WO2006088716A1 - Substituted tetralins as selective estrogen receptor-beta agonists - Google Patents

Substituted tetralins as selective estrogen receptor-beta agonists Download PDF

Info

Publication number
WO2006088716A1
WO2006088716A1 PCT/US2006/004540 US2006004540W WO2006088716A1 WO 2006088716 A1 WO2006088716 A1 WO 2006088716A1 US 2006004540 W US2006004540 W US 2006004540W WO 2006088716 A1 WO2006088716 A1 WO 2006088716A1
Authority
WO
WIPO (PCT)
Prior art keywords
preparation
methoxy
compound
phenyl
nmr
Prior art date
Application number
PCT/US2006/004540
Other languages
French (fr)
Inventor
Venkatesh Krishnan
Julian Stanley Kroin
Bryan Hurst Norman
Elizabeth Marie Thomas
Original Assignee
Eli Lilly And Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eli Lilly And Company filed Critical Eli Lilly And Company
Priority to US11/814,806 priority Critical patent/US8093302B2/en
Priority to EP06720533A priority patent/EP1853578A1/en
Publication of WO2006088716A1 publication Critical patent/WO2006088716A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
    • C07C49/703—Unsaturated compounds containing a keto groups being part of a ring containing hydroxy groups
    • C07C49/747—Unsaturated compounds containing a keto groups being part of a ring containing hydroxy groups containing six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C205/00—Compounds containing nitro groups bound to a carbon skeleton
    • C07C205/27—Compounds containing nitro groups bound to a carbon skeleton the carbon skeleton being further substituted by etherified hydroxy groups
    • C07C205/35—Compounds containing nitro groups bound to a carbon skeleton the carbon skeleton being further substituted by etherified hydroxy groups having nitro groups and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the carbon skeleton
    • C07C205/36—Compounds containing nitro groups bound to a carbon skeleton the carbon skeleton being further substituted by etherified hydroxy groups having nitro groups and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the carbon skeleton to carbon atoms of the same non-condensed six-membered aromatic ring or to carbon atoms of six-membered aromatic rings being part of the same condensed ring system
    • C07C205/37—Compounds containing nitro groups bound to a carbon skeleton the carbon skeleton being further substituted by etherified hydroxy groups having nitro groups and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the carbon skeleton to carbon atoms of the same non-condensed six-membered aromatic ring or to carbon atoms of six-membered aromatic rings being part of the same condensed ring system the oxygen atom of at least one of the etherified hydroxy groups being further bound to an acyclic carbon atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C205/00—Compounds containing nitro groups bound to a carbon skeleton
    • C07C205/45—Compounds containing nitro groups bound to a carbon skeleton the carbon skeleton being further substituted by at least one doubly—bound oxygen atom, not being part of a —CHO group
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C215/00—Compounds containing amino and hydroxy groups bound to the same carbon skeleton
    • C07C215/46—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton
    • C07C215/64—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having hydroxy groups bound to carbon atoms of at least one six-membered aromatic ring and amino groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton with rings other than six-membered aromatic rings being part of the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C217/00—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton
    • C07C217/78—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having amino groups and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the same carbon skeleton
    • C07C217/94—Compounds containing amino and etherified hydroxy groups bound to the same carbon skeleton having amino groups and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the same carbon skeleton having amino groups bound to carbon atoms of six-membered aromatic rings being part of condensed ring systems and etherified hydroxy groups bound to carbon atoms of six-membered aromatic rings of the same carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/02—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/32—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton containing six-membered aromatic rings
    • C07C235/34—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton containing six-membered aromatic rings having the nitrogen atoms of the carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/42—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/66—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings being part of condensed ring systems and singly-bound oxygen atoms, bound to the same carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C247/00—Compounds containing azido groups
    • C07C247/02—Compounds containing azido groups with azido groups bound to acyclic carbon atoms of a carbon skeleton
    • C07C247/08—Compounds containing azido groups with azido groups bound to acyclic carbon atoms of a carbon skeleton being unsaturated
    • C07C247/10—Compounds containing azido groups with azido groups bound to acyclic carbon atoms of a carbon skeleton being unsaturated and containing rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C255/00—Carboxylic acid nitriles
    • C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
    • C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
    • C07C255/36—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring the carbon skeleton being further substituted by hydroxy groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C255/00—Carboxylic acid nitriles
    • C07C255/49—Carboxylic acid nitriles having cyano groups bound to carbon atoms of six-membered aromatic rings of a carbon skeleton
    • C07C255/53—Carboxylic acid nitriles having cyano groups bound to carbon atoms of six-membered aromatic rings of a carbon skeleton containing cyano groups and hydroxy groups bound to the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C37/00—Preparation of compounds having hydroxy or O-metal groups bound to a carbon atom of a six-membered aromatic ring
    • C07C37/68—Purification; separation; Use of additives, e.g. for stabilisation
    • C07C37/70—Purification; separation; Use of additives, e.g. for stabilisation by physical treatment
    • C07C37/82—Purification; separation; Use of additives, e.g. for stabilisation by physical treatment by solid-liquid treatment; by chemisorption
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C39/00—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring
    • C07C39/12—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring polycyclic with no unsaturation outside the aromatic rings
    • C07C39/17—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring polycyclic with no unsaturation outside the aromatic rings containing other rings in addition to the six-membered aromatic rings, e.g. cyclohexylphenol
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C39/00—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring
    • C07C39/23—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring polycyclic, containing six-membered aromatic rings and other rings, with unsaturation outside the aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C39/00—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring
    • C07C39/24—Halogenated derivatives
    • C07C39/42—Halogenated derivatives containing six-membered aromatic rings and other rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C43/00—Ethers; Compounds having groups, groups or groups
    • C07C43/02—Ethers
    • C07C43/03—Ethers having all ether-oxygen atoms bound to acyclic carbon atoms
    • C07C43/14—Unsaturated ethers
    • C07C43/178—Unsaturated ethers containing hydroxy or O-metal groups
    • C07C43/1788—Unsaturated ethers containing hydroxy or O-metal groups containing six-membered aromatic rings and other rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C43/00—Ethers; Compounds having groups, groups or groups
    • C07C43/02—Ethers
    • C07C43/20—Ethers having an ether-oxygen atom bound to a carbon atom of a six-membered aromatic ring
    • C07C43/21—Ethers having an ether-oxygen atom bound to a carbon atom of a six-membered aromatic ring containing rings other than six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C43/00—Ethers; Compounds having groups, groups or groups
    • C07C43/02—Ethers
    • C07C43/20—Ethers having an ether-oxygen atom bound to a carbon atom of a six-membered aromatic ring
    • C07C43/23—Ethers having an ether-oxygen atom bound to a carbon atom of a six-membered aromatic ring containing hydroxy or O-metal groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/27—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by oxidation
    • C07C45/29—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by oxidation of hydroxy groups
    • C07C45/292—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by oxidation of hydroxy groups with chromium derivatives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/44—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reduction and hydrolysis of nitriles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/61—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups
