WO2006099055A2 - Sequence, polymorphisms, and marker test technology for disease resistance and growth (nfkb1) - Google Patents
Sequence, polymorphisms, and marker test technology for disease resistance and growth (nfkb1) Download PDFInfo
- Publication number
- WO2006099055A2 WO2006099055A2 PCT/US2006/008433 US2006008433W WO2006099055A2 WO 2006099055 A2 WO2006099055 A2 WO 2006099055A2 US 2006008433 W US2006008433 W US 2006008433W WO 2006099055 A2 WO2006099055 A2 WO 2006099055A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- sequence
- seq
- animal
- allele
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Definitions
- TITLE SEQUENCE, POLYMORPHISMS, AND MARKER TEST TECHNOLOGY FOR DISEASE RESISTANCE AND GROWTH (NFKBl)
- This invention relates generally to the detection of genetic differences among animals. More particularly, the invention relates to genetic markers which have been identified in several genes indicative of heritable phenotypes associated with improved traits, such as disease resistance. Methods and compositions for use of these markers in genotyping of animals and selection are also disclosed.
- RFLP analysis has been used by several groups to study pig DNA.
- SLA swine leukocyte antigen
- MHC major histocompatibility complex
- DNA markers have several advantages; segregation is easy to measure and is unambiguous, and DNA markers are co-dominant, i.e., heterozygous and homozygous animals can be distinctively identified. Once a marker system is established, selection decisions could be made very easily, since DNA markers can be assayed any time after a tissue or blood sample can be collected from the individual infant animal, or even an embryo.
- the present invention provides a genetic markers, based upon the discovery of polymorphisms in the putative porcine NFKBl gene, which correlate with resistance or susceptibility to pathogenic infection in pigs. This will permit genetic typing of pigs for their NFKBl allele and for determination of the relationship of specific RFLPs to resistance to infection and growth traits. It will also permit the identification of individual males and females that carry the gene for improved resistance and growth. Thus, the markers may be selection tools in breeding programs to develop lines and breeds that produce litters containing more resistant offspring. Also disclosed are novel porcine NFKBl genomic sequences, as well as primers for assays to identify the presence or absence of marker alleles.
- NFKBl gene which is associated with the improved resistance to pathogenic infection.
- Another object of the invention is to provide a method for identifying genetic markers for improved disease resistance.
- a further object of the invention is to provide genetic markers for selection and breeding to obtain pigs that will be expected to have a lower susceptibility to infection than those without the favorable allele.
- a still further object of the invention is to provide genetic markers for selection and breeding to obtain pigs that will be expected to have superior growth traits than those without the favorable allele.
- Yet another object of the invention is to provide a kit for evaluating a sample of pig DNA for specific genetic markers of disease resistance and growth traits.
- the present invention provides a method for screening animals to determine those more likely to have beneficial phenotypes such as, or associated with, improved innate immunity, disease resistance or resistance to bacterial infection, as evidenced by one or more of the following: bacterial clearance, leukocyte base line and response to infection leukocyte function and fever response to infection, in a particular population, when bred, or raised or to select against pigs which have alleles indicating unfavorable phenotypes.
- beneficial phenotypes such as, or associated with, improved innate immunity, disease resistance or resistance to bacterial infection, as evidenced by one or more of the following: bacterial clearance, leukocyte base line and response to infection leukocyte function and fever response to infection, in a particular population, when bred, or raised or to select against pigs which have alleles indicating unfavorable phenotypes.
- improved or superior disease resistance or innate immunity shall mean a measurable statistically significantly difference in indicators of innate immunity or disease resistance including but not limited to lymphocyte counts, bacterial counts, temperature response to infection, monocyte counts, eosinophil counts, and PMN killing when one allele is present as compared to the same indicator when the alternate allele is present.
- the traits are not so limited to these specific measurements.
- the present invention provides a method for screening animals to determine those more likely to have beneficial phenotypes such as, or associated with, growth traits as evidenced by one or more of the following no limiting list of indicia of growth traits: days to 110 Kg, or life time daily gain.
- Growth traits may be measured by any of a number of indicia and the invention is not limited to these particular traits only. The growth traits mentioned herein are beyond and separate from those which may be attributed to improved innate immunity
- the present invention provides a method for screening pigs to determine those more likely to have the improved trait of superior disease resistance or growth and/or those less likely to demonstrate those traits which method comprises the steps: 1) obtaining a sample of tissue of genomic DNA from an animal; and 2) analyzing the mRNA or genomic DNA obtained in 1) to determine which NFKBl allele(s) is/are present. Briefly, the sample of genetic material analyzed to determine the presence or absence of a particular allele that is correlated with a desirable trait, or one which is linked thereto.
- nucleic acid molecules for sequence differences. These include by way of example, restriction fragment length polymorphism analysis, heteroduplex analysis, single strand conformation polymorphism analysis, denaturing gradient electrophoresis and temperature gradient electrophoresis.
- the polymorphism is a restriction fragment length polymorphism and the assay comprises identifying the gene from isolated genetic material; exposing the gene to a restriction enzyme that yields restriction fragments of the gene of varying length; separating the restriction fragments to form a restriction pattern, such as by electrophoresis or HPLC separation; and comparing the resulting restriction fragment pattern from an animal gene that is either known to have or not to have the desired marker. If an animal tests positive for the marker (or allele), such animal can be considered for inclusion in the breeding program. If the animal does not test positive for the marker genotype, the animal can be culled from the group and otherwise used.
- the gene, or a fragment thereof is isolated by the use of primers and DNA polymerase to amplify a specific region of the gene which contains the polymorphism or a polymorphism linked thereto.
- the amplified region is either directly separated or sequenced or is digested with a restriction enzyme and fragments are again separated. Visualization of the separated fragments, or RFLP pattern, is by simple staining of the fragments, or by labeling the primers or the nucleoside triphosphates used in amplification.
- the invention comprises a method for identifying a genetic marker for disease resistance traits, such as bacterial counts, lymphocyte count, neutrophil count, or monocyte count after challenge or for growth traits such as average daily gain, days to 110 Kg., life time daily gain and the like.
- a genetic marker for disease resistance traits such as bacterial counts, lymphocyte count, neutrophil count, or monocyte count after challenge or for growth traits such as average daily gain, days to 110 Kg., life time daily gain and the like.
- Male and female animals of the same breed, breed cross, or similar genetic lineage are bred, and the growth/disease resistance traits are determined.
- a polymorphism in the NFKBl gene of each animal is identified and associated with the desired trait(s).
- PCR-RFLP analysis is used to determine the polymorphism.
- NFKBl gene or the NFKBl gene it would be possible, at least in the short term, to select for pigs likely to produce disease resistance/ superior growth or alternatively, against pigs likely to produce susceptible litters/inferior growth indirectly, by selecting for certain alleles of the NFKBl associated marker or the NFKB 1 associated marker through the selection of specific alleles of alternative markers located on chromosome 8 where NFKBl is.
- 2 different polymorphisms have been identified in the NFKBl gene which are correlated with significant differences in traits associated with disease resistance and innate immunity and/or growth.
- the first is located in intron 18 of the putative NFKBl gene and is a C/A single nucleotide polymorphism. This polymorphism is expected to show significant differences with respect to innate immunity and disease resistance and may thus be used by a breeder to identify animals which are more likely to demonstrate superior disease resistance or innate immunity compared to an animal which has the alternative gene form.
- the second is located in the exon 24 of the putative NFKBl gene and is a C/T single nucleotide polymorphism.
- This polymorphism has shown significant differences with respect to innate host defense including fever response to infection, and bacterial clearance and may thus be used by a breeder to identify animals which are more likely to exhibit superior disease resistance or innate immunity when compared to an animal which has the alternative gene form.
- the exon 24 SNP has also been shown to be significantly correlated with growth traits. Animals with the favorable allele were shown to have fewer days to reach 110 Kg., and a higher life time daily gain than animals without the favorable allele.
- Figure 1 shows a combination of the novel porcine NFKBl partial cDNA sequence, intron 18, which has been placed at its correct position between exon 18 and exon 19 to show SNP 1 in the context of the cDNA sequence, and the 3' untranslated region, including exon 24 which encompasses SNP 2 of the invention.
- Intron 18 is shown in blue text from position 2074 to position 2397 and is 324 base pairs long.
- SNP 1, located in intron 18 is located at position 2089 of SEQ ID NO: 1, and is designated as M (C or A) as the difference between alleles is at this position.
- Primers and SNP 2 are highlighted in red text.
- the SNP 2 is located at position 3082 of SEQ ID NO:1, and is designated as Y (C or T) as the difference between alleles is at this position.
- Figure 2 is the sequence amplified from primers SEQ ID NO: 2 and 3. Primers are bold italic underlined, the C or A polymorphism is indicated in red text as M (amplified sequence for allele 1 with C nucleotide is SEQ ID NO:8).
- Figure 3 is the sequence amplified from primers SEQ ID NO: 4 and 5. Primers are bold italic underlined, the C or T polymorphism is indicated in red text as Y (amplified sequence for allele 1 with C nucleotide is SEQ ID NO: 9).
- Figure 4 is the partial cDNA sequence for porcine NFKBl of 3,314 base pairs (SEQ ID NO: 10). Also shown is the complete open reading frame predicted from SEQ ID NO: 10, and the protein sequence derived (SEQ ID NO: 11). This protein sequence was compared to the known human NFKBl sequence (Genbank Accession number: NM_003998) and our novel sequence (SEQ ID NO: 11) is 92% identical to this sequence.
- the 3' untranslated region is from position 2,877 (position 2878-2880 is a TAG stop codon) to position 3,314.
- NFKB nuclear factor kappa-B
- TNF- ⁇ tumor necrosis factor alpha
- LPS bacterial lipopolysaccharide
- NFKBl functions both as an 1KB in its longer precursor form, pl05, and as an active transcription factor, p50, after proteolytic processing by the proteasome, which removes the IKB-like C-terminal half of pi 05. Processing to p50 occurs in a constitutive, unregulated fashion. However, following cellular stimulation with ligands, such as TNF- ⁇ , two serines in the pl05 PEST domain are rapidly phosphorylated by the 1KB kinase (IKK) complex, triggering complete pl05 degradation with little effect on processing to p50. This degradation results in the release of associated p50 and other NFKB subunits, which can then translocate into the nucleus.
- ligands such as TNF- ⁇
- the invention relates to the identification of quantitative trait loci (QTL) for improved disease resistance or resistance to bacterial infection and/or growth traits, including, but not limited to, Salmonellosis, identifiable by traits such as bacterial count, lymphocyte count, neutrophil count, monocyte count post challenge, days to 110 Kg, or life time daily gain, to identify pigs and other animals which have superior bacterial killing or ability to stave off infection and/or growth.
- QTL quantitative trait loci
- Salmonellosis identifiable by traits such as bacterial count, lymphocyte count, neutrophil count, monocyte count post challenge, days to 110 Kg, or life time daily gain, to identify pigs and other animals which have superior bacterial killing or ability to stave off infection and/or growth.
- the invention also relates to a method of screening animals to determine those more likely to have improved resistance/growth traits when bred by identifying the presence or an absence of a polymorphism in certain genes (NFKBl) that are correlated with these traits.
- NFKBl polymorphism in certain genes
- the invention relates to genetic markers and methods of identifying those markers in a pig or other animal of a particular breed, strain, population, or group, whereby an animal is more likely to have disease resistance/growth that is superior to that of an animal which has a different allele present as well as for the mean for that particular breed, strain, population, or group.
- the marker may be identified by any method known to one of ordinary skill in the art which identifies the presence or absence of the particular allele or marker, including, for example, direct sequencing single-strand conformation polymorphism analysis (SSCP), base excision sequence scanning (BESS), RFLP analysis, heteroduplex analysis, denaturing gradient gel electrophoresis, allelic PCR, temperature gradient electrophoresis, ligase chain reaction, direct sequencing, minisequencing, nucleic acid hybridization, and micro-array-type detection of the NFKBl gene, or other linked sequences, and examination for a polymorphic site.
- SSCP single-strand conformation polymorphism analysis
- BESS base excision sequence scanning
- RFLP analysis heteroduplex analysis
- denaturing gradient gel electrophoresis allelic PCR
- temperature gradient electrophoresis ligase chain reaction
- direct sequencing minisequencing
- nucleic acid hybridization and micro-array-type detection of the NFKBl gene, or other linked sequence
- Samples of genomic DNA are isolated from any convenient source including saliva, buccal cells, hair roots, blood, cord blood, amniotic fluid, interstitial fluid, peritoneal fluid, chorionic villus, and any other suitable cell or tissue sample with intact interphase nuclei or metaphase cells.
- the cells can be obtained from solid tissue as from a fresh or preserved organ or from a tissue sample or biopsy.
- the sample can contain compounds which are not naturally intermixed with the biological material such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
- Genomic DNA can also be isolated from cultured primary or secondary cell cultures or from transformed cell lines derived from any of the aforementioned tissue samples.
- RNA can be isolated from tissues expressing the NFKBl gene as described in Sambrook et al., supra.
- RNA can be total cellular RNA, rnRNA, poly A+ RNA, or any combination thereof.
- the RNA is purified, but can also be unpurified cytoplasmic RNA.
