WO2006133221A2 - Apparatus and method for introducing multiwavelength laser excitation in fluorescence microscopy - Google Patents

Abstract

Use of broadband mirrors to direct light into an objective enables the use of several wavelengths for imaging.

Description

Apparatus and Method for Introducing Multiwavelength Laser Excitation in Fluorescence Microscopy

This application claims priority from US Provisional Application No. 60/687,844, filed June 6, 2005, the entire contents of which are incorporated by reference herein.

This invention was made under National Institutes of Health contract numbers GM00714 and GM43369. The United States government may have certain rights in the invention.

Field of the Invention This invention relates to fluorescence microscopy, and more specifically, to apparatus and methods for directing light during fluorescence microscopy.

Background of the Invention

The difficulty of synchronizing various observations of a reaction can interfere with the isolation and characterization of individual steps in a biological pathway. Single molecule fluorescence experiments provide minimally invasive methods to study the complex pathways that are not easily synchronized for analysis using ensemble experiments. Various aspects of the dye fluorescence have been exploited in this effort. For example, the binary on/off character of a single dye fluorescence signal can indicate substrate binding (Tokunaga et al., 1997) or single enzyme turnover (Lu, H. P., et al., 1998. Single-Molecule enzymatic dynamic. Science

282:1877-1882) while partial quenching of dye emissions can accompany domain movements during an enzymatic cycle (Zhang Z., et al., 2004, Single-molecule and transient kinetics investigation of the interaction of dihydrofolate reductase with NADPH and dihydrofolate. PNAS 101 :2764-2769). High precision spatial tracking (Yildiz et al., 2003) and polarization imaging of single dye emissions (Forkey, J. N., et al., 2003, Three-dimensional structural dynamics of myosin V by single-molecule fluorescence polarization. Nature 422:399-404) have helped distinguish different models for motor enzyme motion, and spectral shifts in single dye labels have been associated with changes in protein conformation (Wazawa, T., et al., 2000, Spectral fluctuation of a single fluorophore conjugated to a protein molecule. Biophys. J. 78:1561-1569). Simultaneous use of multiple dyes enables added complexity, for example allowing co-localized imaging of both a myosin motor enzyme and its ATP substrate (Ishijima et al., 1998, Simultaneous observation of individual ATPase and mechanical events by a single myosin molecule during interaction with actin. Cell 92:161-171 ). Monitoring emissions from two dyes is also central to the use of FRET (fluorescence resonance energy transfer) to track the association of RNA polymerase subunits (Mukhopadhyay, J., et al., 2001, Translocation of σ⁷⁰ with RNA polymerase during transcription: fluorescence resonance energy transfer assay for movement relative to DNA, Cell, 106:453-463), determine the binding orientation of Rep helicase (Rasnik et al., 2004) or characterize multiple states in ribosomal tRNA selection. Single molecule three-color FRET has also been demonstrated with one donor excitation laser and three detection channels to probe correlated motions within a single Holliday junction.

Many reaction pathways involve the assembly or interaction of multiprotein complexes. Excitation and detection of multiple dyes in a single molecule fluorescence experiment would enable us to monitor the assembly order or recruitment of various proteins in these complexes. One experimental difficulty encountered in multi-dye experiments is the need to introduce multiple excitation lasers. A common total internal reflection (TIR) geometry for single molecule fluorescence experiments employs a dichroic missor to first direct the excitation laser into the objective and then selectively remove the excitation wavelength from the low-light imaging path. However, the dichroic design becomes increasingly problematic when multiple lasers are used, resulting in increased losses of the dye emission flux. An alternate geometry involves prism coupling the excitation beams through a flow cell coverslip (Axelrod 1989, Funatsu et al., 1995). This avoids the need for a multiwavelength dichroic, but it is more difficult to maintain the alignment of the various components. The excitation beam is focused through a prism that contacts the slide surface opposite the fluorescence objective. This restricts the sample stage motion and precludes combining SMF with techniques, such as laser trapping or brightfϊeld imaging (Nishizaka et al., 2004), that require a free space above the coverslip. Prism coupling also requires imaging through an aqueous layer, thus increasing the working distance and, as a result, the point spread function (Yildiz et al, 2003).

As a result, it is desirable to have another method for employing multiple excitation wavelengths in TIR fluorescence microscopy.

Summary of the Invention

In one aspect, the invention is a method of performing fluorescence microscopy, comprising employing a first broadband mirror disposed beneath an objective lens of a fluorescence microscope to direct an incident beam comprising a plurality of wavelengths into the objective lens. A second broadband mirror may be disposed beneath the objective lens to direct a reflected beam away from a path for emitted rays. The first and second broadband mirrors may reduce the contribution of autofluorescence from the objective to the emitted rays by a factor of at least 1.5, for example, at least 2. The first and second broadband mirrors may be positioned to block no more than about 10%, for example, no more than about 5% or 4%, of the path for emitted rays. The first broadband mirror may direct light selected from a predetermined range of wavelengths into the objective lens. The reflecting plane of the first broadband mirror may be oriented at about 45° with respect to the plane of an exit pupil of the objective lens. The microscope may be operated in total internal reflectance (TIR) or a non-TIR mode. The first broadband mirror may be disposed about 1-2 mm beneath the objective lens or in a plane that is an image of the plane about 1-2 mm beneath the objective lens. The first broadband mirror may be disposed in a back focal plane of the objective lens or in a plane that is an image of the back focal plane of the objective lens.

In another aspect, the invention is, in a fluorescence microscope comprising an objective lens that receives an incident beam and provides a light path for rays emitted from a sample, a first broadband mirror that directs the incident beam into the objective lens, wherein the first broadband mirror is disposed with respect to the objective such that the objective lens provides a numerical aperture to the incident beam between 1.33 and 1.46 or between 1.33 and 1.52. The microscope may further include a blocking filter for removing scattered rays from the incident beam from the light path Brief Description of the Drawing

The invention is described with reference to the several figures of the drawing, in which,

Figure IA is a schematic of the geometry for a prior art through-the-lens TIR excitation that uses a dichroic to separate the laser excitation λj and fluorescence emission λ₂.

Figure IB is a schematic of the optical layout for a multi-dye single molecule fluorescence microscope according to an exemplary embodiment of the invention. The optics incorporate two small mirrors for directing the TIR laser excitation into the objective (Mj_n) and deflecting the reflected laser beam that exits the objective out of the image path (M_out). The symbols in the figure are as follows: ND: neutral density filter, S: shutter, Q: quarter wave plate, CL: collimating lens pair, LF: laser filter, D: dichroic, M: mirror, L: lens, I: iris, NF: laser notch filter, Mj_n: small input mirror for laser excitation, M_out: small output mirror for laser excitation, EMCCD: electron multiplying charge-coupled device camera.

Figure 1C is a photograph of an exemplary embodiment employing optics

Figure 2 A is a photograph of the objective under illumination by bead fluorescence generated according to an exemplary embodiment of the invention. Figure 2B is a schematic of the geometry of the optics used to obtain the image of Figure 2A.

Figure 2C is a schematic of the optics of an exemplary embodiment in which mirrors are placed at a distance from the objective. The figure shows the ray diagram for the incident and reflected beam. Figure 2D illustrates the ray diagram for the fluorescent image in the embodiment depicted in Figure 2C.

