WO2007015175A2 - Use of pp-1 inhibitors to prevent missplicing events - Google Patents

Use of pp-1 inhibitors to prevent missplicing events Download PDF

Info

Publication number
WO2007015175A2
WO2007015175A2 PCT/IB2006/002936 IB2006002936W WO2007015175A2 WO 2007015175 A2 WO2007015175 A2 WO 2007015175A2 IB 2006002936 W IB2006002936 W IB 2006002936W WO 2007015175 A2 WO2007015175 A2 WO 2007015175A2
Authority
WO
WIPO (PCT)
Prior art keywords
ppl
tra2
betal
splicing
inhibitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2006/002936
Other languages
French (fr)
Other versions
WO2007015175A3 (en
Inventor
Stefan Stamm
Tatyana Novoyatleva
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Friedrich Alexander Universitaet Erlangen Nuernberg
Original Assignee
Friedrich Alexander Universitaet Erlangen Nuernberg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Friedrich Alexander Universitaet Erlangen Nuernberg filed Critical Friedrich Alexander Universitaet Erlangen Nuernberg
Publication of WO2007015175A2 publication Critical patent/WO2007015175A2/en
Publication of WO2007015175A3 publication Critical patent/WO2007015175A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • the present invention relates to methods and compositions for regulating splicing in mammalian cells. More particularly, the invention relates to the use of PPl inhibitors to prevent abnormal splicings in various pathological situations.
  • the invention may be used to prevent or treat various diseases, including degenerative diseases and cystic fibrosis.
  • Sequencing of various eukaryotic genomes demonstrated that a surprisingly small number of genes generate a complex proteome.
  • the estimated 20,000- 25,000 human protein-coding genes give rise to 100-150,000 mRNA variants as estimated by EST comparison.
  • Array analysis shows that 74% of all human genes are alternatively spliced (Johnson et al., 2003) and a detailed array-based analysis of chromosome 22 and 21 suggests that every protein coding gene could undergo alternative splicing (Kampa et al., 2004).
  • the human neurexin 3 gene could form 1728 transcripts (Missler and Sudhof, 1998) and the Drosophila DSCAM gene could give rise to 38016 isoforms, which is larger that the number of genes in Drosophila (Celotto and Graveley, 2001).
  • RNA complexes protein and protein:RNA complexes (trans-factors) to weakly defined sequence elements (cis-factors) on the pre- mRNA. Binding of the trans-factors occurs cotranscriptionally and prevents the pre- mRNA to form RNA : DNA hybrids with the genomic DNA.
  • RNP complexes forming around exons promote binding of U2AF and Ul snRNP at the 3' and 5' splice sites respectively, which marks the sequences to be included in the mRNA. Sequences located in exons or the flanking introns can act as splicing silencers or enhancers.
  • cis-elements can only be described as consensus sequences that are loosely followed (Black, 2003) and in general, they bind only weakly to trans-acting factors. The action of the cis-elements depend on other surrounding elements and due to this sequence context, the same sequence can either promote or inhibit exon inclusion (Carstens et al., 1998). In order to achieve the high fidelity of splice site selection, multiple weak interactions are combined (Maniatis and Reed, 2002; Maniatis and Tasic, 2002) and as a result of this combinatorial control, splice site selection is influenced by multiple factors (Smith and Valcarcel, 2000).
  • trans-acting factors are frequently observed in tumor development, where the concentration and ratio of individual trans-acting factors changes.
  • a misregulation of pre-mRNA processing causes human diseases, for example Cystic Fibrosis, Spinal muscular atrophy and Alzheimer's disease.
  • the inclusion of exons is regulated by SR and SR-like proteins that bind to the exonic RNA and form exon recognition complexes.
  • the SR-like protein tra2-betal is an important component of numerous exon recognition complexes.
  • the interaction between tra2-betal and other proteins is regulated by phosporylation.
  • Antisense nucleic acids can suppress point mutations and promote the formation of the normal gene products. Special chemistries were devised to prevent RNAseH mediated cleavage of the RNA and to lower toxicity (Sazani and KoIe, 2003). Antisense oligonucleotides have been used to modify U7 snRNA which results in the nuclear accumulation of the oligonucleotides in stable U7nRNP complexes (Asparuhova et al., 2005).
  • Oligonucleotides have been used to target cryptic splice sites that are activated in beta-thalassemias (Lacerra et al., 2000), to suppress exon usage in Duchenne muscular dystrophy (Mann et al., 2001) and block HIV replication (Liu et al., 2004).
  • the antisense approach was further developed in ESSENCE (exon-specif ⁇ c splicing enhancement by small chimeric effectors).
  • ESSENCE uses bifunctional reagents that contain a peptide effector domain and an antisense targeting domain.
  • RNA based approaches have been tested in cell culture.
  • RNAi to suppress unwanted isoforms
  • SmaRT spliceosome-mediated RNA trans- splicing
  • ribozymes that use trans-splicing to replace defective p53, beta-globin mRNA and a chloride channel in cell culture
  • SMN2 splicing was also influenced by the phosphatase inhibitor sodium vanadate (Zhang et al., 2001) and the cytotoxic anthracycline antibiotic aclarubicin (Andreassi et al., 2001) and the nonsteroidal anti-inflammatory drug indoprofen (Lunn et al., 2004).
  • Indole derivatives were also found to act on specific SR-proteins that regulate specific ESE sequences (Soret et al., 2005). Since these substances block HIV replication by blocking early viral splicing events, they open the intriguing possibility of a specific pharmacological treatment of splicing disorders. However, a major disadvantage of most of the inhibitors is their low specificity.
  • WO00/04023 relates to synthetic derivatives of cantharidin and their uses for the treatment of cancer.
  • the proposed therapeutic use is based on the assumption that PP inhibitors can prematurely force cells through the cell cycle.
  • DE10038043 relates to the use of PP inhibitors for treating cardiovascular diseases.
  • the present invention now relates to new therapeutic uses of PPl inhibitors. More generally, the invention provides a novel approach for treating diseases caused by improper or aberrant splicings in mammalian cells and organisms.
  • the present invention shows, for the first time, that Protein Phosphatase 1 ("PPl") regulates the activity of splicing enhancer complexes that contain the proteins tra2-betal, SF2/ASF, SRp30c and ⁇ 54.
  • PPl Protein Phosphatase 1
  • the invention more specifically shows that PPl changes the phosphorylation status of these proteins, which alters the formation of exon recognition complexes and influences splice site selection.
  • the present invention shows that PPl represents a valuable target for controlling splicing in a number of pathological conditions, particularly in diseases which involve an improper pre-mRNA processing (alternative splicing) regulated by a tra2-betal -containing splicing enhancer complex.
  • Examples of such improper splicing events that are regulated by tra2-betal -containing splicing enhancer complex include alternative splicing of SMN2, which is involved in spinal muscular atrophy, alternative splicing of CFTR 84nt exon, which is involved in cystic fibrosis, and alternative splicing of tau exon 10, which is involved in Alzheimer's disease and tauopathies.
  • the present invention also demonstrates that PPl activity can be blocked by drugs like tautomycin, tautomyceitin, fostriecin, Calyculin A, Microcystin-LR, Cantharidin and Thyrsiferyl- 23 -acetate. Treatment of cells with these drugs alters splice site selection, which removes the cause of spinal muscular atrophy, tauopathies and forms of cystic fibrosis.
  • an object of this invention relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat a disease caused by improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing.
  • a further object of this invention resides in a method of treating a disease caused by improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing, comprising administering to a subject in need thereof an amount of a PPl inhibitor effective at regulating improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing, thus treating said disease.
  • the improper pre-mRNA processing is preferably regulated by a tra2-betal -containing splicing enhancer complex.
  • the invention may be used to treat a variety of diseases, including neuro-degenerative diseases, tauopathiesand cystic fibrosis.
  • a particular object of this invention resides in the use of a Protein Phosphatase 1 (PPl) inhibitor for the manufacture of a medicament to treat a disease selected from neuro-degenerative diseases, tauopathies and cystic fibrosis.
  • PPl Protein Phosphatase 1
  • An other object of this invention relates to the use of a PPl inhibitor to influence splice site selection in a mammalian cell in vitro or ex vivo, as well as to a corresponding method.
  • a further particular object of this invention is directed to the use of tautomycin for the manufacture of a medicament (drug) to treat spinal muscular atrophy, tauopathies or cystic fibrosis, as well as to a corresponding method of treatment.
  • the invention also relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat the effects of cancer that are caused by the selection of wrong splice sites, as well as to a corresponding method of treatment.
  • a further aspect of this invention is a method of preventing or inhibiting (the effect(s) of) an improper pre-mRNA splicing in a pathological condition, comprising administering to a subject in need thereof an amount of a PPl inhibitor effective at preventing or inhibiting said pre-mRNA splicing.
  • the PPl inhibitor is preferably a selective PPl inhibitor. It is most preferably a small drug inhibitor, selected for instance from Tautomycin, Tautomycetin, Fostriecin, Microcystin-LR, Calyculin A, Cantharidin, Thyrsiferyl-23 -acetate, Nodularin, Dephostatin, 3,4-Dephostatin, Fumonisin Bl and Motuporin, salts and derivatives thereof, as well as any combination(s) thereof. Also, the PPl inhibitor may be used in combination with at least one additional active agent or treatment.
  • the invention also relates to methods of selecting or identifying or improving drugs that regulate pre-mRNA processing, the method comprising a step of determining whether a drug candidate inhibits PP 1.
  • a further embodiment of this invention relates to a method of selecting or identifying or improving a drug candidate for treating cancer or a CNS disorder or a tauopathy or Cystic Fibrosis, the method comprising a step of determining whether said drug candidate inhibits PPl.
  • the method is performed in vitro or ex vivo, in binding or cell-based assays.
  • the method typically comprises contacting the drag candidate with PPl or a portion thereof, and determining whether the drug candidate binds to PPl or said portion thereof.