    • C07C45/62—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by hydrogenation of carbon-to-carbon double or triple bonds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/61—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups
    • C07C45/67—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton
    • C07C45/673—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton by change of size of the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/61—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups
    • C07C45/67—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton
    • C07C45/68—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton by increase in the number of carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C45/00—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds
    • C07C45/61—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups
    • C07C45/67—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton
    • C07C45/68—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton by increase in the number of carbon atoms
    • C07C45/70—Preparation of compounds having >C = O groups bound only to carbon or hydrogen atoms; Preparation of chelates of such compounds by reactions not involving the formation of >C = O groups by isomerisation; by change of size of the carbon skeleton by increase in the number of carbon atoms by reaction with functional groups containing oxygen only in singly bound form
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C47/00—Compounds having —CHO groups
    • C07C47/20—Unsaturated compounds having —CHO groups bound to acyclic carbon atoms
    • C07C47/277—Unsaturated compounds having —CHO groups bound to acyclic carbon atoms containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C47/00—Compounds having —CHO groups
    • C07C47/52—Compounds having —CHO groups bound to carbon atoms of six—membered aromatic rings
    • C07C47/56—Compounds having —CHO groups bound to carbon atoms of six—membered aromatic rings containing hydroxy groups
    • C07C47/57—Compounds having —CHO groups bound to carbon atoms of six—membered aromatic rings containing hydroxy groups polycyclic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C47/00—Compounds having —CHO groups
    • C07C47/52—Compounds having —CHO groups bound to carbon atoms of six—membered aromatic rings
    • C07C47/575—Compounds having —CHO groups bound to carbon atoms of six—membered aromatic rings containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/527—Unsaturated compounds containing keto groups bound to rings other than six-membered aromatic rings
    • C07C49/577—Unsaturated compounds containing keto groups bound to rings other than six-membered aromatic rings containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
    • C07C49/753—Unsaturated compounds containing a keto groups being part of a ring containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
    • C07C49/753—Unsaturated compounds containing a keto groups being part of a ring containing ether groups, groups, groups, or groups
    • C07C49/755—Unsaturated compounds containing a keto groups being part of a ring containing ether groups, groups, groups, or groups a keto group being part of a condensed ring system with two or three rings, at least one ring being a six-membered aromatic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/76—Ketones containing a keto group bound to a six-membered aromatic ring
    • C07C49/82—Ketones containing a keto group bound to a six-membered aromatic ring containing hydroxy groups
    • C07C49/83—Ketones containing a keto group bound to a six-membered aromatic ring containing hydroxy groups polycyclic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/76—Ketones containing a keto group bound to a six-membered aromatic ring
    • C07C49/84—Ketones containing a keto group bound to a six-membered aromatic ring containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/74—Esters of carboxylic acids having an esterified carboxyl group bound to a carbon atom of a ring other than a six-membered aromatic ring
    • C07C69/757—Esters of carboxylic acids having an esterified carboxyl group bound to a carbon atom of a ring other than a six-membered aromatic ring having any of the groups OH, O—metal, —CHO, keto, ether, acyloxy, groups, groups, or in the acid moiety
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/76—Esters of carboxylic acids having a carboxyl group bound to a carbon atom of a six-membered aromatic ring
    • C07C69/94—Esters of carboxylic acids having a carboxyl group bound to a carbon atom of a six-membered aromatic ring of polycyclic hydroxy carboxylic acids, the hydroxy groups and the carboxyl groups of which are bound to carbon atoms of six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
    • C07D295/08—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by singly bound oxygen or sulfur atoms
    • C07D295/096—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by singly bound oxygen or sulfur atoms with the ring nitrogen atoms and the oxygen or sulfur atoms separated by carbocyclic rings or by carbon chains interrupted by carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
    • C07D295/16—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
    • C07D295/18—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carboxylic acids, or sulfur or nitrogen analogues thereof
    • C07D295/182—Radicals derived from carboxylic acids
    • C07D295/185—Radicals derived from carboxylic acids from aliphatic carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
    • C07D307/77—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D307/92—Naphthofurans; Hydrogenated naphthofurans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/78—Ring systems having three or more relevant rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
    • C07B2200/07—Optical isomers
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2603/00—Systems containing at least three condensed rings
    • C07C2603/02—Ortho- or ortho- and peri-condensed systems
    • C07C2603/04—Ortho- or ortho- and peri-condensed systems containing three rings
    • C07C2603/06—Ortho- or ortho- and peri-condensed systems containing three rings containing at least one ring with less than six ring members
    • C07C2603/10—Ortho- or ortho- and peri-condensed systems containing three rings containing at least one ring with less than six ring members containing five-membered rings
    • C07C2603/12—Ortho- or ortho- and peri-condensed systems containing three rings containing at least one ring with less than six ring members containing five-membered rings only one five-membered ring
    • C07C2603/16—Benz[e]indenes; Hydrogenated benz[e]indenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2603/00—Systems containing at least three condensed rings
    • C07C2603/02—Ortho- or ortho- and peri-condensed systems
    • C07C2603/04—Ortho- or ortho- and peri-condensed systems containing three rings
    • C07C2603/22—Ortho- or ortho- and peri-condensed systems containing three rings containing only six-membered rings
    • C07C2603/26—Phenanthrenes; Hydrogenated phenanthrenes

Definitions

  • the present invention relates to novel tetralin ER- ⁇ agonist compounds, pharmaceutical compositions thereof, and use of these compounds to treat a ER- ⁇ mediated disease such as benign prostatic hypertrophy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis.
  • a ER- ⁇ mediated disease such as benign prostatic hypertrophy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis.
  • ER estogen receptor
  • ER- ⁇ is cloned from a rat prostatic cDNA library and is present in murine and human prostates. Consequently, the previously known ER is now designated as ER- ⁇ .
  • ER- ⁇ and ER- ⁇ share high amino acid homology, have similar 17- ⁇ Estradiol (E2) binding affinities, and can hetero- or homodimerize to form a signaling complex. See, e.g., Kuiper GG, et al., Endocrinol.
  • 3-Beta, 17-beta-androstanediol is a major metabolite of dihydrotestosterone (DHT), the 5-alpha-reduced active intracellular androgen in male accessory sex organs.
  • DHT dihydrotestosterone
  • ER- ⁇ activation also stimulates increased glutathione S-transferase and quinone reductase expression.
  • These two enzymes have been shown to possess chemoprotective detoxification properties; Chang WY et al., Prostate 40: 115-24 (1999); Montano MM et al., J. Biol. Chem. 273: 25443-9 (1998).
  • ER-selective modulators would similarly possess significant clinical utility. Since ER- ⁇ is strongly expressed in a number of tissues including prostate, bladder, ovary, testis, lung, small intestine, vascular endothelium, and various parts of the brain, compounds that selectively modulate ER- ⁇ have been suggested as being useful in the treatment of a variety of disease conditions, such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis. See e.g., J.
  • ER- ⁇ agonists will display different therapeutic profiles compared to ER- ⁇ antagonists or agonists, and would be preferentially beneficial in tissues relying on ER- ⁇ signaling.
  • the prostate gland produces components that are found in the semen and blood. Some of these are regulatory peptides.