Figure 3 is a pair of micrographs taken with an EMCCD camera during TIR illumination of a glass slide according to an exemplary embodiment of the invention without (A) and with (B) the output mirror in place. Figure 4 is a schematic of surface-immobilized DNAs labeled with individual dye molecules that fluoresce at one or more wavelengths. Figure 5A is an image of an integrated image for a single Cy3 spot acquired over 1.5 s and including about 37000 photons.

Figures 5B and C show x and y slices through the image of Figure 5 A (open circles) and a gaussian fit (solid line) with a diameter of 287 nm. Figure 6 is a graph recording the photobleach statistics from a region that contained 137 Cy3 spots at time=0 and was exposed to 0.7 mV incident 532nm excitation.

Figure 7 is a series of graphs recording single step photobleaching events for Cy3 and the background noise for the microscope use a (A) fused silica or (B) glass slide. The exposure interval was 200 ms per frame and an 11x11 pixel region was integrated in each instance. Emission at wavelengths <635 from a 0.8 μm² (A) or 0.4 μm² (B) area was recorded with 0.2 s time resolution using 0.7 mW 532 nm excitation. After dye photobleaching (arrows), the camera and excitation laser were sequentially shuttered to record the relative amounts of background noise caused by camera noise, stray light, and autofluorescence.

Figure 8A-E are fluorescence micrographs of a field of DNA molecules hybridized to oligonucleotides labeled with three different dyes (see Fig. 4). The micrographs (18.3 x 20.2 μm ) show the same field excited with a single laser wavelength (Ex) of (A) 633, (B) 532 or (C) 488 nm (close to the excitation maxima of Cy5, Cy3 and Alexa 488 respectively), or (D)-(E) with all three lasers simultaneously. Images were collected from either the long- (> 635 nm; A and E) or short- wavelength (<635 nm; B, C, and D) area of the dual-view optics image. Each image is an average of twenty 0.1 s duration frames. Typical single-molecule spots consist of -3000, -3600, and -2300 photons in A, B, and C, respectively. Figure 8F is a diagram showing the overlaid positions of each kind of dye molecule as detected in (A):Cy5 (square), (B) Cy3 (x), and (C) Alexa 488 (o).

Figure 9 is a series of plots displaying a binding sequence by integrating the fluorescence from a region containing one ssDNA that hybridizes three oligos. (A) and (E) record the fluorescence from the <635 nm and >635 nm fields during the 532 nm laser interval that primarily excites the Cy3 dye. Cross excitation and FRET effects result in the Cy5 signals seen in (E). Note also that Cy3 leakthrough into the >635 nm field produces the step in the (E) plot that occurs at 230 seconds. (C) shows the same >635 ran (Cy5) field during the interval in which the 633 nm laser is on. The 633 nm laser wavelength is close to the Cy5 peak absorbance, and in this instance stronger Cy 5 signal may be due to a dye oligo that blinks on and off following a single binding event. (A) displays the <635 nm field during 488 nm excitation, and we see a clear signature from the Alexa488-oligo binding to the ssDNA. Cross excitation of the Cy3 dye by the 488 nm laser produces the step in the (A) trace at t = 30 sec coincident with the Cy3 -oligo binding. (D) summarizes the information in the remaining plots, indicating the intervals during which the three oligos are recorded as bound to the complementary template. Figure 10 is a series of graphs illustrating the time courses of dye-labeled oligonucleotide binding to multiple immobilized target DNA molecules in the same experiment as shown in Fig. 9. (A) Cumulative number of observed binding events, n, for each oligonucleotide as a function of time t after the start of observation (points). One-parameter Fits (lines) are to the function n(f) = [n(t_max) / (1 - exp(- t_max / τ)][l - exp(-t / τ)], where t_max is the longest observation time for each oligonucleotide. The best-fit values of τ are 182, 905, and 2837 s, respectively, for Cy5, Cy3, and Alexa 488 oligonucleotides. (B) Time until Cy3 oligonucleotide binding and time until Alexa 488 oligonucleotide binding for the 122 individual DNA molecules to which both oligonucleotides were observed to bind (observation times 1598 s for Cy3 and 3233 s for Alexa 488). Clustering of points near the line suggests that binding of the two oligonucleotides is not independent. Inset: Histograms of At = (Alexa 488 oligonucleotide binding time) - (CyS oligonucleotide binding time) for the data (top) and a simulation (bottom) based on the measured second-order rate constants and assuming independent binding of the two oligonucleotides. The large peak in the data histogram that is not seen in the simulation indicates an enhanced rate of Alexa 488 oligonucleotide binding to target DNAs on which the Cy3 oligonucleotide is already bound.

Figure 11. Intensity calibration curve for the Cascade 512B EMCCD camera with electron multiplier gain 3700 and pixel acquisition rate 10 MHz. Detailed Description of Certain Preferred Embodiments

In one embodiment, a modified through-the-lens design eliminates the need for an input dichroic. Instead, a pair of small mirrors is placed at the edge of the objective back focal plane. These broadband mirrors direct the excitation laser beams into and out of the objective while the low-light fluorescence-imaging path remains largely unobstructed. In addition, the mirrors remove a majority of the objective autofluorescence as a contributor to background noise.

The mirrors eliminate the overlap between the illumination path and the detection path and provide many advantages. The small broadband mirrors allow simultaneous use of multiple excitation wavelengths without incurring the emission losses that would accompany use of a multi-wavelength dichroic mirror employed in many epi-illuminated TIRF (total internal reflectance fluorescence) microscopes to separate the excitation and emission pathways. This permits multiple dye labels to be imaged within a single field of view. The multi-dye capability is important for numerous biological experiments and assays.

In many prior art systems, a wavelength sensitive dichroic mirror is specifically selected for the particular dyes being used and is changed if the dyes are altered. A dichroic design for multiple wavelengths can require careful reflection band placement so as to minimize losses of the fluorescent signal photons. In contrast, broadband mirrors according to certain embodiments are functional at any visible or near-IR wavelength and thus allow simultaneous use of or fast switching between different dyes. In addition, use of broadband mirrors reduces fluorescence signal losses in comparison to a dichroic, improving the signal-to-noise ratio.

