthesis of compounds 71-76. The reaction of 57 with 69 (e.g., dichloropyridazine, dihalopyridine, dihalobenzene, dihalopyrazine or other mono halo substituted aryl intermediate) provides 70. Alternatively, 70 may be prepared by the reaction of 68 and 3 in the presence of a base such as potassium carbonate. Compound 70 is converted to 71 by palladium- catalyzed coupling, such as Suzuki coupling, Negishi coupling or Stille coupling. Compound 70 undergoes nucleophilic substitution or palladium-catalyzed coupling reaction with an appropriate sodium alkoxide or amine to afford 72 or 73. Conversion of 70 to nitrile 74 is achieved by the reaction with Zn(CN)2 under Negishi reaction conditions. Hydrolysis of 74 provides acid 75, which is _ n f" .'"""luHi "'11!' ι|"" »11 farther trahsM-ήϊeld11 to1 "arflMe;||l76 'titpdri coupling with an appropriate amine in the presence of a coupling reagent such as BOP.
In certain embodiments, a compound provided herein may contain one or more asymmetric carbon atoms, so that the compound can exist in different stereoisomer^ forms. Such forms can be, for example, racemates or optically active forms. As noted above, all stereoisomers are encompassed by the present invention. Nonetheless, it may be desirable to obtain single enantiomers (i.e., optically active forms). Standard methods for preparing single enantiomers include asymmetric synthesis and resolution of the racemates. Resolution of the racemates can be accomplished, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography using, for example a chiral HPLC column.
Compounds may be radiolabeled by carrying out their synthesis using precursors comprising at least one atom that is a radioisotope. Each radioisotope is preferably carbon (e.g., 14C), hydrogen (e.g., 3H), sulfur (e.g., 35S) or iodine (e.g., 125I). Tritium labeled compounds may also be prepared catalytically via platinum-catalyzed exchange in tritiated acetic acid, acid-catalyzed exchange in tritiated trifluoroacetic acid, or heterogeneous-catalyzed exchange with tritium gas using the compound as substrate. In addition, certain precursors may be subjected to tritium-halogen exchange with tritium gas, tritium gas reduction of unsaturated bonds, or reduction using sodium borotritide, as appropriate. Preparation of radiolabeled compounds may be conveniently performed by a radioisotope supplier specializing in custom synthesis of radiolabeled probe compounds. PHARMACEUTICAL COMPOSITIONS
The present invention also provides pharmaceutical compositions comprising one or more dipiperazinyl ketone or related analogue provided herein, together with at least one physiologically acceptable carrier or excipient. Pharmaceutical compositions may comprise, for example, water, buffers (e.g., neutral buffered saline or phosphate buffered saline), ethanol, mineral oil, vegetable oil, dimethylsulfoxide, carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, adjuvants, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione and/or preservatives. Preferred pharmaceutical compositions are formulated for oral delivery to humans or other animals (e.g., companion animals such as dogs or cats). In addition, other active ingredients may (but need not) be included in the pharmaceutical compositions provided herein.
Pharmaceutical compositions may be formulated for any appropriate manner of administration, including, for example, inhalation (e.g., nasal or oral), topical, oral, nasal, rectal or parenteral administration. The term parenteral as used herein includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, spinal, intracranial, intrathecal and intraperitoneal injection, as well as any similar injection or infusion technique. In certain embodiments, compositions in a form suitable for oral use are preferred. Such forms include, for example, tablets, tiwwies, lozenges;1
Figure imgf000039_0001
dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Within yet other embodiments, compositions of the present invention may be formulated as a lyophilizate.
*
Compositions intended for oral use may further comprise one or more components such as sweetening agents, flavoring agents, coloring agents and/or preserving agents in order to provide appealing and palatable preparations. Tablets contain the active ingredient in admixture with physiologically acceptable excipients that are suitable for the manufacture of tablets. Such excipients include, for example, inert diluents to increase the bulk weight of the material to be tableted {e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate), granulating and disintegrating agents that modify the disintegration rate in the environment of use (e.g., corn starch, starch derivatives, alginic acid and salts of carboxymethylcellulose), binding agents that impart cohesive qualities to the powdered material(s) (e.g., starch, gelatin, acacia and sugars such as sucrose, glucose, dextrose and lactose) and lubricating agents (e.g., magnesium stearate, calcium stearate, stearic acid or talc). Tablets may be formed using standard techniques, including dry granulation, direct compression and wet granulation. The tablets may be uncoated or they may be coated by known techniques.
Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil).
Aqueous suspensions comprise the active material(s) in admixture with one or more suitable excipients, such as suspending agents (e.g., sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); and dispersing or wetting agents (e.g., naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate). Aqueous suspensions may also comprise one or more preservatives, such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
Oily suspensions may be formulated by suspending the active ingredients in a vegetable oil (e.g., arachis oil, olive oil, sesame oil or coconut oil) or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents and/or flavoring agents may be added to provide palatable oral preparations. Such suspensions may be preserved by the addition of an anti-oxidant such as ascorbic acid. „
»"' " J!)iSpftil6iBle"'pOHvdelJris knd1' granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweetening, flavoring and coloring agents, may also be present.
Pharmaceutical compositions may also be formulated as oil-in-water emulsions. The oily phase may be a vegetable oil (e.g., olive oil or arachis oil), ja mineral oil (e.g., liquid paraffin) or a mixture thereof. Suitable emulsifying agents include naturally-occurring gums (e.g., gum acacia or gum tragacanth), naturally-occurring phosphatides (e.g., soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol), anhydrides (e.g., sorbitan monoleate) and condensation products of partial esters derived from fatty acids and hexitol with ethylene oxide (e.g., polyoxyethylene sorbitan monoleate). An emulsion may also comprise one or more sweetening and/or flavoring agents.
Syrups and elixirs may be formulated with sweetening agents, such as glycerol, propylene glycol, sorbitol or sucrose. Such foπnulations may also comprise one or more demulcents, preservatives, flavoring agents and/or coloring agents.
A pharmaceutical composition may be prepared as a sterile injectable aqueous or oleaginous suspension. The active ingredient(s), depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Such a composition may be formulated according to the known art using suitable dispersing, wetting agents and/or suspending agents such as those mentioned above. Among the acceptable vehicles and solvents that may be employed are water, 1,3-butanediol, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectable compositions, and adjuvants such as local anesthetics, preservatives and/or buffering agents can be dissolved in the vehicle.
Pharmaceutical compositions may also be prepared in the form of suppositories (e.g., for rectal administration). Such compositions can be prepared by mixing the drug with a suitable non- irritating excipient that is solid at ordinary temperatures but liquid at the body temperature and will therefore melt in the body to release the drug. Suitable excipients include, for example, cocoa butter and polyethylene glycols.
Compositions for inhalation typically can be provided in the form of a solution, suspension or emulsion that can be administered as a dry powder or in the form of an aerosol using a conventional propellant (e.g., dichlorodifluoromethane or trichlorofluoromethane). Pharmaceutical compositions may be formulated for release at a pre-determined rate.
Instantaneous release may be achieved, for example, via sublingual administration (i.e., administration by mouth in such a way that the active ingredient(s) are rapidly absorbed via the blood vJssfe unM4fe yrigue' MtKir-'tlβ-lia the digestive tract). Controlled release formulations (i.e., formulations such as a capsule, tablet or coated tablet that slows and/or delays release of active ingredient(s) following administration) may be administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at a target site. In general, a controlled release formulation comprises a matrix and/or coating that delays disintegration and absorption in the gastrointestinal tract (or implantation site) and thereby provides a delayed action or a sustained action over a longer period. One type of controlled-release formulation is a sustained-release formulation, in which at least one active ingredient is continuously released over a period of time at a constant rate. Preferably, the therapeutic agent is released at such a rate that blood (e.g., plasma) concentrations are maintained within the therapeutic range, but below toxic levels, over a period of time that is at least 4 hours, preferably at least 8 hours, and more preferably at least 12 hours. Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Carriers for use within such foπnulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of modulator release. The amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.
Controlled release may be achieved by combining the active ingredient(s) with a matrix material that itself alters release rate and/or through the use of a controlled-release coating. The release rate can be varied using methods well known in the art, including (a) varying the thickness or composition of coating, (b) altering the amount or manner of addition of plasticizer in a coating, (c) including additional ingredients, such as release-modifying agents, (d) altering the composition, particle size or particle shape of the matrix, and (e) providing one or more passageways through the coating. The amount of modulator contained within a sustained release formulation depends upon, for example, the method of administration (e.g., the site of implantation), the rate and expected duration of release and the nature of the condition to be treated or prevented.
The matrix material, which itself may or may not serve a controlled-release function, is generally any material that supports the active ingredient(s). For example, a time delay material such as glyceryl monosterate or glyceryl distearate may be employed. Active ingredient(s) may be combined with matrix material prior to formation of the dosage form (e.g., a tablet). Alternatively, or in addition, active ingredient(s) may be coated on the surface of a particle, granule, sphere, microsphere, bead or pellet that comprises the matrix material. Such coating may be achieved by conventional means, such as by dissolving the active ingredient(s) in water or other suitable solvent and spraying. Optionally, additional ingredients are added prior to coating (e.g., to assist binding of the active ingredient(s) to the matrix material or to color the solution). The matrix may then be coated with a barrier agent prior to application of controlled-release coating. Multiple coated matrix units may, if desired, be encapsulated to generate the final dosage form.
Figure imgf000042_0001
release is achieved through the use of a controlled release coating (i.e., a coating that permits release of active ingredient(s) at a controlled rate in aqueous medium). The controlled release coating should be a strong, continuous film that is smooth, capable of supporting pigments and other additives, non-toxic, inert and tack-free. Coatings that regulate release of the modulator include pH-independent coatings, pH-dependent coatings (which may be used to release modulator in the stomach) and enteric coatings (which allow the formulation to pass intact through the stomach and into the small intestine, where the coating dissolves and the contents are absorbed by the body). It will be apparent that multiple coatings may be employed (e.g., to allow release of a portion of the dose in the stomach and a portion further along the gastrointestinal tract). For example, a portion of active ingredient(s) may be coated over an enteric coating, and thereby released in the stomach, while the remainder of active ingredient(s) in the matrix core is protected by the enteric coating and released further down the GI tract. pH dependent coatings include, for example, shellac, cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropylmethylcellulose phthalate, methacrylic acid ester copolymers and zein. In certain embodiments, the coating is a hydrophobic material, preferably used in an amount effective to slow the hydration of the gelling agent following administration. Suitable hydrophobic materials include alkyl celluloses (e.g., ethylcellulose or carboxymethylcellulose), cellulose ethers, cellulose esters, acrylic polymers (e.g., poly(acrylic acid), poly(methacrylic acid), acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxy ethyl methacrylates, cyanoethyl methacrylate, methacrylic acid alkamide copolymer, poly(methyl methacrylate), polyacrylamide, ammonio methacrylate copolymers, aminoalkyl methacrylate copolymer, poly(methacrylic acid anhydride) and glycidyl methacrylate copolymers) and mixtures of the foregoing. Representative aqueous dispersions of ethylcellulose include, for example, AQUACOAT® (FMC Corp., Philadelphia, PA) and SURELEASE® (Colorcon, Inc., West Point, PA), both of which can be applied to the substrate according to the manufacturer's instructions. Representative acrylic polymers include, for example, the various EUDRAGIT® (Rohm America, Piscataway, NJ) polymers, which may be used singly or in combination depending on the desired release profile, according to the manufacturer's instructions.
The physical properties of coatings that comprise an aqueous dispersion of a hydrophobic material may be improved by the addition or one or more plasticizers. Suitable plasticizers for alkyl celluloses include, for example, dibutyl sebacate, diethyl phthalate, triethyl citrate, tributyl citrate and triacetin. Suitable plasticizers for acrylic polymers include, for example, citric acid esters such as triethyl citrate and tributyl citrate, dibutyl phthalate, polyethylene glycols, propylene glycol, diethyl phthalate, castor oil and triacetin. Controlled-release coatings are generally applied using conventional techniques, such as by spraying in the form of an aqueous dispersion. If desired, the coating may comprise pores or channels to facilitate release of active ingredient. Pores and channels may be generated by well known memoas;1 lnclliαiriig'tπPaddϊiόπ'df Sfealiic or inorganic material that is dissolved, extracted or leached from the coating in the environment of use. Certain such pore-forming materials include hydrophilic polymers, such as hydroxyalkylcelluloses (e.g., hydroxypropylmethylcellulose), cellulose ethers, synthetic water-soluble polymers (e.g., polyvinylpyrrolidone, cross-linked polyvinylpyrrolidone and polyethylene oxide), water-soluble polydextrose, saccharides and polysaccharides and alkali metal salts. Alternatively, or in addition, a controlled release coating may include one or more orifices, which may be formed my methods such as those described in US Patent Nos. 3,845,770; 4,034,758; 4,077,407; 4,088,864; 4,783,337 and 5,071,607. Controlled-release may also be achieved through the use of transdermal patches, using conventional technology (see, e.g., US Patent No. 4,668,232). Further examples of controlled release formulations, and components thereof, may be found, for example, in US Patent Nos. 5,524,060; 4,572,833; 4,587,117; 4,606,909; 4,610,870; 4,684,516; 4,777,049; 4,994,276; 4,996,058; 5,128,143; 5,202,128; 5,376,384; 5,384,133; 5,445,829; 5,510,119; 5,618,560; 5,643,604; 5,891,474; 5,958,456; 6,039,980; 6,143,353; 6,126,969; 6,156,342; 6,197,347; 6,387,394; 6,399,096; 6,437,000; 6,447,796; 6,475,493; 6,491,950; 6,524,615; 6,838,094; 6,905,709; 6,923,984; 6,923,988; and 6,911,217; each of which is hereby incorporated by reference for its teaching of the preparation of controlled release dosage forms.
In addition to or together with the above modes of administration, a compound provided herein may be conveniently added to food or drinking water (e.g., for administration to non-human animals including companion animals (such as dogs and cats) and livestock). Animal feed and drinking water compositions may be formulated so that the animal takes in an appropriate quantity of the composition along with its diet. It may also be convenient to present the composition as a premix for addition to feed or drinking water.
Compounds provided herein are generally present within a pharmaceutical composition at a level that provides a therapeutically effective amount upon administration, as described above. Dosage forms providing dosage levels ranging from about 0.1 mg to about 140 mg per kilogram of body weight per day are preferred (about 0.5 mg to about 7 g per human patient per day). The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. Dosage unit forms generally contain between from about 0.1 mg to about 2 g, preferably 0.5 mg to 1 g, and more preferably 1 mg to 500 mg, of an active ingredient. It will be understood, however, that the optimal dose for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed; the age, body weight, general health, sex and diet of the patient; the time and route of administration; the rate of excretion; any simultaneous treatment, such as a drug combination; and the type and severity of the particular disease undergoing treatment. Optimal dosages may be established using routine testing and procedures that are well known in the art.
Pharmaceutical compositions may be packaged for , treating conditions responsive to H3 receptor modulation, including those specifically recited herein. Packaged pharmaceutical , , - , ;l, ,,,.,,, „„;„ ,,., „,, preparations WflpVfsP a1 donta'lribr^lofding one or more dosage units comprising a therapeutically effective amount of at least one H3 receptor modulator as described herein and instructions (e.g., labeling) indicating that the contained composition is to be used for treating a condition responsive to H3 receptor modulation in the patient. METHODS OF USE
H3 receptor modulators provided herein may be used to alter activity and/or activation of H3 receptors in a variety of contexts, both in vitro and in vivo. Within certain aspects, H3 receptor modulators may be used to inhibit or enhance (preferably to inhibit) H3 receptor activity in vitro or in vivo. In general, such methods comprise the step of contacting a H3 receptor with one or more H3 receptor modulators provided herein, in aqueous solution and under conditions otherwise suitable for binding of the modulator(s) to H3 receptor. The H3 receptor modulator(s) are generally present at a concentration that is sufficient to alter H3 receptor GTP binding activity in vitro (using the assay provided in Example 7). The H3 receptor may be present in solution or suspension (e.g., in an isolated membrane or cell preparation), or in a cultured or isolated cell. Within certain embodiments, the H3 receptor is present in a patient (e.g., expressed by a neuronal cell), and the aqueous solution is a body fluid. Preferably, one or more H3 receptor modulators are administered to a patient in an amount such that each H3 receptor modulator is present in at least one body fluid of the patient at a therapeutically effective concentration that is 1 micromolar or less; preferably 500 nanomolar or less; more preferably 100 nanomolar or less, 50 nanomolar or less, 20 nanomolar or less, or 10 nanomolar or less. For example, such compounds may be administered at a dose that is less than 20 mg/kg body weight, preferably less than 5 mg/kg and, in some instances, less than 1 mg/kg. In vivo, modulation of H3 receptor activity may be assessed by detecting an alteration of a symptom (e.g., memory or attention) in a patient being treated with one or more H3 receptor modulators provided herein.
The present invention further provides methods for treating conditions responsive to H3 receptor modulation. Within the context of the present invention, the term "treatment" encompasses both disease-modifying treatment and symptomatic treatment, either of which may be prophylactic (i.e., before the onset of symptoms, in order to prevent, delay or reduce the severity of symptoms) or therapeutic (i.e., after the onset of symptoms, in order to reduce the severity and/or duration of symptoms). A condition is "responsive to H3 receptor modulation" if it is characterized by inappropriate activity of H3 receptor, regardless of the amount of H3 receptor ligand present locally, and/or if modulation of H3 receptor activity results in alleviation of the condition or a symptom thereof. Such conditions may be diagnosed and monitored using criteria that have been established in the art. Patients may include humans, domesticated companion animals and livestock, with dosages as described above. Conditions that are responsive to H3 receptor modulation include, for example: CέrMσv^sd'ul'kl ''ffisϋrtes, "lhciudiπg11 atherosclerosis, hypertension, myocardial infarction, coronary heart disease and stroke; Cancer (e.g., endometrial, breast, prostate and colon cancer, cutaneous carcinoma, medullary thyroid carcinoma and melanoma); Metabolic disorders including impaired glucose tolerance, dyslipidaemia, and diabetes (e.g., non- insulin dependent diabetes mellitus); Immune conditions and disorders including osteoarthritis, allergy (e.g., allergic rhinitis), and inflammation;
Respiratory conditions including nasal congestion, upper airway allergic response, asthma and chronic obstructive pulmonary disease;
Disorders associated with the regulation of sleep and wakefulness, or arousal and vigilance, including excessive daytime sleepiness (EDS), shift work disorder, narcolepsy, jet lag, and sleep disorders such as primary insomnia, idiopathic hypersomnia, circadian rhythm sleep disorder, dyssomnia NOS, parasomnias including nightmare disorder, sleep terror disorder, sleep disorders secondary to depression, anxiety and/or other mental disorders and substance-induced sleep disorder;