  • the method is performed in the presence of tra2-betal or a PPl -binding domain thereof, and comprises determining whether the drug candidate interferes with the binding of PPl to tra2-betal or said binding domain thereof.
  • the invention may be used in various mammalian subjects, including human subjects, at various stages of a disease, either for curative or preventive treatment.
  • This figure shows the interaction of Tra2 ⁇ l-C2 and Tra2 ⁇ l-(RVDF-RATA)-C2 with HA-PPl.
  • EGFP-Tra2-betal was cotransfected with HA-PPl.
  • EGFP and HA are enhanced fluorescent protein and hemagglutinin tags, respectively.
  • Tra2-betal RATA is a mutant that does not bind to PPl (RVDF -> RATA).
  • A Immunoprecipitation was performed with anti -GFP and the successful immunoprecipitation verified by Western blot using anti GFP (B). The reblot was performed with anti-PPl antisera, detecting only PPl signal with the immunoprecipitation of anti tra2-betal.
  • the unrelated protein rSLM-2 serves as a negative control.
  • Figure 2 PPl regulates the activity of tra2-betal dependent splicing enhancer.
  • splicing reporter minigene was cotransfected with either an increasing amount of EGFP-PPl (PP1-C2) or EGFP-NIPP (EGFP-C2). After cotransfection, RNA was isolated and analysed by reverse transcription. A representative ethidiume bromide stained gel is shown below the statistical analysis of at least three independent experiments.
  • the tra2-betal mutant (RVDF-RATA), which is unable to bind to PPl, was compared to the wild type tra2-betal in in vivo minigene assays with the SMN2 minigene.
  • RVxF binding channel mutant F257A and catalytically dead mutant H 125 A of PPl were compared to the action of PPl in the same assay.
  • AU mutants have no significant effect on exon 7 inclusion.
  • Figure 3 The PPl inhibitor tautomycin promotes inclusion of tra2-betal dependent enhancers.
  • Cells were transfected with the tau or SMN reporter minigenes and treated with 300 or 600 nM tautomycin. Splicing patterns were analysed by RT-PCR.
  • Human fibroblasts from SMA patients were treated with 3 mM valproic acid or 40 nM
  • Tautomycin for 2 to three days.
  • An antibody against SMN was used to detect the formation of SMN that is absent in patient fibroblasts.
  • GAPDH was used as a loading control.
  • Fibroblasts from healty individuals were used as a control. Numbers in parenthesis indicate dilution of the antisera.
  • HEK293 cells were transfected with the SMN2 minigene and treated with the inhibitors and their concentration listed below. Treatment was overnight. Error bars represent standard deviation from at least three independent experiments.
  • the present invention stems from the unexpected and important discovery that PPl regulates splice site selection in various pathological conditions, and thus represents a highly valuable target for therapeutic intervention as well as for drug development.
  • protein phosphatase 1 designates a mammalian polypeptide that regulates protein de-phosphorylation.
  • PPl has been isolated and cloned from various species, including human, and the sequence of a wild- type PPl is available in protein libraries under accession number given in Table 1 and Table 2.
  • PPl more specifically refers to the catalytic subunits of protein phosphatase 1.
  • Their HUGO names are PPPlCA, PPPlCB, PPPlCC for protein phosphatase catalytical subunit alpha, beta, and gamma.
  • the identifiers for cDNA are given in the RefSeq Genbank number and for protein in the Uniprot Accession numbers.
  • PPl also includes any naturally-occurring variants of the sequence as depicted above, such as variants resulting from polymorphisms, splicings, mutations, etc. Examples of such variants are also available in protein libraries under accession number given in Table 2.
  • PPl from other mammalian species have also been cloned and examples of Reference sequence accession numbers are given in Table 2. It should be understood that additional naturally-occurring PPl variants or isoforms may be identified using conventional techniques.
  • PPl inhibitor designates any compound or treatment that inhibits (e.g., reduces, abolishes or suppresses), either temporarily or permanently, the activity of a PPl polypeptide.
  • Such inhibitors are preferably but not always selective, i.e., they preferentially inhibit PPl and essentially do not inhibit directly or do not bind other Protein Phosphatases.
  • PPl inhibitors may inhibit the biological activity of PPl (e.g., its effect on protein de-phosphorylation), its binding to tra2-betal or to any tra2-betal- containing complex. They may also inhibit PPl expression (e.g., transcription or translation), maturation, etc.
  • a PPl inhibitor is a small drug compound.
  • Such compounds have been reported in the literature, and include, by way of illustration, Tautomycin, Tautomycetin, Fostriecin, Microcystin-LR, Calyculin A, Cantharidin, Thyrsiferyl-23- acetate, Nodularin, Dephostatin, 3,4-Dephostatin, Fumonisin Bl and Motuporin, salts, optically active isomers and derivatives thereof, as well as any combination thereof.
  • a particularly preferred PPl inhibitor is Tautomycin, as well as salts and derivatives thereof.
  • inhibitors such as decoys, peptides, inhibitory nucleic acids, intrabodies, single chain antibodies (ScFvs), etc.
  • PPl inhibitors suitable for use in the present invention may be selected or validated using a number of tests, such as screening assays disclosed in the present application.
  • the inhibitors may be formulated in any form suitable for pharmaceutical use. This includes isotonic solutions, buffered solution, powder, lyophilized forms, gels, paste, etc.
  • the excipient and/or carriers may be selected from salts, stabilizing agents, etc.
  • excipients include, without limitation, water; alcohols, such as ethanol and methanol ; Chloroform ; DMSO ; phosphate buffers, sodium chloride, polymers, high molecular weigh proteins, etc., as well as combination(s) thereof.
  • alcohols such as ethanol and methanol
  • Chloroform such as ethanol and methanol
  • DMSO DMSO
  • phosphate buffers sodium chloride, polymers, high molecular weigh proteins, etc., as well as combination(s) thereof.
  • Particular excipients for use with the above disclosed PPl inhibitors are listed in Table
  • PPl inhibitors may be administered according to various schedules and routes, which may be adapted by a person skilled in the art.
  • suitable administration routes include intravenous, intraarterial, intramuscular, intraperitoneal, intrathecal, transdermic or intra-organ injection.
  • Oral or topical administrations may also be performed, depending on the inhibitor and disease. Table 3. Examples of in vivo administration conditions of PPl inhibitors.
  • the present invention relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat a disease caused by improper pre-mRNA alternative splicing, as well as to corresponding methods of treatment.
  • treatment includes preventive or curative therapy, and encompasses a complete, partial or local amelioration of a subject condition, including a reduction in the disease symptoms, a reduction in disease progression, a regression, etc.
  • treatment particularly includes a reduction of the effects caused by improper pre-mRNA splicing.
  • the present invention is particularly suited to treat a disease caused by an improper pre- mRNA splicing which is regulated by a tra2-betal -containing splicing enhancer complex.
  • a number of diseases are caused by aberrant use of exons that are regulated by the splicing factor tra2-betal (Stoilov et al., 2004).
  • Such diseases include, more preferably, neuro-degenerative diseases, mental disorders, tauopathies, cancers and cystic fibrosis.
  • a preferred example of a neuro-degenerative disease that can benefit from the present invention is spinal muscular atrophy.
  • Spinal muscular atrophy is a neurodegenerative disorder with progressive paralysis caused by the loss of alpha-motor neurons in the spinal cord. The incidence is 1:6,000 live births and the carrier frequency 1 in 40, making SMA the second most common autosomal recessive disorder and the most frequent genetic cause of infantile death.
  • SMA is caused by the loss of the SMNl gene that encodes the SMN protein, which regulates snRNP assembly. Humans posses an almost identical gene- SMN2, that was generated through a recent dublication.
  • SMN2 cannot compensate the loss of SMNl.
  • the SMN protein functions in the assembly of snRNPs, Although in SMA patients the SMN protein is almost completely absent from all cells, for unknown reasons, alpha motoneurons are most severely affects and die, which causes the muscular atrophy. The disease can manifest in four phenotypes (type I to IV) that differ in onset and severity.
  • the phenotypes correlate roughly with the number of SMN2 copies in the genome, most like because more SMN2 copies produce more SMN protein. Since stimulation of SMN2 exon7 usage would increase SMN protein levels and potentially cure the disease, work has concentrated on understanding the regulation of exon 7. As for CFTR exon 9 and 12, multiple factors determine the regulation, including a suboptimal polypyrimidine tract (Singh et al., 2004c), a central tra2-betal- dependent enhancer (Hofmann et al., 2000) and the sequence around the C->T change at position 6 that can either bind to SF2/ASF or hnRNPAl (Cartegni and Krainer, 2002; Kashima and Manley, 2003).
  • exict extended inhibitory comtext
  • the invention can be used to treat SMA.
  • Tauopathies designate a group of diseases caused by the formation of neurofibrillary tangles (NFTs) (Mann and Pickering-Brown, 2001).
  • NFTs neurofibrillary tangles
  • Tau is a protein enriched in axons of mature and growing neurons.
  • the tau transcript contains at least 16 exons, of which 8 are alternatively spliced, which leads to the expression of multiple isoforms in the brain.
  • Tau protein associates with microtubules (MT), cytoskeletal structures whose primary function is to generate specific cell morphologies and organize intracellular components. In the adult human brain, the function of tau protein is regulated by insertion of protein sequences due to alternative splicing and by phosphorylation.
  • MT microtubules
  • NFTs neurofibrillary tangles
  • NFTs neurofibrillary tangles
  • NFTs are a hallmark of several neurodegenerative diseases that are commonly names “tauopathies” (Mann and Pickering-Brown, 2001). They include progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), Pick's disease (PiD) and frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP- 17). Importantly, NFTs are one of the major neuropathological features of Alzheimer's disease (AD). NFTs are thought to contribute to neuronal cell dysfunction and death.
  • AD Alzheimer's disease
  • the NFT burden is closely related to the decrease in neuronal population and to the intensity of dementia. NFTs are systematically observed in the normal population aged over 75 years.