  • the prostate gland comprises stroma and epithelium cells, the latter group consisting of columnar secretory cells and basal non- secretory cells.
  • the proliferation of these basal cells, as well as stroma cells gives rise to benign prostatic hyperplasia (BPH), which is one common prostate disease.
  • BPH benign prostatic hyperplasia
  • Consequences of BPH can include hypertrophy of bladder smooth muscle, decompensated bladder, and increased incidence of urinary tract infection.
  • the development of BPH is considered to be an inescapable phenomenon for the aging male population. BPH is observed in approximately 70% of males over the age of 70.
  • Drag treatment for BPH currently employs alpha andrenergic antagonists for symptomatic relief or steroid 5-alpha reductase inhibitors to reduce hyperplastic tissue bulk. Because these approaches are of limited therapeutic benefit, new therapies are needed.
  • G is -CH 2 -, -CH 2 CH 2 -, -CH 2 C(CH 3 ) 2 - or -O-;
  • R 1 is hydrogen, hydroxy or amino
  • R is hydrogen or hydroxy
  • R 3 is hydrogen, hydroxy, Br, methyl, n-propyl, i-propyl, n-butyl, hydroxymethyl, methoxy, CH 3 CH(OH)-, acetyl, CH 3 OCH 2 -, R 7 C(O)CH 2 CH 2 - Or R 8 CH 2 CH 2 CH 2 -; or R 2 and R 3 form a -CH 2 CH 2 -X-O- biradical, wherein the oxygen radical represents the R 2 end and the methylene radical represents the R 3 end;
  • R 4 is hydrogen, hydroxy, cyano, R 9 -CH 2 -, vinyl, 4-chlorophenyl, carboxy, aminocarbonyl or methoxycarbonyl;
  • R 5 is hydrogen, methyl, ethyl, R 10 -CH 2 -, CH 3 CH(OH)-, acetyl, carboxyl or methoxycarbonyl;
  • R 6 is hydrogen or fluoro
  • R 7 is amino, methylamino, dimethylamino or piperidin-1-yl
  • R is bromo, hydroxy, dimethylamino or methoxy
  • R 9 is bromo, cyano, hydroxy, methoxy or azido
  • R 10 is bromo, hydroxy, cyano, methoxy or pyrrolidin-1-yl; with the provisos that: at least one or R 1 , R 2 , R 3 and R 4 is hydroxy and at least three of R 1 , R 2 , R 3 , R 4 and R 5 are hydrogen and enantiomers thereof.
  • the compound is of Formula Ia:
  • the compound is of formula Ia and G is -CH 2 -
  • the compound is of formula Ia and G is -O-.
  • the compound is of formula Ia and G is -CH 2 -CH 2 -:
  • the compound is of formula Ia and G is -CH 2 C(CH 3 ) 2 -.
  • the compound is of formula Ib:
  • the compound is of formula Ib and R 3 is R 7 C(O)CH 2 CH 2 -.
  • the compound is of formula Ib and R 3 is R 8 CH 2 CH 2 CH 2 - or hydroxymethyl. In another specific embodiment, the compound is of Formula Ic:
  • the compound is of Formula Id:
  • the compound is of Formula Ie:
  • the compound is of Formula If:
  • the compound is of formula Ig:
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising: a compound of Formula I, or pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier, diluent or excipient.
  • the present invention provides a method of treating nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or pharmaceutically acceptable salt thereof.
  • condition being treated is benign prostatic hypertrophy.
  • condition being treated is prostate cancer.
  • the present invention provides a method of treating nocturia, uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy in a patient, comprising: administering to said patient a pharmaceutical composition comprising a compound of Formula I, or pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier, diluent or excipient.
  • condition being treated is benign prostatic hypertrophy.
  • condition being treated is prostate cancer.
  • the present invention provides the use of a compound, or pharmaceutically acceptable salt thereof, of Formula I for the manufacture of a medicament for the treatment of nocturia, uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
  • the medicament is for the treatment of benign prostatic hypertrophy.
  • the medicament is for the treatment of prostate cancer.
  • the present invention provides a method of agonizing ER- ⁇ receptor function, comprising: contacting the receptor with a compound of Formula I, or a pharmaceutically acceptable salt thereof.
  • the present invention provides a method of agonizing ER- ⁇ receptor function in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.
  • the present invention provides a method of treating ER- ⁇ mediated disease condition in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.
  • the condition is nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
  • condition is benign prostatic hypertrophy.
  • the condition is prostate cancer.
  • C 1 -C 4 alkyl refers to a branched or straight chained alkyl radical containing from 1 to 4 carbon atoms, such as methyl (Me), ethyl (Et), n-propyl, isopropyl, n-butyl, isobutyl, sec butyl (s-Bu) or tert-butyl (t-Bu);
  • C 2 -C 4 alkenyl refers to a straight or branched hydrocarbon chain of 2 to 4 carbon atoms with at least one carbon-carbon double bond.
  • C 2 -C 4 alkenyl groups include, but are not limited to, ethenyl (vinyl), propen- 1-yl, propen-2-yl (isoprenyl), propen-3-yl (allyl), 2-methyl ⁇ propen-3-yl, 2-buten-4-yl, 2- methyl-propen-1-yl, and 1-buten-l-yl; c) the term "C 2 -C 4 alkynyl" refers to a straight or branched hydrocarbon chain of 2 to 4 carbon atoms with at least one carbon-carbon triple bond.
  • C 2 -C 4 alkynyl groups include, but are not limited to, ethynyl, propyn-1-yl, propyn-2-yl (isoprynyl), propyn-3-yl, 2-methyl-propyn-3-yl, 2-butyn-4-yl, 2-methyl-propyn-l-yl, and 1-butyn-l-yl; d) the terms “halo” and “halide” refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom; e) the designation " " " ⁇ " refers to a bond for which the stereochemistry is not designated; f) the designation " ""* " refers to a bond that protrudes forward out of the plane of the page; g) the designation " ' refers to a bond that protrudes backward out of the plane of the page; h) as used in the preparations and examples the following terms have the indicated meanings; "ng” refers
  • the terms "effective amount” and "therapeutically effective amount” of a compound of Formula (I) refer to an amount which is effective in controlling diseases and conditions associated with estrogen receptor-beta mediated diseases such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy;
  • controlling diseases is intended to refer to all processes wherein there may be a slowing, interrupting, arresting, or stopping of the progression of the diseases and conditions described herein, but does not necessarily indicate a total elimination of all disease and condition symptoms, but does include prophylactic treatment of the diseases and conditions associated with estrogen receptor-beta mediated diseases such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy; m) the term “pharmaceutically acceptable salts thereof” refers to either an acid addition salt or a basic addition salt; n) the term “pharmaceutically acceptable acid addition salts” is intended to apply to any non-toxic organic or inorganic acid addition salt of the base compounds represented by formula (I).
  • Illustrative inorganic acids that form suitable salts include hydrochloric, hydrobromic, sulphuric, and phosphoric acid and acid metal salts such as sodium monohydrogen orthophosphate, and potassium hydrogen sulfate.