- RNA can be reverse transcribed to form DNA which is then used as the amplification template, such that the PCR indirectly amplifies a specific population of RNA transcripts. See, e.g., Sambrook, supra, Kawasaki et al., Chapter 8 in PCR Technology, (1992) supra, and Berg et al., Hum. Genet. 85:655-658 (1990).
- PCR polymerase chain reaction
- Tissues should be roughly minced using a sterile, disposable scalpel and a sterile needle (or two scalpels) in a 5 mm Petri dish. Procedures for removing paraffin from tissue sections are described in a variety of specialized handbooks well known to those skilled in the art.
- telomere sequence To amplify a target nucleic acid sequence in a sample by PCR, the sequence must be accessible to the components of the amplification system.
- One method of isolating target DNA is crude extraction which is useful for relatively large samples. Briefly, mononuclear cells from samples of blood, amniocytes from amniotic fluid, cultured chorionic villus cells, or the like are isolated by layering on sterile Ficoll-Hypaque gradient by standard procedures. Interphase cells are collected and washed three times in sterile phosphate buffered saline before DNA extraction.
- the cells are resuspended (10 6 nucleated cells per 100 ⁇ l) in a buffer of 50 mM Tris- HCl (pH 8.3), 50 mM KCl 1.5 mM MgCl 2 , 0.5% Tween 20, 0.5% NP40 supplemented with 100 ⁇ g/ml of proteinase K. After incubating at 56°C for 2 hr. the cells are heated to 95°C for 10 min to inactivate the proteinase K and immediately moved to wet ice (snap-cool). If gross aggregates are present, another cycle of digestion in the same buffer should be undertaken. Ten ⁇ l of this extract is used for amplification.
- the amount of the above mentioned buffer with proteinase K may vary according to the size of the tissue sample.
- the extract is incubated for 4-10 hrs at 50°-60°C and then at 95 0 C for 10 minutes to inactivate the proteinase. During longer incubations, fresh proteinase K should be added after about 4 hr at the original concentration.
- PCR can be employed to amplify target regions in very small numbers of cells (1000-5000) derived from individual colonies from bone marrow and peripheral blood cultures.
- the cells in the sample are suspended in 20 ⁇ l of PCR lysis buffer (10 mM Tris- HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl 2 , 0.1 mg/ml gelatin, 0.45% NP40, 0.45% Tween 20) and frozen until use.
- PCR When PCR is to be performed, 0.6 ⁇ l of proteinase K (2 mg/ml) is added to the cells in the PCR lysis buffer. The sample is then heated to about 60°C and incubated for 1 hr. Digestion is stopped through inactivation of the proteinase K by heating the samples to 95 0 C for 10 min and then cooling on ice.
- a relatively easy procedure for extracting DNA for PCR is a salting out procedure adapted from the method described by Miller et al., Nucleic Acids Res. 16:1215 (1988), which is incorporated herein by reference.
- Mononuclear cells are separated on a Ficoll- Hypaque gradient. The cells are resuspended in 3 ml of lysis buffer (10 mM Tris-HCl, 400 mM NaCl, 2 mM Na 2 EDTA, pH 8.2). Fifty ⁇ l of a 20 mg/ml solution of proteinase K and 150 ⁇ l of a 20% SDS solution are added to the cells and then incubated at 37°C overnight. Rocking the tubes during incubation will improve the digestion of the sample.
- Kits for the extraction of high-molecular weight DNA for PCR include a Genomic Isolation Kit A.S.A.P. (Boehringer Mannheim, Indianapolis, Lid.), Genomic DNA Isolation System (GIBCO BRL, Gaithersburg, Md.), Elu-Quik DNA Purification Kit (Schleicher & Schuell, Keene, N.H.), DNA Extraction Kit (Stratagene, LaJoIIa, Calif.), TurboGen Isolation Kit (Invitrogen, San Diego, Calif.), and the like. Use of these kits according to the manufacturer's instructions is generally acceptable for purification of DNA prior to practicing the methods of the present invention.
- the concentration and purity of the extracted DNA can be determined by spectrophotometric analysis of the absorbance of a diluted aliquot at 260 nm and 280 nm.
- PCR amplification may proceed.
- the first step of each cycle of the PCR involves the separation of the nucleic acid duplex formed by the primer extension. Once the strands are separated, the next step in PCR involves hybridizing the separated strands with primers that flank the target sequence. The primers are then extended to form complementary copies of the target strands.
- the primers are designed so that the position at which each primer hybridizes along a duplex sequence is such that an extension product synthesized from one primer, when separated from the template (complement), serves as a template for the extension of the other primer.
- the cycle of denaturation, hybridization, and extension is repeated as many times as necessary to obtain the desired amount of amplified nucleic acid.
- strand separation is achieved by heating the reaction to a sufficiently high temperature for a sufficient time to cause the denaturation of the duplex but not to cause an irreversible denaturation of the polymerase (see U.S. Pat. No. 4,965,188, incorporated herein by reference).
- Typical heat denaturation involves temperatures ranging from about 80°C to 105°C for times ranging from seconds to minutes.
- Strand separation can be accomplished by any suitable denaturing method including physical, chemical, or enzymatic means.
- Strand separation may be induced by a helicase, for example, or an enzyme capable of exhibiting helicase activity.
- the enzyme RecA has helicase activity in the presence of ATP.
- reaction conditions suitable for strand separation by helicases are known in the art (see Kuhn Hoffman-Berling, 1978, CSH-Quantitative Biology, 43:63-67; and Radding, 1982, Ann. Rev. Genetics 16:405-436, each of which is incorporated herein by reference.
- Template-dependent extension of primers in PCR is catalyzed by a polymerizing agent in the presence of adequate amounts of four deoxyribonucleotide triphosphates (typically dATP, dGTP, dCTP, and dTTP) in a reaction medium comprised of the appropriate salts, metal cations, and pH buffering systems.
- Suitable polymerizing agents are enzymes known to catalyze template-dependent DNA synthesis.
- the target regions may encode at least a portion of a protein expressed by the cell.
- mRNA may be used for amplification of the target region.
- PCR can be used to generate a cDNA library from RNA for further amplification, the initial template for primer extension is RNA.
- Polymerizing agents suitable for synthesizing a complementary, copy-DNA (cDNA) sequence from the RNA template are reverse transcriptase (RT), such as avian myeloblastosis virus RT, Moloney murine leukemia virus RT, or Thermus thermophilus (Tth) DNA polymerase, a thermostable DNA polymerase with reverse transcriptase activity marketed by Perkin Elmer Cetus, Inc.
- RT reverse transcriptase
- Tth Thermus thermophilus
- the genomic RNA template is heat degraded during the first denaturation step after the initial reverse transcription step leaving only DNA template.
- Suitable polymerases for use with a DNA template include, for example, E.
- coli DNA polymerase I or its Klenow fragment T4 DNA polymerase, Tth polymerase, and Taq polymerase, a heat-stable DNA polymerase isolated from Thermus aquaticus and commercially available from Perkin Elmer Cetus, Inc.
- the latter enzyme is widely used in the amplification and sequencing of nucleic acids.
- the reaction conditions for using Taq polymerase are known in the art and are described in GeIf and, 1989, PCR Technology, supra. Allele Specific PCR
- Allele-specific PCR differentiates between target regions differing in the presence of absence of a variation or polymorphism. PCR amplification primers are chosen which bind only to certain alleles of the target sequence. This method is described by Gibbs, Nucleic Acid Res. 17:12427-2448 (1989). Allele Specific Oligonucleotide Screening Methods
- Oligonucleotide (ASO) screening methods employ the allele-specific oligonucleotide (ASO) screening methods, as described by Saiki et al., Nature 324:163-166 (1986). Oligonucleotides with one or more base pair mismatches are generated for any particular allele. ASO screening methods detect mismatches between variant target genomic or PCR amplified DNA and non-mutant oligonucleotides, showing decreased binding of the oligonucleotide relative to a mutant oligonucleotide. Oligonucleotide probes can be designed that under low stringency will bind to both polymorphic forms of the allele, but which at high stringency, bind to the allele to which they correspond.
- ASO allele-specific oligonucleotide
- stringency conditions can be devised in which an essentially binary response is obtained, i.e., an ASO corresponding to a variant form of the target gene will hybridize to that allele, and not to the wildtype allele.
- Target regions of a test subject's DNA can be compared with target regions in unaffected and affected family members by ligase-mediated allele detection.
- Ligase may also be used to detect point mutations in the ligation amplification reaction described in Wu et al., Genomics 4:560-569 (1989).
- the ligation amplification reaction (LAR) utilizes amplification of specific DNA sequence using sequential rounds of template dependent ligation as described in Wu, supra, and Barany, Proc. Nat. Acad. Sci. 88:189-193 (1990).
- Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution.
- DNA molecules melt in segments, termed melting domains, under conditions of increased temperature or denaturation. Each melting domain melts cooperatively at a distinct, base-specific melting temperature (TM). Melting domains are at least 20 base pairs in length, and may be up to several hundred base pairs in length.
- a target region to be analyzed by denaturing gradient gel electrophoresis is amplified using PCR primers flanking the target region.
- the amplified PCR product is applied to a polyacrylamide gel with a linear denaturing gradient as described in Myers et al., Meth. Enzymol. 155:501-527 (1986), and Myers et al., in Genomic Analysis, A Practical Approach, K. Davies Ed. IRL Press Limited, Oxford, pp. 95-139 (1988), the contents of which are hereby incorporated by reference.
- the electrophoresis system is maintained at a temperature slightly below the Tm of the melting domains of the target sequences.
- the target sequences may be initially attached to a stretch of GC nucleotides, te ⁇ ried a GC clamp, as described in Chapter 7 of Erlich, supra.
- a GC clamp Preferably, at least 80% of the nucleotides in the GC clamp are either guanine or cytosine.
- the GC clamp is at least 30 bases long. This method is particularly suited to target sequences with high Tm's.
- the target region is amplified by the polymerase chain reaction as described above.
- One of the oligonucleotide PCR primers carries at its 5' end, the GC clamp region, at least 30 bases of the GC rich sequence, which is incorporated into the 5' end of the target region during amplification.
- the resulting amplified target region is run on an electrophoresis gel under denaturing gradient conditions as described above. DNA fragments differing by a single base change will migrate through the gel to different positions, which may be visualized by ethidium bromide staining.
- Temperature gradient gel electrophoresis is based on the same underlying principles as denaturing gradient gel electrophoresis, except the denaturing gradient is produced by differences in temperature instead of differences in the concentration of a chemical denaturant.
- Standard TGGE utilizes an electrophoresis apparatus with a temperature gradient running along the electrophoresis path. As samples migrate through a gel with a uniform concentration of a chemical denaturant, they encounter increasing temperatures.
- An alternative method of TGGE, temporal temperature gradient gel electrophoresis uses a steadily increasing temperature of the entire electrophoresis gel to achieve the same result. As the samples migrate through the gel the temperature of the entire gel increases, leading the samples to encounter increasing temperature as they migrate through the gel. Preparation of samples, including PCR amplification with incorporation of a GC clamp, and visualization of products are the same as for denaturing gradient gel electrophoresis.
- Target sequences or alleles at the NFKBl locus can be differentiated using single- strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 85:2766-2770 (1989).
- Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products.
- Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence.
- electrophoretic mobility of single-stranded amplification products can detect base-sequence difference between alleles or target sequences.
- heterohybrid means a DNA duplex strand comprising one strand of DNA from one person, usually the patient, and a second DNA strand from another person, usually an affected or unaffected family member. Positive selection for heterohybrids free of mismatches allows determination of small insertions, deletions or other polymorphisms that may be associated with alterations in androgen metabolism.
- Hybridization probes are generally oligonucleotides which bind through complementary base pairing to all or part of a target nucleic acid. Probes typically bind target sequences lacking complete complementarity with the probe sequence depending on the stringency of the hybridization conditions.
- the probes are preferably labeled directly or indirectly, such that by assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence. Direct labeling methods include radioisotope labeling, such as with 32P or 35S.
- Indirect labeling methods include fluorescent tags, biotin complexes which may be bound to avidin or streptavidin, or peptide or protein tags.
- Visual detection methods include photoluminescents, Texas red, rhodamine and its derivatives, red leuco dye and e, e', 5, 5'-5354amethylbenzidine (TMB), fluorescein, and its derivatives, dansyl, umbelliferone and the like or with horse radish peroxidase, alkaline phosphatase and the like.
- Hybridization probes include any nucleotide sequence capable of hybridizing to the porcine chromosome where NFKBl resides, and thus defining a genetic marker linked to NFKBl, including a restriction fragment length polymorphism, a hypervariable region, repetitive element, or a variable number tandem repeat.
- Hybridization probes can be any gene or a suitable analog.
- Further suitable hybridization probes include exon fragments or portions of cDNAs or genes known to map to the relevant region of the chromosome.
- Preferred tandem repeat hybridization probes for use according to the present invention are those that recognize a small number of fragments at a specific locus at high stringency hybridization conditions, or that recognize a larger number of fragments at that locus when the stringency conditions are lowered.
- One or more additional restriction enzymes and/or probes and/or primers can be used. Additional enzymes, constructed probes, and primers can be determined by routine experimentation by those of ordinary skill in the art and are intended to be within the scope of the invention.
- the methods described herein may be in terms of the use of a single restriction enzyme and a single set of primers, the methods are not so limited.
- One or more additional restriction enzymes and/or probes and/or primers can be used, if desired. Additional enzymes, constructed probes and primers can be determined through routine experimentation, combined with the teachings provided and incorporated herein.