Eating disorders (e.g., bulimia, binge eating and anorexia) and obesity; Digestive system and gastrointestinal disorders including gallbladder disease, ulcer, hyper- and hypo- motility of the gastrointestinal tract and irritable bowel syndrome;
CNS disorders including hyper- and hypo-activity of the central nervous system, migraine, epilepsy, seizures, convulsions, mood disorders, attention deficit disorder, attention deficit hyperactivity disorder, bipolar disorder, depression, manic disorders, obsessive compulsive disorder, schizophrenia, migraine, vertigo, motion sickness, dementia, cognitive deficit (e.g., in psychiatric disorder, such as mild cognitive impairment), learning deficit, memory deficit (e.g., age-related memory dysfunction), multiple sclerosis, Parkinson's disease, Alzheimer's disease and other neurodegenerative disorders, addiction (e.g., resulting from drug abuse), neurogenic inflammation and Tourette's syndrome;
Vestibular dysunction (e.g., Meniere's disease, dizziness and motion sickness); Pain (e.g., inflammatory pain or neuropathic pain) and itch; Septic shock; and Glaucoma.
H3 receptor modulators may further be used to enhance a patient's cognitive ability.
In certain embodiments, compounds provided herein are used to treat Alzheimer's disease,
Parkinson's disease, schizophrenia, mood and attention alterations including attention deficit hyperactivity disorder and attention deficit disorder, memory and learning disorders, cognitive disorders (such as mild cognitive impairment and cognitive deficits in psychiatric pathologies), epilepsy, migraine, and disorders associated with the regulation of sleep and wakefulness, as well as , . , „ inll"fflb"tilfea;tπlle!ht:;ildnϋl|:;ij!)rέvlhti;θri' cPPeonditions such as obesity, eating disorders, diabetes, vertigo, motion sickness and allergic rhinitis.
Treatment regimens may vaiy depending on the compound used and the particular condition to be treated. However, for treatment of most disorders, a frequency of administration of 4 times daily or less is preferred. In general, a dosage regimen of 2 times daily is more preferred, with once a day dosing particularly preferred. It will be understood, however, that the specific dose level and treatment regimen for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy. In general, the use of the minimum dose sufficient to provide effective therapy is preferred. Patients may generally be monitored for therapeutic effectiveness using medical or veterinary criteria suitable for the condition being treated or prevented.
Within other aspects, H3 receptor modulators provided herein may be used within combination therapy for the treatment of conditions that are responsive to H3 receptor modulation, as described above. Within such combination therapy, a H3 receptor modulator is administered to a patient along with a second therapeutic agent that is not a H3 receptor modulator. The H3 receptor modulator and second therapeutic agent may be present in the same pharmaceutical composition, or may be administered separately in either order. It will be apparent that additional therapeutic agents may, but need not, also be administered. Second therapeutic agents suitable for use in such combination therapy include, for example, antiobesity agents, antidiabetics, antihypertensive agents, antidepressants, antipsychotic agents and anti-inflammatory agents. In certain combinations, the second therapeutic agent is a compound for the treatment of attention deficit disorder or attention deficit hyperactivity disorder, an antipsychotic agent or an anti-obesity agent. Histamine Hl receptor modulators represent one class of second therapeutic agents.
Combination with Hl receptor modulators may be used, for example, in the treatment of Alzheimer's disease, inflammatory diseases and allergic conditions. Representative Hl receptor antagonists include, for example, loratadine (CLARITIN™), desloratadine (CLARINEX™), fexofenadine (ALLEGRA™) and cetirizine (ZYRTEC™). Other Hl receptor antagonists include ebastine, mizolastine, acrivastine, astemizole, azatadine, azelastine, brompheniramine, chlorpheniramine, clemastine, cyproheptadine, dexchlorpheniramine, diphenhydramine, hydroxyzine, levocabastine, promethazine and tripelenamine.
Antiobesity therapeutic agents for use in combination therapy include, for example, leptin, leptin receptor agonists, melanin concentrating hormone (MCH) receptor antagonists, melanocortin receptor 3 (MC3) agonists, melanocortin receptor 4 (MC4) agonists, melanocyte stimulating hormone (MSH) agonists, cocaine and amphetamine regulated transcript (CART) agonists, dipeptidyl aminopeptidase inhibitors, a growth hormone secretagogue, beta-3 adrenergic agonists, 5HT-2
Figure imgf000047_0001
Yi or Y5 antagonists, tumor necrosis factor (TNF) agonists, galanin antagonists, urocortin agonists, cholecystokinin (CCK) agonists, GLP-I agonists, serotonin (5HT) agonists, bombesin agonists, CBl antagonists such as rimonabant, growth hormone, growth factors such as prolactin or placental lactogen, growth hormone releasing compounds, thyrotropin (TRH) agonists, uncoupling protein 2 or 3 (UCP 2 or 3) modulators, dopamine agonists, agents that modify lipid metabolism such as antilipidemic agents (e.g., cholestyramine, colestipol, clofibrate, gemfibrozil, lovastatin, pravastatin, simvastatin, probucol or dextrothyroxine), lipase/amylase inhibitors, peroxisome proliferator-activated receptor (PPAR) modulators, retinoid X receptor (RXR) modulators, TR-beta agonists, agouti-related protein (AGRP) inhibitors, opioid antagonists such as naltrexone, exendin-4, GLP-I, ciliary neurotrophic factor, corticotropin-releasing factor binding protein (CRF BP) antagonists and/or corticotropin-releasing factor (CRF) agonists. Representative such agents include, for example, sibutramine, dexfenfluramine, dextroamphetamine, amphetamine, orlistat, mazindol, phentermine, phendimetrazine, diethylpropion, fluoxetine, bupropion, topiramate and ecopipam. Antihypertensive therapeutic agents for use in combination therapy include, for example, beta-blockers such as alprenolol, atenolol, timolol, pindolol, propranolol and metoprolol, angiotensin converting enzyme (ACE) inhibitors such as benazepril, captopril, enalapril, fosinopril, lisinopril, quinapril and ramipril, calcium channel blockers such as nifedipine, felodipine, nicardipine, isradipine, nimodipine, diltiazem and verapamil, alpha-blockers such as doxazosin, urapidil, prazosin and terazosin, and angiotensin receptor blockers such as losartan.
CNS-active agents for use in combination therapy include, but are not limited to the following: for anxiety, depression, mood disorders or schizophrenia - serotonin receptor {e.g., 5- HTi A) agonists and antagonists, neurokinin receptor antagonists, GABAergic agents, and corticotropin releasing factor receptor (CRFi) antagonists; for sleep disorders - melatonin receptor agonists; and for neurodegenerative disorders - such as Alzheimer's dementia, nicotinic agonists, muscarinic agents, acetylcholinesterase inhibitors and dopamine receptor agonists. For example, such combination therapy may include a selective serotonin reuptake inhibitor (SSRI) or a non-selective serotonin, dopamine and/or norepinephrine reuptake inhibitor. Such agents include, for example, fluoxetine, sertraline, paroxetine, amitriptyline, seroxat and citalopram. For cognitive disorders, representative agents for use in combination therapy include GABAergic agents.
Other therapeutic agents suitable for combination therapy include, for example, agents that modify cholinergic transmission (e.g., 5-HTβ antagonists), Ml muscarinic agonists, M2 muscarinic antagonists and acetylcholinesterase inhibitors.
Suitable doses for H3 receptor modulator within such combination therapy are generally as described above. Doses and methods of administration of other therapeutic agents can be found, for example, in the manufacturer's instructions in the Physician's Desk Reference. In certain embodiments, the combination administration of a H3 receptor modulator with the second therapeutic aglnr'feiirits ''in";;:a Teduc'ti O1TT or'mFdtlsage of the second therapeutic agent required to produce a therapeutic effect {i.e., a decrease in the minimum therapeutically effective amount). Thus, preferably, the dosage of second therapeutic agent in a combination or combination treatment method is less than the maximum dose advised by the manufacturer for administration of the second therapeutic agent without combination administration of a H3 receptor modulator. More preferably this dosage is less than 3A, even more preferably less than 1A, and highly preferably, less than VA of the maximum dose, while most preferably the dose is less than 10% of the maximum dose advised by the manufacturer for the second therapeutic agent when administered without combination administration of a H3 receptor modulator. It will be apparent that the dosage amount of H3 receptor modulator component(s) of the combination needed to achieve the desired effect may similarly be affected by the dosage amount and potency of the other therapeutic component(s) of the combination.
In certain preferred embodiments, the combination administration of a H3 receptor modulator with other therapeutic agent(s) is accomplished by packaging one or more H3 receptor modulators and one or more other therapeutic agents in the same package, either in separate containers within the package or in the same contained as a mixture of one or more H3 receptor modulators and one or more other therapeutic agents. Preferred mixtures are formulated for oral administration (e.g., as pills, capsules, tablets or the like). In certain embodiments, the package comprises a label bearing indicia indicating that the one or more H3 receptor modulators and one or more other therapeutic agents are to be taken together for the treatment of attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, a cognitive disorder (such as mild cognitive impairment), epilepsy, migraine, narcolepsy, allergic rhinitis, vertigo, motion sickness, a memory disorder such as Alzheimer's disease, Parkinson's disease, obesity, an eating disorder or diabetes.
Within separate aspects, the present invention provides a variety of non-pharmaceutical in vitro and in vivo uses for the compounds provided herein. For example, such compounds may be labeled and used as probes for the detection and localization of H3 receptor (in samples such as cell preparations or tissue sections, preparations or fractions thereof). In addition, compounds provided herein that comprise a suitable reactive group (such as an aryl carbonyl, nitro or azide group) may be used in photoaffinity labeling studies of receptor binding sites. In addition, compounds provided herein may be used as positive controls in assays for receptor activity, as standards for determining the ability of a candidate agent to bind to H3 receptor, or as radiotracers for positron emission tomography (PET) imaging or for single photon emission computerized tomography (SPECT). Such methods can be used to characterize H3 receptors in living subjects. For example, a H3 receptor modulator may be labeled using any of a variety of well known techniques (e.g., radiolabeled with a radionuclide such as tritium, as described herein), and incubated with a sample for a suitable incubation time (e.g., determined by first assaying a time course of binding). Following incubation, unbound compound is removed (e.g., by washing), and bound compound detected using any method suitable for the label employed (e.g., autoradiography or scintillation counting for radiolabeled cciii$©unds''; "spBfilWselbfiϊdι;;;'mii'tihioliIl iay be used to detect luminescent groups and fluorescent groups). As a control, a matched sample containing labeled compound and a greater (e.g., 10-fold greater) amount of unlabeled compound may be processed in the same manner. A greater amount of detectable label remaining in the test sample than in the control indicates the presence of H3 receptor in the sample. Detection assays, including receptor autoradiography (receptor mapping) of H3 receptor in cultured cells or tissue samples may be performed as described by Kuhar in sections 8.1.1 to 8.1.9 of Current Protocols in Pharmacology (1998) John Wiley & Sons, New York.
Compounds provided herein may also be used within a variety of well known cell separation methods. For example, modulators may be linked to the interior surface of a tissue culture plate or other support, for use as affinity ligands for immobilizing and thereby isolating, H3 receptors (e.g., isolating receptor-expressing cells) in vitro. Within one preferred embodiment, a modulator linked to a fluorescent marker, such as fluorescein, is contacted with the cells, which are then analyzed (or isolated) by fluorescence activated cell sorting (FACS).
H3 receptor modulators provided herein may further be used within assays for the identification of other agents that bind to H3 receptor. In general, such assays are standard competition binding assays, in which bound, labeled H3 receptor modulator is displaced by a test compound. Briefly, such assays are performed by: (a) contacting H3 receptor with a radiolabeled H3 receptor modulator as described herein, under conditions that permit binding of the H3 receptor modulator to H3 receptor, thereby generating bound, labeled H3 receptor modulator; (b) detecting a signal that corresponds to the amount of bound, labeled H3 receptor modulator in the absence of test agent; (c) contacting the bound, labeled H3 receptor modulator with a test agent; (d) detecting a signal that corresponds to the amount of bound labeled H3 receptor modulator in the presence of test agent; and (e) detecting a decrease in signal detected in step (d), as compared to the signal detected in step (b), and therefrom identifying an agent that binds to H3 receptor. The following Examples are offered by way of illustration and not by way of limitation.
Unless otherwise specified all reagents and solvent are of standard commercial grade and are used without further purification. Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein.
EXAMPLES Mass spectroscopy data in the following Examples is Electrospray MS, obtained (using either
Method 1 or Method 2, as described below) in positive ion mode using a Micromass Time-of-Flight LCT (Waters Corp.; Milford, MA), equipped with a Waters 600 pump (Waters Corp.; Milford, MA), Waters 996 photodiode array detector (Waters Corp.; Milford, MA), and a Gilson 215 autosampler (Gilson, Inc.; Middleton, WI). MassLynx™ (Waters Corp.; Milford, MA) version 4.0 software with OpenLynx Global Server™, OpenLynx™ and AutoLynx™ processing is used for data collection and analysis. MS conditions are as follows: capillary voltage = 3.5 kV; cone voltage = 30 V, desolvation
Figure imgf000050_0001
0.22 seconds and an interscan delay of 0.05 seconds.
According to MS Method 1, sample volume of 1 microliter is injected onto a 50x4.6mm Chromolith SpeedROD RP- 18e column (Merck KGaA, Darmstadt, Germany), and eluted using a 2- phase linear gradient at a flow rate of 6 ml/min. Sample is detected using total absorbance count over the 220-340nm UV range. The elution conditions are: Mobile Phase A - 95% water, 5% MeOH with 0.05% TFA; Mobile Phase B - 5% water, 95% MeOH with 0.025% TFA. The following gradient is used: 0-0.5 min 10-100%B, hold at 100%B to 1.2 min, return to 10%B at 1.21 min. Inject to inject cycle is 2.15 min. According to MS method 2, sample volume of 1 microliter is injected onto a 30x4.6mm
XBridge™ C 18, 5μ, column (Waters Corp.; Milford, MA), and eluted using a 2-phase linear gradient at a flow rate of 6 ml/min. Sample is detected using total absorbance count over the 220-340nm UV range. The elution conditions are: Mobile Phase A - 95% water, 5% MeOH with 0.025% Ammonium Hydroxide; Mobile Phase B - 5% water, 95% MeOH with 0.025% Ammonium Hydroxide. The following gradient is used: 0-0.5 min 5-100%B, hold at 100%B to 1.2 min, return to 5%B at 1.21 min. Inject to inject cycle is 2.15 min.
EXAMPLE 1 Preparation of Representative Dipiperazinyl Ketones and Related Analogues
A. 2-[4-(4-ACETYL-PHENYL)-PIPERAZIN- 1 -YL]-I -(4-CYCLOPENTYL-PIPERAZIN- 1 -YL)-ETHANONE (COMPOUND 1)
Figure imgf000050_0002
Step 1. Preparation of 2-bromo-l-(4-cyclopentyl-piperazin-l-yl)-ethanone
Figure imgf000050_0003
To a solution of sodium bicarbonate (6.5 mmol) in water (2 mL) and DCM (10 mL) at 00C is added bromoacetyl bromide (6.5 mmol), followed by immediate addition of 1-cyclopentylpiperazine (3.25 mmol). The mixture is stirred at 00C for an additional 40 min. To the mixture is added aqueous sodium bicarbonate (15 mL) and DCM (30 mL). The layers are separated and the organic layers dried (MgSO^ and solvent removed in vacuo to give the title compound, which is used in the next step reaction without further purification. tep -2. ' m -1 -[ - ety -p eny -p perazin-l-y ]-l-(4-cyclopenty -p peraz n- -y - ethanone
Figure imgf000051_0001
A mixture of 2-bromo-l-(4-cyclopentyl-piperazin-l-yl)-ethanone (1.2 mmol), l-(4-piperazin- l-yl-phenyl)-ethanone (1.2 mmol) and potassium carbonate (2.4 mmol) in acetonitrile (10 mL) is stirred at rt overnight. The solvent is removed in vacuo and to the residue is added DCM (40 mL) and aqueous sodium bicarbonate (15 mL). The layers are separated and aqueous layer is extracted with
DCM (15 mL). The combined organic layers are dried (MgSC^) and solvent removed in vacuo to give the crude product, which is purified by PTLC (5% MeOH in DCM) to give the title compound. 1H NMR (CDCl3) δ 7.86 (d, 2H), 6.86 (d, 2H), 3.66-3.60 (m, 4H), 3.36 (t, 4H), 3.23 (s, 2H), 2.65 (t,
4H), 2.51 (s, 3H), 2.50-2.44 (m, 5H), 1.89-1.80 (m, 2H), 1.73-1.63 (m, 2H), 1.61-1.48 (m, 2H), 1.44-
1.32 (m, 2H); LC-MS (M+l) 399.35.
B. 4- { 1 -[2-(4-CYCLOPENTYL-PIPERAZIN- 1 -YL)-2-OXO-ETHYL]-PIPERIDIN-4-YL} -BENZONITRILE
(COMPOUND 2)
Figure imgf000051_0002
A mixture of 2-bromo-l-(4-cyclopentyl-piperazin-l-yl)-ethanone (1.2 mmol), 4-piperidin-4- yl-benzonitrile (1.2 mmol) and potassium carbonate (2.4 mmol) in acetonitrile (10 mL) is stirred at rt overnight. The solvent is removed in vacuo and to the residue is added DCM (40 mL) and aqueous sodium bicarbonate (15 mL). The layers are separated and aqueous layer is extracted with DCM (15 mL). The combined organic layers are dried (MgSC^) and solvent removed in vacuo to give the crude product, which is purified by PTLC (5% MeOH in DCM) to give the title compound. 1H NMR (CDCl3) δ 7.59 (2H, d), 7.32 (2H, d), 3.64 (4H, br,), 3.22 (2H, s), 3.01 (2H, br), 2.40-2.62 (6H, m), 2.21 (2H, dt), 0.80-1.95 (12H, m); LC-MS (M+l) 381.
C. 2-[L-(4-ACETYL-PHENYL)-PIPERIDIN-4-YL]-L-(4-CYCLOBUTYL-PIPERAZIN-L-YL)-ETHANONE (COMPOUND 3)
Figure imgf000051_0003
Figure imgf000052_0001
acid ethyl ester
Figure imgf000052_0002
To a solution of ethyl 4-pyridylacetate (0.121 mol) in EtOH (100 mL) is added concentrated hydrochloric acid (11 mL), followed by the addition of platinum oxide (8.8 mmol). The resulting mixture is hydrogenated under hydrogen atmosphere (50 psi) till no more hydrogen absorption occurs. The catalyst is filtered off and washed with EtOH (20 mL x 2). The filtrate is concentrated to dryness in vacuo to give the title compound as the hydrochloric acid salt.
Step 2. Preparation of [l-(4-acetyl-phenyl)-piperidin-4-yl] -acetic acid ethyl ester
Figure imgf000052_0003
To a solution of piperidin-4-yl-acetic acid ethyl ester hydrochloride (24 mmol) in anhydrous
DMSO (20 mL) is added l-(4-fluoro-phenyl)-ethanone (24 mmol) and potassium carbonate (24 mmol). The resulting mixture is heated at 900C for 36 hr. The reaction mixture is allowed to cool to rt, poured into cold water (100 mL), and extracted with EtOAc (40 mL x 3). The combined organic layers are washed with water and brine, dried over sodium sulfate, and concentrated. The crude product is purified through silica gel flash chromatography (hexane/ethyl acetate 2:1) to give the title compound as a yellow oil. 1H NMR (300 MHz, CDCl3) δ 7.86 (2H, d), 6.85 (2H, d), 4.15 (2H, q), 3.89 (2H, br, d), 2.90 (2H, dt), 2.51 (3H, s), 2.27 (2H, d), 2.04 (IH, m), 1.83 (2H, br, d), 1.38 (2H, dt), 1.27 (3H, t); LC-MS (M+l): 290.
Step 3. Preparation of [l-(4-acetyl-phenyl)-piperidin-4-yl] -acetic acid
Figure imgf000052_0004
To a solution of [l-(4-acetyl-phenyl)-piperidin-4-yl] -acetic acid ethyl ester (20.5 mol) in THF
(10 mL) and water (20 mL) is added lithium hydroxide (41 mmol). The resulting mixture is stirred at rt overnight. The organic solvent is evaporated, and the residue is acidified to pH = 4-5. The solid is collected by filtration, washed with water and dried at 600C in vacuo to give the title compound. 1H NMR (300 MHz, CDCl3) δ 7.86 (2H, d), 6.86 (2H, d), 3.90 (2H, br, d), 2.90 (2H, dt), 2.52 (3H3 s), 2.34 (2H, d), 2.04 (IH, m), 1.88 (2H, br, d), 1.39 (2H, ddd); LC-MS (M+l) 262.
Step 4. Preparation of 2-[ 1 -(4-acetyl-phenyl)-piperidin-4-yl] - 1 -(4-cyclobuty 1-piperazin- 1 -yl)-ethanone
Figure imgf000052_0005
ά bf P a6e l henyl)-piperidin-4-yl]-acetic acid (0.11 mmol) in anhydrous
DCM (2 mL) is added 1-cyclopentylpiperazine (l.leq.), TEA (0.22 mmol), and BOP (0.14 mmol). The resulting mixture is stirred at rt overnight. DCM is evaporated. The residue is dissolved in EtOAc (20 mL), washed with water (5 mL x 3) and brine, dried over sodium sulfate, and concentrated. The crude product is purified through PTLC to give the title compound. 1H NMR (300 MHz5 CDCl3) δ 7.85 (2H, d), 6.85 (2H, d), 3.89 (2H, br), 3.66 (2H, t), 3.49 (2H, t), 2.91 (2H, dt), 2.46-2.57 (8H, overlapped), 2.26 (2H, d), 2.12 (IH, m), 1.22-1.95 (12H, m); LC-MS (M+l) 398.
D. 1-(4-(4-[2-(4-CYCLOBUTYLPIPERAZIN-I-YL)^-OXOETHYL]-R-S-METHYLPIPERAZIN-I-
YL} PHENYL)ETHANONE (COMPOUND 4)
Figure imgf000053_0001
Stepl. Preparation of l-(chloroacetyl)-4-cyclobutylpiperazine
Figure imgf000053_0002
Dissolve 1-cyclobutylpiperazine (9.39 g, 67.1 mmol), Na2CO3 (17 g, 160 mmol) and chloroacetyl chloride (6.41 mL, 80.5 mmol) in EtOAc (200 mL) and water (200 mL). Stir the mixture for 2 h at ambient temperature. Extract the aqueous layer with EtOAc (2 x 200 mL). Combine, dry and evaporate the organic extracts to yield the title compound. LC-MS (M+l): 217.14.
Step 2. Preparation of l-[4-( R-3-methylpiperazin-l-yl)phenyl]ethanone
Figure imgf000053_0003
Dissolve 4-fluoroacetophenone (200 mg, 1.45 mmol) and R-2-methylpiperazine (580 mg, 5.79 mmol) in DMSO (4 mL). Heat the mixture at 140 0C in a microwave reactor. Cool and dilute with EtOAc (50 mL). Extract two times with IN NaOH (50 mL). Dry and evaporate the organic extract. Purify the crude product by silica gel column chromatography eluting first with EtOAc followed by EtOAc/MeOH/TEA(95:5:5) to yield the title compound. LC-MS (M+l): 219.12.
