WO2006103215A1 - Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen - Google Patents
Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen Download PDFInfo
- Publication number
- WO2006103215A1 WO2006103215A1 PCT/EP2006/061069 EP2006061069W WO2006103215A1 WO 2006103215 A1 WO2006103215 A1 WO 2006103215A1 EP 2006061069 W EP2006061069 W EP 2006061069W WO 2006103215 A1 WO2006103215 A1 WO 2006103215A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hydrophobin
- hydrophobins
- cleaning agent
- hard
- treatment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09D—COATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
- C09D5/00—Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes
- C09D5/16—Antifouling paints; Underwater paints
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09D—COATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
- C09D5/00—Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes
Definitions
- hydrophobins for dirt-repellent treatment of hard surfaces
- the present invention relates to the use of hydrophobins for stain-resistant treatment of hard surfaces, in particular in combination with surface cleaning, a hard surface stain-resistant treatment, hard surface cleaners and hard surfaces having a stain-resistant coating comprising hydrophobins.
- These may be permanent, dirt-repellent coatings, for example coatings that are based on the lotus effect.
- Such a temporary soil-repelling effect can be achieved, for example, by substances in a detergent formulation which are applied during cleaning of the surface.
- Essential areas of application of such cleaners are household applications, such as cleaners for the kitchen or sanitary sector, but also industrial applications, such as cleaner for car washing.
- EP-A 467 472 discloses a composition for increasing the hydrophilicity of hard surfaces, for example household surfaces, in order to achieve easier cleaning in subsequent cleaning steps.
- the formulation contains a water-soluble, ionic or nonionic polymer, for example a cationic polymer with quaternized ammonium alkyl methacrylate units.
- the disclosed detergent formulations contain from 0.02 to 5% by weight of the polymer.
- WO 03/002620 discloses the use of (meth) acrylic acid dialkylaminoalkyl esters as soil-release polymers for hard surfaces, for example pebble floors or stainless steel surfaces.
- the disclosed detergent formulations contain from 0.1% to 5% by weight of the polymer.
- DE-A 100 61 897 discloses cleaning agents which contain hydrophilic, silicate-containing particles which lead to an improved soil release while at the same time reducing redeposition.
- the particles deposit on the surface of the substrates to be cleaned and thus change the surface properties.
- Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units.
- Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces.
- Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
- Hydrophobins can be isolated from natural sources. However, it is also possible to synthesize non-naturally occurring hydrophobins by means of chemical and / or biotechnological production processes. Our earlier application DE 102005007480.4 discloses a preparation process for hydrophobins which are not found in nature.
- WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams and cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed.
- EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fuming, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C.
- WO 03/53383 discloses the use of hydrophobins for treating keratin materials in cosmetic applications.
- WO 03/10331 discloses a hydrophobin-coated sensor, for example a measuring electrode, to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
- the soil-repellent treatment is carried out in combination with a cleaning of the surface.
- the invention in a second aspect, relates to a method for stain resistant hard surface treatment comprising contacting the surface with a composition comprising at least one hydrophobin and at least one solvent.
- the invention in a third aspect, relates to a cleaning agent for hard surfaces, which comprises at least one hydrophobin, at least one surfactant and at least one solvent.
- the invention in a fourth aspect, relates to hard surfaces comprising a hydrophobin-containing, soil-repellent coating.
- hard surfaces is known to those skilled in the art and is not or only slightly compressible surfaces, in particular smooth surfaces, for example surfaces of glass, ceramics, metals, such as stainless steel or brass, enamel, plastic and / or.
- painted surfaces include the surface of painted automotive bodies or the surface of household appliances, and the hard surfaces may be, in particular, typical household surfaces, such as the surface of tiles, floors, fixtures, sinks, etc.
- Dirt-repellent is known to the person skilled in the art, which prevents or prevents their contamination by means of a dirt-repellent treatment of a surface at least more difficult and / or facilitates the detachment of dirt from the surface.
- Dirt is in a known manner to all types of unwanted contamination of hard surfaces with solid and / or liquid substances.
- Examples of dirt include fats, oils, egg whites, leftovers, dust or soil.
- Contaminations can also be calcium deposits, such as dried-on traces of water that form due to the hardness of the water.
- Other examples include residues of personal care cleaners and conditioners, or insoluble lime soaps which may form from such cleansing and conditioning agents associated with water hardness, and which may be deposited on hard surfaces such as sinks, shower trays or bathtubs.
- At least one hydrophobin is used for the dirt-repellent treatment of the hard surfaces. Only one hydrophobin or a mixture of several different hydrophobins can be used.
- hydrophobins in the context of this invention is to be understood below as meaning polypeptides of the general structural formula (I)
- X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, He Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
- X may be the same or different.
- the indices standing at X each represent the number of amino acids
- C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the amino acids denoted by C represent cysteine
- the indices n and m are independent of each other for natural numbers of 0 and 500, preferably 15 to 300.