- polymorphisms in the NFBKl gene have been identified which have an association with disease resistance and overall innate immunity as well as growth.
- the presence or absence of the markers in one embodiment may be assayed by PCR-RFLP analysis using the restriction endonucleases and amplification primers may be designed using analogous human, pig or other NFBKl sequences due to the high homology in the region surrounding the polymorphisms, or may be designed using known NFBKl gene sequence data as exemplified in GenBank or even designed from sequences obtained from linkage data from closely surrounding genes based upon the teachings and references herein.
- sequences surrounding the polymorphism will facilitate the development of alternate PCR tests in which a primer of about 4-30 contiguous bases taken from the sequence immediately adjacent to the polymorphism is used in connection with a polymerase chain reaction to greatly amplify the region before treatment with the desired restriction enzyme.
- the novel sequence disclosed herein, SEQ ID NO: 1 may be useful in this regard as well.
- the primers need not be the exact complement; substantially equivalent sequences are acceptable.
- the design of primers for amplification by PCR is known to those of skill in the art and is discussed in detail in Ausubel (ed.), Short Protocols in Molecular Biology, 4th Edition, John Wiley and Sons (1999).
- primer design The following is a brief description of primer design.
- PCR polymerase chain reaction
- Designing oligonucleotides for use as either sequencing or PCR primers requires selection of an appropriate sequence that specifically recognizes the target, and then testing the sequence to eliminate the possibility that the oligonucleotide will have a stable secondary structure. Inverted repeats in the sequence can be identified using a repeat-identification or RNA-folding program such as those described above. If a possible stem structure is observed, the sequence of the primer can be shifted a few nucleotides in either direction to minimize the predicted secondary structure.
- the sequence of the oligonucleotide should also be compared with the sequences of both strands of the appropriate vector and insert DNA. Obviously, a sequencing primer should only have a single match to the target DNA.
- primer sequence should be compared to the sequences in the GenBank database to determine if any significant matches occur. If the oligonucleotide sequence is present in any known DNA sequence or, more importantly, in any known repetitive elements, the primer sequence should be changed.
- the methods and materials of the invention may also be used more generally to evaluate pig DNA, genetically type individual pigs, and detect genetic differences in pigs.
- a sample of pig genomic DNA may be evaluated by reference to one or more controls to determine if a polymorphism in the NFBKl gene is present.
- RFLP analysis is performed with respect to the pig NFBKl gene, and the results are compared with a control.
- the control is the result of a RFLP analysis of the pig NFBKl gene of a different pig where the polymorphism(s) of the pig NFBKlgene is/are known.
- the NFBKl genotype of a pig may be determined by obtaining a sample of its genomic DNA, conducting RFLP analysis of the NFBKl gene in the DNA, and comparing the results with a control. Again, the control is the result of RFLP analysis of the NFBKl gene of a different pig. The results genetically type the pig by specifying the polymorphism(s) in its NFBKl genes. Finally, genetic differences among pigs can be detected by obtaining samples of the genomic DNA from at least two pigs, identifying the presence or absence of a polymorphism in the NFBKl gene, and comparing the results.
- assays are useful for identifying the genetic markers relating to disease resistance and/or innate immunity, as discussed above, for identifying other polymorphisms in the NFBKl gene and for the general scientific analysis of pig genotypes and phenotypes.
- the examples and methods herein disclose certain gene(s) which has been identified to have a polymorphism(s) which is associated either positively or negatively with a beneficial trait that will have an effect on disease resistance or innate immunity for animals carrying this alternate allele.
- the identification of the existence of a polymorphism within a gene is often made by a single base alternative that results in a restriction site in certain allelic forms.
- a certain allele may have a number of base changes associated with it that could be assayed for which are indicative of the same polymorphism (allele).
- genes may be linked to the polymorphisms disclosed herein so that assays may involve identification of other genes or gene fragments, but which ultimately rely upon genetic characterization of animals for the same polymorphism. Any assay which sorts and identifies animals based upon the allelic differences disclosed herein are intended to be included within the scope of this invention.
- One of skill in the art once a polymorphism has been identified and a correlation to a particular trait established will understand that there are many ways to genotype animals for this polymorphism. The design of such alternative tests merely represents optimization of parameters known to those of skill in the art and is intended to be within the scope of this invention as fully described herein.
- genes for genes are determined as follows. Male and female animals of the same breed or breed cross or derived from similar genetic lineages are mated. The offspring with the beneficial trait are determined. RPLP analysis of the parental DNA is conducted as discussed above in order to determine polymorphisms in the selected gene of each animal. The polymorphisms are associated with the traits.
- amplification primers may be designed using analogous human or other closely related animal known sequences. The sequences of many of the genes have high homology. Primers may also be designed using known gene sequences as exemplified in Genbank or even designed from sequences obtained from linkage data from closely surrounding genes. According to the invention, the gene here was identified using primers designed from mouse and human sequences. According to the invention, sets of primers have been selected which identify regions in polymorphic genes. The polymorphic fragments have been shown to be alleles, and each was shown to be associated with beneficial traits, such as disease resistance, for various breeds. Often genotype associated with this trait alternates for different breeds.
- the methods and materials of the invention may also be used more generally to evaluate animal DNA, genetically type individual animals, and detect genetic differences in animals.
- a sample of genomic DNA may be evaluated by reference to one or more controls to determine which allele of the gene is present.
- RFLP analysis is performed with respect to the gene, and the results are compared with a control.
- the control is the result of a RFLP analysis of the gene of a different animal where the polymorphism of the gene is known.
- the genotype of an animal may be determined by obtaining a sample of its mRNA or genomic DNA, conducting RFLP analysis of the gene in the DNA, and comparing the results with a control. Again, the control is the result of RPLP analysis of the same gene of a different animal.
- the results genetically type the pig by specifying the polymorphism in its selected gene.
- genetic differences among animals can be detected by obtaining samples of the mRNA or genomic DNA from at least two animals, identifying the presence or absence of a polymorphism in the gene, and comparing the results.
- assays are useful for identifying the genetic markers relating to disease resistance, as discussed above, for identifying other polymorphisms in the gene that may be correlated with other characteristics, and for the general scientific analysis of genotypes and phenotypes.
- the genetic markers, methods, and novel sequence of the invention are also useful in a breeding program to improve disease resistance in a breed, line, or population of animals. Continuous selection and breeding of animals that are at least heterozygous and preferably homozygous for a polymorphism associated with a beneficial trait such as disease resistance would lead to a breed, line, or population having higher numbers of offspring in each litter of the females of this breed or line. Thus, the markers are selection tools.
- the examples and methods herein disclose certain genes which have been identified to have a polymorphism which is associated either positively or negatively with a beneficial trait that will have an effect on disease resistance of that animal.
- the identification of the existence of a polymorphism within a gene is often made by a single base alternative that results in a restriction site in certain allelic forms.
- a certain allele may have a number of base changes associated with it that could be assayed for which are indicative of the same polymorphism.
- other genetic markers or genes may be linked to the polymorphisms disclosed herein so that assays may involve identification of other genes or gene fragments, but which ultimately rely upon genetic characterization of animals for the same polymorphism. Any assay which sorts and identifies animals based upon the allelic differences disclosed herein are intended to be included within the scope of this invention.
- NFKBl different marker systems have been identified in the porcine NFKBl gene which are associated with different resistance to pathogens as well as growth.
- Novel NFKBl sequence has identified as well as exemplary primers for assaying for the polymorphisms.
- the markers are associated with innate immunity traits which are non pathogen specific, so while bacteria is used for challenge it is expected that these traits will improve animal health against a wide variety of diseases or challenges such as stress, viral pathogen, etc.
- novel primer sequences those of skill in the art will readily be able to design a multitude of alternative primers to amplify the region of the polymorphism using the sequence data already known in the art and are available in sources such as Genbank and disclosed herein.
- NFKB 1 different polymorphisms have been identified in the NFKB 1 gene which are postulated to be correlated with significant differences in traits associated with disease resistance and innate immunity as well as growth.
- the first is located in intron 18 of the NFKBl gene and is a C/A single nucleotide polymorphism.
- This polymorphism is postulated to show significant differences with respect to innate immunity and disease resistance and may thus be used by a breeder to identify animals which are more likely to demonstrate superior disease resistance or innate immunity compared to an animal which has the alternative gene form.
- Novel primers have been designed to amplify this region SEQ ID NO: 2 and 3, and the identification of which allele is present can be assayed by use of a Tsp 5091 restriction enzyme. Allele 1 is the no-cut and allele 2 is the cut.
- the second is located in the exon 24 of NFKBl gene and is a C/T single nucleotide polymorphism.
- This polymorphism has shown significant differences with respect to associated with, improved innate immunity, disease resistance or resistance to bacterial infection, as evidenced by bacterial clearance (ileocecal lymph node count, fecal bacteria counts challenge, % lymphocytes after challenge, % monocytes after challenge, %PMN after challenge, % eosinophils , including leukocyte function and fever response to infection.
- This exon 24 polymorphism has also been shown to be significantly correlated with overall growth including days to 110 Kg, and life time daily gain.
- This marker may thus be used by a breeder to identify animals which are more likely to exhibit superior disease resistance or innate immunity and or growth when compared to an animal which has the alternative gene form.
- Novel primers have been designed to amplify this region SEQ ID NO: 4 and 5, and the identification of which allele is present can be assayed by use of a Fnu4Hl restriction enzyme. Allele 1 is the cut and allele 2 is no cut.
- the traits of disease resistance and innate immunity may be measured by a number of different indicators.
- the indicators are associated with bacterial clearance, innate host defense, fever response to infection, and leukocyte function. It is expected that different indicators may be used to identify the same associations disclosed herein and these are intended to be within the scope of the invention.
- Such indicators may include but are not limited to: % Lymphocytes at various days, % Lymphocytes difference % PMN, % PMN difference % Monocytes day, % Monocytes difference % Eosinophils, % Eosinophils difference, Lymphocyte SI y with Sal heat extract day -2 (pre-challenge, Lymphocyte SI with Sal heat extract day 7 (post-challenge); PMN uptake (number of bacteria/PMN), PMN killing (%), temperature at each particular day am or pm, Ileocecal lymph node bacterial count (loglO colony-forming units/gram tissue), Fecal bacterial counts, Total white blood cell count before challenge, Total white blood cell count after challenge, Difference in total white blood cell count before and after challenge, Lymphocyte count before challenge, Lymphocyte count after challenge, Difference in lymphocyte count before and after challenge, Monocyte count before challenge, Monocyte count after challenge, Difference in monocyte count before and after challenge.
- the traits of overall growth may be measured by a number of different indicators such as average daily gain, overall weight gain, life time daily gain, days to 110 Kg and the like.
- the use of one particular indicator is not critical to the invention and it is expected that many indicia exist for identifying the same correlation.
- the description herein of a particular indicator of the general traits of disease resistance and growth shall not be limited to that particular trait measurement only, but shall be interpreted to include any similar measurement that evidences the same effect on disease resistance/growth.
- Partial cDNA sequence and exon 24 sequence of NFKBl were obtained by PCR amplification using primers designed from the conserved region between human and mouse NFKBl sequence.
- the sequence comparison from animals of Yorkshire, Meishan and a commercial population revealed polymorphisms, 1 in intron 18 and 1 in exon 24. Two of them were used to detect segregation in Salmonella challenge studies.
- the porcine NFKBl was mapped to Chromosome 8 q23-27 by testing a somatic cell hybrid panel and PigMaP family (Archibald et al., 1995).
- Cycle profile 94C 3 min, 40 x (94C 45s, 63C 45s, 72C 45s), 72C 5min
- PCR- Annotation Amplification was performed using 25 ng of genomic DNA and 0.3 ⁇ M of each primer in a 10 ⁇ l of reaction volume.
- Cycle profile 94C 3 min, 40 x (94C 45s, 55C 45s, 72C 45s), 72C 5min
- PCR- Annotation Amplification was performed using 25 ng of genomic DNA and 0.3 ⁇ M of each primer in a 10 ⁇ l of reaction volume.
- SNPl PCR product size is 427bp
- SNP2 PCR product size is 281bp
- SNP2 Fnu4HI digestion was used to reveal allele 1 and 2 :
- NFKBl was physically mapped on the porcine chromosome 8 q21-q23 by using pig/rodent somatic cell hybrid panel (SCHP) comprising 27 cell lines.
- the primers used to map the porcine NFKBl are:
- Fragment 2 (partial sequence of exon 24) is disclosed in Figure 3
- Phenotypic and genotype data were available on 154 challenged animals from PIC lines (Tables 3a-3c). Phenotypic data that were measured quantitatively, were tested with SAS proc Univariate for deviations from normality. Log transformed data were used for the FMPND6 trait since the range of values was so large; this is a standard approach with this type of data structure.
- Statistical association is defined as a comparison between phenotype and genotype that show a P value less that 0.1; i.e., a statistical term that indicates the declared statistically significant difference between classes being compared has a confidence of greater than 90% of being correct.
- Several associations have even higher levels of confidence, such as P values less than 0.05 or even less than 0.01 (see individual Results in Tables 3a-3b below).
- a negative value for the "allele contrasts" means that the allele that is mentioned first (for example, allele 2 in the 2-3 contrast) is associated with a smaller value than the allele mentioned second.
