WO2006095180A2 - Humananized monoclonal antibodies against sars - associated coronavirus and treatment of patients with sars - Google Patents

Humananized monoclonal antibodies against sars - associated coronavirus and treatment of patients with sars Download PDF

Info

Publication number
WO2006095180A2
WO2006095180A2 PCT/GB2006/000848 GB2006000848W WO2006095180A2 WO 2006095180 A2 WO2006095180 A2 WO 2006095180A2 GB 2006000848 W GB2006000848 W GB 2006000848W WO 2006095180 A2 WO2006095180 A2 WO 2006095180A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antibody
sars
chain
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2006/000848
Other languages
French (fr)
Other versions
WO2006095180A3 (en
Inventor
Ka Man Leung
Dong Xiao Feng
Shiu Fun Pang
Yuet Wai Kan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ultra Biotech Ltd
University of California Berkeley
University of California San Diego UCSD
Original Assignee
Ultra Biotech Ltd
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ultra Biotech Ltd, University of California Berkeley, University of California San Diego UCSD filed Critical Ultra Biotech Ltd
Publication of WO2006095180A2 publication Critical patent/WO2006095180A2/en
Publication of WO2006095180A3 publication Critical patent/WO2006095180A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Definitions

  • This invention relates to therapeutic antibodies. More specifically, it relates to humanized single chain variable fragment antibodies and whole antibodies against SARS- associated coronavirus and method of treating patient suffering from SARS (severe acute respiratory syndrome).
  • SARS-Co V SARS-associated coronavirus
  • phage display library As described in [20], a particular phage library, constructed by James Marks (Department of Anesthesia and Pharmaceutical Chemistry, University of California, San Francisco General Hospital), contains millions of independent clones of single-chain variable fragment (scFv) antibodies[9] appears to be a suitable tool to develop specific antibodies against SARS-CoV. Like other coronaviruses, the SARS-CoV also utilizes a surface glycoprotein named as spike protein to infect host cells [I]. The spike protein of SARS-CoV consists of 1255 amino acid residues and can be divided into two sub-domains, Sl and S2 domains.
  • the Sl domain mediates the binding of the virus to its receptor angiotensin-converting enzyme 2 mainly distributing on the surface of human lung cells [18].
  • the S2 domain mediates membrane fusion between the virus and the host cell. Two strategies can be employed to block the infection of SARS-CoV, either to block the binding of the Sl domain to the receptor or to block the fusion of the virus mediated by the S2 domain.
  • humanized antibodies against SARS-CoV are provided.
  • Such humanized antibodies either in the form of scFv or as a whole antibody, bind specifically to the S2 domain of the spike protein of SARS-CoV.
  • a preferred epitope in the S2 domain is the region of Leu803-Ala828, although other epitopes may also provide satisfactory results.
  • An antibody of the present invention preferably has one or more peptide segments defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7 in its V H chain, and/or has one or more segments defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14 in its V L chain.
  • a particular antibody of the present invention comprises seven peptide segments in the V H chain defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively, and seven peptide segments in the V L chain defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, respectively.
  • a preferred antibody comprises a V H chain containing a sequence defined by SEQ ID NO: 24 and a V L chain containing a sequence defined by SEQ ID NO: 25.
  • a method of identifying scFv gene fragment that confers the above antibody the binding specificity to the S2 domain of the spike protein of the SARS-CoV comprises the steps of (a) obtaining a conjugated or recombinant protein containing a peptide segment of the S2 domain of the spike protein; (b) obtaining a phage display library; and (c) selecting from the phage display library specific phage- displayed scFvs using the conjugated or recombinant protein as the binding agent to identify the scFv gene fragment that confer binding specificity to the S2 domain of the spike protein.
  • preparations of the antibody can be made by subcloning the scFv gene fragment into a proper vector, for example, pET28 vector from Novagen, transforming the reconstructed vector into E. Colt strain BL21, and inducing its expression by IPTG.
  • the scFv gene fragment can be subcloned into the gene encoding a whole human antibody so that a whole humanized antibody with the same binding specificity can be expressed.
  • the above preparation of humanized antibody can be further processed using known methods in the pharmaceutical industry into a pharmaceutical formulation with a proper carrier.
  • a method of treating, preventing, or ameliorating a pathological condition in a patient, wherein said pathological condition is associated with coronavirus SARS-CoV comprising a step of administering to said patient a therapeutically effective amount of a humanized antibody that has a binding specificity to an epitope in the S2 domain of the spike protein of SARS-CoV.
  • FIG. 1 shows the results of phage clones from each round of panning in the polyclonal ELISA assay.
  • FIG. 2 shows the results of individual S2-a-specific antibody clones in the monoclonal ELISA assay.
  • FIG. 3 shows the results of individual S2-b-specific antibody clones in the monoclonal
  • FIG. 4 illustrates DNA fingerprinting of clones to determine diversity by BstNI restriction enzyme analysis.
  • FIG. 5 shows results of sequencing analysis of V H and V L chain genes of S2-a and S2-b- specif ⁇ c human mAbs.
  • FIG. 6 shows results of immunofluorescence staining of SARS-CoV infected Vero cells.
  • Synthetic peptide S2a (NFSQILPDPLKPTKRS - SEQ ID NO: 15) was obtained from UCSF (University of California, San Francisco) and was supplied at >95% pure as assessed by
  • S2a corresponds to the S783-798 region in the S2 domain of SARS-CoVs spike protein.
  • S2b is a peptide segment corresponding to the 803 - 828 region of the S2 domain. Pure synthetic S2a peptide was conjugated to BSA and OVA carrier protein to increase the coating efficiency on the Immunotube for screening.
  • BSA carrier protein bovine serum albumin
  • OVA ovalbumin
  • S2b is relatively hydrophobic and is not soluble in the common buffer.
  • S2b was expressed as a purified thioredoxin (Trx) fusion protein in E. coli and as panning bait for selection. Prior to selection, the library was depleted of the Trx fusion protein binders.
  • the amino acid sequence of the SARS-CoV spike protein was used to design a codon- optimized version of the gene encoding the spike protein, as described elsewhere [12].
  • 2Sb an oligonucleotide based on the DNA sequence encoding the residues 803 to 828 (LLFNKVTLADAGFMKQYGECLGDINA - SEQ ID NO: 16) of spike protein, was synthesized.
  • the sequence of the oligonucleotide is 5'AATTCGCTGTTATTTA ATAAGGTGACCCTGGCAGACGCGGGGTTCATGAAACAGTATGGTGAATGCTTGGGC GATATTAACGCCA-3' (SEQ ID NO: 23).
  • the synthetic gene was cloned into the bacterial expression vector pET32b (Novagen) fused with the 3 'terminal of the thioredoxin (Trx) gene.
  • the cloned gene was confirmed by DNA sequencing.
  • the ligated vector was transformed into Escherichia coli BL21 (Novagen).
  • the S2b Trx fusion proteins were induced to express by isopropyl-b-D-thiogalactopyranoside (IPTG) and were purified according to the manufacturer's protocols for Ni-nitrilotriacetic acid (Ni-NTA) resin (QIAGEN).
  • the library can be constructed according to the detailed description provided in the publications by Hoogenboon, et al [Nucleic Acids Research Vol. 19, No. 15, pp 4133-4137] and O'Connell D, et al., [Phage versus phagemid libraries for generation of human monoclonal antibodies. J MoI Biol. 2002 Aug 2;321(l):49-56].
  • a scFv phage antibody library was constructed in fd phage.
  • the fd phage display library was derived from a phagemid library [16] by subcloning the sfil/Notl scFv insert from pHENl into fd-Sfil/Notl [17].
  • Ligation mixtures were used to transform Escherichia coli TGl and the transformation mixture plated on TYE plates containing 15 ug/ml tetracycline.
  • Library size was calculated by counting the number of tetracycline-resistant colonies.
