WO2006133898A2 - Improved biosyntetic production of 2, 3-trans-chd - Google Patents
Improved biosyntetic production of 2, 3-trans-chd Download PDFInfo
- Publication number
- WO2006133898A2 WO2006133898A2 PCT/EP2006/005664 EP2006005664W WO2006133898A2 WO 2006133898 A2 WO2006133898 A2 WO 2006133898A2 EP 2006005664 W EP2006005664 W EP 2006005664W WO 2006133898 A2 WO2006133898 A2 WO 2006133898A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- chd
- microorganism
- trans
- escherichia
- glucose dehydrogenase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
Definitions
- the present invention relates to an improved process for the biosynthetic production of [5S,6S]-5,6-dihydroxycyclohexa-1 ,3-diene-1-carboxylic acid (2,3-fra/?s-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase.
- Biosynthetic syntheses in general, are processes wherein at least one enzymatic reaction step is taking place. When such processes occur in living microorganisms, the process is called an "in vivo" process.
- the term "increased activity" means that the level of a specific enzyme activity is increased to a level of activity above the level of such activity naturally existing in said microorganism under identical conditions. It will be understood that such increased level of enzyme activity can be achieved by all means known to the skilled man, for instance by overexpression of the corresponding gene.
- 2,3-trans-CHD is (S,S)-2,3-dihydroxy-2,3- dihydrobenzoic acid.
- 2,3-frans-CHD is an intermediate in the biosynthetic pathway to enterobactin (for instance in Escherichia coli), and can be used as a building block for the synthesis of a large variety of other molecules due to the fact that the 2,3-frans-CHD molecule contains two chiral C-atoms, two double bonds, two hydroxyl groups and a carboxylic group.
- 2,3-trans-CHD is one of the metabolic pathway products derived from chorismate via the intermediacy of isochorismate.
- Biosynthetic production of 2,3-frans-CHD has been described in WO 02/18611 where this biosynthesis (in casu a fermentation process) occurs in Escherichia coli strains that are deficient in 2,3-dihydroxybenzoate synthase (an enzyme coded for by the gene entA). It is shown in WO 02/18611, that 2,3- ⁇ ans-CHD can be produced in amounts of up to about 4,6 g/l.
- the term "substantially free of gluconate” means that the gluconate concentration in the fermentation supernatant will be at most 1 g/l, preferably at most 0,5 g/l. and most preferably at most 0,1 g/l.
- the present invention also relates to a source for an alternative (and thusfar unknown) co-factor for PQQ-dependent enzymes (pyrroloquinoline quinone dependent enzymes).
- PQQ-dependent enzymes are enzymes which depend on PQQ as co-factor to achieve full enzymatic activity.
- the term PQQ-dependent enzymes is a term well-known to the skilled man. E.g.
- the present inventors now surprisingly have found an improved process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase, wherein the process is carried out in a chorismate overproducing host microorganism also having decreased glucose dehydrogenase activity, or is carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity.
- the 2,3-trans-CHD obtained by the improved, high yield (i.e. at a titer higher than about 10-12 g/l), process according to the invention is substantially free of gluconate.
- Chorismate producing microorganisms generally are microorganisms wherein first shikimate is being formed via any of the known shikimate biosynthetic pathways. Further conversion of shikimate formed into chorismate takes place by means of phosphorylation, addition of a further pyruvate group and dephosphorylation. In fact, this full biosynthetic reaction sequence forms part of the aromatic amino acid pathway.
- Chorismate overproducing host organisms are host organisms that, due to genetic modification of their basic metabolism, are capable of giving increased biosynthetic production of chorismate. Such host organisms, for instance (and preferably) have been engineered by a combination of the following measures: deletion of the tyrA and pheA genes, insertion of the aroF ⁇ ' gene (feed-back-resistant DAHP), and/or overexpression of aroFBL genes. The skilled man can easily assess whether a host strain is a suitable chorismate overproducer, or not.
- Glucose dehydrogenase activity is the enzymatic activity required for the conversion of glucose into gluconate. As mentioned above, in Escherichia cells this enzymatic conversion requires PQQ (pyrroloquinoline quinone) as co-factor. Decreased glucose dehydrogenase activity means that - when PQQ is being added - the (modified, decreased) glucose dehydrogenase activity is lower than the activity of the said (unmodified) glucose dehydrogenase in its natural surroundings when PQQ is being added.
- the enzyme causing glucose dehydrogenase activity in Escherichia is the so- called Gdh protein. It is coded for by the gcd gene.
- the glucose dehydrogenase gene gcd is coding for the apoenzyme of the PQQ dependent glucose dehydrogenase enzyme. Accordingly, the term gcd gene is intended to encompass any gene coding for the function (and/or the apoenzyme) of a PQQ dependent glucose dehydrogenase enzyme.
- the process of the present invention can also be carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity.
- Determining the glucose dehydrogenase activity can be done as described by Velterop et a/., Journal of Bacteriology Vol.177, p. 5088-5098 (1995), or likewise by Cozier ef a/., Biochemical Journal, Vol.340, p.639-647 (1999).
- the coupled reaction of gluconate kinase and phosphogluconate dehydrogenase can be used. See Moellering, H. & Bergmeyer, H.
- the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by lowering the expression of the glucose dehydrogenase gene gcd in the said microorganism.
- mutant gcd genes can be applied that, for instance, result in providing enzymes that are substituted near the active center by one or more bulky, or positively or negatively charged, groups and that thereby have strongly lowered or even totally switched-off glucose dehydrogenase activity.
- the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by deletion of the glucose dehydrogenase gene gcd from the said microorganism, or by switching-off the activation of said gene by any means known to the skilled man, so as to obtain a gcd negative (gcd ' ) microorganism.
- gcd negative (gcd ' ) microorganism indicates that there is no expression of the gcd gene in the microorganism.
- the activity level of the glucose dehydrogenase enzyme in the microorganism is about zero, and is thus very much lower than the activity level of said enzyme naturally existing in said microorganism under identical conditions.
- Deletion (disruption) of the glucose dehydrogenase gene gcd from the microorganism can be done very efficiently by the method described by Datsenko, K.A. and Wanner, B.L, Proc. Natl. Acad. Sci. USA, 97, p. 6640-6645, 2000, followed by subsequent deletion of the antibiotic resistance cassette.
- the increased activity of isochorismate synthase and isochorismatase is preferably obtained by overexpression of the genes entB and entC and/or overexpression of the genes entB and menF from an Escherichia strain, preferably from an Escherichia coli strain.
- the one or more overexpressed genes from the group of aroFBL genes, and/or the overexpressed genes entB and entC and/or the overexpressed genes entB and menF are under control of an inducible promoter, for instance, of the IPTG-inducible promoter Ptac.
- an inducible promoter for instance, of the IPTG-inducible promoter Ptac.
- any further known genetic measure or measures, that can be applied singly or in combination for increasing the carbon flux into and through the aromatic biosynthesis pathway can suitably applied for achieving further improvement of the process according to the present invention.
- the Escherichia microorganism contains one or more overexpressed genes from the group of aroFBL genes from an Escherichia strain.
- the one or more overexpressed genes from the group of aroFBL genes are obtained by overexpression of such genes from an Escherichia strain, preferably from an Escherichia coli strain. Accordingly, these overexpressed genes are homologous to the host strains used in the process according to the present invention.