- Table 2 shows the frequencies of the Tsp5091 andFnu4Hl alleles in all challenge populations used for the trait associations.
- Tables 3a-3c show the trait associations for Salmonellosis and innate immunity for the Fnu4Hl polymorphism in combined and individual lines for the NADC challenges.
- Table 4 shows association data for the Fnu4Hl polymorphism in the Example 3 Compton families experiment..
- results are the product of evaluation of the NFKBl Exon 24 marker using a sire model and single marker analysis.
- the growth traits evaluated were: days to 110 Kg and Lifetime daily gain (Table 5).
- the probabilities are the significance of the genotypic effect from zero.
- the brown cells are those effects with the greatest significance.
- Four commercial lines were tested: Line A, Line B, Line C and Line D. The number of genotypes done for each line varied from 707- 790 pigs and the effects were evaluated on all available animals.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for determining improved disease resistance and or growth in animals is disclosed. The method involves assays for a genetic differences in the NFKB1 gene of the animal which is associated with superior disease resistance and improved overall growth traits. Novel NFKB1 sequence, assays, and compositions for identifying the presence of absence of these alleles are provided.
Description
TITLE: SEQUENCE, POLYMORPHISMS, AND MARKER TEST TECHNOLOGY FOR DISEASE RESISTANCE AND GROWTH (NFKBl)
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority under 35 U.S. C. § 119 of a provisional application Ser. No. 60/660,124 filed March 9, 2005, which application is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
This invention relates generally to the detection of genetic differences among animals. More particularly, the invention relates to genetic markers which have been identified in several genes indicative of heritable phenotypes associated with improved traits, such as disease resistance. Methods and compositions for use of these markers in genotyping of animals and selection are also disclosed.
BACKGROUND OF THE INVENTION
Genetic differences exist among individual animals as well as among breeds which can be exploited by breeding techniques to achieve animals with desirable characteristics. For example, Chinese pig breeds are known for reaching puberty at an early age and for their large litter size, while American breeds are known for their greater growth rates and leanness. Often, however, heritability for desired traits is low, and standard breeding methods which select individuals based upon phenotypic variations do not take fully into account genetic variability or complex gene interactions which exist.
There is a continuing need for an approach that deals with selection for disease resistance at the cellular or DNA level. This method will provide the ability to genetically evaluate animals and to enable breeders to more accurately select those animals which not only phenotypically express desirable traits but those which express favorable underlying genetic criteria. This has largely been accomplished to date by marker-assisted selection.
RFLP analysis has been used by several groups to study pig DNA. Jung et al., Theor. Appl. Genet., 71:211-214 (1989), incorporated herein by reference, discloses the use of RFLP techniques to show genetic variability between two pig breeds. Polymorphism was demonstrated for swine leukocyte antigen (SLA) Class I genes in these breeds. Hoganson et
al.. Abstract for Annual Meeting of Midwestern Section of the American Society of Animal Science, March 26-28, 1990, incorporated herein by reference, reports on the polymorphism of swine major histocompatibility complex (MHC) genes for Chinese pigs, also demonstrated by RFLP analysis. Jung et al. Animal Genetics, 26:79-91 (1989), incorporated herein by reference, reports on RFLP analysis of SLA Class I genes in certain boars. The authors state that the results suggest that there may be an association between swine SLA/MHC Class I genes and production and performance traits. They further state that the use of SLA Class I restriction fragments, as genetic markers, may have potential in the future for improving pig growth performance.
The ability to follow a specific favorable genetic allele involves a novel and lengthy process of the identification of a DNA molecular marker for a major effect gene. The marker may be linked to a single gene with a major effect or linked to a number of genes with additive effects. DNA markers have several advantages; segregation is easy to measure and is unambiguous, and DNA markers are co-dominant, i.e., heterozygous and homozygous animals can be distinctively identified. Once a marker system is established, selection decisions could be made very easily, since DNA markers can be assayed any time after a tissue or blood sample can be collected from the individual infant animal, or even an embryo.
The use of genetic differences in receptor genes has become a valuable marker system for selection. For example, United States Patents 5,550,024 and 5,374,526, issued to Rothschild et al., disclose a polymorphism in the pig estrogen receptor gene which is associated with larger litter size, the disclosure of which is incorporated herein by reference. United States Patent Number 5,935,784 discloses polymorphic markers in the pig prolactin receptor gene which are associated with larger litter size and overall reproductive efficiency, the disclosure of which is incorporated herein by reference.
The present invention provides a genetic markers, based upon the discovery of polymorphisms in the putative porcine NFKBl gene, which correlate with resistance or susceptibility to pathogenic infection in pigs. This will permit genetic typing of pigs for their NFKBl allele and for determination of the relationship of specific RFLPs to resistance to infection and growth traits. It will also permit the identification of individual males and females that carry the gene for improved resistance and growth. Thus, the markers may be selection tools in breeding programs to develop lines and breeds that produce litters
containing more resistant offspring. Also disclosed are novel porcine NFKBl genomic sequences, as well as primers for assays to identify the presence or absence of marker alleles.
According to the invention a polymorphism was identified in the NFKBl gene which is associated with the improved resistance to pathogenic infection.
It is an object of the invention to provide a method of screening pigs to determine those more likely to produce offspring with improved pathogenic resistance and growth through identifying specific variation in the NFKBl gene.
Another object of the invention is to provide a method for identifying genetic markers for improved disease resistance.
A further object of the invention is to provide genetic markers for selection and breeding to obtain pigs that will be expected to have a lower susceptibility to infection than those without the favorable allele.
A still further object of the invention is to provide genetic markers for selection and breeding to obtain pigs that will be expected to have superior growth traits than those without the favorable allele.
Yet another object of the invention is to provide a kit for evaluating a sample of pig DNA for specific genetic markers of disease resistance and growth traits.
Additional objects and advantages of the invention will be set forth in part in the description that follows, and in part will be obvious from the description, or may be learned by the practice of the invention. The objects and advantages of the invention will be attained by means of the instrumentalities and combinations particularly pointed out in the appended claims.
SUMMARY OF THE INVENTION
To achieve the objects and in accordance with the purpose of the invention, as embodied and broadly described herein, the present invention provides a method for screening animals to determine those more likely to have beneficial phenotypes such as, or associated with, improved innate immunity, disease resistance or resistance to bacterial infection, as evidenced by one or more of the following: bacterial clearance, leukocyte base line and response to infection leukocyte function and fever response to infection, in a particular population, when bred, or raised or to select against pigs which have alleles indicating unfavorable phenotypes. As used herein the term improved or superior disease
resistance or innate immunity shall mean a measurable statistically significantly difference in indicators of innate immunity or disease resistance including but not limited to lymphocyte counts, bacterial counts, temperature response to infection, monocyte counts, eosinophil counts, and PMN killing when one allele is present as compared to the same indicator when the alternate allele is present. The traits are not so limited to these specific measurements.
In another embodiment the present invention provides a method for screening animals to determine those more likely to have beneficial phenotypes such as, or associated with, growth traits as evidenced by one or more of the following no limiting list of indicia of growth traits: days to 110 Kg, or life time daily gain. Growth traits may be measured by any of a number of indicia and the invention is not limited to these particular traits only. The growth traits mentioned herein are beyond and separate from those which may be attributed to improved innate immunity
Thus, the present invention provides a method for screening pigs to determine those more likely to have the improved trait of superior disease resistance or growth and/or those less likely to demonstrate those traits which method comprises the steps: 1) obtaining a sample of tissue of genomic DNA from an animal; and 2) analyzing the mRNA or genomic DNA obtained in 1) to determine which NFKBl allele(s) is/are present. Briefly, the sample of genetic material analyzed to determine the presence or absence of a particular allele that is correlated with a desirable trait, or one which is linked thereto.
As is well known to those of skill in the art, a variety of techniques may be utilized when comparing nucleic acid molecules for sequence differences. These include by way of example, restriction fragment length polymorphism analysis, heteroduplex analysis, single strand conformation polymorphism analysis, denaturing gradient electrophoresis and temperature gradient electrophoresis.
In one embodiment, the polymorphism is a restriction fragment length polymorphism and the assay comprises identifying the gene from isolated genetic material; exposing the gene to a restriction enzyme that yields restriction fragments of the gene of varying length; separating the restriction fragments to form a restriction pattern, such as by electrophoresis or HPLC separation; and comparing the resulting restriction fragment pattern from an animal gene that is either known to have or not to have the desired marker. If an animal tests positive for the marker (or allele), such animal can be considered for inclusion in the breeding
program. If the animal does not test positive for the marker genotype, the animal can be culled from the group and otherwise used.
In a most preferred embodiment, the gene, or a fragment thereof, is isolated by the use of primers and DNA polymerase to amplify a specific region of the gene which contains the polymorphism or a polymorphism linked thereto. Next, the amplified region is either directly separated or sequenced or is digested with a restriction enzyme and fragments are again separated. Visualization of the separated fragments, or RFLP pattern, is by simple staining of the fragments, or by labeling the primers or the nucleoside triphosphates used in amplification.
In another embodiment, the invention comprises a method for identifying a genetic marker for disease resistance traits, such as bacterial counts, lymphocyte count, neutrophil count, or monocyte count after challenge or for growth traits such as average daily gain, days to 110 Kg., life time daily gain and the like. Male and female animals of the same breed, breed cross, or similar genetic lineage are bred, and the growth/disease resistance traits are determined. A polymorphism in the NFKBl gene of each animal is identified and associated with the desired trait(s). Preferably, PCR-RFLP analysis is used to determine the polymorphism.
It is also possible to establish linkage between specific alleles of alternative DNA markers and alleles of DNA markers known to be associated with a particular gene (e.g., the NFKBl gene discussed herein) which have previously been shown to be associated with a particular trait. Thus, in the present situation, taking a particular gene, it would be possible, at least in the short term, to select for pigs, or other animals, likely to have superior disease resistance or ability to stave off infection/growth, or alternatively, against pigs likely to have inferior traits, indirectly, by selecting for certain alleles of a particular gene associated with the marker alleles through the selection of specific linked alleles of alternative chromosome markers. Thus, in the present situation, taking the NFKBl gene or the NFKBl gene, it would be possible, at least in the short term, to select for pigs likely to produce disease resistance/ superior growth or alternatively, against pigs likely to produce susceptible litters/inferior growth indirectly, by selecting for certain alleles of the NFKBl associated marker or the NFKB 1 associated marker through the selection of specific alleles of alternative markers located on chromosome 8 where NFKBl is.
According to the inventions 2 different polymorphisms have been identified in the NFKBl gene which are correlated with significant differences in traits associated with disease resistance and innate immunity and/or growth. The first is located in intron 18 of the putative NFKBl gene and is a C/A single nucleotide polymorphism. This polymorphism is expected to show significant differences with respect to innate immunity and disease resistance and may thus be used by a breeder to identify animals which are more likely to demonstrate superior disease resistance or innate immunity compared to an animal which has the alternative gene form.
The second is located in the exon 24 of the putative NFKBl gene and is a C/T single nucleotide polymorphism. This polymorphism has shown significant differences with respect to innate host defense including fever response to infection, and bacterial clearance and may thus be used by a breeder to identify animals which are more likely to exhibit superior disease resistance or innate immunity when compared to an animal which has the alternative gene form. The exon 24 SNP has also been shown to be significantly correlated with growth traits. Animals with the favorable allele were shown to have fewer days to reach 110 Kg., and a higher life time daily gain than animals without the favorable allele.
DETAILED DESCRIPTION OF THE FIGURES
Figure 1 shows a combination of the novel porcine NFKBl partial cDNA sequence, intron 18, which has been placed at its correct position between exon 18 and exon 19 to show SNP 1 in the context of the cDNA sequence, and the 3' untranslated region, including exon 24 which encompasses SNP 2 of the invention. Intron 18 is shown in blue text from position 2074 to position 2397 and is 324 base pairs long. SNP 1, located in intron 18 is located at position 2089 of SEQ ID NO: 1, and is designated as M (C or A) as the difference between alleles is at this position. Primers and SNP 2 are highlighted in red text. The SNP 2 is located at position 3082 of SEQ ID NO:1, and is designated as Y (C or T) as the difference between alleles is at this position.
Figure 2 is the sequence amplified from primers SEQ ID NO: 2 and 3. Primers are bold italic underlined, the C or A polymorphism is indicated in red text as M (amplified sequence for allele 1 with C nucleotide is SEQ ID NO:8).
Figure 3 is the sequence amplified from primers SEQ ID NO: 4 and 5. Primers are bold italic underlined, the C or T polymorphism is indicated in red text as Y (amplified sequence for allele 1 with C nucleotide is SEQ ID NO: 9).
Figure 4 is the partial cDNA sequence for porcine NFKBl of 3,314 base pairs (SEQ ID NO: 10). Also shown is the complete open reading frame predicted from SEQ ID NO: 10, and the protein sequence derived (SEQ ID NO: 11). This protein sequence was compared to the known human NFKBl sequence (Genbank Accession number: NM_003998) and our novel sequence (SEQ ID NO: 11) is 92% identical to this sequence. The 3' untranslated region is from position 2,877 (position 2878-2880 is a TAG stop codon) to position 3,314.
DETAILED DESCRIPTION OF THE INVENTION
Reference will now be made in detail to the presently preferred embodiments of the invention, which together with the following examples, serve to explain the principles of the invention. AU references cited herein are hereby expressly incorporated by reference.
