WO2006102209A2 - Cd34(+) cells and their methods of use - Google Patents
Cd34(+) cells and their methods of use Download PDFInfo
- Publication number
- WO2006102209A2 WO2006102209A2 PCT/US2006/009974 US2006009974W WO2006102209A2 WO 2006102209 A2 WO2006102209 A2 WO 2006102209A2 US 2006009974 W US2006009974 W US 2006009974W WO 2006102209 A2 WO2006102209 A2 WO 2006102209A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- cd45ra
- bright
- cell
- dim
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0646—Natural killers cells [NK], NKT cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
Definitions
- the present invention relates to a novel CD34 (+) cell line, which can be found in human lymph nodes, and is called CD34 dim CD45RA (+) /3 7 b ⁇ ght . Methods for isolating the novel cell type from tissue and methods for its use are also provided.
- Human natural killer (NK) cells are CD3(-)CD14(-)CD56(+) large granular lymphocytes that can kill infected or transformed cells that fail to express normal MHC class I molecules, thereby complementing protection provided by T cells. Similar to other lymphocytes, the total human NK cell population is heterogeneous, with the CD56 br ⁇ gbt and CD56 dim subsets representing two phenotypically and functionally distinct subsets. CD56 br ⁇ gh ⁇ NK cells have few cytotoxic granules and low expression of the low affinity Fc receptor CDl 6 and killer immunoglobulin-like receptors (KIR), all consistent with poor cytolytic properties, but are capable of potent activation-induced cytokine and chemokine production.
- KIR killer immunoglobulin-like receptors
- CD56 dlm NK cells have abundant cytolytic granules and high surface density expression of CDl 6 and KJR for potent antibody-dependent and natural cytolytic function, with little ability to produce immunomodulatory cytokines.
- CD56 bright and CD56 dim human NK subsets are abundant cytolytic granules and high surface density expression of CDl 6 and KJR for potent antibody-dependent and natural cytolytic function, with little ability to produce immunomodulatory cytokines.
- the developmental relationship between the CD56 bright and CD56 dim human NK subsets is
- CD56 dim >90% of NK cells in lymph nodes are CD56 bright .
- IL-2 interleukin-2
- human NK cell precursor would need to reside in lymph nodes. Similar to other leukocyte populations, human NK cells are ultimately derived from CD34(+) hematopoietic precursor cells (HPC), yet the precise phenotype of the human NK precursor cell is unknown. Culture of purified human bone marrow CD34(+) hematopoietic precursor cells in either IL-2 or IL- 15 primarily results in the generation of CD56 b ⁇ ght NK cells. Similarly, mouse NK cells can be generated by in vitro culture of immature bone marrow progenitors in IL-2 or IL-15. Both IL-2 and IL- 15 signal in
- mice part via a common IL-2/IL-15 receptor (R) ⁇ chain, and IL-2/IL-15R ⁇ -deficient mice are
- mouse bone marrow has clearly been identified as the committed mouse NK precursor cell, however, IL-2/IL-15R ⁇ expression on freshly isolated human CD34(+) hematopoietic
- NK precursor cells is below the limits of detection by flow cytometry. Therefore, while the human NK precursor can be defined by its functional ability to differentiate into a CD56 bnght NK cell in response to IL-2 or IL- 15, the precise phenotype of this CD34(+) hematopoietic precursor cell remains elusive.
- CD34(+)CD7(-) and CD34(+)CD10(-) hematopoietic precursor cell populations also contain some NK precursors as determined by differentiation into CD56 b ⁇ ght NK cells following incubation in IL-2 or IL-15.
- the "all-inclusive" human CD34(+) NK precursor cell remained to be identified.
- the present invention provides isolated NK precursor cells that are identified
- CD34 dim CD45RA(+) ⁇ 7 bright The present invention also provides an isolated population of
- human cells that comprises greater than 60%, 70%, 80% or 90% cells that are CD34 dim CD45RA(+)jQ 7 bright .
- the present invention also provides methods for producing a population of functional hematopoietic precursor cells enriched for NK precursor cells, hi one embodiment, the method comprises (a) obtaining a population of hematopoietic precursor cells; (b) selecting CD34+, CD45RA(+) cells from said population of precursor cells; and (c)
- the present invention is thus directed to methods for isolating this novel CD34(+) hematopoietic precursor cell that include at least one negative selection step in which cells expressing other marker proteins are separated and removed from the desired cell set.
- This negative selection step can involve antibodies to, for example, CD3, CD4, CDl 9, CD36, and glycophorin A.
- the methods further include a Ficoll- centrifugation step, in which mononuclear cells are separated from other cell types.
- the methods include a CD34(+)-cell positive selection step in which antibodies to CD34(+) are used.
- the methods also include a cell-sorting step in which cells that are CD34 dim , CD45RA(+), and integrin
- the present invention thus provides methods for providing CD56 b ⁇ gllt NK cells from a population of hematopoietic precursor cells comprising the steps of (a) obtaining an isolated population of hematopoietic precursor cells that are
- the present invention also provides methods for treating an individual suffering from immune deficiency, cancer, or other diseases in which NK action is desirable,
- the methods comprising administering to the individual CD34 dim CD45RA(+) ⁇ 7 bright cells in
- the present invention also provides methods for treating an individual suffering from immune deficiency, cancer, or other diseases in which NK action is desirable, the methods comprising administering to the individual CD56 b ⁇ ght NK cells produced by the methods disclosed herein in an amount effective to relive the symptoms of the disease from which they are suffering.
- Figure 1 illustrates co-expression of CD45RA on CD34(+) hematopoietic precursor cells, which identifies the human NK precursor.
- Figure 2 illustrates functional and phenotypic attributes of CD34(+)-derived CD56 bright NK cells.
- CD34(+)-derived CD56 bright NK cells are cytotoxic against K562 target cells at the indicated effector:target cell ratios. Results are representative of 6
- CD56 bright NK cells The histograms were gated on CD3(-)CD14(-)CD56 bright events; shaded
- Figure 3 illustrates a phenotypic analysis of peripheral blood CD34(+) hematopoietic precursor cells subsets. Dotted lines (open regions) in the histograms represent isotype control staining of total peripheral blood CD34(+) cells; shaded regions represent surface expression on CD34 dim CD45RA(+) cells; solid lines (open regions) represent expression on CD34 b ⁇ ght CD45RA(+) cells; and dashed lines (open regions) represent expression on CD34(+)CD45RA(-) cells. Prior to staining for flow cytometry, CD19(+) and CD4(+) cells, including pro-B and pro-DC2 hematopoietic precursor cells, were removed. The data shown are representative of 10 donors.
- FIG. 4 illustrates that the peripheral blood CD34 dim CD45RA(+) ⁇ 7 bright
- CD34 bright CD45RA(+) ⁇ 7 dim/neg and CD34 dim CD45RA(+) ⁇ 7 Wght cells were sorted and
- Figure 5 illustrates discovery of a unique population of CD34(+) hematopoietic precursor cells in human lymph nodes.
- A Comparative flow cytometric analysis of CD34(+) hematopoietic precursor cell subsets in peripheral blood and lymph nodes following enrichment for CD34(+) cells in each tissue. In contrast to peripheral blood, lymph node CD34(+) cells are almost exclusively CD34 dim CD45RA(+) ⁇ 7 bright .
- B Surface
- CD34(+) cells reside within the parafollicular T cell-rich regions of lymph nodes.
- Shown on the right panel is the same lymph node section depicted on the right in C but at a lower power (20Ox).
- the red arrow in both images indicates the location of the CD34(+) cell detected by in situ RT-PCR.
- On the left is a serial section from the same region of the lymph node stained with an anti-CD3 monoclonal antibody. Cells with brown staining are CD3(+).
- GC germinal center
- PF parafollicular region.
- Figure 6 illustrates how T-cell activation supports CD56 bright NK cell differentiation from CD34(+) hematopoietic precursor cells in vitro.
- Peripheral blood CD34 bright CD45RA(+) ⁇ 7 ditn/neg and CD34 dim CD45RA(+) ⁇ 7 bright subsets (n 6) or total lymph
- FIG. 7 illustrates representative phenotypic analysis of mature peripheral blood CD56 bright NK cells.
- the histograms are gated on CD3(-)CD14(-)CD56 bright events; shaded regions represent staining with the specific monoclonal antibodies as indicated, whereas dotted lines (open regions) represent isotype controls. Compare with CD34(+)- derived CD56 bright NK cells ( Figure 2C and 2D).
- Figure 8 illustrates representative analyses showing the purity of CD34(+) and CD3(+) cell isolations.
- A After two rounds of positive selection, cells were stained with either an isotype control monoclonal antibody (left) or anti-CD34 monoclonal antibody that does not cross-react with the monoclonal antibodies used for positive selection.
- B Representative analysis showing pre- (left) and post-sort (right) staining for lymph node CD34(+) cells.