- the Escherichia microorganism used as host microorganism in the process of the present invention is an Escherichia coli microorganism.
- source for as used herein with respect to the supernatant means that the supernatant can be used as such, i.e. without any further treatment, or that the supernatant can first be treated, for instance by means of a concentration step or purification step, before being used as an alternative for PQQ as co-factor.
- this embodiment of the present invention relates to the use of the supernatant of a process for the biosynthetic production of [5S,6S]-5,6-dihydroxy- cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) where the concentration of 2,3-trans-CHD in the process has arrived at a concentration of at least 12 g/l as a source for a co-factor for PQQ dependent enzymes.
- Standard molecular cloning techniques such as plasmid DNA isolation, gel electrophoresis, enzymatic restriction modification of nucleic acids, E. coli transformation etc. were performed as described by Sambrook et al., 1989, "Molecular Cloning: a laboratory manual", Cold spring Harbor Laboratories, Cold Spring Harbor, NY. Synthetic oligonucleotides were obtained from MWG-Biotech AG (Ebersberg, Germany). DNA sequence analyses were performed by GATC Biotech AG (Konstanz, Germany) and AGOWA GmbH (Berlin, Germany).
- plasmid pJF119EH As expression vector for the 2,3-CHD biosynthesis genes, plasmid pJF119EH was chosen (F ⁇ rste, et al. (1986) Gene, 48:119-131).
- the expression system uses the IPTG inducible tac promoter and carries the lac repressor (/acl q gene), which keeps the expression of the cloned foreign gene in the absence of the inducer extremely low.
- Genomic DNA was prepared from E. coli W3110 strain LJ110 (Zeppenfeld etal. (2000) J.Bacteriol., 182: 4443-4452).
- a 1213 bp DNA-fragment comprising the gene aroF for the DAHP synthase (tyr) was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 5872-6942 of accession number AE000346; amplified region nucleotides 5786-6965) using the following primers:
- DNA-fragment Correct size of the amplified DNA-fragment was confirmed by agarose gel electrophoresis and the DNA-fragment was purified from the gel.
- the DNA-fragment and the plasmid pJF119EH were restricted with the restriction enzymes EcoRI and Sma ⁇ .
- the two DNA-fragments were subsequently ligated and used for the transformation of chemically competent cells of E. coli DH5 ⁇ (Invitrogen GmbH, Düsseldorf, Germany).
- the transformants were selected on LB agar plates containing 100 rng-l "1 ampicillin.
- a plasmid showing the correct insert sequence (as confirmed by sequencing) was called pJF119EH- aroF.
- a 1151 bp DNA-fragment comprising the gene aroB for the 3- dehydroquinate synthase was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 6410-7498 of accession number AE000414; amplified region nucleotides
- Transformants were selected on LB agar plates containing 100 mgT 1 ampicillin.
- a plasmid showing the correct insert sequence (as confirmed by sequencing) was called pJF119EH-aroF-aroS.
- a 600 bp DNA-fragment comprising the gene aroL for the shikimate kinase Il was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 5281-
- a 2124 bp DNA-fragment comprising the genes entC and entB for the isochorismate synthase and isochorismatase of E. coli was amplified by PCR from plasmid pDF3 (Franke et al. (2003) Chem.Eur.J., 9: 4188-4196) using the following primers: 5' - CCCAGATCTTTATCATTTTGTGGAGGATGA - 3' [SEQ ID: No. 7]
- Transformants were selected on LB agar plates containing 100 mgT 1 ampicillin.
- the inactivation cassette was amplified by PCR from the plasmid pKD4 using the following primers:
- a strain carrying the deletion of the pheA-tyrA-aroF gene locus was designated F4. Due to the deletion of the genes tyrA (chorismate mutase/prephenate dehydrogenase) and pheA (chorismate mutase/prephenate dehydratase) the strain F4 is auxotrophic for the amino acids L-tyrosine and L-phenylalanine.
- the inactivation cassette was amplified by PCR from the plasmid pKD3 using the following primers:
- F82 An F4 derivative carrying the deletion of the entC-entE-entB-entA operon was designated F82. Transformation of chemically competent cells of the strain F82 with the plasmid pC20 resulted in the 2,3-CHD production strain F82/pC20.
- the inactivation cassette was amplified by PCR from the plasmid pKD3 using the following primers:
- F111 An F82 derivative carrying the inactivation of the gcd gene was designated F111. Transformation of chemically competent cells of the strain F111 with the plasmid pC20 resulted in the 2,3-CHD production strain F111/pC20. Comparative Example A: Fermentative production of mixture of 2.3-CHD and gluconate in fed-batch bioreactor using a host microorganism not having decreased glucose dehydrogenase activity
- the 2,3-CHD production of E. coli F82/pC20 from glucose was investigated in mineral medium.
- the precultivation medium consisted of MgSO 4 -7H 2 O (0,3 g-r 1 ), CaCI 2 -2H 2 O (0,015 g l "1 ), KH 2 PO 4 (3,0 g l "1 ), K 2 HPO 4 (12,0 g-r 1 ), NaCI (0,1 g-l "1 ), (NH 4 ) 2 SO 4 (5,0 g-r 1 ), FeSO 4 -7H 2 O (0,075 g-r 1 ), Na-citrate-3H 2 0 (1 ,0 g-r 1 ), thiamine-HCI (0,0125 g-r 1 ), L-tyrosine (0,08 g-l "1 ), and L-phenylalanine (0,08 g-l '1 ).
- trace element solution (1,0 mi l "1 ), which trace element solution was composed of AI 2 (SO 4 J 3 - 18H 2 O (2,0 g-r 1 ), CoCI 2 -6H 2 O (0,75 g-r 1 ), CuSO 4 -5H 2 O (2,5 g-r 1 ), H 3 BO 3 (0,5 g-r 1 ), MnCI 2 -4H 2 O (20,0 g-r 1 ) Na 2 Mo0 4 -2H 2 0 (3,0 g-l "1 ), NiSO 4 -6H 2 O (20 g-r 1 ), ZnSO 4 -7H 2 O (15,0 g-l "1 ).
- a glucose stock solution 500 g-l "1 ) was autoclaved separately and added to the sterilized medium to a final concentration of 5 g-l "1 .
- the stock culture of E. coli F82/pC20 was stored at -80 0 C in Luria- Bertani (LB) medium containing 50% glycerol. 1 ml feedstock was used to inoculate 200 ml of precultivation medium containing ampicillin (100 mg-l "1 ) split in two 1 I shaking flasks and incubated at 37°C and 180 rpm for 16 hours.
- LB Luria- Bertani
- the fermentation medium was the same as for precultivation except for the following changes: MgSO 4 -7H 2 O (3,0 g-l "1 ), K 2 HPO 4 was omitted, FeSO 4 -7H 2 O (0,1125 g-l "1 ), Na-citrate-3H 2 0 (1 ,5 g-r 1 ), thiamine-HCI (0,075 g-l "1 ), NaCI (1 g-r 1 ), L-tyrosine
- Example 3 Fermentative production of qluconate-free 2,3-CHD in fed-batch bioreactor using a host microorganism having decreased glucose dehydrogenase activity
- the precultivation of the 2,3-CHD production strain F111/pC20 was performed as described in comparative example A.
- the supernatant was analyzed for 2,3-CHD by 1 H-NMR and the amount present was determined to be 21 ,9 g-l "1 . Gluconate could not be detected. Besides said amount of 2,3-CHD, acetate was found to be present in concentration of 1 ,1 gT 1 as determined by HPLC analysis.