  • the present invention now offers a novel approach to the effective treatment of tauopathies, particularly Alzheimer disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), Pick's disease (PiD), frontotemporal dementia, Parkinsonism linked to chromosome 17 (FTDP- 17), neuronal cell dysfunction and death, dementia and ageing
  • Cystic Fibrosis is caused by 84 nt exon inclusion, which is regulated by the splicing factor tra2-betal (Stoilov et al., 2004). As demonstrated in the examples, this aberrant splicing can be corrected using the present invention, thereby treating such disease.
  • Cancers are also often linked to the presence of aberrant splicings.
  • the invention is thus also appropriate to treat such cancers, including solid or liquid cancers, in which an improper splicing regulated by the splicing factor tra2-betal is observed.
  • the invention stems from the unexpected and important discovery that PPl regulates improper splicing events in a number of pathological conditions. Accordingly, PPl represents a valuable target for drug screening and development.
  • a further aspect of the invention also relates to methods of selecting or identifying or improving drugs that regulate pre-mRNA processing, the method comprising a step of determining whether a drug candidate inhibits PPl.
  • a further embodiment of this invention relates to methods of selecting or identifying or improving a drug candidate for treating cancer or a CNS disorder or a tauopathy or Cystic Fibrosis, the methods comprising a step of determining whether said drug candidate inhibits PPl.
  • the methods are performed in vitro or ex vivo.
  • PPl inhibition may be assessed in a number of ways, including using binding or cell- based assays.
  • the method typically comprises contacting the drug candidate with PPl or a portion thereof, and determining whether the drug candidate binds to PPl or said portion thereof, such binding being an indication that the drug is a PPl inhibitor. If required, the inhibitory activity or the selectivity may be further confirmed in additional assays, such as in vivo assays or in vitro tests as disclosed in the examples.
  • the method is performed in the presence of tra2-betal or a PPl -binding domain thereof, and comprises determining whether the drug candidate interferes with the binding of PPl to tra2-betal or said binding domain thereof.
  • PPl binds to an RVXF motif that is found in the splicing regulatory proteins tra2-betal, SF2/ASF, SRp30c and SRP54. This motif is evolutionary conserved among these proteins ( Figure 6). Multiple domains of PPPlC are involved in binding to substrates. Crystal structure analysis showed that this RVXF motif bound in an extended conformation to a hydrophobic channel within the C-terminal region of PPPlCC that is formed at the interface of the two beta-sheets of the beta-sandwich opposite to the catalytic-site channel. Three residues of the motif are incorporated into one of the PPPlCC beta- sheets as a sixth beta-strand parallel to the edge beta-strand (b- 14) (Barford, 1999).
  • the PPl -binding domain of tra2-betal is a polypeptide fragment of said protein comprising at least the motif RVXF or a derivative thereof.
  • the portion of PPl as used in the screening assay comprises the C-terminal region thereof.
  • HEX293 cells were transfected with EGFP-tra2-betal and an EGFP-tra2-betal mutant (EGFP-tra2-betal RATA) that does not bind PPl.
  • the transfection was performed using standard CaPhosphate method. The method is described in Protocol 1.
  • Immunoprecipitation shows that only tra2-betal binds to PPl, i.e. that the interaction between the molecules is dependent on the PPl binding motif present in tra2-betal.
  • the tra2-betal RATA mutant is no longer able to bind to PPl. Immunoprecipitation was done with anti-GFP (Sigma) and WB with rabbit anti-PPl antibody (1:5000).
  • Protocol 1 Transient transfection using calcium phosphate • Transient transfection of adherent HEK293 cells is performed using the calcium phosphate method on 35 mm plates (six- well tissue culture plate). The day before transfection, 3.0 xlO 5 cells per plate are seeded in 3 ml DMEM/10% FCS. This leads to approximately 40-60% confluency on the day of transfection. After splitting, the cells are incubated at 37°C in 5% CO2 for 17-24L • Splicing assays are based on the titration of increasing amounts of plasmid DNA expressing a splicing factor to a constant concentration of minigene DNA.
  • the 'empty' parental expression plasmid containing the promotor is added to ensure a constant amount of transfected DNA ( Figure 2 A).
  • the standard assay employs five reactions, each containing 1-2 ⁇ g of minigene DNA and an increasing amount of plasmid DNA expressing a splicing factor. The amount of minigene used has to be optimized in several trial experiments. 0, 0.5, 1, 1.5 and 2 ⁇ g of splicing factor DNA is a good starting point for the titration of splicing factors. The appropriate amount of empty vector (2, 0.5, 1, 1.5 and 0 ⁇ g) is added to ensure that equal amounts of DNA are transfected.
  • IM CaCl2 solution Dissolve 5.4g CaCl2-6H2 ⁇ in 20ml H2O, sterilize by filtration, store at -20°C; 2 xHBS: Dissolve 1.6g NaCl (28OmM), 0.074g KCl (1OmM), 0.027g Na2HP ⁇ 4-2H2 ⁇ (1.5mM), 0.2g dextrose (12mM) and Ig HEPES (5OmM) in 90ml H2O. Adjust pH to 7.05 with NaOH, then bring up to a total volume of 100ml with H2O. Sterilize by filtration, store at -2O 0 C.
  • the transfection efficiency can be estimated by fluorescence microscopy if an EGFP -tagged construct is used and should be at least 50% with HEK293 cells. If the splicing factor itself is not EGFP tagged, the use of pEGFP-C2 (Clontech, Heidelberg, Germany) as an 'empty' vector can help to monitor the transfection.
  • Immunoprecipitations were performed overnight at 4°C with agitation using anti-GFP antibody (Boehringer) and protein A sepharose (Pharmacia) (protein A sepharose: sepharose 1:1, resuspended in RIPA rescue buffer), followed by three washes in HNTG (5OmM HEPES ⁇ H7.5, 15OmM NaCl, ImM EDTA, 10% glycerol, 0.1% Triton X-100 and freshly added 2mM sodium ortho vanadate, 100 mM NaF, 1 mM PMSF and 20 ⁇ g/ml aprotinine) (Nayler et al., 1997).
  • the proteins were subsequently analyzed on SDS-PAGE followed by Western blotting and ECL (NEN) using anti-tra2 (Daoud et al., 1999), and anti-GFP (monoclonal: Boehringer-Mannheim, polyclonal: Clontech).
  • tra2-betal dependent exonic enhancers were tested: exon 2 of tra2-betal, exon 7 of SMN2 and exon 10 of tau. Either PPl or its nuclear inhibitor NIPPl was cotransfected with these reporter genes. The splicing patterns were analysed by RT- PCR and quantitated. Three tra2-betal dependent exonic enhancers were tested: exon 2 of Tra2-betal, exon 7 of SMN2 and exon 10 of Tau. Either PPl or its nuclear inhibitor NIPPl was cotransfected in increased concentration (1, 2 and 4 ⁇ g) with these reporter genes. In vivo splicing assays were performed as described in Protocol 3.
  • RNA was isolated 24h (HEK293) posttransfection by using the RNeasy total RNA kit (Qiagen, Hilden, Germany) and transcribed into cDNA Reverse transcription was performed in a total volume of 8.5 ⁇ l by using 2 ⁇ l RNA, l ⁇ l oligo (dT) (0.5mg/ml), Ix first-strand buffer, 10OmM DTT, 1OmM dNTP, 50units Superscript II RT, and 7units RNase inhibitor at 42°C for 45min.
  • dT l ⁇ l oligo
  • Protocol 3 Analysis of splicing patterns derived from Minigenes
  • RNA is isolated 17-24 hours after transfection using an RNeasy mini kit
  • RNA is eluted in 40Dl RNAse free H2O.
  • the optimal transfection time has to be determined empirically. It is important to quantify the mRNA. 4 ⁇ l of the RNA are dissolved in 1 ml of water, the OD at 260 nm is measured. The value obtained is multiplied by 10 and this reading gives the concentration in ⁇ g/ ⁇ l.
  • RNA For reverse transcription, 1 ⁇ g of isolated RNA are mixed with 5 pmol antisense minigene specific primer in 0.5 ⁇ l H2O, 2 ⁇ l 5xRT buffer, 1 ⁇ l 100 niM DTT, 1 ⁇ l 10 mM dNTP, 3 ⁇ l H2O, 0.25 ⁇ l RNase inhibitor and 0.25 ⁇ l H" reverse transcriptase (Superscript, Promega).
  • the RNA is substituted with water as a control. After a brief centrifugation, the tubes are incubated for 45 min in a 42°C water bath.
  • 0.2 ⁇ l Dpnl New England Biolabs
  • the PCR mixture is prepared. It consists of 50 pmol of sense and antisense primer each, 100 ⁇ l 10x PCR buffer, 20 ⁇ l 10 mM dNTPs in a total of 1000 ⁇ l water.
  • the optimal MgCl2 concentration for amplification has to be determined empirically in trial experiments and is usually in a range of a final concentration of 1.5 -3.0 niM.
  • Example 3 The PPl inhibitor tautomycin regulates tra2-betal dependent enhancer HEK293 cells were transfected with wild type SMN2 MG or tra2-betal dependent reporter genes and treated with 5-30OnM of tautomycin or the substances listed in Table 1. Cells were treated 13 hours after transfection. RNA was isolated 18 h after transfection using an RNAesy mini kit (Qiagen), following the manufacturer's instructions.
  • the PPl inhibitors also regulate the tra2-betal dependent enhancer
  • the PPl inhibitors, analogues of tautomycin: Cantharidin (Sigma), Calyculin A (Biomol), Microcystin -LR (Axxora) and Dephostatin (Calbiochem) promote the exon 7 inclusion of SMN2 MG by inhibition of PPl.
  • Cells (3X10 5 ) were transferred in ⁇ xwel ⁇ : dishes and transfected with 1 ⁇ g of pSMN2 wild type MG. The treatment of HEK 293 cells was for 13 hours for each inhibitor after transfection.
  • the concentration for Cantharidin is - O 5 ImIcM to3mkM, for Dephostatin: l-3mkM, for Microcystin: 2nM to 1OnM, for Calyculin A: 0,InM to 2nM.
  • Example 5 The PPl inhibitor tautomycin promotes SMN protein expression in SMA derived patient human fibroblasts.
  • Valproic acid increases the SMN2 protein level: a well-known drug as a potential therapy for spinal muscular atrophy. Hum MoI Genet 12, 2481-9. Carstens, R.P., McKeehan, W.L. and Garcia-Blanco, M.A., 1998. An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing. MoI Cell Biol 18, 2205-17.
  • Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2).
  • SSN2 survival motor neuron 2
  • Maniatis, T. and Reed, R., 2002 An extensive network of coupling among gene expression machines. Nature 416, 499-506. Maniatis, T. and Tasic, B., 2002. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418, 236-43.
  • Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci U S A 100,
  • RNA as a drug target methods for biophysical characterization and screening. Trends Biotechnol 18, 349-56. Zhang, M.L., Lorson, C.L., Androphy, EJ. and Zhou, J., 2001.
  • An in vivo reporter system for measuring increased inclusion of exon 7 in SMN2 mRNA potential therapy of SMA. Gene Ther 8, 1532-8.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurosurgery (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Hospice & Palliative Care (AREA)
  • Epidemiology (AREA)
  • Psychiatry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to methods and compositions for regulating splicings in mammalian cells. More particularly, the invention relates to the use of PP1 inhibitors to prevent abnormal splicings in various pathological situations. The invention may be used to prevent or treat various diseases, including degenerative diseases.