- the polypetides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 °, more preferably at least 30 °, and most preferably at least 35 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
- the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or can be mixed with one another. train sulfide bridges. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to replace those C positions in pairs, which can form intramolecular disulfide bridges with one another.
- cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C positions in the general formulas may change accordingly.
- X, C and the indices standing at X have the above meaning
- the subscripts n and m are numbers between 0 and 300
- the proteins are further characterized by the above-mentioned contact angle change.
- X, C and the indices standing at X have the above meaning
- the indices n and m are numbers between 0 and 200
- the proteins continue to be characterized by the contact angle change mentioned above, and at least 6 of the C named amino acids is cysteine. Most preferably, all amino acids C are cysteine.
- radicals X n and X m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X m are to be understood, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
- X n and / or X m are naturally non-hydrophobic peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length.
- Remainder not linked to a hydrophobin should also be referred to below as a fusion partner. This is to say that the proteins consist of a hydrophobin part and a fusion partner part, which in nature do not coexist in this form.
- the fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X m ) of the protein according to the invention.
- fusion partners are polypeptides that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
- fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18) and thioredoxin.
- fragments or derivatives of said sequences which comprise only a part, preferably 70-99%, particularly preferably 80-98% of said sequences, or in which individual amino acids or nucleotides are altered relative to said sequence.
- proteins used according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
- One property of the proteins used in the invention is the change in surface properties when the surfaces are coated with the proteins.
- the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating a surface with the protein and determining the difference between the two measurements.
- the implementation of contact angle measurements is known in principle to the person skilled in the art.
- the exact experimental conditions for measuring the contact angle are shown in the experimental section.
- the proteins used according to the invention have the property of increasing the contact angle of a water drop on a glass surface by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °.
- a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 is significantly shorter in class II hydrophobins than in class I hydrophobins. Class II hydrophobins also have more charged amino acids than class I.
- hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basF, basf2, which are structurally characterized in the following sequence listing. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobins, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
- fusion proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding for them, in particular the sequences according to SEQ ID NO: 19, 21, 23.
- proteins which are starting from the sequences shown in SEQ ID NO. 20, 22 or 24 represented by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins are particularly preferred embodiments.
- the biological property of the proteins is understood to mean the already described change in the contact angle by at least 20 °.
- polypeptides used according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merri- field.
- Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
- fusion proteins can preferably be effected by genetic engineering processes in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular a DNA sequence, are combined in such a way that that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
- a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular a DNA sequence are combined in such a way that that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
- Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
- prokaryotes including archaea
- eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Asperg
- expression constructs obtained under the genetic control of regulatory nucleic acid sequences a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs for the production of hydrophobins can be used.
- constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
- “Operational linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.
- operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
- Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- a preferred nucleic acid construct advantageously also contains one or more of the aforementioned "enhancer" sequences operably linked to the promoter allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
- the nucleic acids may be contained in one or more copies in the construct.
- the construct may also contain further markers such as antibiotic resistance or auxotrophic complementing genes, optionally for selection on the construct.
- Advantageous regulatory sequences for the method are, for example, in promoters such as cos, tac, trp, tet, trp tet, lpp, lac, lpp-lac, laclq T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
- Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1.MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
- the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
- a vector such as a plasmid or a phage
- all other vectors known to the person skilled in the art ie, z.
- viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
- vectors can be autonomously replicated in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
- Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-III "3-B1, tgt11 or pBdCI, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium for pSA77 or pAJ667, in fungi pALS1, pIL12 or pBB116, in yeasts 2alpha, pAG-1,
- the nucleic acid construct additionally contains 3'- and / or 5'-terminal regulatory sequences for the expression of the further genes contained. tion of expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
- genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
- the regulatory sequences or factors may preferably have a positive effect on the gene expression of the introduced genes and thereby increase it.
- enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
- an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
- the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
- This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
- An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
- Common recombination and cloning techniques are used, such as those described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
- the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
- Vectors are well known to those skilled in the art and may be taken, for example, from "Cloning Vectors" (Pouwels PH et al., Eds., Elsevier, Amsterdam-New York-Oxford, 1985). With the help of the vectors recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the polypeptides used in the invention.
- the recombinant constructs described above are introduced into a suitable host system and expressed.
- Homologously recombined microorganisms can also be produced.
- a vector is prepared which contains at least a portion of a gene or a coding sequence to be used according to the invention, wherein optionally at least one amino acid deletion, addition or substitution has been introduced to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector).
- the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
- the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be altered such that thereby the expression of the endogenous protein is changed).
- the altered portion of the gene used according to the invention is in the homologous recombination vector.
- suitable vectors for homologous recombination is e.g. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.
- prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid or nucleic acid construct used according to the invention.