  • Illustrative organic acids that form suitable salts include the mono-, di ⁇ , and tricarboxylic acids.
  • Such acids are for example, acetic, glycolic, lactic, pyruvic, malonic, succinic, glutaric, fumaric, malic, tartaric, citric, ascorbic, maleic, hydroxymaleic, benzoic, hydroxy-benzoic, phenylacetic, cinnamic, salicyclic, 2-phenoxy-benzoic, p- toluenesulfonic acid, and sulfonic acids such as benzenesulfonic acid, methanesulfonic acid, and 2-hydroxyethanesulfonic acid.
  • Such salts can exist in either a hydrated or substantially anhydrous form.
  • the acid addition salts of these compounds are soluble in water and various hydrophilic organic solvents, and which in comparison to their free base forms, generally demonstrate higher melting points.
  • pharmaceutically acceptable basic addition salts is intended to apply to any non-toxic organic or inorganic basic addition salts of the compounds represented by formula (I).
  • Illustrative bases which form suitable salts include alkali metal or alkaline-earth metal hydroxides such as sodium, potassium, calcium, magnesium, or barium hydroxides; ammonia, and aliphatic, alicyclic, or aromatic organic amines such as methylamine, dimethylamine, trimethylamine, and picoline. Either the mono- or di-basic salts can be formed with those compounds.
  • Compounds of Formula I may have one or more asymmetric centers. As a consequence of these chiral centers, the compounds of the present invention occur as racemates and as individual enantiomers, as well as diastereomers and mixtures of diastereomers. AU asymmetric forms, individual isomers and combinations thereof, are within the scope of the present invention.
  • one optical isomer over its enantiomer a number of routes are available.
  • a mixture of enantiomers may be prepared, and then the two enantiomers may be separated.
  • a commonly employed method for the separation of a racemic mixture is the use of chiral high pressure liquid chromatography. Further details regarding resolution of enantiomeric mixtures may be found in J. Jacques, et al., Enantiomers, Racemates, and Resolutions, (1991).
  • Enantiomeric and stereoisomeric mixtures can be resolved into their component enantiomers or stereoisomers by well known methods, such as chiral phase gas chromatography, chiral- phase high performance liquid chromatography, or crystallizing the compound as a chiral salt complex, and resolutions may be performed at any stage or at the end of any step that is advantageous in the schemes below.
  • Enantiomers and stereoisomers can also be obtained from stereomerically- or enantiomerically-pure intermediates, reagents, and catalysts by well known asymmetric synthetic methods.
  • Reaction of A with the phosphonium ylide results in the ⁇ , ⁇ -unsaturated ester, which isomerized under basic conditions to B.
  • Olefin hydrogenation under standard conditions H 2 , Pd on C gives the cis substituted product C.
  • This material (or related acid chloride) is cyclized using standard Friedel-Crafts conditions (Lewis acid) to give the tricyclic tetralone D.
  • This material is subjected to palladium catalyzed aryl coupling conditions to form the 2-aryl-l -tetralone E.
  • Ketone reduction to give alcohol F, followed by dehydration gave olefin G.
  • This material is reduced using catalytic hydrogenation to yield the all cis tetralin H.
  • Demethylation using boron tribromide provides the product bis phenol I.
  • AU products were isolated using techniques well known by those skilled in the art.
  • starting material H' is prepared according to Scheme 1. This material is either brominated to produce Q, or acetylated to produce R. Q is further substituted by conversion to the aryl lithium, followed by reaction with various reactive electrophilic agents, as are known to one skilled in the art. Both Q and R were subjected to various other functional group interconversions, known to those skilled in the art, to produce related compounds. These procedures are described in the experimental section. Intermediates S are demethylated with boron tribromide, as previously described, to produce bis phenol T.
  • starting material E is prepared according to Scheme 1. This material is converted to vinyl triflate U and then converted to ester V via palladium catalyzed carbonylation chemistry. Compound V is hydrogenated using palladium black to give W. The ester functionality in intermediate W is used to provide various substituted analogs X, using chemistry known to one skilled in the art. Final bis phenols Y were prepared using standard boron tribromide deniethylation conditions, as preciously described.
  • Preparation 13 is prepared from preparation 12 in a manner similar to preparation 3.
  • Preparation 15 is prepared from preparation 14 in a manner similar to preparation 6.
  • Preparation 16 is prepared from preparation 15 in a manner similar to preparation 7.
  • Preparation 17 is prepared from preparation 16 in a manner similar to preparation 8.
  • Preparation 18 is prepared from preparation 17 in a manner similar to preparation 9.
  • Preparation 19 is prepared from cyclopentene oxide and l-bromo-3, 5- dimethoxybenzene in a manner similar to preparation 10.
  • Preparation 20 is prepared from preparation 19 in a manner similar to preparation 11.
  • Preparation 21 is prepared from preparation 20 in a manner similar to preparations 1 and 2.
  • Preparation 22 is prepared from preparation 21 in a manner similar to preparation 3.
  • Preparation 23 is prepared from preparation 22 in a manner similar to preparation 14. MS m/z 247 (M+l).
  • Preparation 24 is prepared from preparation 23 in a manner similar to preparation 6. MS m/z 353 (M+l).
  • Preparation 25 is prepared from preparation 24 in a manner similar to preparation 7.
  • Preparation 26
  • Preparation 26 is prepared from preparation 25 in a manner similar to preparation 8. MS m/z 337 (M+l).
  • Preparation 27 is prepared from preparation 26 in a manner similar to preparation 9.
  • 1 H NMR (DMSO): 12.10 (s, IH), 7.25 (t, IH, / 7.9 Hz), 6.80 (m, 3H), 4.00 (m, 3H), 3.74 (s, 3H), 3.46 (m, 2H), 2.82 (m, IH), 1.87 (m, 2H).
  • Preparation 32 is prepared from preparation 31 in a manner similar to preparation 5.
  • TLC Rf O.11 in 2: 1 hexanes:ethyl acetate.
  • Preparation 37 is prepared from preparation 5 and 4-bromo-2-fluoroanisol in a manner similar to preparation 6.
  • TLC Rf O.13 in 6:1 hexanes:ethyl acetate.
  • Preparation 39 Preparation 39
  • 1 H NMR (CDCl 3 ): 7.2 (m, 4H), 6.9 (m, 2H), 6.8 (m, IH), 4.8 (d, IH, 7 9.4 Hz), 3.8 (s, 6H), 3.2 (m, 2H), 2.2 (m, IH), 2.0 (m, IH), 1.9 (m, IH), 1.5 (m, 6H).
  • 1 H NMR (CDCl 3 ): 7.3 (m, 2H), 7.2 (m, IH), 6.9 (m, 2H), 6.7 (m, 2H), 6.4 (d, IH, 7 2.7 Hz), 3.9 (s, 3H), 3.8 (s, 3H), 3.3 (m, IH), 3.2 (m, IH), 2.1 (m, IH), 1.4 (m, 7H).
  • Preparation 55 is prepared from preparation 54 in a manner similar to preparation 1.
  • Preparation 56 is prepared from preparation 55 in a manner similar to preparation 2.