The nuclear factor kappa-B (NFKB) family of genes encode transcription factors which play an essential role in immune and inflammatory responses . In unstimulated cells, NFKB dimers are inactive due to their retention in the cytoplasm by associated 1KB proteins. In response to stimulation with agonists, such as tumor necrosis factor alpha (TNF-α) and bacterial lipopolysaccharide (LPS), IKBs are degraded by the proteasome. This degradation releases associated NFKB subunits, allowing them to translocate into the nucleus and modulate gene expression.
NFKBl functions both as an 1KB in its longer precursor form, pl05, and as an active transcription factor, p50, after proteolytic processing by the proteasome, which removes the IKB-like C-terminal half of pi 05. Processing to p50 occurs in a constitutive, unregulated fashion. However, following cellular stimulation with ligands, such as TNF-α, two serines in the pl05 PEST domain are rapidly phosphorylated by the 1KB kinase (IKK) complex, triggering complete pl05 degradation with little effect on processing to p50. This degradation results in the release of associated p50 and other NFKB subunits, which can then translocate into the nucleus. Analysis of knockout mice that lack the C-terminal (IκB-like) half of pl05 while still expressing p50 has suggested an essential role for pl05 in the regulation of the nuclear translocation of p50 homodimers
The single nucleotide polymorphisms have been identified by use of primers and probes designed from the mouse and human NFKBl sequences. The resulting novel sequence, SNPs and primers have also been putatively identified as the porcine NFKBl gene by computer analysis. The use of the term NFKBl is not intended to exclude other gene sequences which have the nucleotide or amino acid sequences disclosed herein. Regardless of the actual gene identified, applicants' methods for identification of genetic markers with a relevant correlation and predictability to a particular trait remain, regardless of which gene the sequence, SNPs or primers are ultimately determined to be from.
The invention relates to the identification of quantitative trait loci (QTL) for improved disease resistance or resistance to bacterial infection and/or growth traits, including, but not limited to, Salmonellosis, identifiable by traits such as bacterial count, lymphocyte count, neutrophil count, monocyte count post challenge, days to 110 Kg, or life time daily gain, to identify pigs and other animals which have superior bacterial killing or ability to stave off infection and/or growth. The invention also relates to a method of screening animals to determine those more likely to have improved resistance/growth traits when bred by identifying the presence or an absence of a polymorphism in certain genes (NFKBl) that are correlated with these traits.
Thus, the invention relates to genetic markers and methods of identifying those markers in a pig or other animal of a particular breed, strain, population, or group, whereby an animal is more likely to have disease resistance/growth that is superior to that of an animal which has a different allele present as well as for the mean for that particular breed, strain, population, or group.
The marker may be identified by any method known to one of ordinary skill in the art which identifies the presence or absence of the particular allele or marker, including, for example, direct sequencing single-strand conformation polymorphism analysis (SSCP), base excision sequence scanning (BESS), RFLP analysis, heteroduplex analysis, denaturing gradient gel electrophoresis, allelic PCR, temperature gradient electrophoresis, ligase chain reaction, direct sequencing, minisequencing, nucleic acid hybridization, and micro-array-type detection of the NFKBl gene, or other linked sequences, and examination for a polymorphic site. Yet another technique includes an Invader Assay which includes isothermic amplification that relies on a catalytic release of fluorescence. See Third Wave Technology at
http/www.twt.com. All of these techniques are intended to be within the scope of the invention. A brief description of these techniques follows.
Isolation and Amplification of Nucleic Acid
Samples of genomic DNA are isolated from any convenient source including saliva, buccal cells, hair roots, blood, cord blood, amniotic fluid, interstitial fluid, peritoneal fluid, chorionic villus, and any other suitable cell or tissue sample with intact interphase nuclei or metaphase cells. The cells can be obtained from solid tissue as from a fresh or preserved organ or from a tissue sample or biopsy. The sample can contain compounds which are not naturally intermixed with the biological material such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
Methods for isolation of genomic DNA from these various sources are described in, for example, Kirby, DNA Fingerprinting, An Introduction, W.H. Freeman & Co. New York (1992). Genomic DNA can also be isolated from cultured primary or secondary cell cultures or from transformed cell lines derived from any of the aforementioned tissue samples.
Samples of patient, proband, test subject or family member RNA can also be used. RNA can be isolated from tissues expressing the NFKBl gene as described in Sambrook et al., supra. RNA can be total cellular RNA, rnRNA, poly A+ RNA, or any combination thereof. For best results, the RNA is purified, but can also be unpurified cytoplasmic RNA. RNA can be reverse transcribed to form DNA which is then used as the amplification template, such that the PCR indirectly amplifies a specific population of RNA transcripts. See, e.g., Sambrook, supra, Kawasaki et al., Chapter 8 in PCR Technology, (1992) supra, and Berg et al., Hum. Genet. 85:655-658 (1990).
PCR Amplification
The most common means for amplification is polymerase chain reaction (PCR), as described in U.S. Pat. Nos. 4,683,195, 4,683,202, 4,965,188 each of which is hereby incorporated by reference. If PCR is used to amplify the target regions in blood cells, heparinized whole blood should be drawn in a sealed vacuum tube kept separated from other samples and handled with clean gloves. For best results, blood should be processed immediately after collection; if this is impossible, it should be kept in a sealed container at 4°C until use. Cells in other physiological fluids may also be assayed. When using any of
these fluids, the cells in the fluid should be separated from the fluid component by centrifugation.
Tissues should be roughly minced using a sterile, disposable scalpel and a sterile needle (or two scalpels) in a 5 mm Petri dish. Procedures for removing paraffin from tissue sections are described in a variety of specialized handbooks well known to those skilled in the art.
To amplify a target nucleic acid sequence in a sample by PCR, the sequence must be accessible to the components of the amplification system. One method of isolating target DNA is crude extraction which is useful for relatively large samples. Briefly, mononuclear cells from samples of blood, amniocytes from amniotic fluid, cultured chorionic villus cells, or the like are isolated by layering on sterile Ficoll-Hypaque gradient by standard procedures. Interphase cells are collected and washed three times in sterile phosphate buffered saline before DNA extraction. If testing DNA from peripheral blood lymphocytes, an osmotic shock (treatment of the pellet for 10 sec with distilled water) is suggested, followed by two additional washings if residual red blood cells are visible following the initial washes. This will prevent the inhibitory effect of the heme group carried by hemoglobin on the PCR reaction. If PCR testing is not performed immediately after sample collection, aliquots of 106 cells can be pelleted in sterile Eppendorf tubes and the dry pellet frozen at -20°C until use.
The cells are resuspended (106 nucleated cells per 100 μl) in a buffer of 50 mM Tris- HCl (pH 8.3), 50 mM KCl 1.5 mM MgCl2, 0.5% Tween 20, 0.5% NP40 supplemented with 100 μg/ml of proteinase K. After incubating at 56°C for 2 hr. the cells are heated to 95°C for 10 min to inactivate the proteinase K and immediately moved to wet ice (snap-cool). If gross aggregates are present, another cycle of digestion in the same buffer should be undertaken. Ten μl of this extract is used for amplification.
When extracting DNA from tissues, e.g., chorionic villus cells or confluent cultured cells, the amount of the above mentioned buffer with proteinase K may vary according to the size of the tissue sample. The extract is incubated for 4-10 hrs at 50°-60°C and then at 950C for 10 minutes to inactivate the proteinase. During longer incubations, fresh proteinase K should be added after about 4 hr at the original concentration.
When the sample contains a small number of cells, extraction may be accomplished by methods as described in Higuchi, "Simple and Rapid Preparation of Samples for PCR", in PCR Technology, Ehrlich, H.A. (ed.), Stockton Press, New York, which is incorporated
herein by reference. PCR can be employed to amplify target regions in very small numbers of cells (1000-5000) derived from individual colonies from bone marrow and peripheral blood cultures. The cells in the sample are suspended in 20 μl of PCR lysis buffer (10 mM Tris- HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.1 mg/ml gelatin, 0.45% NP40, 0.45% Tween 20) and frozen until use. When PCR is to be performed, 0.6 μl of proteinase K (2 mg/ml) is added to the cells in the PCR lysis buffer. The sample is then heated to about 60°C and incubated for 1 hr. Digestion is stopped through inactivation of the proteinase K by heating the samples to 950C for 10 min and then cooling on ice.
A relatively easy procedure for extracting DNA for PCR is a salting out procedure adapted from the method described by Miller et al., Nucleic Acids Res. 16:1215 (1988), which is incorporated herein by reference. Mononuclear cells are separated on a Ficoll- Hypaque gradient. The cells are resuspended in 3 ml of lysis buffer (10 mM Tris-HCl, 400 mM NaCl, 2 mM Na2 EDTA, pH 8.2). Fifty μl of a 20 mg/ml solution of proteinase K and 150 μl of a 20% SDS solution are added to the cells and then incubated at 37°C overnight. Rocking the tubes during incubation will improve the digestion of the sample. If the proteinase K digestion is incomplete after overnight incubation (fragments are still visible), an additional 50 μl of the 20 mg/ml proteinase K solution is mixed in the solution and incubated for another night at 370C on a gently rocking or rotating platform. Following adequate digestion, one ml of a 6M NaCl solution is added to the sample and vigorously mixed. The resulting solution is centrifuged for 15 minutes at 3000 rpm. The pellet contains the precipitated cellular proteins, while the supernatant contains the DNA. The supernatant is removed to a 15 ml tube that contains 4 ml of isopropanol. The contents of the tube are mixed gently until the water and the alcohol phases have mixed and a white DNA precipitate has formed. The DNA precipitate is removed and dipped in a solution of 70% ethanol and gently mixed. The DNA precipitate is removed from the ethanol and air-dried. The precipitate is placed in distilled water and dissolved.
Kits for the extraction of high-molecular weight DNA for PCR include a Genomic Isolation Kit A.S.A.P. (Boehringer Mannheim, Indianapolis, Lid.), Genomic DNA Isolation System (GIBCO BRL, Gaithersburg, Md.), Elu-Quik DNA Purification Kit (Schleicher & Schuell, Keene, N.H.), DNA Extraction Kit (Stratagene, LaJoIIa, Calif.), TurboGen Isolation Kit (Invitrogen, San Diego, Calif.), and the like. Use of these kits according to the
manufacturer's instructions is generally acceptable for purification of DNA prior to practicing the methods of the present invention.
The concentration and purity of the extracted DNA can be determined by spectrophotometric analysis of the absorbance of a diluted aliquot at 260 nm and 280 nm. After extraction of the DNA, PCR amplification may proceed. The first step of each cycle of the PCR involves the separation of the nucleic acid duplex formed by the primer extension. Once the strands are separated, the next step in PCR involves hybridizing the separated strands with primers that flank the target sequence. The primers are then extended to form complementary copies of the target strands. For successful PCR amplification, the primers are designed so that the position at which each primer hybridizes along a duplex sequence is such that an extension product synthesized from one primer, when separated from the template (complement), serves as a template for the extension of the other primer. The cycle of denaturation, hybridization, and extension is repeated as many times as necessary to obtain the desired amount of amplified nucleic acid.
In a particularly useful embodiment of PCR amplification, strand separation is achieved by heating the reaction to a sufficiently high temperature for a sufficient time to cause the denaturation of the duplex but not to cause an irreversible denaturation of the polymerase (see U.S. Pat. No. 4,965,188, incorporated herein by reference). Typical heat denaturation involves temperatures ranging from about 80°C to 105°C for times ranging from seconds to minutes. Strand separation, however, can be accomplished by any suitable denaturing method including physical, chemical, or enzymatic means. Strand separation may be induced by a helicase, for example, or an enzyme capable of exhibiting helicase activity. For example, the enzyme RecA has helicase activity in the presence of ATP. The reaction conditions suitable for strand separation by helicases are known in the art (see Kuhn Hoffman-Berling, 1978, CSH-Quantitative Biology, 43:63-67; and Radding, 1982, Ann. Rev. Genetics 16:405-436, each of which is incorporated herein by reference.
