WO2007012807A2 - Dna structures - Google Patents
Dna structures Download PDFInfo
- Publication number
- WO2007012807A2 WO2007012807A2 PCT/GB2006/002606 GB2006002606W WO2007012807A2 WO 2007012807 A2 WO2007012807 A2 WO 2007012807A2 GB 2006002606 W GB2006002606 W GB 2006002606W WO 2007012807 A2 WO2007012807 A2 WO 2007012807A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- single stranded
- template
- molecule
- substrate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
Definitions
- the invention relates to a process for the production of single stranded nucleic acid and its use in the formation of higher order structures comprising DNA.
- nucleic acid molecules are well suited for this purpose due to the inherent self recognition of each of the complementary strands of nucleic acid.
- Linear strands of DNA can self assemble into a range of structures based on the linear sequence information contained in the nucleotide base composition. It is relatively easy to incorporate branching of a double helix by modifying the sequence of a pair of nucleic acid strands to be non-complementary over a specific region of the helix resulting in no annealing in that region of non- complementarity. This can be achieved with anaki level of accuracy to provide nano-scale structures that are stable, predictable and regular and in large quantities. In this way DNA structures can be built of virtually any conformation, for example cages, tubes, nets, scaffolds and other complex three dimensional structures.
- nano-scale structures may be fabricated on self-assembled DNA scaffolds. It is recognised that traditional “top down” lithographic methods for manufacturing microelectronics will soon reach their fundamental limitations and new “bottom up” techniques will be required to provide circuit layouts on a nano- scale.
- the self assembly properties of DNA nanostructures as scaffolds may provide the necessary complexity to construct and position nano-molecular scale electronic devices and wiring.
- DNA sequences can be modified to incorporate specific sequences that bind peptides, proteins and other nucleic acids (e.g. gene therapy vectors) that have therapeutic applications. Further applications in biological systems include the use of DNA nano-structures as binding partners on substrates for the binding of proteins/enzymes involved in macromolecular synthesis.
- nucleotide composition of DNA can be chemically modified to incorporate modified bases and sugars to alter the properties of the molecule.
- modified bases and sugars for example, the incorporation of peptidic linkages between bases to form so called peptide nucleic acids.
- an in vitro method for the production of a single stranded DNA template comprising the steps of: i) forming a preparation comprising: a nucleic acid template molecule; a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template; and polymerase chain reaction components including nucleoside triphosphates and an agent to protect the 5' nucleotide of the amplified template molecule; ii) amplifying said nucleic acid template by a polymerase chain reaction to form a double stranded nucleic acid template wherein the template is modified at the 5' nucleotide of the template to protect the digestion of the template by a non-processive 5'-3'exonuclease; iii) contacting the preparation with a non-processive 5 '-3' exonuclease that digests the template to a single stranded DNA molecule; iv)
- non-processive 5 '-3' exonuclease is T7 gene 6 exonuclease.
- T7 gene 6 exonuclease hydrolyzes double stranded DNA non-processively in the 5'- 3' direction from either 5' phosphoryl or 5' hydroxyl nucleotides. It also degrades nucleotides at gaps and nicks of double stranded DNA from the 5' termini and RNA from RNA-DNA hybrids in a 5 '-3' direction.
- the method of the invention allows the production of single stranded template DNA, the sequence of which is modified to allow complementary base pairing between single stranded nucleic acid to form higher order structures that may be linear, branched or circular and of nanometre dimensions.
- said modification is the incorporation of phosphorothioate to protect the 5 'nucleotide of the template.
- said agent is chemically or physically cleaved from said single stranded template.
- said agent is cleaved with restriction enzyme following hybridisation with a complementary oligonucleotide that comprises a restriction enzyme recognition site for said restriction enzyme.
- said agent is cleaved with a restriction enzyme following generation of a double stranded region by hybridisation with a complementary oligonucleotide, or by any other method, that comprises a restriction enzyme recognition site for said restriction enzyme.
- nucleoside triphosphates are modified.
- modified nucleotides encompasses nucleotides with a covalently modified base and/or sugar.
- modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position.
- modified nucleotides may also include 2' substituted sugars such as 2'-O- methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; T- fluoro-; 2'-halo or 2;azido- ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
- 2' substituted sugars such as 2'-O- methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; T- fluoro-; 2'-halo or 2;azido- ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or
- Modified nucleotides include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6- methyladenine; 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5 fluorouracil;5- bromouracil;5-carboxymethylaminomethyl-2 thiouracil;5carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine;l-niethyladenine;l- methylpseudouracil;l-methylguanine;2,2 dimethylguanine; 2-methyladenine; 2- methylguanine;
- Li a preferred method of the invention said template is adapted by the provision of a nucleic acid sequence motif that binds at least one polypeptide molecule.
- motifs that bind protein or polypeptide molecules include restriction enzymes, DNA binding proteins e.g. histones, transcription factors, DNA polymerases, RNA polymerases, DNA ligases, or an antibody.
- the motifs may be part of a promoter.
- Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors (polypeptides) which have been shown to bind specifically to enhancer elements.
- the binding/activity of transcription factors is responsive to a number of physiological/environmental cues which include, by example and not by way of limitation, intermediary metabolites (e.g. glucose, lipids), environmental effectors (e.g. light).
- Promoter elements also include so called TATA box and RNA polymerase initiation selection sequences which function to select a site of transcription initiation. These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase.
- a single stranded nucleic acid molecule obtainable or obtained by the method according to the invention.
- said nucleic acid molecule is at least about 20 nucleotides in length.
- said nucleic acid molecule is at least about 60 nucleotides in length; at least about 200 nucleotides in length; at least about 400 nucleotides in length; at least about 1000 nucleotides in length; at least about 2000 nucleotides in length; at least about 10000 nucleotides in length; or at least about 50000 nucleotides in length.
- an in vitro method for the formation of a complex comprising nucleic acid comprising the steps of: i) forming a preparation of at least two single stranded nucleic acid molecules obtained or obtainable by the method according to the invention wherein said molecules are adapted to anneal to one another over at least part of their length; ii) heating said preparation to denature secondary structures in said single stranded nucleic acid; and iii) allowing said single stranded nucleic acid molecules to anneal to one another to form a nucleic acid complex.
- said preparation comprises at least three single stranded nucleic acid molecules wherein each molecule comprises a region which is able to anneal to a region in at least one other molecule of said three nucleic acid molecules.
- said nucleic acid molecules include a region complementary td a region found in two of said three nucleic acid molecules.
- said complex comprises a plurality of single stranded nucleic acid molecules.
- nucleic acid complex obtained or obtainable by the method according to the invention.
- a substrate which comprises a surface wherein said surface comprises a nucleic acid complex according to the invention.
- said substrate is selected from the group consisting of: a metal substrate; a plastics substrate; a glass substrate; a mica substrate; a silicon substrate; a silicon dioxide substrate; a gallium arsenide substrate; a germanium substrate; a diamond substrate; a doped or layered semiconductor substrate or combinations thereof.
- a device comprising a substrate according to the invention.
- said device is a product that allows for the directed transport of a molecule or a molecular structure.
- said molecule or molecular structure is transported by a vehicle that associates with said nucleic acid complex.
- said vehicle comprises an organic or inorganic molecule or a molecular complex.
- said vehicle comprises at least one protein.
- Molecules or molecular structures that are transported by the device of the invention include, but are not limited to, metal-, semiconductor- and insulating nanoparticles; carbon-based materials such as single and multi-walled carbon nanotubes, buckyballs; proteins, nucleic acid complexes and chemical compounds; other inorganic and organic materials; information in various forms.
- said molecule or molecular structure is integral with said vehicle.
- said device is adapted for the transport of an electrical charge.
- An electrical charge includes, but is not limited to, a charge in the form of electrons, holes, electron- or hole-like quasiparticles, protons, and ions, amongst others.
- said device is adapted to transport data.
- Data includes, but is not limited to, signalling the occurrence of a specific event, or as means of directing further actions such as triggering catalysis or other chemical reactions at nearby or remote locations.
- said device is an electronic circuit.
- said device is a scaffold for the assembly of nanoscale particles and other complexes.