  • Preparation 57 is prepared from preparation 56 in a manner similar to preparation 3.
  • Preparation 58 is prepared from preparation 57 in a manner similar to preparation 4.
  • Preparation 59 is prepared from preparation 58 in a manner similar to preparation 5.
  • Preparation 60 is prepared from preparation 59 in a manner similar to preparation 6.
  • Preparation 61 is prepared from preparation 60 in a manner similar to preparation 7.
  • Preparation 62 is prepared from preparation 61 in a manner similar to preparation 8.
  • Preparation 63 is prepared from preparation 62 in a manner similar to preparation 9.
  • Preparation 69 is prepared from preparation 68 in a manner similar to preparation 4. (3.3g, 91%): 1 H NMR (CDCl 3 ) ⁇ 7.22-7.17 (m, IH), 6.79-6.71 (m, 3H), 3.79 (s, 3H), 2.50-2.22 (m, IH), 1.95-1.77 (m, 2H), 1.67-1.21 (m, 6H), 1.02 (s, 3H), 0.99 (s, 3H), 0.93 (s, IH).
  • Preparation 70 is prepared from preparation 69 in a manner similar to preparation 5. (1.3g, 41%): 1 H NMR (CDCl 3 ) ⁇ 8.01-7.99 (d, IH), 6.83-6.78 (dd, IH), 6.66-6.65 (d, IH), 3.86 (s, 3H), 3.03-2.98 (m, IH), 2.89-2.82 (m, IH), 2.52-2.49 (m, IH), 2.32-2.26 (m, IH), 1.94-1.87 (m, IH), 1.53-1.37 (m, 4H), 1.30-1.24 (m, IH), 1.09 (s, 3H), 0.94 (s, 3H).
  • Preparation 72 is prepared from preparation 71 in a manner similar to preparation 7. (0.8g, 72%): 1 H NMR (CDCl 3 ) 67.51-7.49 (d, IH), 7.12-7.19 (d, 2H), 6.94-6.91 (d, 2H), 6.81-6.78 (dd, IH), 3.83 (s, 3H), 3.81 (s,3H), 3.07-2.98 (m, IH), 1.65-1.49 (m, 7H), 1.43-1.18 (m, 3H), 1.03 (s, 3H), 0.93 (s, 3H).
  • Preparation 73 is prepared from preparation 72 in a manner similar to preparation 8. (0.7g, 92%)%): 1 H NMR (CDCl 3 ) ⁇ 7.33-7.31 (d, 2H), 7.02-6.99 (d, IH), 6.90-6.88 (d, 2H), 6.79 (m, IH), 6.70-6.67 (dd, IH), 6.47 (bs, IH), 3.83 (s, 3H), 3.82 (s, 3H), 3.09-2.99 (m, IH), 1.45-1.25 (m, 3H), 1.06-1.03 (m, 2H), 1.0 (s, 3H), 0.95-.89 (m, 2H), 082 (s 3H).
  • Preparation 74 is prepared from preparation 73 in a manner similar to preparation 9. (0.38g, 54%): 1 H NMR (CDCl 3 ) ⁇ 7.24-7.22 (d,2H), 7.11-7.05 (m, IH), 6.98-6.97 (m, IH), 6.90-6.88 (d, 2H), 6.72-6.69 (dd, IH), 3.82 (s,3H), 3.81 (s, 3H), 3.3-3.26 (m, IH), 2.81-2.75 (m, IH), 1.43-1.17 (m, 6), 1.11-.99 (m, 3H), 0.88 (s, 3H), 0.49 (s, 3H).
  • Preparation 76 is prepared from preparation 75 in a manner similar to preparation 64. (6.6g, 43 mmol)to give the title compound (5.8g, 87%) : 1 H NMR (CDCl 3 ) ⁇ 7.27- 7.24 (m, IH), 6.92-6.84 (m, 4H), 3.81 (s,3H), 2.45 (s, 2H), 2.43-2.42 (d, 2H), 1.11 (s, 6H).
  • Preparation 77 is prepared from preparation 76 in a manner similar to preparation 65. (5.8g, 99%): 1 H NMR (CDCl 3 ) ⁇ 7.27-7.24 (m, IH), 6.82-6.79 (dd, IH), 6.75-6.73 (d, IH), 6.70-6.69 (m, IH), 3.79 (s, 3H),3.53-3.48 (m, IH), 2.37-2.24 (m, 2H), 2.19-2.13 (m, 2H), 1.83-1.69 (m, 2H), 1.11 (s, 3H), 1.00 (s, 3H).
  • Preparation 78 is prepared from preparation 77 in a manner similar to preparation 66. (5.3g, 74%): 1 H NMR (CDCl 3 ) ⁇ 7.24-7.20 (m, IH), 6.77-6.69 (m, 3H), 5.19 (s, IH), 3.77 (s, 3H), 3.58 (s, 3H), 3.47-3.43 (d, IH), 3.28-3.24 (dd, IH), 2.06-2.01 (m, 2H), 1.94- 1.87(m, IH), 1.56-1.51(m, 2H), 1.03 (s, 3H), 0.91 (s, 3H).
  • Preparation 79 is prepared from preparation 78 in a manner similar to preparation 67. (4.8g, 100%): 1 B NMR (CDCl 3 ) 67.20-7.17 (m, IH), 6.76-6.68 (m, 3H), 3.76 (s, 3H), 3.61 (s, 3H), 2.89 (s, 2H), 2.29-2.26 (t, 2H), 1.86 (s, 2H), 1.46-1.43(t, 2H), 0.95 (s, 6H).
  • Preparation 80 is prepared from preparation 79 in a manner similar to preparation 3. (2g, 99%): 1 H NMR (CDCl 3 ) ⁇ 7.21-7.17 (t, IH), 6.83-6.81 (d, IH), 6.79-6.79 (t, IH), 6.75-6.73 (dd, IH), 2.96-2.92 (m, IH), 2.56-2.48 (m, IH), 2.09-2.07 (d, 2H), 1.92-173 (m, 2H), 1.66-1.52 (m, 3H), 1.43-1.39 (m, IH), 1.33-1.26 (m, IH), 1.02 (s, 3H), 1.0 (s, 3H).
  • Preparation 81 is prepared from preparation 80 in a manner similar to preparation 4. (O.95g, 99%): 1 H NMR (CDCl 3 ) 6 7.21-7.17 (t, IH), 6.84-6.82 (d, IH), 6.79-6.78 (t, IH), 676-6.73 (dd, IH), 3.79 (s, 3H), 2.98-2.93 (q, IH), 2.55-2.46 (m, IH), 2.13-2.09 (dd, 2H), 1.93-1.73 (m, 2H), 1.66-1.55 (m, 2H), 1.46-1.41 (m, IH), 1.33-1.27 (m, IH), 1.04 (s, 3H), 1.00 (s, 3H).
  • Preparation 82 is prepared from preparation 81 in a manner similar to preparation 5. (.72g, 81%): 1 H NMR (CDCl 3 ) ⁇ 8.06-8.04 (d, IH), 6.87 (s, IH), 6.84-6.81 (dd, IH), 3.87 (s, 3H), 3.21-3.17 (m, IH), 2.77-2.72 (m, IH), 2.55-2.47 (m, 2H), 2.28-2.22 (m, IH), 1.98-1.88 (m, IH), 1.21-1.13 (m, 4H), 0.98 (s, 3H), 0.79 (s, 3H).