Description

Use of PP-I inhibitors to prevent missplicing events
The present invention relates to methods and compositions for regulating splicing in mammalian cells. More particularly, the invention relates to the use of PPl inhibitors to prevent abnormal splicings in various pathological situations. The invention may be used to prevent or treat various diseases, including degenerative diseases and cystic fibrosis.
Background
Sequencing of various eukaryotic genomes demonstrated that a surprisingly small number of genes generate a complex proteome. For example, the estimated 20,000- 25,000 human protein-coding genes give rise to 100-150,000 mRNA variants as estimated by EST comparison. Array analysis shows that 74% of all human genes are alternatively spliced (Johnson et al., 2003) and a detailed array-based analysis of chromosome 22 and 21 suggests that every protein coding gene could undergo alternative splicing (Kampa et al., 2004). Extreme examples illustrate the potential of alternative splicing: the human neurexin 3 gene could form 1728 transcripts (Missler and Sudhof, 1998) and the Drosophila DSCAM gene could give rise to 38016 isoforms, which is larger that the number of genes in Drosophila (Celotto and Graveley, 2001).
Proper splice site selection is achieved by binding of protein and protein:RNA complexes (trans-factors) to weakly defined sequence elements (cis-factors) on the pre- mRNA. Binding of the trans-factors occurs cotranscriptionally and prevents the pre- mRNA to form RNA : DNA hybrids with the genomic DNA. RNP complexes forming around exons promote binding of U2AF and Ul snRNP at the 3' and 5' splice sites respectively, which marks the sequences to be included in the mRNA. Sequences located in exons or the flanking introns can act as splicing silencers or enhancers. All cis-elements can only be described as consensus sequences that are loosely followed (Black, 2003) and in general, they bind only weakly to trans-acting factors. The action of the cis-elements depend on other surrounding elements and due to this sequence context, the same sequence can either promote or inhibit exon inclusion (Carstens et al., 1998). In order to achieve the high fidelity of splice site selection, multiple weak interactions are combined (Maniatis and Reed, 2002; Maniatis and Tasic, 2002) and as a result of this combinatorial control, splice site selection is influenced by multiple factors (Smith and Valcarcel, 2000). This combinatorial control is mirrored in the complex composition of splicing regulatory complexes that often combine overlapping enhancing and silencing parts that collaborate to regulate exon usage (Singh et al., 2004b) (Pagani et al., 2003).
The usage of alternative exons changes during development or cell differentiation both in vivo and in cell cultures. Furthermore, numerous external stimuli have been identified that change alternative splicing patterns. In most cases, these changes are reversible, indicating that they are part of a normal physiological response (Stamm, 2002).
Since alternative splicing plays such an important role in gene expression, it is not surprisingly that an increasing number of diseases are caused by abnormal splicing patterns. There is a positive correlation between the number of splice sites and the likelihood of a gene to cause a disease, suggesting that many mutations causing diseases may actually disrupt the splicing pattern of a gene (Lopez-Bigas et al., 2005). The disease causing mechanism can be subdivided into changes in cis and trans-factors. Changes in cis-factors are caused by mutation in splice sites, silencer and enhancer sequences and through generation of novel binding sites in triplet repeat extensions. Alterations in trans-acting factors are frequently observed in tumor development, where the concentration and ratio of individual trans-acting factors changes. A misregulation of pre-mRNA processing causes human diseases, for example Cystic Fibrosis, Spinal muscular atrophy and Alzheimer's disease. The inclusion of exons is regulated by SR and SR-like proteins that bind to the exonic RNA and form exon recognition complexes. The SR-like protein tra2-betal is an important component of numerous exon recognition complexes. The interaction between tra2-betal and other proteins is regulated by phosporylation.
So far, treatment of diseases caused by missplicing has been attempted by two strategies: transfer of genes (Garcia-Blanco et al., 2004.) or nucleic acids that act directly on genes and low molecular weight drugs. Gene transfer methods
Antisense nucleic acids can suppress point mutations and promote the formation of the normal gene products. Special chemistries were devised to prevent RNAseH mediated cleavage of the RNA and to lower toxicity (Sazani and KoIe, 2003). Antisense oligonucleotides have been used to modify U7 snRNA which results in the nuclear accumulation of the oligonucleotides in stable U7nRNP complexes (Asparuhova et al., 2005). Oligonucleotides have been used to target cryptic splice sites that are activated in beta-thalassemias (Lacerra et al., 2000), to suppress exon usage in Duchenne muscular dystrophy (Mann et al., 2001) and block HIV replication (Liu et al., 2004). The antisense approach was further developed in ESSENCE (exon-specifϊc splicing enhancement by small chimeric effectors). ESSENCE uses bifunctional reagents that contain a peptide effector domain and an antisense targeting domain. The effector domains of these protein-nucleic acids were arginine-serine (RS) repeats that mimic the effect of SR-proteins (Cartegni and Krainer, 2003). Related to ESSENCE is the use of bifunctional oligonucleotides in TOES (targeted oligonucleotide enhancer of splicing), where a part of the oligonucleotide binds to an SR-protein, which promotes exon inclusion (Skordis et al., 2003). Several RNA based approaches have been tested in cell culture. They include use of RNAi to suppress unwanted isoforms (Celotto and Graveley, 2002), spliceosome-mediated RNA trans- splicing (SmaRT) to correct factor VIII deficiency in a mouse model (Chao et al., 2003) and ribozymes that use trans-splicing to replace defective p53, beta-globin mRNA and a chloride channel in cell culture (Lan et al., 1998; Watanabe and Sullenger, 2000; Rogers et al., 2002).
Low molecular weight drugs It is well known that small molecules can interact with RNA and this principle is used by several RNA binding antibiotics, such as gentamicin, chloramphenicoland tetracycline (Xavier et al., 2000). Therefore, several chemical screens were performed to identify small molecular weight molecules that interfere with splice site selection. It was found that (-)-epigallocatechin gallate (EGCG), a polyphenol and component of green tea (Anderson et al., 2003), as well as kinetin and the related benzyladenine, a plant hormone (Slaugenhaupt et al., 2004), promote correct splice site usage in the IKAP gene, involved in Familial dysautonomia. An important class of these components are histone deacetylase inhibitors, such as sodium butyrate and valproic acid that have been used to increase the correct level of SMN2 splicing (Chang et al., 2001; Brichta et al., 2003). SMN2 splicing was also influenced by the phosphatase inhibitor sodium vanadate (Zhang et al., 2001) and the cytotoxic anthracycline antibiotic aclarubicin (Andreassi et al., 2001) and the nonsteroidal anti-inflammatory drug indoprofen (Lunn et al., 2004). Indole derivatives were also found to act on specific SR-proteins that regulate specific ESE sequences (Soret et al., 2005). Since these substances block HIV replication by blocking early viral splicing events, they open the intriguing possibility of a specific pharmacological treatment of splicing disorders. However, a major disadvantage of most of the inhibitors is their low specificity.
WO00/04023 relates to synthetic derivatives of cantharidin and their uses for the treatment of cancer. The proposed therapeutic use is based on the assumption that PP inhibitors can prematurely force cells through the cell cycle. DE10038043 relates to the use of PP inhibitors for treating cardiovascular diseases.
Summary of the Invention
The present invention now relates to new therapeutic uses of PPl inhibitors. More generally, the invention provides a novel approach for treating diseases caused by improper or aberrant splicings in mammalian cells and organisms.
In particular, the present invention shows, for the first time, that Protein Phosphatase 1 ("PPl") regulates the activity of splicing enhancer complexes that contain the proteins tra2-betal, SF2/ASF, SRp30c and ρ54. The invention more specifically shows that PPl changes the phosphorylation status of these proteins, which alters the formation of exon recognition complexes and influences splice site selection. Accordingly, the present invention shows that PPl represents a valuable target for controlling splicing in a number of pathological conditions, particularly in diseases which involve an improper pre-mRNA processing (alternative splicing) regulated by a tra2-betal -containing splicing enhancer complex. Examples of such improper splicing events that are regulated by tra2-betal -containing splicing enhancer complex include alternative splicing of SMN2, which is involved in spinal muscular atrophy, alternative splicing of CFTR 84nt exon, which is involved in cystic fibrosis, and alternative splicing of tau exon 10, which is involved in Alzheimer's disease and tauopathies. The present invention also demonstrates that PPl activity can be blocked by drugs like tautomycin, tautomyceitin, fostriecin, Calyculin A, Microcystin-LR, Cantharidin and Thyrsiferyl- 23 -acetate. Treatment of cells with these drugs alters splice site selection, which removes the cause of spinal muscular atrophy, tauopathies and forms of cystic fibrosis.
Accordingly, an object of this invention relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat a disease caused by improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing.
A further object of this invention resides in a method of treating a disease caused by improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing, comprising administering to a subject in need thereof an amount of a PPl inhibitor effective at regulating improper pre-mRNA processing, particularly an improper pre-mRNA alternative splicing, thus treating said disease.
As will be discussed below, the improper pre-mRNA processing is preferably regulated by a tra2-betal -containing splicing enhancer complex. The invention may be used to treat a variety of diseases, including neuro-degenerative diseases, tauopathiesand cystic fibrosis.
In this respect, a particular object of this invention resides in the use of a Protein Phosphatase 1 (PPl) inhibitor for the manufacture of a medicament to treat a disease selected from neuro-degenerative diseases, tauopathies and cystic fibrosis.
An other object of this invention relates to the use of a PPl inhibitor to influence splice site selection in a mammalian cell in vitro or ex vivo, as well as to a corresponding method. A further particular object of this invention is directed to the use of tautomycin for the manufacture of a medicament (drug) to treat spinal muscular atrophy, tauopathies or cystic fibrosis, as well as to a corresponding method of treatment.
The invention also relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat the effects of cancer that are caused by the selection of wrong splice sites, as well as to a corresponding method of treatment.
A further aspect of this invention is a method of preventing or inhibiting (the effect(s) of) an improper pre-mRNA splicing in a pathological condition, comprising administering to a subject in need thereof an amount of a PPl inhibitor effective at preventing or inhibiting said pre-mRNA splicing.
As will be discussed in detail below, the PPl inhibitor is preferably a selective PPl inhibitor. It is most preferably a small drug inhibitor, selected for instance from Tautomycin, Tautomycetin, Fostriecin, Microcystin-LR, Calyculin A, Cantharidin, Thyrsiferyl-23 -acetate, Nodularin, Dephostatin, 3,4-Dephostatin, Fumonisin Bl and Motuporin, salts and derivatives thereof, as well as any combination(s) thereof. Also, the PPl inhibitor may be used in combination with at least one additional active agent or treatment.
The invention also relates to methods of selecting or identifying or improving drugs that regulate pre-mRNA processing, the method comprising a step of determining whether a drug candidate inhibits PP 1.
A further embodiment of this invention relates to a method of selecting or identifying or improving a drug candidate for treating cancer or a CNS disorder or a tauopathy or Cystic Fibrosis, the method comprising a step of determining whether said drug candidate inhibits PPl. Preferably, the method is performed in vitro or ex vivo, in binding or cell-based assays. The method typically comprises contacting the drag candidate with PPl or a portion thereof, and determining whether the drug candidate binds to PPl or said portion thereof. Most preferably, the method is performed in the presence of tra2-betal or a PPl -binding domain thereof, and comprises determining whether the drug candidate interferes with the binding of PPl to tra2-betal or said binding domain thereof.