Step 3. Preparation of l-(4-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]-R-3-methylpiperazin-l- yl}phenyl)ethanone
Figure imgf000053_0004
,,
V- .ώ -. ^ (144 mg, 0.66 mmol), 1-
(chloroacetyl)-4-cyclobutylpiperazine (143 mg, 0.66 mmol), NaI (50 mg, 0.33 mmol) and K2CCb (200 mg, 1.45 mmol) in dry acetonitrile (7 mL). Heat the mixture at 50 0C overnight. Dilute with EtOAc (50 mL) and extract twice with IN NaOH (50 mL). Dry and evaporate the organic extract. Chromatograph the crude product on silica gel eluting with acetone/hexane/TEA(60/40/5) to yield the title compound. 1H NMR (CDCl3) δ 7.87 (d, 2H), 6.85 (d, 2H), 3.80-3.5 (m, 7H), 3.3.08-2.54(m, 6H), 2.52 (s, 3H), 2.42-2.39 (m, 2H), 2.23-2.16 (m, IH), 2.07-2.05 (m, 4H), 1.91-1.84 (m, 2H), 1.76- 1.66 (m, 2H), 1.16 (d, 3H); LC-MS (M+l) 399.13.
E. L-(4-ACETYLPHENYL)-4-[2-(4-CYCLOBUTYLPIPERAZIN-L-YL)-2-OXOETHYL]PIPERAZIN-2-ONE (COMPOUND 5)
Figure imgf000054_0001
Step 1. Preparation of benzyl 4-(4-acetylphenyl)-3-oxopiperazine-l-carboxylate
Figure imgf000054_0002
In a sealed tube, dissolve benzyl 3-oxopiperazine-l-carboxylate (500 mg, 2.13 mmol), A- bromo-acetophenone (425 mg, 2.13 mmol), Cs2CO3 (1.4 g, 4.26 mmol), Pd2dba3 (195 mg, 0.213 mmol) and xantphos (124 mg, 0.213 mmol) in dry dioxane (10 mL). Degas the mixture with Argon and heat at 115 0C overnight. Cool and dilute with EtOAc (25 mL). Filter the solution through Ce lite and evaporate the filtrate. Chromatograph the crude product on silica eluting with hexane/acetone (2: 1) to yield the title compound. LC-MS (M+l): 353.14. Step 2. Preparation of l-(4-acetylphenyl)piperazin-2-one
Figure imgf000054_0003
Dissolve benzyl 4-(4-acetylphenyl)-3-oxopiperazine-l-carboxylate (420 mg, 1.20 mmol) in MeOH (100 mL). Flush the flask with N2 and add 10 % Pd/C (100 mg). Hydrogenate overnight under a hydrogen filled balloon. Remove the catalyst by filtration through Celite and wash with MeOH. Evaporate the solvent to yield the title compound. LC-MS (M+l): 219.13. Step 3. Preparation of 1-(4-acetylphenyl)-4-[2-(4-cyclobutylpiperazin- 1 -yl)-2-oxoethyl]piperazin-2- one
Figure imgf000055_0001
The intermediate obtained from step 2 is reacted with l-(chloroacetyl)-4-cyclobutylpiperazine as in Example ID, step 3 to give the title compound. LC-MS (M+l): 399.21.
F. 2-BROMO-5- {4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-0X0ETHYL]PIPERAZIN- 1 -YL}PYRAZINE (COMPOUND 6)
Figure imgf000055_0002
Step 1. Preparation of 2-bromo-5-piperazin-l-ylpyrazine
Figure imgf000055_0003
Dissolve 2-piperazin-l-ylpyrazine (4.92 g, 30 mmol) in dry CH2Cl2 (100 mL). Add NBS
(10.7 g, 60 mmol) in portions over one hour. Stir the mixture at ambient temperature overnight.
Dilute the mixture with IN NaOH and filter through Celite. Wash the Celite with CH2Cl2 (2 x 100 mL). Remove the organic layer and extract the aqueous layer with CH2Cl2 (100 mL). Combine, dry and evaporate the organic extracts to yield the title compound. LC-MS (M+l) 243.05.
Step 2. Preparation of 2-bromo-5-(4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin-l- yl}pyrazine
Figure imgf000055_0004
The intermediate obtained from step 1 is reacted with l-(chloroacetyl)-4-cyclobutylpiperazine as in example ID, step 3 to give the title compound. LC-MS (M+l): 425.1.
G. 6- (4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]PIPERAZIN- 1 -YL} PYRID AZINE-3 -
CARBONITRILE (COMPOUND 7)
Figure imgf000055_0005
Srep'Ψϊ Jfreparatiόn"OTi d!n yl 'Φ IZ- '-oyclobutylpiperazin-l-yO^-oxoethylJpiperazine-l-carboxylate
Figure imgf000056_0001
Place benzyl piperazine-1-carboxylate (6.10 g, 27.7 mmol), l-(chloroacetyl)-4- cyclobutylpiperazine (6.00 g, 27.7 mmol), NaI (100 mg, 0.66 mmol) and K2CO3 (7.65 g, 55.4 mmol) in acetonitrile (100 mL). Heat the mixture at 55 0C overnight. Filter the solution though Celite and wash the Celite bed with EtOAc (50 mL). Evaporate the solution and partition the residue between
CH2Cl2 (100 mL) and 1 N NaOH (100 mL). Remove the organic layer and dry over MgSO4.
Evaporate the organic extract and chromatograph the crude product on silica gel eluting with EtOAc first, followed by EtOAc/MeOH (95:5) and EtOAc/MeOH/TEA(95:5:5) to yield the title compound. LC-MS (M+l) 400.26.
Step 2. Preparation of l-cyclobutyl-4-(piperazin-l-ylacetyl)piperazine
Figure imgf000056_0002
Dissolve benzyl 4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazine-l-carboxylate (9.33 g, 23.3 mmol) in MeOH and add flush the flask with N2. Add 10% Pd/C (300 mg) and hydrogenate at 50 psi for 4 h. Filter the mixture through Celite to remove the catalyst and wash with MeOH. Evaporate the filtrate to yield the title compound. LC-MS (M+l) 267.30.
Step 3. Preparation of 3-chloro-6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin-l- yl}pyridazine
Figure imgf000056_0003
Dissolve l-cyclobutyl-4-(piperazin-l-ylacetyl)piperazine (2.05 g, 5.46 mmol) and 3,6- dichloropyridazine (810 mg, 5.46 mmol) in dry DMSO (25 mL). Add K2CO3 (3.77 g, 27.3 mmol) and heat the mixture at 120 0C overnight. Cool and partition between CH2Cl2 (100 mL) and 1 N NaOH (150 mL). Extract the aqueous phase with CH2Cl2 (2 x 100 mL). Combine, dry and evaporate the organic extracts. Triturate the resulting residue with ether and filter off the solid (product). Evaporate the filtrate and chromatograph the resulting residue with EtOAc followed by EtOAc/MeOH (95:5) and EtOAc/MeOH/TEA(95:5:5) to yield additional product. 1H NMR (CDCl3) δ 7.21 (d, IH), 6.89 (d, IH), 3.68-3.59 (m, 8H), 3.22 (s, 2H), 2.78-2.62 (m, 5H), 2.38-2.28 (m, 4H), 2.13-2.03 (m, 2H), 1.93-1.8 (m, 2H), 1.73-1.69 (m, 2H); LC-MS (M+l) 378.98.
Figure imgf000057_0001
carbonitrile
Figure imgf000057_0002
In a sealed tube, dissolve 3-chloro-6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin- l-yl}pyridazine (205 mg, 0.541 mmol), Zn(CN)2 (39 mg, 0.325 mmol), Pd2dba3 (12.3 mg, 0.0135 mmol) and DPPF (15 mg, 0.027 mmol) in DMF (3 mL). Add 1 drop Of H2O and degas the solution with N2. Seal the tube and heat at 120 0C overnight. Cool and dilute with 3 N HCl (30 mL). Extract with CH2Cl2 (2 x 25 mL). Discard these extracts. Basify the aqueous layer with 10 N NaOH and extract with CH2Cl2 (3 x 35 mL). Combine, dry (MgSO^ and evaporate the organic extracts to yield the title compound. 1H NMR (CDCl3) δ 7.44 (d, IH), 6.83 (d, IH), 3.84-3.1 (m, 4H), 3.66-3.58 (m,
4H), 3.26 (s, 2H), 2.75-2.66 (m, 5H), 2.33-2.29 (m, 4H), 2.07-2.01 (m, 2H), 1.91-1.85 (m, 2H), 1.76-
1.70 (m, 2H); LC-MS (M+l) 370.00.
H. 3 - (4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]PIPERAZIN- 1 -YL} -6-[(2- METHYLPYRROLiDiN-l-YL)cARBONYL)]PYRiDAziNE (COMPOUND 8)
Figure imgf000057_0003
Step 1. Preparation of 6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethylJpiperazin-l-yl}pyridazine-3- carboxylic acid dihydrochloride
Figure imgf000057_0004
Dissolve 6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin-l-yl}pyridazine-3- carbonitrile (338 mg, 0.92 mmol) in 12 N HCl (6 mL). Heat at 100 0C for 3 h. Cool and remove the solvent under reduced pressure to yield the title compound. LC-MS (M+l) 389.20.
Step 2. Preparation of 3-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin-l-yl}-6-[(2- methylpyrrolidin- 1 -yl)carbonyl)]pyridazine
Figure imgf000057_0005
Dissolve 6- {4-[2-(4-cyclobutylpiperazin- 1 -yl)-2-oxoethyl]piperazin- 1 -yl} pyridazine-3 - carboxylic acid dihydrochloride (106 mg, 0.229 mmol) and 2-methylpyrrolidine (100 mg, 1.41 mmol) in dry CH2Cl2 (5 mL) and TEA (0.5 mL). Cool the mixture in an ice bath and add DMC (77 mg, 0.46 11U11U17V aτirς me-MiiW fSr l:;iln"'aflnlbient temperature. Add CH2Cl2 (25 mL) and extract with 1 N NaOH (2 x 25 mL). Dry and evaporate the organic extract. Chromatograph the crude product on silica eluting with EtOAc/MeOH/TEA (95:5:5) to yield the title compound. 1H NMR (CDCl3) δ 7.86 (d, IH), 6.94 (d, IH), 4.45-4.39 (m, IH), 4.13-4.09 (m, IH), 3.94-3.80 (m, IH), 3.84-3.3.72 (m, 4H), 3.65 (br m, 4H), 3.24 (s, 2H), 2.79-2.64 (m, 5H), 2.34-2.2.31 (br m, 4H), 2.11-1.59 (m, 1OH), 1.42- 1.09 (m, 3H); LC-MS (M+l) 456.09.
I. 1 -(6- {4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]PIPERAZIN- 1 -YL} P YRIDAZIN-3 - YL)ETHANONE (COMPOUND 9)
Figure imgf000058_0001
In a sealed tube, dissolve 3-chloro-6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]- piperazin-l-yl}pyridazine (150 mg, 0.396 mmol), tributyl-(l-ethoxyvinyl)tin (157 mg 0.435 mmol), and Pd(PPh3)4 (23 mg, 0.020 mmol) in toluene (5 mL). Degas the mixture with N2 and seal the tube. Heat the solution at 120 0C overnight. Cool and filter through Celite. Wash the Celite bed with EtOAc (25 mL). Evaporate the solvent and dissolve the residue in IN HCl and heat at 50 0C for 2 h. Cool and extract with CH2Cl2 (2 x 25 mL). Discard the extracts. Basify the aqueous phase with IO N NaOH and extract with CH2Cl2 (2 x 25 mL). Combine the organic extracts and wash once with saturated aqueous KF solution (50 mL). Dry the organic extract and evaporate to yield the title compound. 1H NMR (CDCl3) δ 7.89 (d, IH), 6.90 (d, IH), 3.85 (t, 4H), 3.64-3.59 (m, 4H), 3.26 (s, 2H), 2.77 (s, 3H), 2.75-2.66 (m, 5H), 2.33-2.30 (m, 4H), 1.91-1.68 (m, 4H), 1.43-1.40 (m, 2H); LC- MS (M+l) 387.11.
J. 3- (4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]PIPERAZIN- 1 -YL} -6-PHENYLPYRIDAZINE
(COMPOUND 10)
Figure imgf000058_0002
In a sealed vial, dissolve 3-chloro-6-(4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperazin- l-yl}pyridazine (15.1 mg, 0.04 mmol), phenyl boronic acid (9.8 mg, 0.08 mmol), and Pd(PPh3)4 (2.3 mg, .002 mmol) in dioxane (0.7 mL) and 2N K2CO3 (0.1 mL). Degas with N2 and seal the vial. Heat the mixture at 85 0C overnight. Cool and partition between EtOAc (0.5 mL) and IN NaOH (0.5 mL).
Extract the organic phase and place directly on an SCX ion exchange resin cartridge. Wash the resin with EtOAc/MeOH (9: 1). Discard this wash. Wash the resin with EtOAc/MeOH/TEA(9:l:l) and collect. Remove the solvent to yield the title compound. 1H NMR (CDCl3) δ 8.00 (dd, 2H) 7.66 (d, ■ y Wφβ.S m W3 (t, 4H), 3.66-3.63 (m, 4H), 3.26 (s, 2H), 2.75-2.66 (m. 5H), 2.35-2.29 (m, 4H), 1.88-1.84 (ra, 2H), 1.74-1.71 (m, 2H) 1.35-1.2 (m, 2H); LC-MS (M+l) 421.05.
K. 3- {4-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-0X0ETHYL]PIPERAZIN- 1 -YL} -6-( 1 ,3 -THIAZ0L-2- YL)PYRIDAZINE (COMPOUND 11)
Figure imgf000059_0001
In a sealed tube, dissolve 3-chloro-6-{4-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]- piperazin-l-yl}pyridazine (100 mg, 0.264 mmol), and 2-tributylstannylthiazole (197 mg, 0.528 mmol), Pd(PPh3)4 (30 mg, 0.262 mmol) in toluene (5 mL). Degas with N2 and seal the tube. Heat the mixture at 120 0C overnight. Cool and filter the solution through Celite. Wash the Celite bed with EtOAc (25 mL). Evaporate the solvent and dissolve the residue in 3N HCl (50 mL). Extract with CH2Cl2 (2 x 25 mL). Discard these organic extracts. Basify the aqueous phase with IO N NaOH and extract with CH2Cl2 (2 x 40 mL). Combine these organic extracts and wash once with saturated aqueous KF solution (50 mL). Dry the organic extract and evaporate to yield the title compound. 1H NMR (CDCl3) δ 8.07 (d, IH) 7.88 (d, IH), 7.37 (d, IH) 6.99 (d, IH), 3.78 (t, 4H), 3.66-3.62 (m, 4H), 3.26 (s, 2H), 2.75-2.66 (m, 5H), 2.35-2.29 (m, 4H), 2.07-2.00 (m, 2H), 1.90-1.84 (m, 2H), 1.74-1.71 (m, 2H); LC-MS (M+l) 428.17.
L. 1-BIPHENYL-3-YL-4-[2-(4-CYCLOBUTYLPIPERAZΓN-1-YL)-2-OXOETHYL]PIPERAZINE (COMPOUND 12)
Figure imgf000059_0002
In a sealed vial, dissolve l-(3-bromophenyl)-4-[2-(4-cyclobutylpiperazin-l-yl)-2- oxoethyl]piperazine (17 mg, 0.04 mmol), phenyl boronic acid (9.8 mg, 0.08 mmol), and Pd(PPh3)4 (2.3 mg, .002 mmol) in dioxane (0.7 mL) and 2N K2CO3 (0.1 mL). Degas with N2 and seal the vial. Heat the mixture at 85 0C overnight. Cool and add partition EtOAc (0.5 mL) and IN NaOH (0.5 mL). Extract the organic phase and place directly on SCX ion exchange resin. Wash the resin with EtOAc/MeOH (9: 1). Discard this wash. Wash the resin with EtOAc/MeOH/TEA(9: 1 : 1) and collect. Remove the solvent to yield the title compound. 1H NMR (CDCl3) δ 7.59-7.56 (m, 2H) 7.45-7.40 (m, 2H), 7.36-7.31 (m, 2H), 7.13-7.07 (m, 2H) 6.94-6.90 (m, IH), 3.64 (t, 4H), 3.29-3.25 (m, 6H), 2.73- 2.67 (m, 5H), 2.33-2.27 (m, 4H), 2.06-2.02 (m, 2H), 1.90-1.83 (m, 2H), 1.75-1.69 (m, 2H); LC-MS (M+l) 419.06. YL}PHENYL)PYRR0LIDIN-2-0NE (COMPOUND 13)
Figure imgf000060_0001
In a sealed tube, place l-(3-bromophenyl)-4-[2-(4-cyclobutylpiperazin-l-yl)-2- oxoethyljpiperazine (150 mg, 0.355 mraol), 2-pyrrolidone (90 mg, 1.07 mmol), Cs2CO3 (346 mg,
1.065 mmol), xantphos (20 mg, 0.036 mmol), and Pd2dba3 (32 mg, 0.355 mmol). Add dioxane (6 mL) and degas the mixture with N2. Seal the tube and heat at 120 0C overnight. Cool and partition between EtOAc (50 mL) and IN NaOH (50 mL). Extract with EtOAc (2 x 50 mL). Combine, dry and evaporate the organic extracts. Purify the crude product by PTLC eluting with EtOAc/MeOH/TEA(95:5:5) to yield the title compound. 1H NMR (CDCl3) δ 7.48 (d, 2H) 6.3 (d, 2H),
3.84 (t, 2H), 3.66 (br m, 4H), 3.25 (s, 2H), 3.18 (t, 4H), 2.76-2.57 (m, 7H), 2.35-2.30 (m, 4H), 2.20-
2.02 (m, 4H), 1.98-1.86 (m, 2H), 1.77-1.68 (m, 2H); LC-MS (M+l) 426.09.
EXAMPLE 2 Preparation of Additional Representative Dipiperazinyl Ketones and Related Analogues
A. 4-CYCLOPENTYL-PIPERAZINE-l-CARBOXYLIC ACID [l-(4-ACETYL-PHENYL)-PlPERIDIN-4-YL]-
AMiDE (COMPOUND 14)
Figure imgf000060_0002
Step 1. Preparation of l-[4-(4-amino-piperidin-l-yl)-phenyl]-ethanone
Figure imgf000060_0003
To a solution of piperidin-4-yl-carbamic acid tert-butyl ester (24 mmol) in anhydrous DMSO
(20 mL) is added l-(4-fluoro-phenyl)-ethanone (24 mmol) and potassium carbonate (24 mmol). The resulting mixture is heated at 900C for 36 hr. The reaction mixture is allowed to cool to rt, poured into cold water (100 mL), and extracted with EtOAc (40 mL x 3). The combined organic layers are washed with water and brine, dried over sodium sulfate, and concentrated. The crude product is purified through silica gel flash chromatography (hexane/ethyl acetate 2:1) to give [l-(4-acetyl- phenyl)-piperidin-4-yl]-carbamic acid tert-butyl ester, which is refluxed in HCl-MeOH solution. Removing MeOH in vacuo gives the hydrochloride salt of the title compound. Step 2. Preparation of 4-cyclopentyl-piperazine-l-carboxylic acid [l-(4-acetyl-phenyl)-piperidin-4- yl] -amide
Figure imgf000061_0001
To a suspension of sodium bicarbonate (40 mmol) in acetonitrile (50 mL) is added hydrochloride salt of l-[4-(4-amino-piperidin-l-yl)-phenyl]-ethanone (10 mmol) and /Miitrophenyl chloroformate (10 mmol) at 00C. The mixture is stirred at rt for 1 hour. A solution of 1- cyclopentylpiperazine (10.5 mmol) and TEA (25 mmol) in acetonitrile (15 mL) is added to the mixture at rt. The resulting mixture is stirred until no p-nitrophenoxyl carbamate remained by TLC.
The mixture is then concentrated, diluted with EtOAc (100 mL) and washed with aqueous potassium carbonate (2 x 80 mL), and dried over MgSO4. Removal of the solvent, followed by PTLC purification gives the title compound. 1H NMR (300 MHz, CDCl3) δ 7.85 (d, 2H), 6.84 (d, 2H), 4.41
(d, IH), 3.81-3.98 (m, 3H), 3.52-3.40 (m, 4H), 3.02 (t, 2H), 2.2.66-2.43 (m, 8H), 2.15-2.01 (m, 2H),
1.97-1.82 (m, 2H), 1.78-1.64 (m, 2H), 1.60-1.41 (m, 6H); LC-MS (M+ 1) 399.5.
B. 1 - (4-[4-(4-CYCLOBUTYL-PIPERAZINE- 1 -CARBONYL)-PIPERAZIN- 1 -YL]-PHENYL}-ETHANONE (COMPOUND 15)
Figure imgf000061_0002
Step 1. Preparation of l-{4-[4-(imidazole-l-carbonyl)-piperazin-l-yl]-phenyl}-ethanone
Figure imgf000061_0003
To a suspension of CDI (60 mmol) in THF (100 mL) is added l-(4-piperazin-l-yl-phenyl)- ethanone (55 mmol). The mixture is refluxed for 24 hours before cooling to rt. The solvent is removed. The residue is dissolved in DCM (100 mL), and washed with water (2 x 50 mL). The organic layer is dried over MgSθ4 and solvent removed to give the title compound, which is used in the next step reaction without further purification. . Step 2. Prepartion of 1-{4-[4-cyclobutyl-piperazine-1-carbonyl)-piperazin- 1 -yl]-phenyl} -ethanone
Figure imgf000062_0001
To a solution of l-{4-[4-(imidazole-l-carbonyl)-piρerazin-l-yl]-phenyl}-ethanone (8 mmol) in acetonitrile (15 mL) is added MeI (32 mmol). The mixture is stirred at rt for 24 h. Solvent is removed in vacuo to yield a light yellow solid. The solid is dissolved in DCM (40 mL), followed by the addition of 1-cyclobutylpiperazine (8 mmol) and TEA (8 mmol). The mixture is stirred at rt for
24 h, washed with aqueous sodium bicarbonate (20 mL). The organic layer is dried over MgSC>4 and solvent removed to give the crude product, which is purified by column chromatography (5% MeOH in DCM) to give the pure title compound. 1H NMR (300 MHz, CDCl3) δ 7.87 (d, 2H), 6.86 (d, 2H), 3.49-3.33 (m, 12H), 2.76-2.71 (m, IH), 2.53 (s, 3H), 2.32 (t, 4H), 2.05-2.01 (m, 2H), 1.91-1.85 (m,
2H), 1.76-1.69 (m, 2H); LC-MS (M+l) 371.1.
C. N- { 1 -[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]PIPERIDIN-4-YL} BENZAMIDE
(COMPOUND 16)
Figure imgf000062_0002
Step 1. Preparation of tert-butyl {l-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperidin-4- yl} carbamate
Figure imgf000062_0003
To a solution of l-(chloroacetyl)-4-cyclobutylpiperazine (10 mmol) and tert-butyl piperidin- 4-ylcarbamate (10 mmol) in acetonitrile (20 mL) is added potassium carbonate (20 mmol). The mixture is stirred at rt overnight. To the mixture is added aqueous sodium bicarbonate (15 mL) and DCM (50 mL). The layers are separated and the aqueous layer is extracted with DCM (30 mL). The combined organic layer is dried (MgSC^) and the solvent removed in vacuo to give the title compound, which is pure enough to be used in the next step reaction.
Step 2. Preparation of l-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperidin-4-amine
Figure imgf000062_0004
To a solution of tert-butyl {l-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperidin-4- yl}carbamate (9.2 mmol) in DCM, is added 4N HCl in dioxane (10 mL) slowly. The mixture is heated at 50 0C for 30 min. The solvent is removed in vacuo to give the title compound as a white solid (trihydrochloric acid salt).
Step 3. Preparation ofN-{l-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]piperidin-4-yl}benzamide
Figure imgf000063_0001
To a suspension of l-[2-(4-cyclobutylpiperazin~l-yl)-2-oxoethyl]piperidin-4- amine trihydrochloric acid salt (30 mg) in DCM (5 mL), is added benzoyl chloride (30 mg) and TEA (100 mg). The mixture is stirred at rt for one hour. To the mixture is added aqueous sodium bicarbonate (5 mL) and DCM (10 mL). The layers are separated and the organic layer is dried (MgSC^) and solvent removed in vacuo to give the crude product, which is purified by PTLC (5% MeOH in DCM) to give the title compound. LC-MS (M+ 1): 385.1.
B. l-BENZOYL-4-[2-(4-CYCLOBUTYLPIPERAZIN-l-YL)-2-OXOETHYL]PIPERAZINE (COMPOUND 17)
Figure imgf000063_0002
Dissolve l-cyclobutyl-4-(piperazin-l-ylacetyl)piperazine (32 mg, 0.12 mmol) and benzoic acid (17.6 mg, 0.14 mmol) in dry DMA (0.75 mL), TEA (0.033 mL, 0.24 mmol) and toluene (0.75 mL). Add a solution of DMC (41 mg, 27.3 mmol) in acetonitrile (1.2 mL). Heat the mixture at 50 0C for 3 h. Cool and concentrate. Partition the residue between EtOAc (10 mL) and 1 N NaOH (10 mL). Extract the organic phase and place directly on an SCX ion exchange resin cartridge. Wash the resin first with EtOAc (4 mL). Discard this wash. Second, wash the resin with EtOAC/MeOH/TEA (10/1/1). Collect this wash and evaporate to yield the title compound. 1H NMR (CDCl3) 8 7.41-7.39 (m, 5H), 6.89 (d, IH), 3.86-3.78 (m, 2H), 3.63-3.57 (m, 4H), 3.44-3.40 (m, 2H), 3.23 (s, 2H), 2.74- 2.66 (m, IH), 2.6-2.43 (m, 4H) 2.33-2.26 (m, 4H), 2.08-2.00 (m, 2H), 1.90-1.84 (m, 2H), 1.76-1.70 (m, 2H); LC-MS (M+l) 371.02. C. 2-BENZYL-1-[2--(4-OYCLOBUTYLPIPERAZIN-1-YL)- 2-XOETHYL]SPIRO[ISOINDOLE- 1 ,4'-PIPERIDIN]-
3 (2H)-ONE (COMPOUND 18) AND 2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL 2-BENZYL-3 -
OXO-2,3 -DIHYDRO- 1 Η-SPIROflSOINDOLE- 1 ,4'-PIPERIDINE]-l '-CARBOXYLATE (COMPOUND 19)
Figure imgf000064_0001
Step 1. Preparation of tert-butyl 4-[benzyl(2-iodobenzoyl)amino]-3,6-dihydropyridine-l(2H)- carboxylate
Figure imgf000064_0002
A mixture of tert-butyl 4-oxopiperidine-l-carboxylate (7.36 g, 36.96 mmol) and benzylamine (36.96 mmol) in toluene (60 ml) is refluxed for 4 h with a Dean-Stark trap to remove water formed. Solvent is removed in vacuo and the resulting thick oil is dissolved in toluene (70 ml). TEA (10.3 ml, 73.92 mmol) is added followed by iodobenzoyl chloride (36.96 mmol). The mixture is heated at 80 0C for 2 h, and then cooled to rt. Water (80 ml) is added, the layers are separated and the aqueous layer is extracted with EtOAc (60 ml). The combined extracts are washed with brine (60 ml), dried over Na2SO4 and evaporated. The residue is purified by flash column to give the title compound as a light yellow oil.
Step 2. Preparation of tert-butyl 2-benzyl-3-oxo-2,2',3,3'-tetrahydro-rH-spiro[isoindole-l,4'- pyridine]- 1 '-carboxylate
Figure imgf000064_0003
A mixture of tert-butyl 4-[benzyl(2-iodobenzoyl)amino]-3,6-dihydropyridine-l(2H)- carboxylate (4.63 mmol), Pd(OAc)2 (73 mg, 0.32 mmol, 7 mol%), PPh3 (170 mg, 0.65 mmol, 14 mol%), K2CO3 (959 mg, 6.95 mmol) and Et4NCl (537 mg, 3.24 mmol) in CH3CN (30 ml) is degassed by Argon for 15 min then heated at 110 0C in a sealed tube overnight. Water (40 ml) is added, the
Figure imgf000065_0001
aξiήdB %er is extracted with EtOAc (40 ml). The combined extracts are washed with brine (40 ml), dried over Na2SC^ and evaporated. The residue is purified by flash column to give the title compound as a light yellow oil.
Step 3. Preparation of 2-benzyl-2',3'-dihydiO-lΗ-spiro[isoindole-l,4l-pyridin]-3(2H)-one
Figure imgf000065_0002
To solution of tert-butyl 2-benzyl-3-oxo-2,2',3,3'-tetrahydro-lΗ-spiro[isoindole-l,4'- pyridine]-l'-carboxylate (4 mmol) in dioxane (10 ml) is added HCl solution in dioxane (4N, 15 ml, 60 mmol) and the mixture is stirred at rt overnight. The solvent is removed and to the residue is added aqueous NaHCO3 solution (30 ml) and EtOAc (30 ml). The layers are separated and the aqueous layer is extracted with EtOAc (30 ml). The combined extracts are washed with brine (30 ml), dried over Na24 and evaporated. The residue is purified by flash column to give the title compound as an off-white solid.
Step 4. Preparation of 2-benzylspiro[isoindole-l,4'-piperidin]-3(2H)-one
Figure imgf000065_0003
To a solution of 2-benzyl-2',3'-dihydro-l'H-spiro[isoindole-l,4'-pyridin]-3(2H)-one (3.6 mmol) in HOAc (20 ml) is added 10% Pd on C (100 mg) and the mixture is hydrogenated at 50 psi overnight. The catalyst is filtered and washed with methanol (2 x 10 ml) and the combined filtrate is evaporated to dryness. The residue is partitioned between aqueous NaHCO3 solution (30 ml) and EtOAc (30 ml). The layers are separated and the aqueous layer is extracted with EtOAc (30 ml). The combined extracts are washed with brine (30 ml), dried over Na24 and evaporated. The resulting title product as a light yellow solid is used in the next step without further purification. piperidin]-3(2H)-one and 2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl 2-benzyl-3-oxo-2,3-dihydro-lΗ- spiro[isoindole- 1 ,4'-piperidine]- 1 '-carboxylate