- the assembly can be, but is not limited to be, 'directed' with spatial and orientational precision at the nanometer scale, i.e. objects are assembled at designed locations on said device.
- Objects to be assembled include, but are not limited to, metal-, semiconductor- and insulating nanoparticles; carbon-based materials such as single and multi-walled carbon nanotubes, buckyballs; proteins, nucleic acid complexes and chemical compounds; other inorganic and organic materials.
- said device is a scaffold wherein objects are assembled at random locations along the whole scaffold.
- said device is a self-assembled, nanoscale object.
- said device is a scaffold for a subsequent chemical reaction or reactions or catalysis of a chemical reaction or reactions.
- the reactions or catalysis of reactions occur, but are not limited to occur, with spatial precision at the nanometer scale, i.e. the reaction or catalysis occurs at a designed location or locations on said device.
- said device is a drug delivery vehicle.
- composition comprising a drug delivery vehicle according to the invention.
- compositions of the present invention are administered in pharmaceutically acceptable preparations.
- Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents, such as chemotherapeutic agents.
- the therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time.
- the administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal.
- compositions of the invention are administered in effective amounts.
- An "effective amount” is that amount of a composition that alone, or together with further doses, produces the desired response.
- the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or can be monitored according to diagnostic methods of the invention discussed herein.
- Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
- compositions used in the foregoing methods preferably are sterile and contain an effective amount of nucleic acid for producing the desired response in a unit of weight or volume suitable for administration to a patient.
- the response can, for example, be measured by determining regression of a tumour, decrease of disease symptoms, modulation of apoptosis, etc.
- the doses of the composition administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
- compositions for the administration of compositions
- administration of compositions to mammals other than humans e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above.
- a subject as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.
- the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions.
- pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents.
- the salts should be pharmaceutically acceptable, but non- pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention.
- Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like.
- pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
- compositions may be combined, if desired, with a pharmaceutically-acceptable carrier.
- pharmaceutically-acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human.
- carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- the pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- suitable buffering agents including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
- the pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
- suitable preservatives such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
- the pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound.
- Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion.
- compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of the composition, which is preferably isotonic with the blood of the recipient.
- This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1, 3-butane diol.
- a non-toxic parenterally-acceptable diluent or solvent for example, as a solution in 1, 3-butane diol.
- acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil may be employed including synthetic mono-or di-glycerides.
- fatty acids such as oleic acid may be used in the preparation of injectables.
- Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's
- said device is a diagnostic assay product.
- Diagnostic assay products typically will include substrates upon which is immobilised an molecule, for example an antigen, antibody or nucleic acid probe, which detects a molecule present in a biological sample the detection of which is desirable because it may be associated with a specific disease or condition.
- a method to fabricate a surface of a substrate comprising the steps of: i) providing a preparation comprising a nucleic acid complex according to the invention; and ii) bringing into contact the preparation in (i) with a substrate to be fabricated.
- nucleic acid complex obtainable or obtained by the method according to the invention in the production of electronic circuits.
- nucleic acid complex obtainable or obtained by the method according to the invention in the delivery of a drug to a subject.
- kits comprising: a container comprising a single stranded template nucleic acid molecule according to the invention.
- said template nucleic acid is included in a vector, preferably a plasmid.
- vectors also include cosmids, mammalian artificial chromosomes, yeast artificial chromosomes and bacteriophage vectors.
- said kit includes a non processive 5 '-3' exonuclease; preferably said exonuclease is T7 gene 6 exonuclease.
- said kit further comprises: a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template; polymerase chain enzyme reaction components and optionally including nucleoside triphosphates.
- a method for the isolation of a nucleic acid complex according to the invention comprising providing a nucleic acid complex according to the invention wherein at least one single stranded nucleic acid template comprising said complex is provided with a nucleic acid sequence affinity tag that allows the selection of complexes by affinity purification.
- Figure 1 Design schematic for 3 way junction a) Schematic of final assembled 3 way junction after annealing, b) Map of Lambda DNA showing regions used as DNA source for the 3-way junction, c) Three single stranded components. Each component contains two regions which are complementary to regions of a neighbouring components (indicated by blue, red, and orange). In addition each component has an upstream 20bp fragment which serves as a unique region leaving a single stranded overhang in the final molecule;
- FIG. 1 Design methodology for junction fabrication. In the example used in the paper this procedure is followed for all three components given in Figure Ic;
- FIG. 3 a) T7 Gene 6 exonuclease digested products of A, B, C (ds double stranded undigested controls, ss single stranded T7 gene 6 treated products). Single stranded DNA fragments run slower than double stranded DNA fragments. Double stranded size in base pairs is indicated on the left, b) 2% Agarose Gel shift assay of individual components of the three way junction; [lanes 1-3] individual T7 gene 6 exonuclease digested products; [lanes 4-6] two components of the three way junction annealed; [lane 7] all three components of the three way junction annealed;
- Figure 4 a) Schematic of method to remove phosphothioate protection groups from T7 gene 6 exonuclease digested components using a complementary oligonucleotide bridge to create an active Nsi l (New England Biolabs) binding site, b) 20% Acrylamide gel of digested products showing removal of phosphorothioate blocking regions: lane 1 ⁇ double stranded (-yds), lane 2 ⁇ single stranded ( ⁇ ss), lane 3 ⁇ single stranded + bridging primer, lane 4 ⁇ single stranded + bridging primer + 5Ou of Nsi I, lane 5 y single stranded;
- FIG. 5 Atomic force micrograph of three way branched structures on a mica substrate; and Figure 6 A Design schematic for double branched complex after annealing; Figure 6B The temperature decay curve of 1.6 litres of water in a Pyrex beaker O/N after heating to 95 0 C.
- Figure 6C Atomic force micrograph of a branched DNA structure containing two branch points on a mica substrate.
- PCR primers were designed for the amplification of each fragment (fragments a & b-RC in Figure 2) such that a linker restriction enzyme (LRE) site is incorporated in the downstream 5' end of the fragment. These restriction sites also later allow for a "checksum" of the assembled construct as individual arms can be removed. In addition, a unique 20 bp sequence was added upstream of all three components to serve as a functional 5' overhang in the assembled complex. After PCR, both products were digested appropriately and purified.
- LRE linker restriction enzyme
- FIG. 2 Amplification and protection with phosphorothioate
- Figure 2 Purified plasmids (Plasmid Mini, Qiagen) were used as templates to amplify the individual components using Pfu Turbo hotstart DNA polymerase (Stratagene).
- the forward primer of this reaction contains five phosphorothioate modified nucleotides on the 5' end, as well as a bridging restriction enzyme (BRE) site, which can be used to remove the five phosphorothioates if required.
- BRE bridging restriction enzyme
- T7 Gene 6 exonuclease digestion and purification (Figure 2; e-g) Double stranded phosphorothioate protected products were digested with 20 units of T7 exonuclease (New England Biolabs M0263) by incubation for 120 minutes at 37 0 C followed by heat inactivation for 10 minutes at 8O 0 C. Products were then purified using Qiaquick columns (Qiagen) with PB binding buffer, and analysed for complete T7 Exonuclease digestion on a polyacrylamide gel. Removal of pliosphorothioate protection groups
- DNA was deposited onto mica substrates (Aztech Trading) as follows. Freshly cleaved mica was washed with a drop of deionised water (18.2 M ⁇ cm, Millipore) for lOseconds and excess water was removed. The Mica was the covered in 1OmM MgCl 2 for 10 sec, with the excess then removed. Assembled DNA complexes at approximately 5ng/ ⁇ l in 1OmM MgCl 2 were then allowed to adsorb onto the surface for 5 minutes. The mica substrate was washed twice with ddH 2 O for lOsec and blow-dried under Nitrogen.
- Imaging was performed using tapping mode AFM (DI Multimode AFM, Veeco, USA) under air, using etched silicon tips (OTESPA, Veeco, USA). Length measurements of the imaged structures were performed using the ImageJ image analysis software (Rasband, 1997-2004). Testing of Functionalised Group availability
- oligonucleotides corresponding to regions of Bacteriophage lambda DNA are shown in bold and are reflected in their name with U or L denoting the upper and lower strand of lambda DNA, respectively, followed by a number indicating the position on lambda DNA of the 5.