  • Library quality was verified by determining the percentage of clones with inserts of appropriate size for an scFv gene, performed by colony PCR screening using the primer fdseq [15] and fd2 [15].
  • Library diversity was confirmed by BstNl fingerprinting the amplified scFv genes [15].
  • the library was stored in 2xYT containing 15 ug/ml tetracycline and 15% glycerol at -8O 0 C.
  • Phase library selection scFvs were selected by using antibody phage display library and technology. Specific phage-displayed scFvs were affinity-selected by using proteins absorbed to Immunotubes (Nunc). For selections with S2a conjugated protein, Immunotubes (Nunc, Maxisorb) were coated with 10 ug/ml of BSA conjugated S2a overnight at 4 0 C. For the subsequent round of panning, selection was alternated between OVA conjugated and BSA conjugated S2a protein to prevent selection against carrier protein.
  • phages were depleted against recombinant control protein before selection by pre-incubating the phage library with 10 ug/ml recombinant control protein in a total volume of 1 ml for 60 minutes at room temperature.
  • the coated immunotubes were blocked with 2% (w/v) skimmed milk powder in PBS for one hour at room temperature.
  • the phage library was first adsorbed in phosphate-buffered saline (PBS) containing 2% skimmed milk powder.
  • plaque-forming units (9 x 10 11 ) of phage-scFvs prepared from phage library was mixed and introduced for panning into immunotubes. Unbound phages were removed by 6 washes with PBS containing 0.02% Tween 20, followed by 10 washes with PBS.
  • Bound phages were eluted with 1 ml of 10OmM Triethylamine (Sigma), neutralized with 0.5 ml of IM Tris-HCl (pH7.4) and then used to infect 20 ml of exponentially growing E. coli TGl.
  • E. coli was grown at 37 0 C for 30 minutes after which time the culture was plated on TYE plates containing 15 ug/ml tetracycline. After overnight growth, colonies were scraped from the plates and used to generate phage for second round of selection as described in ref 15.
  • Antigen-binding phage antibodies were identified by phage ELISA. Individual colonies were picked into 96-well microtiter plates containing 2 xYT with 15 ug/ml tetracycline. Bacteria were grown overnight at 3O 0 C, the bacteria pelleted, and supernatant, containing phage particles used for ELISA. The spike protein fragments, either carrier protein conjugated (BSA or OVA conjugated S2a, 10 ug/ml) or recombinant antigens (S2b-Trx, 10 ug/ml) were coated onto 96-well plates in bicarbonate buffer (pH 9.6) overnight at 4 0 C.
  • BSA carrier protein conjugated
  • S2b-Trx recombinant antigens
  • the number of unique phage antibodies were estimated by PCR fingerprinting of the scFv genes with the restriction enzyme BstNI (New England Biolab) as described in ref 5 and confirmed by DNA sequencing. Sequencing runs were performed in both directions for each clone using fd2 primer 5'-TTTTTGGAGATTTTCAAC-S' and fdseql primer 5'- GAATTTTCTGTATGAGG-3', referenced to as SEQ ID NO: 17 and SEQ ID NO: 18, respectively.
  • BIOCHIPS slides (Euroimmun, Luebeck, Germany), coated with SARS-Co V-infected cells and non-infected cells were utilized. 25 ul of diluted scFv was added to a well of the slide and incubated for overnight at 4 0 C. The slide was washed with PBST and air dried. 20 ul of the diluted fluorescein labeled mouse anti-c-myc secondary antibodies (1:100) were added and incubated at room temperature for 30 minutes. The slide was washed with PBST with diluted Evan Blue (1:400), air dried, and mounted. The mounted slide was observed under fluorescence microscope (Leica DML).
  • the scFv gene fragments were subcloned into pSynl vector and transformed into E. coli BL21 (DE3) (Novagen).
  • the scFv expression was induced by growth in 2xYT medium supplemented with 100 ug/ml ampicillin and 1 mM isopropyl-D-thiogalactoside for 4 hours at
  • Soluble periplasmic extracts were obtained by osmotic shock at 4 0 C using lysis buffer containing 20% sucrose, ImM EDTA, 30OmM Tris-
  • scFvs contain a His-6 tag that allows purification by Ni-NTA agarose column (Qiagen).
  • the scFvs purified from the periplasmic extracts were dialyzed with PBS for immunofluorescence and neutralization assays.
  • VH genes of Al 1 single-chain fragment variable were amplified using PCR from the phage DNA with the primer pairs: CTACGCGTGTCTTGTCCCAGGTGGAGCTGGTGGA (SEQ ID NO: 19) and GTGCTAGCTGAGGAGACGGTGACCAGG (SEQ ID NO: 20)
  • the amplified DNA was digested with Mlul and Nhel, ligated into N5KGlVal-Lark( IDEC Pharmaceuticals, San Diego) and clones containing the correct V H were identified by DNA sequencing.
  • Y n genes of Al 1 scFv were amplified from the PHAGE DNA with the primer pairs: TGCACGATGTGAGTCTGTGTTGACGCAGG (SEQ ID NO: 21) and GTAAGCTTGGTCCCTCCGCCGAA (SEQ ID NO: 22).
  • the resulting DNA was subcloned into pGEM-T easy vector (Promega) and clones containing the correct Vr* identified by DNA sequencing.
  • V « genes were excised from pGEM-T easy vector with Dralll and Hindlll and ligated into Dralll- and HiddiiI-digestedN5KGl Val-Lark DNA containing the appropriate V H gene.
  • Clones containing the correct V H and Y ⁇ gene were identified by DNA sequencing, and vector DNA was used to transfect CHO DG44 cells by electroporation.
  • Stable cell lines were established by selection in 400ug/ml G418 and expanded into IL spinner flasks. Supernatant containing IgG was collected, concentrated by ultrafiltration, and purified on Protein G (GE healthcare). Panning against purified SARS-CoV spike protein fragment
  • the above human non-immune phage display antibody library was then screened to select the scFv antibodies specific to the above selected antigenic determinant region (S2-a or S2-b) of the spike protein.
  • Each round of panning selection comprised a cycle of scFv-phage binding to the immobilized antigen, washing away of unbound and non-specifically bound scFv-phage, elution of the specifically bound scFv-phage, and propagation of enriched scFv-phage for entry into next round of panning.
  • the titer of the recovered phage was 7.3 x 10 6 and 3.6 x 10 6 cfu/ml after four round of selection on carrier protein conjugated S2a and S2b-Trx fusion protein. It is believed that an increase in the number of eluted phages after several rounds of panning manifested the specific binding.
  • Table 1 Results obtained after panning a human phage display scFv library (9 x 10 11 cfu diversity) against spike protein fragments S2-a and S2-b.
  • polyclonal phage were prepared after the fourth round of selection and analyzed for its binding to two target fragments (S2a and S2b) by ELISA. After each round of panning, the output phages were amplified and applied to microtiter wells coated with different antigens. Each microtiter well was coated with 10 ug/ml of the antigen. Bound phages were detected by horseradish peroxidase (HRP)-conjugated anti- Mi 3 antibody. Phage ELISA, shown in FIG. 1, demonstrated the enrichment of S2a and S2b- specific phages during panning cycles.
  • HRP horseradish peroxidase
  • phages were prepared from individual colonies from the fourth round of selection.
  • the binding specificity of the scFv was determined by phage ELISA using the target antigen and other control proteins as substrates. Referring to the results in Table 2, forty eight and ninety six individual clones were picked for the ELISA analysis against S2-a and S2-b spike protein fragments, respectively.
  • FIG. 2a of the 48 random clones analyzed, 16 clones specifically recognized S2-a protein, but not control peptide CETA, OVA and BSA control protein.
  • FIG. 2b shows that six specific clones were found to bind S2-a in a dose-dependent manner.
  • the scFv gene was amplified by PCR and the PCR product was digested with the frequently cutting restriction enzyme BstNI (PCR fingerprinting). From the sixteen S2-a binding scFvs, unique fingerprints were observed, indicating the presence of unique antibody (see Figure 4a). DNA sequence of representative scFv clones 6 and 13 was shown in Figure 5.
  • Table 2 Monoclonal ELISA. Single clones obtained after 4th rounds of panning were tested for binding to the target antigen and control antigen in ELISA. Binding phages were detected with an HRP-conjugated anti-M13 antibody. Signal to noise ratio over 2 are regarded as ELISA positive. Number of ELISA positive clones/ Target antigen Control antigen , « . . , . ,. ,
  • Synthetic S2a Carrier protein (BSA, OVA), 16 / 48