- microorganisms such as bacteria, fungi or yeast are used as host organisms.
- Gram-positive or gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are advantageously used .
- the organisms used in the production process for fusion proteins are grown or bred, depending on the host organism, in a manner known to those skilled in the art.
- Microorganisms are usually stored in a liquid medium containing a carbon source, usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and, where appropriate, vitamins, at temperatures between 0 undiOO 0 C, preferably between 10 to 60 0 C attracted to oxygen.
- the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
- the cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
- the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
- the polypeptides or functional, biologically active fragments thereof used according to the invention can be prepared by means of a recombinant process in which a polypeptide-producing microorganism is cultured, optionally the expression of the polypeptides induced and isolated from the culture.
- the polypeptides can thus also be produced on an industrial scale, if desired.
- the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
- the cells are then disrupted if the polypeptides are not secreted into the culture medium and the product recovered from the lysate by known protein isolation techniques.
- the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
- Purification of the polypeptides can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other conventional methods, such as ultrafiltration, crystallization, salting out , Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, FG, Biochemische Harvey Methoden, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
- vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered polypeptides or fusion proteins which serve, for example, a simpler purification.
- suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press).
- Suitable tags include HA, calmodulin BD, GST, MBD; Chitin-BD, Steptavidin-BD-Avi-Tag, Flag-Tag, T7 etc.
- anchors can be used to attach the proteins to a solid support, such as.
- a polymer matrix serve, which may be filled for example in a chromatography column, or may be used on a microtiter plate or other carrier.
- the corresponding purification protocols are available from the commercial affinity tag providers.
- the proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner as "pure" hydrophobins.
- a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
- Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools.
- Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
- the hydrophobins can be used in bulk.
- the hydrophobins are preferably used as formulations or compositions in at least one suitable solvent.
- hydrophobins for carrying out the invention are not limited. It is possible to use one hydrophobin or else several different ones. The skilled person makes a suitable choice. For example, fusion proteins such as yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) can be used.
- the solvents for formulations may be water and / or organic solvents. Of course, solvent mixtures can also be used.
- the type of solvent depends on the hydrophobin, the type of acting surface and the application and will be selected by the expert. For household applications, water or aqueous formulations are generally preferred. In industrial applications, both aqueous, predominantly aqueous and non-aqueous formulations are suitable.
- the solvent is preferably water or mixtures of water and water-miscible organic solvents.
- organic solvents include water-miscible monohydric or polyhydric alcohols, such as, for example, methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerol.
- it may also be ether alcohols.
- examples include monoalkyl ethers of (poly) ethylene or (poly) propylene glycols such as ethylene glycol monobutyl ether.
- the type and amount of water-soluble and organic solvents are chosen by the person skilled in the art.
- aqueous mixtures contain at least 80% by weight of water with respect to the sum of all solvents.
- Preferred solvents besides water are alcohols.
- the aqueous solutions of the hydrophobins obtained in the synthesis, isolation and / or purification of the hydrophobins can preferably be used. Depending on their purity, they may also contain residues of auxiliaries from the synthesis.
- the hydrophobins can also initially be isolated as a substance, for example by freeze-drying, and formulated in a second step.
- the amount of hydrophobins in the formulation may be determined by those skilled in the art according to the nature of the surface and / or application. But there are already relatively small amounts sufficient to achieve a dirt-repellent effect. An amount of from 0.0001 to 1% by weight with respect to the sum of all constituents of the formulation has proven useful, without the invention being restricted to this range. The amount is preferably from 0.0005 to 0.5% by weight and more preferably from 0.001 to 0.1% by weight.
- the composition used is preferably a cleaning agent, for example glass cleaner, floor cleaner, all-purpose cleaner, bathroom cleaner, rinse aid, dishwashing detergent for hand or machine cleaning of dishes, machine cleaners, metal degreasers, high-pressure cleaners, alkaline cleaners, acid cleaners, top degreasers or dairy cleaners ,
- the cleaning agent according to the invention comprises in addition to a solvent and at least one hydrophobin in a manner known in principle one or more surfactants in effective amounts.
- compositions may also be hard surface pretreatment or post-treatment agents, in particular glass, ceramics or floors.
- the surfactants may be anionic, nonionic, amphoteric and / or cationic surfactants. Such surfactants and their particular preferred purpose are known in principle to those skilled in the art.
- anionic surfactants include fatty alcohol sulfates, alkyl ether sulfates, alkanesulfonates, alkylbenzenesulfonates or alkyl phosphates.
- the free acids or salts thereof can be used.
- nonionic surfactants include alkoxylated C 8 -C 22 alcohols, such as fatty alcohol alkoxylates or oxo alcohol alkoxylates, alkylphenol ethoxylates having C 6 -C 14 -alkyl chains and from 5 to 30 moles of ethylene oxide units, alkyl polyglucosides having from 8 to 22 in the alkyl chain, alkylamine alkoxylates or alkylamide ethoxylates.