- C Representative analysis showing pre- (left) and post-sort (right) staining for peripheral blood and lymph node CD3(+) T cells, hi A-C, each of the populations shown are >98% pure.
- Figure 9 illustrates cellular yields from peripheral blood
- peripheral blood CD34 dim CD45RA(+) ⁇ 7 bright cells were cultured for 12 days in 10 pM IL-2, 1
- nM IL-2 1 nM IL-15, or on the AFT024 stromal cell line with 10 ng/ml IL-7 (7), 100 ng/ml c-kit ligand (KL), and 100 ng/ml flt-3 ligand (FL) with or without 1 nM IL-2.
- CD34 dim CD45RA(+) ⁇ 7 bright is selectively and highly enriched within human lymph nodes
- CD34 dim CD45RA(+) ⁇ 7 bright subset is unique in that differentiation into functional CD56 bright NK cells appears to occur exclusively within this CD34(+) hematopoietic precursor cell subset and can occur in the presence of IL- 15 or at concentrations of IL-2 that only saturate its high affinity IL-2 receptor. Further, we have shown that activated lymph node T cells can
- CD56 b ⁇ ght NK cell in vitro The data support a model of human NK development in which a
- bone marrow-derived CD34 dim CD45RA(+) ⁇ 7 bright NK cell precursor population selectively
- Mononuclear cells may be isolated by suitable separation techniques, preferably by density gradient centrifugation over inert, non-ionizable synthetic polymer comprising the crosslinldng product of epichlorohydrin and sucrose, available under the trademark FICOLL from Pharmacia, Germany. Samples are treated with antibodies to CD3, CD4, CD 19, CD36, and glycophorin A in order to deplete cells expressing these marker proteins during the FICOLL centrifugation step. The mononuclear cells may be further treated in order to enrich the CD34(+)-cells. This can be done by incubating the cells with a monoclonal antibody which is specific for the CD34 antigen.
- the cells treated with the monoclonal antibody are then loaded onto a magnetic column in order to isolate the CD34(+) cells.
- the absorbed CD34(+) cells are then removed from the column. It is possible to further enrich the CD34(+) cells by using a fluorescence activated cell sorter which is commercially available from e.g. Becton Dickinson. With the help of the fluorescence activated cell sorter, highly purified cells can be obtained.
- 6 7 b ⁇ ght cells are resuspended in a suitable medium.
- a suitable medium may constitute, for example, 1640 RPMI with GlutaMAX, 10% heat-inactivated human AB serum, antibiotics, 10 mM HEPES, 100 ⁇ m non-essential amino acids, ImM sodium pyruvate, and 50 ⁇ M 2-BME plus exogenous cytokines.
- the exogenous cytokines may include one or both of IL-2 and IL-15.
- the concentrations of IL-2 or IL- 15 can range from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, or 800 pmol or higher to about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, or 900 pmol or higher, or to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nM.
- the concentration of IL-2 can range from 1 pM to InM, or from 1-20 pM, or from 5-15 pM, or can be about 10 pM IL-2.
- the concentration of IL-15 can range from 900 pM-10 nM, or from 990 pM-5 nM, or can be about InM IL-15.
- Half of the culture medium is replaced every 3-4 days.
- Purified cells may be cultured for 2-4 weeks. At the time of final harvest, total cells/well may be determined on a hemacytometer using trypan blue dye exclusion. The absolute number of mature cells may be calculated by multiplying the average number of total viable cells from triplicate wells by the average percent of cells determined by FACS analyses.
- cultured cells are then pooled and resuspended in complete medium plus 10/ng IL- 12 and 100 ng/ml IL- 18 for overnight culture at 37 C.
- Golgi-plug (BD Biosciences) may be added for a 4-hour incubation and cells are stained for surface CD3, CD14, and CD56 and then permeabilized using the Cytofix/Cytoperm reagent.
- Cells may be stained with either anti-IF-gamma-FITC monoclonal antibody or isotype control-FITC monoclonal antibody, washed, and then analyzed by FACS.
- cultured cells may be stimulated with recombinant monokines or 5xlO 3 K562 target cells for 72 hours. Supernatants may then be analyzed by ELISA for cytokine production.
- Fresh human bone marrow was donated or purchased from AllCells, LLC (Berkeley, CA) and received within 24 hours of harvest.
- Peripheral blood leukopaks were obtained from the American Red Cross. Bone marrow or peripheral blood mononuclear cells were enriched by a ficoll-centrifugation step and then total CD34(+) cells were either enriched over 1 magnetic column or purified (>97%, Figure 8) over 2 magnetic columns using the Miltenyi CD34(+)-enrichment kit (Miltenyi Biotec, Auburn, CA).
- lymph nodes were retrieved fresh from surgically discarded tissue from non-cancer patients by the OSU Tissue Procurement Resource and from the National Disease Research Interchange. Lymph node single-cell suspensions were prepared and total CD34(+) cells were enriched as above. Lymph node CD34(+) hematopoietic precursor cells were either stained for flow cytometric analyses or sorted to purity for cell culture.
- Nonspecific binding was minimized by pre-incubation with whole mouse IgG (direct primary staining) or whole goat IgG (indirect staining) (Sigma, St. Louis, MO).
- Cells were assessed on a FACSCalibur analyzer and analyzed with CellQuest (BD Biosciences) or WmMDI (J. Trotter, Scripps Institute, La Jolla CA) software.
- FACSVantage cell sorter BD Biosciences
- IL-2 was provided by Hoffman LaRoche (Nutley, NJ) and used at the indicated concentrations.
- Flt3 ligand and IL- 15 were provided by Amgen (Thousand Oaks, CA), and c-ldt ligand and IL-7 were from R&D Systems. Unless otherwise indicated, human
- NK development cultures were initiated with 2x10 4 CD34(+) hematopoietic precursor cells in
- hematopoietic precursor cells were incubated with 2.5xlO 3 autologous peripheral blood or
- lymph node CD3(+) T cells purified via Facs Vantage sorting
- IFN- ⁇ production by intracellular flow cytometry cultured cells were pooled and then
- Cytofix/Cytoperm reagent (BD Biosciences). Cells were stained with either anti-IFN- ⁇ -FITC
- CD34(+)-derived CD56 bright NK cells were tested for their ability to lyse K562 target cells in a standard chromium-release assay.
- Optimal protease digestions of lymph node sections were followed by overnight incubation in RNase free-DNase (10 U per sample, Boehringer Mannheim, Indianapolis, IN) and one step RT-PCR using the rTth system and digoxigenin dUTP.
- the primer sequences for CD34 mRNA detection were: forward 5' accctgtgtctcaacatggca 3'; reverse 5' tctctgatgcctgaacat 3'. Additional controls included pretreatment with RNase digestion as well as RT-PCR with irrelevant primers (HPV pl6 specific primers). Immunohistochemistry staining using an anti-human CD3 monoclonal antibody (Zymed Laboratories Inc., San Francisco, CA) was performed.
- Human NK precursors are enriched within peripheral blood
- the CD56 bright NK cell is the only resting lymphocyte population in blood to
- the high affinity IL-2R ⁇ is unique in that it can signal following the binding
- CD56 bright NK cells derived under these conditions from CD34(+) hematopoietic precursor cells were cytotoxic against the NK-sensitive K562 cell line ( Figure 2A) and capable of cytokine production when co-stimulated in recombinant monokines (Figure 2B and Table 1). Similar to peripheral blood CD56 bright NK cells, these cells could not produce cytokines when only co-cultured with K562 targets (not shown).
- Figure 2C and 2D provide a representative phenotype of CD34(+)-derived CD56 bright NK cells.
- 2x10 purified CD34(+) hematopoietic precursor cells were cultured in 10 pM IL-2 for 2 weeks. Subsequently, one-half the medium was replaced with 2x concentrations of stimulatory monokines, the combinations of which were chosen based on optimal cytokine production by peripheral blood CD56 brlght NK cells that produce measurable amounts of each of these cytokines.
- IL-10 cultures were treated with 10 ng/ml IL- 12 and 100 ng/ml IL-15.
- TNF- ⁇ , GM-CSF, and IL-13 cultures were treated with 100 ng/ml IL-15 and 100 ng/ml IL-18.
- NK precursor frequency in bone marrow and peripheral blood suggested that these CD34(+)CD45(+) NK precursor cells may be trafficking out of the bone marrow to the periphery.
- CAMs cell adhesion molecules
- CD34(+) cells express similar levels of ⁇ 4 ⁇ i integrin and PEN5 (not shown), whereas
- CD34(+)CD45RA(+) cells display relatively higher levels of LFA-I compared to CD34(+)CD45RA(-) hematopoietic precursor cells ( Figure 3). While peripheral blood CD56 bright jr ⁇ r cells express C Q R 7 and CXCR3, we could not detect the expression of either
- CD34 dim CD45RA(+) subset expresses very high levels of L-selectin and integrin ⁇ 4 ⁇ 7
- CD34 dim CD45RA(+)CD4(+)IL-3R ⁇ bright pro-DC2 cells which are IL-2R ⁇ (-)c-kit(-) ⁇ 4 ⁇ 7 dim
- peripheral blood CD34 d ⁇ m CD45RA(+) subset we describe here is strikingly pronounced of mature peripheral blood CD56 b ⁇ ght NK cells based on its expression of CD2, CD7, NKR-PlA, and c-kit (shaded histograms in Figure 3 and Figure 7).