- nucleotide for the upper strand and the 3' nucleotide for the lower strand are complementary sequences from the upper and lower strand of lambda DNA, respectively.
- the single branch structure was constructed with components a, ⁇ , and 7.
- Fragment a (Ua denotes the unique 20bp region shown in italics)
- Fragment b consists of two regions (bl and b2)
- Fragment bl (Ub denotes the unique 20bp region shown in italics) Ub-U27086 GATAAGTGGATGCCATCAGGTTGAACTTAACGGGGCATCG
- Fragment b-RC consists of two regions (bl-RC and b2-RC) Fragment c (Uc denotes the unique 20bp region shown in italics)
- the double branch structure was constructed with components a, % ⁇ , and e which when annealed will form the complex shown in Figure 6A.
- Fragment d (Ud denotes the unique 20bp region shown in italics)
- DNA was deposited onto mica substrates (Aztech Trading) as follows. Freshly cleaved mica was washed with a drop of deionised water (18.2 MUcm, Millipore) for 10 sec and excess water was removed. The mica was then covered in 10 mM MgC12 for 10 sec, with the excess removed. Assembled DNA complexes at approximately 1 ng/ ⁇ l in 1OmM MgC12 were then allowed to adsorb onto the surface for 5 minutes. The mica substrate was washed twice with deionised water for 10 sec and blow-dried under nitrogen. Imaging was performed using tapping mode AFM (DI Multimode AFM, Veeco, USA) under air, using etched silicon tips (OTESPA, Veeco, USA). Length measurements of the imaged structures were performed using the Image J image analysis software.21.
- the schematic design for the three-arm DNA complex is shown in Figure Ia.
- the junction comprises three arms, A, B, and C, each composed of an upstream fragment (a, b, and c) and a downstream fragment (a-RC, b-RC, and c-RC).
- the individual arms A, B, and C were taken from suitable regions of lambda- Bacteriophage DNA (Sigma D0144), as indicated in Figure Ib.
- the only restrictions imposed on the individual regions was the required length of the arm and that they do not contain recognition sites for a certain set of enzymes which will subsequently be used for modifications of the assembled complex and checksum tests.
- three components are required, designed such that each fragment of a given component will recognise a fragment of another component.
- each component contains two fragments which will each form one half of an arm of the DNA complex.
- each component has a downstream region in reverse complement (RC) orientation to the upstream region of another component, such that: a binds ⁇ and ⁇ , ⁇ binds 7 and a; and 7 binds a and ⁇ .
- RC reverse complement
- the only possible conformation that can be formed is the one shown in Figure Ia.
- the individual steps undertaken to generate the component a are shown in Figure 2.
- the components ⁇ and ⁇ are obtained in a similar manner, however we note that the fragments b and b-RC of the components ⁇ and ⁇ , respectively, consist of two individual fragments as opposed to just one for all other components.
- the template for component a was obtained by PCR amplification and subsequent ligation of the two fragments a and c-RC.
- the ligation product was then cloned into a bacterial vector and sequenced to isolate a pure, error-free template.
- the double stranded component template was amplified by PCR which also incorporated a further restriction site (BRE) and five phosphorothioates on the 5' end of the upstream strand.
- BRE further restriction site
- the results of this PCR are shown on a 5% polyacrylamide gel in Figure 3 a (lane 1; lane 3 and 5 shows the results of the equivalent PCR for components ⁇ and ⁇ ).
- DNA complexes were self-assembled by mixing each component at l ⁇ ng/ ⁇ .1 in IX hybridisation buffer (Mao et. al., 1999). The component mixture was annealed by slowly reducing the temperature. The results of this annealing process was analysed by gel shift assay on a 2% agarose gel (Figure 3b). Lanes 1, 2, and 3 show the individual conponents, lanes 4, 5, and 6 DNA complexes missing one component, and lane 7 shows the complete, assembled three-arm DNA complex. A substantial increase in apparent size of the product was found upon introducing a further component. We note that there are no visible traces of either individual single stranded component, or incompletely assembled complexes when all components were added (lane 7).
- Figure 5 shows a typical AFM image.
- the inset shows a high resolution scan of one of the three arm complexes.
- a typical atomic force micrograph of this complex is given in Figure 6.
- Nikiforov TT Rendle RB, Kotewicz ML, Rogers YH.
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Nanotechnology (AREA)
- Physics & Mathematics (AREA)
- Composite Materials (AREA)
- Condensed Matter Physics & Semiconductors (AREA)
- General Physics & Mathematics (AREA)
- Materials Engineering (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Abstract
We describe a method for the production of single stranded DNA molecules and their use in the production of nano-scale DNA complexes.
Description
PNA Structures
The invention relates to a process for the production of single stranded nucleic acid and its use in the formation of higher order structures comprising DNA.
The formation of nano-scale devices on substrates and in solution is a central problem faced by nanotechnology. Nucleic acid molecules are well suited for this purpose due to the inherent self recognition of each of the complementary strands of nucleic acid. Linear strands of DNA can self assemble into a range of structures based on the linear sequence information contained in the nucleotide base composition. It is relatively easy to incorporate branching of a double helix by modifying the sequence of a pair of nucleic acid strands to be non-complementary over a specific region of the helix resulting in no annealing in that region of non- complementarity. This can be achieved with an exquisite level of accuracy to provide nano-scale structures that are stable, predictable and regular and in large quantities. In this way DNA structures can be built of virtually any conformation, for example cages, tubes, nets, scaffolds and other complex three dimensional structures.
The utility of these nano-scale structures has broad application in nanotechnology. For example, electronic nanostructures may be fabricated on self-assembled DNA scaffolds. It is recognised that traditional "top down" lithographic methods for manufacturing microelectronics will soon reach their fundamental limitations and new "bottom up" techniques will be required to provide circuit layouts on a nano- scale. The self assembly properties of DNA nanostructures as scaffolds may provide the necessary complexity to construct and position nano-molecular scale electronic devices and wiring.
The physical, chemical and biological properties of DNA also lend itself to drug delivery devices in pharmaceutical compositions and also delivery vehicles for gene therapy vectors. DNA sequences can be modified to incorporate specific sequences that bind peptides, proteins and other nucleic acids (e.g. gene therapy vectors) that
have therapeutic applications. Further applications in biological systems include the use of DNA nano-structures as binding partners on substrates for the binding of proteins/enzymes involved in macromolecular synthesis.
In addition the nucleotide composition of DNA can be chemically modified to incorporate modified bases and sugars to alter the properties of the molecule. For example, the incorporation of peptidic linkages between bases to form so called peptide nucleic acids. There is no doubt that DNA has considerable versatility with respect to providing structures of defined structure and function.
A number of studies utilise synthetic methods for building DNA structures. However, these methods are limited by the chemical synthesis methods of the DNA molecules at their root in terms of molecule size (typically 100-120 base pairs (bp)). Applications that require self-assembling DNA complexes of several tens or more nanometres will therefore need to utilise other techniques. Here, we present a generic scalable technique to generate large DNA macromolecular complexes. Utilising the method outlined here, linear, branched and/or circular DNA complexes can be synthesised and functionalised in a specific manner, allowing assembled complexes to be directly incorporated into their intended application. The effectiveness of this technique is illustrated here by the use of lambda bacteriophage DNA as a template to generate a three-way DNA structure approximately 120 nm in length.
We describe a generic technique to generate large, branched DNA complexes, and in this context we will demonstrate the assembly of a three-arm DNA junction with unique single stranded overhangs on all arms. The technique is based on the concept of using enzymatic methods to generate large single stranded DNA components consisting of two fragments with distinct base sequences, an upstream and downstream reverse complement fragment. Each fragment is complementary to a fragment of another single stranded component, thus allowing for the formation of the whole DNA complex by self-assembly. Although we only demonstrate the assembly of a three-arm complex, we note that the number of arms is not restricted.
The number of individual single stranded components equals the number of arms and thus only increases linearly with the complexity of the DNA complex.