Template-dependent extension of primers in PCR is catalyzed by a polymerizing agent in the presence of adequate amounts of four deoxyribonucleotide triphosphates (typically dATP, dGTP, dCTP, and dTTP) in a reaction medium comprised of the appropriate salts, metal cations, and pH buffering systems. Suitable polymerizing agents are enzymes known to catalyze template-dependent DNA synthesis. In some cases, the target regions may encode at least a portion of a protein expressed by the cell. In this instance, mRNA may be used for
amplification of the target region. Alternatively, PCR can be used to generate a cDNA library from RNA for further amplification, the initial template for primer extension is RNA. Polymerizing agents suitable for synthesizing a complementary, copy-DNA (cDNA) sequence from the RNA template are reverse transcriptase (RT), such as avian myeloblastosis virus RT, Moloney murine leukemia virus RT, or Thermus thermophilus (Tth) DNA polymerase, a thermostable DNA polymerase with reverse transcriptase activity marketed by Perkin Elmer Cetus, Inc. Typically, the genomic RNA template is heat degraded during the first denaturation step after the initial reverse transcription step leaving only DNA template. Suitable polymerases for use with a DNA template include, for example, E. coli DNA polymerase I or its Klenow fragment, T4 DNA polymerase, Tth polymerase, and Taq polymerase, a heat-stable DNA polymerase isolated from Thermus aquaticus and commercially available from Perkin Elmer Cetus, Inc. The latter enzyme is widely used in the amplification and sequencing of nucleic acids. The reaction conditions for using Taq polymerase are known in the art and are described in GeIf and, 1989, PCR Technology, supra. Allele Specific PCR
Allele-specific PCR differentiates between target regions differing in the presence of absence of a variation or polymorphism. PCR amplification primers are chosen which bind only to certain alleles of the target sequence. This method is described by Gibbs, Nucleic Acid Res. 17:12427-2448 (1989). Allele Specific Oligonucleotide Screening Methods
Further diagnostic screening methods employ the allele-specific oligonucleotide (ASO) screening methods, as described by Saiki et al., Nature 324:163-166 (1986). Oligonucleotides with one or more base pair mismatches are generated for any particular allele. ASO screening methods detect mismatches between variant target genomic or PCR amplified DNA and non-mutant oligonucleotides, showing decreased binding of the oligonucleotide relative to a mutant oligonucleotide. Oligonucleotide probes can be designed that under low stringency will bind to both polymorphic forms of the allele, but which at high stringency, bind to the allele to which they correspond. Alternatively, stringency conditions can be devised in which an essentially binary response is obtained, i.e., an ASO corresponding to a variant form of the target gene will hybridize to that allele, and not to the wildtype allele.
Ligase Mediated Allele Detection Method
Target regions of a test subject's DNA can be compared with target regions in unaffected and affected family members by ligase-mediated allele detection. See Landegren et al, Science 241:107-1080 (1988). Ligase may also be used to detect point mutations in the ligation amplification reaction described in Wu et al., Genomics 4:560-569 (1989). The ligation amplification reaction (LAR) utilizes amplification of specific DNA sequence using sequential rounds of template dependent ligation as described in Wu, supra, and Barany, Proc. Nat. Acad. Sci. 88:189-193 (1990).
Denaturing Gradient Gel Electrophoresis
Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. DNA molecules melt in segments, termed melting domains, under conditions of increased temperature or denaturation. Each melting domain melts cooperatively at a distinct, base-specific melting temperature (TM). Melting domains are at least 20 base pairs in length, and may be up to several hundred base pairs in length.
Differentiation between alleles based on sequence specific melting domain differences can be assessed using polyacrylamide gel electrophoresis, as described in Chapter 7 of Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W.H. Freeman and Co., New York (1992), the contents of which are hereby incorporated by reference.
Generally, a target region to be analyzed by denaturing gradient gel electrophoresis is amplified using PCR primers flanking the target region. The amplified PCR product is applied to a polyacrylamide gel with a linear denaturing gradient as described in Myers et al., Meth. Enzymol. 155:501-527 (1986), and Myers et al., in Genomic Analysis, A Practical Approach, K. Davies Ed. IRL Press Limited, Oxford, pp. 95-139 (1988), the contents of which are hereby incorporated by reference. The electrophoresis system is maintained at a temperature slightly below the Tm of the melting domains of the target sequences.
In an alternative method of denaturing gradient gel electrophoresis, the target sequences may be initially attached to a stretch of GC nucleotides, teπried a GC clamp, as described in Chapter 7 of Erlich, supra. Preferably, at least 80% of the nucleotides in the GC
clamp are either guanine or cytosine. Preferably, the GC clamp is at least 30 bases long. This method is particularly suited to target sequences with high Tm's.
Generally, the target region is amplified by the polymerase chain reaction as described above. One of the oligonucleotide PCR primers carries at its 5' end, the GC clamp region, at least 30 bases of the GC rich sequence, which is incorporated into the 5' end of the target region during amplification. The resulting amplified target region is run on an electrophoresis gel under denaturing gradient conditions as described above. DNA fragments differing by a single base change will migrate through the gel to different positions, which may be visualized by ethidium bromide staining.
Temperature Gradient GeI Electrophoresis
Temperature gradient gel electrophoresis (TGGE) is based on the same underlying principles as denaturing gradient gel electrophoresis, except the denaturing gradient is produced by differences in temperature instead of differences in the concentration of a chemical denaturant. Standard TGGE utilizes an electrophoresis apparatus with a temperature gradient running along the electrophoresis path. As samples migrate through a gel with a uniform concentration of a chemical denaturant, they encounter increasing temperatures. An alternative method of TGGE, temporal temperature gradient gel electrophoresis (TTGE or tTGGE) uses a steadily increasing temperature of the entire electrophoresis gel to achieve the same result. As the samples migrate through the gel the temperature of the entire gel increases, leading the samples to encounter increasing temperature as they migrate through the gel. Preparation of samples, including PCR amplification with incorporation of a GC clamp, and visualization of products are the same as for denaturing gradient gel electrophoresis.
Single-Strand Conformation Polymorphism Analysis
Target sequences or alleles at the NFKBl locus can be differentiated using single- strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 85:2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products. Single-stranded nucleic acids may refold or form secondary structures which are partially
dependent on the base sequence. Thus, electrophoretic mobility of single-stranded amplification products can detect base-sequence difference between alleles or target sequences.
Chemical or Enzymatic Cleavage of Mismatches.
Differences between target sequences can also be detected by differential chemical cleavage of mismatched base pairs, as described in Grompe et al., Am. J. Hum. Genet. 48:212-222 (1991). In another method, differences between target sequences can be detected by enzymatic cleavage of mismatched base pairs, as described in Nelson et al., Nature Genetics 4:11-18 (1993). Briefly, genetic material from a patient and an affected family member may be used to generate mismatch free heterohybrid DNA duplexes. As used herein, "heterohybrid" means a DNA duplex strand comprising one strand of DNA from one person, usually the patient, and a second DNA strand from another person, usually an affected or unaffected family member. Positive selection for heterohybrids free of mismatches allows determination of small insertions, deletions or other polymorphisms that may be associated with alterations in androgen metabolism.
Non-PCR Based DNA Diagnostics
The identification of a DNA sequence linked to NFKBl can be made without an amplification step, based on polymorphisms including restriction fragment length polymorphisms in a patient and a family member. Hybridization probes are generally oligonucleotides which bind through complementary base pairing to all or part of a target nucleic acid. Probes typically bind target sequences lacking complete complementarity with the probe sequence depending on the stringency of the hybridization conditions. The probes are preferably labeled directly or indirectly, such that by assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence. Direct labeling methods include radioisotope labeling, such as with 32P or 35S. Indirect labeling methods include fluorescent tags, biotin complexes which may be bound to avidin or streptavidin, or peptide or protein tags. Visual detection methods include photoluminescents, Texas red, rhodamine and its derivatives, red leuco dye and e, e', 5, 5'-5354amethylbenzidine (TMB), fluorescein, and its derivatives, dansyl, umbelliferone and the like or with horse radish peroxidase, alkaline phosphatase and the like.
Hybridization probes include any nucleotide sequence capable of hybridizing to the porcine chromosome where NFKBl resides, and thus defining a genetic marker linked to NFKBl, including a restriction fragment length polymorphism, a hypervariable region, repetitive element, or a variable number tandem repeat. Hybridization probes can be any gene or a suitable analog. Further suitable hybridization probes include exon fragments or portions of cDNAs or genes known to map to the relevant region of the chromosome.
Preferred tandem repeat hybridization probes for use according to the present invention are those that recognize a small number of fragments at a specific locus at high stringency hybridization conditions, or that recognize a larger number of fragments at that locus when the stringency conditions are lowered.
One or more additional restriction enzymes and/or probes and/or primers can be used. Additional enzymes, constructed probes, and primers can be determined by routine experimentation by those of ordinary skill in the art and are intended to be within the scope of the invention.
Although the methods described herein may be in terms of the use of a single restriction enzyme and a single set of primers, the methods are not so limited. One or more additional restriction enzymes and/or probes and/or primers can be used, if desired. Additional enzymes, constructed probes and primers can be determined through routine experimentation, combined with the teachings provided and incorporated herein.
According to the invention, polymorphisms in the NFBKl gene have been identified which have an association with disease resistance and overall innate immunity as well as growth. The presence or absence of the markers, in one embodiment may be assayed by PCR-RFLP analysis using the restriction endonucleases and amplification primers may be designed using analogous human, pig or other NFBKl sequences due to the high homology in the region surrounding the polymorphisms, or may be designed using known NFBKl gene sequence data as exemplified in GenBank or even designed from sequences obtained from linkage data from closely surrounding genes based upon the teachings and references herein. The sequences surrounding the polymorphism will facilitate the development of alternate PCR tests in which a primer of about 4-30 contiguous bases taken from the sequence immediately adjacent to the polymorphism is used in connection with a polymerase chain reaction to greatly amplify the region before treatment with the desired restriction enzyme. The novel sequence disclosed herein, SEQ ID NO: 1 may be useful in this regard as well. The
primers need not be the exact complement; substantially equivalent sequences are acceptable. The design of primers for amplification by PCR is known to those of skill in the art and is discussed in detail in Ausubel (ed.), Short Protocols in Molecular Biology, 4th Edition, John Wiley and Sons (1999).
The following is a brief description of primer design.
Primer Design Strategy
Increased use of polymerase chain reaction (PCR) methods has stimulated the development of many programs to aid in the design or selection of oligonucleotides used as primers for PCR. Four examples of such programs that are freely available via the Internet are: PRIMER by Mark Daly and Steve Lincoln of the Whitehead Institute (UNIX, VMS, DOS, and Macintosh), Oligonucleotide Selection Program (OSP) by Phil Green and LaDeana Hiller of Washington University in St. Louis (UNIX, VMS, DOS, and Macintosh), PGEN by Yoshi (DOS only), and Amplify by Bill Engels of the University of Wisconsin (Macintosh only). Generally these programs help in the design of PCR primers by searching for bits of known repeated-sequence elements and then optimizing the Tm by analyzing the length and GC content of a putative primer. Commercial software is also available and primer selection procedures are rapidly being included in most general sequence analysis packages.
Sequencing and PCR Primers
Designing oligonucleotides for use as either sequencing or PCR primers requires selection of an appropriate sequence that specifically recognizes the target, and then testing the sequence to eliminate the possibility that the oligonucleotide will have a stable secondary structure. Inverted repeats in the sequence can be identified using a repeat-identification or RNA-folding program such as those described above. If a possible stem structure is observed, the sequence of the primer can be shifted a few nucleotides in either direction to minimize the predicted secondary structure. The sequence of the oligonucleotide should also be compared with the sequences of both strands of the appropriate vector and insert DNA. Obviously, a sequencing primer should only have a single match to the target DNA. It is also advisable to exclude primers that have only a single mismatch with an undesired target DNA sequence. For PCR primers used to amplify genomic DNA, the primer sequence should be compared to the sequences in the GenBank database to determine if any significant matches
occur. If the oligonucleotide sequence is present in any known DNA sequence or, more importantly, in any known repetitive elements, the primer sequence should be changed.
The methods and materials of the invention may also be used more generally to evaluate pig DNA, genetically type individual pigs, and detect genetic differences in pigs. In particular, a sample of pig genomic DNA may be evaluated by reference to one or more controls to determine if a polymorphism in the NFBKl gene is present. Preferably, RFLP analysis is performed with respect to the pig NFBKl gene, and the results are compared with a control. The control is the result of a RFLP analysis of the pig NFBKl gene of a different pig where the polymorphism(s) of the pig NFBKlgene is/are known. Similarly, the NFBKl genotype of a pig may be determined by obtaining a sample of its genomic DNA, conducting RFLP analysis of the NFBKl gene in the DNA, and comparing the results with a control. Again, the control is the result of RFLP analysis of the NFBKl gene of a different pig. The results genetically type the pig by specifying the polymorphism(s) in its NFBKl genes. Finally, genetic differences among pigs can be detected by obtaining samples of the genomic DNA from at least two pigs, identifying the presence or absence of a polymorphism in the NFBKl gene, and comparing the results.
These assays are useful for identifying the genetic markers relating to disease resistance and/or innate immunity, as discussed above, for identifying other polymorphisms in the NFBKl gene and for the general scientific analysis of pig genotypes and phenotypes.
The examples and methods herein disclose certain gene(s) which has been identified to have a polymorphism(s) which is associated either positively or negatively with a beneficial trait that will have an effect on disease resistance or innate immunity for animals carrying this alternate allele. The identification of the existence of a polymorphism within a gene is often made by a single base alternative that results in a restriction site in certain allelic forms. A certain allele, however, as demonstrated and discussed herein, may have a number of base changes associated with it that could be assayed for which are indicative of the same polymorphism (allele). Further, other genetic markers or genes may be linked to the polymorphisms disclosed herein so that assays may involve identification of other genes or gene fragments, but which ultimately rely upon genetic characterization of animals for the same polymorphism. Any assay which sorts and identifies animals based upon the allelic differences disclosed herein are intended to be included within the scope of this invention.
One of skill in the art, once a polymorphism has been identified and a correlation to a particular trait established will understand that there are many ways to genotype animals for this polymorphism. The design of such alternative tests merely represents optimization of parameters known to those of skill in the art and is intended to be within the scope of this invention as fully described herein.
Genetic markers for genes are determined as follows. Male and female animals of the same breed or breed cross or derived from similar genetic lineages are mated. The offspring with the beneficial trait are determined. RPLP analysis of the parental DNA is conducted as discussed above in order to determine polymorphisms in the selected gene of each animal. The polymorphisms are associated with the traits.