  • Preparation 83 is prepared from preparation 82 in a manner similar to preparation 6. (.43g 49%): 1 H NMR (CDCl 3 ) ⁇ 8.16-8.14 (d, IH), 7.01-6.99 (d, 2H), 6.89-6.86 (m, 2H), 6.80-6.78 (d, 2H), 3.89 (s, 3H), 3.75 (s, 3H), 3.61-3.60 (m, IH), 3.13-3.11 (m, IH), 2.56-2.51 (m, IH), 2.23-2.18 (m, IH), 1.84-1.77 (m, IH), 1.49-1.46 (d, 2H), 1.33-1.21 (m, 2H), 0.98 (s, 3H), 0.82 (s, 3H).
  • Preparation 84 is prepared from preparation 83 in a manner similar to preparation 7. (.34g, 55%): 1 H NMR (CDCl 3 ) ⁇ 7.51-7.49 (d, IH), 7.19-7.17 (d, 2H), 6.93-6.88 (m, 3H), 6.83-6.78 (m, 2H), 4.63-4.59 (m, IH), 3.83 (s, 3H), 3.82 (s, 3H), 2.90-2.85 (m, IH), 2.78-2.73 (m, IH), 2.43-2.40 (m,lH), 2.04-1.96 (m, IH), 1.52-1.45 (m, 2H), 1.38-1.34 (m, 2H), 1.26-1.24 (m, 2H), 0.82 (s, 3H), 0.79 (s,3H).
  • Preparation 85 is prepared from preparation 84 in a manner similar to preparation 8. (.3g 93%): 1 H NMR (CDCl 3 ) ⁇ 7.49-7.46 (d, 2H), 7.05-7.03 (d, IH), 6.89-6.86 (m, 3H) 6.69-6.66 (m, 2H), 3.80 (s, 3H), 3.79 (s, 3H), 3.15-3.12 (m, IH), 2.98-2.92 (m, IH), 2.33-2.28 (m, IH), 2.0-1.92 (m, Ih), 1.47-1.39 (m, 2H), 1.23-1.12 (M, 2H), 1.04 (s, 3H), 0.74 (s, 3H).
  • Preparation 86 is prepared from preparation 85 in a manner similar to preparation 9. (.3g, 99%): 1 H NMR (CDCl 3 ) ⁇ 7.17-7.15 (d, 2H), 7.03-7.01 (d, IH), 6.88-6.87 (m, IH), 6.83-6.81 (d, 2H), 6.80-6.65 (dd, IH), 3.75 (s, 3H), 3.74 (s, 3H), 3.10-3.08 (m, 3H), 2.83-2.76 (m, IH), 2.24-2.16 (m, 2H), 1.91-1.83 (m, IH), 1.04-1.0 (m, 2H), 0.94-0.80 (m, 2H), 0.76 (s, 3H), 0.66 (s, 3H).
  • Preparation 93 is prepared from preparation 92 in a manner similar to preparation 5. (0.9g, 97%): 1 H NMR (CDCl 3 ) ⁇ 6.99-6.96 (d, IH), 6.78-6.76 (d, IH), 3.84 (s, 3H), 3.82 (s, 3H), 3.41-3.35 (q, IH), 2.73-2.65 (m, IH), 2.6-2.46 (m, 2H), 2.44-2.36 (m, IH), 1.97-1.88 (m, IH), 1.85-1.69 (m, 2H), 1.55-1.47 (m, IH).
  • Preparation 94 is prepared from preparation 93 in a manner similar to preparation 71. (0.79g, 61%) : 1 H NMR (CDCl 3 ) ⁇ 7.08-7.06 (d, 2H), 6.97-6.95 (d, IH), 6.87-6.85 (d, 2H), 6.77-6.75 (d, IH), 3.83 (s, 3H), 3.79 (s, IH), 3.72-3.69 (d, IH), 3.54-3.48 (q, IH), 2.93-2.86 (m, IH), 2.56-2.47 ((m, IH), 1.85-1.58 (m, 4H), 1.5-1.4 (m, IH).
  • Preparation 95 is prepared from preparation 94 in a manner similar to preparation 7. (0.57g, 72%) : 1 H NMR (CDCl 3 ) ⁇ 7.30-7.23 (m, 2H), 6.92-6.89 (m, 2H), 6.78-6.68 (m, 2H), 4.97-4.95 (m, IH), 4.03-3.98 (m, IH), 3.82 (s, 3H), 3.81 (s, 3H), 3.78 (s, 3H), 3.34-3.28 (m, IH), 3.0-2.93 (m, IH), 2.78-2.66 (m, IH), 2.50-2.38 (m, 2H), 1.83-1.76 (m, IH), 1.68-1.62 (m, 2H), 1.43-1.36 (m, IH).
  • Preparation 96 is prepared from preparation 95 in a manner similar to preparation 8. (0.2Og, 37%): 1 H NMR (CDCl 3 ) ⁇ 7.41-7.39 (d, 2H), 6.92-6.87 (m, 3H), 6.67-6.66 (d, 2H), 3.83 (s, 3H), 3.82 (s, 3H), 3.79 (s, 3H), 3.48-3.46 (m, 2H), 2.89-2.22 (m, IH), 2.14- 2.06 (m, IH), 1.67-1.60 (m, IH), 1.53-1.42 (m, 4H).
  • Preparation 97 is prepared from preparation 96 in a manner similar to preparation 9. (0.19g, 94%): 1 H NMR (CDCl 3 ) ⁇ 7.24-07.22 (d, 2H), 6.88-6.85 (d, 2H), 6.66-6.65 (d, 2H), 3.81 (s, 3H), 3.80 (s, 3H), 3.78 (s, 3H), 3.62-3.56 (m, IH), 3.13-3.08 (m, IH), 3.02- 2.97 (m, IH), 2.71-2.64 (m, IH), 2.60-2.52 (m, IH), 2.40-2.33 (m, IH), 1.53-1.23 (m, 5H).
  • Preparation 98 Preparation 98
  • Preparation 99 is prepared from preparation 98 in a manner similar to preparations 7 and 8.
  • 1 H NMR (CDCl 3 ): 7.43 (m, 2H), 6.9 (d, J 8.8 Hz, 2H), 6.85 (m, IH), 6.45(m, IH), 6.2 ( s, IH), 3.83 (s, 3H), 3.8 (m, 3H), 3.4-3 (m, IH), 2.2-1.95 (m, 3H), 1.7-1.4 (m, 4H).
  • Preparation 100 is prepared from preparation 99 in a manner similar to preparation 9.
  • Trifluoromethanesulfonic acid 8-methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b- hexahydro-lH-cyclopenta[a]naphthalen-6-yl ester
  • Preparation 106 is prepared from cyclohexene oxide and l-bromo-3,5- dimethoxybenzene in a manner similar to preparation 10.