According to an aspect of the invention there is provided an in vitro method for the production of a single stranded DNA template comprising the steps of: i) forming a preparation comprising: a nucleic acid template molecule; a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template; and polymerase chain reaction components including nucleoside triphosphates and an agent to protect the 5' nucleotide of the amplified template molecule; ii) amplifying said nucleic acid template by a polymerase chain reaction to form a double stranded nucleic acid template wherein the template is modified at the 5' nucleotide of the template to protect the digestion of the template by a non-processive 5'-3'exonuclease; iii) contacting the preparation with a non-processive 5 '-3' exonuclease that digests the template to a single stranded DNA molecule; iv) removing the agent that protects the 5' nucleotide of the single stranded template; and optionally v) purifying the deprotected single stranded nucleic acid template.
Li a preferred method of the invention said non-processive 5 '-3' exonuclease is T7 gene 6 exonuclease.
T7 gene 6 exonuclease hydrolyzes double stranded DNA non-processively in the 5'- 3' direction from either 5' phosphoryl or 5' hydroxyl nucleotides. It also degrades nucleotides at gaps and nicks of double stranded DNA from the 5' termini and RNA from RNA-DNA hybrids in a 5 '-3' direction. The method of the invention allows the production of single stranded template DNA, the sequence of which is modified to allow complementary base pairing between single stranded nucleic acid to form higher order structures that may be linear, branched or circular and of nanometre dimensions.
In a further preferred method of the invention said modification is the incorporation of phosphorothioate to protect the 5 'nucleotide of the template.
In a further preferred method of the invention said agent is chemically or physically cleaved from said single stranded template.
In a preferred method of the invention said agent is cleaved with restriction enzyme following hybridisation with a complementary oligonucleotide that comprises a restriction enzyme recognition site for said restriction enzyme.
hi a preferred method of the invention said agent is cleaved with a restriction enzyme following generation of a double stranded region by hybridisation with a complementary oligonucleotide, or by any other method, that comprises a restriction enzyme recognition site for said restriction enzyme.
hi a preferred embodiment of the invention said nucleoside triphosphates are modified.
The term "modified" encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleotides may also include 2' substituted sugars such as 2'-O- methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; T- fluoro-; 2'-halo or 2;azido- ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
Modified nucleotides are known in the art and include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art
and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6- methyladenine; 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5 fluorouracil;5- bromouracil;5-carboxymethylaminomethyl-2 thiouracil;5carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine;l-niethyladenine;l- methylpseudouracil;l-methylguanine;2,2 dimethylguanine; 2-methyladenine; 2- methylguanine; 3-methylcytosine; 5-methylcytosine; N6-methyladenine; 7- methylguanine; 5- methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N6-isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N- uracil-5-oxyacetic acid methylester; uracil 5 — oxyacetic acid; queosine; 2- thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5- butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1-methylguanine; 1-methylcytosine.
Li a preferred method of the invention said template is adapted by the provision of a nucleic acid sequence motif that binds at least one polypeptide molecule.
Examples of motifs that bind protein or polypeptide molecules include restriction enzymes, DNA binding proteins e.g. histones, transcription factors, DNA polymerases, RNA polymerases, DNA ligases, or an antibody. The motifs may be part of a promoter.
"Promoter" is an art recognised term and, for the sake of clarity, includes the following features which are provided by example only, and not by way of limitation.
Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factors (polypeptides) which have been shown to bind specifically to enhancer elements. The binding/activity of transcription
factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of physiological/environmental cues which include, by example and not by way of limitation, intermediary metabolites (e.g. glucose, lipids), environmental effectors ( e.g. light).
Promoter elements also include so called TATA box and RNA polymerase initiation selection sequences which function to select a site of transcription initiation. These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase.
According to a further aspect of the invention there is provided a single stranded nucleic acid molecule obtainable or obtained by the method according to the invention.
In a preferred embodiment of the invention said nucleic acid molecule is at least about 20 nucleotides in length.
Ih a preferred embodiment of the invention said nucleic acid molecule is at least about 60 nucleotides in length; at least about 200 nucleotides in length; at least about 400 nucleotides in length; at least about 1000 nucleotides in length; at least about 2000 nucleotides in length; at least about 10000 nucleotides in length; or at least about 50000 nucleotides in length.
According to a further aspect of the invention there is provided an in vitro method for the formation of a complex comprising nucleic acid comprising the steps of: i) forming a preparation of at least two single stranded nucleic acid molecules obtained or obtainable by the method according to the invention wherein said molecules are adapted to anneal to one another over at least part of their length; ii) heating said preparation to denature secondary structures in said single stranded nucleic acid; and
iii) allowing said single stranded nucleic acid molecules to anneal to one another to form a nucleic acid complex.
In a further preferred method of the invention said preparation comprises at least three single stranded nucleic acid molecules wherein each molecule comprises a region which is able to anneal to a region in at least one other molecule of said three nucleic acid molecules.
In a preferred method of the invention said nucleic acid molecules include a region complementary td a region found in two of said three nucleic acid molecules.
hi a preferred method of the invention said complex comprises a plurality of single stranded nucleic acid molecules.
According to a further aspect of the invention there is provided a nucleic acid complex obtained or obtainable by the method according to the invention.
According to a further aspect of the invention there is provided a substrate which comprises a surface wherein said surface comprises a nucleic acid complex according to the invention.
In a preferred embodiment of the invention said substrate is selected from the group consisting of: a metal substrate; a plastics substrate; a glass substrate; a mica substrate; a silicon substrate; a silicon dioxide substrate; a gallium arsenide substrate; a germanium substrate; a diamond substrate; a doped or layered semiconductor substrate or combinations thereof.
According to a further aspect of the invention there is provided a device comprising a substrate according to the invention.
In a preferred embodiment of the invention said device is a product that allows for the directed transport of a molecule or a molecular structure.
In a further preferred embodiment of the invention said molecule or molecular structure is transported by a vehicle that associates with said nucleic acid complex.
hi a preferred embodiment of the invention said vehicle comprises an organic or inorganic molecule or a molecular complex.
m a further preferred embodiment of the invention said vehicle comprises at least one protein.
Molecules or molecular structures that are transported by the device of the invention include, but are not limited to, metal-, semiconductor- and insulating nanoparticles; carbon-based materials such as single and multi-walled carbon nanotubes, buckyballs; proteins, nucleic acid complexes and chemical compounds; other inorganic and organic materials; information in various forms.
In a further preferred embodiment of the invention said molecule or molecular structure is integral with said vehicle.
In an alternative preferred embodiment of the invention said device is adapted for the transport of an electrical charge.
An electrical charge includes, but is not limited to, a charge in the form of electrons, holes, electron- or hole-like quasiparticles, protons, and ions, amongst others.
In a further preferred embodiment of the invention said device is adapted to transport data.
Data includes, but is not limited to, signalling the occurrence of a specific event, or as means of directing further actions such as triggering catalysis or other chemical reactions at nearby or remote locations.
In a preferred embodiment of the invention said device is an electronic circuit.
In a further preferred embodiment of the invention, said device is a scaffold for the assembly of nanoscale particles and other complexes.
The assembly can be, but is not limited to be, 'directed' with spatial and orientational precision at the nanometer scale, i.e. objects are assembled at designed locations on said device. Objects to be assembled include, but are not limited to, metal-, semiconductor- and insulating nanoparticles; carbon-based materials such as single and multi-walled carbon nanotubes, buckyballs; proteins, nucleic acid complexes and chemical compounds; other inorganic and organic materials.
In an alternative embodiment, said device is a scaffold wherein objects are assembled at random locations along the whole scaffold.
In a further preferred embodiment of the invention, said device is a self-assembled, nanoscale object.
This includes, but is not limited to, a grating in an optoelectronic device; an interconnection between appropriately functionalized surfaces or electrodes; a nanoscale mechanical switch.
In a further preferred embodiment of the invention, said device is a scaffold for a subsequent chemical reaction or reactions or catalysis of a chemical reaction or reactions. The reactions or catalysis of reactions occur, but are not limited to occur, with spatial precision at the nanometer scale, i.e. the reaction or catalysis occurs at a designed location or locations on said device.