- Example 4 (and comparative Example B): Use of supernatant of process for the biosynthetic production of f5S,6S1-5,6-dihydroxy-cvclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) as a source of a co-factor for PQQ dependent enzymes
- a single colony of the E. coli LJ110 was used to inoculate 100 ml of LB medium. Cells were grown at 3O 0 C with 180 rpm for 15h. At OD 546nm 4.7, the cells were harvested. After washing the cells with 50 mM potassium phosphate buffer, pH 6.5, the cells were resuspended in 8 ml of the same buffer (approx. OD 546nrn 59) for the determination of gluconate formation as measure of glucose dehydrogenase activity in whole resting cells.
Abstract
The invention relates to a process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1,3-diene-1-carboxylic acid (2,3-trans-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase, wherein the process is carried out in a chorismate overproducing host microorganism also having decreased glucose dehydrogenase activity, or is carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity. In this improved biosynthetic process, 2,3-trans-CHD is being produced in high yields and at concentrations in the biosynthetic reaction medium of at least 12 g/l. The invention further relates to the use of the supernatant of a process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1,3-diene-1-carboxylic acid (2,3-trans-CHD) where the concentration of 2,3-trans-CHD in the process has arrived at a concentration of at least 12 g/l as a source for a co-factor for PQQ dependent enzymes.
Description
IMPROVED BIOSYNTHETIC PRODUCTION OF rδS.eSI-δ.β-DIHYDROXYCYCLOHEXA-i .3-DIENE-I -CARBOXYLIC ACID
(2,3-frans-CHD)
The present invention relates to an improved process for the biosynthetic production of [5S,6S]-5,6-dihydroxycyclohexa-1 ,3-diene-1-carboxylic acid (2,3-fra/?s-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase. Biosynthetic syntheses, in general, are processes wherein at least one enzymatic reaction step is taking place. When such processes occur in living microorganisms, the process is called an "in vivo" process. As meant herein, the term "increased activity" (of an enzyme) means that the level of a specific enzyme activity is increased to a level of activity above the level of such activity naturally existing in said microorganism under identical conditions. It will be understood that such increased level of enzyme activity can be achieved by all means known to the skilled man, for instance by overexpression of the corresponding gene.
Another name for 2,3-trans-CHD is (S,S)-2,3-dihydroxy-2,3- dihydrobenzoic acid. 2,3-frans-CHD is an intermediate in the biosynthetic pathway to enterobactin (for instance in Escherichia coli), and can be used as a building block for the synthesis of a large variety of other molecules due to the fact that the 2,3-frans-CHD molecule contains two chiral C-atoms, two double bonds, two hydroxyl groups and a carboxylic group.
2,3-trans-CHD is one of the metabolic pathway products derived from chorismate via the intermediacy of isochorismate. Biosynthetic production of 2,3-frans-CHD has been described in WO 02/18611 where this biosynthesis (in casu a fermentation process) occurs in Escherichia coli strains that are deficient in 2,3-dihydroxybenzoate synthase (an enzyme coded for by the gene entA). It is shown in WO 02/18611, that 2,3-^ans-CHD can be produced in amounts of up to about 4,6 g/l. The transformation from chorismate into 2,3-frans-CHD occurs by means of two enzymes: isochorismate synthase (coded by the gene entC) and isochorismatase (coded by the gene entB). The known process for the biosynthetic production of 2,3-frans-CHD as described in WO 02/18611 , at the 2,3-trans-CUD concentration levels obtained therein,
does not pose real problems, except for the fact that the titers obtained in this process are considered to be still quite low if a commercially attractive process is envisaged. Accordingly, there is need for finding possibilities for increasing the titer and yield of 2,3-trans-CHD in the biosynthetic production process. It has been demonstrated in further, but (except for some unrevealing general remarks in a lecture of Bujnicki et a/., at the October 12-14, 2004 Dechema Annual Meeting at Karlsruhe, as will be discussed hereinafter) yet unpublished, studies of the present inventors regarding the biosynthetic production of 2,3-trans-CHD, that the yields of 2,3-trans-CHD, as achievable by the methods of WO 02/18611 , indeed could be further improved substantially by performing the biosynthesis in Escherichia strains, more particularly in Escherichia coli strains, with additionally overexpressed aroFBL genes. This indeed resulted in a strong increase of the concentration level of 2,3-trans-CHD, but simultaneously the disadvantage was found that production of 2,3-trans-CHD at relatively high concentrations (i.e. when concentration of 2,3-trans-CHD has reached about at least 12 g/l) is accompanied by strong gluconate by-product formation from the glucose used as carbon source for the fermentation, which by-product formation increases as concentration of 2,3-trans-CHD becomes higher. Evidently, such by-product formation lowers the yield of 2,3-trans-CHD on glucose consumed. For further use of 2,3-trans-CHD in the production of derivatives thereof it is, moreover, highly disadvantageous if the 2,3-trans-CHD is contaminated with gluconate.
Purifying 2,3-tøans-CHD from the by-product gluconate is troublesome and would require, for instance, repeated recrystallisations, because other types of purification processes (e.g. anionic adsorption, reactive extraction or electrodialysis) would have quite indiscriminating affinity for both the gluconate by-product and the desired product 2,3-trans-CHD. Accordingly, and this is the aim of the present invention, there is need for finding possibilities for increasing the titer and yield of 2,3-trans-CHD in the biosynthetic production process whilst avoiding gluconate by-product formation and leading to 2,3-trans-CHD substantially free of gluconate, so that no such further purification steps are required. As meant herein, the term "substantially free of gluconate" means that the gluconate concentration in the fermentation supernatant will be at most 1 g/l, preferably at most 0,5 g/l. and most preferably at most 0,1 g/l.
The present invention also relates to a source for an alternative (and thusfar unknown) co-factor for PQQ-dependent enzymes (pyrroloquinoline quinone dependent enzymes). PQQ-dependent enzymes are enzymes which depend on PQQ as co-factor to achieve full enzymatic activity. The term PQQ-dependent enzymes is a term well-known to the skilled man. E.g. see Oubrie, A., et al., Protein Science, 2000, Vol.9, p.1265-1273 ; Laurinavicius, V., Bioelectrochem., 2002, Vol.55, p.29-32 ; Oubrie, A., Biochimica Biophysica Acta - Proteins and Proteomics, 2003, Vol.1647, p.143-151.
The present inventors now surprisingly have found an improved process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase, wherein the process is carried out in a chorismate overproducing host microorganism also having decreased glucose dehydrogenase activity, or is carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity.
The 2,3-trans-CHD obtained by the improved, high yield (i.e. at a titer higher than about 10-12 g/l), process according to the invention is substantially free of gluconate.