In some embodiments, the mirrors can be used in microscope designs that have a fixed objective lens as well as in designs that include an adjustable or movable objective. For example, the excitation beam may be introduced through an optical fiber that moves with the objective. In an alternative embodiment, multi-wavelength excitation in single-molecule TIRF microscopy can also be achieved through a transillumination mode that uses a prism to couple the excitation beams through a coverslip on the side of the specimen distal to the objective (1, 2, 10). The prism approach also achieves low background by spatially segregating the excitation and emission pathways. However, through-objective TIRF optics reduce spherical aberration by imaging the surface of the coverslip closest to the objective, leave the other side of the sample free for use in combining SMF with techniques such as laser trapping (16) or brightfield imaging (17), and may be simpler to maintain in alignment. The use of broadband mirrors also has advantages for using one or multiple lasers in a TIR or non-TIR geometry. In the TIR geometry, the laser beam is introduced through the far edge of the objective back aperture, resulting in a very steep incident angle. The laser beam is reflected off an interface between high and low refractive index media (e.g., a glass slide-sample interface) so that only those dye molecules in the low index medium that are within approximately 100 to 200 xlO^"9 m of the interface are excited. By only exciting the interface region, a user avoids background fluorescence that could otherwise originate from dye molecules located further from the surface. These advantages are most obvious when using multiple lasers in TIR, but the use of broadband mirrors also provide advantages when TIR is not used. As used herein, non-TIR indicates that the laser beam passes through the sample buffer rather than being reflected off the glass-buffer interface. In a non-TIR geometry, the user excites a larger volume of the sample rather than just the dyes at the surface region. In some embodiments, the input mirror can be translated slightly to alter the input angle of the laser and achieve non-TIR fluorescence excitation. The laser is then no longer reflected at the glass-buffer interface but rather passes through the sample. It is often useful to switch between the TIR and non-TIR excitation while viewing a single sample.

In other embodiments, a small translation in the input mirror position can alter the angle of the incident excitation beam on the sample so that the beam no longer undergoes total internal reflection at the slide-sample interface. Instead, the beam passes through the sample at a steep angle and excites dye molecules that may be located many microns away from the slide-sample interface. In this embodiment, a user may then detect and image dye molecules located throughout a much larger sample region. To achieve non-TIR illumination, the input mirror is moved further into the image path.

The use of broadband mirrors also provides advantages even in embodiments where only one laser is employed. In fluorescence microscopy, wavelength-specific optics are often employed to remove laser scatter from the image path. The dichroic mirror used in prior art systems partially performs this task, but additional blocking filters may still be necessary. The broadband mirrors result in a lesser amount of scatter that can be removed with OD 6 blocking filters (e.g., attenuation by 10^'6 at the laser wavelength) rather than the OD 8 or greater that is often employed in systems employing a dichroic. An advantage may result even when using a single excitation laser since the removal of the dichroic and use of more modest blocking filters may reduce both costs and losses of the fluorescent image signal. In some embodiments with modest time requirements, wavelength-specific filters may be mechanically switched into and out of the image path.

The excitation and imaging optics for an exemplary multiwavelength TIR fluorescence microscope are diagrammed in Figure 1. Three lasers are combined using dichroics and all are focused onto the back focal plane of the objective (e.g., Zeiss: plan-fluar, 10Ox magnification, oil immersion 1.45 numerical aperture or Olympus: plan-apo 6Ox magnification, oil immersion, TIRFM, 1.45 numerical aperture). Computer-controlled mechanical shutters govern the order and duration of each laser excitation. A small mirror positioned just beneath the objective directs the input beams onto the edge of the objective back focal plane to achieve TIR excitation at the slide-buffer interface. In some embodiments, the input mirror is positioned as close as possible to the objective lens, for example, 1-2 mm beneath the objective lens. The proximity of the mirror to the objective minimizes the necessary intrusion of the mirror into the image path. The mirrors may be elliptical in shape and fabricated at a 45° angle on a cylindrical glass substrate, as depicted in Figures 1 and 2. The angle may be varied; in most embodiments, the path of the incident beam is close to being perpendicular to the plane of the exit pupil of the objective. For the majority of commercial objective lenses, the incident beam needs to be within a few degrees of perpendicular to the exit pupil plane or the incident beam will not pass through the objective. One skilled in the art will recognize how to adjust the angle of the beam incident on the mirror and that of the mirror to achieve the necessary angle for the beam to enter the objective. Suitable mirrors may have alternative geometries, e.g., a prism, that present an angle, for example, about 45° or less, between the silver side and the glass. In some embodiments, the mirrors are about 1-2 mm across. Corners of larger mirrors may also be employed. The position of the input mirror, as described herein, is the position of the portion of the mirror that directs the incident beam into the objective.

An output element removes the output beam from the image path. In some embodiments, a second mirror at the opposite edge of the back focal plane directs the primary reflected laser excitation, e.g., the beam reflected from the interface between the slide and the buffer, into a beam dump. This output mirror is also placed close to the objective, for example, 1-2 mm beneath the objective lens. Suitable output mirrors are similar to the input mirrors described above. Other suitable output elements, e.g., high optical density neutral density filter, capable of efficiently absorbing the reflected excitation beam from the image path may also be employed.

In another embodiment, the mirrors are placed in an intermediate image plane of the back of the objective (Figures 2C and 2D). The mirrors would block very little of the image path and would still remove a significant portion of the objective autofluorescence. As shown in Figure 2C, the mirrors are placed in a plane that reimages the back of the objective region, e.g., the location where the mirrors are placed in Figure IB. Additional optic elements known to those of skill in the art may be included, e.g., irises for limiting the angular range accepted by the lenses, and filters and lenses for spectrally splitting the image (see Figure IB). The excitation beams passing through Ll and L2 in Figure 2C may result in autofluorescence; this may be reduced by employing low fluorescence fused silica lenses. While the additional optic elements Ll and L2 have the potential to increase background fluorescence, placing the mirrors farther from the objective enables this embodiment to be more easily directly substituted for a dichroic in a pre-existing fluorescence microscope.

As shown in the figures, the excitation beam is being focused as it enters the back of the objective and therefore converges rapidly. Likewise, the reflected exit beam diverges rapidly as it leaves the objective. As a result, it may be desirable to have the mirrors intrude on more of the image aperture to divert the reflected beam away from the fluorescence image (see Figure 2D).

Regardless of the distance from the objective, appropriate placement of the mirrors allows imaging in TIR mode while using a glass (refractive index 1.52) or a low autofluorescence fused silica (refractive index 1.46) coverslip. In these embodiments, the mirrors are placed in an annulus in a plane behind the objective corresponding to a numerical aperture between 1.33 (the refractive index of aqueous buffer) and either 1.52 or 1.46 (depending on the composition of the cover slip). This insures that the excitation beam angle allows the beam to pass through the cover slip and experience total internal reflection at the coverslip-buffer interface. One skilled in the art will recognize that these values may need to be adjusted for other compositions of slides, cover slips, or buffers.

Broadband input and/or output mirrors that cover desired wavelength ranges and that have a geometry that minimizes obstruction of the image path can be custom ordered. The reflectivity spectra of these mirrors may be designed to direct the excitation beams into and out of the objective and also to direct the objective autofluoresence out of the image path. Suitable broadband mirrors may also be commercially purchased to cover various wavelength ranges. In one embodiment, the mirrors are stock number G54-092 from Edmund Optics. In one embodiment, the mirrors are planar. While mirrors are available with a slightly beveled top edge, this also is less optimal because the beveled edge introduces a further intrusion into the image path.

In some embodiments, for example, in a microscope operated with a single wavelength excitation, either or both of the input or the output mirror may be replaced by a wavelength-specific element, e.g., a dichroic mirror, which may be positioned close to the objective lens as described above.