  • Preparation 107 is prepared from preparation 106 in a manner similar to preparation 11.
  • Preparation 108 is prepared from preparation 107 in a manner similar to preparations 1 and 2.
  • Preparation 109 is prepared from preparation 108 in a manner similar to preparation 3.
  • Preparation 110 is prepared from preparation 109 in a manner similar to preparation 5. MS m/z 261 (M+ 1).
  • Preparation 111 is prepared from preparation 110 in a manner similar to preparation 6. MS m/z 367 (M+ 1).
  • Preparation 112 is prepared from preparation 111 in a manner similar to preparation 98. MS m/z 353 (M+l).
  • Preparation 113 is prepared from preparation 112 in a manner similar to preparation 7. MS m/z 353 (M-I).
  • Preparation 114 is prepared from preparation 113 in a manner similar to preparation 8. MS m/z 335 (M-I).
  • Preparation 115 is prepared from preparation 114 in a manner similar to preparation 9. MS m/z 337 (M-I).
  • Trifluoro-methanesulfonic acid 3-methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10- octahydro-phenanthren-1-yl ester
  • Preparation 116 is prepared from preparation 115 in a manner similar to preparation 101.
  • Preparation 117 is prepared from preparation 116 in a manner similar to preparation 103.
  • 1 H NMR (CDCl 3 ): 7.3 (m, 2H), 7.2 (s, IH), 6.93 (d, J 8.4 Hz, 2H), 3.92 (s, 3H), 3.88(s, 3H), 3.85 (s, 3H), 3.5-3.05 (m, 4H), 2.5 (m, IH), 2.05 (m, IH), 1.75 (m, IH), 1.7-1.05 (m, 6H).
  • Preparation 118 is prepared from preparation 117 in a manner similar to preparation 104.
  • 1 H NMR (CDCl 3 ) 7.3 (m, 2H), 6.95 (m, 4H), 4.77 (s, 2H), 3.87 (s, 3H), 3.88(s, 3H), 3.85 (s, 3H), 3.25 (s, IH), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.5 (m, IH), 2.05 (m, IH), 1.8-1.05 (m, 7H).
  • Preparation 119 is prepared from preparation 117 in a manner similar to example 13. MS m/z 365 (M-I).
  • Preparation 127 is prepared from preparation 123 in a manner similar to preparation 126.
  • Preparation 128 is prepared from preparation 124 in a manner similar to example 18. MS m/z 363(M+1).
  • Preparation 130 is prepared from preparation 123, using dimethylformamide as the electrophile, in a manner similar to preparation 126. MS m/z 351 (M+l).
  • Preparation 132 is prepared from preparation 131 in a manner similar to preparation 129.
  • Methanesulfonic acid 9-(4-methanesulfonyloxy-phenyl)-2-(3-methanesulfonyloxy- propyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yI ester
  • Methanesulfonic acid 9-(4-methanesulfonyloxy-phenyl)-2-(3-methoxy-propyl)- 4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yl ester
  • Preparation 134 is prepared in a manner similar to Example 16. MS m/z 523 (M+l).
  • Preparation 136 is prepared from preparation 135 in a manner similar to Example 1. MS m/z 337 (M-I). Preparation 137
  • Preparation 137 is prepared from preparation 130 in a manner similar to Example 1. MS m/z 321 (M-I).
  • Trifluoro-methanesulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,10a- hexahydro-phenanthren-9-yl ester
  • Example 2 is prepared from preparation 18 in a manner similar to example 1.
  • Example 2 Separate example 2 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 3
  • Example 3 is prepared from preparation 27 in a manner similar to example 1.
  • example 3 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 4 Separate example 4 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 5 P-CS-Fluoro ⁇ -hydroxy-phenyO- ⁇ jSyojT ⁇ S ⁇ a ⁇ jlO-octahydro-phenanthren-S-ol
  • Example 5 is prepared from preparation 40 in a manner similar to example 1.
  • Example 6 is prepared from preparation 53 in a manner similar to example 1.
  • example 6 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 7 is prepared from preparation 63 in a manner similar to example 1.
  • example 7 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 9 9-(4-Hydroxy-phenyl)-7,7-dimethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
  • example 9 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 10 is prepared from preparation 97 in a manner similar to example 1. (0.067g, 40%): 1 H NMR (CDCl 3 ) ⁇ 7.19-7.17 (d, 2H), 6.82-6.79 (d, 2H), 6.55-6.54 (d, 2H), 4.59 (s, IH), 4.37 (s, IH), 3.55-3.49 (m, IH), 3.08-3.02 (m, IH), 2.98-2.93 (m, IH), 2.78-2.71 (m, IH), 2.65-2.57 (m, IH), 2.43-2.35 (m, IH), 1.48-1.25 (m, 5H).
  • Example 10 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 11 is prepared from preparation 102 in a manner similar to Example 1.
  • Example 12 is prepared from preparation 103 in a manner similar to Example 1.
  • Example 19 is prepared from preparation 115 in a manner similar to Example 1.
  • example 19 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 20 is prepared from preparation 118 in a manner similar to example 14. MS m/z 387, 385 (M + ).
  • example 20 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 21 is prepared from example 20 in a manner similar to example 16.
  • example 21 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 22 is prepared from preparation 117 in a manner similar to example 1.
  • example 22 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 23 is prepared from example 22 in a manner similar to preparation 104.
  • 1 HNMR (DMSO-J 6 ): 9.18 (s, IH), 8.95 (s, IH), 7.14 (d, J 8.8 Hz, 2H), 6.75 (m, 3H), 6.69 (s, IH), 4.45 (m, 2H), 3.15 (m, IH), 3.0 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.9 (m, IH), 1.7-0.9 (m, 7H). MS m/z 323 (M-I).
  • example 23 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 24 is prepared from example 20 in a manner similar to example 15.
  • 1 H NMR (DMSOd 6 ): 9.28 (s, IH), 9.21 (s, IH), 7.16 (d, J 8.4 Hz, 2H), 6.8 (s, IH), 6.74 (m, 3H), 3.97 (s, 2H), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.95 (m, IH), 1.65 (m, IH), 1.55 (m, IH), 1.4 (m, IH), 1.3-0.8 (m, 4H). MSm/z 332 (M- 1).
  • example 24 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 26 is prepared from preparation 121 in a manner similar to example 1.
  • Example 27 is prepared from preparation 123 in a manner similar to example 1.
  • Example 28 l-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yI]- ethanone
  • Example 28 is prepared from preparation 124 in a manner similar to example 1.
  • Example 30 is prepared from preparation 125 in a manner similar to example 1.
  • example 30 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 32 is prepared from preparation 126 in a manner similar to example 1.
  • example 32 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 33 is prepared from preparation 127 in a manner similar to example 1.
  • MS m/z 335 Separate example 33 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 34 is prepared from preparation 129 in a manner similar to example 1.
  • example 34 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 35 is prepared from preparation 132 in a manner similar to example 1.
  • Example 37 is prepared from example 35 in a manner similar to example 36.
  • Example 38 is prepared from example 35 in a manner similar to example 36.
  • Example 38 is prepared from example 35 in a manner similar to example 36.