It is first of all to be noted, that it is completely unexpected that 2,3-trans-CHD biosynthesis is accompanied by gluconate formation. Gluconate formation in microorganisms such as E. coli is known to occur (periplasmically) under the influence of a membrane bound, and PQQ (pyrroloquinoline quinone) dependent, glucose dehydrogenase enzyme (Gdh), but only if PQQ is added. This can be seen from a number of references: for instance, Hommes, R.W. et al., FEMS Microbiol. Lett., Vol.24, p.329- 333, 1984; Ameyama, M. et al., Agric. Biol. Chem., Vol.50, p.49-57, 1986; Hommes, R.W. et al., Antonie van Leeuwenhoek, Vol.60, p.373-382, 1991. From the said literature it would follow that, without addition of PQQ, no gluconate formation takes place from glucose in E. coli cells. Goldstein, A. et al., Biochim. Biophys. Acta, 1647, p.266-271 (2003), however, suggests that inducible PQQ biosynthesis might be taking place, the induction being caused by expression of heterologous genes. In the process for the biosynthesis of 2,3-trans-CHD according to the present invention no PQQ is being added at all, nor have any heterologous genes been expressed. Nevertheless, gluconate
formation is observed in biosynthesis of 2,3-frans-CHD at high titers thereof, if the process is not carried out according to the process of the present invention. Such strong formation of gluconate is not only unexpected, but also undesirable. Increased levels of gluconate in the fermentation broth are, for instance, likely to be causing osmotic stress for the host cells, and thereby have a negative effect on growth and/or product formation, and thus also on the maximum obtainable amount of 2,3-trans-CHD to be formed.
It is further noted, that the high yield biosynthetic production of 2,3-trans-CHD already has been presented in the aforementioned lecture at the 12-14 October 2004 Dechema Annual meeting at Karlsruhe, Germany. The abstract of said presentation is reported in Chemie lngenieur Technik, 2004, vol.76, A-14 at page 1239 (Bujnicki, R., et a/.). The abstract and the presentation, however, only addressed the reactor configuration for the development of a fed-batch process and integration with reactive extraction. It did not address any details of byproducts formed nor of the configuration of the strain used with respect to the measures to be taken for avoiding the byproduct formation according to the present invention.
According to the (in vivo) biosynthetic process of the present invention not only very high titers of 2,3-trans-CHD are achieved (of about up to 20 g/l), but also at high conversion yields from glucose and without substantial gluconate by-product formation. It is thereby avoided that glucose import, by means of the microorganism's phosphotransferase system (PTS system), into the cells is lowered because of the periplasmatic conversion into gluconate, which unexpectedly occurs without addition of PQQ and without expression of heterologous genes.
Chorismate producing microorganisms generally are microorganisms wherein first shikimate is being formed via any of the known shikimate biosynthetic pathways. Further conversion of shikimate formed into chorismate takes place by means of phosphorylation, addition of a further pyruvate group and dephosphorylation. In fact, this full biosynthetic reaction sequence forms part of the aromatic amino acid pathway.
Chorismate overproducing host organisms are host organisms that, due to genetic modification of their basic metabolism, are capable of giving increased biosynthetic production of chorismate. Such host organisms, for instance (and preferably) have been engineered by a combination of the following measures: deletion of the tyrA and pheA genes, insertion of the aroF^' gene (feed-back-resistant DAHP), and/or
overexpression of aroFBL genes. The skilled man can easily assess whether a host strain is a suitable chorismate overproducer, or not.
Glucose dehydrogenase activity is the enzymatic activity required for the conversion of glucose into gluconate. As mentioned above, in Escherichia cells this enzymatic conversion requires PQQ (pyrroloquinoline quinone) as co-factor. Decreased glucose dehydrogenase activity means that - when PQQ is being added - the (modified, decreased) glucose dehydrogenase activity is lower than the activity of the said (unmodified) glucose dehydrogenase in its natural surroundings when PQQ is being added. The enzyme causing glucose dehydrogenase activity in Escherichia is the so- called Gdh protein. It is coded for by the gcd gene. More particularly, the glucose dehydrogenase gene gcd is coding for the apoenzyme of the PQQ dependent glucose dehydrogenase enzyme. Accordingly, the term gcd gene is intended to encompass any gene coding for the function (and/or the apoenzyme) of a PQQ dependent glucose dehydrogenase enzyme. Instead of being carried out in a chorismate overproducing host microorganism having decreased glucose dehydrogenase activity, the process of the present invention can also be carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity.
Determining the glucose dehydrogenase activity (and assessing whether glucose dehydrogenase activity is decreased or not) can be done as described by Velterop et a/., Journal of Bacteriology Vol.177, p. 5088-5098 (1995), or likewise by Cozier ef a/., Biochemical Journal, Vol.340, p.639-647 (1999). In alternative method for determining the level glucose dehydrogenase activity (and for assessing whether the glucose dehydrogenase activity is decreased or not) the coupled reaction of gluconate kinase and phosphogluconate dehydrogenase can be used. See Moellering, H. & Bergmeyer, H. U., in Methods of Enzymatic Analysis (Bergmeyer, H.U. ed.), 3rd ed., VoI Vl, pp.220-227, VCH Weinheim, Germany (1988). Needless to say, that all such comparative activity assessments, for each comparison as such, are to be performed under identical conditions as to growth and media used.
Preferably, the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by lowering the expression of the glucose dehydrogenase gene gcd in the said microorganism.
Alternatively, and deemed to be encompassed by the general term of
"lowering the expression" (i.e. leading to "less active glucose dehydrogenase enzymes"), also mutant gcd genes can be applied that, for instance, result in providing enzymes that are substituted near the active center by one or more bulky, or positively or negatively charged, groups and that thereby have strongly lowered or even totally switched-off glucose dehydrogenase activity.
It is especially preferred that the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by deletion of the glucose dehydrogenase gene gcd from the said microorganism, or by switching-off the activation of said gene by any means known to the skilled man, so as to obtain a gcd negative (gcd') microorganism.
As meant herein the term "gcd negative" (gcd') microorganism indicates that there is no expression of the gcd gene in the microorganism. As a result the activity level of the glucose dehydrogenase enzyme in the microorganism, even when PQQ is being added, is about zero, and is thus very much lower than the activity level of said enzyme naturally existing in said microorganism under identical conditions.
Deletion (disruption) of the glucose dehydrogenase gene gcd from the microorganism can be done very efficiently by the method described by Datsenko, K.A. and Wanner, B.L, Proc. Natl. Acad. Sci. USA, 97, p. 6640-6645, 2000, followed by subsequent deletion of the antibiotic resistance cassette. In the biosynthetic process according to the invention, the increased activity of isochorismate synthase and isochorismatase is preferably obtained by overexpression of the genes entB and entC and/or overexpression of the genes entB and menF from an Escherichia strain, preferably from an Escherichia coli strain.
It is especially preferred that the one or more overexpressed genes from the group of aroFBL genes, and/or the overexpressed genes entB and entC and/or the overexpressed genes entB and menF, are under control of an inducible promoter, for instance, of the IPTG-inducible promoter Ptac. However, any further known genetic measure or measures, that can be applied singly or in combination for increasing the carbon flux into and through the aromatic biosynthesis pathway, can suitably applied for achieving further improvement of the process according to the present invention.
Preferably, the Escherichia microorganism contains one or more overexpressed genes from the group of aroFBL genes from an Escherichia strain.
The one or more overexpressed genes from the group of aroFBL genes are obtained by overexpression of such genes from an Escherichia strain, preferably from an Escherichia coli strain. Accordingly, these overexpressed genes are homologous to the host strains used in the process according to the present invention. Preferably, the Escherichia microorganism used as host microorganism in the process of the present invention is an Escherichia coli microorganism.
Recovery of the [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) formed in the process of the present invention can be carried out by any means known to the skilled man. Most preferably, however, the [5S,6S]-5,6-dihydroxy- cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) formed in the process is separated from the microorganism biomass by in situ product recovery (ISPR). Suitable methods for ISPR are described in, for instance, EP-B-1181089 (using membranes) or in WO-03/092853 (using centrifuges).