The direction of the incident beam entering the input optical path, including the input mirror and the objective lens, can be the same, nearly the same, parallel or nearly parallel to the direction in which the exit beam emerges from the output optical path, which includes the objective lens and the output mirror. In other examples, the direction of the exit beam following the exit mirror can be at a different angle, e.g., in the range of from about 0 to about 180 degrees, from that of the incident beam prior to the input mirror. The emission and excitation paths can be perpendicular or nearly perpendicular to each other or can be at another suitable angle that permits fluorescence detection. In certain embodiments, the output from the objective includes secondary reflections that are diminished by around 10^"3 with respect to the incident beam, possibly arising from lens interfaces within the objective. These miss the small output mirror but are not collinear with the image path. The brightest of these angled reflections separate from the image path and are removed by the iris labeled 12 in Figure 1. An OD 6 block at each excitation wavelength may be sufficient to remove any remaining laser scatter from the image path. In one embodiment, a long-pass (HQ505LP Chroma Technology, Rockingham VT) and 532/633 nm dual notch filter (Barr Associates, Westford MA) are used to eliminate this residual laser scatter. One skilled in the art will be familiar with other suitable filters. A second iris 13 at the intermediate image plane selects a restricted field of view so that two nonoverlapping images of the sample will fit onto the camera. The image path is split in the infinite conjugate space using a dichroic to afford a dual image divided at the 635 nm wavelength (Rasnik et al., 2004). With this arrangement, for example, one may simultaneously excite and record fluorescence from two different fluorophores using the spatially split image. Alternatively or in addition, one may choose to time- multiplex excitations from dyes that fluoresce at closely spaced wavelengths. In certain embodiments, small broadband mirrors replace a dichroic in directing the excitation lasers into the objective and removing the reflected beams from the image path. The mirrors intrude into the image path, thus raising questions with regard to the signal flux and background in an application that is sensitive to both. A closer examination reveals that the area blocked by the mirror is quite small, and this area is coincident with the image path containing most of the objective autofluorescence. Figure 2 shows a close-up view near the objective back focal plane while looking into the objective. Fluorescent beads (Molecular Probes 580/605 F8786) retained on a slide surface and excited with a TIR 532 nm beam provide strong fluorescence that highlights the objective region relevant for providing signal. At the edge of the illuminated region are small circular outlines of the input and output mirrors that are used to reflect the excitation lasers. The intrusion on the image path is modest because in the TIR geometry, the excitation lasers enter and exit at the very edge of the aperture. Figure 2 indicates that the mirrors only block about 4% of the image path. This geometry is expected to maintain a broadband throughput for signal photons comparable to the peak transmission for a dichroic. In contrast, a conventional microscope design with a dichroic mirror (Fig. IA) utilizes the full objective aperture but can suffer significant loss of emission due to reduced spectral bandwidth. The reduced bandwidth results from the dichroic reflecting light of the wavelengths used for excitation. For example, using the transmission spectrum for a commercially-available dichroic mirror with three reflection bands appropriate for the laser wavelengths described in the Examples, only 53% of the Alexa488 and 54% of the Cy3 fluorescence emission would pass through this optic into the imaging path. A different view of the objective back focal plane reveals that it is in fact desirable to block the image path in the small area used for entry and exit of the laser beams. A glass slide with a lane containing only an aqueous buffer was illuminated with a TIR 0.7 mW 532 nm excitation beam. Figure 3 shows the objective back focal plane imaged with the electron multiplying camera to record the objective autofluorescence. With the mirrors in place, a faint autofluorescence line is present between the two mirrors, resulting from the side-view of the beam as it traverses the objective. However, moving the output mirror aside reveals a localized autofluorescence spot at the exit point of the excitation beam. To avoid laser leak- through, an additional 6 OD 532 nm attenuation was also inserted in the image path. Alterations in this 532 nm attenuation did not affect the spot intensity proportionately, indicating that the 532 nm laser light did not directly contribute to the imaged spot. The autofluorescence spot at the location of the input beam can also be viewed on a conventional Axiovert fluorescence microscope equipped with an input dichroic. The spot vanished when the input beam was directed at a reflective aluminum foil strip affixed to the back of the objective. In addition, no spot was visible when the objective was replaced with a mirror. These controls all verify that the imaged spot was due to autofluorescence rather than laser leak-through.

Integrating the prominent autofluorescence spot in Figure 3 shows that the photon flux is sufficient to contribute several times the total measured background if spread uniformly over the 512x512 pixel array of the camera. However, the actual background contributed by the spot depends in part on the lens placement and iris adjustments during imaging. While imaging single dye molecules, the output mirror was translated to allow the objective autofluorescence into the image path. The resulting increase in background noise was measured and used to estimate the additional contribution from the input beam. The background without the mirrors blocking the objective autofluorescence was about 1.5 times as great as the background observed with the mirrors in place. With the irises open (e.g., not optimally adjusted), this factor for the background increase was greater than 2. Thus, placement of these mirrors in the back focal plane of the objective directs the objective autofluorescence out of the image path and eliminates a significant source of noise. In contrast, designs incorporating a dichroic often allow this objective autofluorescence into the image path. In dichroic-based TIRF setups, there may be intermediate images of the back of the objective where the autofluorescence may be removed with small beam blocks at the image edge. The autofluorescence contribution might then be reduced with judicious use of apertures, beam blocks and bandpass filters. In contrast, placement of small mirrors according to an embodiment of the invention provides an easy and simple solution to the problem. For imaging purposes, single dyes may be immobilized at the slide surface; otherwise, thermal diffusion will carry them out of the 150 nm thick surface layer subject to TIR laser excitation. In one demonstrative example, dye-labeled DNA oligos were tethered to a PEG:PEG-biotin (=100:1) coated surface (Nektar Therapeutics, Huntsville, AL) using a biotin-streptavidin-biotin linkage. A biotin- labeled ssDNA template was first tethered to the surface, and complementary dye- labeled oligos were then allowed to hybridize (Figure 4). Single dyes image as diffraction limited spots, and these spots were examined to verify that the mirror intrusion on the imaging path did not lead to appreciable degradation of the point spread function or photon flux. Figure 5 shows a typical single spot image and cross section from a single Cy3 fluorescent spot. Spots were approximately Gaussian with a full width at half maximum (FWHM = 2.35σ_x = 288 and 2.35σ_y = 313 nm in Fig. 5) in agreement with prior measurements from single-molecule microscopes (13) and comparable to that expected for the diffraction limit (0.61λ/NA = 266 nm for a λ = 580 nm emission wavelength and an NA = 1.33 effective numerical aperture). With a low autofluorescence fused silica coverslip, the spot FWHM increased to -335 nm due to aberrations resulting from the lower refractive index of the coverslip.

Photobleach statistics fnr the C!v3-ΩNA rrmςtrπrt nr<= aisrv in flσrppmpnt with published values (Yildiz et al., 2003). Figure 6 shows results from a single field of view with a starting count of 137 individual spots. The number of photons emitted by the dye molecule before photobleaching and the efficiency with which the microscope detects these photons are among the limiting factors in the application of single- molecule fluorescence to the study of biochemical processes in vitro. To verify that the microscope efficiently collects and registers fluorescence emission, we calibrated the camera output (see Examples) and then measured the number of photons emitted before photobleaching from a population of DNA molecules containing single Cy3 dyes. We recorded >2xlO⁶ photons from 65% of the Cy3-DNA constructs and > 7x10⁶ from 15% (Fig. 6), yields which are comparable to those obtained with TIR microscopes employing dichroic mirrors (13). The somewhat non-exponential character of the distribution in Fig. 6 may arise from non-uniform excitation across the microscope field combined with the variation of single-dye photon yields from Cy3-DNA with excitation intensity (data not shown). Taken together, the photobleaching and spot width measurements confirm that the mirror intrusions into the image path do not appreciably degrade the point spread function or diminish the photon collection efficiency.