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A humanized antibody with a binding specificity to an epitope in the S2 domain of a spike protein of SARS-CoV, particular an epitope in the region of Leu803-Ala828. The antibody specifically recognizes SARS-CoV infected cells and is useful in treating patient suffering from SARS-CoV.

Description

HUMANIZED MONOCLONAL ANTIBODIES AGAINST SARS-ASSOCIATED CORONAVIRUS AND TREATMENT OF PATIENTS WITH SARS
CROSS REFERENCE TO RELATED APPLICATION
Pursuant to 35 U.S.C. § 119(e), this application claims priority to U.S. Provisional Application No. 60/659,906, filed March 10, 2005, which is hereby incorporated in its entirety by reference.
FIELD OF THE INVENTION
This invention relates to therapeutic antibodies. More specifically, it relates to humanized single chain variable fragment antibodies and whole antibodies against SARS- associated coronavirus and method of treating patient suffering from SARS (severe acute respiratory syndrome).
BACKGROUND OF THE INVENTION
SARS is a life threatening form of atypical pneumonia caused by a newly identified SARS-associated coronavirus (SARS-Co V)[l,2], It apparently began in Guangdong province of China in November 2002 and has spread to several countries, including Hong Kong [3], Although the epidemic appears to have abated, it is believed that the new break of SARS is possible in the future. As there appears to be no effective treatment currently available, the development of effective therapeutics to control the disease is of paramount importance [3].
During the last epidemic, SARS patients showed clinical improvement if they were given convalescent serum collected from recovered subjects [4]. However, the source of convalescent serum is extremely limited and there is the possibility of transmitting other blood-borne infections. Although animals can be used to develop anti-serum against this virus, these sera, being foreign proteins, would elicit immune responses and may cause anaphylactic reactions. Developing human non-immune antibodies against SARS-virus thus represents a significant advance in treating patients suffering from SARS-virus infection.
One of the methods for developing humanized antibodies is the use of a phage display library. As described in [20], a particular phage library, constructed by James Marks (Department of Anesthesia and Pharmaceutical Chemistry, University of California, San Francisco General Hospital), contains millions of independent clones of single-chain variable fragment (scFv) antibodies[9] appears to be a suitable tool to develop specific antibodies against SARS-CoV. Like other coronaviruses, the SARS-CoV also utilizes a surface glycoprotein named as spike protein to infect host cells [I]. The spike protein of SARS-CoV consists of 1255 amino acid residues and can be divided into two sub-domains, Sl and S2 domains. The Sl domain mediates the binding of the virus to its receptor angiotensin-converting enzyme 2 mainly distributing on the surface of human lung cells [18]. The S2 domain mediates membrane fusion between the virus and the host cell. Two strategies can be employed to block the infection of SARS-CoV, either to block the binding of the Sl domain to the receptor or to block the fusion of the virus mediated by the S2 domain.
Several humanized antibodies against the Sl domain have been generated and all of these antibodies can neutralize the virus in vitro and in vivo (animal model). Unfortunately, point mutations have been identified in the Sl domain, so the virus may not be recognized by these antibodies in the future. It appears that no mutation has been found in the S2 domain and this region seems to be more conserved than the Sl domain. Therefore it is of significance to develop humanized antibodies targeting the S2 domain of the spike protein to neutralize SARS-CoV infection.
SUMMARY OF THE INVENTION
As an object of the present invention, there is provided humanized antibodies against SARS-CoV. Such humanized antibodies, either in the form of scFv or as a whole antibody, bind specifically to the S2 domain of the spike protein of SARS-CoV. A preferred epitope in the S2 domain is the region of Leu803-Ala828, although other epitopes may also provide satisfactory results. An antibody of the present invention preferably has one or more peptide segments defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7 in its VH chain, and/or has one or more segments defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14 in its VL chain. By way of example, not limitation, a particular antibody of the present invention comprises seven peptide segments in the VH chain defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively, and seven peptide segments in the VL chain defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, respectively. According to the invention, a preferred antibody comprises a VH chain containing a sequence defined by SEQ ID NO: 24 and a VL chain containing a sequence defined by SEQ ID NO: 25.
As another object of the present invention, there is provided a method of identifying scFv gene fragment that confers the above antibody the binding specificity to the S2 domain of the spike protein of the SARS-CoV. The method comprises the steps of (a) obtaining a conjugated or recombinant protein containing a peptide segment of the S2 domain of the spike protein; (b) obtaining a phage display library; and (c) selecting from the phage display library specific phage- displayed scFvs using the conjugated or recombinant protein as the binding agent to identify the scFv gene fragment that confer binding specificity to the S2 domain of the spike protein.
Using known methods, preparations of the antibody can be made by subcloning the scFv gene fragment into a proper vector, for example, pET28 vector from Novagen, transforming the reconstructed vector into E. Colt strain BL21, and inducing its expression by IPTG. Similarly, the scFv gene fragment can be subcloned into the gene encoding a whole human antibody so that a whole humanized antibody with the same binding specificity can be expressed.
The above preparation of humanized antibody can be further processed using known methods in the pharmaceutical industry into a pharmaceutical formulation with a proper carrier.
As another object of the present invention, there is provided a method of treating, preventing, or ameliorating a pathological condition in a patient, wherein said pathological condition is associated with coronavirus SARS-CoV, comprising a step of administering to said patient a therapeutically effective amount of a humanized antibody that has a binding specificity to an epitope in the S2 domain of the spike protein of SARS-CoV.