Figure imgf000066_0001
To a solution of 2-benzylspiro[isoindole-l,4'-piperidin]-3(2H)-one (1.84 mmol) and 1- (chloroacetyl)-4-cyclobutylpiperazine (1.84 mmol) in CH3CN (8 ml) is added K2CO3 (761 mg, 5.52 mmol). The resulting suspension is stirred at rt overnight. Water (10 ml) and EtOAc (10 ml) is added and the layers are separated. The aqueous layer is extracted with EtOAc (20 ml) and the combined extracts are washed with brine (20 ml), dried over Na2SO4 and evaporated. The residue is purified by flash column to give 2-benzyl-r-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]spiro[isoindole-l,4'- piperidin]-3(2H)-one as an off-white solid (LC-MS (M+l): 472.3) and 2-(4-cyclobutylpiperazin-l-yl)- 2-oxoethyl 2-benzyl-3-oxo-2,3-dihydro-rH-spiro[isoindole-l,4'-piperidine]-r-carboxylate as a minor product.
D. l'-[2-(4-CYCLOBUTYLPIPERAZIN-l-YL)-2-OXOETHYL]SPIRO[ISOINDOLE-l,4'- PEPERIDIN]-3(2H)-ONE (COMPOUND 20)
Figure imgf000066_0002
Step 1. Preparation of l'-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]-2-(2,4- dimethoxybenzyl)spiro[isoindole- 1 ,4'-piperidin]-3 (2H)-one
Figure imgf000066_0003
The title compound is obtained as described in Example 4A. LC-MS (M+l): 532.3. Sp S* re'parat yclo )utylpiperazin-l-y -2-oxoet y ]spiro[isoindole-l,4'-piperi in]- 3(2H)-one
Figure imgf000067_0001
At O0C, 1 '-[2-(4-cyclobutylpiperazin- 1 -yl)-2-oxoethyl]-2-(2,4-dimethoxybenzyl)spiro [isoindole-l,4'-piperidin]-3(2H)-one (1.4 mmol) is added to trifluoroacetic acid (10 ml) and the resulting solution is heated at 60 0C for 4 h. Solvent is removed and the residue is partitioned between aqueous NaHCO3 solution (20 ml) and EtOAc (20 ml). The layers are separated and the aqueous layer is extracted with EtOAc (20 ml). The combined extracts are washed with brine (20 ml), dried over Na24 and evaporated. The residue is purified by flash column to give the title compound as a off-white solid. LC-MS (M+ 1): 382.2.
E. Γ-[2-(4-CYCLOBUTYLPIPERAZIN-1-YL)-2-OXOETHYL]-1-METHYLSPIRO[INDOLE-3,4'-PIPERIDIN]- 2(1H)-ONE (COMPOUND 21)
Figure imgf000067_0002
Step 1. Preparation of tert-butyl 4-[(2-bromophenyl)carbamoyi]piperidine-l-carboxylate
Figure imgf000067_0003
At 0 0C, to a solution of l-(te/"?-butoxycarbonyl)piperidine-4-carboxylic acid (2.29 g, 10 mmol), pyridine (2.1 ml, 26 mmol) in CH2Cl2 (20 ml) is added SOCl2 (0.89 ml, 12.2 mmol) dropwise and the resulting solution is stirred at rt for 30 min. The solution is cooled to 0 0C and a solution of 2- bromoaniline (10 mmol), TEA (4.9 ml, 35 mmol), and DMAP (122 mg, 1 mmol) in CH2Cl2 (20 ml) is added dropwise. The mixture is stirred at 0 0C to rt overnight. The reaction mixture is washed with water (2 x 30 ml), and brine (30 ml), dried over Na24 and evaporated in vacuo. The residue is purified by flash column to give the title compound as a light yellow oil. Step 2. Preparation of tert-butyl 4-[benzyl(2-bromophenyl)carbamoyl]piperidine-1-carboxylate
Figure imgf000068_0001
A mixture of tert-butyl 4-[(2-bromophenyl)carbamoyl]piperidine-l-carboxylate (8- mmol), benzylbromide (1.05 ml, 8.8 mmol) and Cs2CO3 (5.2 g, 16 mmol) in DMF (20 ml) is stirred at it overnight. DMF is removed in vacuo and the residue is partitioned between H2O (40 ml) and EtOAc (40 ml). The layers are separated and the aqueous layer is extracted with EtOAc (20 ml). The combined extracts are washed with brine (20 ml), dried over Na24 and evaporated. The residue is purified by flash column to give the title compound as a light yellow oil.
Step 3. Preparation of tert-butyl l-benzyl-2-oxo-l,2-dihydro-lΗ-spiro[indole-3,4'~piperidine]-r- carboxylate
Figure imgf000068_0002
A mixture of tert-butyl 4-[benzyl(2-bromophenyl)carbamoyl]piperidine-l -carboxylate (5.3 mmol), Pd(dba)3 (340 mg, 0.37 mmol), BINAP (330 mg, 0.53 mmol) and tBuONa (770 mg, 8 mmol) in dioxane (120 ml) is degassed by Argon then heated at 110 0C in a sealed tube overnight. Water (100 ml) is added to the mixture, the layers are separated and the aqueous layer is extracted with EtOAc (100 ml). The combined extracts are washed with brine (120 ml), dried over Na24 and evaporated. The residue is purified by flash column to give the title compound as a light yellow oil.
Step 4. Preparation of l-benzylspiro[indole-3,4'-piperidin]-2(lH)-one
Figure imgf000068_0003
To a solution of tert-butyl l-benzyl-2-oxo-l,2-dihydro-lΗ-spiro[indole-3,4'-piperidine]-r- carboxylate (4 mmol) in dioxane (10 ml) is added HCl solution in dioxane (4N, 15 ml, 60 mmol) and the mixture is stirred at rt overnight. The solvent is removed and the residue is partitioned between aqueous NaHCO3 (40 ml) and EtOAc (40 ml). The layers are separated and the aqueous layer is extracted with EtOAc (20 ml). The combined extracts are washed with brine (30 ml), dried over l &Tα m cvapdr :'' ielit e ωipound (a colorless oil) is used in the next step without further purification.
Step 5. Preparation of spiro[indole-3,4'-piperidin]-2(lH)-one
Figure imgf000069_0001
At -78 0C, to liquid NH3 (20 ml) is added dropwise a solution of l-benzylspiro[indole-3,4'- piperidin]-2(lH)-one (2 mmol) in THF (30 ml) and the mixture is stirred at -78 0C for 10 min. Li (42 mg, 6 mmol) is added in 3 portions and the resulting dark blue solution is stirred at -78 0C for 2 h. Anhydrous EtOH (1 ml) is added dropwise and the mixture is allowed to warm to rt overnight. Solvent is removed in vacuo and the resulting title compound (a light yellow solid) is used in the next step without further purification.
Step 6. Preparation of r-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]spiro[indole-3,4'-piperidin]- 2(lH)-one
Figure imgf000069_0002
The solid spiro[indole-3,4'-piperidin]-2(lH)-one obtained from step 5 (2 mmol) is stirred with l-chloroacetyl-4-cyclobutylpiperazine (2 mmol) and K2CO3 (828 mg, 6 mmol) in CH3CN (10 ml) at rt overnight. Water (10 ml) and EtOAc (10 ml) is added and the layers are separated. The aqueous layer is extracted with EtOAc (20 ml) and the combined extracts are washed with brine (20 ml), dried over Na2SO4 and evaporated. The residue is purified by flash column to give the title compound as an off-white solid. LC-MS (M+l): 382.2.
Step 7. Preparation of l'-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]-l-methylspiro[indole-3,4'- piperidin]-2( 1 H)-one
Figure imgf000069_0003
2(lH)-one (0.136 mmol), iodomethane (0.544 mmol) and Cs2CO3 (177 mg, 0.544 mmol) in DMF (3 ml) is heated in a sealed tube at 65 0C overnight. DMF is removed in vacuo and the residue is partitioned between water (5 ml) and EtOAc (10 ml). The layers are separated and the aqueous layer is extracted with EtOAc (10 ml). The combined extracts are washed with brine (20 ml), dried over Na2SO4 and evaporated. Purification of the residue with PTLC gives the title compound as a white solid. LC-MS (M+!): 396.3.
F. 1 '-[2-(4-CYCLOBUTYLPIPERAZIN- 1 -YL)-2-OXOETHYL]- 1 -PYRIDIN-2-YLSPIRO[INDOLE-3,4'- PIPERIDIN]-2(1H)-ONE (COMPOUND 22)
Figure imgf000070_0001
A mixture of l'-[2-(4-cyclobutylpiperazin-l-yl)-2-oxoethyl]spiro[indole-3,4'-piperidin]- 2(lH)-one (0.052 mmol), 2-bromopyridine (0.078 mmol), CuI (2 mg, 0.01 mmol), K3PO4 (28 mg, 0.13 mmol), glycine (lmg, 0.012 mmol) in 1,4-dioxane (3 ml) is degassed by Argon then heated in a sealed tube at 110 0C for 24 h. Solid is filtered and the filtrate is concentrated and purified by PTLC to give the title compound as a light yellow solid. LC-MS (M+l): 459.3.
G. l-BENZYL-l'-[(4-CYCLOBUTYLPIPERAZIN-l-YL)CARBONYL]SPIRO[INDOLE-3,4'- PIPERIDIN]-2(1H)-ONE (COMPOUND 23)
Figure imgf000070_0002
A suspension of l-ben2ylspiro[indole-3,4'-piperidin]-2(lH)-one (0.417 mmol), 4-nitrophenyl chloroformate (84 mg, 0.417 mmol) and K2CO3 (172 mg, 1.25 mmol) in CH3CN (6 ml) is stirred at ambient temperature for 2 h. A solution of 1-cyclobutylpiperazine (0.417 mmol) and TEA (0.175 ml,
1.25 mmol) in CH3CN (4 ml) is added and the mixture is heated at 110 0C in a sealed tube overnight.
Solvent is removed in vacuo and to the residue is added EtOAc (15 ml). The mixture is stirred at rt for 15 min and filtered. The filtrated is evaporated and the residue is purified by PTLC to give the title compound as a white solid. LC-MS (M+l): 458.3. EXAMPLE 3 Additional Representative Dipiperazinyl Ketones and Related Analogues
Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein. Compounds listed in Tables I and II are prepared using such methods. All compounds listed in Table I have a Kj in the assay of Example 7 that is less than 500 nanomolar. In Table II, a "*" in the column headed "Kj" indicates that the K1 in the assay of Example 7 is less than 1 micromolar, and a "+" in that column indicates that the percent inhibition of agonist-induced GTP-gammaS binding to H3, in the assay described in Example 8, is at least 90%. The molecular weight (presented as M+l) obtained using the method provided above is shown in the column headed "MS" of Tables I and II. In Table II, the retention time (TR) is provided in minutes. Mass spectroscopy data in Table II obtained via Method 1 is indicated with a dagger (f ) in the TR column. All other data in Table II is obtained via Method 2.
Other representative compounds within the scope of the present invention are shown in Table III, wherein the predicted molecular weight is provided in the column headed "MW."
Table I Representative Dipiperazinyl Ketones and Related Analogues
COMPOUND NAME MS
1 -(4-Phenyl-piperazin- 1 -yl)-2-[4-(3 - phenyl-propyl)-piperazin-l-yl]- 407 ethanone
2- [4-(4-Acetyl-phenyl)-piperazin- 1 - yl]- 1 -[4-( 1 -phenyl-ethyl)-piperazin- 434 l-yl]-ethanone
2-[4-(4-Nitro-phenyl)-piperazin- 1 - yl]- 1 -[4-( 1 -phenyl-ethyl)piperazin- 1 - 438 yl]-ethanone
1 -(4-Cycloheptyl-piperazin- 1 -yl)-2- [4-(4-nitro-phenyl)-piperazin- 1 -yl]- 430 ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- „ <. „ (4-phenyl-piperazin- 1 -yl)-ethanone
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0001
2-[4-(4-tert-Butyl-benzyl)-piperazin- 1 -yl]- 1 -(4-cyclopentyl-piperazin- 1 - 427 yl)-ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- [4-(4-isopropyl-benzyl)-piperazin- 1 - 413 yl]-ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- [4-(3 ,4-dichloro-benzyl)-piperazin- 1 ■ 439 yl]-ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- [4-(3,4-dimethyl-phenyl)-piperazin- 385 l-yl]-ethanone
2-[4-(5-Chloro-2-methoxy-phenyI)- piperazin- 1 -yl]- 1 -(4-cyclopentyl- 421 piperazin- 1 -yl)-ethanone
2-[4-(3 -Chloro-phenyl)-piperazin- 1 - yl] - 1 -(4-cyclopentyl-piperazin- 1 -yl)- 391 ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- (3-methyl-4-m-tolyl-piperazin- 1 -yl)- 385 ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- [4-(4-methoxy-phenyl)-3 -methyl- 401 piperazin- 1 -yl]-ethanone
2-[4-(4-Aceryl-phenyl)-piperazin-
1 -yl] - 1 -(4-cyclopentyl-piperazin- 1 - 399 yl)-ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- [4-(2,5-dimethyl-phenyl)-piperazin- 385 1-yl] -ethanone
Figure imgf000074_0002
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
v
NAME MS
2-(4-Azepan- 1 -yl-piperidin- 1 -yl)- 1 - (4-isopropyl-piperazin- 1 -yl)- 351 ethanone
2-(4-Azepan- 1 -yl-piperidin- 1 -yl)-
1 -(4-isopropyl-[ 1 ,4]diazepan- 1 -yl)- 365 ethanone
2-(4-Azepan- 1 -yl-piperidin- 1 -yl)- 1 - (4-cyclopentyl-piperazin-l-yl)- 377 ethanone
2-(4-Azepan- 1 -yl-piperidin- 1 -yl)- 1 - „ _ 1 [ 1 ,4']bipiperidinyl- 1 '-yl-ethanone
2-[4-(Cyclopropylmethyl-propyl- amino)-piperidin- 1 -yl] - 1 -(4- 365 isopropyl-piperazin- 1 -yl)-ethanone
Figure imgf000078_0001
Figure imgf000078_0002
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2-
105 [4-(cyclopropylraethyl-propyl- 391 amino)-piperidin- 1 -yl] -ethanone
l-[l,4']Bipiperidinyl-l'-yl-2-[4-
106 (cyclopropylmethyl-propyl-amino)- 405 piperidin- 1 -yl]-ethanone
2-(4-Dipropylamino-piperidin- 1 -yl)-
107 1 -(4-isopropyl-piperazin- 1 -yl)- 353 ethanone
l-(4-Cyclopentyl-piperazin-l-yl)-2-
108 (4-dipropylamino-piperidin- 1 -yl)- 379 ethanone
Figure imgf000078_0003
i '
NAME MS
2-[4-(Benzyl-methyl-amino)-
109 piperidin- 1 -yl]- 1 -(4-isopropyl- 373 piperazin- 1 -yl)-ethanone
2-[4-(Benzyl-methyl-amino)-
110 piperidin- 1 -yl]- 1 -(4-isopropyl- 387
[ 1 ,4]diazepan- 1 -yl)-ethanone
2~[4-(Benzyl-methyl-amino)-
111 piperidin- 1 -yl]- 1 -(4-cyclopentyl- 399 piperazin- 1 -yl)-ethanone
Figure imgf000079_0001
2-[4-(Benzyl-methyl-amino)- piperidin-1-y I]-I- 413
[ 1 ,4']bipiperidinyl- 1 '-yl-ethanone
1 -(4-Isopropyl-piperazin- 1 -yl)-2-(4- pyrrolidin- 1 -yl-piperidin- 1 -yl)- 323 ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- (4-pyrrolidin- 1 -yl-piperidin- 1 -yl)- 349
Figure imgf000079_0002
ethanone
115
Figure imgf000079_0003
2-[ 1 ,4']Bipiperidinyl- 1 !-yl- 1 -(4-
116 isopropyl-[ 1 ,4]diazepan- 1 -yl)- 351 ethanone
Figure imgf000079_0004
117
Figure imgf000079_0005
2-(4-Dimethylamino-piperidin- 1 -yl)-
1 -(4-isopropyl-piperazin- 1 -yl)- 297 ethanone
1 -(4-Cyclopentyl-piperazin- 1 -yl)-2- (4-dimethylamino-piperidin- 1 -y I)- 323
Figure imgf000079_0006
ethanone
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
1 ■
Figure imgf000083_0001
l-cyclohexyl-4-({4-[4-
160 (trifluoromethyl)phenyl]piperazin-l- 439 yl } acetyl)piperazine
1 -cyclobutyl-4-( {4- [4-
161 (trifluoromethyl)phenyl]piperazin- 1 - 411
Figure imgf000083_0002
yl } acetyl)piperazine 425
411
443
429
Figure imgf000084_0001
W ^ 7Sl NAME MS
175 4-[2-(4-cyclohexylpiperazin-l-yl)-2- oxoethyl]- 1 -(4-methoxyphenyl)-2- 415 methylpiperazine
4-[2-(4-cyclobutylpiperazin- 1 -yl)-2-
176 oxoethyl]- 1 -(4-methoxyphenyl)-2- 387 methylpiperazine l-cyclohexyl-4-{[4-(3-
" methoxyphenyl)piperazin- 1 - 401
Figure imgf000085_0001
yl]acetyl}piperazine l-cyclobutyl-4-{[4-(3- methoxyphenyl)piperazin-l- 373
Figure imgf000085_0002
yl] acetyl } piperazine l-cyclobutyl-4-{[4-(3-
179 methylphenyl)piperazin-l- 357 yl]acetyl} piperazine
1 -( 1 ,3 -benzodioxol-5-yl)-4-[2-(4-
180 cyclopentylpiperazin- 1 -yl)-2- 401 oxoethyljpiperazine
1 -( 1 ,3 -benzodioxol-5-yl)-4- [2-(4-
181 cyclobutylpiperazin-l-yl)-2- 387 oxoethyljpiperazine
1 -(3 ,4-dimethoxyphenyl)-4-[2-(4-
182 isopropylpiperazin-l-yl)-2- 391 oxoethyljpiperazine
Figure imgf000085_0003
1 -cyclopentyl-4- { [4-(3 ,4- dimethoxyphenyl)piperazin- 1 - 417 y 1] acetyl } piperazine
1 -cyclobuτyl-4- { [4-(3 ,4- dimethoxyphenyl)piperazin- 1 - 403 y 1] acetyl } piperazine
1 -(4-bromo-3 -methoxyphenyl)-4- [2-(4-cyclopentylpiperazin- 1 -yl)-2- 466 oxoethyljpiperazine
1 -(4-bromo-3 -methoxypheny l)-4- [2- (4-cyclobutylpiperazin- 1 -yl)-2- 452
Figure imgf000085_0004
oxoethyljpiperazine
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001
COMPOUND NAME MS
2-[ 1 -(4-acetylphenyl)piperidin-4- yl]-N-[2-(dimethylamino)ethyl]-N- 346 methylacetamide
2-[ 1 -(4-acetylphenyl)piperidin-4-yl]-
224 N-[3 -(diraethylamino)propy I]-N- 360 methylacetamide
225 2-[ 1 -(4-acetylphenyl)ρiperidin-4- yl]-N-(2-methoxyethyl)-N-( 1 - 416 methylpiperidin-4-yl)acetamide
2-[ 1 -(4-acetylphenyl)piperidin-4-
226 yl]-N-methyl-N-(l- 358
Figure imgf000089_0001
methylpyrrolidin-3 -yl)acetamide
3?4
392
388
-yl)- 402
388
-yl)- 386
372
Figure imgf000089_0002
Figure imgf000091_0001
Table II
Additional Representative Dipiperazinyl Ketones and Related Analogues
Figure imgf000091_0002
Figure imgf000092_0001
Figure imgf000093_0001
Figure imgf000094_0001
Figure imgf000095_0001
Figure imgf000096_0001
2
1
Figure imgf000097_0001
1-(3-chlorophenyl)-4-[2- (4-isopropylpiperazin-1- * 0.94 365.2 yl)-2-oxoethyljpiperazine
1-(3-fluorophenyl)-4-[2- (4-isopropylpiperazin-1- * 0.94 349.2 yl)-2-oxoethyl]piperazine
Figure imgf000097_0002
Figure imgf000098_0001
Figure imgf000099_0001
Figure imgf000100_0001
Figure imgf000101_0001
Figure imgf000102_0001
Figure imgf000103_0001
Figure imgf000104_0001
Figure imgf000105_0001
1-[(1-tert-butyl-3-methyl-
1H-pyrazol-5- yl)carbonyl]-4-[2-(4- + 0.94431.2 cyclobutylpiperazin-1 -yl)-
2-oxoethyl]piperazine
Figure imgf000105_0002
1
1
Figure imgf000105_0003
Figure imgf000106_0001
Figure imgf000107_0001
i R
+ 0.94 431.1
+ 0.94 431.1
Figure imgf000108_0001
1-[(2E)-3-(5-bromo-2- ethoxyphenyl)prop-2-
392 enoyl]-4-[2-(4- + 0.94 519.1 cyclobutylpiperazin-1 -yl)-
2-oxoethyl]piperazine
Figure imgf000108_0002
3
Figure imgf000109_0001
-yl)-
+ 0.94 463.1
+ 0.94 461.1
Figure imgf000109_0002
Figure imgf000110_0001
Figure imgf000111_0001
Figure imgf000112_0001
Figure imgf000113_0001
Figure imgf000114_0001
Figure imgf000115_0001
Figure imgf000116_0001
Figure imgf000117_0001
Figure imgf000118_0001
Figure imgf000119_0001
Figure imgf000120_0001
Figure imgf000121_0001
Figure imgf000122_0001
Figure imgf000123_0001
Figure imgf000124_0001
Figure imgf000125_0001
Figure imgf000126_0001
Figure imgf000127_0001
5 1
5 1
Figure imgf000128_0001
yl-4-({4-[(2E)-
517 phenyl)prop-2- + 0.94457.1 razin-1- iperazine
Figure imgf000128_0002
5 4487.2
5 4465.0
Figure imgf000129_0001
E)-
520 p-2- + 0.94457.2
Figure imgf000129_0002
1
Figure imgf000130_0001
522
523
Figure imgf000130_0002
Figure imgf000131_0001
Figure imgf000132_0001
Figure imgf000133_0001
Figure imgf000134_0001
Figure imgf000135_0001
Figure imgf000136_0001
Figure imgf000137_0001
Figure imgf000138_0001
Figure imgf000139_0001
Figure imgf000140_0001
Figure imgf000141_0001
Figure imgf000142_0001
Figure imgf000143_0001
Figure imgf000144_0001
Figure imgf000145_0001
Figure imgf000146_0001
1
.1
Figure imgf000147_0001
Figure imgf000148_0001
Figure imgf000149_0001
Figure imgf000150_0001
Figure imgf000151_0001
Figure imgf000152_0001
Figure imgf000153_0001
Figure imgf000154_0001
Figure imgf000155_0001
Figure imgf000156_0001
Figure imgf000157_0001
Figure imgf000158_0001
Figure imgf000159_0001
686
687
688
Figure imgf000159_0002
Figure imgf000160_0001
Figure imgf000161_0001
Figure imgf000162_0001
Figure imgf000163_0001
Figure imgf000164_0001
Figure imgf000165_0001
Figure imgf000166_0001
Figure imgf000167_0001
1-cyclobutyl-4-{[4-(3,5-
742 dimethylbenzoyl)piperazi + 0.94 399.2 n-1 -yl]acetyl}piperazine
Figure imgf000167_0002
Figure imgf000168_0001
Figure imgf000169_0001
Figure imgf000170_0001
1-cyclobutyl-4-{[4-(3'- methoxybiphenyl-4- yl)piperazin-1- °-ϊ4 449.3 yl]acetyl}piperazine
1-cyclobutyl-4-{[4-(3- methoxyphenyl)piperazin * 0.94 373.2 -1 -yl]acetyl}piperazine
1-cyclobutyl-4-{[4-(3- methyl-2- Q Q4 42J 2 phenylbutanoyl)piperazin
-1-yl]acetyl}piperazine
1-cyclobutyl-4-{[4-(3- methylbenzoyl)piperazin- + 0.94 385.1 1 -yl]acetyl}piperazine
Figure imgf000170_0002
Figure imgf000171_0001
Figure imgf000172_0001
Figure imgf000173_0001
Figure imgf000174_0001
Figure imgf000175_0001
Figure imgf000176_0001
IP C T/ U B KLl NAME ' Ki ΪR MS
1 -cyclohexyl-4-{[4-(2,4- 7 difluorophenyl)piperazin- 0.94 407.2 1-yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(2,4- 8 dimethoxyphenyl)piperazi 0.94 431.3 n-1 -yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(2 ,4- 9 dimethylphenyl)piperazin 0.94 399.3 -1 -yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(2 , 5- 0 dimethylphenyl)piperazin 0.94 399.3 -1 -yl]acetyl}piperazine
Figure imgf000177_0001
1 399.3
2 415.3
3 389.3
4 385.3
Figure imgf000177_0002
1-cyclohexyl-4-{[4-(3,4- Q g4 5 dichlorophenyl)piperazin- * . 231.0 1-yl]acetyl}piperazine τ 1-cyclohexyl-4-{[4-(3,4- g4 6 ddiimmeetthhooxxyypphheennyyOl)ppiippeerraazzii ** "".. 431.3 n-1-yl]acetyl}piperazine τ
1-cyclohexyl-4-{[4-(3,4- 7 dimethyiphenyl)piperazin * 0.94 399.3 -1 -yl]acetyl}piperazine
1-cyclohexyl-4-{[4-(3,5- 8 dichlorophenyl)piperazin- 0.94 439.2 1-yl]acetyl}piperazine
Figure imgf000177_0003
3
Figure imgf000178_0001
1 -cyclohexyl-4-{[4-(3- methoxyphenyl)piperazin * 0.94 401.3 -1 -yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(3- methylphenyl)piperazin- * 0.94 385.3 1-yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(4- fluorophenyl)piperazin-1- * 0.94 389.3 yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(4- methoxyphenyl)piperazin * 0.94 401.3 -1-yl]acetyl}piperazine
1 -cyclohexyl-4-{[4-(4- methylphenyl)piperazin- * 0.94 385.3
Figure imgf000178_0002
1 -yl]acetyl}piperazine
Figure imgf000178_0003
Figure imgf000179_0001
1 -cyclopentyI-4-{[4-(4- methoxyphenyl)piperazin * 0.94 387.4 -1 -yl]acetyl}piperazine
1-cyclopentyl-4-{[4-(4- Q g . nitrophenyl)piperazin-1- * , 402.2 yl]acetyl}piperazine '
1-cyclopentyl-4-{[4-
(tetrahydrofuraπ-2- * 0 94 379 1 ylcarbonyl)piperazin-1 - yl]acetyl}piperazine
1-ethyl-4-({4-[4-
(trifluoromethyl)phenyl]pi * 0 94 385 2 perazin-1- yl}acetyl)piperazine
1-ethyl-4-{[4-(4- methoxyphenyl)piperazin * 0.94 347.2 -1 -yl]acetyl}piperazine
Figure imgf000179_0002
Figure imgf000180_0001
1-sec-butyl-4-[(4-
857 phenylpiperazin-1- * 0.94 345.2 yl)acetyl]piperazine
Figure imgf000181_0001
1-sec-butyl-4-[(4-
858 pyrrolidin-1-ylpiperidin-l- * 1.12 337.2 yl)acetyl]piperazine
1-sec-butyl-4-{[4-(2,3-
859 dichlorophenyl)piperazin- * 0.94 413.0 1 -yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2,3-
860 dimethylphenyl)piperazin * 0.94 373.2 -1 -yl]acetyl}piperazine
Figure imgf000181_0002
1-sec-butyl-4-{[4-(2,4- difluorophenyl)piperazin- * 0.94 381.1 1-yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2,4- dimethoxyphenyl)piperazi * 0.94 405.1 n-1-yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2,4- dimethylphenyOpiperazin * 0.94 373.2 -1 -yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2,5- dimethylphenyl)piperazin * 0.94 373.2 -1 -yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2,6- dimethylphenyl)piperazin * 0.94 373.2 -1-yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2- chlorophenyl)piperazin-1- * 0.94 379.1 yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2- fluorophenyl)piperazin-1- * 0.94 363.2 yl]acetyl}piperazine
1-sec-butyl-4-{[4-(2- methylphenyl)piperazin- * 0.94 359.2 1-yl]acetyl}piperazine
Figure imgf000181_0003
Figure imgf000182_0001
1-sec-butyl-4-{[4-(4- chloro-3- methylphenyl)piperazin- * 0.94 393.1 1-yl]acetyl}piperazine
1-sec-butyl-4-{[4-(4- chlorophenyl)piperazin-1- * 0.94 379.2 yl]acetyl}piperazine
1-sec-butyl-4-{[4-(4- fluorophenyl)piperazih-1- * 0.94 363.2 yl]acetyl}piperazine
Figure imgf000182_0002
1
Figure imgf000183_0001
1-sec-butyl-4-{[4-(4-
882 methylphenyl)piperazin- * 0.94 359.1 1-yl]acetyl}piperazine
Figure imgf000183_0002
Figure imgf000183_0003
Figure imgf000184_0001
Figure imgf000185_0001
Figure imgf000186_0001
Figure imgf000187_0001
-
907 1.13 454.3
Figure imgf000187_0002
442.3
Figure imgf000187_0003
-
909 * 1.1f 455.3
Figure imgf000187_0004
Figure imgf000188_0001
II"'-
918
Figure imgf000189_0001
439.23
453.19
453.19
453.19
453.19
Figure imgf000189_0002
erazin-1 -yl)-
924 perazin-1- * 0.94 435.20
Figure imgf000189_0003
l)pyrazine
-yl)-
925 * 0.94 435.20
Figure imgf000189_0004
926 3
927 3
Figure imgf000190_0001
-yl)-
928 * 0.94 449.22
-yl)-
929 * 0.94 449.21