In a further preferred embodiment of the invention said device is a drug delivery vehicle.
According to a further aspect of the invention there is provided a pharmaceutical composition comprising a drug delivery vehicle according to the invention.
When administered, the pharmaceutical compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents, such as chemotherapeutic agents.
The therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, or transdermal.
The compositions of the invention are administered in effective amounts. An "effective amount" is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a particular disease, such as cancer, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or can be monitored according to diagnostic methods of the invention discussed herein.
Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent
therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of nucleic acid for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining regression of a tumour, decrease of disease symptoms, modulation of apoptosis, etc.
The doses of the composition administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration (e.g., intra-tumour) and the like vary from the foregoing. Administration of compositions to mammals other than humans, e.g. for testing purposes or veterinary therapeutic purposes, is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.
When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non- pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
Compositions may be combined, if desired, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt.
The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion.
Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of the composition, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents.
The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1, 3-butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's
Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
In a further preferred embodiment of the invention said device is a diagnostic assay product.
Diagnostic assay products typically will include substrates upon which is immobilised an molecule, for example an antigen, antibody or nucleic acid probe, which detects a molecule present in a biological sample the detection of which is desirable because it may be associated with a specific disease or condition.
According to a further aspect of the invention there is provided a method to fabricate a surface of a substrate comprising the steps of: i) providing a preparation comprising a nucleic acid complex according to the invention; and ii) bringing into contact the preparation in (i) with a substrate to be fabricated.
According to a further aspect of the invention there is provided the use of a nucleic acid complex obtainable or obtained by the method according to the invention in the production of electronic circuits.
According to a further aspect of the invention there is provided the use of a nucleic acid complex obtainable or obtained by the method according to the invention in the delivery of a drug to a subject.
According to a further aspect of the invention there is provided a kit comprising: a container comprising a single stranded template nucleic acid molecule according to the invention.
In a preferred embodiment of the invention said template nucleic acid is included in a vector, preferably a plasmid. Examples of vectors also include cosmids, mammalian artificial chromosomes, yeast artificial chromosomes and bacteriophage vectors.
In a preferred embodiment of the invention said kit includes a non processive 5 '-3' exonuclease; preferably said exonuclease is T7 gene 6 exonuclease.
In a further preferred embodiment of the invention said kit further comprises: a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template; polymerase chain enzyme reaction components and optionally including nucleoside triphosphates.
According to a further aspect of the invention there is provided a method for the isolation of a nucleic acid complex according to the invention said method comprising providing a nucleic acid complex according to the invention wherein at least one single stranded nucleic acid template comprising said complex is provided with a nucleic acid sequence affinity tag that allows the selection of complexes by affinity purification.
Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.
Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires, hi particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.
An embodiment of the invention will now be described by example only and with reference to the following figures:
Figure 1: Design schematic for 3 way junction a) Schematic of final assembled 3 way junction after annealing, b) Map of Lambda DNA showing regions used as DNA source for the 3-way junction, c) Three single stranded components. Each component contains two regions which are complementary to regions of a neighbouring components (indicated by blue, red, and orange). In addition each component has an upstream 20bp fragment which serves as a unique region leaving a single stranded overhang in the final molecule;
Figure 2: Design methodology for junction fabrication. In the example used in the paper this procedure is followed for all three components given in Figure Ic;
Figure 3 a) T7 Gene 6 exonuclease digested products of A, B, C (ds double stranded undigested controls, ss single stranded T7 gene 6 treated products). Single stranded DNA fragments run slower than double stranded DNA fragments. Double stranded size in base pairs is indicated on the left, b) 2% Agarose Gel shift assay of individual components of the three way junction; [lanes 1-3] individual T7 gene 6 exonuclease digested products; [lanes 4-6] two components of the three way junction annealed; [lane 7] all three components of the three way junction annealed;
Figure 4 a) Schematic of method to remove phosphothioate protection groups from T7 gene 6 exonuclease digested components using a complementary oligonucleotide bridge to create an active Nsi l (New England Biolabs) binding site, b) 20% Acrylamide gel of digested products showing removal of phosphorothioate blocking regions: lane 1 γ double stranded (-yds), lane 2 γ single stranded (γss), lane 3 γ single stranded + bridging primer, lane 4 γ single stranded + bridging primer + 5Ou of Nsi I, lane 5 y single stranded;
Figure 5 Atomic force micrograph of three way branched structures on a mica substrate; and
Figure 6 A Design schematic for double branched complex after annealing; Figure 6B The temperature decay curve of 1.6 litres of water in a Pyrex beaker O/N after heating to 95 0C. Figure 6C Atomic force micrograph of a branched DNA structure containing two branch points on a mica substrate.
Materials and Methods
FCR of fragments and ligation
(Figure 2; a-b) PCR primers were designed for the amplification of each fragment (fragments a & b-RC in Figure 2) such that a linker restriction enzyme (LRE) site is incorporated in the downstream 5' end of the fragment. These restriction sites also later allow for a "checksum" of the assembled construct as individual arms can be removed. In addition, a unique 20 bp sequence was added upstream of all three components to serve as a functional 5' overhang in the assembled complex. After PCR, both products were digested appropriately and purified. Appropriate fragments (fragments a & b-RC in Figure 2) were mixed together and ligated using T4 DNA Ligase (New Enlgand Biolabs) giving the template for one component of the branched DNA complex. For a detailed list of PCR primers and sequences used see supplementary information. Cloning into bacterial vector (Figure 2; c) All three ligated components (a, β, γ) were cloned into pGEM-T easy (Promega). Individual bacterial colonies were selected; plasmids were isolated and sequenced to ensure no errors were introduced during PCR or ligation. Amplification and protection with phosphorothioate (Figure 2; c) Purified plasmids (Plasmid Mini, Qiagen) were used as templates to amplify the individual components using Pfu Turbo hotstart DNA polymerase (Stratagene). The forward primer of this reaction contains five phosphorothioate modified nucleotides on the 5' end, as well as a bridging restriction enzyme (BRE) site, which can be used to remove the five phosphorothioates if required. T7 Gene 6 exonuclease digestion and purification (Figure 2; e-g) Double stranded phosphorothioate protected products were digested with 20 units of T7 exonuclease (New England Biolabs M0263) by incubation for 120 minutes at 370C followed by heat inactivation for 10 minutes at 8O0C. Products
were then purified using Qiaquick columns (Qiagen) with PB binding buffer, and analysed for complete T7 Exonuclease digestion on a polyacrylamide gel. Removal of pliosphorothioate protection groups
(Figure 2, f-g)The phosphorothioate protection groups are removed by adding a 10 fold excess of bridge primer (see supplementary information for details) which was annealed by heating the reaction to 950C and allowing it to cool overnight. This single stranded template and bridge complex were digested with Nsi I and cleaned with a Qiaquick column (Qiagen). Annealing of single stranded components Purified single stranded components a, β, γ (in 5mM Hepes pH7.0, 2mM MgC12, 0.5mM EDTA) were heated in a Mastercycler® EP S (Eppendorf, UK) with a heated lid, to 95°C for 10 minutes, and allowed to cool in a stepwise fashion designed to approximate the temperature decay of 1.5 litres of water in a glass beaker (see supplementary data for details). Individual component annealing was analysed by agarose gel electrophoresis. Atomic force microscopy
DNA was deposited onto mica substrates (Aztech Trading) as follows. Freshly cleaved mica was washed with a drop of deionised water (18.2 MΩcm, Millipore) for lOseconds and excess water was removed. The Mica was the covered in 1OmM MgCl2 for 10 sec, with the excess then removed. Assembled DNA complexes at approximately 5ng/μl in 1OmM MgCl2 were then allowed to adsorb onto the surface for 5 minutes. The mica substrate was washed twice with ddH2O for lOsec and blow-dried under Nitrogen. Imaging was performed using tapping mode AFM (DI Multimode AFM, Veeco, USA) under air, using etched silicon tips (OTESPA, Veeco, USA). Length measurements of the imaged structures were performed using the ImageJ image analysis software (Rasband, 1997-2004). Testing of Functionalised Group availability
A ten times excess of 3' biotinylated oligonucleotides complementary to one of the unique single stranded overhangs was added to the mixture containing the three components before annealing. The annealed complexes were then conjugated to paramagnetic streptavidin coated beads (New England Biolabs). The beads and thus
the complexes were then separated from the supernatant using magnetic fields. The supernatant was pipetted off and analysed on a standard PAGE acrylamide gel.
