WO2006096989A2

WO2006096989A2 - Expression vectors containing a truncated epstein barr nuclear antigen 1 lacking the gly-gly-ala domain for enhanced transient gene expression

Info

Publication number: WO2006096989A2
Application number: PCT/CA2006/000403
Authority: WO
Inventors: Yves Durocher
Original assignee: National Research Council Of Canada
Priority date: 2005-03-17
Filing date: 2006-03-17
Publication date: 2006-09-21
Also published as: EP1861498A4; CA2578908A1; US8551774B2; EP1861498A2; US20080070232A1; CA2578908C; WO2006096989A3

Abstract

This invention relates to the unexpected discovery that nucleotide coding sequences coding for a truncated Epstein Barr Nuclear Antigen 1 (EBNA1t) protein (lacking the Gly-Gly-Ala domain), when in cells of mammalian origin, are associated with improved growth and increased transient gene expression when compared with cells expressing a complete EBNA1 coding sequence. The expression of EBNA1t also appear to be more stable over time.

Description

Expression Vectors for Enhanced Transient Gene Expression and Mammalian Cells expressing them

FIELD OF THE INVENTION This invention relates to new mammalian cells and cell lines, especially CHO and

293 cell lines, which comprise expression vectors encoding truncated EBNAl genes which enhance transient gene expression. The invention also relates to expression cassettes which include such truncated genes. BACKGROUND OF THE INVENTION Mammalian cells are an established expression system in the biotechnology industry for the production of recombinant proteins (r-proteins). In contrast to lower eukaryotes or prokaryotes, mammalian cells provide active r-proteins that possess relevant post-translational modifications. However, in order to obtain sufficient amount of protein for structure/activity analyses or high-throughput screenings, one needs to go through the long and tedious process of stable clone isolation and characterization. Protein production by large-scale transfection is an interesting alternative to the generation of stable clones as it allows the very fast generation of mg to gram quantities of r-protein within few days. The use of vectors containing the Epstein-Barr virus (EBV) oriP in cell lines stably expressing EBVs EBNAl protein, such as the HEK293-EBNA1 (293E) cell line (ATCC#CRL-10852) significantly increases protein yield (Durocher et al., 2002). EBNAl is a multi-functional protein that have been shown to positively regulate many viral promoters present on plasmid DNA when the oriP is present in cis (Reisman and Sugden, 1986).

The production of secreted r-protein often needs to be performed in serum-free medium in order to facilitate their purification. Adaptation of the 293E cell line to serum- free medium formulations is not straightforward and is rarely successful. To circumvent this problem, the generation of new 293-EBNA1 cell line from a serum-free medium adapted 293 cell line is preferable (Pham et al., 2003;Pham et al., 2005). However, these new cell lines do not always show optimal growth properties or high transfectabilities in serum-free medium. Also, the isolation of new clones stably expressing full-length EBNAl is difficult as this protein seems to be cytotoxic to the cells. Preliminary transient gene expression studies with the commercially available 293 F cells adapted to the FreeStyle™ medium showed that this cell line has a good potential for the large-scale r-protein production in serum-free medium. Improvement of this cell line by stably expressing a less cytotoxic but functional EBNAl protein is needed. Kennedy, G. and Sugden, B. (2003) EBNA-I, a Bifunctional Transcriptional

Activator Molecular and Cellular Biology, 23: 6901-6908 disclose that the ability of EBNAl to activate transcription from both integrated and transfected templates can be inhibited by a derivative of EBNAl lacking the amino acids required for activation from integrated templates (aa 65-89). We have found, against previous expectations, that truncations of these amino acids from EBNAl -coding nucleotide sequences can enhance transient gene expression in HEK293 cells to a level similar to EBNAl . SUMMARY OF THE INVENTION