Figure 7 shows a pair of single dye photobleach events recorded with a Cy3DNA construct tethered to either a fused silica or glass slide while using a 0.7 mW 532 nm excitation. High signal-to-noise ratios (S/N) were obtained when the microscope was used to record the fluorescence from single dye-labeled DNA molecules, even at excitation powers sufficiently low to permit acquiring hundreds or thousands of time points before dye photobleaching. In an example record obtained with a fused silica coverslip (Fig. 7A), the dye S/N is 14.8, allowing determination of the presence or absence of the dye in each time point with high certainty (P<10^"6). Records obtained with a glass coverslip (e.g., Fig. 7B) have higher noise due to the larger coverslip autofluorescence. Glass autofluorescence is even more severe in the >635 nm images of the dual view optics (data not shown). The large reduction of noise upon photobleaching in Figure 7A demonstrates that the variability in the single dye signal with a fused silica coverslip is dominated by photon shot noise. In this instance, only an insignificant fraction (~5%) of the dye signal standard deviation is contributed by noise from the background fluorescence. The fused silica data in Figure 7 illustrate that, with moderate signals, it is possible for the signal photon statistics (as opposed to system background noise) to determine the signal to noise ratio. This indicates that the introduction of mirrors in the image path does not introduce excess laser scatter or background noise. The selection of glass or fused silica depends on whether the smaller point-spread function obtained with the former is of more value in a particular application than the reduced noise obtained with the latter. In many applications the photon background from dye-labeled species in solution will be a primary consideration with respect to background.

One motivation for replacing the input dichroic with mirrors in this microscope is that it affords an efficient design for introducing fluorescence excitation lasers at multiple wavelengths. As described above, the broadband mirrors allow use of multiple excitation lasers with a minor impact on the fluorescence throughput. In this example, three single molecule dyes were imaged within the same field of view. A biotin-tagged ssDNA template was surface tethered to the PEG/PEG-biotin glass slide surface of a flow cell. The ssDNA is complementary to three oligos that are dye labeled with Cy5, Cy3 or Alexa488. The surface tethered ssDNA template was first incubated with a buffer containing 5 nM concentration of each oligo. After a 20 minute incubation, the lane was flushed clear using an oxygen scavenger buffer, and TIRF images were recorded using sequential laser excitation at 488, 532 and 633 nm. Figure 8 shows 18.3 x 20.2 μm images of the same field of view using three lasers to sequentially excite each of the three dyes. Single step photobleaching confirmed that these were single dye fluorescent spots. Each single molecule fluorescent spot in the Alexa488, Cy3 and Cy5 image is formed from approximately 3000, 3600, and 2300 photons respectively. Co-localization of the dye spots excited with the different lasers indicated that multiple oligos hybridize to the same ssDNA template. With proteins, this sort of simultaneous co-localization may help identify the constituents of a multi- subunit complex. Which dyes are present in each DNA molecule can be readily determined by shuttering the excitation lasers and/or by using the emission wavelength selection afforded by the dual-view optics (Fig. 8F). Even when all three lasers are on simultaneously (Figs. 8D,E), the background fluorescence is sufficiently low that single molecules are imaged with high signal-to-noise ratios. The ability to detect which of the three dyes is present at each point in the field in a given frame allows us to examine the sequence and kinetics of reaction steps by which dye-labeled molecules assemble into a complex. The oligo binding reaction can be followed in real time using an image sequence during which the different laser excitations are continuously cycled. 200 ms frame exposures were employed for excitation intervals of 25, 5 and 5 frames for the 532 (Cy3), 633 (Cy5) and 488 nm (Alexa) lasers, respectively. These excitation levels and integration times were chosen according to the oligo binding kinetics and bleaching characteristics for the dyes. The Cy3/Alexa488 images were spatially separated from the Cy5 image with the split image arrangement noted above. The two fields were mapped using a function that incorporates a translation in addition to a small magnification and rotation to define coincident AOIs (areas of interest). Images such as those in Figure 8 are used to provide data points for the mapping function. An AOI is initially chosen by the persistence of one dye spot in a FOV. The AOI is then mapped to the other field and both are integrated (or Gaussian fit) as the image sequence cycles through excitation by the three lasers.

Fluorescence correlation spectroscopy (FCS) presents another approach for measuring some binding interactions between multiple dye-labeled biological molecules. Dyes are excited as they diffuse through a focused laser beam, and the emissions from different dye-labeled molecules show cross correlations only when those molecules are bound together. Simultaneous excitation of three and four dyes have been demonstrated (18, 19) while monitoring DNA hybridization and Qdot presence. Fluorescence correlation spectroscopy is a statistical approach for monitoring binding reactions, in that many molecules diffuse in and out of the excitation volume. However, in many prior art methods, individual complexes are not tracked, rendering correlations in single bindings and the time course of reaction pathways more difficult to interpret.

Broadband mirrors according to certain embodiments of the invention allow an observer to detect the binding of multiple molecules labeled with different dyes to an immobilized target in single-molecule experiments. This in turn allows direct measurement of individual binding (and dissociation) rate constants even when experiments are performed with mixtures of probe molecules. Such observations can more easily reveal complex kinetic interdependencies (such as tendencies for one molecule to bind only after another has already bound) than experiments that are restricted to observing the population-averaged properties of molecular ensembles.

Figure 9 shows the integrated photon flux for an 11x11 pixel AOI containing a single ssDNA template that binds to all three dye labeled oligos. Traces are identified according to both the field (<635 nm or > 635 run fluorescence) and laser excitation. The signals for binding and subsequent photobleaching (or detachment) of the three dyes are clearly resolved in the three detection channels (Fig. 9A-C). The intensity fluctuations seen in Fig. 9C are presumed to arise not from detachment and rebinding of the dye but rather from the blinking or optical switching previously reported to be characteristic of the Cy5 fluor (14, 15). Figure 9B (532 nm excitation) records the Cy3 binding at 230 seconds, and some signal attenuation features can be seen associated with FRET between the Cy3 and Cy5 (separated by 24 bp). Figure 9E displays the Cy5 field (>635 nm fluorescence) during the 532 nm excitation interval that primarily excites the Cy3 dye. Figure 9E shows cross excitation of the Cy5 by the 532 laser prior to the Cy3 binding, a leakthrough Cy3 signal pedestal that begins at 230 seconds and a FRET contribution to the Cy5 signal following the Cy3-oligo binding. Figure 9C shows the Cy5 fluorescence excited directly by the 633 nm laser and a blinking signature that is echoed in the 9B and 9E plots. The Figure 9 A data again plots the <635 nm field AOI but during the 488 nm laser excitation. The

Alexa488-oligo binding signature was observed atop a signal pedestal arising from 488nm cross excitation of the Cy3.