Without being bound to any scientific theory or concept, the present inventors conclude from their observations in the improved biosynthesis of
[5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) according to the present invention, that the supernatant of this biosynthetic process surprisingly contains one or more products, other than PQQ, that can act as co-factor for PQQ- dependent enzymes. Accordingly, a further embodiment of the present invention is based on this observation, which can find important industrial use in all kinds of processes where PQQ dependent enzymes are involved. This embodiment of the present invention, thus, relates to a source for an alternative (and thus far unknown) co-factor for PQQ-dependent enzymes. The term "source for ..." as used herein with respect to the supernatant means that the supernatant can be used as such, i.e. without any further treatment, or that the supernatant can first be treated, for instance by means of a concentration step or purification step, before being used as an alternative for PQQ as co-factor.
In particular, this embodiment of the present invention relates to the use of the supernatant of a process for the biosynthetic production of [5S,6S]-5,6-dihydroxy- cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) where the concentration of 2,3-trans-CHD in the process has arrived at a concentration of at least 12 g/l as a source for a co-factor for PQQ dependent enzymes.
The invention is further elucidated by means of the following examples
and comparative examples. The examples, however, are by no means intended to restrict the scope of the claims.
Experimental part
General procedures for Examples 1 and 2
Standard molecular cloning techniques such as plasmid DNA isolation, gel electrophoresis, enzymatic restriction modification of nucleic acids, E. coli transformation etc. were performed as described by Sambrook et al., 1989, "Molecular Cloning: a laboratory manual", Cold spring Harbor Laboratories, Cold Spring Harbor, NY. Synthetic oligonucleotides were obtained from MWG-Biotech AG (Ebersberg, Germany). DNA sequence analyses were performed by GATC Biotech AG (Konstanz, Germany) and AGOWA GmbH (Berlin, Germany).
Example 1 : Construction of plasmid pC20
As expression vector for the 2,3-CHD biosynthesis genes, plasmid pJF119EH was chosen (Fϋrste, et al. (1986) Gene, 48:119-131). The expression system uses the IPTG inducible tac promoter and carries the lac repressor (/aclq gene), which keeps the expression of the cloned foreign gene in the absence of the inducer extremely low.
Genomic DNA was prepared from E. coli W3110 strain LJ110 (Zeppenfeld etal. (2000) J.Bacteriol., 182: 4443-4452). A 1213 bp DNA-fragment comprising the gene aroF for the DAHP synthase (tyr) was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 5872-6942 of accession number AE000346; amplified region nucleotides 5786-6965) using the following primers:
51 - CTATCGAATTCGAGCATAAACAGGATCGCC - 3' [SEQ ID: No. 1] (with EcoRI recognition site underlined) and
5' - CACTTCAGCAACCAGTTCCCGGGGCTTCGC - 31 [SEQ ID: No. 2] (with Smal recognition site underlined). A list of all nucleotide sequences used in the context of the present application is presented in the SEQUENCE LISTING annexed hereto.
Correct size of the amplified DNA-fragment was confirmed by agarose
gel electrophoresis and the DNA-fragment was purified from the gel. The DNA-fragment and the plasmid pJF119EH were restricted with the restriction enzymes EcoRI and Sma\.
The two DNA-fragments were subsequently ligated and used for the transformation of chemically competent cells of E. coli DH5α (Invitrogen GmbH, Karlsruhe, Germany). The transformants were selected on LB agar plates containing 100 rng-l"1 ampicillin. A plasmid showing the correct insert sequence (as confirmed by sequencing) was called pJF119EH- aroF.
A 1151 bp DNA-fragment comprising the gene aroB for the 3- dehydroquinate synthase was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 6410-7498 of accession number AE000414; amplified region nucleotides
6402-7521) using the following primers:
5' - ACTCGTCTGCGGGATCCGTAATTAAGGTGG - 31 [SEQ ID: No. 3]
(with BamH\ recognition site underlined) and
5' - AGCGGCCTAAGCTTTCTTGTTGTTACGCTG - 31 [SEQ ID: No. 4] (with Hind\\\ recognition site underlined).
Correct size of the amplified DNA-fragment was confirmed by agarose gel electrophoresis and the DNA-fragment was purified from the gel. The DNA-fragment and the plasmid pJF119EH-aroF were restricted with the restriction enzymes βamHI and
Hind\\\. The two DNA-fragments were ligated and used for the transformation of chemically competent cells of E. coli DH5α.
Transformants were selected on LB agar plates containing 100 mgT1 ampicillin. A plasmid showing the correct insert sequence (as confirmed by sequencing) was called pJF119EH-aroF-aroS.
A 600 bp DNA-fragment comprising the gene aroL for the shikimate kinase Il was amplified by PCR from E. coli LJ110 chromosomal DNA (nucleotides 5281-
5805 of accession number AE000145; amplified region nucleotides 5262-5816) using the following primers:
51 - CATGACACCGGCTTTCGCCGCATAAGCTTCTATTGG - 3' [SEQ ID: No. 5]
(with HindlU recognition site underlined) and 51 - TGAACGTTAAAAGCTTGCGCTCGAAAATCAACAATT - 3' [SEQ ID: No. 6]
(with Hind\\\ recognition site underlined).
Correct size of the amplified DNA-fragment was confirmed by agarose
gel electrophoresis and the DNA-fragment was purified from the gel. The DNA-fragment and the plasmid pJF119EH-aroF-aroS were restricted with the restriction enzyme HindWl and the linear plasmid DNA was dephosphorylated. The two DNA-fragments were ligated and used for the transformation of chemically competent cells of E. coli DH5α. Transformants were selected on LB agar plates containing 100 mg T1 ampicillin. A plasmid showing the correct insert sequence (as confirmed by sequencing) was called pJF1 "\9EH-aroF-aroB-aroL.
A 2124 bp DNA-fragment comprising the genes entC and entB for the isochorismate synthase and isochorismatase of E. coli was amplified by PCR from plasmid pDF3 (Franke et al. (2003) Chem.Eur.J., 9: 4188-4196) using the following primers: 5' - CCCAGATCTTTATCATTTTGTGGAGGATGA - 3' [SEQ ID: No. 7]
(with Bgl\ recognition site underlined) and
51 - CCCAGATCTGAAATCCATTATTTCACCTCGC - 31 [SEQ ID: No. 8]
(with βg/1 recognition site underlined). Correct size of the amplified DNA-fragment was confirmed by agarose gel electrophoresis and the DNA-fragment was purified from the gel. The DNA-fragment was restricted with the restriction enzyme Bgl\, the plasmid pJF119EH-aroF-aroB-aroL was restricted with the restriction enzyme SamHI, and the linear plasmid DNA was dephosphorylated. The two DNA-fragments were subsequently ligated and used for the transformation of chemically competent cells of E. coli DH5α.
Transformants were selected on LB agar plates containing 100 mgT1 ampicillin. A plasmid showing the correct insert sequence (as confirmed by sequencing) was called pC20 (= pJF11 ΘEH-aroF-eArfC-e/rfS-aroβ-aroL).