- the majority of peripheral blood CD34 b ⁇ ght CD45RA(+) cells lack these markers yet express surface CDlO, suggesting that this population may be functionally similar to the CD34(+)CD10(+) common lymphoid progenitor previously described in adult bone marrow..
- CD34 bright CD45RA(+) subset expresses the early stem cell marker, AC133, potentially indicating that this subset is relatively immature compared to the CD34 dim CD45RA(+) subset that displays no AC 133 ( Figure 3).
- precursor population is contained exclusively within the CD34 dim CD45RA(+) ⁇ 7 bright
- peripheral blood subset
- CD34 dim CD45RA(+) ⁇ 7 bright cells reside in human lymph nodes
- CD56 dim >90% of NK cells in human lymph nodes are CD56 b ⁇ ght and are located in the parafollicular T-cell rich regions.
- CD56 b ⁇ ght NK cells develop in the bone marrow and traffic to lymph nodes where they participate in the immune response through
- bone marrow-derived NK precursors first traffic through peripheral blood to lymph nodes where they can differentiate into CD56 b ⁇ ght NK cells in response to endogenous cytokines. Indeed, consistent with the significantly greater number of CD56 b ⁇ ght NK cells derived from peripheral blood versus bone marrow CD34(+) hematopoietic precursor cells noted above, ⁇ 1% of bone marrow CD34(+) hematopoietic precursor cells display the phenotype of the
- CD34 dim CD45RA(+) ⁇ 7 bright population shown in Figure 3 (n 5), compared to -6% of peripheral blood CD34(+) hematopoietic precursor cells ( ⁇ -20).
- CD34 dim CD45RA(+) ⁇ 7 bright subset displays very high surface density expression of LFA-I
- CD34 dim CD45RA(+) ⁇ 7 brigllt ( Figure 5A and 5B).
- CD34 dim CD45RA(+) ⁇ 7 bright subset represents only ⁇ 6% of all peripheral blood CD34(+) hematopoietic precursor cells
- CD34(+) hematopoietic precursor cells in lymph nodes eliminates peripheral blood contamination as the source of these cells. Further, peripheral blood
- CD34 dim CD45RA(+) ⁇ 7 bright cells express high levels of surface L-selectin while the lymph
- CD34 dim CD45RA(+) ⁇ 7 bright subset that exclusively
- lymph node CD34(+) hematopoietic precursor cells were co-cultured with autologous lymph node CD3(+) T cells in the presence of CD3/CD28 stimulation.
- CD3(-)CD14(-)CD56 bright NK cell development after only 7 days under these conditions, along with a >10-fold increase in activated T cell numbers (not shown).
- peripheral blood CD3(+) T cells were observed that similar to the results obtained by 7-day
- CD34 dim CD45RA(+) ⁇ 7 bright hematopoietic precursor cells can induce human CD56 bright NK
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides isolated cells that are selectively enriched for hematopoietic progenitor cells that are precursors for natural killer (NK) cells. These cells are both CD34 and CD45RA positive and express C-integrin β7, and are referred to as CD34dimCD45RA(+)C-integrinβ7bright. The invention provides methods for isolating these cells, for inducing formation CD56bright NK cells, and for treating diseases associated with immunodeficiency, and cancer.
Description
TITLE: CD34(+) CELLS AND THEIR METHODS OF USE
STATEMENT ON FEDERALLY FUNDED RESEARCH
[001] Research leading to this invention was funded, al least in party, by grants CA68458 and CA95426 (MAC) from the National Cancer Institute. The government has certain rights in this invention.
PRIORITY CLAIM
[002] This application claims priority to U.S. Provisional Patent Application 60/662,975, filed March 18, 2005, which is incorporated herein by reference, in its entirety.
FIELD OF THE INVENTION
[003] The present invention relates to a novel CD34(+) cell line, which can be found in human lymph nodes, and is called CD34dimCD45RA(+)/37 bπght. Methods for isolating the novel cell type from tissue and methods for its use are also provided.
BACKGROUND OF THE INVENTION
[004] Human natural killer (NK) cells are CD3(-)CD14(-)CD56(+) large granular lymphocytes that can kill infected or transformed cells that fail to express normal MHC class I molecules, thereby complementing protection provided by T cells. Similar to other lymphocytes, the total human NK cell population is heterogeneous, with the CD56brιgbt and CD56dim subsets representing two phenotypically and functionally distinct subsets. CD56brιghι NK cells have few cytotoxic granules and low expression of the low affinity Fc receptor CDl 6 and killer immunoglobulin-like receptors (KIR), all consistent with poor cytolytic properties, but are capable of potent activation-induced cytokine and chemokine production.
[005] By comparison, CD56dlm NK cells have abundant cytolytic granules and high surface density expression of CDl 6 and KJR for potent antibody-dependent and natural
cytolytic function, with little ability to produce immunomodulatory cytokines. Currently, the developmental relationship between the CD56bright and CD56dim human NK subsets is
unclear, as is their site(s) of differentiation. While >90% of NK cells in peripheral blood are
CD56dim, >90% of NK cells in lymph nodes are CD56bright. A recent study by Munz and colleagues showed that the resident CD56bnght NK cells in lymph nodes and tonsils could be induced with interleukin (IL)-2 to adopt functional and phenotypic qualities of peripheral blood CD56dim NK cells, suggesting that CD56bright NK cells may be less mature than CD56dim NK cells in a sequential scheme of human NK development.
[006] A correlate to this hypothesis is that the human NK cell precursor would need to reside in lymph nodes. Similar to other leukocyte populations, human NK cells are ultimately derived from CD34(+) hematopoietic precursor cells (HPC), yet the precise phenotype of the human NK precursor cell is unknown. Culture of purified human bone marrow CD34(+) hematopoietic precursor cells in either IL-2 or IL- 15 primarily results in the generation of CD56bπght NK cells. Similarly, mouse NK cells can be generated by in vitro culture of immature bone marrow progenitors in IL-2 or IL-15. Both IL-2 and IL- 15 signal in
part via a common IL-2/IL-15 receptor (R) β chain, and IL-2/IL-15Rβ -deficient mice are
severely deficient in mature NK cells. Indeed, the lineage (Lin)(-)IL-2Rβ(+) population in
mouse bone marrow has clearly been identified as the committed mouse NK precursor cell, however, IL-2/IL-15Rβ expression on freshly isolated human CD34(+) hematopoietic
precursor cells is below the limits of detection by flow cytometry. Therefore, while the human NK precursor can be defined by its functional ability to differentiate into a CD56bnght NK cell in response to IL-2 or IL- 15, the precise phenotype of this CD34(+) hematopoietic precursor cell remains elusive.
[007] Previous work by other laboratories has provided invaluable insight into the phenotype of the CD34(+) human NK precursor by associating surface antigen expression
with NK precursor function. For example, Miller and colleagues provided early evidence that co-expression of CD7 on CD34(+) hematopoietic precursor cells selectively enriches for NK precursors, hi addition, work by the Chen laboratory demonstrated that the co- expression of CDlO on bone marrow CD34(+) hematopoietic precursor cells identified the human common lymphoid progenitor (CLP) that included the NK precursor. Despite these advances, both CD34(+)CD7(-) and CD34(+)CD10(-) hematopoietic precursor cell populations also contain some NK precursors as determined by differentiation into CD56bπght NK cells following incubation in IL-2 or IL-15. Thus, the "all-inclusive" human CD34(+) NK precursor cell remained to be identified.
SUMMARY OF THE INVENTION [008] The present invention provides isolated NK precursor cells that are identified
as CD34dimCD45RA(+)β7 bright . The present invention also provides an isolated population of
human cells that comprises greater than 60%, 70%, 80% or 90% cells that are CD34dimCD45RA(+)jQ7 bright.
[009] The present invention also provides methods for producing a population of functional hematopoietic precursor cells enriched for NK precursor cells, hi one embodiment, the method comprises (a) obtaining a population of hematopoietic precursor cells; (b) selecting CD34+, CD45RA(+) cells from said population of precursor cells; and (c)
further selecting cells expressing integrin β7 "9 on their surfaces.
[010] In some embodiments, the present invention is thus directed to methods for isolating this novel CD34(+) hematopoietic precursor cell that include at least one negative selection step in which cells expressing other marker proteins are separated and removed from the desired cell set. This negative selection step can involve antibodies to, for example, CD3, CD4, CDl 9, CD36, and glycophorin A.