- alkoxylated C 8 -C 22 alcohols such as fatty alcohol alkoxylates or oxo alcohol alkoxylates, alkylphenol ethoxylates having C 6 -C 14 -alkyl chains and from 5 to 30 moles of ethylene oxide units, alkyl polyglucosides having from 8 to 22 in the alkyl chain, alkylamine alkoxylates or alkylamide ethoxylates.
- amphoteric surfactants include alkyl betaines, alkyl amide betaines, aminopropionates, aminoglycinates or amphoteric imidazolium compounds.
- cationic surfactants include substituted or unsubstituted, geradketti- ge or branched quaternary ammonium salts, for example C 8 - 6 -Dialkyldimethylammonium- halides, imidazolium dialkoxydimethylammonium halides or with all, long chain alkyl tigern.
- the formulation may optionally further comprise further components, for example additives and / or auxiliaries.
- additives and / or auxiliaries include acids or bases, for example, carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO 2 or silicates, dyes, fragrances or biocides.
- Further examples of additives are listed in DE-A 101 60 993, in particular Sections [0074] to [0131]. The person skilled in the art makes a suitable choice with regard to the type and amount of additional components, depending on the application.
- the hard surface antisoiling treatment is accomplished by contacting the hard surface with a composition comprising at least one hydrophobin and at least one solvent.
- the "contacting" depends on the nature of the article, for example, by spraying, rinsing or wiping the surface with the composition, or by dipping the entire article in the formulation, which is naturally only for non-installed objects
- the duration of the treatment is determined by a specialist and may take from a few seconds to several hours, after which the surface can be rinsed to remove excess treatment solution, for example with water.
- the antisoiling treatment may be particularly advantageously used in combination with a cleaning, i. take place in the course of the actual cleaning process itself.
- a cleaning agent is used which, as described above, comprises at least one hydrophobin, at least one surfactant and at least one solvent.
- the treatment can be carried out at temperatures below room temperature, can be carried out at room temperature or at elevated temperatures, for example at 20 to 100 ° C, preferably 20 to 60 0 C.
- the treatment at temperatures of not more than 30 0 C is performed, in particular 20 to 30 0 C.
- the treated surface After treating with the composition, the treated surface is dried. Drying of the treated surface can, as it were, be done at room temperature, or it can be dried at elevated temperatures.
- the treatment and optionally the drying of the surface may be followed by a thermal aftertreatment of the surface at elevated temperatures, for example at temperatures of up to 120.degree.
- the thermal aftertreatment can of course also be combined with the drying.
- the temperatures are in a thermal post-treatment 30 to 100 ° C, particularly preferably 40 to 80 0 C and for example 50 to 70 0 C.
- the duration of treatment will be determined by the skilled man, for example it may be from 1 min to 10 h.
- a hard surface which has a dirt-repellent coating comprising at least one hydrophobin.
- the coating is usually at least one monomolecular layer of the hydrophobin on the surface.
- the antisoiling effect can be determined by methods known in the art, for example by comparing the removability of soil by rinsing with water from an untreated and a hydrophobin-treated surface.
- the hydrophobins have a clear effect even in small amounts. Already the treatment with a composition containing only 0.01% by weight of hydrophobins leads to a significantly improved soil release.
- the inventive, dirt-repellent treatment is particularly advantageous for ceramic surfaces, such as tiles.
- the treatment can also achieve a clear hydrophobization of the surface. This is a further advantage, especially in damp rooms, such as bathrooms.
- Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
- the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
- the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
- This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
- the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
- Hal570 gcgcgcccatggctcaaacaggtactga
- Hal571 gcagatctccagccgcgttcttgcatac
- Hal572 ggccatgggattaacaataggtgtactagg
- Hal573 gcagatcttacaagtgccttttgcttatattcc
- the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
- the template DNA used was genomic DNA of the mold Aspergillus nidulans.
- the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
- the PCR fragment was purified and digested with the restriction endonuclease se BamHI cut. This DNA fragment was used as insitu and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BglII.
- the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
- KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
- KaM417 CCCGTAG CTAGTG G ATCCATTG AAGG CCG CATGAAGTTCTCCGTCTCCGC
- plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
- KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
- plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
- KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C
- Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
- KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG
- Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
- the template DNA used was Schyzophyllum commune cDNA (see Appendix).
- KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC KaM465: G CTAACAG ATCTATGTTCGCCCGTCTCCCCGTCGT
- 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
- the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated.
- filter with a glass cartridge P1.
- two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH; Microfluidics Corp.).
- the homogenate is centrifuged (Sorvall RC-5B GSA rotor, 250 ml centrifuge tube, 60 minutes, 4 0 C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5, resuspended , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition.