Example 2: Construction of host strains F82 and F111
Gene inactivations in E. coli were performed according to the procedure of Datsenko and Wanner ((2000) PNAS, 97: 6640-6645) using the plasmids pKD3 and pKD4 as templates for the inactivation cassettes. The target chromosomal locus, comprising one or more genes, is first replaced by an antibiotic resistance gene. Subsequently, the resistance gene can be eliminated leaving behind a marker-less chromosomal deletion.
In order to delete the pheA-tyrA-aroF gene locus of E. coli W3110 strain
LJ110 (T. Zeppenfeld et al., (2000) J. Bacterid., 182: 4443-4452) the inactivation cassette was amplified by PCR from the plasmid pKD4 using the following primers:
5' - AACTTCGTCGAAGAAGTTGAAGAAGAGTAGTCCTTTATATTGAGTGTATCGT-
GTAGGCTGGAGCTGCTTC- 3' [SEQ ID: No. 9] 5' - AGTGTAAATTTATCTATACAGAGGTAAGGGTTGAAAGCGCGACTAAATTGCA-
TATGAATATCCTCCTTAG- 3' [SEQ ID: No. 10]
A strain carrying the deletion of the pheA-tyrA-aroF gene locus was designated F4. Due to the deletion of the genes tyrA (chorismate mutase/prephenate dehydrogenase) and pheA (chorismate mutase/prephenate dehydratase) the strain F4 is auxotrophic for the amino acids L-tyrosine and L-phenylalanine.
In order to delete additionally the entC-entE-entB-entA operon of the strain F4 the inactivation cassette was amplified by PCR from the plasmid pKD3 using the following primers:
51 - TAAATGATAATCATTATTAAAGCCTTTATCATTTTGTGGAGGATGATATGGTG- TAGGCTGGAGCTGCTTC - 31 [SEQ ID: No. 11]
5' - TTATCGCTGGTGGCGTTCAGTTCGTCGAGCGTTAAATGGCGTTTCCAGATC-
ATATGAATATCCTCCTTAG- 31 [SEQ ID: No. 12]
An F4 derivative carrying the deletion of the entC-entE-entB-entA operon was designated F82. Transformation of chemically competent cells of the strain F82 with the plasmid pC20 resulted in the 2,3-CHD production strain F82/pC20.
In order to delete additionally the gcd gene of the strain F82 the inactivation cassette was amplified by PCR from the plasmid pKD3 using the following primers:
5' - AACAACGCGCACGTTGTCAGCAATCTGAGCAAGTCTTACTTCACATCATCGT- GTAGGCTGGAGCTGCTTC - 3' [SEQ ID: No. 13]
5' - CTATAATTAATTGCTACTAAAATATTAATGAATTGAAATGGTGTCTCTTTCATA-
TGAATATCCTCCTTAG - 3' [SEQ ID: No. 14]
An F82 derivative carrying the inactivation of the gcd gene was designated F111. Transformation of chemically competent cells of the strain F111 with the plasmid pC20 resulted in the 2,3-CHD production strain F111/pC20.
Comparative Example A: Fermentative production of mixture of 2.3-CHD and gluconate in fed-batch bioreactor using a host microorganism not having decreased glucose dehydrogenase activity
The 2,3-CHD production of E. coli F82/pC20 from glucose was investigated in mineral medium. The precultivation medium consisted of MgSO4-7H2O (0,3 g-r1), CaCI2-2H2O (0,015 g l"1), KH2PO4 (3,0 g l"1), K2HPO4 (12,0 g-r1), NaCI (0,1 g-l"1), (NH4)2SO4 (5,0 g-r1), FeSO4-7H2O (0,075 g-r1), Na-citrate-3H20 (1 ,0 g-r1), thiamine-HCI (0,0125 g-r1), L-tyrosine (0,08 g-l"1), and L-phenylalanine (0,08 g-l'1). Additional minerals were added in the form of a trace element solution (1,0 mi l"1), which trace element solution was composed of AI2(SO4J3- 18H2O (2,0 g-r1), CoCI2-6H2O (0,75 g-r1), CuSO4-5H2O (2,5 g-r1), H3BO3 (0,5 g-r1), MnCI2-4H2O (20,0 g-r1) Na2Mo04-2H20 (3,0 g-l"1), NiSO4-6H2O (20 g-r1), ZnSO4-7H2O (15,0 g-l"1). A glucose stock solution (500 g-l"1) was autoclaved separately and added to the sterilized medium to a final concentration of 5 g-l"1.
The stock culture of E. coli F82/pC20 was stored at -800C in Luria- Bertani (LB) medium containing 50% glycerol. 1 ml feedstock was used to inoculate 200 ml of precultivation medium containing ampicillin (100 mg-l"1) split in two 1 I shaking flasks and incubated at 37°C and 180 rpm for 16 hours.
The fermentation medium was the same as for precultivation except for the following changes: MgSO4-7H2O (3,0 g-l"1), K2HPO4 was omitted, FeSO4-7H2O (0,1125 g-l"1), Na-citrate-3H20 (1 ,5 g-r1), thiamine-HCI (0,075 g-l"1), NaCI (1 g-r1 ), L-tyrosine
(0,3 g l"1), L-phenylalanine (0,3 g-l"1), glucose (10 g-l'1) and ampicillin (0,1 g-l"1) Additional minerals were added in the form of a trace element solution (1 ,5 mi l"1). Fermentation medium was autoclaved for 20 min. at 1210C, FeSO4/ citrate and glucose solution were autoclaved separately. Ampicillin and thiamin solutions were sterilized via filtration. Fed-batch cultivation was performed in 7,5 I Bioengineering bioreactor
(Bioengineering AG, WaId, Switzerland) with 10% inoculation for 35 h; 3,5 1 initial volume, cultivation temperature 37°C, pH 6,5. pH was controlled by 12,5 % ammonia and 5 N KOH titration. After 7 h a feed for L-tyrosine and L-phenylalanine (25 g-l"1 L-tyrosine, 22,8 g-l"1 L- phenylalanine dissolved in 10% ammonia) was started. The optimal amino acid feed rate during the growth phase was calculated using the factor m = 2 for the volumetric L-tyrosine consumption rate (described in: Gerigk et al., Biotechnology and Bioengineering 80 (7): 746-754, 2002). After 13 h the amino acid feed rate was reduced to 2 g/h. After 5 h on-line
control of the glucose concentration (OLGA, IBA GmbH, Germany) was started with a setpoint of 3 gT1 and a glucose monohydrate feed solution (770 gT1). After 7 h at biomass concentration (dry cell weight) of 2,2 g T1 production was induced by addition of 0,1 mM IPTG. A total biomass concentration of 23,5 gT1 was achieved. A sample of the culture supernatant was lyophilized and re-dissolved in
D2O. 600 MHz 1H-NMR at 303 K showed the resonance spectra of 2,3-CHD and gluconate. The assignment of all the resonances was done by using several 2D NMR techniques (1H-1H COSY, 1H-1H TOCSY, 1H-13C COSY and 1H-13C long range HMBC). All the spectra confirmed the presence of 2,3-CHD and gluconate. The amount of 2,3-CHD and gluconate present were determined to be 18,5 g T1 and 37,8 gT1, respectively. As a minor by-product acetate was present in concentration of 3,5 gT1 as determined by HPLC analysis.
Example 3: Fermentative production of qluconate-free 2,3-CHD in fed-batch bioreactor using a host microorganism having decreased glucose dehydrogenase activity
The precultivation of the 2,3-CHD production strain F111/pC20 was performed as described in comparative example A.