The invention may be used in various mammalian subjects, including human subjects, at various stages of a disease, either for curative or preventive treatment.
Legend to the Figures
Figure 1: Tra2-betal interacts with PPIc
This figure shows the interaction of Tra2βl-C2 and Tra2βl-(RVDF-RATA)-C2 with HA-PPl. EGFP-Tra2-betal was cotransfected with HA-PPl. EGFP and HA are enhanced fluorescent protein and hemagglutinin tags, respectively. Tra2-betal RATA is a mutant that does not bind to PPl (RVDF -> RATA). (A) Immunoprecipitation was performed with anti -GFP and the successful immunoprecipitation verified by Western blot using anti GFP (B). The reblot was performed with anti-PPl antisera, detecting only PPl signal with the immunoprecipitation of anti tra2-betal. The unrelated protein rSLM-2 serves as a negative control.
(C): Reblotting the immunoprecipitates with anti tra2-betal reveals that wild type tra2- betal, but not the tra2-betal RATA mutant binds to endogenous tra2-betal.
Figure 2: PPl regulates the activity of tra2-betal dependent splicing enhancer.
The appropriate splicing reporter minigene was cotransfected with either an increasing amount of EGFP-PPl (PP1-C2) or EGFP-NIPP (EGFP-C2). After cotransfection, RNA was isolated and analysed by reverse transcription. A representative ethidiume bromide stained gel is shown below the statistical analysis of at least three independent experiments.
A: The inclusion of tra2-betal exon II was tested B: The SMN2 minigene, exon 7 was tested C: The Tau minigene, exon 10 was tested
In panel D the tra2-betal mutant (RVDF-RATA), which is unable to bind to PPl, was compared to the wild type tra2-betal in in vivo minigene assays with the SMN2 minigene. In panel E the RVxF binding channel mutant F257A and catalytically dead mutant H 125 A of PPl were compared to the action of PPl in the same assay. AU mutants have no significant effect on exon 7 inclusion.
F: The increasing amounts of the proteins PP1-C2 and NIPP 1-C2 were verified by
Western Blot
Figure 3: The PPl inhibitor tautomycin promotes inclusion of tra2-betal dependent enhancers. Cells were transfected with the tau or SMN reporter minigenes and treated with 300 or 600 nM tautomycin. Splicing patterns were analysed by RT-PCR.
A: Analysis of the tau exon 10 minigene
B: Analysis of the SMN2 -minigene
C: Analysis of the SMN2 -minigene with different concentrations of tautomycin
Figure 4: Tautomycin promotes SMN Protein formation in human fibroblasts
Human fibroblasts from SMA patients were treated with 3 mM valproic acid or 40 nM
Tautomycin for 2 to three days. An antibody against SMN was used to detect the formation of SMN that is absent in patient fibroblasts. GAPDH was used as a loading control. Fibroblasts from healty individuals were used as a control. Numbers in parenthesis indicate dilution of the antisera.
Figure 5: Comparison of different PPl inhibitors
HEK293 cells were transfected with the SMN2 minigene and treated with the inhibitors and their concentration listed below. Treatment was overnight. Error bars represent standard deviation from at least three independent experiments.
Figure 6: Conservation of the RVXF binding motif in splicing factors
A. Partial alignment of tra2-betal sequences from different species. Residues that are fully conserved between the species are shown in yellow
B. Partial alignment of SF2/ASF between different species
C. Partial alignment of SRp30c between different species D. Partial alignment of SRp54 between different species
E. Comparison of human SR-proteins that bind PPl, only the sequence around the PPl binding site are shown.
Figure 7: A Tra2beta 1-C2 and PPl-CFP in cells
B Change of Tra(NES)-C2 under the action of PP 1
C Localisation of Tra2betal (RVDF-RATA)-C2 and Tra2betal (RVDF- RATA)-C2 with PPl-CFP in the cell.
Detailed description of the Invention
The present invention stems from the unexpected and important discovery that PPl regulates splice site selection in various pathological conditions, and thus represents a highly valuable target for therapeutic intervention as well as for drug development.
Protein Phosphatase 1 (PPH
Within the context of the present invention, the term protein phosphatase 1 designates a mammalian polypeptide that regulates protein de-phosphorylation. PPl has been isolated and cloned from various species, including human, and the sequence of a wild- type PPl is available in protein libraries under accession number given in Table 1 and Table 2. PPl more specifically refers to the catalytic subunits of protein phosphatase 1. There are three subunits derived from related genes with biochemically distinguishable identities. Their HUGO names are PPPlCA, PPPlCB, PPPlCC for protein phosphatase catalytical subunit alpha, beta, and gamma. The identifiers for cDNA are given in the RefSeq Genbank number and for protein in the Uniprot Accession numbers.
Table 1: Acessioii numbers of human PPl isoforms
Figure imgf000010_0001
The term PPl also includes any naturally-occurring variants of the sequence as depicted above, such as variants resulting from polymorphisms, splicings, mutations, etc. Examples of such variants are also available in protein libraries under accession number given in Table 2.
Table 2: Acession numbers of PPl isoforms from other species
Figure imgf000011_0001
PPl from other mammalian species have also been cloned and examples of Reference sequence accession numbers are given in Table 2. It should be understood that additional naturally-occurring PPl variants or isoforms may be identified using conventional techniques.
PPl Inhibitors
The term PPl inhibitor designates any compound or treatment that inhibits (e.g., reduces, abolishes or suppresses), either temporarily or permanently, the activity of a PPl polypeptide. Such inhibitors are preferably but not always selective, i.e., they preferentially inhibit PPl and essentially do not inhibit directly or do not bind other Protein Phosphatases. PPl inhibitors may inhibit the biological activity of PPl (e.g., its effect on protein de-phosphorylation), its binding to tra2-betal or to any tra2-betal- containing complex. They may also inhibit PPl expression (e.g., transcription or translation), maturation, etc.
In a preferred embodiment, a PPl inhibitor is a small drug compound. Such compounds have been reported in the literature, and include, by way of illustration, Tautomycin, Tautomycetin, Fostriecin, Microcystin-LR, Calyculin A, Cantharidin, Thyrsiferyl-23- acetate, Nodularin, Dephostatin, 3,4-Dephostatin, Fumonisin Bl and Motuporin, salts, optically active isomers and derivatives thereof, as well as any combination thereof. A particularly preferred PPl inhibitor is Tautomycin, as well as salts and derivatives thereof.
It should be understood that other types of inhibitors may be used, such as decoys, peptides, inhibitory nucleic acids, intrabodies, single chain antibodies (ScFvs), etc.
More generally, PPl inhibitors suitable for use in the present invention may be selected or validated using a number of tests, such as screening assays disclosed in the present application.
The inhibitors may be formulated in any form suitable for pharmaceutical use. This includes isotonic solutions, buffered solution, powder, lyophilized forms, gels, paste, etc. The excipient and/or carriers may be selected from salts, stabilizing agents, etc.
Examples of such excipients include, without limitation, water; alcohols, such as ethanol and methanol ; Chloroform ; DMSO ; phosphate buffers, sodium chloride, polymers, high molecular weigh proteins, etc., as well as combination(s) thereof. Particular excipients for use with the above disclosed PPl inhibitors are listed in Table
3 below, together with suitable dosages. Furthermore, the PPl inhibitors may be administered according to various schedules and routes, which may be adapted by a person skilled in the art. In particular, suitable administration routes include intravenous, intraarterial, intramuscular, intraperitoneal, intrathecal, transdermic or intra-organ injection. Oral or topical administrations may also be performed, depending on the inhibitor and disease. Table 3. Examples of in vivo administration conditions of PPl inhibitors.
Figure imgf000013_0001
Pharmaceutical uses
As mentioned before, the present invention relates to the use of a PPl inhibitor for the manufacture of a medicament (drug) to treat a disease caused by improper pre-mRNA alternative splicing, as well as to corresponding methods of treatment.
Within the context of this invention, the term treatment includes preventive or curative therapy, and encompasses a complete, partial or local amelioration of a subject condition, including a reduction in the disease symptoms, a reduction in disease progression, a regression, etc. The term "treatment" particularly includes a reduction of the effects caused by improper pre-mRNA splicing.
The present invention is particularly suited to treat a disease caused by an improper pre- mRNA splicing which is regulated by a tra2-betal -containing splicing enhancer complex. A number of diseases are caused by aberrant use of exons that are regulated by the splicing factor tra2-betal (Stoilov et al., 2004). Such diseases include, more preferably, neuro-degenerative diseases, mental disorders, tauopathies, cancers and cystic fibrosis.
A preferred example of a neuro-degenerative disease that can benefit from the present invention is spinal muscular atrophy. Spinal muscular atrophy is a neurodegenerative disorder with progressive paralysis caused by the loss of alpha-motor neurons in the spinal cord. The incidence is 1:6,000 live births and the carrier frequency 1 in 40, making SMA the second most common autosomal recessive disorder and the most frequent genetic cause of infantile death. SMA is caused by the loss of the SMNl gene that encodes the SMN protein, which regulates snRNP assembly. Humans posses an almost identical gene- SMN2, that was generated through a recent dublication. Although both genes are almost identical in sequence, due to a translationally silent C- >T change at position 6 in exon 7, they have different splicing pattern and exon 7 is predominantly excluded in SMN2. This exon skipping event generates a truncated, less stable and probably non-functional protein. Therefore, SMN2 cannot compensate the loss of SMNl. The SMN protein functions in the assembly of snRNPs, Although in SMA patients the SMN protein is almost completely absent from all cells, for unknown reasons, alpha motoneurons are most severely affects and die, which causes the muscular atrophy. The disease can manifest in four phenotypes (type I to IV) that differ in onset and severity. The phenotypes correlate roughly with the number of SMN2 copies in the genome, most like because more SMN2 copies produce more SMN protein. Since stimulation of SMN2 exon7 usage would increase SMN protein levels and potentially cure the disease, work has concentrated on understanding the regulation of exon 7. As for CFTR exon 9 and 12, multiple factors determine the regulation, including a suboptimal polypyrimidine tract (Singh et al., 2004c), a central tra2-betal- dependent enhancer (Hofmann et al., 2000) and the sequence around the C->T change at position 6 that can either bind to SF2/ASF or hnRNPAl (Cartegni and Krainer, 2002; Kashima and Manley, 2003). Recent large scale mutagenesis studies indicate that again a composite regulatory exonic element termed exict (extended inhibitory comtext) is responsible for the regulation of exon 7 inclusion (Singh et al., 2004a; Singh et al., 2004b). As illustrated in the examples, by regulating the improper alternative splicing, the invention can be used to treat SMA.