[011] According to such embodiments, the methods further include a Ficoll- centrifugation step, in which mononuclear cells are separated from other cell types. The methods include a CD34(+)-cell positive selection step in which antibodies to CD34(+) are used. The methods also include a cell-sorting step in which cells that are CD34dim, CD45RA(+), and integrin|37 bright are separated from other cells.
[012] Also provided by the invention are methods for producing CD56bπght NK cells from the CD34dimCD45RA(+)l87 bright cells, hi one embodiment the natural killer cells are produced in vitro by contacting a hematopoietic cell population having greater than 60%, 70%, 80%, 90% or more cells that are CD34dimCD45RA(+)167 bright with a composition comprising one or both of IL-2 and IL-15. The present invention thus provides methods for providing CD56bπgllt NK cells from a population of hematopoietic precursor cells comprising the steps of (a) obtaining an isolated population of hematopoietic precursor cells that are
enriched with cells that are CD34(+), CD45RA(+), and express integrin β7 bright on their
surfaces; (b) contacting the isolated population of cells with one or both IL-2 and IL-15 in an amount effective to stimulate differentiation of some or all of the cells into CD56bπght NK cells.
[013] The present invention also provides methods for treating an individual suffering from immune deficiency, cancer, or other diseases in which NK action is desirable,
the methods comprising administering to the individual CD34dimCD45RA(+)β7 bright cells in
an amount effective to establish a population of hematopoietic cells in said subject. The present invention also provides methods for treating an individual suffering from immune deficiency, cancer, or other diseases in which NK action is desirable, the methods comprising administering to the individual CD56bπght NK cells produced by the methods disclosed herein in an amount effective to relive the symptoms of the disease from which they are suffering.
[014] Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.
[015] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
[016] The accompanying drawings, which are incorporated in and constitute a part of this specification, may illustrate embodiments of the invention, and together with the description, serve to explain the principles of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[017] Figure 1 illustrates co-expression of CD45RA on CD34(+) hematopoietic precursor cells, which identifies the human NK precursor. CD34(+)CD45RA(-) and CD34(+)CD45RA(+) populations from bone marrow (n=3) and peripheral blood («=7) were sorted and cultured for 2 weeks in 10 pM IL-2, 1 nM IL-2, or 1 nM IL- 15. Results shown are representative. Only CD34(+)CD45RA(+) cells differentiate into CD56bright NK cells in IL-2 or IL-15.
[018] Figure 2 illustrates functional and phenotypic attributes of CD34(+)-derived CD56bright NK cells. (A) CD34(+)-derived CD56bright NK cells are cytotoxic against K562 target cells at the indicated effector:target cell ratios. Results are representative of 6
experiments. (B) IFN-γ production by CD34(+)-derived CD56bright NK cells. The dot plots
were gated on CD3(-)CD14(-) events. (C) Surface expression of CD34(+)-derived
CD56bright NK cells. The histograms were gated on CD3(-)CD14(-)CD56bright events; shaded
regions represent staining with the specific monoclonal antibodies as indicated, whereas
dotted lines (open regions) represent isotype controls. No consistent differences in function or phenotype were observed between CD56bπght NK cells derived from CD34(+) cells of bone marrow or peripheral blood origin. (D) Representative phenotypic comparison of CD56bπght NK cells derived from CD34(+) hematopoietic precursor cells following a two week culture in IL-2 or IL-15 versus purified mature peripheral blood CD56bπght NK cells cultured for two weeks in IL-2 or IL-15. Comparing Figure 2C and Figure 7 also shows a difference in NKp44 expression.
[019] Figure 3 illustrates a phenotypic analysis of peripheral blood CD34(+) hematopoietic precursor cells subsets. Dotted lines (open regions) in the histograms represent isotype control staining of total peripheral blood CD34(+) cells; shaded regions represent surface expression on CD34dimCD45RA(+) cells; solid lines (open regions) represent expression on CD34bπghtCD45RA(+) cells; and dashed lines (open regions) represent expression on CD34(+)CD45RA(-) cells. Prior to staining for flow cytometry, CD19(+) and CD4(+) cells, including pro-B and pro-DC2 hematopoietic precursor cells, were removed. The data shown are representative of 10 donors.
[020] Figure 4 illustrates that the peripheral blood CD34dimCD45RA(+)β7 bright
subset uniquely differentiates into CD56bright NK cells in IL-2 or IL-15. Peripheral blood
CD34brightCD45RA(+)β7 dim/negand CD34dimCD45RA(+)β7 Wght cells were sorted and
subsequently cultured for 2 weeks in 10 pM IL-2 or 1 nM IL-2 or IL-15 followed by FACS analysis to assess for CD3(-)CD14(-)CD56bright NK cell development. The results are representative of 11 donors.
[021 ] Figure 5 illustrates discovery of a unique population of CD34(+) hematopoietic precursor cells in human lymph nodes. (A) Comparative flow cytometric analysis of CD34(+) hematopoietic precursor cell subsets in peripheral blood and lymph nodes following enrichment for CD34(+) cells in each tissue. In contrast to peripheral blood,
lymph node CD34(+) cells are almost exclusively CD34dimCD45RA(+)β7 bright. (B) Surface
antigen expression of enriched lymph node CD34(+) cells as determined by flow cytometric
analysis. The CD34dimCD45RA(+)β7 brisht subset in lymph nodes is strikingly similar to the
subset in peripheral blood except for the former's low or absent L-selectin expression (compare with bottom right panel in Figure 3). (C) RT in situ PCR for CD34 mRNA on human lymph node sections. The power of these images is 100Ox. Control primers used in the left panel were specific for the human papilloma virus (HPV) pi 6 gene. The red arrow in the right panel indicates a representative lymph node CD34(+) cell detected by this method. Note the uniform cytoplasmic signal coming from this cell indicative of cytoplasmic CD34 mRNA. (D) CD34(+) cells reside within the parafollicular T cell-rich regions of lymph nodes. Shown on the right panel is the same lymph node section depicted on the right in C but at a lower power (20Ox). The red arrow in both images indicates the location of the CD34(+) cell detected by in situ RT-PCR. On the left is a serial section from the same region of the lymph node stained with an anti-CD3 monoclonal antibody. Cells with brown staining are CD3(+). GC, germinal center; PF, parafollicular region.
[022] Figure 6 illustrates how T-cell activation supports CD56bright NK cell differentiation from CD34(+) hematopoietic precursor cells in vitro. Peripheral blood CD34brightCD45RA(+)β7 ditn/neg and CD34dimCD45RA(+)β7 bright subsets (n=6) or total lymph
node CD34(+) hematopoietic precursor cells [>95% CD34dimCD45RA(+)β7 bright] (n=3) were
cultured for 7 days in exogenous IL-2 or IL- 15 (left column) or co-cultured for 7 days with autologous peripheral blood or lymph node CD3(+) T cells activated via CD3/CD28 stimulation (right column). The CD3(-)CD14(-)CD56bright NK cells derived from these cultures are seen in the upper left quadrant of each histogram. In data not shown, culture of sorted lymph node CD3(+) T cells stimulated with anti-CD3/CD28 beads did not produce any CD56bπght NK cells without co-culture of the CD34(+) hematopoietic precursor cells.
[023] Figure 7 illustrates representative phenotypic analysis of mature peripheral blood CD56bright NK cells. The histograms are gated on CD3(-)CD14(-)CD56bright events; shaded regions represent staining with the specific monoclonal antibodies as indicated, whereas dotted lines (open regions) represent isotype controls. Compare with CD34(+)- derived CD56bright NK cells (Figure 2C and 2D).
[024] Figure 8 illustrates representative analyses showing the purity of CD34(+) and CD3(+) cell isolations. (A) After two rounds of positive selection, cells were stained with either an isotype control monoclonal antibody (left) or anti-CD34 monoclonal antibody that does not cross-react with the monoclonal antibodies used for positive selection. (B) Representative analysis showing pre- (left) and post-sort (right) staining for lymph node CD34(+) cells. (C) Representative analysis showing pre- (left) and post-sort (right) staining for peripheral blood and lymph node CD3(+) T cells, hi A-C, each of the populations shown are >98% pure.
[025] Figure 9 illustrates cellular yields from peripheral blood
CD34dimCD45RA(+)β7 bright hematopoietic precursor cell differentiation assays. Sorted
peripheral blood CD34dimCD45RA(+)β7 bright cells were cultured for 12 days in 10 pM IL-2, 1
nM IL-2, 1 nM IL-15, or on the AFT024 stromal cell line with 10 ng/ml IL-7 (7), 100 ng/ml c-kit ligand (KL), and 100 ng/ml flt-3 ligand (FL) with or without 1 nM IL-2. Shown are the combined results (+ S.D.) from 3 representative donors. The values were obtained by dividing the absolute numbers of CD56bπght NK cells enumerated per well at the end of the
culture period by the starting number of CD34dimCD45RA(+)β7 bright cells per well.
DESCRIPTION OF THE EMBODIMENTS
[026] The present invention will now be described by reference to more detailed embodiments, with occasional reference to the accompanying drawings. This invention may, however, be embodied in different forms and should not be construed as limited to the
embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
[027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. AU publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety.