This invention relates to the unexpected discovery that nucleotide coding sequences coding for a truncated Epstein Barr Nuclear Antigen 1 (e.g. EBNAIt) protein (lacking the Gly-Gly-Ala domain), when in cells of mammalian origin, are associated with increased transient gene expression when compared with control cells. In addition, expression of this truncated EBNAl gene is more stable and expressed at higher levels than expression of the full-length EBNAl gene. This results in cell lines with better growth properties and with enhanced transient gene expression. Mammalian cell lines in general are contemplated and human embryonic kidney 293 cells, CHO cells and PER- C6™ cells are of particular interest. This invention also relates to a mammalian cell line such as a 293 cell line stably expressing a processed version of EBNAIt (e.g. 293-6E cells) also showing enhanced transient gene expression compared to EBNAIt, EBNAl and control cell lines. Preferably the transfected gene expression is performed in a cell line stably expressing truncated EBNAl . Alternatively, the transfected gene expression is associated with a transiently transfected EBNAl gene. Also, preferably the EBNAl nucleotide sequence is truncated to lack most of (i.e. more than 50%, preferably nmore than 75% and, in some embodiments, all) the Gly-Gly-Ala domain. Preferably the nucleotide sequence is less than 70% of a complete EBNAl coding sequence, especially less than 50% of the complete EBNAl coding sequence. Alternatively, or as well, one or more of the DNA linking regions LRl and LR2 can be absent from the truncated sequence. One of the truncated sequences we have used lacks LRl and we expect that an equivalent sequence lacking LR2 (with or without LRl present) to serve a similar purpose. The nucleotide sequence can be included in an expression vector, such as a pTT vector or any other vectors containing a complete or partial Epstein Barr Virus (EBV) oriP sequence, allowing expression of the gene.

Stable cell lines including such expression vectors with truncated EBNAl nucleotide coding sequences comprise an aspect of the invention.

According to one aspect of the invention, we provide new stable serum-free 293 F- EBNAl cell lines, including full-length of truncated versions of EBNAl . The use of EBNAIt reduces the difficulty of obtaining stable clones (apparent deleterious effects of over-expressing the full-length EBNAl protein). To our knowledge, no reports describing stable 293-EBNAlt cell lines exist. Also, by isolating and characterizing a stable 293F-EBNAIt cell line (clones 6E), we observed another new further truncated and functional form of EBNAl, of even shorter amino acid sequence length than EBNAIt (location of truncation not yet identified).

According to another aspect of the invention we provide a series of new truncated EBNAIt expressed proteins (including EBNAIc).

The following aspects of the invention are described in detail below.

1. The new 293FEt cell line, where Et is a truncated version of the EBNAl protein e.g. EBNAIt described below and in the figures.

2. The new 293-6E cell line expressing a processed form of EBNAIt protein

3. The new truncated EBNA 1 protein, EBNA 1 c consisting of LR2+NLS+DBD domains

4. Using transient EBNAl (full-length or truncated) expression in trans to increase protein production in EBNAl (full-length or truncated) and non-EBNAl cell lines

5. The use of an EBNAIt or EBNAIc expression cassette in the pTT vector or other oriP-containing vectors (expression in cis) to increase protein production in EBNAl and non-EBNAl cells.

6. New truncated EBNAl protein consisting of LR1+NLS+DBD domains. The invention further relates to a process for in vitro production of a protein which process comprises: (a) transfecting a mammalian cell with an expression vector coding for said protein, said mammalian cell having been transfected with a truncated EBNAl expression vector of the invention;

(b) culturing a transfected cell resulting from (a) to yield said protein.