-yl)-
930 * 0.94 449.21
Figure imgf000190_0002
-yl)-
931 - * 0.94 463.23
Figure imgf000190_0003
93 2
93 9
Figure imgf000191_0001
Figure imgf000191_0002
Figure imgf000192_0001
940 * 0.94487.17
Figure imgf000192_0002
-yl)-
941 1- * 0.94501.21
Figure imgf000192_0003
Figure imgf000193_0001
Figure imgf000194_0001
erazin-1 -yl)-
950 perazin-1- * 0.94 465.29 oxy-2- l)pyrazine
Figure imgf000195_0001
-yl)-
951 * 0.94 451.19
Figure imgf000195_0002
Figure imgf000195_0003
Figure imgf000196_0001
Figure imgf000197_0001
Figure imgf000198_0001
razine
970
971
972
973
974
Figure imgf000198_0002
,
NAME Ki Tg MS
975
976
977
Figure imgf000199_0001
505.3
365.1
1' 471.3
Figure imgf000199_0002
Figure imgf000200_0001
985 1 '
Figure imgf000201_0001
986 * 0.94 465.1 -
987 * 0.94 473.1 -
Figure imgf000201_0002
3-(3-chlorophenyl)-6-{4-
[2-(4-cyclobutylpiperazin-
988 1-yl)-2- * 0.94 455.1 oxoethyl]piperazin-1- yl}pyridazine
Figure imgf000201_0003
Figure imgf000202_0001
Figure imgf000203_0001
-yl)-
996 1- * 0.94464.2 N-
Figure imgf000203_0002
in-1 -yl)- zin-1- * 0.94446.2
Figure imgf000203_0003
998 1
999 '
Figure imgf000203_0004
Figure imgf000204_0001
Figure imgf000205_0001
Figure imgf000206_0001
Figure imgf000207_0001
Figure imgf000208_0001
1029
1030
1031
Figure imgf000209_0001
Figure imgf000209_0002
-yl)- * 0.94 465.2 e
Figure imgf000209_0003
Figure imgf000210_0001
1040
Figure imgf000211_0001
-1 -yl)- n-1 -
* 0.94 481.2 yridazi
Figure imgf000211_0002
1042 * 0.94 481.2
1043 * 0.94 465.2
1044 * 0.94 511.1
Figure imgf000211_0003
Figure imgf000212_0001
Figure imgf000213_0001
Figure imgf000214_0001
Figure imgf000215_0001
Figure imgf000216_0001
Figure imgf000217_0001
1
1
1
1
Figure imgf000218_0001
-1 -yl)-
1088 n-1- + 0.94400.2
Figure imgf000218_0002
Figure imgf000219_0001
Figure imgf000220_0001
in-1-yl)-
1097 zin-1- * 0.94464.31 ,N-
Figure imgf000220_0002
-1 -yl)-
1098 n-1- * 0.94446.26
Figure imgf000220_0003
Figure imgf000221_0001
Figure imgf000222_0001
Figure imgf000223_0001
Figure imgf000224_0001
Figure imgf000225_0001
Figure imgf000226_0001
Figure imgf000227_0001
-1-yl)-
1155 n-1- * 0.95 412.3 lin-1 -
Figure imgf000227_0002
Figure imgf000228_0001
Figure imgf000230_0001
Figure imgf000231_0001
Figure imgf000232_0001
Figure imgf000233_0001
Figure imgf000234_0001
Figure imgf000235_0001
Figure imgf000236_0001
Figure imgf000237_0001
Figure imgf000238_0001
Figure imgf000239_0001
1223 )- 1.13 445.3 l}-
Figure imgf000239_0002
1224
1225
Figure imgf000239_0003
1226 * 1.12 447.1
Figure imgf000239_0004
-yl)-
* 1.1 391.2 mi
Figure imgf000239_0005
* 1.13 449.2
Figure imgf000239_0006
Figure imgf000240_0001
Figure imgf000241_0001
Figure imgf000242_0001
1247 * 0.94365.16
1248 * 0.94377.15
1249 * 0.94391.16
1250 * 0.94391.16
1251 * 0.94365.15
Figure imgf000242_0002
-1 -yl)-
1252 n-3- * 0.94409.17
Figure imgf000242_0003
e
371.11
447.09
389.15
377.23
461.13
Figure imgf000242_0004
1258
1259
1260
1261
Figure imgf000243_0001
Figure imgf000243_0002
Figure imgf000244_0001
Table III Additional Representative Dipiperazinyl Ketones and Related Analogues
COMPOUND NAME MW
2-[4-(4-Acetyl-phenyl)- piperazin- 1 -yl] - 1 -(4-cyclobutyl- . . _ piperazin- 1 -yl)-2-methyl-
Figure imgf000244_0002
propan-1-one
Figure imgf000244_0003
. ιr1l ,,;;;: / .g o ;;;;, |E| ,,J1
NAME MW
Figure imgf000245_0001
EXAMPLE 4 Preparation of Chimeric Human H3 Receptor
Chimeric H3 receptor cDNA from human H3 receptor is generated from three cDNA fragments: (1) a human H3 receptor cDNA 5' fragment; (2) a human H3 receptor cDNA 3' fragment; and (3) a rat Ga12 cDNA fragment, each containing appropriate, overlapping linker sequences.
The human H3 receptor cDNA 5' fragment is generated from an adult human brain cDNA Library (INVITROGEN, Carlsbad, CA) by PCR using the primers TGAGCCTGCGGGGCCATGGAG (forward, SEQ ID NO:1) and
GAGGAGGTGCACAGCAGGTAG (reverse, SEQ ID NO:2). PCR is performed using the Advantage-GC cDNA PCR kit (BD BIOSCIENCES CLONTECH, Palo Alto, CA) in 25 μl reactions containing: 5 μl GC melt, 5 μl 5X PCR reaction buffer, 0.5 μl dNTP Mix (10 mM each), 10 pmol each forward and reverse primers, 0.5μl Advantage GC cDNA Polymerase Mix and lμl undiluted
Figure imgf000246_0001
'ΘbrMitions for touchdown PCR thermal cycling are 940C for 2 min then, over 10 cycles: 940C for 30 seconds, 600C to 550C in 0.50C intervals for 1 min and 68°C for 1 min, then over 20 cycles: 940C for 30 seconds, 550C for 1 min and 680C for 1 min. The human H3 receptor cDNA 5' fragment is initially cloned into the vector pcDNA3.1/V5His TOPO TA (INVITROGEN).
The human H3 receptor cDNA 3' fragment is generated from the Human Brain Library by
PCR using the primers CTACCTGCTGTGCACCTCCTC (forward, SEQ ID NO:3) and
GCAGTGCTCTAGAGAGCTGTGG (reverse, SEQ ID NO:4) and conditions as described for the human H3 receptor cDNA 5' fragment. The human H3 receptor cDNA 3' fragment is initially cloned into the vector pcDNA3. l/V5His TOPO TA (INVITROGEN).
The rat Ga12 cDNA fragment is generated from a rat Gαj2-containing vector (Jones and Reed (1987) J. Biol. Chem. 262(29): 14241-49, which is hereby incorporated by reference for its description of the rat GoCj2-containing vector) by PCR using the primers CTCTCTAGAGCACTGCTGGAAGATGGGCTGCACCGTGAGCGC (forward, SEQ ID NO:5) and TCAGAAGAGGCCACAGTCCTTCAG (reverse, SEQ ID NO:6) and conditions as described for the human H3 receptor cDNA 5' fragment. The rat Gα;2 cDNA fragment is initially cloned into the vector pcDNA3.1/V5His TOPO TA (INVITROGEN).
Each cDNA fragment is excised from the pcDNA3.1/V5His TOPO TA vector using the restriction enzymes Kpnl and Notl. The human H3 receptor cDNA 5' fragment is further treated with the restriction enzyme ApaLI. The human H3 receptor cDNA 3' fragment is further treated with the restriction enzymes ApaLI and Xbal. The rat Gocj2 cDNA fragment is further treated with the restriction enzyme Xbal. All three individual cDNA fragments are ligated and subcloned together into the Kpnl/Notl site of the baculoviral expression vector pBacPAK 9 (BD BIOSCIENCES
CLONTECH) to generate the chimeric human H3 receptor-rat GoIj2 baculoviral expression construct (SEQ ID NO:7).
EXAMPLE 5
Chimeric Human H3 Receptor Baculovirus Preparation and Infection
The chimeric human H3 receptor-rat Gαj2 baculoviral expression vector is co-transfected along with BACULOGOLD DNA (BD PHARMINGEN, San Diego, CA) into S/9 cells. The S/9 cell culture supernatant is harvested three days post-transfection. The recombinant virus-containing supernatant is serially diluted in Hink's TNM-FH insect medium (JRH Biosciences, Kansas City, KS) supplemented Grace's salts and with 4.1 mM L-GIn, 3.3 g/L LAH, 3.3 g/L ultrafϊltered yeastolate and
10% heat-inactivated fetal bovine serum (hereinafter "insect medium") and plaque assayed for recombinant plaques. After four days, recombinant plaques are selected and harvested into 1 ml of insect medium for amplification. Each 1 ml volume of recombinant baculovirus (at passage 0) is used
Figure imgf000247_0001
S/9 cells in 5 ml of insect medium. After five days of incubation at 270C, supernatant medium is harvested from each of the T25 infections for use as passage 1 inoculum.
Two of seven recombinant baculoviral clones are chosen for a second round of amplification, using 1 ml of passage 1 stock to infect 1 x 10s cells in 100 ml of insect medium divided into two Tl 75 flasks. Forty-eight hours post infection, passage 2 medium from each 100 ml prep is harvested and plaque assayed to determine virus titer. The cell pellets from the second round of amplification are assayed by affinity binding as described below to verify recombinant receptor expression. A third round of amplification is then initiated using a multiplicity of infection of 0.1 to infect a liter of S/9 cells. Forty hours post-infection, the supernatant medium is harvested to yield passage 3 baculoviral stock.
The remaining cell pellet is assayed for affinity binding using the protocol of DeMartino et al. (1994) J. Biol. Chem. 269(20): 14446-50 (which is incorporated herein by reference for its teaching of binding assays at page 14447), adapted as follows. Radioligand ranges from 0.40 - 40 nM [3H]-N- (a)methylhistamine (Perkin Elmer, Boston, MA) and assay buffer contains 50 mM Tris, 1 mM CaCl2, 5 mM MgCl2, 0.1% BSA, 0.1 mM bacitracin, and 100 KIU/ml aprotinin, pH 7.4. Filtration is carried out using GF/C WHATMAN filters (presoaked in 1.0% polyethyeneimine for 2 hr prior to use). Filters are washed three times with 5 ml cold assay buffer without BSA, bacitracin, or aprotinin and air dried for 12-16 hr. Radioactivity retained on filters is measured on a beta scintillation counter. Titer of the passage 3 baculoviral stock is determined by plaque assay and a multiplicity of infection, incubation time course, binding assay experiment is carried out to determine conditions for optimal receptor expression. A multiplicity of infection of 0.5 and a 72-hr incubation period are preferred infection parameters for chimeric human H3 receptor-rat GCSB expression in up to 1 -liter S/9 cell infection cultures. Log-phase S/9 cells (INVITROGEN), are infected with one or more stocks of recombinant baculovirus followed by culturing in insect medium at 270C. Infections are carried out with virus directing the expression of human H3 receptor-rat Gαi2 in combination with three G-protein subunit- expression virus stocks: 1) rat Gα;2 G-protein-encoding virus stock (BIOSIGNAL #V5J008), 2) bovine βl G-protein-encoding virus stock (BIOSIGNAL #V5H012), and 3) human γ2 G-protein- encoding virus stock (BIOSIGNAL #V6B003), which may be obtained from BIOSIGNAL Inc., Montreal.
The infections are conveniently carried out at a multiplicity of infection of 0.5:1.0:0.5:0.5. At 72 hr post-infection, an aliquot of cell suspension is analyzed for viability by trypan blue dye exclusion. If no blue is detected by visual inspection, the S/9 cells are harvested via centrifugation (3000 rpm / 10 min / 4°C). i::!l lB ./ E «i 76 :IL EXAMPLE S
Chimeric Human H3 Receptor Cell Membrane Preparations
S/9 cell pellets obtained as described in Example 5 are resuspended in homogenization buffer (10 mM HEPES, 250 raM sucrose, 0.5 μg/ml leupeptin, 2 μg/ml Aprotinin, 200 μM PMSF, and 2.5 mM EDTA, pH 7.4) and homogenized using a POLYTRON PT10-35 homogenizer (KINEMATICA AG, Lucerne, Switzerland; setting 5 for 30 seconds). The homogenate is centrifuged (536 x g/ 10 min at 40C) to pellet the nuclei and unbroken cells. The supernatant containing the membranes is decanted to a clean centrifuge tube, centrifuged (48,000 x g/ 30 min, 40C) and the resulting pellet resuspended in 30 ml homogenization buffer. This centrifugation and resuspension step is repeated twice. The final pellet is resuspended in ice cold Dulbecco's PBS containing 5 mM EDTA and stored in frozen aliquots at -8O0C until used for radioligand binding or functional response assays. The protein concentration of the resulting membrane preparation (hereinafter termed "P2 membranes") is conveniently measured using a Bradford protein assay (BIO-RAD LABORATORIES, Hercules, CA). By this measure, a 1-liter culture of cells typically yields 100-150 mg of total membrane protein.
EXAMPLE ?
Chimeric Human H3 Receptor GTP Binding Assays
This Example illustrates a representative assay for evaluating agonist-stimulated GTP- gamma35S binding ("GTP binding") activity. Such GTP binding activity can be used to identify H3 antagonists and to differentiate neutral antagonist compounds from those that possess inverse agonist activity. This agonist-stimulated GTP binding activity can also be used to detect partial agonism mediated by antagonist compounds. A compound analyzed in this assay is referred to herein as a "test compound."
Four independent baculoviral stocks (one directing the expression of the chimeric human H3 receptor and three directing the expression of each of the three subunits of a heterotrimeric G-protein) are used to infect a culture of Sfl cells as described above. P2 membranes are prepared as described above, and agonist-stimulated GTP binding on the P2 membranes is assessed using histamine (Sigma Chemical Co., St. Louis, MO) as agonist in order to ascertain that the receptor/G-protein-alpha-beta- gamma combination(s) yield a functional response as measured by GTP binding. P2 membranes are resuspended by Dounce homogenization (tight pestle) in GTP binding assay buffer (50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl2, 2 mM EGTA, 1 mg/ml BSA, 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 μM GDP) and added to assay tubes at a concentration of 35 μg protein/reaction tube. After adding increasing doses of histamine at concentrations ranging from 10"12 M to 10"5 M, reactions are initiated by the addition of 125 pM GTP-gamma35S (PERKESf ELMER; Boston, MA) with a final assay volume of 0.20 ml. In competition experiments, non-radiolabeled test c mpωuHQ are 'tό' p e sa tions at concentrations ranging from 10"IU M to 10"6 M along with 1 μM histamine to yield a final volume of 0.20 ml.
Neutral antagonists are antagonists that are substantially free of inherent agonist activity, and include those test compounds that reduce the histamine-stimulated GTP binding activity towards, but not below, baseline levels. In contrast, in the absence of added histamine, inverse agonists reduce the GTP binding activity of the receptor-containing membranes below baseline. The elevation of GTP binding activity above baseline by a compound in the absence of added histamine in this assay demonstrates agonist activity.
After a 60-min incubation at room temperature, reactions are terminated by vacuum filtration over WHATMAN GF/C filters (pre-soaked in wash buffer, 0.1% BSA) followed by washing with ice- cold wash buffer (50 mM Tris pH 7.4, 12OmM NaCl). The amount of receptor-bound (and thereby membrane-bound) GTP-gamma35S is determined by measuring the filter-bound radioactivity, preferably by liquid scintillation spectrometry of the washed filters. Non-specific binding is determined in parallel assays including 10 μM unlabeled GTP-gammaS and typically represents less than 5 percent of total binding. Data is expressed as percent above basal (baseline). The results of GTP binding experiments are analyzed using SIGMAPLOT software (SPSS Inc., Chicago, IL).
IC50 values are calculated by non-linear regression analysis of dose-response curves using Kaleidograph (Synergy Software, Reading, PA). Calculated IC50 values are converted to Ki values by the Cheng-Prusoff correction (Cheng and Prusoff (1973) Biochem. Pharmacol. 22(23):3099-3108). Accordingly, the following equation: Ki = IC50/(l + [L]/EC50) is used, where [L] is the histamine concentration in the GTP binding assay, and EC50 is the concentration of histamine producing a 50% response, as determined by a dose-response analysis using concentrations of histamine ranging from 10"10 M tO 10"6M.
To assess agonist or inverse agonist activity of a test compound, this assay is performed in the absence of added histamine, and EC50 values are determined by analogous calculations, where the EC50 is the concentration of test compound producing a 50% response.
EXAMPLE 8 Chimeric Human H3 Receptor Screening: GTP Binding Assays
This Example illustrates a representative screening assay for evaluating inhibition of histamine-stimulated GTP-gamma35S binding. Such GTP binding activity can be used to identify H3 antagonists and inverse agonists. A compound analyzed in this assay is referred to herein as a "test compound," and the initial identification of antagonists and inverse agonists is performed using a test compound concentration of 4 μM.
Four independent baculoviral stocks (one directing the expression of the chimeric human H3 receptor and three directing the expression of each of the three subunits of a heterotrimeric G-protein)
Figure imgf000250_0001
above, P2 membranes are prepared as described above, and are resuspended by Dounce homogenization (tight pestle) in GTP binding assay buffer (50 mM Tris pH 7.4, 120 mM NaCl, 5 mM MgCl2, 2 mM EGTA, 1 mg/ml BSA3 0.2 mg/ml bacitracin, 0.02 mg/ml aprotinin, 0.01 mg/ml saponin, 10 μM GDP) and added to assay tubes at a concentration of 35 μg protein/reaction tube. Non-radiolabeled test compounds are added to separate reactions at a concentration of 4 μM along with 1 μM histamine (agonist). Reactions are initiated by the addition of 125 pM GTP-gamma35S with a final assay volume of 0.20 ml.
After a 60-min incubation at room temperature, reactions are terminated by vacuum filtration over GF/C filters (pre-soaked in 50 mM Tris pH 7.4, 12OmM NaCl plus 0.1% BSA) followed by washing with ice-cold buffer (50 mM Tris pH 7.4, 12OmM NaCl). The amount of receptor-bound (and thereby membrane-bound) GTP-gamma35S is determined by measuring the bound radioactivity, preferably by liquid scintillation spectrometry of the washed filters. Non-specific binding is determined using 10 uM GTP-gammaS and typically represents less than 5 percent of total binding. After subtraction of non-specific binding, data is expressed as percent inhibition of 1 μM histamine signal.
Neutral antagonists are those test compounds that reduce the histamine-stimulated GTP binding activity towards, but not below, baseline levels. In contrast, in the absence of added histamine, inverse agonists reduce the GTP binding activity of the receptor-containing membranes below baseline. Any test compound that elevates GTP binding activity above baseline in the absence of added histamine in this assay is defined as having agonist activity.
EXAMPLE 9 Microsomal in vitro half-life
This Example illustrates the evaluation of compound half-life values (tI/2 values) using a representative liver microsomal half-life assay. Pooled human liver microsomes are obtained from XENOTECH LLC (Kansas City, KS).
Such liver microsomes may also be obtained from IN VITRO TECHNOLOGIES (Baltimore, MD) or TISSUE TRANSFORMATION TECHNOLOGIES (Edison, NJ). Six test reactions are prepared, each containing 25 μl microsomes, 5 μl of a 100 μM solution of test compound, and 399 μl 0.1 M phosphate buffer (19 mL 0.1 M NaH2PO4, 81 mL 0.1 M Na2HPO4, adjusted to pH 7.4 with H3PO4). A seventh reaction is prepared as a positive control containing 25 μl microsomes, 399 μl 0.1 M phosphate buffer, and 5 μl of a 100 μM solution of a compound with known metabolic properties (e.g., diazepam or clozapine). Reactions are preincubated at 39°C for 10 min.
CoFactor Mixture is prepared by diluting 16.2 mg NADP and 45.4 mg Glucose-6-phosphate in 4 mL 100 mM MgCl2. Glucose-6-phosphate dehydrogenase solution is prepared by diluting 214.3 μl glucose-6-phosphate dehydrogenase suspension (ROCHE MOLECULAR BIOCHEMICALS;
Figure imgf000251_0001
water. 71 μl Starting Reaction Mixture (3 mL CoFactor
Mixture; 1.2 mL Glucose-6-phosphate dehydrogenase solution) is added to 5 of the 6 test reactions and to the positive control. 71 μl 100 niM MgCl2 is added to the sixth test reaction, which is used as a negative control. At each time point (0, 1, 3, 5, and 10 min), 75 μl of each reaction mix is pipetted into a well of a 96-well deep-well plate containing 75 μl ice-cold acetonitrile. Samples are vortexed and centrifuged 10 min at 3500 rpm (SORVAL T 6000D centrifuge, HlOOOB rotor). 75 μl of supernatant from each reaction is transferred to a well of a 96-well plate containing 150 μl of a 0.5 μM solution of a compound with a known LCMS profile (internal standard) per well. LCMS analysis of each sample is carried out and the amount of unmetabolized test compound is measured as AUC, compound concentration vs. time is plotted, and the tχ/2 value of the test compound is extrapolated.
Preferred compounds provided herein exhibit in vitro ti/2 values of greater than 10 min and less than 4 hr, preferably between 30 min and 1 hr, in human liver microsomes.
EXAMPLE 10 MDCK Toxicity Assay This Example illustrates the evaluation of compound toxicity using a Madin Darby canine kidney (MDCK) cell cytotoxicity assay.
1 μL of test compound is added to each well of a clear bottom 96-well plate (PACKARD, Meriden, CT) to give final concentration of compound in the assay of 10 micromolar, 100 micromolar or 200 micromolar. Solvent without test compound is added to control wells. MDCK cells, ATCC no. CCL-34 (American Type Culture Collection, Manassas, VA), are maintained in sterile conditions following the instructions in the ATCC production information sheet. Confluent MDCK cells are trypsinized, harvested, and diluted to a concentration of 0.1 x 106 cells/ml with warm (37°C) medium (VITACELL Minimum Essential Medium Eagle, ATCC catalog # 30- 2003). 100 μL of diluted cells is added to each well, except for five standard curve control wells that contain 100 μL of warm medium without cells. The plate is then incubated at 37°C under 95% O2, 5% CO2 for 2 hr with constant shaking. After incubation, 50 μL of mammalian cell lysis solution (from the PACKARD (Meriden, CT) ATP-LITE-M Luminescent ATP detection kit) is added per well, the wells are covered with PACKARD TOPSEAL stickers, and plates are shaken at approximately 700 rpm on a suitable shaker for 2 min. Compounds causing toxicity will decrease ATP production, relative to untreated cells. The
ATP-LITE-M Luminescent ATP detection kit is generally used according to the manufacturer's instructions to measure ATP production in treated and untreated MDCK cells. PACKARD ATP LITE-M reagents are allowed to equilibrate to rt. Once equilibrated, the lyophilized substrate solution is reconstituted in 5.5 mL of substrate buffer solution (from kit). Lyophilized ATP standard solution is reconstituted in deionized water to give a 10 mM stock. For the five control wells, 10 μL of serially „1
Figure imgf000252_0001
to each of the standard curve control wells to yield a final concentration in each subsequent well of 200 nM, 100 nM, 50 nM, 25 nM and 12.5 nM. PACKARD substrate solution (50 μL) is added to all wells, which are then covered, and the plates are shaken at approximately 700 rpm on a suitable shaker for 2 min. A white PACKARD sticker is attached to the bottom of each plate and samples are dark adapted by wrapping plates in foil and placing in the dark for 10 min. Luminescence is then measured at 22°C using a luminescence counter (e.g., PACKARD TOPCOUNT Microplate Scintillation and Luminescence Counter or TECAN SPECTRAFLUOR PLUS), and ATP levels calculated from the standard curve. ATP levels in cells treated with test compound(s) are compared to the levels determined for untreated cells. Cells treated with 10 μM of a preferred test compound exhibit ATP levels that are at least 80%, preferably at least 90%, of the untreated cells. When a 100 μM concentration of the test compound is used, cells treated with preferred test compounds exhibit ATP levels that are at least 50%, preferably at least 80%, of the ATP levels detected in untreated cells.