[028] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.
[029] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Every numerical range given throughout this specification
will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein, hi accordance with the invention, we have identified a novel subset of CD34dim hematopoietic
precursor cells that constitutively express CD45RA and high surface density integrin α4β7
with functional evidence for expression of the heterotrimeric high affinity IL-2Rαβγ. This subset of CD34(+) hematopoietic precursor cells, referred to herein as
CD34dimCD45RA(+)β7 bright , is selectively and highly enriched within human lymph nodes
and resides in the T cell-rich regions along with CD56bπghtNK cells. The
CD34dimCD45RA(+)β7 bright subset is unique in that differentiation into functional CD56bright NK cells appears to occur exclusively within this CD34(+) hematopoietic precursor cell subset and can occur in the presence of IL- 15 or at concentrations of IL-2 that only saturate its high affinity IL-2 receptor. Further, we have shown that activated lymph node T cells can
also promote the differentiation of the CD34dimCD45RA(+)β7 bright NK precursor into a
CD56bπght NK cell in vitro. The data support a model of human NK development in which a
bone marrow-derived CD34dimCD45RA(+)β7 bright NK cell precursor population selectively
resides in lymph nodes where endogenous cytokines can drive its differentiation into CD56bright NK cells in vivo. Methods for isolating cells that are CD34dimCD45RA(+)/?7 bright
[030] Peripheral blood, bone marrow or lymph node samples are obtained. Mononuclear cells may be isolated by suitable separation techniques, preferably by density gradient centrifugation over inert, non-ionizable synthetic polymer comprising the crosslinldng product of epichlorohydrin and sucrose, available under the trademark FICOLL from Pharmacia, Germany. Samples are treated with antibodies to CD3, CD4, CD 19, CD36, and glycophorin A in order to deplete cells expressing these marker proteins during the
FICOLL centrifugation step. The mononuclear cells may be further treated in order to enrich the CD34(+)-cells. This can be done by incubating the cells with a monoclonal antibody which is specific for the CD34 antigen. The cells treated with the monoclonal antibody are then loaded onto a magnetic column in order to isolate the CD34(+) cells. The absorbed CD34(+) cells are then removed from the column. It is possible to further enrich the CD34(+) cells by using a fluorescence activated cell sorter which is commercially available from e.g. Becton Dickinson. With the help of the fluorescence activated cell sorter, highly purified cells can be obtained.
Methods for using CD34dimCD45RA(+)j37 bright cells to produce natural killer cells in vitro
[031 ] The above-isolated CD34dimCD45RA(+)|67 bπght cells are resuspended in a suitable medium. Such a medium may constitute, for example, 1640 RPMI with GlutaMAX, 10% heat-inactivated human AB serum, antibiotics, 10 mM HEPES, 100 μm non-essential amino acids, ImM sodium pyruvate, and 50 μM 2-BME plus exogenous cytokines. The exogenous cytokines may include one or both of IL-2 and IL-15. In various embodiments, the concentrations of IL-2 or IL- 15 can range from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, or 800 pmol or higher to about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, or 900 pmol or higher, or to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nM. In some embodiments, the concentration of IL-2 can range from 1 pM to InM, or from 1-20 pM, or from 5-15 pM, or can be about 10 pM IL-2. In some embodiments, the concentration of IL-15 can range from 900 pM-10 nM, or from 990 pM-5 nM, or can be about InM IL-15. Half of the culture medium is replaced every 3-4 days. Purified cells may be cultured for 2-4 weeks. At the time of final harvest, total cells/well may be determined on a hemacytometer using trypan blue dye exclusion. The absolute number of mature cells may be calculated by multiplying the average number of total viable cells from triplicate wells by the average percent of cells determined by FACS analyses.
[032] In order to test the function of the in vitro-derived NEC cells, cultured cells are then pooled and resuspended in complete medium plus 10/ng IL- 12 and 100 ng/ml IL- 18 for overnight culture at 37 C. Golgi-plug (BD Biosciences) may be added for a 4-hour incubation and cells are stained for surface CD3, CD14, and CD56 and then permeabilized using the Cytofix/Cytoperm reagent. Cells may be stained with either anti-IF-gamma-FITC monoclonal antibody or isotype control-FITC monoclonal antibody, washed, and then analyzed by FACS. Alternatively, cultured cells may be stimulated with recombinant monokines or 5xlO3 K562 target cells for 72 hours. Supernatants may then be analyzed by ELISA for cytokine production.
[033] Would we want to discuss potential therapeutic uses here? The original disclosure forms contemplates clinical uses such as adoptive therapy into immune compromised patients and cellular vaccination. DEFINITIONS SECTION?
EXAMPLES
[034] EXPERIMENTAL PROCEDURES
[035] Purification of CD34(+) hematopoietic precursor cells from human tissue
[036] Fresh human bone marrow was donated or purchased from AllCells, LLC (Berkeley, CA) and received within 24 hours of harvest. Peripheral blood leukopaks were obtained from the American Red Cross. Bone marrow or peripheral blood mononuclear cells were enriched by a ficoll-centrifugation step and then total CD34(+) cells were either enriched over 1 magnetic column or purified (>97%, Figure 8) over 2 magnetic columns using the Miltenyi CD34(+)-enrichment kit (Miltenyi Biotec, Auburn, CA). For sorting experiments and phenotypic analyses, total peripheral blood was treated with a rosette cocktail against CD3, CD4, CD19, CD36, and glycophorin A (StemCell Technologies,
Vancouver, BC Canada) to deplete cells expressing these markers during the ficoll- centrifugation step. Human lymph nodes were retrieved fresh from surgically discarded tissue from non-cancer patients by the OSU Tissue Procurement Resource and from the National Disease Research Interchange. Lymph node single-cell suspensions were prepared and total CD34(+) cells were enriched as above. Lymph node CD34(+) hematopoietic precursor cells were either stained for flow cytometric analyses or sorted to purity for cell culture.
[037] Flow cytometry and cell sorting
[038] AU conjugated and unconjugated experimental and isotype control monoclonal antibodies used in this report were purchased from BD Biosciences except
CD16, CD56, CD122 (IL-2Rβ), CD158a, CD158b, NKp30, NKp44, NKp46 (Coulter, Miami FL), NKG2D (R&D Systems, Minneapolis, MN), and AC133 (Miltenyi Biotec, Auburn, CA). Nonspecific binding was minimized by pre-incubation with whole mouse IgG (direct primary staining) or whole goat IgG (indirect staining) (Sigma, St. Louis, MO). Cells were assessed on a FACSCalibur analyzer and analyzed with CellQuest (BD Biosciences) or WmMDI (J. Trotter, Scripps Institute, La Jolla CA) software. For culture experiments of purified CD34(+) subsets, cells were sorted on a FACSVantage cell sorter (BD Biosciences) and then sort purities were verified on a FACSCalibur.
[039] NK cell development cultures
[040] IL-2 was provided by Hoffman LaRoche (Nutley, NJ) and used at the indicated concentrations. Flt3 ligand and IL- 15 were provided by Amgen (Thousand Oaks, CA), and c-ldt ligand and IL-7 were from R&D Systems. Unless otherwise indicated, human
NK development cultures were initiated with 2x104 CD34(+) hematopoietic precursor cells in
200 μl complete medium consisting of 1640 RPMI with GlutaMAX, 10% heat-inactivated
human AB serum (ICN Biomedicals, Irvine, CA), antibiotics, 10 mM HEPES, 100 μM non-
essential amino acids, 1 mM sodium pyruvate (all from Invitrogen), and 50 μM 2-βME
(Sigma) plus exogenous cytokines. Half the culture medium was replaced every 3-4 days. At the time of final harvest, total cells/well were determined on a hemacytometer using trypan blue dye exclusion. The absolute numbers of mature CD56bπght NK cells/well were calculated by multiplying the average numbers of total viable cells from triplicate wells by the average percent of CD3(-)CD14(-)CD56bright NK cells determined by FACS analyses. For CD34(+) hematopoietic precursor cell /T cell co-culture experiments, 0.5-2x103
Peripheral blood CD34(+) hematopoietic precursor cell subsets or total lymph node CD34(+)
hematopoietic precursor cells were incubated with 2.5xlO3 autologous peripheral blood or
lymph node CD3(+) T cells (purified via Facs Vantage sorting) and stimulated with 5xlO3
anti-CD3/CD28 beads (Dynal Biotech, Brown Deer, WI) in the presence or absence of 10 Dg/ml anti-IL-2 or control antibody (R&D Systems). After 7 days of culture, cells were harvested, counted for viability, and stained for flow cytometry.