The various features of novelty which characterize the invention are pointed out with particularity in the claims annexed to and forming a part of this disclosure. For a better understanding of the invention, its operating advantages, and specific objects attained by its use, reference should be made to the drawings and the following description in which there are illustrated and described preferred embodiments of the invention. BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 shows the results of phage clones from each round of panning in the polyclonal ELISA assay.
FIG. 2 shows the results of individual S2-a-specific antibody clones in the monoclonal ELISA assay.
FIG. 3 shows the results of individual S2-b-specific antibody clones in the monoclonal
ELISA assay.
FIG. 4 illustrates DNA fingerprinting of clones to determine diversity by BstNI restriction enzyme analysis.
FIG. 5 shows results of sequencing analysis of VH and VL chain genes of S2-a and S2-b- specifϊc human mAbs.
FIG. 6 shows results of immunofluorescence staining of SARS-CoV infected Vero cells.
DETAILED DESCRIPTION OF PARTICULAR EMBODIMENTS
The follow detailed description about a particular embodiment is intended to illustrate various aspects of the present invention, of which various specifics are set forth as example, not limitation to the present invention. It is contemplated that modifications may be made by people with ordinary skill in the art to obtain satisfactory result.
Synthesizing peptide segment of the S2 domain
Synthetic peptide S2a (NFSQILPDPLKPTKRS - SEQ ID NO: 15) was obtained from UCSF (University of California, San Francisco) and was supplied at >95% pure as assessed by
HPLC. Peptide was conjugated to carrier protein bovine serum albumin (BSA; Pierce) and ovalbumin (OVA; Pierce) as described by the manufacturer (Imject Immunogen EDC Kit; Pierce) to facilitate the panning. S2a corresponds to the S783-798 region in the S2 domain of SARS-CoVs spike protein. As detailed below, S2b is a peptide segment corresponding to the 803 - 828 region of the S2 domain. Pure synthetic S2a peptide was conjugated to BSA and OVA carrier protein to increase the coating efficiency on the Immunotube for screening. One problem with this method is that antibodies recognizing BSA and OVA carrier protein are also isolated. This can be avoided by alternating between using BSA and OVA conjugated S2a peptide in selection rounds. On the other hand, S2b is relatively hydrophobic and is not soluble in the common buffer. In order to solve the solubility problem, S2b was expressed as a purified thioredoxin (Trx) fusion protein in E. coli and as panning bait for selection. Prior to selection, the library was depleted of the Trx fusion protein binders.
Expression and purification of a recombinant S2 domain epitode The amino acid sequence of the SARS-CoV spike protein was used to design a codon- optimized version of the gene encoding the spike protein, as described elsewhere [12]. 2Sb, an oligonucleotide based on the DNA sequence encoding the residues 803 to 828 (LLFNKVTLADAGFMKQYGECLGDINA - SEQ ID NO: 16) of spike protein, was synthesized. The sequence of the oligonucleotide is 5'AATTCGCTGTTATTTA ATAAGGTGACCCTGGCAGACGCGGGGTTCATGAAACAGTATGGTGAATGCTTGGGC GATATTAACGCCA-3' (SEQ ID NO: 23). The synthetic gene was cloned into the bacterial expression vector pET32b (Novagen) fused with the 3 'terminal of the thioredoxin (Trx) gene. The cloned gene was confirmed by DNA sequencing. The ligated vector was transformed into Escherichia coli BL21 (Novagen). The S2b Trx fusion proteins were induced to express by isopropyl-b-D-thiogalactopyranoside (IPTG) and were purified according to the manufacturer's protocols for Ni-nitrilotriacetic acid (Ni-NTA) resin (QIAGEN).
Phage display library construction
The construction of the phage display library is not part of this invention, which was obtained from Professor James Marks (Department of Anesthesia and Pharmaceutical Chemistry,
University of California, San Francisco General Hospital). The library can be constructed according to the detailed description provided in the publications by Hoogenboon, et al [Nucleic Acids Research Vol. 19, No. 15, pp 4133-4137] and O'Connell D, et al., [Phage versus phagemid libraries for generation of human monoclonal antibodies. J MoI Biol. 2002 Aug 2;321(l):49-56]. In brief, a scFv phage antibody library was constructed in fd phage. The fd phage display library was derived from a phagemid library [16] by subcloning the sfil/Notl scFv insert from pHENl into fd-Sfil/Notl [17]. Ligation mixtures were used to transform Escherichia coli TGl and the transformation mixture plated on TYE plates containing 15 ug/ml tetracycline. Library size was calculated by counting the number of tetracycline-resistant colonies. Library quality was verified by determining the percentage of clones with inserts of appropriate size for an scFv gene, performed by colony PCR screening using the primer fdseq [15] and fd2 [15]. Library diversity was confirmed by BstNl fingerprinting the amplified scFv genes [15]. The library was stored in 2xYT containing 15 ug/ml tetracycline and 15% glycerol at -8O0C.
Phase library selection scFvs were selected by using antibody phage display library and technology. Specific phage-displayed scFvs were affinity-selected by using proteins absorbed to Immunotubes (Nunc). For selections with S2a conjugated protein, Immunotubes (Nunc, Maxisorb) were coated with 10 ug/ml of BSA conjugated S2a overnight at 40C. For the subsequent round of panning, selection was alternated between OVA conjugated and BSA conjugated S2a protein to prevent selection against carrier protein. For selection of scFv to the S2b-Trx fusion proteins, phages were depleted against recombinant control protein before selection by pre-incubating the phage library with 10 ug/ml recombinant control protein in a total volume of 1 ml for 60 minutes at room temperature.
The coated immunotubes were blocked with 2% (w/v) skimmed milk powder in PBS for one hour at room temperature. To eliminate non-specific binding, the phage library was first adsorbed in phosphate-buffered saline (PBS) containing 2% skimmed milk powder. Subsequently, plaque-forming units (9 x 1011) of phage-scFvs prepared from phage library was mixed and introduced for panning into immunotubes. Unbound phages were removed by 6 washes with PBS containing 0.02% Tween 20, followed by 10 washes with PBS. Bound phages were eluted with 1 ml of 10OmM Triethylamine (Sigma), neutralized with 0.5 ml of IM Tris-HCl (pH7.4) and then used to infect 20 ml of exponentially growing E. coli TGl. E. coli was grown at 370C for 30 minutes after which time the culture was plated on TYE plates containing 15 ug/ml tetracycline. After overnight growth, colonies were scraped from the plates and used to generate phage for second round of selection as described in ref 15.