Fed-batch cultivation was performed in 7,5 I Bioengineering bioreactor (Bioengineering AG, WaId, Switzerland) with 10% inoculation for 51 h; 3,5 I initial volume, cultivation temperature 37°C, pH 6,5. pH was controlled by 12,5 % ammonia and 5 N KOH titration. After 6 h a feed for L-tyrosine and L-phenylalanine (25 g I"1 L-tyrosine, 22,8 gT1 L- phenylalanine dissolved in 10% ammonia) was started. The optimal amino acid feed rate during the growth phase was calculated using the factor m = 2 for the volumetric L-tyrosine consumption rate (described in: Gerigk et al., Biotechnology and Bioengineering 80 (7): 746-754, 2002). After 12 h the amino acid feed rate was reduced to 2 g/h. After 5 h on-line control of the glucose concentration (OLGA, IBA GmbH, Germany) was started with a setpoint of 3 gT1 and a glucose monohydrate feed solution (770 gT1). After 6 h at biomass concentration (dry cell weight) of 1,7 g T1 production was induced by addition of 0,1 mM IPTG. A total biomass concentration of 22,4 gT1 was achieved. The supernatant was analyzed for 2,3-CHD by 1H-NMR and the amount present was determined to be 21 ,9 g-l"1. Gluconate could not be detected. Besides said amount of 2,3-CHD, acetate was found to be present in concentration of 1 ,1 gT1 as
determined by HPLC analysis.
Example 4 (and comparative Example B): Use of supernatant of process for the biosynthetic production of f5S,6S1-5,6-dihydroxy-cvclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) as a source of a co-factor for PQQ dependent enzymes
By using the glucose dehydrogenase reaction leading to the formation of gluconate in the culture supernatant of resting cells of E. coli LJ110 as model reaction, the inventors have demonstrated, that the supernatant of the process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-frans-CHD) can be used as a source of a co-factor for PQQ dependent enzymes. In the Comparative Example 5.A, instead of 2,3-frafis-CHD process, pure PQQ was used. In Comparative Example 5.B neither PQQ, nor any supernatant of 2,3-CHD fermentation was used.
A single colony of the E. coli LJ110 was used to inoculate 100 ml of LB medium. Cells were grown at 3O0C with 180 rpm for 15h. At OD546nm 4.7, the cells were harvested. After washing the cells with 50 mM potassium phosphate buffer, pH 6.5, the cells were resuspended in 8 ml of the same buffer (approx. OD546nrn 59) for the determination of gluconate formation as measure of glucose dehydrogenase activity in whole resting cells.
The test was performed in 24 well microtiter plates at 30°C at 100 rpm. Four different vials were filled with the following compounds:
(i): 350 μl culture supernatant of comparative example A, 25 μl MgSO4
(ii): 350 μl culture supernatant of example 3, 25 μl MgSO4
(a): 15 μl 50 μM PQQ, 25 μl MgSO4, 335 μl 50 mM potassium phosphate buffer, pH 6.5
(b): 350 μl 50 mM potassium phosphate buffer, pH 6.5, 25 μl MgSO4. They were used in respectively Examples 4.1 and 4.2, and in Comparative Examples B.1 and B.2.
By addition of 100 μl of the cell suspension together with 25 μl of 1 M glucose, the reaction was started. Samples of 150 μl were taken for the gluconate determination directly after the start of the reaction and after 22 h of incubation. Determination of the amount of gluconate was performed enzymatically with a coupled reaction of gluconate kinase and phosphogluconate dehydrogenase according to Moellering, H. & Bergmeyer, H. U., D-gluconate (D-glucono-d-lactone) and D-
gluconate 6-phosphate, as described in Methods of Enzymatic Analysis (Bergmeyer, H. U. ed.), 3rd ed., VoI Vl, pp.220-227, VCH Weinheim, Germany (1988), with 1 :100 diluted samples. The results are given in table 1.
Table 1
It can be seen from these results, that the supernatant of the 2,3-CHD fermentation is able to cause conversion of glucose into gluconate in a similar way as can be achieved with PQQ as a co-factor, but at some lower activity.
All sequences of nucleotides referred to in the experimental part are listed hereinafter, and will be submitted in electronic format (Patentln).
Sequence listings of oligonucleotides
[SEQ ID: No.l] CTATCGAATT CGAGCATAAA CAGGATCGCC 30
[SEQ ID: No.2]
CACTTCAGCA ACCAGTTCCC GGGGCTTCGC 30
[SEQ ID: No.3]
ACTCGTCTGC GGGATCCGTA ATTAAGGTGG 30
[SEQ ID: No.4] AGCGGCCTAA GCTTTCTTGT TGTTACGCTG 30
[SEQ ID: No.5]
CATGACACCG GCTTTCGCCG CATAAGCTTC TATTGG 36
[SEQ ID: No.6] TGAACGTTAA AAGCTTGCGC TCGAAAATCA ACAATT 36
[SEQ ID: No.7]
CCCAGATCTT TATCATTTTG TGGAGGATGA 30
[SEQ ID: No.8]
CCCAGATCTG AAATCCATTA TTTCACCTCG C 31
[SEQ ID: No.9]
AACTTCGTCG AAGAAGTTGA AGAAGAGTAG TCCTTTATAT TGAGTGTATC GTGTAGGCTG GAGCTGCTTC 70
[SEQ ID: No.10]
AGTGTAAATT TATCTATACA GAGGTAAGGG TTGAAAGCGC GACTAAATTG CATATGAATA TCCTCCTTAG 70
[SEQ ID: No.11]
TAAATGATAA TCATTATTAA AGCCTTTATC ATTTTGTGGA GGATGATATG GTGTAGGCTG
GAGCTGCTTC 70
[SEQ ID: No.12]
TTATCGCTGG TGGCGTTCAG TTCGTCGAGC GTTAAATGGC GTTTCCAGAT CATATGAATA TCCTCCTTAG 70
[SEQ ID: No.13] AACAACGCGC ACGTTGTCAG CAATCTGAGC AAGTCTTACT TCACATCATC GTGTAGGCTG
GAGCTGCTTC 70
[SEQ ID: No.14]
CTATAATTAA TTGCTACTAA AATATTAATG AATTGAAATG GTGTCTCTTT CATATGAATA TCCTCCTTAG 70
Claims
1. Process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa- 1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) in an Escherichia microorganism having increased activity of isochorismate synthase and isochorismatase, and being deficient in activity of 2,3-dihydroxybenzoate synthase, characterized in that the process is carried out in a chorismate overproducing host microorganism also having decreased glucose dehydrogenase activity, or is carried out in a chorismate overproducing host microorganism naturally lacking glucose dehydrogenase activity.
2. Process according to claim 1 , characterized in that the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by lowering the expression of the glucose dehydrogenase gene gcd in the said microorganism.
3. Process according to any of claims 1 or 2, characterized in that the decreased glucose dehydrogenase activity in the Escherichia microorganism has been achieved by deletion of the glucose dehydrogenase gene gcd from the said microorganism, or by switching-off the activation of said gene by any means known to the skilled man, so as to obtain a gcd negative microorganism.
4. Process according to any of claims 1 to 3, characterized in that the increased activity of isochorismate synthase and isochorismatase is obtained by overexpression of at least one of the genes entB and entC and/or of the genes entB and menF from Escherichia, preferably from Escherichia coli.