In Figure 9, it is the combination of laser sequencing and spatially separated fields for the Cy3/Alexa488 and Cy 5 that allows clear assignment of curve features that might otherwise obscure the binding signatures. In addition to the binding, fluorescence leakthrough (Cy3 pedestal in 9E), laser cross excitation (Cy5 excitation in 9E for t <230 sec, Cy3 pedestal in 9A) and FRET (Cy3 signal jumps in 9A for 300 < t < 400) were also observed. These features are also likely to arise in the context of interactions between labeled proteins. The photon requirement is also modest in that the Alexa488 bleached after registering only around 44x10³ photons, but a clear signature of the oligonucleotide binding was still present. The photon requirements could be generally improved by using a fused silica slide to further lower the background noise. These results show that, despite several complications contributing to the signals, it is straightforward to discern the order and specific times for the oligomer binding (Figure 9D).

The ability to observe binding reactions of different molecules to the same individual DNA allows the rate constants of the individual binding reactions and the extent to which the different reactions are interdependent to be directly determined. For example, we can readily measure the aggregate rates for hybridization of each dye-labeled oligonucleotide were readily measured and are shown in Figure 1OA. For the hybridization of the Cy5-, Cy3-, and Alexa 488-labeled oligonucleotides, aggregate second-order rate constants (27.5 ± 0.3 x 10⁵, 2.21 ± 0.01 * 10⁵, and 0.564 ± 0.004 x 10⁵ M^"1 s^"1, 0.95 C.I.) varied over a range of ~50-fold. The wide range of rates measured for these DNAs of similar lengths suggests that some of the reactions are slowed by secondary structure in the probe and/or target DNA strand. Even in this comparatively simple reaction system, one might predict that the different binding steps are not independent — the secondary structure in the target strand might be at least partially disrupted by binding of one probe oligonucleotide, resulting in faster binding of the second and third probes to react with the same target molecule. Such an effect is apparent in a comparison of the time until binding of the Cy3 and Alexa 488 oligonucleotides to individual target DNA molecules (Fig. 10B). These data reveal a tendency for Alexa 488-DNA to bind after Cy3-DNA that is more marked than would be expected for independent hybridization of the two oligonucleotides. Detailed analysis of the conditional binding probabilities (not shown) suggests that the rate constant for Alexa-488 binding is >2-fold faster to complexes that have already bound Cy3-DNA.

Examples

Oligonucleotides

Dye- or biotin-tagged DNA oligonucleotides were purchased from IDT (Coralville, IA). The Cy5, Cy3 and Alexa 488-tagged probe molecules were 5 -GTGTGTGGTCTGTGGTGTCT/Cy5/-3', 5 -GTGTCCCTCTCGAT/Cy3/-3'and 5'-/Alexa488/AGGGTTTTCCCAGTCACGAC-3^'. The sequence for the surface- tethered biotin-ssDNA was 5'-/BiOZCCAAAGACACCACAGACCACACACAAGAATCGAGAGGGACACCA ACGTCGTGACTGGGAAAACCCT-3 '. where the sequences complimentary to the Cy5, Cy3, and Alexa 488 oligonucleotides are shown with single, double, and dotted underlines, respectively. Sample preparation. Flow chambers for microscopy were prepared with two glass or one glass and one fused silica (Bond Optics, Lebanon, NH) coverslips that were cleaned (3) and then derivatized with an aminosilane reagent (Vectabond, Vector Laboratories, Burlingame, CA) according to the manufacturer's instructions except that the acetone pre-soak was eliminated to reduce background surface fluorescence. The coverslip surfaces were then derivatized with a mixture of succinimidyl (NHS) polyethylene glycol (PEG) and NHS-PEG-biotin (Nektar; Huntsville, AL) as described (3), with the following modifications: NHS-PEG and NHS-PEG-biotin were stored under dry nitrogen gas at -2O⁰C. Into a flow cell lane delimited by lines of silicone vacuum grease sandwiched between the two coverslips (typical volume 20 μl), we introduced freshly prepared 25% NHS-PEG (w/v), 0.25% NHS-PEG-biotin (w/v), 0. IM NaHCO₃, pH 8.3. The cell was incubated >3 hours, then washed with 5 x 100 μl water and then with 2 x 100 μl of 0.1 mg/ml bovine serum albumin (126615; Calbiochem; San Diego, CA) 50 mM TRIS acetate pH 8.0, 100 mM potassium acetate, 8 mM magnesium acetate, and 27 mM ammonium acetate. All subsequent DNA additions and washes used this solution. Typically, biotin-ssDNA was introduced at 160 pM and incubated for 30 minutes. To initiate the hybridization reaction, a solution containing the three dye-labeled oligonucleotides supplemented with an O₂ scavenging system (8) was introduced into the cell.

Optical system: The imaging system was constructed as a tabletop microscope using commercially available hardware and optics. The sample slides are mounted atop a precision xyz translation stage (Mad City Labs, Madison WI) used for focus and calibration of the magnification. The piezoelectric stage itself is mounted on a translation stage used for coarse positioning. The 10Ox 1.45 NA Plan-Fluar objective (Zeiss, Thornwood, NY) is in a fixed mount, and the normal spring mount for the objective is held in maximum compression by a machined collar to hold its position relative to the two small input mirrors. The two small mirrors (Edmund Optics, Barrington NJ) used to direct the input excitation lasers are positioned approximately 1 mm below the objective lens. The laser beam in this region is rapidly converging (Figure 1), and the small lens-mirror separation serves to minimize the intrusion of the mirrors into the imaging path. Further from the lens, the excitation beam is wider. Thus, to intercept the expanded excitation beam farther from the lens, the mirrors may need to intrude further into the image path. This effect may be magnified when lower refractive index coverslips, e.g. fused silica with refractive index = 1.46 or normal glass with an index = 1.52, are employed for the purpose of reducing autofluorescence (e.g., fused silica) or cost (e.g., normal glass cost relative to that for high refractive index coverslips). In that instance the mirrors are moved closer towards the center of the objective aperture (e.g., towards the optic axis) in order to direct the TIR excitation light at the angle compatible with entry into the lower index coverslip. Mirror positioning closer to the optic axis will obscure more of the image path. However, placing the mirrors in an image plane of the objective or very close to the objective, e.g., 1-2 mm or less, e.g., 0.5 mm, minimizes both the obscuration necessary and the associated signal loss.

Each mirror is cemented onto the end of a threaded rod, which is itself screwed into a miniature post/post holder (Newport, Irvine CA) that is positioned using a miniature xyz stage. The input mirror plane angle is aligned with the objective removed, so that the input laser excitation beam is perpendicular to the sample slide plane. The imaging optics are mostly rail mounted, so as to allow easy repositioning for switching between glass and fused silica sample slides. Microscope operation and image acquisition were controlled by custom software (9) implemented with Lab View (National Instruments; Austin, TX). This software also operated the laser shutters (Uniblitz; Vincent Associates, Rochester, NY) and the electron multiplying charge coupled device (EMCCD) camera (iXon 87, Andor Technology; South Windsor, CT, or Cascade 512b; Photometries; Tuscon, AZ). Uncompressed digital images were streamed continuously to disk; each frame was identified with respect to both the excitation wavelength and acquisition time to facilitate subsequent reconstruction and analysis of the image sequence. Off-line image analysis was performed with custom software implemented with Matlab (Mathworks; Natick, MA). Image alignment between the two fields of the dual view apparatus was performed using a function that accommodates small fixed differences in the relative magnifications and rotational orientations of the two fields. Intensity calibration of the camera is described below. Disk spooled frames are identified with respect to both the active lasers and time, allowing later reconstruction and analysis of the image sequence. Suitable lasers include but are not limited to Spectra Physics model 177- G02 (for the 488 nm laser line), Coherent model 31-2108 (633 nm ) and Coherent model Compas-215 M-20 (532 nm).