Tauopathies designate a group of diseases caused by the formation of neurofibrillary tangles (NFTs) (Mann and Pickering-Brown, 2001). Tau is a protein enriched in axons of mature and growing neurons. The tau transcript contains at least 16 exons, of which 8 are alternatively spliced, which leads to the expression of multiple isoforms in the brain. Tau protein associates with microtubules (MT), cytoskeletal structures whose primary function is to generate specific cell morphologies and organize intracellular components. In the adult human brain, the function of tau protein is regulated by insertion of protein sequences due to alternative splicing and by phosphorylation. Since the alternatively spliced exon 10 encodes a microtubule binding site, alternative splicing regulates the formation of tau proteins containing either 4 or 3 microtubule binding domains (4R, 3R). Adult human neurons have a characteristic ratio of these isoforms and pertubation of the correct ratio leads to the formation of neurofibrillary tangles (NFTs) and cell death. Pathological hyperphosphorylation of tau results in the dissociation of tau from microtubules and also leads to the formation of neurofibrillary tangles (NFTs). Hyperphosphorylated tau is a major component of NFTs. Once NFTs are formed, tau no longer binds to and stabilizes the neuronal cytoskeleton, which contributes to neuronal malfunction and death. Therefore, NFTs are a hallmark of several neurodegenerative diseases that are commonly names "tauopathies" (Mann and Pickering-Brown, 2001). They include progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), Pick's disease (PiD) and frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP- 17). Importantly, NFTs are one of the major neuropathological features of Alzheimer's disease (AD). NFTs are thought to contribute to neuronal cell dysfunction and death. The NFT burden is closely related to the decrease in neuronal population and to the intensity of dementia. NFTs are systematically observed in the normal population aged over 75 years. The present invention now offers a novel approach to the effective treatment of tauopathies, particularly Alzheimer disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), Pick's disease (PiD), frontotemporal dementia, Parkinsonism linked to chromosome 17 (FTDP- 17), neuronal cell dysfunction and death, dementia and ageing
Cystic Fibrosis (CFTR) is caused by 84 nt exon inclusion, which is regulated by the splicing factor tra2-betal (Stoilov et al., 2004). As demonstrated in the examples, this aberrant splicing can be corrected using the present invention, thereby treating such disease.
Cancers are also often linked to the presence of aberrant splicings. The invention is thus also appropriate to treat such cancers, including solid or liquid cancers, in which an improper splicing regulated by the splicing factor tra2-betal is observed.
Drug Screening
The invention stems from the unexpected and important discovery that PPl regulates improper splicing events in a number of pathological conditions. Accordingly, PPl represents a valuable target for drug screening and development.
A further aspect of the invention also relates to methods of selecting or identifying or improving drugs that regulate pre-mRNA processing, the method comprising a step of determining whether a drug candidate inhibits PPl.
A further embodiment of this invention relates to methods of selecting or identifying or improving a drug candidate for treating cancer or a CNS disorder or a tauopathy or Cystic Fibrosis, the methods comprising a step of determining whether said drug candidate inhibits PPl.
Preferably, the methods are performed in vitro or ex vivo.
PPl inhibition may be assessed in a number of ways, including using binding or cell- based assays. The method typically comprises contacting the drug candidate with PPl or a portion thereof, and determining whether the drug candidate binds to PPl or said portion thereof, such binding being an indication that the drug is a PPl inhibitor. If required, the inhibitory activity or the selectivity may be further confirmed in additional assays, such as in vivo assays or in vitro tests as disclosed in the examples. Most preferably, the method is performed in the presence of tra2-betal or a PPl -binding domain thereof, and comprises determining whether the drug candidate interferes with the binding of PPl to tra2-betal or said binding domain thereof. PPl binds to an RVXF motif that is found in the splicing regulatory proteins tra2-betal, SF2/ASF, SRp30c and SRP54. This motif is evolutionary conserved among these proteins (Figure 6). Multiple domains of PPPlC are involved in binding to substrates. Crystal structure analysis showed that this RVXF motif bound in an extended conformation to a hydrophobic channel within the C-terminal region of PPPlCC that is formed at the interface of the two beta-sheets of the beta-sandwich opposite to the catalytic-site channel. Three residues of the motif are incorporated into one of the PPPlCC beta- sheets as a sixth beta-strand parallel to the edge beta-strand (b- 14) (Barford, 1999).
In a specific embodiment, the PPl -binding domain of tra2-betal is a polypeptide fragment of said protein comprising at least the motif RVXF or a derivative thereof. In an other particular embodiment, the portion of PPl as used in the screening assay comprises the C-terminal region thereof.
Further advantages and aspects of this invention will be disclosed in the following examples, which should be regarded as illustrative and not limiting the scope of this invention.
Examples
Example 1. Tra2-betal binds to PPl
3 x 106 HEX293 cells were transfected with EGFP-tra2-betal and an EGFP-tra2-betal mutant (EGFP-tra2-betal RATA) that does not bind PPl. The transfection was performed using standard CaPhosphate method. The method is described in Protocol 1. Immunoprecipitation shows that only tra2-betal binds to PPl, i.e. that the interaction between the molecules is dependent on the PPl binding motif present in tra2-betal. The tra2-betal RATA mutant is no longer able to bind to PPl. Immunoprecipitation was done with anti-GFP (Sigma) and WB with rabbit anti-PPl antibody (1:5000). Denatured protein samples were resolved by 12% SDS-PAGE and transferred to nitrocellulose membrane by wet blotting. Immunostaining of the membranes and detection of the signals was performed with ECL solutions. Chemiluminescence reagent was carried out according to standard protocols. Immunoprecipitations are described in Protocol 2. The results are presented in Figures 1 and 7. They show that only tra2-betal binds to PPl, i.e. that the interaction between the molecules is dependent on the PPl binding motif present in tra2-betal . The tra2-betal RATA mutant is no longer able to bind to PPl . EGFP-tagged rSLM2 protein was used in this assay as a negative control.
This example thus demonstrates the principle that PPl binds in a complex with tra2- betal and regulates its protein interactions.
Protocol 1 : Transient transfection using calcium phosphate • Transient transfection of adherent HEK293 cells is performed using the calcium phosphate method on 35 mm plates (six- well tissue culture plate). The day before transfection, 3.0 xlO5 cells per plate are seeded in 3 ml DMEM/10% FCS. This leads to approximately 40-60% confluency on the day of transfection. After splitting, the cells are incubated at 37°C in 5% CO2 for 17-24L • Splicing assays are based on the titration of increasing amounts of plasmid DNA expressing a splicing factor to a constant concentration of minigene DNA. To avoid "squelching" effects, the 'empty' parental expression plasmid containing the promotor is added to ensure a constant amount of transfected DNA (Figure 2 A). • The standard assay employs five reactions, each containing 1-2 μg of minigene DNA and an increasing amount of plasmid DNA expressing a splicing factor. The amount of minigene used has to be optimized in several trial experiments. 0, 0.5, 1, 1.5 and 2 μg of splicing factor DNA is a good starting point for the titration of splicing factors. The appropriate amount of empty vector (2, 0.5, 1, 1.5 and 0 μg) is added to ensure that equal amounts of DNA are transfected. The DNA solutions are brought to a total volume of 75 μl with water and 25 μl 1 M CaCl2 are added. While mixing the DNA/CaCl2 solution with a vortex, 100 μl of 2 x HBS is added dropwise. IM CaCl2 solution: Dissolve 5.4g CaCl2-6H2θ in 20ml H2O, sterilize by filtration, store at -20°C; 2 xHBS: Dissolve 1.6g NaCl (28OmM), 0.074g KCl (1OmM), 0.027g Na2HPθ4-2H2θ (1.5mM), 0.2g dextrose (12mM) and Ig HEPES (5OmM) in 90ml H2O. Adjust pH to 7.05 with NaOH, then bring up to a total volume of 100ml with H2O. Sterilize by filtration, store at -2O0C.
• The mixture is incubated for 10-20 min at room temperature to allow the calcium phosphate-DNA precipitate to form.
• The precipitates are resuspended by pipetting and the complete mixture is added dropwise to the cultured cells. • The dishes are incubated at 37°C in 3% CO2 overnight.
• After the incubation, a fine precipitate is visible on the cells. The transfection efficiency can be estimated by fluorescence microscopy if an EGFP -tagged construct is used and should be at least 50% with HEK293 cells. If the splicing factor itself is not EGFP tagged, the use of pEGFP-C2 (Clontech, Heidelberg, Germany) as an 'empty' vector can help to monitor the transfection.
Protocol 2: Immunoprecipitations
The day before transfection, 3.0 xlO^ HEK293 cells per 3.5cm plate were seeded in 3 ml DMEM/10% FCS and incubated at 37°C in 5% CO2 for 17-24h. Transient transfections of adherent HEK293 cells with 1 μg of total cDNA (EGFP-tra2-betal , HA- PPl) constructs were performed using the calcium phosphate method, see protocol 1. Cells were lysed in 200 μl RPA buffer (1 % NP40, 1 % sodium deoxycholate, 0.1 % SDS, 150 mM NaCl, 1OmM Na-phosphate pH 7.2, 2 mM EDTA, 50 niM NaF, 5 mM β- glycerolphosphate and freshly added 4 mM sodium orthovanadate, 1 mM DTT, 1 mM PMSF, 20 μg/ml aprotinine, and 100 U/ml benzonase) for 30 minutes on ice. Precipitates were cleared by centrifugation. 50 μl of this total cellular lysate were transferred into a 1.5ml tube, mixed with an equal amount of lxLaemmli buffer, boiled, and stored at -2O0C overnight. 150 μl of the lysate were diluted fourfold in RIPA rescue (10 mM Na-ρhosρhate pH 7.2, 1 mM NaF, 5 mM D-glycerolρhosρhate, 20 mM NaCl and freshly added 2 mM sodium orthovanadate, 1 mM DTT, 1 mM PMSF and 20 μg/ml aprotinine). Immunoprecipitations were performed overnight at 4°C with agitation using anti-GFP antibody (Boehringer) and protein A sepharose (Pharmacia) (protein A sepharose: sepharose 1:1, resuspended in RIPA rescue buffer), followed by three washes in HNTG (5OmM HEPES ρH7.5, 15OmM NaCl, ImM EDTA, 10% glycerol, 0.1% Triton X-100 and freshly added 2mM sodium ortho vanadate, 100 mM NaF, 1 mM PMSF and 20 μg/ml aprotinine) (Nayler et al., 1997). The proteins were subsequently analyzed on SDS-PAGE followed by Western blotting and ECL (NEN) using anti-tra2 (Daoud et al., 1999), and anti-GFP (monoclonal: Boehringer-Mannheim, polyclonal: Clontech).
Example 2. Tra2-betal dependent splicing enhancers are regulated by PPl
Three tra2-betal dependent exonic enhancers were tested: exon 2 of tra2-betal, exon 7 of SMN2 and exon 10 of tau. Either PPl or its nuclear inhibitor NIPPl was cotransfected with these reporter genes. The splicing patterns were analysed by RT- PCR and quantitated. Three tra2-betal dependent exonic enhancers were tested: exon 2 of Tra2-betal, exon 7 of SMN2 and exon 10 of Tau. Either PPl or its nuclear inhibitor NIPPl was cotransfected in increased concentration (1, 2 and 4μg) with these reporter genes. In vivo splicing assays were performed as described in Protocol 3. In brief, 1 μg of the indicated wild-type pSMN minigene, MGTra minigene that spans the first four exons of the gene Tra2beta and human SV9/10L/11 exon 10 tau MG were used together with increasing amounts of pEGFP-PPlgammal and pEGFP -NIPPl. The appropriate amount of empty pEGFP-C2 vector was added to ensure that equal amounts of DNA were transfected. HEK293 cells were transfected by using calcium phosphate method. The splicing patterns were analysed by RT-PCR and quantitated. RNA was isolated 24h (HEK293) posttransfection by using the RNeasy total RNA kit (Qiagen, Hilden, Germany) and transcribed into cDNA Reverse transcription was performed in a total volume of 8.5μl by using 2μl RNA, lμl oligo (dT) (0.5mg/ml), Ix first-strand buffer, 10OmM DTT, 1OmM dNTP, 50units Superscript II RT, and 7units RNase inhibitor at 42°C for 45min. To ensure that only plasmid-derived SMN, TXSLL beta or Tau transcripts were detected, subsequent amplification was performed with a vector-specific forward primer (pCI-forw: 5'-GGT GTC CAC TCC CAG TTC AA, SEQ ID NO: 1) and the SMV-specific reverse primer SMNex8-rev (SMNex8-rev: 5'-GCC TCA CCA CCG TGC TGG, SEQ ID NO: 2) for SMN, for reverse transcription of Tra2beta: a vector specific primer pCR-RT-reverse (GCCCTCTAGACTCGAGCTCGA, SEQ ID NO: 3)' for the following PCR amplification primers, MGTra-F-Bam and MGTra-R-Xho were used that annealed to both the endogenous and transfected human Tra2beta cDNA, and for the tau SV9/10L/11 minigene, reverse transcription followed by PCR using the primers sense INSl (cag eta cag teg gaa ace ate age aag cag) and antisense INS3 (cac etc cag tgc caa ggt ctg aag gtc ace) was performed.
PCR products were then separated on agarose and PA gels and quantified using Image Quant (AP Biotech). All the experiments were repeated at least 3 times. The results are presented on Figure 2. They demonstrate the principle that tra2-betal- dependent splicing enhancers are regulated by PPl .
Protocol 3: Analysis of splicing patterns derived from Minigenes
• RNA is isolated 17-24 hours after transfection using an RNeasy mini kit
(Qiagen, Hilden, Germany) following the manufacturer's instructions. RNA is eluted in 40Dl RNAse free H2O. The optimal transfection time has to be determined empirically. It is important to quantify the mRNA. 4 μl of the RNA are dissolved in 1 ml of water, the OD at 260 nm is measured. The value obtained is multiplied by 10 and this reading gives the concentration in μg/μl.