Oligonucleotide Sequences used to eenerate components
Restriction endonuclease recognition sites are underlined. The regions of the oligonucleotides corresponding to regions of Bacteriophage lambda DNA are shown in bold and are reflected in their name with U or L denoting the upper and lower strand of lambda DNA, respectively, followed by a number indicating the position on lambda DNA of the 5. nucleotide for the upper strand and the 3' nucleotide for the lower strand. For example, U23869 and L23869 are complementary sequences from the upper and lower strand of lambda DNA, respectively.
Single branch point structure (Schematic in Figure 1 and AFM in Figure 5)
The single branch structure was constructed with components a, β, and 7.
Component template a. Fragment a (Ua denotes the unique 20bp region shown in italics)
Ua-U20973 TACGCAATCGCTACTA C4CGATACGCTGAATGAACTGGCC
Nhel-Apal-L21074 TGGCTAGCGGGCCCTCAGTGTCGCATTCTTCGGT
Fragment c-RC
NheI-L30041 TGGCTAGCTCTTGTTGTTCGCCATCCTG
U29936 AGCGATGCGTAATGATGTCG
Component template β
Fragment b consists of two regions (bl and b2)
Fragment bl (Ub denotes the unique 20bp region shown in italics)
Ub-U27086 GATAAGTGGATGCCATCAGGTTGAACTTAACGGGGCATCG
AflIII-PvuI-L27150 CCACGCGTGGCGATCGGCAACATGAATAACAGTGGG
Fragment b2-RC and a-RC
Ascl-Xbal-L21176 TGGGCGCGCCTCTAGAAATATCCCTGCCAACCTGAG
U20937 ATACGCTGAATGAACTGGCC
Component template y
Fragment b-RC consists of two regions (bl-RC and b2-RC) Fragment c (Uc denotes the unique 20bp region shown in italics)
Uc-U29936 ΛraΛGCrΛGGCTΣ4GCrGCAGCGATGCGTAATGATGTCG ApaI-NheI-L30041 TGGGGCCCGCTAGCTCTTGTTGTTCGCCATCCTG
Fragment b2-RC
ApaI-U21075 TGGGGCCCCGGCGCTGGCAGGGCTTTCC
Ascl-Xbal-L21176 TGGGCGCGCCTCTAGAAATATCCCTGCCAACCTGAG
Fragment bl-RC
AflIII-PvuI-L27150 CCACGCGTGGCGATCGGCAACATGAATAACAGTGGG U27086 TTGAACTTAACGGGGCATCG
Double Branch Structure
The double branch structure was constructed with components a, % δ, and e which when annealed will form the complex shown in Figure 6A.
Component template δ
Fragment bl (Ub denotes the unique 20bp region shown in italics) Ub-U27086
GATAAGTGGATGCCATCAGGTTGAACTTAACGGGGCATCG
Afliπ-PvuI-L27150
CCACGCGTGGCGATCGGCAACATGAATAACAGTGGG
Fragment d-RC AscI-KpnI-BamHI-L29872
TGGGCGCGCCGGTACCGGATCCCTGCATATGATGTCTGACGC
U29715
GTACGGTCATCATCTGACAC
Component template e
Fragment d (Ud denotes the unique 20bp region shown in italics)
Ud-U29751
GACTAGCATTAGCAGCGTAGGTACGGTCATCATCTGACAC
Kpnl-Bamffl-L29891
TATGGGTACCGGATCCCTGCATATGATGTCTGACGC
Fragment b2-RC and a-RC
Kpnl-Xbal-L21176
TATGGGTACCTCTAGAAATATCCCTGCCAACCTGAG
U20937
ATACGCTGAATGAACTGGCC
Primers used to amplify components from plasmids and protect with phosphorothioates (phosphorothioates are denoted by *).
Component a
Forward: Phos-Nsi-Ua-U20973
A*G*T*C*A* AGCGATTGATGCATTACGCAATCGCTACTACACG
Reverse: U29936
AGCGATGCGTAATGATGTCG
Component β
Forward: Phos-Nsil-Ub-U27086
A*G*T*C* A* AGCGATTGATGCATGATAAGTGGATGCCATCAGG
Reverse: U20937
ATACGCTGAATGAACTGGCC
Component γ
Forward: Phos-Nsil-U10331-U29936
C*A*G*C*G* ATCCGGATATGCATCCGCTGGATTTCAGTCTGCTAGCGAT GCGTAATGATGTCG
Reverse: U27086
TTGAACTTAACGGGGCATCG
Component δ
Forward: Phos-Nsil-Ub-U27086 A*G*T*C*A*AGCGATTGATGCATGATAAGTGGATGCCATCAGG
Reverse: U29715
GTACGGTCATCATCTGACAC
Component e
Forward: Phos-Nsi-Ud-U29751
A*G*T*C* A* AGCGATTGATGCATGACTAGCATTAGCAGCGTAG
Reverse: U20937 ATACGCTGAATGAACTGGCC
Bridging Oligonucleotide (BRE)
U10331-NsiI AGCAGACTGAAATCCAGCGGATGCATATCCGGATCGCTG
Annealing of single stranded components
Purified single stranded components a, β, y(a, δ, γ, and e for the double branched complex) were heated in a Mastercycler® EP S (Eppendorf, Germany) with a heated lid, to 950C for 10 minutes, and allowed to cool over 15 hours using a program written to follow the temperature decay curve shown in Figure 6B.
Atomic force microscopy
DNA was deposited onto mica substrates (Aztech Trading) as follows. Freshly cleaved mica was washed with a drop of deionised water (18.2 MUcm, Millipore) for 10 sec and excess water was removed. The mica was then covered in 10 mM MgC12 for 10 sec, with the excess removed. Assembled DNA complexes at approximately 1 ng/μl in 1OmM MgC12 were then allowed to adsorb onto the surface for 5 minutes. The mica substrate was washed twice with deionised water for 10 sec and blow-dried under nitrogen. Imaging was performed using tapping mode AFM (DI Multimode AFM, Veeco, USA) under air, using etched silicon tips (OTESPA, Veeco, USA). Length measurements of the imaged structures were performed using the Image J image analysis software.21.
EXAMPLES
The schematic design for the three-arm DNA complex is shown in Figure Ia. The junction comprises three arms, A, B, and C, each composed of an upstream fragment (a, b, and c) and a downstream fragment (a-RC, b-RC, and c-RC). Here, the individual arms A, B, and C were taken from suitable regions of lambda- Bacteriophage DNA (Sigma D0144), as indicated in Figure Ib. The only restrictions imposed on the individual regions was the required length of the arm and that they do not contain recognition sites for a certain set of enzymes which will subsequently be used for modifications of the assembled complex and checksum tests. For the three arm junction three components are required, designed such that each fragment of a given component will recognise a fragment of another component. The individual components for the three arm construct are shown schematically in Figure Ic (components α, β, γ). As can be seen from Figure 1, each component contains two fragments which will each form one half of an arm of the DNA complex. In the case of the three arm complex discussed here, each component has a downstream region in reverse complement (RC) orientation to the upstream region of another component, such that: a binds β and γ, β binds 7 and a; and 7 binds a and β. Upon self-assembly, the only possible conformation that can be formed is the one shown in
Figure Ia. The individual steps undertaken to generate the component a are shown in Figure 2. The components β and γ are obtained in a similar manner, however we note that the fragments b and b-RC of the components β and γ, respectively, consist of two individual fragments as opposed to just one for all other components.
The template for component a was obtained by PCR amplification and subsequent ligation of the two fragments a and c-RC. The ligation product was then cloned into a bacterial vector and sequenced to isolate a pure, error-free template. The double stranded component template was amplified by PCR which also incorporated a further restriction site (BRE) and five phosphorothioates on the 5' end of the upstream strand. The results of this PCR are shown on a 5% polyacrylamide gel in Figure 3 a (lane 1; lane 3 and 5 shows the results of the equivalent PCR for components β and γ).