- 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
- the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
- Figure 1 shows the purification of the prepared hydrophobin
- Lanes 3 - 5 OD 280 maxima of the elution fractions
- the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
- the smaller bands partially represent degradation products of the hydrophobin.
- the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
- a solution of the fusion protein yaad-Xa-dewA-his (SEQ ID NO: 19) prepared according to Example 8 was used in water.
- Ceramic tile glossy white, 10 cm x 15 cm (Novocker), wiped with ethanol and water.
- aqueous hydrophobin solution having a concentration of 100 ⁇ g / ml was dropped (1.3 ⁇ m hydrophobin / cm 2 ) and gently rubbed with a cloth so that the entire surface was covered. The tile was then dried lying for 24 h in air.
- the tile was then rinsed with water and placed in a beaker of water for 3 ⁇ 10 min. Fresh water was used for each rinse. The tile was then dried standing in air. Contact angle measurement and dirt repellent effect
- the tiles were then rinsed 3 times with 500 ml each of water. While the dirt did not detach from the untreated surface, a partial removal of soil from the hydrophobin-pretreated tile was observed.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Materials Engineering (AREA)
- Detergent Compositions (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Cleaning And De-Greasing Of Metallic Materials By Chemical Methods (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020077023724A KR101250067B1 (ko) | 2005-03-30 | 2006-03-27 | 경질 표면 방오 처리를 위한 하이드로포빈의 용도 |
| BRPI0609541-0A BRPI0609541A2 (pt) | 2005-03-30 | 2006-03-27 | uso de hidrofobinas, processo para tratar superfìcies duras de forma a repelir sujeira, agente de limpeza, e, superfìcie dura |
| CA002602155A CA2602155A1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
| JP2008503492A JP5064376B2 (ja) | 2005-03-30 | 2006-03-27 | 硬質表面の防汚処理へのハイドロフォビンの使用方法 |
| EP06725335A EP1866401B1 (de) | 2005-03-30 | 2006-03-27 | Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen |
| CN200680009940.0A CN101151359B (zh) | 2005-03-30 | 2006-03-27 | 疏水蛋白在硬表面防污处理中的用途 |
| MX2007012023A MX2007012023A (es) | 2005-03-30 | 2006-03-27 | Uso de hidrofobina para tratamiento repelente a suciedad de superficies duras. |
| US11/887,129 US20090305930A1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
| DE502006007963T DE502006007963D1 (de) | 2005-03-30 | 2006-03-27 | Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen |
| AT06725335T ATE483009T1 (de) | 2005-03-30 | 2006-03-27 | Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE200510014844 DE102005014844A1 (de) | 2005-03-30 | 2005-03-30 | Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen |
| DE102005014844.1 | 2005-03-30 | ||
| DE200510036341 DE102005036341A1 (de) | 2005-07-29 | 2005-07-29 | Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen |
| DE102005036341.5 | 2005-07-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2006103215A1 true WO2006103215A1 (de) | 2006-10-05 |
Family
ID=36602657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2006/061069 Ceased WO2006103215A1 (de) | 2005-03-30 | 2006-03-27 | Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20090305930A1 (https=) |
| EP (1) | EP1866401B1 (https=) |
| JP (1) | JP5064376B2 (https=) |
| KR (1) | KR101250067B1 (https=) |
| AT (1) | ATE483009T1 (https=) |
| BR (1) | BRPI0609541A2 (https=) |
| CA (1) | CA2602155A1 (https=) |
| DE (1) | DE502006007963D1 (https=) |
| MX (1) | MX2007012023A (https=) |
| WO (1) | WO2006103215A1 (https=) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007014897A1 (de) * | 2005-08-01 | 2007-02-08 | Basf Se | Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche |
| WO2006131564A3 (de) * | 2005-06-10 | 2007-06-07 | Basf Ag | Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung |
| WO2008142111A1 (de) * | 2007-05-24 | 2008-11-27 | Basf Se | Verwendung von hydrophobinen als hilfsmittel bei der kristallisation von feststoffen |
| EP2042155A1 (de) | 2007-09-28 | 2009-04-01 | Basf Se | Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen |
| WO2008110456A3 (en) * | 2007-03-12 | 2009-05-22 | Ciba Holding Inc | Method of treating cellulosic materials with hydrophobins |
| WO2010072665A1 (de) | 2008-12-23 | 2010-07-01 | Basf Se | Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen |
| WO2010102934A1 (de) | 2009-03-09 | 2010-09-16 | Basf Se | Verwendung einer mischung aus wasserloslichen polymeren und hydrophobinen zum verdicken wässriger phasen |
| US7799741B2 (en) | 2005-04-01 | 2010-09-21 | Basf Se | Drilling mud containing hydrophobin |
| WO2011015530A2 (en) | 2009-08-03 | 2011-02-10 | Basf Se | Process for deposition of thin layers of metal oxides |
| US7892788B2 (en) | 2005-02-07 | 2011-02-22 | Basf Se | Hydrophobin fusion products, production and use thereof |
| WO2011101457A1 (en) | 2010-02-18 | 2011-08-25 | B.R.A.I.N. Biotechnology Research And Information Network Ag | Chimeric surface active proteins |
| EP2371844A1 (en) | 2010-03-25 | 2011-10-05 | B.R.A.I.N. Biotechnology Research and Information Network AG | Chimeric surface active proteins |
| WO2011121009A1 (en) | 2010-03-31 | 2011-10-06 | Basf Se | Coated stents and process for coating with protein |
| US8038740B2 (en) | 2005-10-12 | 2011-10-18 | Basf Se | Use of proteins as an antifoaming constituent in fuels |
| US20120006354A1 (en) * | 2010-07-07 | 2012-01-12 | Basf Se | Composition and method for cleaning surfaces |
| US8096484B2 (en) | 2006-08-15 | 2012-01-17 | Basf Se | Method for the production of dry free-flowing hydrophobin preparations |
| WO2012049250A2 (de) | 2010-10-13 | 2012-04-19 | Basf Se | Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen |
| US8173716B2 (en) | 2007-03-06 | 2012-05-08 | Basf Se | Open-cell foam modified with hydrophobines |
| US8535535B2 (en) | 2005-04-01 | 2013-09-17 | Basf Se | Use of hydrophobin as a phase stabilizer |
| EP2676680A1 (de) | 2007-09-13 | 2013-12-25 | Basf Se | Verwendung von Hydrophobin-Polipeptiden als Penetrationsverstärker |
| US8859106B2 (en) | 2005-03-31 | 2014-10-14 | Basf Se | Use of polypeptides in the form of adhesive agents |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102005033002A1 (de) * | 2005-07-14 | 2007-01-18 | Basf Ag | Wässrige Monomeremulsionen enthaltend Hydrophobin |
| EP3243894A1 (en) * | 2016-05-10 | 2017-11-15 | The Procter and Gamble Company | Cleaning composition |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001057066A2 (en) * | 2000-02-04 | 2001-08-09 | Applied Nanosystems B.V. | Method of stabilizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin |
| WO2003053383A2 (fr) * | 2001-12-14 | 2003-07-03 | L'oreal | Utilisation cosmetique d’au moins une hydrophobine pour le traitement des matieres keratiniques |
| WO2005033316A2 (de) * | 2003-09-16 | 2005-04-14 | Basf Aktiengesellschaft | Sekretion von proteinen aus hefen |
| WO2005068087A2 (en) * | 2004-01-16 | 2005-07-28 | Applied Nanosystems B.V. | Method for coating an object with hydrophobin at low temperatures |
| US20060040349A1 (en) * | 2004-08-18 | 2006-02-23 | Sweigard James A | Thermophilic hydrophobin proteins and applications for surface modification |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2399161A (en) * | 1942-06-30 | 1946-04-30 | Claude R Wickard | Process for producing glues and adhesives from keratin protein materials |
| GB1278924A (en) * | 1970-02-06 | 1972-06-21 | Ici Ltd | Improvements in synthetic film materials |
| DE2609104A1 (de) * | 1976-03-05 | 1977-09-15 | Basf Ag | Verfahren zur herstellung von styrol-suspensionspolymerisaten |
| DE2638839A1 (de) * | 1976-08-28 | 1978-03-02 | Basf Ag | Verfahren zur herstellung von styrol-suspensionspolymerisaten |
| US5049504A (en) * | 1986-11-24 | 1991-09-17 | Genex Corporation | Bioadhesive coding sequences |
| JPS6323670A (ja) * | 1986-04-25 | 1988-01-30 | バイオ−ポリマ−ズ インコ−ポレ−テツド | 接着・被覆組成物とその使用方法 |
| DE4024871A1 (de) * | 1990-08-06 | 1992-02-13 | Basf Ag | Perlfoermige antistatische expandierbare styrolpolymerisate |
| DE10131371A1 (de) * | 2001-06-28 | 2003-01-16 | Clariant Gmbh | Verwendung von quaternierten (Meth)Acrylsäuredialkylaminoalkylestern als Soil Release Polymere für harte Oberflächen, sowie ein Verfahen zu deren Herstellung |
| DE4220225A1 (de) * | 1992-06-20 | 1993-12-23 | Basf Ag | Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten |
| IL110938A (en) * | 1994-09-12 | 2001-01-28 | Haber Meir | Adhesive proteins isolated from mature macro and microalgae |
| AU5914196A (en) * | 1995-06-12 | 1997-01-09 | Proefstation Voor De Champignoncultuur | Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof |
| DE19956802A1 (de) * | 1999-11-25 | 2001-06-13 | Cognis Deutschland Gmbh | Waschmitteltabletten |