• Best results are achieved when reverse transcription and PCR are performed immediately after the RNA purification, thus avoiding freezing of the RNA or reverse transcription reaction.
• For reverse transcription, 1 μg of isolated RNA are mixed with 5 pmol antisense minigene specific primer in 0.5 μl H2O, 2 μl 5xRT buffer, 1 μl 100 niM DTT, 1 μl 10 mM dNTP, 3 μl H2O, 0.25 μl RNase inhibitor and 0.25 μl H" reverse transcriptase (Superscript, Promega). In one sample the RNA is substituted with water as a control. After a brief centrifugation, the tubes are incubated for 45 min in a 42°C water bath. Optionally 0.2μl Dpnl (New England Biolabs) can be included in each sample to destroy vector DNA.
• During this incubation period, the PCR mixture is prepared. It consists of 50 pmol of sense and antisense primer each, 100 μl 10x PCR buffer, 20 μl 10 mM dNTPs in a total of 1000 μl water. The optimal MgCl2 concentration for amplification has to be determined empirically in trial experiments and is usually in a range of a final concentration of 1.5 -3.0 niM.
• For six reactions, 1 μl Taq polymerase is added to 300 μl PCR mixture. 2 μl of the RT reaction are added to 50 μl of this mix and PCR is performed.
• The PCR program must be optimized for each minigene in trial experiments as we found that often identical programs show variations of amplification products when different thermocycler models are used. Using the Gene Amp PCR Systems 9799 from Perkin Elmer Applied Biosystems, we use the following profile for the SMN2 minigene (Figure 2): Initial denaturation for 4 minutes at 94°C; 30 cycles: 20 seconds denaturation at 94°C, annealing at 62°C for 20 seconds, extension at 72 °C for 20 seconds, after 30 cycles final extension at 72°C for 5 min and cooling to 40C. This program was used as a starting point when optimizing a new reaction.
• The PCR reaction products are analyzed on a 0.3-0.4 cm thick 2% agarose TBE gel.
Example 3. The PPl inhibitor tautomycin regulates tra2-betal dependent enhancer HEK293 cells were transfected with wild type SMN2 MG or tra2-betal dependent reporter genes and treated with 5-30OnM of tautomycin or the substances listed in Table 1. Cells were treated 13 hours after transfection. RNA was isolated 18 h after transfection using an RNAesy mini kit (Qiagen), following the manufacturer's instructions.
The results of these experiments are depicted Figure 3B and show that tra2-betal- dependent splicing enhancers can be manipulated by the drug tautomycin.
Example 4. The PPl inhibitors also regulate the tra2-betal dependent enhancer The PPl inhibitors, analogues of tautomycin: Cantharidin (Sigma), Calyculin A (Biomol), Microcystin -LR (Axxora) and Dephostatin (Calbiochem) promote the exon 7 inclusion of SMN2 MG by inhibition of PPl. Cells (3X10 5) were transferred in όxwelϊ :dishes and transfected with 1 μg of pSMN2 wild type MG. The treatment of HEK 293 cells was for 13 hours for each inhibitor after transfection. The concentration for Cantharidin is - O5ImIcM to3mkM, for Dephostatin: l-3mkM, for Microcystin: 2nM to 1OnM, for Calyculin A: 0,InM to 2nM.
The results of this experiment are presented Figure 3 A and show that tra2-betal- dependent splicing enhancer can also be manipulated by different PPl inhibitors.
Example 5. The PPl inhibitor tautomycin promotes SMN protein expression in SMA derived patient human fibroblasts.
Human patient un-transformed SMAl fibroblasts GM03815 from NIGMS family 553 (heterozygous with SMA type I) and a healthy GMO357 with Metachromatic Leucodystrophy, Late-Infantile (provided by Coriell Cell Repository, NJ, USA) were transferred (2x105 ) into 6 well dishes using DMEM medium supplemented with 10% FCS. Tautomycin (Calbiochem) was dissolved in ethanol (99%) and added dropwise for a final concentration of 5-4OnM 24 hours posttransfection. For each experiment, to one of the dishes only ethanol was added to serve as a control. VPA in concentration 3 μM was used as a positive control. Cells were incubated for 1 to 5 days at 5% CO2 and 37°C. Prior to lysis in 150μl RIPA buffer, cells were washed in Ix PBS buffer. The level of SMN protein expression was identified by WB with a specific mouse monoclonal anti-SMN antibody 7B10 (1:700). The equal loading of the protein was proved by mouse anti-GAPDH antibody (1:2000). Denatured protein samples were resolved by 12% SDS-PAGE and transferred to nitrocellulose membrane by wet blotting. Irrimunostaining of the membranes and detection of the signals was performed with ECL solutions. Chemiluminescence reagent was carried out according to standard protocols.
The results of this experiment are presented in Figures 4 and 5, and show that low molecular weight PPl inhibitors can correct the splicing pattern of the endogenous human SMN2 gene in vivo. References
Anderson, S.L., Qiu, J. and Rubin, B. Y., 2003. EGCG corrects aberrant splicing of IKAP mRNA in cells from patients with familial dysautonomia. Biochem Biophys Res Commun 310, 627-33.
Andreassi, C, Jarecki, J., Zhou, J., Coovert, D.D., Monani, U.R., Chen, X., Whitney, M., Pollok, B., Zhang, M., Androphy, E. and Burghes, A.H., 2001. Aclarubicin treatment restores SMN levels to cells derived from type I spinal muscular atrophy patients. Hum MoI Genet 10, 2841-9. Asparuhova, M., KoIe, R. and Schumperli, D., 2005. Antisense derivatives of U7 and other small nuclear RNAs as tools to modify pre-mRNA splicing patterns. Gene Ther. Regualtion in press.
Barford, D., 1999. Colworth Medal Lecture. Structural studies of reversible protein phosphorylation and protein phosphatases. Biochem Soc Trans 27, 751-66. Barker, H.M., Brewis, N.D., Street, A.J., Spurr, N.K. and Cohen, P.T., 1994. Three genes for protein phosphatase 1 map to different human chromosomes: sequence, expression and gene localisation of protein serine/threonine phosphatase 1 beta (PPPlCB). Biochim Biophys Acta 1220, 212-8. Black, D. L., 2003. Mechanisms of Alternative Pre-Messenger RNA Splicing. Annu Rev Biochem 291-336.
Brichta, L., Hofmann, Y., Hahnen, E., Siebzehnrubl, F.A., Raschke, H., Blumcke, L, Eyupoglu, LY. and Wirth, B., 2003. Valproic acid increases the SMN2 protein level: a well-known drug as a potential therapy for spinal muscular atrophy. Hum MoI Genet 12, 2481-9. Carstens, R.P., McKeehan, W.L. and Garcia-Blanco, M.A., 1998. An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing. MoI Cell Biol 18, 2205-17.
Cartegni, L. and Krainer, A.R., 2002. Disruption of an SF2/ASF-dependent exonic splicing enhancer in SMN2 causes spinal muscular atrophy in the absence of SMNl. Nat Genet 30, 377-84.
Cartegni, L. and Kramer, A.R., 2003. Correction of disease-associated exon skipping by synthetic exon-specific activators. Nat Struct Biol 10, 120-5. Celotto, A.M. and Graveley, B.R., 2001. Alternative splicing of the Drosophila Dscam pre-mRNA is both temporally and spatially regulated. Genetics 159, 599-608. Celotto, A.M. and Graveley, B.R., 2002. Exon-specific RNAi: a tool for dissecting the functional relevance of alternative splicing. Rna 8, 718-24. Chang, J.G., Hsieh-Li, H.M., Jong, YJ., Wang, N.M., Tsai, CH. and Li, H., 2001. Treatment of spinal muscular atrophy by sodium butyrate. Proc Natl Acad Sci U S A 98, 9808-13.
Chao, H., Mansfield, S.G., Bartel, R.C., Hiriyanna, S., Mitchell, L.G., Garcia-Blanco, M. A. and Walsh, C.E., 2003. Phenotype correction of hemophilia A mice by spliceosome-mediated RNA trans-splicing. Nat Med 9, 1015-9.
Garcia-Blanco, M.A., Baraniak, A.P. and Lasda, EX., 2004. Alternative splicing in disease and therapy. Nat Biotechnol 22, 535-46.
Hofmann, Y., Lorson, C.L., Stamm, S., Androphy, EJ. and Wirth, B., 2000. Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2). Proc Natl Acad Sci U S A 97, 9618-23. Johnson, J.M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P.M., Armour, CD., Santos, R., Schadt, E.E., Stoughton, R. and Shoemaker, D.D., 2003. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302, 2141-4.
Kampa, D., Cheng, J., Kapranov, P., Yamanaka, M., Brubaker, S., Cawley, S.,
Drenkow, J., Piccolboni, A., Bekiranov, S., HeIt, G., Tammana, H. and Gingeras, T.R.,
2004. Novel RNAs identified from an in-depth analysis of the transcriptome of human chromosomes 21 and 22. Genome Res 14, 331-42.
Kashima, T. and Manley, J.L., 2003. A negative element in SMN2 exon 7 inhibits splicing in spinal muscular atrophy. Nat Genet 34, 460-3.
Lacerra, G., Sierakowska, H., Carestia, C, Fucharoen, S., Summerton, J., Weller, D. and KoIe, R., 2000. Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients. Proc Natl Acad Sci U S A 97, 9591-6. Lan, N., Howrey, R.P., Lee, S.W., Smith, CA. and Sullenger, B.A., 1998. Ribozyme- mediated repair of sickle beta-globin mRNAs in erythrocyte precursors. Science 280,
1593-6.
Liu, S., Asparuhova, M., Brondani, V., Ziekau, I., Klimkait, T. and Schumperli, D., 2004. Inhibition of HIV-I multiplication by antisense U7 snRNAs and siRNAs targeting cyclophilin A. Nucleic Acids Res 32, 3752-9.
Lopez-Bigas, N., Audita, B., Ouzounis, C, Parra, G. and Guigo, R., 2005. Are splicing mutations the most frequent cause of hereditary disease? FEBS Lett in press.
Lunn, M.R., Root, D.E., Martino, A.M., Flaherty, S.P., Kelley, B.P., Coovert, D.D., Burghes, A.H., Man, N.T., Morris, G.E., Zhou, J., Androphy, E. J., Sumner, CJ. and
Stockwell, B.R., 2004. Indoprofen upregulates the survival motor neuron protein through a cyclooxygenase-independent mechanism. Chem Biol 11, 1489-93.
Maniatis, T. and Reed, R., 2002. An extensive network of coupling among gene expression machines. Nature 416, 499-506. Maniatis, T. and Tasic, B., 2002. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418, 236-43.
Mann, C.J., Honeyman, K., Cheng, AJ., Ly, T., Lloyd, F., Fletcher, S., Morgan, J.E.,
Partridge, T.A. and Wilton, S.D., 2001. Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse. Proc Natl Acad Sci U S A 98, 42-7. Mann, D.A. and Pickering-Brown, S., 2001. The status of "Pick's Disease" and other tauopathies within the frontotemporal dementias. Neurobiol Aging 22, 109-111.
Missler, M. and Sudhof, T.C., 1998. Neurexins: three genes and 1001 products. Trends
Genet 14, 20-6.
Pagani, F., Stuani, C, Tzetis, M., Kanavakis, E., Efthymiadou, A., Doudounakis, S., Casals, T. and Baralle, F.E., 2003. New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum MoI
Genet 12, 1111-20.
Rogers, C.S., Vanoye, C.G., Sullenger, B.A. and George, A.L., Jr., 2002. Functional repair of a mutant chloride channel using a trans-splicing ribozyme. J Clin Invest 110, 1783-9.
Sazani, P. and KoIe, R., 2003. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Invest 112, 481-6. Singh, N.N., Androphy, EJ. and Singh, R.N., 2004a. An extended inhibitory context causes skipping of exon 7 of SMN2 in spinal muscular atrophy. Biochem Biophys Res
Commun 315, 381-8.
Singh, N.N., Androphy, EJ. and Singh, R.N., 2004b. In vivo selection reveals combinatorial controls that define a critical exon in the spinal muscular atrophy genes.
Rna 10, 1291-305.
Singh, N.N., Androphy, EJ. and Singh, R.N., 2004c. The regulation and regulatory activities of alternative splicing of the SMN gene. Crit. Rev. Eukary. Gene Exp. 14, in press. Skordis, L. A., Dunckley, M.G., Yue, B., Eperon, LC. and Muntoni, F., 2003.
Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci U S A 100,
4114-9.
Slaugenhaupt, S.A., Mull, J., Leyne, M., Cuajungco, M.P., Gill, S.P., Hims, M.M., Quintero, F., Axelrod, F.B. and Gusella, J.F., 2004. Rescue of a human mRNA splicing defect by the plant cytokinin kinetin. Hum MoI Genet 13, 429-36.
Smith, CW. and Valcarcel, J., 2000. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem. Sci. 25, 381-388.
Song, Q., Khanna, K.K., Lu, H. and Lavin, M.F., 1993. Cloning and characterization of a human protein phosphatase 1 -encoding cDNA. Gene 129, 291 -5
Soret, J., Bakkour, N., Maire, S., Durand, S., Zekri, L., Gabut, M., Fie, W., Divita, G.,
Rivalle, C, Dauzonne, D., Nguyen, C-H., Jeanteur, P. and Tazi, J., 2005. Selective modification of alternative splicing by indole derivatives that target SR protein splicing factors. Proc Natl Acad Sci U S A in press. Stamm, S., 2002. Signals and their transduction pathways regulating alternative splicing: a new dimension of the human genome. Hum. MoI. Genet. 11, 2409-2416.
Stoilov, P., Daoud, R., Nayler, O. and Stamm, S., 2004. Human tra2-betal autoregulates its protein concentration by influencing alternative splicing of its pre-mRNA. Hum MoI
Genet 13, 509-524. Watanabe, T. and Sullenger, B.A., 2000. Induction of wild-type p53 activity in human cancer cells by ribozymes that repair mutant ρ53 transcripts. Proc Natl Acad Sci U S A
97, 8490-4. Xavier, K.A., Eder, P. S. and Giordano, T., 2000. RNA as a drug target: methods for biophysical characterization and screening. Trends Biotechnol 18, 349-56. Zhang, M.L., Lorson, C.L., Androphy, EJ. and Zhou, J., 2001. An in vivo reporter system for measuring increased inclusion of exon 7 in SMN2 mRNA: potential therapy of SMA. Gene Ther 8, 1532-8.