[041] Functional analyses of in vitro-άerxw&ά NK cells [042] Purified CD34(+) cells were cultured as above for 2-4 weeks. To assess
IFN-γ production by intracellular flow cytometry, cultured cells were pooled and then
resuspended at 106 cells/ml in complete medium plus 10 ng/ml IL- 12 (Genetics Institute, Cambridge, MA) and 100 ng/ml IL- 18 (BASF, Worcester, MA) for overnight culture at
37°C. Golgi-plug (BD Biosciences) was added for a 4-hour incubation, and cells were next
stained for surface CD3, CD14, and CD56 and then permeabilized using the
Cytofix/Cytoperm reagent (BD Biosciences). Cells were stained with either anti-IFN-γ-FITC
monoclonal antibody or isotype control-FITC monoclonal antibody, washed, and then analyzed by FACS. Alternatively, cultured cells were stimulated with recombinant
monokines or 5x103 K562 target cells for 72 hours, and then supernatants were analyzed by
ELISA for cytokine production using Quantikine kits from R&D Systems. CD34(+)-derived
CD56bright NK cells were tested for their ability to lyse K562 target cells in a standard chromium-release assay.
[043] Immunohistochemistry and in situ RT-PCR
[044] Optimal protease digestions of lymph node sections were followed by overnight incubation in RNase free-DNase (10 U per sample, Boehringer Mannheim, Indianapolis, IN) and one step RT-PCR using the rTth system and digoxigenin dUTP. The primer sequences for CD34 mRNA detection were: forward 5' accctgtgtctcaacatggca 3'; reverse 5' tctctgatgcctgaacat 3'. Additional controls included pretreatment with RNase digestion as well as RT-PCR with irrelevant primers (HPV pl6 specific primers). Immunohistochemistry staining using an anti-human CD3 monoclonal antibody (Zymed Laboratories Inc., San Francisco, CA) was performed.
[045] Statistical analyses
[046] The paired data were analyzed using an exact Wilcoxon Signed Rank test and the unpaired data an exact Wilcoxon Rank Sum test. S-Plus version 6.0 and SAS version 8.02 were used for the analyses.
[047] RESULTS
[048] Human NK precursors are enriched within peripheral blood
[049] The CD56bright NK cell is the only resting lymphocyte population in blood to
constitutively express a heterotrimeric high affinity IL-2Rαβγ. To identify its precursor, we
first searched for a subset of CD34(+) hematopoietic precursor cells that might also express
the high affinity IL-2Rαβγ and differentiate into a CD56bπshtNK cell via signaling through
this receptor. The high affinity IL-2Rαβγ is unique in that it can signal following the binding
of very low concentrations (10 pM or 2.3 U/ml) of IL-2, and this binding can be completely
abrogated with the anti-IL-2Rα monoclonal antibody. This population was found entirely
within the CD45RA(+) subset of CD34(+) hematopoietic precursor cells of both bone marrow and peripheral blood (Figure 1). We observed identical results in nanomolar
concentrations of either IL- 15 or IL-2 that utilize the shared IL-2/IL-15Rβγ but not the IL-
2Rα (not shown). Importantly, there was a significant difference in the absolute numbers of
CD56bπgbt NK cells derived from 2x104 CD34(+) bone marrow hematopoietic precursor cells
(537 ± 340, n=9) versus an equal number of peripheral blood CD34(+) hematopoietic
precursor cells (6831 ± 4329, n=5) (P=0.0013), suggesting that peripheral blood contains a much higher percentage of CD34(+) NK precursors than bone marrow (see below).
[050] Functional and phenotypic characterization of the CD34(+)-derived CD56brigllt NK cells
[051] The CD56bright NK cells derived under these conditions from CD34(+) hematopoietic precursor cells were cytotoxic against the NK-sensitive K562 cell line (Figure 2A) and capable of cytokine production when co-stimulated in recombinant monokines (Figure 2B and Table 1). Similar to peripheral blood CD56bright NK cells, these cells could not produce cytokines when only co-cultured with K562 targets (not shown). Figure 2C and 2D provide a representative phenotype of CD34(+)-derived CD56bright NK cells. We did not observe any consistent phenotypic differences between bone marrow or peripheral blood CD34(+)-derived CD56bπght NK cells, but a few distinct differences in phenotype were noted between these cells (Figure 2C) and mature peripheral blood CD56bπght NK cells (Figure 7). For example, fresh or in vitro cultured mature peripheral blood CD56bπght NK cells display uniform expression of CD94 (bright) and leukocyte function- associated antigen- 1 (LFA-I), whereas most of the CD34(+)-derived CD56bright NK cells lack these antigens (Figure 2D). Given these qualitative differences in phenotype, the consistent high purities of our CD34 preparations (Figure 8), and the very limited growth potential of mature peripheral blood CD56bright NK cells cultured ex vivo, the detection of CD56bright NK cells following prolonged
cultures of CD34(+) hematopoietic precursor cells with IL-2 or IL- 15 cannot result from contamination by mature peripheral blood CD56bπght NK cells. Rather, these data collectively show that the human NK precursor cell which differentiates to a CD56bπght NK cell in the presence of IL- 15 or IL-2 is found exclusively within CD34(+)CD45RA(+) hematopoietic precursor cells and is more abundant in peripheral blood than in bone marrow.
Table 1. Cytokine production by in v#rø-derived CD56bright NK cells
2x10 purified CD34(+) hematopoietic precursor cells were cultured in 10 pM IL-2 for 2 weeks. Subsequently, one-half the medium was replaced with 2x concentrations of stimulatory monokines, the combinations of which were chosen based on optimal cytokine production by peripheral blood CD56brlght NK cells that produce measurable amounts of each of these cytokines. For production of IL-10, cultures were treated with 10 ng/ml IL- 12 and 100 ng/ml IL-15. For production of TNF-β, GM-CSF, and IL-13, cultures were treated with 100 ng/ml IL-15 and 100 ng/ml IL-18. For production of TNF-α and IFN-γ, cultures were treated with 10 ng/ml IL- 12 and 100 ng/ml IL-18. Cultures that received medium alone or 5x103 K562 target cells had undetectable cytokine levels (data not shown).
[052] Refinement of the phenotype of the CD34(+)CD45RA(+) NK cell precursor
[053] Our statistical analyses of NK precursor frequency in bone marrow and peripheral blood noted above suggested that these CD34(+)CD45(+) NK precursor cells may be trafficking out of the bone marrow to the periphery. We therefore analyzed surface expression of homing and chemokine receptors and cell adhesion molecules (CAMs) on peripheral blood CD34(+) hematopoietic precursor cells. We observed that all peripheral
blood CD34(+) cells express similar levels of α4βi integrin and PEN5 (not shown), whereas
CD34(+)CD45RA(+) cells display relatively higher levels of LFA-I compared to CD34(+)CD45RA(-) hematopoietic precursor cells (Figure 3). While peripheral blood
CD56 bright jrør cells express CQR7 and CXCR3, we could not detect the expression of either
of these chemokine receptors on any peripheral blood CD34(+) subset (not shown). Interestingly, we found that among total peripheral blood CD34(+) cells, a unique
CD34dimCD45RA(+) subset expresses very high levels of L-selectin and integrinα4β7
(represented by integrin βp Figure 3). Of note, these cells are distinct from
CD34dimCD45RA(+)CD4(+)IL-3Rαbright pro-DC2 cells, which are IL-2Rα(-)c-kit(-)α4β7 dim
and were depleted from our peripheral blood CD34 preparations with an anti-CD4 monoclonal antibody. The peripheral blood CD34dιmCD45RA(+) subset we describe here is strikingly reminiscent of mature peripheral blood CD56bπght NK cells based on its expression of CD2, CD7, NKR-PlA, and c-kit (shaded histograms in Figure 3 and Figure 7). In contrast, the majority of peripheral blood CD34bπghtCD45RA(+) cells (open regions with solid lines in Figure 3) lack these markers yet express surface CDlO, suggesting that this population may be functionally similar to the CD34(+)CD10(+) common lymphoid progenitor previously described in adult bone marrow.. In addition, the CD34brightCD45RA(+) subset expresses the early stem cell marker, AC133, potentially indicating that this subset is relatively immature compared to the CD34dimCD45RA(+) subset that displays no AC 133 (Figure 3).