Camera Instensity Calibration To express the fluorescence signal detected by a camera in terms of the actual number of photons contributing to that signal, it is necessary to determine the conversion factor between the analog-to-digital units (ADU) output of the camera and the corresponding photon number. We here describe the procedure used for the calibration, which is based on measuring the signal fluctuations due to photon shot noise.

Rationale. The output u (in ADU) of a pixel on our camera is proportional to n, the number of photons registered by that pixel,

(1) u = g n , with the constant of proportionality g representing the ADU per photon. The purpose of the calibration procedure is to obtain a value for g. We may write the per pixel variance v_p as

(2) v_p = <u²> - <u>² , or equivalently as

(3) v_p = g² (<n²> - <n>²) ,

where <u> denotes the per pixel output averaged over multiple acquisitions.

Since the photon number follows a Poisson distribution, the number variance (<n²> - <ri>²) equals <n>. From Eqs. 3 and 1 we therefore obtain

(4) v_p = g² <n> ,

(5) v_p = g <u> , and

(6) Vp = g m_p ,

where m_p - <u> is the per pixel mean expressed in ADU. Eq. 6 suggests that plotting values of the per pixel variance vs. per pixel mean, obtained over a range of camera exposures, should lead to a line whose slope is the camera calibration factor g.

Method. The per pixel variance and mean were measured by a modification of the approach of Becker (Becker, P., Quantitative Fluorescence Measurements, in Fluorescence Imaging Spectroscopy (eds. Xue Feng Wang and Brian Herman) chapter 1 (John Wiley and Sons, 1996)). The camera pixel array was uniformly illuminated using a battery-powered light-emitting diode, and a 100 pixel x 200 pixel x 200 frame sequence .4(100,200,200) was saved for processing. (The large camera area was used to avoid pixel correlation effects.) We computed the per pixel mean

(7) m_v = (\ I N) ∑A{Uj,k) ,

where N = (100)(200)(200) = 4 x 10⁶ is the total number of pixels in the data set. Spurious temporal variations unrelated to photon arrival statistics arise in m_p due to intensity changes from the light emitting diode and electronic drift in the camera.

Because both of these effects are spatially uniform across the array pixels, we can eliminate this temporal drift by computing the difference of the right and left halves of each frame. (8) BQjJc) ≡ AQjJc) - AQj+lOOJc) for i,j e [1, 100], k e [1, 200] ,

The camera may also be subject to non-uniform illumination and/or pixel response that leads to spatial variations across the array. These (temporally constant) spatial variations may be removed by substracting each odd-numbered difference frame from the following even-numbered frame: (9) CQjJc) ≡ BQjZk) - BQjZk-I) for ijjc e [1, 100] .

Again, the operation of Equation 8 eliminated time-dependent drift in the frame mean; that of Equation 9 eliminated pixel-to-pixel response differences and small non- uniformities in the illumination. Summing the JVc ⁼10⁴ pixels of each frame of C yields a sequence sQc) of 100 numbers with zero mean, (\0) _S(k) = ∑C(i,j,k) ,

IJ from which we calculated v_p, the per pixel variance, as (11) Vp = (1 / 4) (1 / Nc ) (<s²> - <s>²)

In eq. 11, the factor of 1 / 4 was included because of the two subtractions in eqs. 8 and 9, each of which doubled the variance.

The above procedure was repeated to measure m_p and v_p for a series of different camera exposures typically obtained by varying the frame integration interval. A plot of these values (e.g., Fig. 11) yielded a line whose slope is g, the intensity calibration factor (eq. 6). This procedure was repeated to produce a separate calibration factor for each camera configuration (e.g. gain setting) used. For example, the data used for Figure 11₅ which was collected at a high gain setting of the electron multiplier of the EMCCD camera, yielded g = 22.5 ADU/photon. When the same camera was re-tested with the electron multiplier bypassed (data not shown), we obtained g = 0.47 ADU/photon in agreement with the g = 0.5 ADU/photon calibration factor cited by the camera manufacturer.

An additional correction to the calibration factor is required with intensified or electron multiplier cameras, which contain an amplification stage that adds additional noise to the final pixel output. This results in an excess noise factor that multiplies the camera variance expressed in Eq. 6 (Saleh, B. E., Teich, M. C. 1991. Fundamentals of Photonics, Chapter 17. John Wiley). We measured the excess noise for the electron multiplying mode (which has lower overall noise for single molecule applications) of the EMCCD cameras used in this work simply by imaging the same field of view with the camera configured both in electron multiplying mode and in "normal" mode (in which the electron multiplier is bypassed, so there is no excess noise to contend with). The integrated intensities of a single Cy3 dye imaged in the two modes were used to calculate a calibration factor corrected for excess noise. The number of photons registered by the camera may be expressed as (/Ν / g^), where I_M is the camera ADU integrated from a single Cy3 dye image in the "normal" mode and g_N is the "normal" mode calibration factor. We then express the calibration factor for the camera in the electron multiplying mode as ¹N ,

>N where I EM is the camera ADU integrated from the same Cy3 dye image with the camera in the electron multiplying mode. The values for photon number quoted in the present paper are based on the above calibration procedure including this correction for the excess noise.

References

1. Funatsu, T., Y. Harada, M. Tokunaga, K. Saito, and T. Yanagida. 1995. Imaging of single fluorescent molecules and individual ATP turnovers by single myosin molecules in aqueous solution. Nature 374:555-559.

2. Margeat, E., A. N. Kapanidis, P. Tinnefeld, Y. Wang, J. Mukhopadhyay, R. H. Ebright, and S. Weiss. 2005. Direct Observation Of Abortive Initiation And Promoter Escape Within Single Immobilized Transcription Complexes. Biophys J. 3. Rasnik, I., S. Myong, W. Cheng, T. M. Lohman, and T. Ha. 2004. DNA- binding orientation and domain conformation of the E. coli rep helicase monomer bound to a partial duplex junction: single-molecule studies of fluorescently labeled enzymes. J MoI Biol 336:395-408.

4. Blanchard, S. C, R. L. Gonzalez, H. D. Kim, S. Chu, and J. D. Puglisi. 2004. tRNA selection and kinetic proofreading in translation. Nat Struct MoI Biol

1 1:1008-1014.