Claims

What is claimed is:
1. A compound of the formula:
Figure imgf000253_0001
or a pharmaceutically acceptable salt or hydrate thereof, wherein: Z] and Z2 are independently nitrogen or CRa, wherein each Ra is independently chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy and C1-C4alkanoyl;
Z3 is nitrogen or CRb, wherein Rb is absent or chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl and groups that are taken together with R2 or a substituent Of R6 to form a spiro ring that is substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C1-C4haloalkyl,
C!-C4alkoxy and substituents that are taken together to form a fused 5- to 7-membered ring;
_ a b
-^ and :ZJ=J=- independently represent a single or double bond; such that: a (i) if Z3 is N, then =L=L= is a single bond; and a b
(ii) at least one of — = and - — - is a single bond;
W is CR3R4, NR5, CC=O)CR3R4 or CC=O)OCR3R4, wherein:
R3 and R4 are independently chosen from hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-Cealkyl ether and (C3-C6cycloalkyl)C0-C2alkyl, or R3 and R4 are taken together to form a 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and R5 is hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether or (C3-C6cycloalkyl)C0-C2alkyl;
Each q is independently O, 1 or 2; such that neither q is O if both Z2 and Z3 are N; m is O, 1 or 2;
R1 is C3-C6alkyl, C3-C6alkenyl, C3-C6alkynyl, (C3-C8cycloalkyl)C0-C2alkyl or (3- to 8-membered heterocycloalkyl)C0-C2alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C1- C6alkyl, C1-C6alkenyl, CrCehaloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkanoyl, mono- or di-(C1-C6alkyl)amino, mono- or di-(C1-C6alkyl)aminocarbonyl, C3-C7cycloalkyl and 3- to 7-membered heterocycloalkyl; such that R1 does not comprise a - COOH group;
R2 represents from O to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-Qalkylene bridge;
R6 is CrC8alkyl, C2-C8alkenyl, C2-C8alkynyl, C1-C3alkanoyl, C1-C8alkoxycarbonyl, mono- or di-(Cr Csalkyl)amino, (C3-C ]0carbocycle)-X-(Co-C4alky I)- or (4- to 10-membered heterocycle)-X-(C0- C4alkyl)-, each of which is substituted with from O to 4 substituents independently chosen from: (i) oxo, halogen, cyano, hydroxy, amino, nitro, aminosulfonyl and aminocarbonyl; and (ii) groups of the formula D-X-E- wherein:
D represents C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, (C3-Ci4carbocycle)Co-C2alkyl or (4- to
14-membered heterocycle)C0-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from:
(a) halogen, cyano, hydroxy, nitro, amino, oxo, aminocarbonyl, aminosulfonyl and - COOH;
(b) C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6haloalkyl, C1-C6alkoxy, C1- C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkoxycarbonyl, C1- C6alkanoyloxy, C1-C6alkylsulfonyl, mono- or di-(C1-C6alkyl)aminoC0-C4alkyl, phenylC0-C2alkyl and phenylC0-C2alkoxy;
(c) groups that are taken together to form a fused 5- to 7-membered ring or a fused 8- to
10-membered bicyclic group; and
(d) groups that are taken together with Rb to form an optionally substituted spiro ring; each of which (b)-(d) is further substituted with from O to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, C1-C4haloalkyl, Cr C4alkoxy, C1-C4haloalkoxy and phenyl;
Each X is independently absent, O, CH2O, OCH2, C(=0), CH2C(=O), 0C(=0), CH2OC(=O), C(=0)0, S(0)r, N(R2), CC=O)N(R8), N(R2)C(=0), N(Rz)S(O)r or S(O)nN(R2), wherein each r is independently O, 1 or 2 and each R2 is independently hydrogen, C1-C6alkyl, (C3- Cscycloalkyl)Co-C2alkyl, or taken together with Rb to form an optionally substituted spiro ring; and
E is absent or represents C1-C6alkylene or C1-C6alkoxy; and
R7 represents from O to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-Csalkylene bridge.
2. A compound or salt or hydrate thereof according to claim 1, wherein W is CR3R4, Q=O)CR3R4 or C(=O)OCR3R4, and R3 and R4 are independently hydrogen or methyl.
3. A compound or salt or hydrate thereof according to claim 1, wherein W is NR5, and R5 is hydrogen or methyl.
4. A compound or salt or hydrate thereof according to any one of claims 1-3, wherein R2 and R7 independently represent O substituents or 1 or 2 methyl substituents.
5. A compound or salt or hydrate thereof according to any one of claims 1-3, wherein R2 represents O substituents or 1 or 2 methyl substituents, and wherein R7 represents two substituents that are taken together to form a C1-C3alkylene bridge.
6. A compound or salt or hydrate thereof according to any one of claims 1 -5, wherein Ri is C3-C6alkyl, C3-C6alkenyl, cyclobutyl, cyclopentyl or cyclohexyl.
7. A compound or salt or hydrate thereof according to any one of claims 1-6, wherein m is 1.
8. A compound or salt or hydrate thereof according to any one of claims 1-7, wherein one q is 1 and the other q is 0, 1 or 2.
9. A compound or salt or hydrate thereof according to any one of claims 1-8, wherein Z3 is N.
10. A compound or salt or hydrate thereof according to claim 9, wherein the compound satisfies the formula:
Figure imgf000255_0001
11. A compound or salt or hydrate thereof according to claim 10, wherein the compound satisfies the formula:
Figure imgf000255_0002
12. A compound or salt or hydrate thereof according to any one of claims 1-11, wherein R5 is C1-Cδalkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6aminoalkyl, C1-C6alkanoyl, C1-C6alkoxycarbonyl, mono- or di-(C1-C6alkyl)aminoC0-C4alkyl, (C3-C7cycloalkyl)Co-C4alkyl, (3- to 7-membered heterocycloalkyl)C0-C4alkyl, phenylCo-C4alkyl, naphthylC0-C4alkyl or (5- to 10-membered heteroaryl)C0-C4alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from:
(i) oxo, halogen, cyano, hydroxy, amino, nitro, aminosulfonyl and aminocarbonyl; and (ii) C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6haloalkyl, C1-C6alkylthio, C,-C6alkoxy, C1- Cδhaloalkoxy, C1-C6alkanoyl, mono- or di-(C1-C6alkyl)aminoCo-C2alkyl, mono- or di-(C1- C6alkyl)aminocarbonylC0-C2alkyl, (C3-C7cycloalkyl)Co-C2alkyl, (3- to 10-membered heterocycloalkyl)Co-C2alkyl, phenylCo-C2alkyl, phenylCo-C2alkoxy, phenylCo-C2alkylthio, naphthylCo-C2alkyl and (5- or 6-membered heteroaryl)C0-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, C1-C4alkyl, C2-C4alkenyl, C1-C4haloalkyl, C1-C4alkoxy, Cr C4haloalkoxy, C1-C4alkyl ether, C1-C4alkoxycarbonyl, mono- or di-(C1-C4alkyl)amino, phenylC0-C2alkyl and phenylC0-C2alkoxy.
13. A compound or salt or hydrate thereof according to claim 12, wherein R6 is C1- Qalkyl, C2-C8alkenyl, C2-C8alkynyl, (C3-C7cycloalkyl)Co-C2alkyl, C2-C8alkyl ether, or mono- or di- (C1-C8alkyl)aminoCo-C4alkyl, each of which is substituted with from 0 to 2 oxo substituents.
14. A compound or salt or hydrate thereof according to claim 12, wherein R6 has the formula Y-(C=0)t-(NRio)p-L- , wherein:
Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1- C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl, d-C6alkoxy, C,-C6haloalkyl, C,-C6haloalkoxy, C1- C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(C1- C6alkyl)aminoC0-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylC0-C4alkyl, pheny!Co-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4IIaIOaIlCyI, C1- Qhaloalkoxy, C1-C4alkylthio, phenyl and phenoxy; t is 0 or 1; p is 0 or 1;
Rio is hydrogen, methyl or ethyl; and
L is absent or C1-C4alkylene that is optionally substituted with oxo or phenyl.
15. A compound or salt or hydrate thereof according to claim 14, wherein R6 is a group of the formula Y— C(=O)t-, wherein:
Y is phenyl, naphthyl or a 5- to 10-membered heteroaryl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1- C6alkyl, (C3-C3cycloalkyl)Co-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1- C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(C1- C6alkyl)aminoC0-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylCo-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- C4haloalkoxy, C1-C4alkylthio, phenyl and phenoxy; and t is O or 1.
16. A compound or salt or hydrate thereof according to claim 14, wherein R6 is phenylC0- Caalkyl, pyridylCo-C3alkyl, pyrimidylC0-C3alkyl, pyridazinylCo-C3alkyl, or a N-linked (5- to 7- membered heterocycloalkyl)C0-C3alkyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1-C4alkoxy, C1-Qalkanoyl, C1-C4haloalkyl and phenyl-(C=O)s- wherein s is 0 or 1.
17. A compound or salt or hydrate thereof according to claim 16, wherein R6 is phenyl, pyridyl, pyridazinyl or pyrimidyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl, C1-C4haloalkyl and phenyl-(C=O)s-.
18. A compound or salt or hydrate thereof according to any one of claims 1-11, wherein R6 is phenyl that is fused to a 5- or 6-membered ring that is optionally substituted with oxo.
19. A compound or salt or hydrate thereof according to any one of claims 1-18, wherein the compound satisfies one of the following formulas:
Figure imgf000257_0001
20. A compound or salt or hydrate thereof according to any one of claims 1-18, wherein the compound satisfies one of the following formulas:
Figure imgf000257_0002
21. A compound or salt or hydrate thereof according to any one of claims 1-18, wherein the compound satisfies one of the following formulas:
Figure imgf000257_0003
22. A compound or salt or hydrate thereof according to any one of claims 1-18, wherein the compound satisfies one of the following formulas:
Figure imgf000258_0001
23. A compound or salt or hydrate thereof according to any one of claims 1-8, wherein Z2 is N and Z3 is CRb.
24. A compound or salt or hydrate thereof according to claim 23, wherein the compound satisfies the formula:
Figure imgf000258_0002
wherein:
RB is a group of the formula Y-C(=O)-, wherein Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, C1-C6alkyl, (C3-C8cycloalkyl)C0-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1- C6haloalkoxy, C1-C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, phenylC0- C2alkyl, (5- to 7-membered heterocycle)Co-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1- C4haloalkyl, C1-C4haloalkoxy, C1-C4alkylthio, phenyl and phenoxy; and
RH is hydrogen or C1-C4alkyl; or R]3 is taken together with R14 to form a 5- to 10-membered heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo and C1-C4alkyl.
25. A compound or salt or hydrate thereof according to claim 23, wherein the compound satisfies one of the following formulas:
Figure imgf000258_0003
Figure imgf000259_0001
Figure imgf000259_0002
Rb is taken together with a substituent OfR6 to form an optionally substituted 5- or 6-membered ring.
27. A compound or salt or hydrate thereof according to claim 26, wherein the compound satisfies the formula:
Figure imgf000259_0003
A wherein ^ represents a spiro 4- to 7-membered heterocycloalkyl that is:
(i) substituted with from 0 to 2 substituents independently chosen from:
(a) oxo; and
(b) d-C6alkyl, C1-C6alkoxy, (C3-C7cycloalkyl)Co-C2alkyl, phenylC0-C2alkyl and (5-or 6- membered heterocycle)Co-C2alkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, C1-C4alkyl and C1-C4alkoxy; and
(ii) optionally fused to phenyl or 6-membered heteroaryl.
28. A compound or salt or hydrate thereof according to claim 1, wherein the compound satisfies one of the following formulas:
Figure imgf000259_0004
29. A compound of the formula:
Figure imgf000260_0001
or a pharmaceutically acceptable salt thereof, wherein:
Zi and Z2 are independently nitrogen or CRa, wherein each Ra is independently chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy and C^alkanoyl;
Z3 is nitrogen or CRb, wherein Rb is absent or chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl and groups that are taken together with Rz or a substituent of R6 to form a spiro ring that is substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C1-C4haloalkyl, CpC4alkoxy and substituents that are taken together to form a fused 5- to 7-membered ring; such that Z2 is not CR3 if Zi and Z3 are both nitrogen, and at least one of Z2 and Z3 is nitrogen;
_ a b
=-= and =-=-= independently represent a single or double bond; such that: a (i) if Z3 is N, then =-ri^: is a single bond; and
_ a b
(ii) at least one of — =-= and =-=-= is a single bond;
Each q is independently 0, 1 or 2; such that neither q is 0 if both Z2 and Z3 are N; m is 0, 1 or 2;
R1 is C3~C6alkyl, C3-C6alkenyl, C3-C6alkynyl, (C3-C8cycloalkyl)C0-C2alkyl or (3- to 8-membered heterocycloalkyl)Co-C2alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C1- C6alkyl, C1-C6alkenyl, C1-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkanoyl, mono- or di-(C1-C6alkyl)amino, mono- or di-(C1-C6alkyl)amiriocarbonyl, C3-C7cycloalkyl and 3- to 7-membered heterocycloalkyl; R2 represents from 0 to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-Qalkylene bridge;
R6 is C1-C8alkyl, C1-C8alkenyl, C1-C8alkynyl, C1-C3alkanoyl, C1-C8alkoxycarbonyl, mono- or di-(Cr C8alkyl)amino, (C3-Ciocarbocycle)-X-(Co-C4alkyl)- or (4- to 10-membered heterocycle)-X-(C0- C4alkyl)-, each of which is substituted with from 0 to 4 substituents independently chosen from: (i) oxo, halogen, cyano, hydroxy, amino, nitro and aminocarbonyl; and (ii) groups of the formula D-X-E- wherein:
D represents C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, (C3-Ci4carbocycle)C0-C2alkyl or (4- to 14-membered heterocycle)C0-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from:
(a) halogen, cyano, hydroxy, nitro, amino, oxo, aminocarbonyl, aminosulfonyl and - COOH; (b) C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6haloalkyl, d-C6alkoxy, Cr C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkoxycarbonyl, Cr C6alkanoyloxy, C1-C6alkylsulfonyl, mono- or di-(C1-C6alkyl)arninoCo-C4alkyl, phenylC0-C2alkyl and phenylC0-C2alkoxy;
(c) groups that are taken together to form a fused 5- to 7-membered ring or a fused 8- to
10-membered bicyclic group;
(d) and groups that are taken together with Rb to form an optionally substituted spiro ring; each of which (b)-(d) is further substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, C1-C4alkyl, C1-C4haloalkyl, C^alkoxy C1-C^aloalkoxy and phenyl;
Each X is independently absent, O, CH2O, OCH2, C(=0), CH2C(=O), OC(=O), CH2OC(=O), C(=0)0, S(0)r, N(R2), C(=O)N(RZ), N(RZ)C(=O), N(Rz)S(O)r or S(O)rN(Rz), wherein each r is independently O, 1 or 2 and each R2 is independently hydrogen, C1-C6alkyl, (C3- C8cycloalkyl)C0-C2alkyl, or taken together with Rb to form an optionally substituted spiro ring; and
E is absent or represents C1-C6alkylene or C1-C6alkoxy; such that R6 is not phenyl substituted with halogen; and
R7 represents from 0 to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-C3alkylene bridge.
30. A compound or salt or hydrate thereof according to claim 29, wherein R2 and R7 independently represent 0 substituents or 1 or 2 methyl substituents.
31. A compound or salt or hydrate thereof according to claim 29, wherein R2 represents 0 substituents or 1 or 2 methyl substituents, and wherein R7 represents two substituents that are taken together to form a C1-C3alkylene bridge.
32. A compound or salt or hydrate thereof according to any one of claims 29-31, wherein Ri is C3-C6alkyl, C1-C6alkenyl, cyclobutyl, cyclopentyl or cyclohexyl.
33. A compound or salt or hydrate thereof according to any one of claims 29-32, wherein m is 1.
34. A compound or salt or hydrate thereof according to any one of claims 29-33, wherein one q is 1 and the other q is 0, 1 or 2.
35. A compound or salt or hydrate thereof according to any one of claims 29-34, wherein Z3 is N.
36. A compound or salt or hydrate thereof according to claim 35, wherein the compound has the formula:
Figure imgf000262_0001
37. A compound or salt or hydrate thereof according to any one of claims 29-36, wherein R6 is C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6aminoalkyl, C1-C6alkanoyl, C1-C6alkoxycarbonyl, mono- or di-(C1-C6alkyl)aminoC0-C4alkyl, (C3-C7cycloalkyl)Co-C4alkyl, (3- to 7-membered heterocycloalkyl)C0-C4alkyl, phenylC0-C4alkyl, naphthylC0-C4alkyl or (5- to 10-membered heteroaryl)Co-C4alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from:
(i) 0x0, halogen, cyano, hydroxy, amino, nitro, aminosulfonyl and aminocarbonyl; and (ii) C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6haloalkyl, CrC6alkylthio, C1-C6alkoxy, C1- C6haloalkoxy, C1-C6alkanoyl, mono- or di-(C1-C6alkyl)aminoCo-C2alkyl, mono- or di-(C1- C6alkyl)aminocarbonylCo-C2alkyl, (C3-C7cycloalkyl)Co-C2alkyl, (3- to 10-membered heterocycloalkyl)Co-C2alkyl, phenylC0-C2alkyl, phenylC0-C2alkoxy, phenylC0-C2alkylthio, naphthylCo-C2alkyl and (5- or 6-membered heteroaryl)Co-C2alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, C1-C4alkyl, C2-C4alkenyl, C1-C4haloalkyl, C1-C4alkoxy, C1- C4haloalkoxy, C1-C4alkyl ether, C1-C4alkoxycarbonyl, mono- or di-(C1-C4alkyl)amino, phenylC0-C2alkyl and pheny!C0-C2alkoxy.
38. A compound or salt or hydrate thereof according to claim 37, wherein R6 is C1- C8alkyl, C2-C8alkenyl, C2-C8alkynyl, (C1-Qcycloalkyl)C0-C2alkyl, C2-C8alkyl ether, or mono- or di- (C1-C8alkyl)aminoC0-Qalkyl, each of which is substituted with from 0 to 2 oxo substituents.