[054] Subtle overlaps in phenotype between the two peripheral blood CD34(+)CD45RA(+) populations presented an initial challenge to sort these subsets to high purity. For example, not all the CD34dimCD45RA(+) cells are CDIO(-) and not all the CD34brightCD45RA(+) cells are CD7(-) (Figure 3). Among the surface markers we analyzed,
relative bright surface expression of integrin β7 best differentiated the CD34dlmCD45RA(+)
subset not only from other CD34(+) subsets but also from mature CD56bright and CD56dim NK
cells, which have absent or low expression of integrin β7, respectively (Figure 7 and data not
shown). Therefore, we used a combination of monoclonal antibodies against CD34,
CD45RA, and integrin β7 to purify the two peripheral blood CD34(+)CD45RA(+) subsets
and to reduce the potential for mature NK cell contamination in our sorts, a representative of which is shown in Figure 4. After 2 weeks of culture in 10 pM IL-2 or 1 nM IL- 15 or IL-2,
we observed that the CD34dimCD45RA(+)β7 bright subset repeatedly gave rise to CD3(- )CD14(-)CD56bright NK cells (n=l 1) by FACS with excellent purity (Figure 4). Generally, we observed only ~l-3-fold expansion when the cells were cultured in 10 pM IL-2, and ~15- fold expansion when cultured in 1 nM IL-2 or IL- 15 (Figure 9). However, there was much greater expansion of these cells when cultured on the AFT024 fetal liver stromal cell line in the presence of 1 nM IL-2 and 100 ng/ml of flι3 ligand (FL), 100 ng/ml c-kit ligand (KL), and 10 ng/ml IL-7 (Figure 9), indicating that these cells are highly proliferative when cultured in the presence of excess cytokines and cellular support. The CD56bπght NK cells derived on the AFT024 line displayed the same phenotype as that shown in Figure 2C and 2D
(not shown). In stark contrast to the results obtained from the CD34dimCD45RA(+)β7 bright
subset, most of the CD34brightCD45RA(+)β7 dim/neg cells died in culture with only IL-2 or IL- 15
(not shown), and none of the live cells had the CD3(-)CD14(-)CD56bright phenotype (Figure 4). Based on these results and those from Figure 1, we conclude that the CD56bπght NK
precursor population is contained exclusively within the CD34dimCD45RA(+)β7 bright
peripheral blood subset.
[055] CD34dimCD45RA(+)β7 bright cells reside in human lymph nodes [056] In contrast to peripheral blood where >90% of NK cells are CD56dim, >90% of NK cells in human lymph nodes are CD56bπght and are located in the parafollicular T-cell rich regions. One potential model predicts that CD56bπght NK cells develop in the bone marrow and traffic to lymph nodes where they participate in the immune response through
release of IFN-γ and other cytokines. An alternative model is that bone marrow-derived NK precursors first traffic through peripheral blood to lymph nodes where they can differentiate
into CD56bπght NK cells in response to endogenous cytokines. Indeed, consistent with the significantly greater number of CD56bπght NK cells derived from peripheral blood versus bone marrow CD34(+) hematopoietic precursor cells noted above, <1% of bone marrow CD34(+) hematopoietic precursor cells display the phenotype of the
CD34dimCD45RA(+)β7 bright population shown in Figure 3 (n=5), compared to -6% of peripheral blood CD34(+) hematopoietic precursor cells (τι-20). These data support the possibility that at least a subset of NK precursors is destined for the periphery. Further, in
addition to integrinααβ7, our data also show that the peripheral blood
CD34dimCD45RA(+)β7 bright subset displays very high surface density expression of LFA-I
and L-selectin (Figure 3), all three of which can facilitate the extravasation of leukocytes across lymph node high endothelial venules.
[057] To test the hypothesis that CD34dimCD45RA(+)β7 bright cells reside in lymph
nodes, phenotypic analyses of CD34(+)-enriched single-cell lymph node suspensions from eight individual donors were performed. In striking contrast to peripheral blood, nearly the entire CD34(+) population discovered within human lymph nodes was
CD34dimCD45RA(+)β7 brigllt (Figure 5A and 5B). Thus, while the CD34dimCD45RA(+)β7 bright subset represents only ~6% of all peripheral blood CD34(+) hematopoietic precursor cells, this subset represents >95% of all lymph node CD34(+) hematopoietic precursor cells (n=8).
This natural and nearly exclusive enrichment for the CD34dimCD45RA(+)β7 bright subset of
CD34(+) hematopoietic precursor cells in lymph nodes eliminates peripheral blood contamination as the source of these cells. Further, peripheral blood
CD34dimCD45RA(+)β7 bright cells express high levels of surface L-selectin while the lymph
node CD34dimCD45RA(+)β7 bright cells had lower or absent expression (compare Figure 3,
bottom right panel to Figure 5B). This suggests that L-selectin may be involved in the
extravasation of peripheral blood CD34dimCD45RA(+)β7 bright cells into lymph nodes and may
subsequently downregulate upon entrance. As shown in Figure 5C, we were able to detect CD34(+) cells within lymph node tissue sections using in situ RT-PCR (note the uniform cytoplasmic staining within the indicated cell). The frequency of CD34(+) cells detected by this method corresponds to an estimate of ~1 CD34(+) cell per 35,000-50,000 total lymph node cells. This is in agreement with the predicted frequency from our flow cytometry data that shows the cell to represent <0.05% of all events without CD34(+) enrichment when using a live forward scatter/side scatter gate (not shown). To our knowledge, this represents the first identification of CD34(+) hematopoietic precursor cells in human lymph nodes. Collectively, these results support the notion that among all peripheral blood CD34(+)
hematopoietic precursor cells, it is the CD34dimCD45RA(+)β7 bright subset that exclusively
contains the CD56bπght NK. precursor and selectively resides in lymph nodes. Formal proof that this cell actually traffics from peripheral blood to lymph nodes will await further study. [058] T cell activation promotes CD56bright NK differentiation in vitro [059] Immunohistochemistry staining on serial lymph node sections with an anti- CD3 monoclonal antibody revealed that the CD34(+) hematopoietic precursor cells we observed by in situ RT-PCR (Figure 5C) were located within T cell rich regions of lymph node sections (Figure 5D), where CD56bπght NK cells also reside. To recapitulate what might occur in vivo during T cell activation, lymph node CD34(+) hematopoietic precursor cells were co-cultured with autologous lymph node CD3(+) T cells in the presence of CD3/CD28 stimulation. As shown in Figure 6, we observed CD3(-)CD14(-)CD56bright NK cell development after only 7 days under these conditions, along with a >10-fold increase in activated T cell numbers (not shown). We similarly cultured purified peripheral blood
CD34brightCD45RA(+)β7 dim/neg and CD34dimCD45RA(+)β7 bright subsets with autologous
peripheral blood CD3(+) T cells and observed that similar to the results obtained by 7-day
culture in exogenous IL-2 or IL-15, only CD34dimCD45RA(+)β7 bright cells gave rise to NK
cells in the presence of CD3/CD28 stimulated T cells (Figure 6). The addition of an anti-IL-2 monoclonal antibody to these co-cultures resulted in variable (average 25%, n=9) reduction in CD56bπght NK cell development, likely due to the contribution of other endogenous factors (e.g., IL-7, IL-15, IL-21, KL) that might directly or indirectly contribute to this process. Thus, activated lymph node T cells, in close proximity to lymph node
CD34dimCD45RA(+)β7 bright hematopoietic precursor cells, can induce human CD56bright NK
cell differentiation without the addition of exogenous cytokines.
[060] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the appended claims.
Claims
1. A method of isolating CD34dimCD45RA(+Wegrinj87 bright cells from a biological sample comprising the steps of: separating cells expressing at least one first marker protein by using an antibody to the at least one first marker protein; isolating mononuclear cells using Ficoll- centrifugation; isolating CD34(+)-cell positive cells using at least one antibody to CD34(+); and sorting cells in a cell sorter using at least one second marker protein.
2. The method of claim 1, wherein said first marker protein is chosen from CD3, CD4, CD19, CD36, and glycophorin A.
3. The method of claim 1, wherein said second marker protein is chosen from CD34, CD45RA, and integrin β7.
4. The method of claim 1, wherein said second marker protein is integrin β7.
5. The method of claim 1, wherein the biological sample is obtained from lymph nodes.
6. The method of claim 4, wherein the isolated cells are selected using cytoadhesion.
7. The method of claim 4, wherein the isolated cells are selected using immunomagnetic separation.
8. The method of claim 6 wherein said cytoadhesion uses binding to galactose.
9. The method of claim 8 wherein said cytoadhesion uses binding to N-acetyl galactosamine.
10. The method of claim 9, wherein said N-acetyl galactosamine cytoadhesion is affinity chromatography.
11. The method of claim 9, wherein the N-acetyl galactosamine is conjugated to BSA.
12. The method of claim 4, wherein the isolated cells are purified by equilibrium density centrifugation.
13. The method of claim 1, further comprising fractionating said purified population of hematopoietic precursor cells by fluorescence activated flow cytometry, velocity sedimentation or counter flow centrifugal elutriation.
14. Isolated NK precursor cells that are CD34(+), constitutively express CD45RA and high
surface density integral α4β7 .
15. The isolated NK cells according to claim 14 that express heterotrimeric high affinity
IL-2Rαβγ.
16. A method for producing a population of functional hematopoietic precursor cells enriched for NK precursor cells, comprising: (a) obtaining a population of hematopoietic precursor cells; (b) selecting CD34+, CD45RA(+) cells from said population of precursor
cells; and (c) further selecting cells expressing integrin β7 br'9ht on their surfaces.