When this analysis is conducted and the polymorphism is determined by RELP or other analysis, amplification primers may be designed using analogous human or other closely related animal known sequences. The sequences of many of the genes have high homology. Primers may also be designed using known gene sequences as exemplified in Genbank or even designed from sequences obtained from linkage data from closely surrounding genes. According to the invention, the gene here was identified using primers designed from mouse and human sequences. According to the invention, sets of primers have been selected which identify regions in polymorphic genes. The polymorphic fragments have been shown to be alleles, and each was shown to be associated with beneficial traits, such as disease resistance, for various breeds. Often genotype associated with this trait alternates for different breeds. This outcome is similar to the situation disclosed in U.S. patent 5,374,523 entitled "Allelic variants of Bovine Somatotropin gene: Genetic marker for Superior Milk Production in Bovine" where the inventor found an allelic polymorphism in the somatotropin gene and one allelic form was beneficial for jersey cows and the alternate form was beneficial for Holstein cows.
The methods and materials of the invention may also be used more generally to evaluate animal DNA, genetically type individual animals, and detect genetic differences in animals. In particular, a sample of genomic DNA may be evaluated by reference to one or more controls to determine which allele of the gene is present. Preferably, RFLP analysis is performed with respect to the gene, and the results are compared with a control. The control is the result of a RFLP analysis of the gene of a different animal where the polymorphism of the gene is known. Similarly, the genotype of an animal may be determined by obtaining a
sample of its mRNA or genomic DNA, conducting RFLP analysis of the gene in the DNA, and comparing the results with a control. Again, the control is the result of RPLP analysis of the same gene of a different animal. The results genetically type the pig by specifying the polymorphism in its selected gene. Finally, genetic differences among animals can be detected by obtaining samples of the mRNA or genomic DNA from at least two animals, identifying the presence or absence of a polymorphism in the gene, and comparing the results.
These assays are useful for identifying the genetic markers relating to disease resistance, as discussed above, for identifying other polymorphisms in the gene that may be correlated with other characteristics, and for the general scientific analysis of genotypes and phenotypes.
The genetic markers, methods, and novel sequence of the invention are also useful in a breeding program to improve disease resistance in a breed, line, or population of animals. Continuous selection and breeding of animals that are at least heterozygous and preferably homozygous for a polymorphism associated with a beneficial trait such as disease resistance would lead to a breed, line, or population having higher numbers of offspring in each litter of the females of this breed or line. Thus, the markers are selection tools.
The examples and methods herein disclose certain genes which have been identified to have a polymorphism which is associated either positively or negatively with a beneficial trait that will have an effect on disease resistance of that animal. The identification of the existence of a polymorphism within a gene is often made by a single base alternative that results in a restriction site in certain allelic forms. A certain allele, however, as demonstrated and discussed herein, may have a number of base changes associated with it that could be assayed for which are indicative of the same polymorphism. Further, other genetic markers or genes may be linked to the polymorphisms disclosed herein so that assays may involve identification of other genes or gene fragments, but which ultimately rely upon genetic characterization of animals for the same polymorphism. Any assay which sorts and identifies animals based upon the allelic differences disclosed herein are intended to be included within the scope of this invention.
One of skill in the art, once a polymorphism has been identified and a correlation to a particular trait established, will understand that there are many ways to genotype animals for this polymorphism. The design of such alternative tests merely represent optimization of
parameters known to those of skill in the art and are intended to be within the scope of this invention as fully described herein.
According to the invention NFKBl different marker systems have been identified in the porcine NFKBl gene which are associated with different resistance to pathogens as well as growth. Novel NFKBl sequence has identified as well as exemplary primers for assaying for the polymorphisms. The markers are associated with innate immunity traits which are non pathogen specific, so while bacteria is used for challenge it is expected that these traits will improve animal health against a wide variety of diseases or challenges such as stress, viral pathogen, etc. Disclosed herein are novel primer sequences, however those of skill in the art will readily be able to design a multitude of alternative primers to amplify the region of the polymorphism using the sequence data already known in the art and are available in sources such as Genbank and disclosed herein.
According to the inventions 2 different polymorphisms have been identified in the NFKB 1 gene which are postulated to be correlated with significant differences in traits associated with disease resistance and innate immunity as well as growth. The first is located in intron 18 of the NFKBl gene and is a C/A single nucleotide polymorphism. This polymorphism is postulated to show significant differences with respect to innate immunity and disease resistance and may thus be used by a breeder to identify animals which are more likely to demonstrate superior disease resistance or innate immunity compared to an animal which has the alternative gene form. Novel primers have been designed to amplify this region SEQ ID NO: 2 and 3, and the identification of which allele is present can be assayed by use of a Tsp 5091 restriction enzyme. Allele 1 is the no-cut and allele 2 is the cut.
The second is located in the exon 24 of NFKBl gene and is a C/T single nucleotide polymorphism. This polymorphism has shown significant differences with respect to associated with, improved innate immunity, disease resistance or resistance to bacterial infection, as evidenced by bacterial clearance (ileocecal lymph node count, fecal bacteria counts challenge, % lymphocytes after challenge, % monocytes after challenge, %PMN after challenge, % eosinophils , including leukocyte function and fever response to infection. This exon 24 polymorphism has also been shown to be significantly correlated with overall growth including days to 110 Kg, and life time daily gain. This marker may thus be used by a breeder to identify animals which are more likely to exhibit superior disease resistance or innate immunity and or growth when compared to an animal which has the alternative gene
form. Novel primers have been designed to amplify this region SEQ ID NO: 4 and 5, and the identification of which allele is present can be assayed by use of a Fnu4Hl restriction enzyme. Allele 1 is the cut and allele 2 is no cut.
The traits of disease resistance and innate immunity may be measured by a number of different indicators. Preferably the indicators are associated with bacterial clearance, innate host defense, fever response to infection, and leukocyte function. It is expected that different indicators may be used to identify the same associations disclosed herein and these are intended to be within the scope of the invention. Such indicators may include but are not limited to: % Lymphocytes at various days, % Lymphocytes difference % PMN, % PMN difference % Monocytes day, % Monocytes difference % Eosinophils, % Eosinophils difference, Lymphocyte SIy with Sal heat extract day -2 (pre-challenge, Lymphocyte SI with Sal heat extract day 7 (post-challenge); PMN uptake (number of bacteria/PMN), PMN killing (%), temperature at each particular day am or pm, Ileocecal lymph node bacterial count (loglO colony-forming units/gram tissue), Fecal bacterial counts, Total white blood cell count before challenge, Total white blood cell count after challenge, Difference in total white blood cell count before and after challenge, Lymphocyte count before challenge, Lymphocyte count after challenge, Difference in lymphocyte count before and after challenge, Monocyte count before challenge, Monocyte count after challenge, Difference in monocyte count before and after challenge. Similarly, the traits of overall growth may be measured by a number of different indicators such as average daily gain, overall weight gain, life time daily gain, days to 110 Kg and the like. The use of one particular indicator is not critical to the invention and it is expected that many indicia exist for identifying the same correlation. The description herein of a particular indicator of the general traits of disease resistance and growth shall not be limited to that particular trait measurement only, but shall be interpreted to include any similar measurement that evidences the same effect on disease resistance/growth.
EXAMPLE 1
Polymorphism and allele frequency test of the porcine nuclear factor kappa-B subunit 1 gene
Brief Summary
Partial cDNA sequence and exon 24 sequence of NFKBl were obtained by PCR amplification using primers designed from the conserved region between human and mouse
NFKBl sequence. The sequence comparison from animals of Yorkshire, Meishan and a commercial population revealed polymorphisms, 1 in intron 18 and 1 in exon 24. Two of them were used to detect segregation in Salmonella challenge studies. The porcine NFKBl was mapped to Chromosome 8 q23-27 by testing a somatic cell hybrid panel and PigMaP family (Archibald et al., 1995).
Primers and PCR conditions used to amplify the porcine NFKB 1 polymorphic fragment:
Fragment 1 (intron 18):
Forward: 5'GTGGAGCTCGACAACATCTCCT3'(22mer) (SEQ E) NO:2)
Reverse: 5'CGCTATGTGCAGGGGTGTAGTTS' (22mer) (SEQ ID NO:3)
Mg++ 1.5mM, dNTPs 200μM, Taq 1.5U, Ix buffer (Promega, WI)
Cycle profile: 94C 3 min, 40 x (94C 45s, 63C 45s, 72C 45s), 72C 5min
PCR- Annotation: Amplification was performed using 25 ng of genomic DNA and 0.3μM of each primer in a 10 μl of reaction volume.
Fragment 2 (in exon 24)
Forward: 5'CTCCGGGATGACAGCATCT3'(22mer) (SEQ ID NO:4)
Reverse: 5'CATCCAGAACCATTCAGGCAS' (22mer) (SEQ ID NO:5)
Mg++ 1.5mM, dNTPs 200μM, Taq 1.5U, Ix buffer (Promega, WI)
Cycle profile: 94C 3 min, 40 x (94C 45s, 55C 45s, 72C 45s), 72C 5min
PCR- Annotation: Amplification was performed using 25 ng of genomic DNA and 0.3μM of each primer in a 10 μl of reaction volume.
SNPl: PCR product size is 427bp SNP2: PCR product size is 281bp
Table 1 NFKBl polymorphisms revealed by sequence comparison.
SNPl: Tsp 5091 digestion was conducted to reveal allele 1 and allele 2:
Allele 1: 35 lbp, 76bp
Allele 2: 35 lbp, 59, 17bp
SNP2: Fnu4HI digestion was used to reveal allele 1 and 2 :
Allele 1:200,51, 27, 3bp,
Allele 2: 200, 78, 3bp
Challenge Studies:
SNPl:
Challenge 1 (59 pigs) : Allele 1: 0.949
Allele 2:0.0508
Challenge 2: no polymorphism for Tsp509I
Compton parents: only one boar is a heterozygote: Allele frequency in the population generated by this boar: Allele 1: 0.7917
Allele 2: 0.2083
SNP2:
Challenge 1 (59 pigs) : Allele 1: 0.5678
Allele 2:0.4322 Challenge 2 (94pigs): Allele 1: 05213
Allele 2: 0.4787
Compton: F2 populations: Allelel: 0.4447
Allele 2: 0.5553
Chromosome location
NFKBl was physically mapped on the porcine chromosome 8 q21-q23 by using pig/rodent somatic cell hybrid panel (SCHP) comprising 27 cell lines. The primers used to map the porcine NFKBl are:
Forward: 5'GACGGATGCACTAATTTGCCCTS' (SEQ ID NO:6)
Reverse: 5'CGCTATGTGCAGGGGTGTAGTTS '(SEQ ID NO:7)
Genetic mapping in PiGMap family also mapped this gene to Chromosome 8 using the software CRI-MAP (Green et al., 1990), the highest Lod score by two point analysis is: NFKBl-SW61:Lod score= 8.94
Porcine NFKBl sequence amplified by SNP 1 is disclosed in Figure 2.
Fragment 2: (partial sequence of exon 24) is disclosed in Figure 3
EXAMPLE 2
Associations of markers in NFKBl with Salmonella cholerasuis infection parameters in commercial lines
Summary
Two batches of animals were experimentally challenged with salmonella at the USDA-ARS National Animal Disease Center (NADC), and infection related measurements were taken for 7 days post infection. Tests for polymorphisms at genes (NFKBl) were as described earlier. These tests were used to genotype the challenged animals. Association analysis revealed potential effects of NFKBl genotype on fecal bacteria counts, as well as several measures of immune cell numbers, during the challenge. Controlling fecal bacterial counts has economic value as an infected animal is the main source of transmission to healthy animals. Thus a marker that would identify animals with decreased fecal bacterial counts would be valuable.
Materials and Methods
Bacterial Challenge
Two separate groups of piglets (8-19 days old) were shipped to isolation facilities at the National Animal Disease Center, Ames, Iowa. Piglets consisted of 2 lines of PIC pigs from two different farms in Kentucky. Piglets were determined to be Salmonella-ϊme, by frequent bacterial culture of fecal material. In NADC challenge 1, piglets were divided into principals and controls and grown to 7-9 weeks of age prior to intranasal challenge with 109 Salmonella choleraesuis 3246. The control group (saline inoculated) consisted of 1 piglet/litter (Exp #1A, n = 13; Exp #1B, n = 12). The principal group {Salmonella infected) consisted of 2 or 3 piglets/litter (Exp #1A, n = 29; Exp #1B, n = 30). Following challenge, animals were
monitored daily for temperature, clinical signs and Salmonella shedding (qualitative and quantitative most probable number). Pigs were necropsied on day 7 post S. choleraesuis or saline inoculation and quantitative bacteriology (most probable number) was performed on ileocecal lymph nodes. Portions of mesenteric lymph node, spleen, liver, lung, and muscle were collected and frozen in liquid nitrogen for DNA analysis. Comparison of clinical signs and infection rates with the control group showed the principals were infected with the bacteria, and the control group animals were not used further. Similar procedures were performed to collect data for another 94 principals in challenge experiment 2 (Tables 3a-3c).
Statistical Treatment
Phenotypic and genotype data were available on 154 challenged animals from PIC lines (Tables 3a-3c). Phenotypic data that were measured quantitatively, were tested with SAS proc Univariate for deviations from normality. Log transformed data were used for the FMPND6 trait since the range of values was so large; this is a standard approach with this type of data structure.