BRIEF DESCRIPTION OF THE DRAWINGS

In drawings which illustrate the invention, Figure 1 shows transient SEAP expression in 293F cells following co-transfection of various amounts of pTT/EBNAlt vector. Figure 2 shows stable or transient EBNAl constructs expression in 293 cells. Figure 3 shows transient GFP expression in various 293F-EBNA1 clones or pools. Figure 4 shows a Western Blot analysis of EBNAl expression in various 293 F clones. Figure 5 shows transient human placental secreted alkaline phosphatase (SEAP) expression in various EBNAl clones. Figure 6 shows the growth of various 293F-EBNA1 clones following transfection (hpt = hours post-transfection). Figure 7 shows the growth curve of 293-6E cells compared to 293F cell in 125 ml shaker flasks. Figure 8 shows the amino acid sequence of EBNAl (SEQ ID NO: 1) with various parts of the sequence identified in the Figure. Figure 9 shows the amino acid sequence of full-length EBNAl protein (SEQ ID NO: 1) and EBNAIt (underline) (SEQ ID NO: 2) and EBNAIc (bold) (SEQ ID NO: 3) truncated versions. The first amino acid of the new EBNAIc protein is a methionine (as indicated above the glycine residue). Figure 10 shows the schematic structure of various EBNAl constructs. Figure 11 (A-C) shows DNA sequence of full-length EBNAl(SEQ ID NO: 4), and truncated EBNAl (EBNAIt (SEQ ID NO: 5) and EBNAIc (SEQ ID NO: 6)). Figure 12 shows transient EBNAIt and EBNAIc expression in 293 F cells compared to 293F or 293-6E cells. Figure 13 shows the effect of co-expressing EBNAIt or EBNAIc on transient SEAP expression in 293F cells. Figure 14 shows examples of proteins transiently expressed in 293-6E cells. DETAILED DESCRIPTION OF THE INVENTION

This invention relates to nucleotide coding sequences coding for a truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein which, when in cells of a mammalian cell line, are associated with increased transfected gene expression when compared with cells of a control cell line comprising a complete EBNAl coding sequence. By "truncated" we mean a sequence which is less than the full EBNAl nucleotide sequence. As shown in Figures 8 and 10 there are identified components of the full EBNAl sequence. These include DNA Linking Regions 1 and 2, a Transcription activation domain, a Nuclear Localization Signal and a DNA Binding and Dimerization region. Truncated sequences of the invention preferably contain the DNA Binding and Dimerization region along with the Nuclear Localization Signal and one or more DNA Linking Regions. Figure 1 shows that transient SEAP expression can be increased significantly by co-expression of EBNAIt protein. Similar increase can be observed using full length EBNAl protein (not shown). This Figure also shows that transient SEAP expression does increase by augmenting EBNAIt expression. However, it seems that over expressing full-length EBNAl is difficult to achieve in mammalian cells. This is illustrated in Figure 2 where stable expression of full-length EBNAl in the commercially available cell line HEK293-EBNA1 (formerly available at Invitrogen or available at ATCC #CRL- 10852) or in our best SFE clone (SFE41 ;(Pham et al., 2003)) is significantly lower than in 293FEt bulks (lanes 6 and 7) or 293-6E cells (lanes 8 and 9). In addition, expression of full-length EBNAl in 293F cells (bulk) in also very low (lanes 4 and 5). Note that while truncated forms of EBNAl increases with time in these bulks (lanes 6 vs 7 and lanes 8 vs 9), expression of full length EBNAl drops with time (lanes 4 vs 5), indicating that overexpression of full-length EBNAl may have negative effects on cell physiology. Unexpectedly, a major and smaller form of EBNAIt was observed in clone 6E (lanes 8 and 9). EBNAIt was amplified by PCR using forward (ACGGAATTCGCCGCCACCATGTCTGAC GAGGGGCCA) (SEQ ID NO:7) and reverse (GAGGAAGGGCAGGA GTGAGAATTCCCT) (SEQ ID NO: 8) primers and cloned at the EcoRI site of pIRES-Neo vector (Clontech). We made the 293FEt cell line (including the 293-6E clone) following transfection of 293F cells with the pIRES- EBNAlt-Neo vector and selection with 25 ug/ml geneticin. Stable clones were isolated by limiting dilution and clones selected based on EBNAl expression using the rat monoclonal antibody 1H4 (Grasser et al., 1994)