Phase ELISA
Antigen-binding phage antibodies were identified by phage ELISA. Individual colonies were picked into 96-well microtiter plates containing 2 xYT with 15 ug/ml tetracycline. Bacteria were grown overnight at 3O0C, the bacteria pelleted, and supernatant, containing phage particles used for ELISA. The spike protein fragments, either carrier protein conjugated (BSA or OVA conjugated S2a, 10 ug/ml) or recombinant antigens (S2b-Trx, 10 ug/ml) were coated onto 96-well plates in bicarbonate buffer (pH 9.6) overnight at 40C. The next day, wells were blocked for one hour at room temperature with 2% skimmed milk powder in PBS. 100 ul of scFv phage supernatant were added to the wells and incubated for 1 hour at room temperature. The plates were washed and phage binding was detected with anti-M13 antibody (Amersham Pharmacia) as described by manufacturer. The results were read at 405nm in plate reader.
DNA fingerprinting and sequencing
The number of unique phage antibodies were estimated by PCR fingerprinting of the scFv genes with the restriction enzyme BstNI (New England Biolab) as described in ref 5 and confirmed by DNA sequencing. Sequencing runs were performed in both directions for each clone using fd2 primer 5'-TTTTTGGAGATTTTCAAC-S' and fdseql primer 5'- GAATTTTCTGTATGAGG-3', referenced to as SEQ ID NO: 17 and SEQ ID NO: 18, respectively.
Immunofluorescence staining ofVero cells infected with SARS-CoV
BIOCHIPS slides (Euroimmun, Luebeck, Germany), coated with SARS-Co V-infected cells and non-infected cells were utilized. 25 ul of diluted scFv was added to a well of the slide and incubated for overnight at 40C. The slide was washed with PBST and air dried. 20 ul of the diluted fluorescein labeled mouse anti-c-myc secondary antibodies (1:100) were added and incubated at room temperature for 30 minutes. The slide was washed with PBST with diluted Evan Blue (1:400), air dried, and mounted. The mounted slide was observed under fluorescence microscope (Leica DML).
Production of single-chain variable fragment (scFv)
The scFv gene fragments were subcloned into pSynl vector and transformed into E. coli BL21 (DE3) (Novagen). The scFv expression was induced by growth in 2xYT medium supplemented with 100 ug/ml ampicillin and 1 mM isopropyl-D-thiogalactoside for 4 hours at
30°C. The scFv was collected from the periplasm. Soluble periplasmic extracts were obtained by osmotic shock at 40C using lysis buffer containing 20% sucrose, ImM EDTA, 30OmM Tris-
HCl, pH 8. All scFvs contain a His-6 tag that allows purification by Ni-NTA agarose column (Qiagen). The scFvs purified from the periplasmic extracts were dialyzed with PBS for immunofluorescence and neutralization assays.
Production of whole humanized antibody
This process starts with IgG Construction. VH genes of Al 1 single-chain fragment variable (scFv) were amplified using PCR from the phage DNA with the primer pairs: CTACGCGTGTCTTGTCCCAGGTGGAGCTGGTGGA (SEQ ID NO: 19) and GTGCTAGCTGAGGAGACGGTGACCAGG (SEQ ID NO: 20)
The amplified DNA was digested with Mlul and Nhel, ligated into N5KGlVal-Lark( IDEC Pharmaceuticals, San Diego) and clones containing the correct VH were identified by DNA sequencing. Yn genes of Al 1 scFv were amplified from the PHAGE DNA with the primer pairs: TGCACGATGTGAGTCTGTGTTGACGCAGG (SEQ ID NO: 21) and GTAAGCTTGGTCCCTCCGCCGAA (SEQ ID NO: 22). The resulting DNA was subcloned into pGEM-T easy vector (Promega) and clones containing the correct Vr* identified by DNA sequencing. V« genes were excised from pGEM-T easy vector with Dralll and Hindlll and ligated into Dralll- and HiddiiI-digestedN5KGl Val-Lark DNA containing the appropriate VH gene. Clones containing the correct VH and Yκ gene were identified by DNA sequencing, and vector DNA was used to transfect CHO DG44 cells by electroporation. Stable cell lines were established by selection in 400ug/ml G418 and expanded into IL spinner flasks. Supernatant containing IgG was collected, concentrated by ultrafiltration, and purified on Protein G (GE healthcare). Panning against purified SARS-CoV spike protein fragment
The above human non-immune phage display antibody library was then screened to select the scFv antibodies specific to the above selected antigenic determinant region (S2-a or S2-b) of the spike protein. Each round of panning selection comprised a cycle of scFv-phage binding to the immobilized antigen, washing away of unbound and non-specifically bound scFv-phage, elution of the specifically bound scFv-phage, and propagation of enriched scFv-phage for entry into next round of panning. As shown in Table 1, the titer of the recovered phage was 7.3 x 106 and 3.6 x 106 cfu/ml after four round of selection on carrier protein conjugated S2a and S2b-Trx fusion protein. It is believed that an increase in the number of eluted phages after several rounds of panning manifested the specific binding.
Table 1: Results obtained after panning a human phage display scFv library (9 x 1011 cfu diversity) against spike protein fragments S2-a and S2-b.
S2-a synthetic peptide S2-b fusion protein
Panning Bait Phage eluted (cfu/ml) Bait Phage eluted (cfu/ml)
1st S2a-BSA 1.7 x lO4 S2-b 3.4 x lO4
2nd S2a-OVA 7.8 x lO4 S2-b 8.O x IO5
3rd S2a-BSA 3.0 x l05 S2-b 2,8 x 106
4th S2a-OVA 7.3 x 106 S2-b 3.6 x lO6
To determine the outcome of the selection strategy, polyclonal phage were prepared after the fourth round of selection and analyzed for its binding to two target fragments (S2a and S2b) by ELISA. After each round of panning, the output phages were amplified and applied to microtiter wells coated with different antigens. Each microtiter well was coated with 10 ug/ml of the antigen. Bound phages were detected by horseradish peroxidase (HRP)-conjugated anti- Mi 3 antibody. Phage ELISA, shown in FIG. 1, demonstrated the enrichment of S2a and S2b- specific phages during panning cycles.
Selection and identification ofscFvs to SARS-CoV spike protein
To identify phages that specifically bound antigens, phages were prepared from individual colonies from the fourth round of selection. The binding specificity of the scFv was determined by phage ELISA using the target antigen and other control proteins as substrates. Referring to the results in Table 2, forty eight and ninety six individual clones were picked for the ELISA analysis against S2-a and S2-b spike protein fragments, respectively.