17. A method for isolating CD34(+) hematopoietic precursor cells, comprising (i) at least one negative selection step in which cells expressing one or more marker proteins selected from the group of CD3, CD4, CD19, CD36, and glycophorin A are separated and removed from the desired cell set; (ii) a Ficoll-centrifugation step in which mononuclear cells are separated from other cell types; (iii) a CD34(+)-cell positive selection step in which antibodies to CD34(+) are used to select CD34(+) cells; and (iv) a cell-sorting step in which cells that are CD34dim, CD45RA(+), and integrm|37 bright are separated from other cells.
18. A method for producing CD56bright NK cells from the CD34dimCD45RA(+)j37 bright cells by contacting a hematopoietic cell population having greater than 60%, 70%, 80%, 90% or more cells that are CD34dimCD45RA(+)/37 brisht with a composition comprising one or both of IL-2 and IL-15.
19. The method according to claim 18 wherein the natural killer cells are produced in vitro.
20. A method for producing CD56bπght NK cells from a population of hematopoietic precursor cells comprising the steps of (a) obtaining an isolated population of hematopoietic precursor cells that are enriched with cells that are CD34(+), CD45RA(+), and express
integrin β7 brιght on their surfaces; (b) contacting the isolated population of cells with one or both IL-2 and IL- 15 in an amount effective to stimulate differentiation of some or all of the cells into CD56bright NK cells.
21. The method according to claim 20 wherein the natural killer cells are produced in vitro.
22. The method according to claim 20, comprising contacting the cells with only IL-2 and wherein the concentration of IL-2 is greater than 10 pM.
23. The method according to claim 20, comprising contacting the cells with only IL- 15 and wherein the concentration of IL- 15 is greater than 1 nM.
24. The method according to claim 20, comprising contacting the cells with IL-2 and IL- 15 and wherein concentration of IL-2 is greater than 10 pM and the concentration of IL- 15 is greater than 1 nM.
25. A method for treating an individual suffering from immune deficiency or cancer
comprising administering to the individual CD34dimCD45RA(+)β7 bright cells in an amount
effective to establish a population of hematopoietic cells in said subject.
26. A method for treating an individual suffering from immune deficiency or cancer comprising administering to the individual CD56bright NK cells produced by the method of claim 16 in an amount effective to relive the symptoms of the disease from which they are suffering.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/908,831 US7915043B2 (en) | 2005-03-18 | 2006-03-20 | CD34(+) cells and their methods of use |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US66297505P | 2005-03-18 | 2005-03-18 | |
| US60/662,975 | 2005-03-18 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006102209A2 true WO2006102209A2 (en) | 2006-09-28 |
| WO2006102209A3 WO2006102209A3 (en) | 2008-12-24 |
Family
ID=37024471
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/009974 Ceased WO2006102209A2 (en) | 2005-03-18 | 2006-03-20 | Cd34(+) cells and their methods of use |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US7915043B2 (en) |
| WO (1) | WO2006102209A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012075412A1 (en) * | 2010-12-03 | 2012-06-07 | Michael Verneris | Generation of natural killer cells and lymphoid tissue inducer-like (lti-like) nk-22 cells |
| US20150010583A1 (en) * | 2012-02-08 | 2015-01-08 | Ipd-Therapeutics B.V. | Ex vivo nk cell differentiation from cd34+ hematopoietic cells |
| US10016839B1 (en) | 2017-03-09 | 2018-07-10 | King Fahd University Of Petroleum And Minerals | Friction stir welding tool and a method of fabricating the same |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8518397B2 (en) * | 2009-08-14 | 2013-08-27 | Case Western Reserve University | Notch induced natural killer cell generation and therapeutic uses |
| US11697799B2 (en) | 2019-04-15 | 2023-07-11 | Ossium Health, Inc. | System and method for extraction and cryopreservation of bone marrow |
| EP4181675A4 (en) | 2020-07-18 | 2024-04-24 | Ossium Health, Inc. | PERMEATION OF WHOLE VERTEBRAL BODY WITH CRYOPROTECTIVE USING VACUUM-ASSISTED DIFFUSION |
| CA3195653A1 (en) | 2020-10-14 | 2022-04-21 | Ossium Health, Inc. | Systems and methods for extraction and cryopreservation of bone marrow |
| WO2022133282A1 (en) | 2020-12-18 | 2022-06-23 | Ossium Health, Inc. | Methods of cell therapies |
| CN113416700B (en) * | 2021-07-09 | 2023-04-11 | 天晴干细胞股份有限公司 | Efficient factor-secreting NK cell amplification method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5877299A (en) * | 1995-06-16 | 1999-03-02 | Stemcell Technologies Inc. | Methods for preparing enriched human hematopoietic cell preparations |
| US6008004A (en) * | 1996-10-04 | 1999-12-28 | Becton Dickinson & Company | Identification of a CD34+ bone marrow precursor for dendritic cells in blood and lymphoid tissues |
-
2006
- 2006-03-20 WO PCT/US2006/009974 patent/WO2006102209A2/en not_active Ceased
- 2006-03-20 US US11/908,831 patent/US7915043B2/en not_active Expired - Lifetime
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012075412A1 (en) * | 2010-12-03 | 2012-06-07 | Michael Verneris | Generation of natural killer cells and lymphoid tissue inducer-like (lti-like) nk-22 cells |
| US9862928B2 (en) | 2010-12-03 | 2018-01-09 | Regents Of The University Of Minnesota | Generation of natural killer cells and lymphoid tissue inducer-like (LTi-like) NK-22 cells |
| US20150010583A1 (en) * | 2012-02-08 | 2015-01-08 | Ipd-Therapeutics B.V. | Ex vivo nk cell differentiation from cd34+ hematopoietic cells |
| US20180044636A1 (en) * | 2012-02-08 | 2018-02-15 | Ipd-Therapeutics B.V. | Ex vivo nk cell differentiation from cd34+ hematopoietic cells |
| US10822589B2 (en) | 2012-02-08 | 2020-11-03 | Glycostem Therapeutics B.V. | Ex vivo NK cell differentiation from CD34+ hematopoietic cells |
| US10016839B1 (en) | 2017-03-09 | 2018-07-10 | King Fahd University Of Petroleum And Minerals | Friction stir welding tool and a method of fabricating the same |
Also Published As
| Publication number | Publication date |
|---|---|
| US20080206205A1 (en) | 2008-08-28 |
| WO2006102209A3 (en) | 2008-12-24 |
| US7915043B2 (en) | 2011-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Freud et al. | A human CD34 (+) subset resides in lymph nodes and differentiates into CD56brightNatural killer cells | |
| US6541249B2 (en) | Immortalized human stromal cell lines | |
| Strobl et al. | Myeloperoxidase expression in CD34+ normal human hematopoietic cells | |
| Gritzapis et al. | Large-scale expansion of CD3+ CD56+ lymphocytes capable of lysing autologous tumor cells with cytokine-rich supernatants | |
| US20090208471A1 (en) | Isolation and Use of Human Regulatory T Cells | |
| CN112626018B (en) | High-purity allogeneic NK cell culture medium and in-vitro amplification method | |
| US20110143431A1 (en) | Method Of Preparing An Undifferentiated Cell | |
| CN111500535B (en) | Methods and media for culturing human natural killer cells in vitro | |
| Demoulin et al. | Production of large numbers of plasmacytoid dendritic cells with functional activities from CD34+ hematopoietic progenitor cells: use of interleukin-3 | |
| JP2014515259A (en) | Lymphocyte cell line containing γδT cells, composition thereof, and production method thereof | |
| Harada et al. | A Wilms tumor cell line, HFWT, can greatly stimulate proliferation of CD56+ human natural killer cells and their novel precursors in blood mononuclear cells | |
| WO2017194924A1 (en) | Methods of sorting and culturing t cells | |
| Periasamy et al. | Stroma-dependent development of two dendritic-like cell types with distinct antigen presenting capability | |
| US7915043B2 (en) | CD34(+) cells and their methods of use | |
| EP3790958A1 (en) | Compositions and methods for culturing and expanding cells | |
| KR20250039412A (en) | How to expand T cell populations | |
| EP1268746B1 (en) | PRODUCTION OF TcR GAMMA DELTA T CELLS | |
| Schmitt et al. | Identification of mature and immature human thymic dendritic cells that differentially express HLA-DR and interleukin-3 receptor in vivo | |
| US7220412B2 (en) | Method of preparing an undifferentiated cell | |
| AU2001248162A1 (en) | Production of TcR gamma delta T cells | |
| EP0765398A1 (en) | Population of cells enriched for myeloid and/or lymphoid progenitors and methods of making and using | |
| US20210371821A1 (en) | Induced regulatory t cells, methods of production, and uses thereof | |
| Alexander et al. | Detection of antigen specific T lymphocytes by determination of intracellular calcium concentration using flow cytometry | |
| KR20120046157A (en) | Methods of generating cells exhibiting phenotypic plasticity | |
| US20030157060A1 (en) | Production of tcr gamma delta t cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 11908831 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 06748460 Country of ref document: EP Kind code of ref document: A2 |