Figure 1 shows that expressing EBNAIt increases transient SEAP expression in a dose-dependent manner. 293 F cells were transfected with 100% pTT-SEAP vector (CTRL) or with mixtures of 99 to 60% pTT-SEAP and 1 to 40% of pTT-EBNAlt respectively. With 60% pTT-SEAP and 40% pTT-EBNAlt, the expression level of SEAP was increased by 3 -fold over control. Figure 2 shows EBNAl expression levels in various stable HEK293 cell lines or following transient transfection. Stable expression of full-length EBNAl in HEK293- EBNAl cell line (lane 1) and 293-SFE cell line (lane 2). Lane 3: 293F cells (no EBNAl expression). Expression of full-length EBNAl in 293F cells following transfection and G418 selection for 2 months (lane 4) and 4 months (lane 5). Note that expression of full- length EBNAl decreases with time in this non-clonal cell population. Expression of truncated EBNAl (EBNAIt) in 293F cells following transfection and G418 selection for 2 months (lane 6) and 4 months (lane 7). Note that expression of EBNAIt increases with time in this non-clonal cell population. Expression of the new form of EBNAIt in clone 6E derived from 293F-EBNAIt after 4 months in culture in the presence of G418 and 1% serum (lane 8) or G418 in serum-free medium (lane 9). Transient expression of full-length EBNAl (lane 10) or EBNAIt (lane 1 1) in 293F cells.

The precise nature of the new EBNAIt protein remains to be solved. Detection of EBNAl was performed using a rat monoclonal antibody (clone 1H4). The two bands seen at Mr 200 and above are not-specific.

Figure 3 shows transient GFP expression in various EBNAl cell lines. Cells (cultured for 3 months under G418 selection following transfection) were transfected with pTT-GFP and GFP expression was measured 3 days later by flow cytometry. The 293F- EBNAIt clone 6E shows the highest GFP expression. Transfection efficiency was between 40% and 65% for all clones.

Figure 4 shows EBNAl expression levels in various 293 clones. All clones were cultured in the presence of 25 μg/ml geneticin. Expression of EBNAl in clone 6A can be detected with longer exposure time.

Figure 5 shows that when various 293 F-EBNAl stable clones were transfected with pTT/SEAP, the clones expressing truncated EBNAl coding sequences showed enhanced SEAP expression when measured 5 days later (clones 6E, 11 and 13) when compared to clones expressing the full length (clones IA and 2B) or another uncharacterized truncated form of EBNAl (clone 6A). In the context of this invention, SEAP is an example of a recombinant protein. Genetic material coding for a protein or polypeptide of choice can be used in place of SEAP coding sequences and, indeed, this is an aim of this invention (see Figure 14 for additional examples). Figure 6 shows that cell growth and viability does not appear to be affected when truncated EBNAl nucleotide sequences are stably overexpressed. Cells were fed with 0.5% TNl 24 hpt (Pham et al, 2005) and counted 6 days after transfection.

Figure 7 shows the growth characteristic of the 293FEt-clone 6E (lower panel) compared to the parental 293F cell line (upper panel). Maximum viable cell density is about 3.5xlO⁶ cells/ml for the clone 6E compared to 4.2x10 cells/ml for the 293F cell line.

Figure 8, Figure 9, Figure 10 and Figure 1 1 are best reviewed together. They show the amino acid sequence and schematic structure of EBNAl constructs and the relationship to the EBNAl DNA sequences (Figures 1 1 A-C).

Figure 8 shows the EBNAl full length protein (641 aa, 56.4 kDa) (Accession number: NC_001345) with its main features. Figure 9 highlights the differences between EBNAl , EBNAIt and EBNAI c and the amino acid level. EBNAIt truncated protein (underline: 417 aa, 42.5 kDa) and EBNAI c further truncated protein (bold: 306 aa, 32.5 kDa). The first amino acid of the new EBNAIc protein is a Methionine (as indicated above the Glycine residue).

Figure 12 contrasts transient expression of two truncated EBNAl constructs with 293F and 293-6E cells. Cells were transfected with pTT/EBNAlt or pTT/EBNA Ic vectors and EBNAl expression was detected 3 days later by Western blot. Non-transfected 293F cells and 293-6E cells are also shown as controls.