| GB0002663D0 (en) * | 2000-02-04 | 2000-03-29 | Biomade B V | Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin |
| WO2002020651A2 (en) * | 2000-09-06 | 2002-03-14 | Zymogenetics, Inc. | Human phermone polypeptide |
| DE10061897A1 (de) * | 2000-12-12 | 2002-06-13 | Clariant Gmbh | Wasch- und Reinigungsmittel, enthaltend mikrodisperse silikathaltige Partikel |
| EP1279742A1 (en) * | 2001-07-23 | 2003-01-29 | Applied NanoSystems B.V. | Method of binding a compound to a sensor surface using hydrophobin |
| CA2602158A1 (en) * | 2005-03-30 | 2006-10-05 | Basf Aktiengesellschaft | Use of hydrophobins for the surface treatment of hardened mineral building materials, natural stone and ceramics |
-
2006
- 2006-03-27 KR KR1020077023724A patent/KR101250067B1/ko not_active Expired - Fee Related
- 2006-03-27 BR BRPI0609541-0A patent/BRPI0609541A2/pt not_active IP Right Cessation
- 2006-03-27 WO PCT/EP2006/061069 patent/WO2006103215A1/de not_active Ceased
- 2006-03-27 JP JP2008503492A patent/JP5064376B2/ja not_active Expired - Fee Related
- 2006-03-27 CA CA002602155A patent/CA2602155A1/en not_active Abandoned
- 2006-03-27 EP EP06725335A patent/EP1866401B1/de not_active Expired - Lifetime
- 2006-03-27 DE DE502006007963T patent/DE502006007963D1/de not_active Expired - Lifetime
- 2006-03-27 AT AT06725335T patent/ATE483009T1/de active
- 2006-03-27 US US11/887,129 patent/US20090305930A1/en not_active Abandoned
- 2006-03-27 MX MX2007012023A patent/MX2007012023A/es active IP Right Grant
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001057066A2 (en) * | 2000-02-04 | 2001-08-09 | Applied Nanosystems B.V. | Method of stabilizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin |
| WO2003053383A2 (fr) * | 2001-12-14 | 2003-07-03 | L'oreal | Utilisation cosmetique d’au moins une hydrophobine pour le traitement des matieres keratiniques |
| WO2005033316A2 (de) * | 2003-09-16 | 2005-04-14 | Basf Aktiengesellschaft | Sekretion von proteinen aus hefen |
| WO2005068087A2 (en) * | 2004-01-16 | 2005-07-28 | Applied Nanosystems B.V. | Method for coating an object with hydrophobin at low temperatures |
| US20060040349A1 (en) * | 2004-08-18 | 2006-02-23 | Sweigard James A | Thermophilic hydrophobin proteins and applications for surface modification |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7892788B2 (en) | 2005-02-07 | 2011-02-22 | Basf Se | Hydrophobin fusion products, production and use thereof |
| US8859106B2 (en) | 2005-03-31 | 2014-10-14 | Basf Se | Use of polypeptides in the form of adhesive agents |
| US8535535B2 (en) | 2005-04-01 | 2013-09-17 | Basf Se | Use of hydrophobin as a phase stabilizer |
| US7799741B2 (en) | 2005-04-01 | 2010-09-21 | Basf Se | Drilling mud containing hydrophobin |
| WO2006131564A3 (de) * | 2005-06-10 | 2007-06-07 | Basf Ag | Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung |
| US7910699B2 (en) | 2005-06-10 | 2011-03-22 | Basf Se | Cysteine-depleted hydrophobin fusion proteins, their production and use thereof |
| WO2007014897A1 (de) * | 2005-08-01 | 2007-02-08 | Basf Se | Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche |
| US8038740B2 (en) | 2005-10-12 | 2011-10-18 | Basf Se | Use of proteins as an antifoaming constituent in fuels |
| US8096484B2 (en) | 2006-08-15 | 2012-01-17 | Basf Se | Method for the production of dry free-flowing hydrophobin preparations |
| US8173716B2 (en) | 2007-03-06 | 2012-05-08 | Basf Se | Open-cell foam modified with hydrophobines |
| WO2008110456A3 (en) * | 2007-03-12 | 2009-05-22 | Ciba Holding Inc | Method of treating cellulosic materials with hydrophobins |
| US8455107B2 (en) | 2007-03-12 | 2013-06-04 | Basf Se | Method of treating cellulosic materials with hydrophobins |
| WO2008142111A1 (de) * | 2007-05-24 | 2008-11-27 | Basf Se | Verwendung von hydrophobinen als hilfsmittel bei der kristallisation von feststoffen |
| EP2676680A1 (de) | 2007-09-13 | 2013-12-25 | Basf Se | Verwendung von Hydrophobin-Polipeptiden als Penetrationsverstärker |
| EP2042155A1 (de) | 2007-09-28 | 2009-04-01 | Basf Se | Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen |
| WO2009050000A1 (de) * | 2007-09-28 | 2009-04-23 | Basf Se | Verfahren zum entfernen von wasserunlöslichen substanzen von substratoberflächen |
| EP2042156A1 (de) * | 2007-09-28 | 2009-04-01 | Basf Se | Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen |
| WO2010072665A1 (de) | 2008-12-23 | 2010-07-01 | Basf Se | Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen |
| WO2010102934A1 (de) | 2009-03-09 | 2010-09-16 | Basf Se | Verwendung einer mischung aus wasserloslichen polymeren und hydrophobinen zum verdicken wässriger phasen |
| WO2011015530A2 (en) | 2009-08-03 | 2011-02-10 | Basf Se | Process for deposition of thin layers of metal oxides |
| WO2011101457A1 (en) | 2010-02-18 | 2011-08-25 | B.R.A.I.N. Biotechnology Research And Information Network Ag | Chimeric surface active proteins |
| EP2371844A1 (en) | 2010-03-25 | 2011-10-05 | B.R.A.I.N. Biotechnology Research and Information Network AG | Chimeric surface active proteins |
| WO2011121009A1 (en) | 2010-03-31 | 2011-10-06 | Basf Se | Coated stents and process for coating with protein |
| US20120006354A1 (en) * | 2010-07-07 | 2012-01-12 | Basf Se | Composition and method for cleaning surfaces |
| WO2012004255A1 (de) | 2010-07-07 | 2012-01-12 | Basf Se | Zusammensetzung enthaltend ein hydrophobin und verfahren zum reinigen von hydrophoben oberflächen |
| WO2012049250A2 (de) | 2010-10-13 | 2012-04-19 | Basf Se | Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1866401A1 (de) | 2007-12-19 |
| KR101250067B1 (ko) | 2013-04-03 |
| JP5064376B2 (ja) | 2012-10-31 |
| CA2602155A1 (en) | 2006-10-05 |
| JP2008534726A (ja) | 2008-08-28 |
| US20090305930A1 (en) | 2009-12-10 |
| KR20080000590A (ko) | 2008-01-02 |
| EP1866401B1 (de) | 2010-09-29 |
| ATE483009T1 (de) | 2010-10-15 |
| BRPI0609541A2 (pt) | 2011-10-18 |
| DE502006007963D1 (de) | 2010-11-11 |
| MX2007012023A (es) | 2007-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1866401B1 (de) | Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen | |
| EP1913123B1 (de) | Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche | |
| EP1866106B1 (de) | Verwendung von hydrophobinen zur oberflächenbehandlung von gehärteten mineralischen baustoffen, naturstein, kunststein und keramiken | |
| EP1848733B1 (de) | Neue hydrophobinfusionsproteine, deren herstellung und verwendung | |
| EP1893639A2 (de) | Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung | |
| EP1848734A2 (de) | Verfahren zum beschichten von oberflächen mit hydrophobinen | |
| EP1866150B1 (de) | Metallische substrate mit polypeptiden als haftvermittler | |
| EP1869138B1 (de) | Bohrspülung enthaltend hydrophobin | |
| DE102005048720A1 (de) | Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen | |
| EP1891261A2 (de) | Verfahren zur beschichtung von oberflächen von faserigen substraten | |
| EP1893675B9 (de) | Hydrophobin als beschichtungsmittel für expandierbare oder expandierte, thermoplastische polymerpartikel | |
| DE102005025969A1 (de) | Verfahren zur Verringerung der Verdunstungsgeschwindigkeit von Flüssigkeiten | |
| DE102005036341A1 (de) | Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen | |
| DE102005014844A1 (de) | Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen | |
| DE102005015043A1 (de) | Verwendung von Polypeptiden als Haftvermittler | |
| DE102005007480A1 (de) | Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung | |
| DE102005051515A1 (de) | Verfahren zum Beschichten von Oberflächen mit Hydrophobinen | |
| DE102005036339A1 (de) | Verwendung von Hydrophobinen zur Oberflächenbehandlung von gehärteten mineralischen Baustoffen, Naturstein, Kunststein und Keramiken | |
| DE102005026143A1 (de) | Verfahren zur Beschichtung von Oberflächen von faserigen Substraten | |
| DE102005005737A1 (de) | Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung | |
| DE102005030786A1 (de) | Verfahren zur Beschichtung von Oberflächen von faserigen Substraten | |
| DE102005014843A1 (de) | Verwendung von Hydrophobinen zur Oberflächenbehandlung von gehärteten mineralischen Baustoffen, Naturstein, Kunststein und Keramiken |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006725335 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2602155 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11887129 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008503492 Country of ref document: JP Ref document number: 200680009940.0 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/012023 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020077023724 Country of ref document: KR |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: RU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006725335 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0609541 Country of ref document: BR Kind code of ref document: A2 Effective date: 20070928 |