39. A compound or salt or hydrate thereof according to claim 37, wherein R6 has the formula Y-(C=0)t-(NRio)P-L- , wherein:
Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1- C6alkyl, (C3-C8cycloalkyl)C0-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1- C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(C1- C6alkyl)aminoC0-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylC0-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)Co-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- Qhaloalkoxy, C1-C4alkylthio, phenyl and phenoxy; t is O or 1; p is 0 or 1; Rio is hydrogen, methyl or ethyl; and
L is absent or C1-C4alkylene that is optionally substituted with oxo or phenyl.
40. A compound or salt or hydrate thereof according to claim 39, wherein R6 is a group of the formula Y-C(=O)t-, wherein:
Y is phenyl, naphthyl or a 5- to 10-membered heteroaryl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1- C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1- C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl5 C1-C6alkylsulfonyl, mono- or di-(Cr C6alkyl)aminoCo-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylC0-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- C4haloalkoxy, C1-C4alkylthio, phenyl and phenoxy; and t is O or 1.
41. A compound or salt or hydrate thereof according to claim 39, wherein R6 is phenylC1- C3alkyl, pyridylC0-C3alkyl, pyrimidylC0-C3alkyl, pyridazinylC0-C3alkyl, or a N-linked (5- to 7- membered heterocycloalkyl)Co-C3alkyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-Qalkyl, C1-Qalkoxy, C1-C4alkanoyl, C1-C4haloalkyl and phenyl-(C=O)s- wherein s is 0 or 1.
42. A compound or salt or hydrate thereof according to claim 41, wherein R6 is phenyl, pyridyl, pyridazinyl or pyrimidyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl, C1-C4haloalkyl and phenyl-(C=O)s-.
43. A compound or salt or hydrate thereof according to claim 37, wherein R6 is phenyl that is fused to a 5- or 6-membered ring that is optionally substituted with oxo.
44. A compound or salt or hydrate thereof according to any one of claims 29-43, wherein the compound satisfies one of the following formulas:
Figure imgf000263_0001
Figure imgf000264_0001
45. A compound or salt or hydrate thereof according to any one of claims 29-43, wherein the compound satisfies one of the following formulas:
Figure imgf000264_0002
46. A compound of the formula:
Figure imgf000264_0003
or a pharmaceutically acceptable salt thereof, wherein:
Z2 is nitrogen or CR3, wherein each R3 is independently chosen from hydrogen, hydroxy, halogen, C1-
C4alkyl, C1-C4alkoxy and C1-C4alkanoyl; Z3 is nitrogen or CRb, wherein Rb is absent or chosen from hydrogen, hydroxy, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl and groups that are taken together with R2 or a substituent Of R6 to form a spiro ring that is substituted with from 0 to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, oxo, C1-C4alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C1-Qhaloalkyl, y and substituents that are taken together to form a fused 5- to 7-membered ring;
Figure imgf000265_0001
independ present a single or double bond; such that:
Figure imgf000265_0002
(i) if Z3 is N, the bond; and (ii) at least one o s a single bond;
Figure imgf000265_0003
Each q is independently 0, 1 or 2; such that neither q is 0 if both Z2 and Z3 are N; W is CR3R4, NR5, CC=O)CR3R4 or C(O)OCR3R4, wherein:
R3 and R4 are independently chosen from hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkyl ether and (C3-C6cycloalkyl)C0-C2alkyl, or R3 and R4 are taken together to form a 4- to 6-membered cycloalkyl or heterocycloalkyl ring; and
R5 is hydrogen, C1-C6alkyl, C1-C6haloalkyl, C2-C8alkyl ether or (C3-C6cycloalkyl)C0-C2alkyl; Each q is independently O, 1 or 2; such that neither q is O if both Z2 and Z3 are N; m is O, 1 or 2; R2 represents from O to 4 substituents independently chosen from C1-C3alkyl and groups that are taken together to form a C1-C3alkylene bridge;
R6 is C1-C8alkyl, C1-C8alkenyl, C1-C3alkynyl, C1-C8alkanoyl, C1-C8alkoxycarbonyl, mono- or di-(C1- C8alkyl)amino, (C3-C iocarbocycle)-X-(Co-C4alky I)- or (4- to 10-membered heterocycle)-X-(Co- Qalkyl)-, each of which is substituted with from O to 4 substituents independently chosen from: (i) oxo, halogen, cyano, hydroxy, amino, nitro and aminocarbonyl; and (ii) groups of the formula: D-X-E-, wherein:
D represents C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, (C3-C14carbocycle)C0-C2alkyl or (5- to 14-membered heterocycle)Co-C2alkyl, each of which is substituted with from O to 6 substituents independently chosen from:
(a) halogen, cyano, hydroxy, nitro, amino, oxo, aminocarbonyl, aminosulfonyl and - COOH;
(b) C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, C1-C6haloalkyl, C1-C6alkoxy, C1- C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, C1-C6alkoxycarbonyl, Cr C6alkanoyloxy, C1-C6alkylsulfonyl, mono- or di-(C1-C6alkyl)aminoCo-C4alkyl, phenylC0-C2alkyl and phenylC0-C2alkoxy;
(c) groups that are taken together to form a fused 5- to 7-membered ring or a fused 8- to
10-membered bicyclic group;
(d) and groups that are taken together with Rb to form an optionally substituted spiro ring; each of which (b)-(d) is further substituted with from O to 4 substituents independently chosen from halogen, cyano, hydroxy, amino, C1-Qalkyl, C1-C4haloalkyl, C1-C4alkoxy C1-C4haloalkoxy and phenyl; Each X is independently absent, O, CH2O, OCH2, C(O), CH2C(O), OC(=O), CH2OC(=O), C(O)O, S(0)r, N(R2), C(O)N(R8), N(R8)C(O), N(R2)S(O), or S(O)1N(R8), wherein each r is independently O, 1 or 2 and each R2 is independently hydrogen, C1-C6alkyl, (C3- Cgcycloalkyl)Co-C2alkyl, or taken together with Rb to form an optionally substituted spiro ring; and
E is absent or represents C1-C6alkylene or C1-C6alkoxy; R7 represents from O to 4 substituents independently chosen from d-C3alkyl and groups that are taken together to form a C0-C2alkylene bridge;
R8 and R9 are independently hydrogen, C)-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, (C3-C8cycloalkyl)Co- C2alkyl or (3- to 8-membered heterocycloalkyl)C0-C2alkyl, each of which is substituted with from O to 4 substituents independently chosen from Rx; or Rg and R9 are taken together to form a 4- to 8-membered heterocycloalkyl that is substituted with from O to 4 substituents independently chosen from Rx; and
Each Rx is independently oxo, nitro, halogen, amino, cyano, hydroxy, aminocarbonyl, C1-C6alkyl, C1- C6alkenyl, C1-C6haloalkyl, C1-C6alkoxy, C1-C6haloalkoxy, C1-C6alkylthio, C1-C6alkyl ether, Cr C6alkanoyl, mono- or di-(C1-C6alkyl)amino, mono- or di-(C1-C6alkyl)aminocarbonyl, C3- C7cycloalkyl, 3- to 7-membered heterocycloalkyl, phenyl and 5- or 6-membered heteroaryl.
47. A compound or salt or hydrate thereof according to claim 46, wherein W is CR3R4, CC=O)CR3R4 or Q=O)OCR3Rt, and R3 and R4 are independently hydrogen or methyl.
48. A compound or salt or hydrate thereof according to claim 46, wherein W is NR5, and R5 is hydrogen or methyl.
49. A compound or salt or hydrate thereof according to any one of claims 46-48, wherein R2 and R7 independently represent O substituents or 1 or 2 methyl substituents.
50. A compound or salt or hydrate thereof according to any one of claims 46-48, wherein R2 represents O substituents or 1 or 2 methyl substituents, and wherein R7 represents two substituents that are taken together to form a C1-Qalkylene bridge.
51. A compound or salt or hydrate thereof according to any one of claims 46-50, wherein m is 1.
52. A compound or salt or hydrate thereof according to any one of claims 46-51, wherein one q is 1 and the other q is O, 1 or 2.
53. A compound or salt or hydrate thereof according to any one of claims 46-52, wherein
Z3 is N.
54. A compound or salt or hydrate thereof according to any one of claims 46-53, wherein R6 is C1-C6alkyl, C1-C6alkenyl, CpC6alkynyl, C,-C6aminoalkyl, C1-C6alkanoyl, C1-C6alkoxycarbonyl, mono- or di-(C1-C6alkyl)aminoC0-C4alkyl, (C3-C7cycloalkyl)C0-C4alkyl, (3- to 7-membered heterocycloalkyl)Co-C4alkyl, phenylC0-C4alkyl, naphthylC0-C4alkyl or (5- to 10-membered heteroaryl)Co-C4alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from:
(i) oxo, halogen, cyano, hydroxy, amino, nitro, aminosulfonyl and aminocarbonyl; and (ii) C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6haloalkyl, C1-C6alkylthio, C,-C6alkoxy, C1- C6haloalkoxy, C1-C6alkanoyl, mono- or di-(C1-C6alkyl)aminoC0-C2alkyl, mono- or di-(Cr C6alkyl)aminocarbonylCo-C2alkyl, (C3-C7cycloalkyl)C0-C2alkyl, (3- to 10-membered heterocycloalkyl)C0-C2alkyl, phenylC0-C2alkyl, phenylCo-C2alkoxy, phenylC0-C2alkylthio, naphthylCo-C2alkyl and (5- or 6-membered heteroaryl)C0-C2alkyl, each of which is substituted with from O to 6 substituents independently chosen from oxo, halogen, cyano, hydroxy, amino, nitro, C1-C4alkyl, C2-C4alkenyl, C1-C4haloalkyl, C1-C4alkoxy, C1- C4haloalkoxy, C1-C4alkyl ether, C1-C4alkoxycarbonyl, mono- or di-(C1-C4alkyl)amino, phenylCo-C2alkyl and phenylCo-C2alkoxy.
55. A compound or salt or hydrate thereof according to claim 54, wherein R6 is C1- C8alkyl, C2-C8alkenyl, C2-C8alkynyl, (C3-C7cycloalkyl)Co-C2alkyl, C2-C8alkyl ether, or mono- or di- (C1-C8alkyl)aminoCo-C4alkyl, each of which is substituted with from O to 2 oxo substituents.
56. A compound or salt or hydrate thereof according to claim 54, wherein R6 has the formula Y-{C=0)r(NRio)p-I^ , wherein:
Y is phenyl, naphthyl or a 5- to 7-membered heterocycle, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, C1- C6alkyl, (C3-C8cycloalkyl)C0-C2alkyl, C1-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, C1- C6hydroxyalkyl, C1-Cδalkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(C1- C6alkyl)aminoC0-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylC0-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)Co-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- C4haloalkoxy, CpQalkylthio, phenyl and phenoxy; t is 0 or 1; p is 0 or 1;
Rio is hydrogen, methyl or ethyl; and
L is absent or C1-C4alkylene that is optionally substituted with oxo or phenyl.
57. A compound or salt or hydrate thereof according to claim 56; wherein R6 is a group of the formula Y-C(=O)t-, wherein:
Y is phenyl, naphthyl or a 5- to 10-membered heteroaryl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, cyano, halogen, aminocarbonyl, aminosulfonyl, Cr C6alkyl, (C3-C8cycloalkyl)Co-C2alkyl, C|-C6alkoxy, C1-C6haloalkyl, C1-C6haloalkoxy, Cr C6hydroxyalkyl, C1-C6alkylthio, C1-C6alkanoyl, C1-C6alkylsulfonyl, mono- or di-(Cr C6alkyl)aminoC0-C4alkyl, mono- or di-(C1-C6alkyl)aminocarbonylC0-C4alkyl, phenylC0-C2alkyl, (5- to 7-membered heterocycle)C0-C2 and phenoxy, each of which is substituted with from 0 to 3 substituents independently chosen from oxo, C1-C4alkyl, C1-C4alkoxy, C1-C4haloalkyl, C1- C4haloalkoxy, C1-C4alkylthio, phenyl and phenoxy; and t is O or 1.
58. A compound or salt or hydrate thereof according to claim 56, wherein Re is phenylC0- C3alkyl, pyridylCo-C3alkyl, pyrimidylC0-C3alkyl, pyridazinylCo-C3alkyl, or a N-linked (5- to 7- membered heterocycloalkyl)Co-C3alkyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl, C1-C4haloalkyl and phenyl-(C=O)s- wherein s is 0 or 1.
59. A compound or salt or hydrate thereof according to claim 58, wherein R6 is phenyl, pyridyl, pyridazinyl or pyrimidyl, each of which is substituted with from 0 to 2 substituents independently chosen from nitro, halogen, C1-C4alkyl, C1-C4alkoxy, C1-C4alkanoyl, C1-C4haloalkyl and pheny 1-(C=O)5-.
60. A compound or salt or hydrate thereof according to claim 54, wherein R6 is phenyl that is fused to a 5- or 6-membered ring that is optionally substituted with oxo.
61. A compound or salt or hydrate thereof according to claim 46, wherein the compound satisfies one of the following formulas:
Figure imgf000268_0001
Figure imgf000269_0001
62. A compound or salt or hydrate thereof according to any one of claims 1-61, wherein the compound has a K; value of 1 micromolar or less, as determined using an assay for H3 receptor GTP binding.
63. A compound or salt or hydrate thereof according to claim 62, wherein the compound has a Kj value of 100 nanomolar or less, as determined using an assay for H3 receptor GTP binding.
64. A pharmaceutical composition, comprising at least one compound or salt or hydrate thereof according to any one of claims 1-63 in combination with a physiologically acceptable carrier or excipient.
65. A pharmaceutical composition according to claim 64 wherein the composition is formulated as an injectible fluid, an aerosol, a cream, a gel, a pill, a capsule, a syrup or a transdermal patch.
66. A method for treating a condition responsive to H3 receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of a compound or salt or hydrate thereof according to any one of claims 1-63, and thereby alleviating the condition in the patient.
67. A method according to claim 66, wherein the compound exhibits H3 receptor antagonist activity.
68. A method according to claim 66, wherein the condition is attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, a cognitive disorder, epilepsy, migraine, narcolepsy, idiopathic hypersomnia, allergic rhinitis, vertigo, motion sickness, a memory disorder, or Parkinson's disease.
69. A method according to claim 66, wherein the condition is obesity, an eating disorder or diabetes.
70. A method according to claim 66, wherein the patient is a human.
71. A compound or salt or hydrate thereof according to any one of claims 1-63, wherein the compound or salt or hydrate thereof is radiolabeled.
72. A method for determining the presence or absence of H3 receptor in a sample, comprising the steps of:
(a) contacting a sample with a compound or salt or hydrate thereof according to any one of claims 1-63, under conditions that permit binding of the compound to H3 receptor; and
(b) detecting a level of the compound bound to H3 receptor, and therefrom determining the presence or absence of H3 receptor in the sample.
73. A method according to claim 72, wherein the compound is radiolabeled, and wherein the step of detection comprises the steps of:
(i) separating unbound compound from bound compound; and
(ii) detecting the presence or absence of bound compound in the sample.
74. A packaged pharmaceutical preparation, comprising:
(a) a pharmaceutical composition according to claim 64 in a container; and
(b) instructions for using the composition to treat a condition responsive to H3 receptor modulation in a patient.
75. A packaged pharmaceutical preparation, according to claim 74, wherein the condition is attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, a cognitive disorder, epilepsy, migraine, narcolepsy, idiopathic hypersomnia, allergic rhinitis, vertigo, motion sickness, a memory disorder, or Parkinson's disease.
76. A packaged pharmaceutical preparation, according to claim 74, wherein the condition is obesity, an eating disorder or diabetes.
77. The use of a compound or salt or hydrate thereof according to any one of claims 1-64 for the manufacture of a medicament for the treatment of a condition responsive to H3 receptor modulation.
78. A use according to claim 77, wherein the condition is attention deficit disorder, attention deficit hyperactivity disorder, schizophrenia, a cognitive disorder, epilepsy, migraine, a sleep disorder, excessive daytime sleepiness, shift work disorder, narcolepsy, idiopathic hypersomnia, allergic rhinitis, vertigo, motion sickness, a memory disorder, or Parkinson's disease.
79. A use according to claim 77, wherein the condition is obesity, an eating disorder or diabetes.
PCT/US2006/029761 2005-08-02 2006-07-28 Dipiperazinyl ketones and related analogues Ceased WO2007016496A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP06788999A EP1909797A4 (en) 2005-08-02 2006-07-28 Dipiperazinyl ketones and related analogues
AU2006275568A AU2006275568A1 (en) 2005-08-02 2006-07-28 Dipiperazinyl ketones and related analogues
CA002606004A CA2606004A1 (en) 2005-08-02 2006-07-28 Dipiperazinyl ketones and related analogues
JP2008525081A JP2009506987A (en) 2005-08-02 2006-07-28 Dipiperazinyl ketone and related analogs

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US70472205P 2005-08-02 2005-08-02
US60/704,722 2005-08-02

Publications (2)

Publication Number Publication Date
WO2007016496A2 true WO2007016496A2 (en) 2007-02-08
WO2007016496A3 WO2007016496A3 (en) 2009-04-30

Family

ID=37709282

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/029761 Ceased WO2007016496A2 (en) 2005-08-02 2006-07-28 Dipiperazinyl ketones and related analogues

Country Status (6)

Country Link
US (1) US7851474B2 (en)
EP (1) EP1909797A4 (en)
JP (1) JP2009506987A (en)
AU (1) AU2006275568A1 (en)
CA (1) CA2606004A1 (en)
WO (1) WO2007016496A2 (en)