Selection on conjugated synthetic S2a spike protein fragment
Referring to FIG. 2a, of the 48 random clones analyzed, 16 clones specifically recognized S2-a protein, but not control peptide CETA, OVA and BSA control protein. FIG. 2b shows that six specific clones were found to bind S2-a in a dose-dependent manner. To determine the number of unique antibodies generated, the scFv gene was amplified by PCR and the PCR product was digested with the frequently cutting restriction enzyme BstNI (PCR fingerprinting). From the sixteen S2-a binding scFvs, unique fingerprints were observed, indicating the presence of unique antibody (see Figure 4a). DNA sequence of representative scFv clones 6 and 13 was shown in Figure 5.
Selection on purified recombinant S2b spike protein
After four rounds of selection, a total of 96 clones were screened for S2b specific binding by ELISA. 70 clones specifically recognized S2b-Trx protein, but not S2a and vector control protein (see Table 2). Eight representative clones showing the highest signals in ELISA were identified and seven clones were found to bind S2b in a dose-dependent manner (see FIG. 3). Twenty-four S2b specific clones were subjected to DNA fingerprint analysis and a diverse pattern was observed (see FIG. 4b). Ten unique anti-scFvs were identified. DNA sequencing analysis of clone Al l, which has the highest specificity and affinity binding to S2b, was completed (see Figure 5).
Table 2: Monoclonal ELISA. Single clones obtained after 4th rounds of panning were tested for binding to the target antigen and control antigen in ELISA. Binding phages were detected with an HRP-conjugated anti-M13 antibody. Signal to noise ratio over 2 are regarded as ELISA positive. Number of ELISA positive clones/ Target antigen Control antigen , «. . , . ,. ,
The number of antigen-bindmg clones screened
Synthetic S2a Carrier protein (BSA, OVA), 16 / 48
Conjugated control peptide
Recombinant S2b Recombinant vector control 70 / 96
Immunofluorescence assay on SARS-CoV infected cells
Four scFvs (C6, Cl 3, Al 1 and GlO) tagged with His-6 in pSynl vector were expressed in
E. coli and purified by immobilized metal affinity chromatography. Reactivity with SARS- CoV-infected cells by scFvs was assessed by indirect immunofluorescence. This test utilized BIOCHIP slides containing the two substrates SARS-CoV infected cells and non-infected cells positioned side by side in each reaction field. As shown in FIG. 6A, immunofluorescence analysis revealed that the scFv-Al 1 specifically recognize SARS-CoV infected but not uninfected Vero cells. Irrelevant scFv produced in an identical fashion, did not react with SARS-CoV infected Vero cells (see FIG. 6B).
Processing antibodies into pharmaceutical compositions
It is believed to be within ordinary skill in the pharmaceutical industry to further processing an isolated antibody into a form of pharmaceutical formulation suitable for administering to human subjects.
While there have been described and pointed out fundamental novel features of the invention as applied to a preferred embodiment thereof, it will be understood that various omissions and substitutions and changes, in the form and details of the embodiments illustrated, may be made by those skilled in the art without departing from the spirit of the invention. The invention is not limited by the embodiments described above which are presented as examples only but can be modified in various ways within the scope of protection defined by the appended patent claims. REFERENCES
1. Ksiazek, T.G., et al., A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med, 2003. 348(20): p. 1953-66.
2. Kuiken, T., et al., Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. Lancet, 2003. 362(9380): p. 263-70.
3. Drosten, C, et al., Severe acute respiratory syndrome: identification of the etiological agent. Trends MoI Med, 2003. 9(8): p. 325-7. 4. Cheng, Y., et al., Use of convalescent plasma therapy in SARS patients in Hong Kong. Eur J Clin Microbiol Infect Dis, 2004.
5. Marks, J.D., et al., By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J MoI Biol, 1991. 222(3): p. 581-97.
6. Hayashi, T., et al., Recombinant humanized anti-CD40 monoclonal antibody triggers autologous antibody-dependent cell-mediated cytotoxicity against multiple myeloma cells.
Br J Haematol, 2003. 121(4): p. 592-6.
7. Juweid, M., Technology evaluation: epratuzumab, Immunomedics/Amgen. Curr Opin MoI Ther, 2003. 5(2): p. 192-8.
8. Leonard, J.P., et al., Phase I/II trial of epratuzumab (humanized anti-CD22 antibody) in indolent non-Hodgkin's lymphoma. J Clin Oncol, 2003. 21(16): p. 3051-9.
9. Poul, M.A., et al., Selection of tumor-specific internalizing human antibodies from phage libraries. J MoI Biol, 2000. 301(5): p. 1149-61.
10. Gallagher, T.M. and MJ. Buchmeier, Coronavirus spike proteins in viral entry and pathogenesis. Virology, 2001. 279(2): p. 371-4. 11. Rota, P.A., et al., Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science, 2003. 300(5624): p. 1394-9.
12. Castilla J , et al., Interference of coronavirus infection by expression of immunoglobulin G (IgG) or IgA virus-neutralizing antibodies. J Virol. 1997 Jul;71(7):5251-8
13. Zhang H., et al., Identification of an antigenic determinant on the S2 domain of the severe acute respiratory syndrome coronavirus spike glycoprotein capable of inducing neutralizing antibodies. J Virol. 2004 Jul;78(13):6938-45. 14. Jacobsson K., et al., Shotgun Phage Display - Selection for Bacterial Receptins or other Exported Proteins. Biol Proced Online. 2003;5:123-135. Epub 2003 May 1
15. Huie MA., et al.; Antibodies to human fetal erythroid cells from a nonimmune phage antibody library. Proc Natl Acad Sci U S A. 2001 Feb 27;98(5):2682-7 16. Sheets, M.D., et al., Efficient construction of a large nonimmune phage antibody library: the production of high-affinity human single-chain antibodies to protein antigens. Proc Natl Acad Sci U S A. 1998 May 26;95(11):6157-62 17. Poul MA., et al., Targeted gene delivery to mammalian cells by filamentous bacteriophage.
J MoI Biol. 1999 Apr 30;288(2):203-l 1 18. Li W., et al., Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature. 2003 Nov 27;426(6965):450-4
19. Sui J., et al., Potent neutralization of severe acute respiratory syndrome (SARS) coronavirus by a human mAb to Sl protein that blocks receptor association. Proc Natl Acad Sci U S A. 2004 Feb 24;101(8):2536-41. 20. O'Connell D, et al., Phage versus phagemid libraries for generation of human monoclonal antibodies. J MoI Biol. 2002 Aug 2;321(l):49-56.