It has been shown that a modification at the 5' end of double stranded DNA with five phosphorothioates blocks the 5' exonuclease activity of T7 gene 6 exonuclease (Nikiforov, et. al., 1994). We exploited this blocking capability and generated the single stranded components from the double stranded PCR product by digestion with T7 gene 6 exonuclease (Figure Ic). This reaction has been assessed by standard PAGE gel analysis and the results are shown in Figure 3 a. Lane 1, 3, and 5 show the undigested, double stranded PCR products a, β, and γ, respectively, and lanes 2, 4, and 6 the respective digested, single stranded components. As expected, the single stranded bands appear much fainter in the PAGE gel and run slower. We note that for all components, no remaining double stranded DNA could be detected, strongly indicating that the digestion reaction was very efficient.
The five phorphorothioates at the 5' end of the resulting single stranded components were removed using a corresponding bridge primer. This bridging oligonucleotide was used to make the 5' end of the component temporarily double stranded to allow digestion by a restriction enzyme similar to the method used by Peale et. al., 1994. This process is schematically shown in Figure 4a. Figure 4b shows a standard 20%
PAGE gel analysis of the digested products (Lane 4) demonstrating the successful cutting of the phosphorothioated 5' end from the single stranded γ component.
DNA complexes were self-assembled by mixing each component at lθng/μ.1 in IX hybridisation buffer (Mao et. al., 1999). The component mixture was annealed by slowly reducing the temperature. The results of this annealing process was analysed by gel shift assay on a 2% agarose gel (Figure 3b). Lanes 1, 2, and 3 show the individual conponents, lanes 4, 5, and 6 DNA complexes missing one component, and lane 7 shows the complete, assembled three-arm DNA complex. A substantial increase in apparent size of the product was found upon introducing a further component. We note that there are no visible traces of either individual single stranded component, or incompletely assembled complexes when all components were added (lane 7). This indicates that the self-assembly process was reasonably efficient. A more detailed analysis of the DNA complexes was performed by AFM imaging. Figure 5 shows a typical AFM image. The inset shows a high resolution scan of one of the three arm complexes. The measured dimensions (Figure 5, inset) of the three arms, 67nm 40nm and 53nm, respectively, correspond well with the expected lengths of the three arms (77nm, 41nm, and 53nm). In order to verify further the ability of thistechnique to generate complex branched structures, we extended the single branched three-armcomplex to include a second three-way branch point giving rise to a four-arm complex. A typical atomic force micrograph of this complex is given in Figure 6.
References
Franklin V. Peale, Jr., Karen Mason, Andrew W. Hunter and Mark Bothwell. Multiplex Display Polymerase Chain Reaction Amplifies and Resolves Related Sequences Sharing a Single Moderately Conserved Domain. Analytical Biochemistry. 1998 Feb; 256(2):158-168.
Chengde Mao, Weiqiong Sun, and Nadrian C. Seeman. Designed two-dimensional DNA Holliday junction arrays visualized by atomic force microscopy. Journal of the American Chemical Society. 1999, 121:5437-5443.
Nikiforov TT, Rendle RB, Kotewicz ML, Rogers YH. The use of phosphorothioate primers and exonuclease hydrolysis for the preparation of single-stranded PCR products and their detection by solid-phase hybridization. PCR Methods Appl. 1994 Apr; 3(5):285-91.
Rasband, W.S. ImageJ, National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997-2004
Claims
1. An in vitro method for the production of a single stranded DNA template comprising the steps of: i) forming a preparation comprising: a nucleic acid template molecule; a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template; and polymerase chain reaction enzyme components including nucleoside triphosphates and an agent to protect the 5' nucleotide of the amplified template molecule; ii) amplifying said nucleic acid template by a polymerase chain reaction to form a double stranded nucleic acid template wherein the template is modified at the 5' nucleotide of the template to protect the digestion of the template by a non-processive 5 '-3 'exonuclease; iii) contacting the preparation with a non-processive 5 '-3' exonuclease that digests the template to a single stranded DNA molecule; iv) removing the agent that protects the 5' nucleotide of the single stranded template; and optionally v) purifying the deprotected single stranded nucleic acid template.
2. A method according to claim 1 wherein said non-processive 5 '-3' exonuclease is T7 gene 6 exonuclease.
3. A method according to claim 1 or 2 wherein said agent is phosphorothioate.
4. A method according to any of claims 1-3 said agent is chemically or physically cleaved from said single stranded template.
5. A method according to claim 4 wherein said agent is cleaved with restriction enzyme following hybridisation with a complementary oligonucleotide that comprises a restriction enzyme recognition site for said restriction enzyme.
6. A method according to claim 4 wherein said agent is cleaved with a restriction enzyme following generation of a double stranded region by hybridisation with a complementary oligonucleotide, or by any other method, that comprises a restriction enzyme recognition site for said restriction enzyme.
7. A method according to any of claims 1-6 wherein said nucleoside triphosphates are modified.
8. A method according to any of claims 1-7 wherein said template is adapted by the provision of a nucleic acid sequence motif that binds at least one polypeptide molecule.
9. A single stranded nucleic acid molecule obtainable or obtained by the method according to any of claims 1-8.
10. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 20 nucleotides in length.
11. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 200 nucleotides in length.
12. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 400 nucleotides in length;
13. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 1000 nucleotides in length;
14. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 2000 nucleotides in length;
15. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 10000 nucleotides in length;
16. A single stranded nucleic acid molecule according to claim 9 wherein said nucleic acid is at least about 50000 nucleotides in length.
17. An in vitro method for the formation of a complex comprising nucleic acid comprising the steps of: i) forming a preparation of at least two single stranded nucleic acid molecules obtained or obtainable by the method according to any of claims 1-8 wherein said molecules are adapted to anneal to one another over at least part of their length; ii) heating said preparation to denature secondary structures in said single stranded nucleic acid; and vi) allowing said single stranded nucleic acid molecules to anneal to one another to form a nucleic acid complex.
18. A method according to claim 17 wherein said preparation comprises at least three single stranded nucleic acid molecules wherein each molecule comprises a region which is able to anneal to a region in at least one other molecule of said three nucleic acid molecules.
19. A method according to claim 17 wherein said nucleic acid molecules include a region complementary to a region found in two of said three nucleic acid molecules.
20. A method according to any of claims 17-19 wherein said complex comprises a plurality of single stranded nucleic acid molecules.
21. A nucleic acid complex obtained or obtainable by the method according to any of claims 17-20.
22. A substrate which comprises a surface wherein said surface comprises a nucleic acid complex according to claim 21.
23. A substrate according to claim 22 wherein said substrate is a metal substrate; a plastics substrate; a glass substrate; a mica substrate; a silicon substrate; a silicon dioxide substrate; a gallium arsenide substrate; a germanium substrate; a diamond substrate; a doped or layered semiconductor substrate or combinations thereof.
24. A device comprising a substrate according to claim 22 or 23.
25. A device according to claim 24 wherein said device is a product that allows for the directed transport of a molecule or a molecular structure.
26. A device according to claim 25 wherein said molecule or molecular structure is transported by a vehicle that associates with said nucleic acid complex.
27. A device according to claim 25 or 26 wherein said vehicle comprises an organic or inorganic molecule or a molecular complex.
28. A device according to any of claims 24-26 wherein said vehicle comprises at least one protein.
29. A device according to any of claims 24-28 wherein said molecule or molecular structure is integral with said vehicle.
30. A device according to any of claims 24-29 wherein said device is adapted for the transport of an electrical charge.
31. A device according to any of claims 24-30 wherein said device is adapted to transport data.
32. A device according to any of claims 24-31 wherein said device is an electronic circuit.
33 A device according to any of claims 24-32 wherein said device is a drug delivery vehicle.
34. A device according to any of claims 24-32 wherein said device is a diagnostic assay product.
35. A pharmaceutical composition comprising a drug delivery vehicle according to claim 33.
36. A method to fabricate a surface of a substrate comprising the steps of: i) providing a preparation comprising a nucleic acid complex according to claim 21; and ii) bringing into contact the preparation in (i) with a surface of a substrate to be fabricated.