Figure 13 shows 293F cells co-transfected with pTT/SEAP and pTT/EBNAl constructs. 293F cells were co-transfected with a mixture of 50% pTT-SEAP vector with pTT/EBNAlt, 50% pTT/EBNAlc, or 50% salmon sperm DNA (stuffer DNA). SEAP expression was measured 5 days later. Figure 14 shows examples of proteins transiently expressed in 293-6E cells. 293-

6E cells were transfected with pTT vectors encoding various secreted proteins and culture medium (20 microliters) was harvested 5 days after transfection and analyzed by SDS- PAGE and Coomassie staining. Reference List Durocher, Y., Perret, S., and Kamen, A., 2002. High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res. 30, E9. Grasser, F. A., Murray, P. G., Kremmer, E., Klein, K., Remberger, K., Feiden, W., Reynolds, G., Niedobitek, G., Young, L. S., and Mueller-Lantzsch, N., 1994. Monoclonal antibodies directed against the Epstein-Barr virus-encoded nuclear antigen 1 (EBNAl): immunohistologic detection of EBNAl in the malignant cells of Hodgkin's disease. Blood 84, 3792-3798.

Pham, P. L., Perret, S., Cass, B., Carpentier, E., St-Laurent, G., Bisson, L., Kamen, A., and Durocher, Y., 2005. Transient gene expression in HEK293 cells: peptone addition posttransfection improves recombinant protein synthesis. Biotechnol. Bioeng. 90, 332- 344.

Pham, P. L., Perret, S., Doan, H.C., Cass, B., St-Laurent, G., Kamen, A., and

Durocher, Y., 2003. Large-scale transient transfection of serum-free suspension-growing HEK293 EBNAl cells: peptone additives improve cell growth and transfection efficiency. Biotechnol. Bioeng. 84, 332-342.

Reisman, D. and Sugden, B., 1986. trans activation of an Epstein-Barr viral transcriptional enhancer by the Epstein-Barr viral nuclear antigen 1. MoI. Cell Biol. 6, 3838-3846.

The above-described embodiments of the present invention are intended to be examples only. Alterations, modifications and variations may be effected to the particular embodiments by those of skill in the art without departing from the scope of the invention, which is defined solely by the claims appended hereto.

Claims

CLAIMS:

1. A nucleotide coding sequence coding for a truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein, said coding sequence, when stably expressed in a mammalian cell line, being associated with increased transfected gene expression when compared with a control cell line not expressing EBNAl .

2. The nucleotide sequence of claim 1 wherein said transfected gene expression is associated with a transiently transfected gene.

3. The nucleotide sequence of claim 1 wherein said nucleotide sequence is truncated to lack most of the the Gly-Gly-Ala domain.

4. The nucleotide sequence of claim 1 which is less than 70% of a complete EBNAl coding sequence.

5. The nucleotide sequence of claim 1 which is less than 50% of a complete EBNAl coding sequence.

6. The nucleotide sequence of claim 1 which codes for SEQ ID NO: 2.

7. The nucleotide sequence of claim 1 which codes for SEQ ID NO: 3.

8. A stable mammalian cell line comprising the coding sequence according to claim 1.

9. The stable mammalian cell line of claim 8 wherein said cell line is a CHO, PER-C6 or 293 cell line.

10. The stable mammalian cell line of claim 9 stably expressing a truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein which is less than 70% of a complete EBNAl protein.

11. The stable mammalian cell line of claim 9 stably expressing a truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein which is less than 50% of a complete EBNAl protein.

12. A truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein which is less than 70% of a complete EBNAl protein.

13. The truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein of claim 12 consisting essentially of SEQ ID NO: 2.

14. A truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein which is less than 50% of a complete EBNAl protein.

15. The truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein of claim 14 consisting essentially of SEQ ID NO: 3.

16. An expression vector comprising the coding sequence of claim 1.

17. A pTT vector comprising the coding sequence of claim 1.

18. A stable mammalian cell comprising the nucleotide sequence of claim 1.

19. A stable 293 cell line comprising the expression vector of claim 16.

20. A stable 293 cell line comprising the expression vector of claim 17.

21. A stable 293 cell line expressing a truncated Epstein Barr Nuclear Antigen 1 (EBNAl) protein lacking its Gly-Gly-Ala domain. 2. A process for in vitro production of a protein which process comprises:

(a) transfecting a mammalian cell with an expression vector coding for said protein, said mammalian cell having been transfected with the expression vector of claim 16;

(b) culturing a transfected cell resulting from (a) to yield said protein.