Claims

Claims
1. The use of a Protein Phosphatase 1 (PPl) inhibitor for the manufacture of a medicament to treat a disease selected from neuro-degenerative diseases, tauopathies and cystic fibrosis.
2. The use of claim 1, wherein the disease is caused by an improper pre-mRNA processing regulated by a tra2-betal -containing splicing enhancer complex.
3. The use of anyone of claims 1 to 2, wherein the disease is selected from spinal muscular atrophy, Alzheimer disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), Pick's disease (PiD), frontotemporal dementia, Parkinsonism linked to chromosome 17 (FTDP- 17), neuronal cell dysfunction and death, dementia, ageing and cystic fibrosis.
4. The use of a PPl inhibitor to influence splice site selection in a mammalian cell in vitro or ex vivo.
5. The use of any one of claims 1 to 4, wherein the inhibitor is a selective PPl inhibitor.
6. The use of any one of claims 1 to 4, wherein the PPl inhibitor is a small drug, preferably selected from Tautomycin, Tautomycetin, Fostriecin, Microcystin-LR, Calyculin A, Cantharidin, Thyrsiferyl-23 -acetate, Nodularin, Dephostatin, 3,4- Dephostatin, Fumonisin Bl and Motuporin, salts and derivatives thereof, as well as any combination thereof.
7. The use of any one of claims 1 to 6, wherein the PPl inhibitor is used, simultaneously or sequentially, in combination with at least one additional active agent or treatment.
8. The use of tautomycin for the manufacture of a medicament to treat spinal muscular atrophy, tauopathies or Cystic fibrosis.
9. A method of selecting or identifying or improving a drug candidate for treating a CNS disorder, a tauopathy or Cystic Fibrosis, the method comprising a step of determining in vitro or ex vivo whether said drug candidate inhibits PPl.
10. The method of claim 9, which comprises contacting the drug candidate with PPl or a portion thereof, and determining whether the drug candidate binds to PPl or said portion thereof, such drugs being selected.
11. The method of claim 10, wherein said contacting step is performed in the presence of tra2-betal or a PPl -binding domain thereof, and the method comprises determining whether the drug candidate interferes with the binding of PPl to tra2-betal or said binding domain thereof.
PCT/IB2006/002936 2005-06-24 2006-06-23 Use of pp-1 inhibitors to prevent missplicing events Ceased WO2007015175A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP05013659 2005-06-24
EP05013659A EP1736154A1 (en) 2005-06-24 2005-06-24 Use of PP-1 inhibitors to prevent missplicing events

Publications (2)

Publication Number Publication Date
WO2007015175A2 true WO2007015175A2 (en) 2007-02-08
WO2007015175A3 WO2007015175A3 (en) 2007-04-12

Family

ID=35406295

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2006/002936 Ceased WO2007015175A2 (en) 2005-06-24 2006-06-23 Use of pp-1 inhibitors to prevent missplicing events

Country Status (2)

Country Link
EP (1) EP1736154A1 (en)
WO (1) WO2007015175A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009001097A3 (en) * 2007-06-27 2009-07-02 Isis Innovation Substrate reduction therapy
WO2016051799A1 (en) * 2014-10-01 2016-04-07 学校法人同志社 2-aminohydroquinone derivative and tau aggregation inhibitor
CN120514821A (en) * 2025-07-17 2025-08-22 云南洛宇生物科技有限公司 A method for modeling Parkinson's disease in tree shrews

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4939432B2 (en) 2004-12-01 2012-05-23 ホワイトヘッド インスティテュート フォー バイオメディカル リサーチ Modulator of alpha-synuclein toxicity
US9018003B2 (en) 2005-05-13 2015-04-28 Whitehead Institute For Biomedical Research Modulators of alpha-synuclein toxicity
JP2010502681A (en) 2006-09-08 2010-01-28 アンスティテュ・グスターブ・ルシ Inhibitors of protein phosphatase 1, GADD34 and protein phosphatase 1 / GADD34 complex, their preparation and use
WO2008089961A1 (en) * 2007-01-22 2008-07-31 University Of Zurich Use of phosphatase inhibitors for the treatment of neurodegenerative diseases
WO2009086306A1 (en) * 2007-12-21 2009-07-09 Whitehead Institute For Biomedical Research Modulators of alpha-synuclein toxicity

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPP466598A0 (en) * 1998-07-14 1998-08-06 University Of Newcastle Research Associates Limited, The Product and process
DE10038043B4 (en) * 2000-08-02 2006-09-07 Walter, Michael, Dr. Phamacologically active substance for the treatment of cardiovascular diseases

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009001097A3 (en) * 2007-06-27 2009-07-02 Isis Innovation Substrate reduction therapy
US8557844B2 (en) 2007-06-27 2013-10-15 The Chancellor, Masters And Scholars Of The University Of Oxford Substrate reduction therapy
US9428541B2 (en) 2007-06-27 2016-08-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Substrate reduction therapy
WO2016051799A1 (en) * 2014-10-01 2016-04-07 学校法人同志社 2-aminohydroquinone derivative and tau aggregation inhibitor
CN120514821A (en) * 2025-07-17 2025-08-22 云南洛宇生物科技有限公司 A method for modeling Parkinson's disease in tree shrews

Also Published As

Publication number Publication date
WO2007015175A3 (en) 2007-04-12
EP1736154A1 (en) 2006-12-27

Similar Documents

Publication Publication Date Title
Paulson et al. Polyglutamine spinocerebellar ataxias—from genes to potential treatments
Fiesel et al. Knockdown of transactive response DNA-binding protein (TDP-43) downregulates histone deacetylase 6
Bossers et al. Analysis of gene expression in Parkinson's disease: possible involvement of neurotrophic support and axon guidance in dopaminergic cell death
CA2792696C (en) Modified u7 snrnas for treatment of neuromuscular diseases
An et al. Exon silencing by UAGG motifs in response to neuronal excitation
Tramarin et al. The antidepressant tianeptine reverts synaptic AMPA receptor defects caused by deficiency of CDKL5
Kataria et al. C-terminal HSP90 inhibitors block the HIF-1 hypoxic response by degrading HIF-1α through the oxygen-dependent degradation pathway
JP2011515653A (en) Target sequences useful for the treatment of neurodegenerative diseases and methods for identifying them
US8436049B2 (en) Uses of pentamidine and related compounds
Shenouda et al. Mechanisms associated with TDP-43 neurotoxicity in ALS/FTLD
Liu et al. miR-134-5p/Foxp2/Syn1 is involved in cognitive impairment in an early vascular dementia rat model
US20210180023A1 (en) Cardiac repair by reprogramming of adult cardiac fibroblasts into cardiomyocytes
WO2007015175A2 (en) Use of pp-1 inhibitors to prevent missplicing events
McCallister et al. A high-fidelity CRISPR-Cas13 system improves abnormalities associated with C9ORF72-linked ALS/FTD
Bloom et al. Constitutively active SARM1 variants found in ALS patients induce neuropathy
US20090281040A1 (en) Methods For Treating Endoplasmic Reticulum (ER) Stress Disorders
Ocharan-Mercado et al. RNA-binding proteins: a role in neurotoxicity?
Kolb et al. RNA processing defects associated with diseases of the motor neuron
Wang et al. C9ORF72 poly-PR disrupts expression of ALS/FTD-implicated STMN2 through SRSF7
US20160199463A1 (en) Hdac2 defends vascular endothelium from injury
JP2011515072A (en) α-synuclein kinase
CA2711585A1 (en) Molecular targets and compounds, and methods to identify the same, useful in the treatment of neurodegenerative diseases
Almaguer-Mederos et al. Spinal cord phosphoproteome of a SCA2/ALS13 mouse model reveals alteration of ATXN2-N-term SH3-actin interactome and of autophagy via WNK1-MYO6-OPTN-SQSTM1
EP2352828A1 (en) Method for identifying compounds useful for increasing the functional activity and cell surface expression of cf-associated mutant cystic fibrosis transmembrane conductance regulator
US12310947B2 (en) Methods and compositions for unsilencing imprinted genes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06809073

Country of ref document: EP

Kind code of ref document: A2