Statistical Analysis- Summary of Results
Statistical association is defined as a comparison between phenotype and genotype that show a P value less that 0.1; i.e., a statistical term that indicates the declared statistically significant difference between classes being compared has a confidence of greater than 90% of being correct. Several associations have even higher levels of confidence, such as P values less than 0.05 or even less than 0.01 (see individual Results in Tables 3a-3b below). A negative value for the "allele contrasts" means that the allele that is mentioned first (for example, allele 2 in the 2-3 contrast) is associated with a smaller value than the allele mentioned second.
NFKBl Results
The number of bacteria shed by an infected animal is a critically important trait, as it determines the exposure of healthy animals to the pathogen in animal pens. Thus the association of NFKBl genotypes using a series of polymorphism tests, with this trait would be of practical importance and utility.
EXAMPLE 3 Bacterial Challenge and Association testing in Compton F2 challenged population
Summary
To further assess the utility of the marker tests to identify animals that differ in innate disease resistance, some of these markers were tested on offspring of sires that were susceptible or resistant to Salmonellosis. The offspring were challenged orally with S. choleraesuis serovar Kunzendorf and infection and innate immunity related traits were measured. Association analyses revealed that potential effects of NFKBl genotype on fever, bacterial load in liver and spleen, and immune cell numbers and function. The presence of bacteria in internal organs demonstrates that the animal's immune system was unable to control spread of the infection. Reduced bacterial counts and lower fever in one genotype class are indicative of the heightened ability of those animals to control infection. These traits have economic value since fever and systemic infection decrease appetite and suppress growth and performance in a measurable way.
Experiment description
Challenged pigs were offspring of a reference population (Compton) that was bred from sires was that differed in susceptibility to Salmonellosis. The founder sires were selected based on the results of a preliminary study to identify individuals that differed in susceptibility to infection with S. choleraesuis. Sires were mated to 23 Fl gilts (crosses of commercial lines A x B and B x A) and produced one litter. Three to nine piglets from each litter were selected for oral challenge with 8 x 108S. choleraesuis (n=216). Piglets were challenged at 6 weeks of age and killed 1 week later, at 7 weeks of age. Blood samples were taken from animals for innate immunity studies one week before challenge, on the day of challenge and at necropsy. Traits of innate immunity included total leukocyte count and differential, bacterial uptake, phagocytosis and killing by neutrophils, lymphocyte proliferation against several antigens. At the time of the necropsy, the amount of Salmonella (colony forming units) in liver and spleen was determined by quantitative culture on one gram of tissue.
DNA was also isolated from blood for genetic analysis. Pigs were genotyped by using several marker systems described above/below. Statistical associations between genotypes and measured traits are shown in the following Tables.
Statistical treatment of data
The associations between the sequence polymorphisms and phenotypes were tested using mixed model procedures (SAS™ procedure MIXED) with a model which always included dam as a random effect and Group and marker parameters as fixed effects. Single point significance values are reported, without making adjustments for multiple comparisons.
Bi-allelic markers
For our markers with 2 alleles the following mixed model was used to estimate Least square means for the 3 genotype classes.
Trait = sow id + group + genotype With sow id as random effect and group and genotype as fixed effects.
Overall results are summarized in the following tables. Results that were obtained on Log transformed data are italicized in the tables to indicate that these values are not on the phenotypic scale. Table 2shows the frequencies of the Tsp5091 andFnu4Hl alleles in all challenge populations used for the trait associations. Tables 3a-3c show the trait associations for Salmonellosis and innate immunity for the Fnu4Hl polymorphism in combined and individual lines for the NADC challenges. Table 4 shows association data for the Fnu4Hl polymorphism in the Example 3 Compton families experiment..
References
Archibald, A., et al, "The PigMaP Consortium Linkage Map of the Pig (Sus scrofa)", Mamm.
Genome 6:157-175 (1995) Green, P., et al., "Documentation for CRI-MAP, version 2.4", Washington University School of Medicine, St. Louis, MO (1990)
Table 2 NFKB1 allele frequency in both Salmonella challenge populat i ons
O
*AIleIe frequencies for only 17 animals in the Compton F2 population are shown; all other litters did not segregate this marker and the remaining 196 F2's were not genotyped,
Additional genotyping was performed with the NFKBl exon 24 marker in lines within PIC commercial lines. In addition to the immunity results shown earlier, the results indicated that there were significant associations between NFKBl Exon 24 and growth traits.
These results are the product of evaluation of the NFKBl Exon 24 marker using a sire model and single marker analysis. The growth traits evaluated were: days to 110 Kg and Lifetime daily gain (Table 5). The genotypic effects are given for 2 genotypes: 12, 22 (1= cut with enzyme, 2 = no cut). These genotypic effects are deviations from the 11 genotype. I.e. for Line A and Lifetime daily gain, the genotypic effects (b) are: 11 = 0; 12 = +7.23; 22 = +17.20. The probabilities are the significance of the genotypic effect from zero. The brown cells are those effects with the greatest significance. Four commercial lines were tested: Line A, Line B, Line C and Line D. The number of genotypes done for each line varied from 707- 790 pigs and the effects were evaluated on all available animals.
Significant associations were found between the NFKBl Exon 24 marker and days to 110 Kg (P<0.01 for lines C and D) and life time daily gain (P<0.01 for lines A, C and D). Significant associations (P>0.01 and P<0.2) were also found for Days to 100 Kg, for lines A and B. Effects were different for different lines e.g. for Lifetime daily gain allele 2 was the favorable allele for lines A and D, allele 1 was favorable for line B and C showed a lot of over dominance.
Table 5. Results of association analysis for the NFKBl marker and growth traits.
* Sig. between P>0.01 and P<0.2
# Sig. P<0.01
Fl= frequency of allele 1
Claims
1. A method of identifying a genetic marker correlated with favorable innate immunity or growth traits comprising: obtaining a sample of genetic material from an animal; assaying for the presence of a polymorphic allele in a gene which encodes an NFKBl protein, and_correlating whether a statistically significant association exists between said polymorphic allele and one or more traits indicative of favorable disease resistance or growth in an animal of a particular breed, strain, population, or group whereby said animal can be characterized for said marker.
2^ A method of genetically identifying an animal comprising: obtaining a sample of genetic material from said animal, assaying for a polymorphic sequence in an NFKBl gene in said sample, wherein said polymorphic sequence comprises a first sequence which is indicative of an animal more likely to have more favorable innate immunity and/or growth traits when compared to an animal with a second sequence that is indicative of said animal to be more likely to have decreased innate immunity or growth traits.
3. The method of claim 2 wherein said animal is a pig.
4. The method of claim 2 wherein said assaying is selected from the group consisting of: restriction fragment length polymorphism (RFLP), heteroduplex analysis, single- strand conformational polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), single base extension, mass spectrometry, oligo ligation assay (ligase chain reaction), DNA sequencing and temperature gradient gel electrophoresis (TGGE).
5. The method of claim 2 further comprising amplifying an amount of said gene or a portion thereof which contains said polymorphism.
6. The method of claim 5 wherein said amplification includes selecting a forward a reverse primer capable of amplifying a region of said gene which contains at least one polymorphic site.
7. The method of claim 2 wherein said NFKB 1 gene contains a polymorphic Tsp509I site.
8. The method of claim 6 wherein said polymorphic site is amplified by primers selected from and based upon SEQ ID NO: 2 and SEQ ID NO: 3.
9. The method of claim 8 wherein said polymorphic site is a C to A single nucleotide substitution in intron 18 of said gene.
10. The method of claim 2 wherein said NFKB 1 gene contains a polymorphic Fnu 4HI site.
11. The method of claim 10 wherein said polymorphic site is amplified by primers selected from and based upon SEQ ID NO: 4 and SEQ ID NO: 5.
12. The method of claim 8 wherein said polymorphic site is a C to T single nucleotide substitution in a exon 24 of said gene.
13. A purified and isolated nucleotide sequence which encodes upon expression porcine NFKBl and has at least 90% homology to SEQ ID NO: 10.
14. A porcine NFKB 1 protein encoded by the sequence of claim 13.
15. A porcine NFKB 1 protein with at least 90% homology to SEQ ID NO : 11.
16. A method for identifying a pig with an increased likelihood of having a phenotype which includes higher bacterial clearance, improved fever response to infection, stronger innate host defense, wherein a pig with a cytosine at position 3082 of SEQ ID NO: 1 is indicative of said pig being more likely to have the phenotype than a pig with an thymine at position 3082 of SEQ ID NO: 1, said method comprising: detecting the nucleotide present at position 3082 of SEQ ID NO: 1, and relating the nucleotide to the phenotype.
17. The method of claim 16 wherein the nucleotide is detected within an amplified PCR sequence using a forward primer and a reverse primer.
18. The method of claim 17 wherein said forward primer has an oligonucleotide sequence of SEQ ID NO:4 and said reverse primer has an oligonucleotide sequence of SEQ ID NO:5.
19. The method of claim 18 wherein the step of detecting the nucleotide is selected from the group consisting of restriction fragment length polymorphism (RFLP) analysis, heteroduplex analysis, single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), and temperature gradient gel electrophoresis (TGGE).
20. The method of claim 19 further comprising the step of amplifying SEQ ID NO: 1 or a region of thereof containing said nucleotide.
21. The method of claim 20 further comprising the step of digesting the amplified region with the restriction endonuclease Fnu 4HI .
22. A method for identifying a pig with an increased likelihood of having a phenotype which includes improved growth traits, wherein a pig with a one allele comprising either a cytosine or thymine at position 3082 of SEQ ID NO: 1 is indicative of said pig being more likely to have improved growth traits that the alternate allele, said method comprising: detecting the nucleotide present at position 3082 of SEQ ID NO: 1, and relating the nucleotide to the phenotype.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US66012405P | 2005-03-09 | 2005-03-09 | |
| US60/660,124 | 2005-03-09 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006099055A2 true WO2006099055A2 (en) | 2006-09-21 |
| WO2006099055A3 WO2006099055A3 (en) | 2007-03-08 |
Family
ID=36992231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/008433 Ceased WO2006099055A2 (en) | 2005-03-09 | 2006-03-09 | Sequence, polymorphisms, and marker test technology for disease resistance and growth (nfkb1) |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2006099055A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117363650A (en) * | 2023-08-04 | 2024-01-09 | 中山大学 | A method for increasing intramuscular fat content of pigs |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030219427A1 (en) * | 1998-08-18 | 2003-11-27 | Allen Hamish J. | TPL-2/COT kinase and methods of use |
-
2006
- 2006-03-09 WO PCT/US2006/008433 patent/WO2006099055A2/en not_active Ceased
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117363650A (en) * | 2023-08-04 | 2024-01-09 | 中山大学 | A method for increasing intramuscular fat content of pigs |
| CN117363650B (en) * | 2023-08-04 | 2025-11-14 | 中山大学 | A method to increase intramuscular fat content in pigs |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2006099055A3 (en) | 2007-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7244564B2 (en) | HMGA alleles and use of the same as genetic markers for growth, fatness, meat quality, and feed efficiency traits | |
| AU5011600A (en) | Genetic marker for meat quality, growth, carcass and reproductive traits in livestock | |
| CA2549397A1 (en) | Methods and compositions for genetically detecting improved milk production traits in cattle | |
| AU758179B2 (en) | Melanocortin-4 receptor gene and use as a genetic marker for fat content, weight gain, and/or feed consumption of animals | |
| US7070929B2 (en) | Genetic markers for improved disease resistance in animals (BPI) | |
| JP2007504841A (en) | Detailed mapping of the chromosome 17 quantitative trait locus and its use for marker-based selection | |
| US20050059021A1 (en) | Insulin-like growth factor-1 receptor (IGF-1R) polymorphic alleles and use of the same to identify DNA markers for reproductive longevity | |
| US6844159B2 (en) | Genetic markers for screening animals for improved disease resistance (NRAMP) | |
| US6458531B1 (en) | Leptin receptor gene as a genetic marker for leanness in pigs | |
| US7081335B2 (en) | Prolactin receptor gene as a genetic marker for increased litter size in animals | |
| US7074562B2 (en) | Ghrelin alleles and use of the same for genetically typing animals | |
| WO2006099055A2 (en) | Sequence, polymorphisms, and marker test technology for disease resistance and growth (nfkb1) | |
| CN101490256A (en) | Method of determining size of fatty acid content in intramuscular fat of cattle based on genotype of fatty acid synthase and method of determining eating quality of beef based on the result | |
| Tuggle et al. | Genetic markers for improved disease resistance in animals (BPI) | |
| US20040259127A1 (en) | Approaches to identifying genetic traits in animals | |
| RU2267538C2 (en) | Method for screening animals at increased level of offspring quantity and/or preferable signs of meat quality, protein prkag3 (variants) and protein-coding nucleotide sequence (variants) | |
| US7700291B2 (en) | Genetic test for the identification of dwarfism in cattle | |
| Tuggle et al. | Genetic markers for screening animals for improved disease resistance (NRAMP) | |
| Rothschild et al. | Ghrelin alleles and use of the same for genetically typing animals | |
| WO2007051248A1 (en) | Single nucleotide polymorphisms (snp) and their association with tick resistance in bovine animals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 06737594 Country of ref document: EP Kind code of ref document: A2 |