Claims

WHAT IS CLAIMED IS:
1. A method of treating, preventing, or ameliorating a pathological condition in a patient, wherein said pathological condition is associated with coronavirus SARS-CoV, comprising a step of administering to said patient a therapeutically effective amount of a humanized antibody, said antibody comprising a VH chain and a VL chain and having a binding specificity to a region in an S2 domain of a spike protein of SARS-CoV.
2. The method of claim 1, wherein said humanized antibody is a scFv antibody or a whole antibody.
3. The method of claim 2, wherein said humanized antibody is a scFv antibody.
4. The method of claim 2, wherein said VH chain of said antibody comprises a segment defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.
5. The method of claim 2, wherein said VL chain of said antibody comprises a segment defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.
6. The method of claim 4, wherein said VL chain of said antibody comprises a segment defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.
7. The method of claim 4, wherein said VL chain of said antibody comprises seven segments defined by SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, respectively.
8. The method of claim 5, wherein said VH chain of said antibody comprises seven segments defined by SEQ ID NO: I5 SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively.
9. The method of claim 7, wherein said VH chain of said antibody comprises seven segments defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively.
10. The method of claim 1, wherein said region in said S2 domain is from Leu803 to Ala828.
11. A preparation of a humanized antibody with a binding specificity to an epitope in an S2 domain of a spike protein of SARS-CoV and comprising a VH chain and a VL chain.
12. The preparation of claim 11 , wherein said humanized antibody a scFv antibody or a whole antibody and said epitope is a region from Leu803 to Ala828.
13. The preparation of claim 12, wherein said humanized antibody is a scFv antibody.
14. The preparation of claim 11, wherein said VH chain comprises at least one sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least one sequence selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
15. The preparation of claim 11, wherein said VH chain comprises at least two sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least two sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
16. The preparation of claim 11, wherein said VH chain comprises at least three sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least three sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
17. The preparation of claim 11 , wherein said VH chain comprises at least four sequences selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least four sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
18. The preparation of claim 11 , wherein said VH chain comprises at least five sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least five sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
19. The preparation of claim 11, wherein said VH chain comprises at least six sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises at least six sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
20. The preparation of claim 11, wherein said VH chain comprises seven sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and said VL chain comprises seven sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.
21. A method of neutralizing SARS-CoV infection in human, comprising a step of contacting an antibody of claim 11 with a human cell infected with said SARS-CoV.
22. A pharmaceutical composition comprising a preparation of a humanized antibody of claim 11 and a pharmaceutically acceptable carrier.
23. The pharmaceutical composition of claim 22, wherein said preparation of a humanized antibody is according to claim 20.
24. The preparation of claim 20, wherein said VH chain comprises a sequence of SEQ ID NO: 24 and said VL chain comprises a sequence of SEQ ID NO: 25.
PCT/GB2006/000848 2005-03-10 2006-03-10 Humananized monoclonal antibodies against sars - associated coronavirus and treatment of patients with sars Ceased WO2006095180A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US65990605P 2005-03-10 2005-03-10
US60/659,906 2005-03-10

Publications (2)

Publication Number Publication Date
WO2006095180A2 true WO2006095180A2 (en) 2006-09-14
WO2006095180A3 WO2006095180A3 (en) 2006-12-21

Family

ID=36694257

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/000848 Ceased WO2006095180A2 (en) 2005-03-10 2006-03-10 Humananized monoclonal antibodies against sars - associated coronavirus and treatment of patients with sars

Country Status (1)

Country Link
WO (1) WO2006095180A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111471103A (en) * 2020-03-20 2020-07-31 唐山怡安生物工程有限公司 Heterologous antibody of new coronavirus (2019-nCOV) and preparation method thereof
CN111778218A (en) * 2020-06-04 2020-10-16 山东宽和正生物医药有限公司 Phage-displayed antibody library and monoclonal antibodies against the new coronavirus SARS-CoV-2 obtained based on its panning
WO2021186190A1 (en) * 2020-03-19 2021-09-23 Imperial College Innovations Limited Coronavirus antibody
WO2021238910A1 (en) * 2020-05-25 2021-12-02 Guo Bingshi Anti-coronavirus spike protein antibodies and uses thereof
WO2022010353A1 (en) * 2020-07-10 2022-01-13 Leyden Laboratories B.V. Methods for identifying coronavirus cross-reacting antibodies
WO2022161346A1 (en) * 2021-01-27 2022-08-04 Bioduro (Jiangsu) Co., Ltd. Antibody against sars-cov-2