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008017381A1 (en) 2006-08-08 2008-02-14 Sanofi-Aventis Arylaminoaryl-alkyl-substituted imidazolidine-2,4-diones, processes for preparing them, medicaments comprising these compounds, and their use
WO2009021740A2 (en) 2007-08-15 2009-02-19 Sanofis-Aventis Substituted tetrahydronaphthalenes, process for the preparation thereof and the use thereof as medicaments
WO2010003624A2 (en) 2008-07-09 2010-01-14 Sanofi-Aventis Heterocyclic compounds, processes for their preparation, medicaments comprising these compounds, and the use thereof
WO2010027567A3 (en) * 2008-07-23 2010-05-20 Schering Corporation Tricyclic spirocycle derivatives and methods of use thereof
WO2010062245A1 (en) * 2008-11-25 2010-06-03 Astrazeneca Ab Spirocyclobutyl piperidine derivatives
WO2010068601A1 (en) 2008-12-08 2010-06-17 Sanofi-Aventis A crystalline heteroaromatic fluoroglycoside hydrate, processes for making, methods of use and pharmaceutical compositions thereof
JP2010528089A (en) * 2007-05-31 2010-08-19 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング CCR2 receptor antagonist and use thereof
WO2010123018A1 (en) * 2009-04-24 2010-10-28 日本ケミファ株式会社 Diazaspiroalkane derivative
WO2011002067A1 (en) * 2009-07-02 2011-01-06 武田薬品工業株式会社 Heterocyclic compound and use thereof
WO2011023754A1 (en) 2009-08-26 2011-03-03 Sanofi-Aventis Novel crystalline heteroaromatic fluoroglycoside hydrates, pharmaceuticals comprising these compounds and their use
US8063215B2 (en) 2007-08-22 2011-11-22 Astrazeneca Ab Cyclopropyl amide derivatives
US8093248B2 (en) 2007-12-05 2012-01-10 Astrazeneca Ab (Publ) Compounds useful for the treatment of conditions associated with weight gain
EP2162451A4 (en) * 2007-06-25 2012-04-18 Neurogen Corp Piperazinyl oxoalkyl tetrahydro-beta-carbolines and related analogues
WO2012120054A1 (en) 2011-03-08 2012-09-13 Sanofi Di- and tri-substituted oxathiazine derivates, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120053A1 (en) 2011-03-08 2012-09-13 Sanofi Branched oxathiazine derivatives, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120052A1 (en) 2011-03-08 2012-09-13 Sanofi Oxathiazine derivatives substituted with carbocycles or heterocycles, method for producing same, drugs containing said compounds, and use thereof
WO2012120055A1 (en) 2011-03-08 2012-09-13 Sanofi Di- and tri-substituted oxathiazine derivates, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120056A1 (en) 2011-03-08 2012-09-13 Sanofi Tetrasubstituted oxathiazine derivatives, method for producing them, their use as medicine and drug containing said derivatives and the use thereof
US8344001B2 (en) 2007-06-11 2013-01-01 High Point Pharmaceuticals, Llc Heterocyclic H3 antagonists
US8378097B2 (en) 2006-05-29 2013-02-19 High Point Pharmaceuticals, Llc 3-(1,3-benzodioxol-5-yl)-6-(4-cyclopropylpiperazin-1-yl)-pyridazine, its salts and solvates and its use as histamine H3 receptor antagonist
WO2013050987A1 (en) 2011-10-08 2013-04-11 Novartis Ag Carbamate/ urea derivatives containing piperidin and piperazin rings as h3 receptor inhibitors
CN103172635A (en) * 2011-12-21 2013-06-26 上海医药工业研究院 Piperazine or piperidine compound as well as salts, intermediates, preparation method and application thereof
US8501739B2 (en) 2005-07-04 2013-08-06 High Point Pharmaceuticals, Llc Medicaments
WO2014013469A1 (en) 2012-07-20 2014-01-23 Novartis Ag Carbamate/urea derivatives
US8765949B2 (en) 2009-12-17 2014-07-01 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists and uses thereof
US8835440B2 (en) 2008-12-19 2014-09-16 Boehringer Ingelheim International Gmbh Cyclic pyrimidin-4-carboxamides as CCR2 receptor antagonists for treatment of inflammation, asthma and COPD
US8841313B2 (en) 2010-05-17 2014-09-23 Boehringer Ingelheim International Gmbh CCR2 antagonists and uses thereof
US8877745B2 (en) 2010-05-12 2014-11-04 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists, method for producing the same, and use thereof as medicaments
US8946218B2 (en) 2010-05-12 2015-02-03 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists, method for producing the same, and use thereof as medicaments
US8962656B2 (en) 2010-06-01 2015-02-24 Boehringer Ingelheim International Gmbh CCR2 antagonists
US8993577B2 (en) 2009-02-20 2015-03-31 Astrazeneca Ab Cyclopropyl amide derivatives
US9012452B2 (en) 2010-02-18 2015-04-21 Astrazeneca Ab Processes for making cyclopropyl amide derivatives and intermediates associated therewith
US9018212B2 (en) 2010-05-25 2015-04-28 Boehringer Ingelheim International Gmbh Pyridazine carboxamides as CCR2 receptor antagonists
US9108958B2 (en) 2011-07-15 2015-08-18 Boehringer Ingelheim International Gmbh Selective CCR2 antagonists
WO2015179414A1 (en) * 2014-05-19 2015-11-26 Merial, Inc. Anthelmintic compounds
US10213428B2 (en) 2015-07-02 2019-02-26 Centrexion Therapeutics Corporation (4-((3R,4R)-3-methoxytetrahydro-pyran-4-ylamino)piperidin-1-yl)(5-methyl-6-(((2R,6S)-6-(p-tolyl)tetrahydro-2H-pyran-2-yl)methylamino)pyrimidin-4-yl)methanone citrate
EP3584236A1 (en) 2018-06-20 2019-12-25 Universitat de Barcelona Polycyclic compounds soluble epoxide hydrolase inhibitors
TWI810229B (en) * 2017-12-15 2023-08-01 瑞士商英夕亞生物科技公司 Oxopiperazine derivatives
US12233062B2 (en) 2018-09-26 2025-02-25 Jacobio Pharmaceuticals Co., Ltd. Heterocyclic derivatives useful as SHP2 inhibitors
US12486222B2 (en) 2021-03-24 2025-12-02 Universitat De Barcelona Compounds as soluble epoxide hydrolase inhibitors

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100651849B1 (en) * 2005-02-01 2006-12-01 엘지전자 주식회사 washer
WO2007103719A2 (en) * 2006-03-03 2007-09-13 Incyte Corporation MODULATORS OF 11-β HYDROXYL STEROID DEHYDROGENASE TYPE 1, PHARMACEUTICAL COMPOSITIONS THEREOF, AND METHODS OF USING THE SAME
TW200902007A (en) * 2007-05-25 2009-01-16 Astrazeneca Ab Spirocyclopropyl piperidine derivatives
JP2011519934A (en) * 2008-05-08 2011-07-14 メルク・シャープ・エンド・ドーム・コーポレイション Spiroza indole
EP2501232A1 (en) * 2009-11-16 2012-09-26 Merck Sharp & Dohme Corp. Imidazole derivatives and methods of use thereof
GB201000685D0 (en) * 2010-01-15 2010-03-03 Glaxo Group Ltd Novel compounds
EP2575815A4 (en) 2010-06-04 2013-12-25 Albany Molecular Res Inc Glycine transporter-1 inhibitors, methods of making them, and uses thereof
EA202092442A3 (en) * 2016-06-07 2021-08-31 Джакобио Фармасьютикалс Ко., Лтд. NEW HETEROCYCLIC DERIVATIVES USED AS SHP2 INHIBITORS
CN119816484A (en) * 2022-08-26 2025-04-11 富士胶片株式会社 Novel piperazine derivative or its salt and pharmaceutical composition
WO2025178125A1 (en) * 2024-02-22 2025-08-28 富士フイルム株式会社 Novel piperazine derivative or salt thereof

Family Cites Families (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2436213A1 (en) * 1978-09-13 1980-04-11 Oreal COMPOSITION FOR TREATING FIBROUS MATERIALS BASED ON CATIONIC AND ANIONIC POLYMERS
DE3315424A1 (en) * 1983-04-28 1984-12-20 Cassella Ag, 6000 Frankfurt SUBSTITUTED PIPERAZIN-1-YL-ACETIC ACID AMIDES, METHOD FOR THEIR PRODUCTION AND THEIR USE
DE4302485A1 (en) * 1993-01-29 1994-08-04 Merck Patent Gmbh Piperazine derivatives
US5753659A (en) * 1993-03-29 1998-05-19 Zeneca Limited Heterocyclic compouds
IL115420A0 (en) * 1994-09-26 1995-12-31 Zeneca Ltd Aminoheterocyclic derivatives
PL321003A1 (en) * 1994-12-23 1997-11-24 Thomae Gmbh Dr K Derivatives of piperasine, drugs containing them, their application and methods of obtaining them
US5700801A (en) * 1994-12-23 1997-12-23 Karl Thomae, Gmbh Piperazine derivatives, pharmaceutical compositions containing these compounds, their use and processes for preparing them
GB9516709D0 (en) * 1995-08-15 1995-10-18 Zeneca Ltd Medicament
CN1209125A (en) * 1995-12-18 1999-02-24 藤泽药品工业株式会社 Piperazine derivatives as tachykinin antagonists
DE19952146A1 (en) 1999-10-29 2001-06-07 Boehringer Ingelheim Pharma Arylalkanes, arylalkenes and aryl-azaalkanes, medicaments containing these compounds and process for their preparation
US6559140B2 (en) * 2000-03-09 2003-05-06 Abbott Laboratories Cyclic and bicyclic diamino histamine-3 receptor antagonists
US6699997B2 (en) * 2000-06-28 2004-03-02 Teva Pharmaceutical Industries Ltd. Carvedilol
BR0210391A (en) * 2001-06-12 2004-06-15 Elan Pharm Inc Compound, methods of treating a patient who has or prevent a patient from contracting a disease or condition and preparing a compound, and, using a compound
JP2005502623A (en) 2001-07-02 2005-01-27 ノボ ノルディスク アクティーゼルスカブ Substituted piperazines and diazepanes
US7208497B2 (en) * 2001-07-02 2007-04-24 Novo Nordisk A/S Substituted piperazines and diazepanes
CN1158270C (en) * 2001-09-26 2004-07-21 四川大学 Bispiperazine Derivatives with Calcium Antagonism
AR036812A1 (en) * 2001-10-17 2004-10-06 Schering Corp INHIBITORS OF THE 17BETA-HYDROXIESTEROID DEHYDROGENASE TYPE 3, PHARMACEUTICAL COMPOSITIONS AND THE USE OF SUCH COMPOUNDS FOR THE MANUFACTURE OF MEDICINES FOR THE TREATMENT OF ANDROGEN-DEPENDENT DISEASES
US7105505B2 (en) * 2002-04-18 2006-09-12 Schering Corporation Benzimidazole derivatives useful as histamine H3 antagonists
KR20040099449A (en) * 2002-04-18 2004-11-26 쉐링 코포레이션 1-(4-Piperidinyl)benzimidazolones as histamine H3 antagonists
CN1150176C (en) 2002-05-22 2004-05-19 上海医药工业研究院 Aralkanone piperazine derivatives and their applications
EP1539742B1 (en) * 2002-06-24 2006-11-08 Schering Corporation Indole derivatives useful as histamine h3 antagonists
US20040034019A1 (en) * 2002-08-08 2004-02-19 Ronald Tomlinson Piperazine and piperidine derivatives
CL2003002356A1 (en) * 2002-11-18 2005-02-11 Schering Corp COMPOUNDS DERIVED FROM 1- (1-ACETYL-PIPERIDIN-4-IL) - (ESTER OR AMIDA) -4- (SUBSTITUTED BENCIDRILE) -2-TERT-BUTIL-PIPERAZINE, PHARMACEUTICAL COMPOSITION, AND ITS USE IN THE INHIBITION OF 17B- HYDROXIESTEROID DEHYDROGENASE TYPE 3 AND DISEASES THAT DEPEND
US7332508B2 (en) * 2002-12-18 2008-02-19 Novo Nordisk A/S Substituted homopiperidine, piperidine or pyrrolidine derivatives
DE602004015269D1 (en) 2003-04-23 2008-09-04 Glaxo Group Ltd PIPERAZINE DERIVATIVES AND ITS USE IN THE TREATMENT OF NEUROLOGICAL AND PSYCHIATRIC DISEASES.
ES2291913T3 (en) 2003-07-18 2008-03-01 Glaxo Group Limited PIPERIDINS REPLACED AS LIGANDOS OF THE H3 HISTAMINE RECEIVER.
SE0401970D0 (en) 2004-08-02 2004-08-02 Astrazeneca Ab Novel compounds
SE0401971D0 (en) 2004-08-02 2004-08-02 Astrazeneca Ab Piperidne derivatives

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1909797A4 *

Cited By (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8846677B2 (en) 2005-07-04 2014-09-30 High Point Pharmaceuticals, Llc Medicaments
US8501739B2 (en) 2005-07-04 2013-08-06 High Point Pharmaceuticals, Llc Medicaments
US8378097B2 (en) 2006-05-29 2013-02-19 High Point Pharmaceuticals, Llc 3-(1,3-benzodioxol-5-yl)-6-(4-cyclopropylpiperazin-1-yl)-pyridazine, its salts and solvates and its use as histamine H3 receptor antagonist
WO2008017381A1 (en) 2006-08-08 2008-02-14 Sanofi-Aventis Arylaminoaryl-alkyl-substituted imidazolidine-2,4-diones, processes for preparing them, medicaments comprising these compounds, and their use
US8653262B2 (en) 2007-05-31 2014-02-18 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists and uses thereof
JP2010528089A (en) * 2007-05-31 2010-08-19 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング CCR2 receptor antagonist and use thereof
US8344001B2 (en) 2007-06-11 2013-01-01 High Point Pharmaceuticals, Llc Heterocyclic H3 antagonists
EP2162451A4 (en) * 2007-06-25 2012-04-18 Neurogen Corp Piperazinyl oxoalkyl tetrahydro-beta-carbolines and related analogues
WO2009021740A2 (en) 2007-08-15 2009-02-19 Sanofis-Aventis Substituted tetrahydronaphthalenes, process for the preparation thereof and the use thereof as medicaments
US9029381B2 (en) 2007-08-22 2015-05-12 Astrazeneca Ab Cyclopropyl amide derivatives
US8063215B2 (en) 2007-08-22 2011-11-22 Astrazeneca Ab Cyclopropyl amide derivatives
US8093248B2 (en) 2007-12-05 2012-01-10 Astrazeneca Ab (Publ) Compounds useful for the treatment of conditions associated with weight gain
WO2010003624A2 (en) 2008-07-09 2010-01-14 Sanofi-Aventis Heterocyclic compounds, processes for their preparation, medicaments comprising these compounds, and the use thereof
WO2010027567A3 (en) * 2008-07-23 2010-05-20 Schering Corporation Tricyclic spirocycle derivatives and methods of use thereof
WO2010062245A1 (en) * 2008-11-25 2010-06-03 Astrazeneca Ab Spirocyclobutyl piperidine derivatives
WO2010068601A1 (en) 2008-12-08 2010-06-17 Sanofi-Aventis A crystalline heteroaromatic fluoroglycoside hydrate, processes for making, methods of use and pharmaceutical compositions thereof
US8835440B2 (en) 2008-12-19 2014-09-16 Boehringer Ingelheim International Gmbh Cyclic pyrimidin-4-carboxamides as CCR2 receptor antagonists for treatment of inflammation, asthma and COPD
US9067951B2 (en) 2008-12-19 2015-06-30 Boehringer Ingelheim International Gmbh Process and intermediates for the production of CCR2 antagonists
US8993577B2 (en) 2009-02-20 2015-03-31 Astrazeneca Ab Cyclopropyl amide derivatives
WO2010123018A1 (en) * 2009-04-24 2010-10-28 日本ケミファ株式会社 Diazaspiroalkane derivative
WO2011002067A1 (en) * 2009-07-02 2011-01-06 武田薬品工業株式会社 Heterocyclic compound and use thereof
WO2011023754A1 (en) 2009-08-26 2011-03-03 Sanofi-Aventis Novel crystalline heteroaromatic fluoroglycoside hydrates, pharmaceuticals comprising these compounds and their use
US8765949B2 (en) 2009-12-17 2014-07-01 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists and uses thereof
US10196402B2 (en) 2009-12-17 2019-02-05 Centrexion Therapeutics Corporation CCR2 receptor antagonists and uses thereof
US11731981B2 (en) 2009-12-17 2023-08-22 Centrexion Therapeutics Corporation CCR2 receptor antagonists and uses thereof
US12209094B2 (en) 2009-12-17 2025-01-28 Centrexion Therapeutics Corporation CCR2 receptor antagonists and uses thereof
US11046706B2 (en) 2009-12-17 2021-06-29 Centrexion Therapeutics Corporation CCR2 receptor antagonists and uses thereof
US9670222B2 (en) 2009-12-17 2017-06-06 Centrexion Therapeutics Corporation CCR2 receptor antagonists and uses thereof
US9012452B2 (en) 2010-02-18 2015-04-21 Astrazeneca Ab Processes for making cyclopropyl amide derivatives and intermediates associated therewith
US8877745B2 (en) 2010-05-12 2014-11-04 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists, method for producing the same, and use thereof as medicaments
US8946218B2 (en) 2010-05-12 2015-02-03 Boehringer Ingelheim International Gmbh CCR2 receptor antagonists, method for producing the same, and use thereof as medicaments
US8841313B2 (en) 2010-05-17 2014-09-23 Boehringer Ingelheim International Gmbh CCR2 antagonists and uses thereof
US9018212B2 (en) 2010-05-25 2015-04-28 Boehringer Ingelheim International Gmbh Pyridazine carboxamides as CCR2 receptor antagonists
US8962656B2 (en) 2010-06-01 2015-02-24 Boehringer Ingelheim International Gmbh CCR2 antagonists
WO2012120055A1 (en) 2011-03-08 2012-09-13 Sanofi Di- and tri-substituted oxathiazine derivates, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120053A1 (en) 2011-03-08 2012-09-13 Sanofi Branched oxathiazine derivatives, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120052A1 (en) 2011-03-08 2012-09-13 Sanofi Oxathiazine derivatives substituted with carbocycles or heterocycles, method for producing same, drugs containing said compounds, and use thereof
WO2012120054A1 (en) 2011-03-08 2012-09-13 Sanofi Di- and tri-substituted oxathiazine derivates, method for the production thereof, use thereof as medicine and drug containing said derivatives and use thereof
WO2012120056A1 (en) 2011-03-08 2012-09-13 Sanofi Tetrasubstituted oxathiazine derivatives, method for producing them, their use as medicine and drug containing said derivatives and the use thereof
US9108958B2 (en) 2011-07-15 2015-08-18 Boehringer Ingelheim International Gmbh Selective CCR2 antagonists
CN103917534A (en) * 2011-10-08 2014-07-09 诺华股份有限公司 Carbamate/urea derivatives containing piperidine and piperazine rings as H3 receptor inhibitors
WO2013050987A1 (en) 2011-10-08 2013-04-11 Novartis Ag Carbamate/ urea derivatives containing piperidin and piperazin rings as h3 receptor inhibitors
US9216182B2 (en) 2011-10-08 2015-12-22 Novartis Ag Carbamate/urea derivatives containing piperidin and piperazin rings as H3 receptor inhibitors
CN103917534B (en) * 2011-10-08 2016-11-16 诺华股份有限公司 Carbamate/urea derivatives containing piperidine and piperazine rings as H3 receptor inhibitors
CN103172635A (en) * 2011-12-21 2013-06-26 上海医药工业研究院 Piperazine or piperidine compound as well as salts, intermediates, preparation method and application thereof
CN103172635B (en) * 2011-12-21 2016-04-27 上海医药工业研究院 Piperazine or piperidines, its salt, intermediate, preparation method and application
US9273026B2 (en) 2012-07-20 2016-03-01 Novartis Ag Carbamate/urea derivatives
US9624192B2 (en) 2012-07-20 2017-04-18 Novartis Ag Carbamate/urea derivatives
US9034874B2 (en) 2012-07-20 2015-05-19 Novartis Ag Carbamate/urea derivatives
CN104470911B (en) * 2012-07-20 2018-04-06 诺华股份有限公司 Urethane/urea derivative
WO2014013469A1 (en) 2012-07-20 2014-01-23 Novartis Ag Carbamate/urea derivatives
CN104470911A (en) * 2012-07-20 2015-03-25 诺华股份有限公司 Carbamate/Urea Derivatives
AU2015264336B2 (en) * 2014-05-19 2018-08-30 Boehringer Ingelheim Animal Health USA Inc. Anthelmintic compounds
US10045979B2 (en) 2014-05-19 2018-08-14 Merial Inc. Anthelmintic compounds
US10463661B2 (en) 2014-05-19 2019-11-05 Boehringer Ingelheim Animal Health USA Inc. Anthelmintic compounds
WO2015179414A1 (en) * 2014-05-19 2015-11-26 Merial, Inc. Anthelmintic compounds
CN106536518A (en) * 2014-05-19 2017-03-22 梅里亚股份有限公司 Anthelmintic compounds
CN106536518B (en) * 2014-05-19 2020-05-12 勃林格殷格翰动物保健美国公司 anthelmintic compounds
US11147814B2 (en) 2015-07-02 2021-10-19 Centrexion Therapeutics Corporation (4-((3R,4R)-3-methoxytetrahydro-pyran-4-ylamino)piperidin-1-yl)(5-methyl-6-(((2R,6S)-6-(p- tolyl)tetrahydro-2H-pyran-2-yl)methylamino)pyrimidin-4-yl)methanone citrate
US10213428B2 (en) 2015-07-02 2019-02-26 Centrexion Therapeutics Corporation (4-((3R,4R)-3-methoxytetrahydro-pyran-4-ylamino)piperidin-1-yl)(5-methyl-6-(((2R,6S)-6-(p-tolyl)tetrahydro-2H-pyran-2-yl)methylamino)pyrimidin-4-yl)methanone citrate
US10568885B2 (en) 2015-07-02 2020-02-25 Centrexion Therapeutics Corporation (4-((3R,4R)-3-methoxytetrahydro-pyran-4-ylamino)piperidin-1-y1)(5-methyl-6-(((2R,6S)-6-(p-tolyl)tetrahydro-2H-pyran-2-citrate
US12076321B2 (en) 2015-07-02 2024-09-03 Centrexion Therapeutics Corporation (4-((3R,4R)-3-methoxytetrahydro-pyran-4-ylamino)piperidin-1-yl)(5-methyl-6-(((2R,6S)-6-(p-tolyl)tetrahydro-2H-pyran-2-yl)methylamino)pyrimidin-4-yl)methanone citrate
TWI810229B (en) * 2017-12-15 2023-08-01 瑞士商英夕亞生物科技公司 Oxopiperazine derivatives
US12012393B2 (en) 2017-12-15 2024-06-18 Inthera Bioscience AG Oxopiperazine derivatives
EP3584236A1 (en) 2018-06-20 2019-12-25 Universitat de Barcelona Polycyclic compounds soluble epoxide hydrolase inhibitors
US12233062B2 (en) 2018-09-26 2025-02-25 Jacobio Pharmaceuticals Co., Ltd. Heterocyclic derivatives useful as SHP2 inhibitors
US12486222B2 (en) 2021-03-24 2025-12-02 Universitat De Barcelona Compounds as soluble epoxide hydrolase inhibitors

Also Published As

Publication number Publication date
AU2006275568A1 (en) 2007-02-08
US20070049571A1 (en) 2007-03-01
JP2009506987A (en) 2009-02-19
EP1909797A4 (en) 2013-02-27
WO2007016496A3 (en) 2009-04-30
EP1909797A2 (en) 2008-04-16
CA2606004A1 (en) 2007-02-08
US7851474B2 (en) 2010-12-14

Similar Documents

Publication Publication Date Title
WO2007016496A2 (en) Dipiperazinyl ketones and related analogues
EP2041117B1 (en) Heterocyclic substituted piperazine compounds with cxcr3 antagonist activity
US20100297035A1 (en) Thiazole Amides, Imidazole Amides and Related Analogues
US6159982A (en) 2,4-diaminopyrimidine derivates as dopamine D4 receptor antagonist
WO2007133561A2 (en) Substituted azaspiro derivatives
EP1996577B1 (en) Heterocyclic substituted pyridine compounds with cxcr3 antagonist activity
EP1856098B1 (en) Pyrazinyl substituted piperazine-piperidines with cxcr3 antagonist activity
US20100317679A1 (en) Substituted aryl-fused spirocyclic amines
EP2029588A2 (en) Tetrahydropyrido[3,4-d]pyrimidines and related analogues
EP1499596B1 (en) Muscarinic antagonists
CZ20033437A3 (en) N-aroyl cyclic amine derivatives functioning as orexin receptor antagonists
CN101426373A (en) Piperazinyl oxoalkyl tetrahydroisoquinolines and related analogues
CN1146559C (en) muscarinic antagonists
DE60314170T2 (en) SUBSTITUTED 4-AMINO-1- (PYRIDYLMETHYL) PIPERIDINES FOR USE AS MUSCARIN RECEPTOR ANTAGONISTS
JP2011516398A (en) Benzimidazole derivatives having heterospiro-decane residues as NPY-Y5 antagonists
JP5193878B2 (en) Novel substituted pyrazinone derivatives for use in diseases mediated by MCH-1
WO2007015162A1 (en) Piperidinoyl-pyrrolidine and piperidinoyl-piperidine compounds
CN101466375A (en) Substituted azaspiro derivatives
WO2009100120A2 (en) Pyridinyl-substituted piperazinyl oxoethyl tetrahydropyrazolopyridines
JP2009520781A (en) Piperazine compounds useful as antagonists of CC chemokines (CCR2B and CCR5) for the treatment of inflammatory diseases
EP1873150A1 (en) Fluorinated indoleamides useful as ligands of the ORL-1 receptor
KR101246056B1 (en) Pyrazolebutyl compounds as dopamine D4 receptor antagonists, preparation method there of and pharmaceutical compositions containing the same
KR101121662B1 (en) 3-(Methoxymethyl)pyrazole derivatives as dopamine D3 and D4 receptor antagonists, preparation method thereof and pharmaceutical compositions containing the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2606004

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2006788999

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006275568

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2008525081

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2006275568

Country of ref document: AU

Date of ref document: 20060728

Kind code of ref document: A