37. The use of a nucleic acid complex according to claim 21 in the production of a device for use in the transport of an electrical charge.
38. Use according to claim 37 wherein said device is an electrical circuit.
39. The use of a nucleic acid complex according to claim 21 in the delivery of a drug to a subject.
40. The use of a nucleic acid complex according to claim 21 in the production of a diagnostic device.
41. A kit comprising: a container comprising a single stranded template nucleic acid molecule according to any of claims 9-16.
42. A kit according to claim 41 wherein said kit includes a non processive 5 '-3' exonuclease.
43. A kit according to claim 42 wherein said non processive 5 '-3' exonuclease is T7 gene 6 exonuclease.
44. A kit according to any of claims 41-43 wherein said kit further comprises: a thermostable DNA polymerase; at least two oligonucleotide primer molecules adapted to anneal to said template nucleic acid; polymerase chain enzyme reaction components and optionally including nucleoside triphosphates.
45. A kit according to any of claims 41-44 wherein said kit is provided with instructions for the preparation of single stranded template nucleic acid.
46. A method for the isolation of a nucleic acid complex comprising the steps: i) providing a nucleic acid complex according to claim 21 wherein at least one single stranded nucleic acid template comprising said complex is provided with a nucleic acid sequence affinity tag that allows the selection of complexes by affinity purification; and ii) contacting said tagged complex with an affinity column.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0515413A GB0515413D0 (en) | 2005-07-27 | 2005-07-27 | DNA structures |
| GB0515413.3 | 2005-07-27 | ||
| GB0602625A GB0602625D0 (en) | 2006-02-09 | 2006-02-09 | DNA structures |
| GB0602625.6 | 2006-02-09 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007012807A2 true WO2007012807A2 (en) | 2007-02-01 |
| WO2007012807A3 WO2007012807A3 (en) | 2007-04-19 |
Family
ID=37487688
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2006/002606 Ceased WO2007012807A2 (en) | 2005-07-27 | 2006-07-13 | Dna structures |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2007012807A2 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011133695A3 (en) * | 2010-04-20 | 2012-03-29 | Swift Biosciences, Inc. | Materials and methods for nucleic acid fractionation by solid phase entrapment and enzyme-mediated detachment |
| WO2015008091A1 (en) * | 2013-07-19 | 2015-01-22 | Atlas Genetics Limited | Modified primers for nucleic acid amplification and detection |
| WO2016144755A1 (en) * | 2015-03-07 | 2016-09-15 | President And Fellows Of Harvard College | Single-stranded dna nanostructures |
| US9796749B2 (en) | 2011-08-05 | 2017-10-24 | President And Fellows Of Harvard College | Compositions and methods relating to nucleic acid nano- and micro-technology |
| US9975916B2 (en) | 2012-11-06 | 2018-05-22 | President And Fellows Of Harvard College | Compositions and methods relating to complex nucleic acid nanostructures |
| US10099920B2 (en) | 2014-05-22 | 2018-10-16 | President And Fellows Of Harvard College | Scalable nucleic acid-based nanofabrication |
| US10604543B2 (en) | 2012-07-24 | 2020-03-31 | President And Fellows Of Harvard College | Self-assembly of nucleic acid nanostructures |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6261779B1 (en) * | 1998-11-10 | 2001-07-17 | Bio-Pixels Ltd. | Nanocrystals having polynucleotide strands and their use to form dendrimers in a signal amplification system |
| US6815167B2 (en) * | 2002-04-25 | 2004-11-09 | Geneohm Sciences | Amplification of DNA to produce single-stranded product of defined sequence and length |
-
2006
- 2006-07-13 WO PCT/GB2006/002606 patent/WO2007012807A2/en not_active Ceased
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011133695A3 (en) * | 2010-04-20 | 2012-03-29 | Swift Biosciences, Inc. | Materials and methods for nucleic acid fractionation by solid phase entrapment and enzyme-mediated detachment |
| US9796749B2 (en) | 2011-08-05 | 2017-10-24 | President And Fellows Of Harvard College | Compositions and methods relating to nucleic acid nano- and micro-technology |
| US10604543B2 (en) | 2012-07-24 | 2020-03-31 | President And Fellows Of Harvard College | Self-assembly of nucleic acid nanostructures |
| US9975916B2 (en) | 2012-11-06 | 2018-05-22 | President And Fellows Of Harvard College | Compositions and methods relating to complex nucleic acid nanostructures |
| WO2015008091A1 (en) * | 2013-07-19 | 2015-01-22 | Atlas Genetics Limited | Modified primers for nucleic acid amplification and detection |
| US11180798B2 (en) | 2013-07-19 | 2021-11-23 | Binx Health Limited | Modified primers for nucleic acid amplification and detection |
| US12275990B2 (en) | 2013-07-19 | 2025-04-15 | Binx Health Limited | Modified primers for nucleic acid amplification and detection |
| US10099920B2 (en) | 2014-05-22 | 2018-10-16 | President And Fellows Of Harvard College | Scalable nucleic acid-based nanofabrication |
| WO2016144755A1 (en) * | 2015-03-07 | 2016-09-15 | President And Fellows Of Harvard College | Single-stranded dna nanostructures |
| US10550145B2 (en) | 2015-03-07 | 2020-02-04 | President And Fellows Of Harvard College | Single-stranded DNA nanostructures |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007012807A3 (en) | 2007-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Russell et al. | Gold nanowire based electrical DNA detection using rolling circle amplification | |
| CN110088299B (en) | Nucleic acid detection methods guided by nanopores | |
| Zhao et al. | Isothermal amplification of nucleic acids | |
| US9803236B2 (en) | Microarray-based assay integrated with particles for analyzing molecular interactions | |
| Wang et al. | Ultrasensitive electrochemical DNA biosensor based on a label-free assembling strategy using a triblock polyA DNA probe | |
| US20080287668A1 (en) | Nanostructures and methods of making | |
| Ohayon et al. | Covalent linkage of one-dimensional DNA arrays bonded by paranemic cohesion | |
| ES2981331T3 (en) | Methods for detecting target polynucleotides | |
| JPH07503370A (en) | A method for denaturing a nucleic acid-containing solution by electrochemical treatment, and an amplification method, replication method, detection method, and kit using such a denaturation method. | |
| JP2010521142A (en) | Gene expression assay | |
| Zheng et al. | Ultrastable bimolecular G-quadruplexes programmed DNA nanoassemblies for reconfigurable biomimetic DNAzymes | |
| JP2004536317A (en) | Sorting and immobilization systems for nucleic acids using synthetic binding systems | |
| Li et al. | Graphene nanoprobes for real-time monitoring of isothermal nucleic acid amplification | |
| JP2002534097A5 (en) | ||
| Capek | DNA engineered noble metal nanoparticles: Fundamentals and state-of-the-art of nanobiotechnology | |
| Mariconti et al. | Enzymatically active DNA-protein nanogels with tunable cross-linking density | |
| Russell et al. | Formation of silver nanostructures by rolling circle amplification using boranephosphonate-modified nucleotides | |
| WO2007012807A2 (en) | Dna structures | |
| Moll et al. | Grouping of ferritin and gold nanoparticles conjugated to pRNA of the phage phi29 DNA-packaging motor | |
| KR100482718B1 (en) | Nucleic Acid Probe-Immobilized Substrate and Method of Detecting the Presence of Target Nucleic Acid by Using the Same | |
| Niemeyer et al. | Supramolecular DNA-streptavidin nanocircles with a covalently attached oligonucleotide moiety | |
| Di Giusto et al. | Special-purpose modifications and immobilized functional nucleic acids for biomolecular interactions | |
| Wind et al. | Integrating DNA with Functional Nanomaterials | |
| Lyonnais et al. | A three-branched DNA template for carbon nanotube self-assembly into nanodevice configuration | |
| JP2003511660A (en) | Electrochemiluminescence helicase assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 06764955 Country of ref document: EP Kind code of ref document: A2 |