5. Process according to any of claims 1 to 4, characterized in that the Escherichia microorganism further contains one or more overexpressed genes from the group of aroFBL genes from an Escherichia strain.
6. Process according to any of claims 1 to 5, characterized in that the Escherichia microorganism is an Escherichia coli microorganism.
7. Process according to any of claims 1 to 6, characterized in that the [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) formed in the process is separated from the microorganism biomass by in situ product recovery (ISPR).
8. Use of the supernatant of a process for the biosynthetic production of [5S,6S]-5,6-dihydroxy-cyclohexa-1 ,3-diene-1-carboxylic acid (2,3-trans-CHD) where the concentration of 2,3-frans-CHD in the process has arrived at a concentration of at least 12 g/l as a source for a co-factor for PQQ dependent enzymes.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05076396.0 | 2005-06-16 | ||
EP05076396A EP1734130A1 (en) | 2005-06-16 | 2005-06-16 | Improved biosynthetic production of 2,3-trans-CHD |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2006133898A2 true WO2006133898A2 (en) | 2006-12-21 |
WO2006133898A3 WO2006133898A3 (en) | 2007-10-04 |
Family
ID=35457071
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2006/005664 WO2006133898A2 (en) | 2005-06-16 | 2006-06-13 | Improved biosyntetic production of 2, 3-trans-chd |
Country Status (2)
Country | Link |
---|---|
EP (1) | EP1734130A1 (en) |
WO (1) | WO2006133898A2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010027045A1 (en) | 2008-09-08 | 2010-03-11 | 味の素株式会社 | Microorganism capable of producing l-amino acid, and method for producing l-amino acid |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19919490B4 (en) | 1999-04-29 | 2005-04-14 | Forschungszentrum Jülich GmbH | Process for the separation of organic substances from an aqueous mixture |
DE10042535A1 (en) | 2000-08-30 | 2002-03-28 | Forschungszentrum Juelich Gmbh | Process for the improved production and isolation of trans-dihydroxy-cyclohexadiene carboxylic acids and / or their secondary products, and a genetically modified organism suitable for this |
DE10220235A1 (en) | 2002-05-06 | 2003-12-04 | Forschungszentrum Juelich Gmbh | Integrated separation of organic substances from an aqueous bioprocess mixture |
-
2005
- 2005-06-16 EP EP05076396A patent/EP1734130A1/en not_active Withdrawn
-
2006
- 2006-06-13 WO PCT/EP2006/005664 patent/WO2006133898A2/en active Application Filing
Non-Patent Citations (3)
Title |
---|
BUJNICKI ET AL: "Fed-batch-Prozessentwicklung zur Produktion und Gewinnung von Cyclitolen mit rekombinanten Escherichia coli" CHEMIE INGENIEUR TECHNIK, vol. 76, 2004, page 1239, XP002366828 * |
FRANKE ET AL: "(S,S)-2,3-dihydro-2,3-dihydrobenzoic acid: Microbial access with engineered cells of Escherichia coli and application as starting material in natural-product synthesis" CHEMISTRY - A EUROPEAN JOURNAL, vol. 9, 2003, pages 4188-4196, XP002366829 * |
PANKE ET AL: "Advances in biocatalytic synthesis of pharmaceutical intermediates" CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 9, 5 April 2005 (2005-04-05), pages 188-194, XP004848122 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010027045A1 (en) | 2008-09-08 | 2010-03-11 | 味の素株式会社 | Microorganism capable of producing l-amino acid, and method for producing l-amino acid |
KR20110074521A (en) * | 2008-09-08 | 2011-06-30 | 아지노모토 가부시키가이샤 | Microorganism capable of producing l-amino acid, and method for producing l-amino acid |
CN102177246A (en) * | 2008-09-08 | 2011-09-07 | 味之素株式会社 | Microorganism capable of producing L-amino acid, and method for producing L-amino acid |
US8206954B2 (en) | 2008-09-08 | 2012-06-26 | Ajinomoto Co., Inc. | L-amino acid-producing microorganism and a method for producing an L-amino acid |
JP5598329B2 (en) * | 2008-09-08 | 2014-10-01 | 味の素株式会社 | Microorganism producing L-amino acid and method for producing L-amino acid |
CN102177246B (en) * | 2008-09-08 | 2015-02-11 | 味之素株式会社 | Microorganism capable of producing L-amino acid, and method for producing L-amino acid |
KR101627095B1 (en) | 2008-09-08 | 2016-06-03 | 아지노모토 가부시키가이샤 | Microorganism capable of producing L-amino acid, and method for producing L-amino acid |
Also Published As
Publication number | Publication date |
---|---|
WO2006133898A3 (en) | 2007-10-04 |
EP1734130A1 (en) | 2006-12-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1781797B1 (en) | Mutant e. coli strain with increased succinic acid production | |
JP4669613B2 (en) | Synthesis of shikimic acid by biological catalyst | |
US8778656B2 (en) | Organic acid production in microorganisms by combined reductive and oxidative tricaboxylic acid cylce pathways | |
JP2018500911A (en) | Production and processing of diamines | |
KR20120002593A (en) | Method for producting high amount of glycolic acid by fermentation | |
JP2008511318A (en) | Fermentation method with improved substrate conversion efficiency | |
KR20090029256A (en) | Glycolic acid production by fermentation from renewable resources | |
US20090186398A1 (en) | Increased Bacterial CoA and Acetyl-CoA Pools | |
US20140065697A1 (en) | Cells and methods for producing isobutyric acid | |
WO2006066072A2 (en) | Production of glucurono-3,6-lactone with low environmental impact | |
CN109890960B (en) | Process for producing aldehyde | |
US20180179499A1 (en) | Biobased production of functionalized alpha-substituted acrylates and c4-dicarboxylates | |
CA2890922A1 (en) | Method for producing phenol from renewable resources by fermentation | |
KR101483012B1 (en) | Method for production of 3-hydroxypropionic acid using recombinant E. coli with high yield | |
JP5142268B2 (en) | Improved gallic acid synthase and method for producing gallic acid | |
JP5140848B2 (en) | Method for producing gallic acid | |
US20080311631A1 (en) | Biosynthetic Production of 4-Amino 4-Deoxychorismate (Adc) and [3R,4R]-4-Amino-3-Hydroxycyclohexa-1,5-Diene-1-Carboxylic Acid (3,4-Cha) | |
KR20190007403A (en) | Method of producing 2-hydroxy gamma butyrolactone or 2,4-dihydroxybutanoic acid | |
RU2466186C2 (en) | BACTERIUM Escherichia coli - SUCCINIC ACID PRODUCER AND METHOD FOR PREPARING SUCCINIC ACID | |
WO2006133898A2 (en) | Improved biosyntetic production of 2, 3-trans-chd | |
WO2021230222A1 (en) | Genetically modified microorganism and method for producing organic acid | |
Skorokhodova et al. | Anaerobic synthesis of succinic acid by recombinant Escherichia coli strains with activated NAD+-reducing pyruvate dehydrogenase complex | |
KR101541034B1 (en) | Escherichia coli for high production of d―galactonate and use thereof | |
RU2816654C2 (en) | Method for reducing erroneous inclusion of non-canonical branched-chain amino acids | |
WO2013125666A1 (en) | Microorganism producing inositol with high yield, and method for manufacturing inositol by using same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 06754332 Country of ref document: EP Kind code of ref document: A2 |