5. Zhuang, X., L. E. Bartley, H. P. Babcock, R. Russell, T. Ha, D. Herschlag, and S. Chu. 2000. A single-molecule study of RNA catalysis and folding. Science 288:2048-2051. 6. Deniz, A. A., T. A. Laurence, G. S. Beligere, M. Dahan, A. B. Martin, D. S. Chemla, P. E. Dawson, P. G. Schultz, and S. Weiss. 2000. Single-molecule protein folding: diffusion fluorescence resonance energy transfer studies of the denaturation of chyrnotrypsin inhibitor 2. Proc Natl Acad Sci U S A 97:5179- 5184. 7. Hohng, S., C. Joo, and T. Ha. 2004. Single-molecule three-color FRET. Biophys J 87:1328-1337.

8. Pierce, D. W., and R. D. Vale. 1998. Assaying processive movement of kinesin by fluorescence microscopy. Methods Enzymol 298:154-171.

9. http ://www. brandeis . edu/proi ects/gelleslab/glimpse/glimpse.htrnl 10. Axelrod, D. 1989. Total internal reflection fluorescence microscopy. Methods

Cell Biol 30:245-270. 11. Tokunaga, M., K. Kitamura, K. Saito, A. H. Iwane, and T. Yanagida. 1997.

Single molecule imaging of fluorophores and enzymatic reactions achieved by objective-type total internal reflection fluorescence microscopy. Biochem Biophys Res Commun 235:47-53. 12. Kinosita, K., Jr., H. Itoh, S. Ishiwata, K. Hirano, T. Nishizaka, and T. Hayakawa. 1991. Dual- view microscopy with a single camera: real-time imaging of molecular orientations and calcium. J Cell Biol 115:67-73.

13. Yildiz, A., J. N. Forkey, S. A. McKinney, T. Ha, Y. E. Goldman, and P. R. Selvin. 2003. Myosin V walks hand-over-hand: single fluorophore imaging with 1.5-nm localization. Science 300:2061-2065.

14. Heilemann, M., E. Margeat, R. Kasper, M. Sauer, and P. Tinnefeld. 2005. Carbocyanine dyes as efficient reversible single-molecule optical switch. J Am Chem Soc 127:3801-3806. 15. Bates, M., T. R. Blosser, and X. Zhunag. 2005. Short-range spectroscopic ruler based on a single-molecule optical switch. Phys Rev Lett 94:108101. 16. Lang, M. J., P. M. Fordyce, A. M. Engh, K. C. Neuman, and S. M. Block. 2004. Simultaneous, coincident optical trapping and single-molecule fluorescence. Nat Methods 1 :133-139. 17. Nishizaka, T., K. Oiwa, H. Noji, S. Kimura, E. Muneyuki, M. Yoshida, and K. Kinosita, Jr. 2004. Chemomechanical coupling in Fl-ATPase revealed by simultaneous observation of nucleotide kinetics and rotation. Nat Struct MoI Biol 11 :142-148.

18. Heinze, K. G., M. Jahnz, and P. Schwille. 2004. Triple-color coincidence analysis: one step further in following higher order molecular complex formation. Biophys J 86:506-516.

19. Burkhardt, M., K. G. Heinze, and P. Schwille. 2005. Four-color fluorescence correlation spectroscopy realized in a grating-based detection platform. Opt Lett 30:2266-2268. Other embodiments of the invention will be apparent to those skilled in the art from a consideration of the specification or practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the invention being indicated by the following claims. What is claimed is:

Claims

1 A method of performing fluorescence microscopy, comprising employing a first broadband mirror disposed beneath an objective lens of a fluorescence microscope to direct an incident beam comprising a plurality of wavelengths into the objective lens.

2 The method of claim 1, further comprising employing a second broadband mirror disposed beneath the objective lens to direct a reflected beam away from a path for emitted rays.

3 The method of claim 2, wherein the first and second broadband mirrors reduce the contribution of autofluorescence from the objective to the emitted rays by a factor of at least 1.5.

4 The method of claim 2, wherein the first and second broadband mirrors reduce the contribution of autofluorescence from the objective to the emitted rays by a factor of at least 2.

5 The method of claim 2, further comprising positioning the first and second broadband mirrors to block no more than about 10% of the path for emitted rays.

6 The method of claim 2, further comprising positioning the first and second broadband mirrors to block no more than about 5% of the path for emitted rays.

7 The method of claim 2, further comprising positioning the first and second broadband mirrors no more than about 4% of the path for emitted rays.

8 The method of claim 1, wherein the first broadband mirror directs light selected from a predetermined range of wavelengths into the objective lens.

9 The method of claim 1, wherein the reflecting plane of the first broadband mirror is oriented at about 45° with respect to the plane of an exit pupil of the objective lens.

10 The method of claim 1, further comprising operating the microscope in total internal reflectance (TIR) mode.

11 The method of claim I₅ further comprising operating the microscope in a non- TIR mode.

12 The method of claim 1, further comprising disposing the first broadband mirror about 1-2 mm beneath the objective lens or in a plane that is an image of the plane about 1-2 mm beneath the objective lens.

13 The method of claim 1, further comprising disposing the first broadband mirror in a back focal plane of the objective lens or in a plane that is an image of the back focal plane of the objective lens.

14 A fluorescence microscope comprising an objective lens that receives an incident beam and provides a light path for rays emitted from a sample, the improvement comprising: a first broadband mirror that directs the incident beam into the objective lens, wherein the first broadband mirror is disposed with respect to the objective such that the objective lens provides a numerical aperture to the incident beam between 1.33 and 1.46 or between 1.33 and 1.52.

15 The fluorescence microscope of claim 14, further comprising a second broadband mirror.

16 The fluorescence microscope of claim 14, further comprising a blocking filter for removing scattered rays from the incident beam from the light path

17 The fluorescence microscope of claim 14, wherein the microscope is configured for use in TIR or non-TIR mode.

18 The fluorescence microscope of claim 14, further comprising a second broadband mirror to deflect a reflected beam away from a path for emitted rays.

19. The fluorescence microscope of claim 18, wherein the first and second broadband mirrors reduce the contribution of autofluorescence from the objective to the emitted rays by a factor of at least 1.5.

20. The fluorescence microscope of claim 18, wherein the first and second broadband mirrors reduce the contribution of autofluorescence from the objective to the emitted rays by a factor of at least 2.

21. The fluorescence microscope of claim 18, wherein the first and second broadband mirrors are positioned to block no more than about 10% of the path for emitted rays.

22. The fluorescence microscope of claim 18, wherein the first and second broadband mirrors are positioned to block no more than about 5% of the path for emitted rays.

23. The fluorescence microscope of claim 18, wherein the first and second broadband mirrors are positioned to block no more than about 4% of the path for emitted rays.

24. The fluorescence microscope of claim 14, wherein the first broadband mirror directs light selected from a predetermined range of wavelengths into the objective lens.

25. The fluorescence microscope of claim 14, wherein the reflective plane of the first broadband mirror is oriented at about 45° with respect to the plane of an exit pupil of the objective lens.

26. The fluorescence microscope of claim 14, wherein the first broadband mirror is disposed about 1 -2 mm beneath the objective lens.

27. The fluorescence microscope of claim 14, wherein the first broadband mirror is disposed in a plane that is an image of a plane that is between 1 and 2 mm beneath the objective lens.

28. The fluorescence microscope of claim 14, wherein the first broadband mirror is disposed in a back focal plane of the objective lens or in a plane that is an image of the back focal plane of the objective lens.