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005001069A1 (en) * 2002-11-08 2005-01-06 Avant Immunotherapeutics, Inc. Genetic marker for live bacterial vaccines
WO2004091524A2 (en) * 2003-04-14 2004-10-28 Acambis Inc. Respiratory virus vaccines
CN1318449C (en) * 2003-05-13 2007-05-30 雅臣药业集团(远东)有限公司 Application of anti-atypical pneumonia (SARS) specific IgY in the preparation of preparations for preventing and treating atypical pneumonia
EP1633775A2 (en) * 2003-06-13 2006-03-15 Crucell Holland B.V. Antigenic peptides of sars coronavirus and uses thereof
WO2005012337A2 (en) * 2003-07-15 2005-02-10 Crucell Holland B.V. Antigenic peptides of sars coronavirus and uses thereof
WO2005081716A2 (en) * 2003-11-24 2005-09-09 The Johns Hopkins University DNA VACCINES TARGETING ANTIGENS OF THE SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS (SARS-CoV)
WO2005060520A2 (en) * 2003-11-25 2005-07-07 Dana-Farber Cancer Institute, Inc. ANTIBODIES AGAINST SARS-CoV AND METHODS OF USE THEREOF

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021186190A1 (en) * 2020-03-19 2021-09-23 Imperial College Innovations Limited Coronavirus antibody
US20240207401A1 (en) * 2020-03-19 2024-06-27 Imperial College Innovations Limited Coronavirus antibody
CN111471103A (en) * 2020-03-20 2020-07-31 唐山怡安生物工程有限公司 Heterologous antibody of new coronavirus (2019-nCOV) and preparation method thereof
WO2021238910A1 (en) * 2020-05-25 2021-12-02 Guo Bingshi Anti-coronavirus spike protein antibodies and uses thereof
CN113336846B (en) * 2020-06-04 2023-11-10 山东宽和正生物医药有限公司 Monoclonal antibody E11 against novel coronavirus SARS-CoV-2
CN111778218A (en) * 2020-06-04 2020-10-16 山东宽和正生物医药有限公司 Phage-displayed antibody library and monoclonal antibodies against the new coronavirus SARS-CoV-2 obtained based on its panning
CN113336846A (en) * 2020-06-04 2021-09-03 山东宽和正生物医药有限公司 Monoclonal antibody E11 against novel coronavirus SARS-CoV-2
NL2026043B1 (en) * 2020-07-10 2022-03-15 Leyden Laboratories B V Methods for identifying coronavirus cross-reacting antibodies
JP2023533343A (en) * 2020-07-10 2023-08-02 ライデン ラボラトリーズ ビー.ブイ. Methods of identifying coronavirus cross-reactive antibodies
WO2022010353A1 (en) * 2020-07-10 2022-01-13 Leyden Laboratories B.V. Methods for identifying coronavirus cross-reacting antibodies
CN115427441A (en) * 2021-01-27 2022-12-02 保诺生物科技(江苏)有限公司 Antibodies against SARS-COV-2
CN115427441B (en) * 2021-01-27 2023-09-05 保诺生物科技(江苏)有限公司 Antibodies against SARS-COV-2
WO2022161346A1 (en) * 2021-01-27 2022-08-04 Bioduro (Jiangsu) Co., Ltd. Antibody against sars-cov-2

Also Published As

Publication number Publication date
WO2006095180A3 (en) 2006-12-21

Similar Documents

Publication Publication Date Title
JP7235256B2 (en) Antibody that binds to outer membrane glycoprotein of severe fever with thrombocytopenic syndrome virus and use thereof
CN113045647B (en) Neutralizing antibody of novel coronavirus SARS-CoV-2 and application thereof
JP7171737B2 (en) Nanobodies capable of binding to SFTSV and uses thereof
AU2008298939A1 (en) Donor specific antibody libraries
Chan et al. Comparison of the efficiency of antibody selection from semi-synthetic scFv and non-immune Fab phage display libraries against protein targets for rapid development of diagnostic immunoassays
US11248039B2 (en) Immunoglobulin single variable domain antibody against RSV prefusion F protein
WO2023168776A1 (en) Humanized antibody against broad-spectrum novel coronavirus and use thereof
US20240182549A1 (en) Peptides and antibody fusions that bind to sars-cov-2 and methods of using same
CN114456264B (en) Novel human antibody of rare broad-spectrum epitope of coronavirus and application thereof
CN104045709B (en) Humanized neutralizing antibody A6 against avian influenza virus (AIV) H7N9 as well as preparation method and application thereof
CN104031146A (en) Humanized avian influenza virus H7N9 resisting neutralizing antibody M5 as well as preparation method and application thereof
WO2006095180A2 (en) Humananized monoclonal antibodies against sars - associated coronavirus and treatment of patients with sars
TW201712031A (en) Antibody library presented by phage and use thereof
CN104045710A (en) Humanized neutralizing antibody D5 against avian influenza virus (AIV) H7N9 as well as preparation method and application thereof
CN104031147B (en) People source anti-H7N9 bird flu virus neutrality antibody H8, its preparation method and application
Houimel et al. Isolation and characterization of human neutralizing antibodies to rabies virus derived from a recombinant immune antibody library
Flego et al. Generation of human antibody fragments recognizing distinct epitopes of the nucleocapsid (N) SARS-CoV protein using a phage display approach
Lee et al. Chicken single-chain variable fragments against the SARS-CoV spike protein
Leung et al. Development of human single-chain antibodies against SARS-associated coronavirus
CN104045711A (en) Humanized neutralizing antibody B5 against avian influenza virus (AIV) H7N9 as well as preparation method and application thereof
Duan et al. A human neutralizing antibody against a conformational epitope shared by oligomeric SARS S1 protein
CN105859882A (en) Human-derived anti-MERS virus neutralizing antibody A1, and preparation method and application thereof
RU2847808C2 (en) Neutralising respiratory syncytial virus antibody and its application
RU2847808C9 (en) Neutralising respiratory syncytial virus antibody and its application
CN116987183B (en) Anti-respiratory syncytial virus neutralizing antibodies and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

WWW Wipo information: withdrawn in national office

Country of ref document: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06710060

Country of ref document: EP

Kind code of ref document: A2

WWW Wipo information: withdrawn in national office

Ref document number: 6710060

Country of ref document: EP