  • example 40 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Methanesulfonic acid 9-(4-methanesulfonyloxy ⁇ phenyl)-2-(3 ⁇ methoxy- propyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yl ester (0.044g, 0.084 mmol), 5N KOH ( 2Ml), and methanol (2 ml) and heat at 8O 0 C for 2 hours. Remove solvent in vacuo. Add ethyl acetate and 6N HCl. Wash organic layer with water, dry over anhydrous sodium sulfate and remove solvent in vacuo.
  • Example 43 is prepared from Example 40 in a manner similar to Example 1.
  • Example 44 is prepapred from preparation 136 in a manner similar to preparation 104.
  • example 46 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 48
  • Example 49 is prepared from preparation 142 in a manner similar to example 1.
  • Example 50 is prepared from preparation 146 in a manner similar to example 1.
  • example 52 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 56 is prepared from preparation 153 in a manner similar to example 1.
  • Example 58 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
  • Example 59 is prepared from preparation 160 in a manner similar to example 1. (15.8 mg, 49%).
  • the competition ER binding assay is run in a buffer containing 50 mM N-[2- hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid (Hepes) pH 7.5, 1.5 mM EDTA, 150 mM NaCl, 10% glycerol, 1 mg/mL ovalbumin, 5mM DTT, 0.025 ⁇ Ci per well of 3 H- Estradiol (New England Nuclear #NET517 at 118 Ci/mmol, 1 mCi/mL), and 10 ng/well ER- ⁇ or ER- ⁇ Receptor (Pan Vera). Competing compounds are added at 10 different concentrations.
  • Non-specific binding is determined in the presence of 1 ⁇ M of E2 (17- ⁇ Estradiol, Sigma, St. Louis, MO).
  • the binding reaction (140 ⁇ L) is incubated for 4 hours at room temperature, then 70 ⁇ L of cold dextran coated charcoal (DCC) buffer is added to each reaction (DCC buffer is prepared by adding 0.75g of charcoal [Sigma] and 0.25g of dextran [Pharmacia] per 50 mL of assay buffer).
  • DCC buffer is prepared by adding 0.75g of charcoal [Sigma] and 0.25g of dextran [Pharmacia] per 50 mL of assay buffer).
  • the incubation plates are mixed for 8 minutes on an orbital shaker at 4°C and then centrifuged at 3,000 rpm for 10 minutes at 4°C.
  • Preferred compounds bind to the ER- ⁇ receptor with a Kj of less than 20 nM. More preferred compounds bind to the ER- ⁇ receptor with a Kj of less than 1 nM. Compounds that are selective to binding to the ER- ⁇ receptor compared to the ER- ⁇ receptor bind to the ER- ⁇ receptor with a lower Kj compared to the Ki for the ER- ⁇ receptor.
  • the compounds of examples 1-59 exhibit binding affinities (Ki) at the ER- ⁇ subtype in the range approximately 4->1000 nM and to the ER- ⁇ subtype in the range of approximately 0.2-500 nM.
  • the agonist activity of the compounds of the invention can be determined from assay(s) described in Harris, H. A.; Katzenellenbogen, J. A.; Katzenellenbogen, B. S. Endocrinology, 143, p. 4172-4177 (2002).
  • ER- ⁇ agonists are evaluated for their effects on the growth of androgen-sensitive LNCaP human prostatic cancer (PCa) xenografts grown in intact sexually mature (5-6 weeks old) Hsd: Athymic Nude-nu (Athymic Nude) male mice. 2.0x10 ⁇ LNCaP tumor cells are injected bilaterally by the subcutaneous route into the pre-tracheal region of testicular intact male mice. Mice are castrated via the scrotal route to serve as the positive control group. Test compounds are administered once per day by subcutaneous or gavage administration at multiple dose levels in a volume of 0.2 ml to xenograft- bearing mice starting on the day following tumor injection.
  • PCa human prostatic cancer
  • Test compounds are reformulated weekly based on average group mean body weights.
  • the vehicle for these studies is 1% carboxymethyl cellulose (CMC) with 0.25% Tween 80.
  • CMC carboxymethyl cellulose
  • Tween 80 1% Tween 80.
  • Body weights and tumor measurements are recorded on a weekly basis and entered directly into a JMPTM (SAS; Cary, NC) spreadsheet from electronic caliper measurement.
  • Tumor volumes in mm ⁇ are calculated in JMP using the following formula: L x W x H x 0.5236.
  • Tumor and body weight responses for individual mice are recorded on a weekly basis. When LNCaP tumor volumes enter log-phase expansion, lesions are measured every 3-4 days.
  • SAS linear extrapolation model
  • a mouse BPH study is essentially performed as a modified version of the rat BPH study as described earlier (Eur J Endocrinol. 2004 Apr;150(4):591-60313).
  • CD-I male mice are single caged and housed for 1 week and treated with vehicle or compounds at various daily doses, given orally in a 1% Carboxymethylcellulose (CMC) + 0.25% Tween 80 in PBS, pH 6.8 formulation.
  • CMC Carboxymethylcellulose
  • Tween 80 in PBS, pH 6.8 formulation.
  • the animals are sacrificed using CO 2 , followed by blood collection using cardiac puncture. The animals are then subjected to necropsy to collect intact ventral prostate, seminal vesicle and/or testes to measure organ wet weight changes between treatment groups.
  • RNA later TM solution Total RNA is obtained using the RNeasy kit (Qiagen Corp.).
  • Specific Taqman primers for SGP-2 or clusterin, 18S ribosomal RNA (Applied Biosystems, Foster City, CA, Catalog # 4310893E) and smooth muscle myosin heavy chain (derived from Genebank sequence for rat NMJ313607) are used to quantify biomarker changes in these prostate tissues using real time PCR.
  • PCR primers mouse SGP-2 gi 192149 -6 IF CGCAGACCGGACTCCAGAT mouse SGP-2 gi 192149 -121R CCACGCACAGCAGGAGAAT mouse SGP-2 TaqMan " probe: mouse SGP-2 gi 192149 -81T CCAAGGAGGCCACGCCATGAA While the exemplified compounds of the present invention demonstrate significant lowering of ventral prostate weights compared to vehicle control according to this test, preferred compounds demonstrate a significant lowering in prostate weight at doses of 10 mg/kg/day or less.
  • a therapeutically effective amount can be readily determined by the attending diagnostician, as one skilled in the art, by the use of conventional techniques and by observing results obtained under analogous circumstances.
  • the dose a number of factors are considered by the attending diagnostician, including, but not limited to: the species of mammal; its size, age, and general health; the specific disease involved; the degree of or involvement or the severity of the disease; the response of the individual patient; the particular compound administered; the mode of administration; the bioavailability characteristic of the preparation administered; the dose regimen selected; the use of concomitant medication; and other relevant circumstances.
  • a therapeutically effective amount of a compound of Formula I is expected to vary from about 0.001 milligram per kilogram of body weight per day (mg/kg/day) to about 100 mg/kg/day. Preferred amounts can be determined by one skilled in the art.
  • a compound of Formula I can be administered in any form or mode which makes the compound bioavailable in a therapeutically effective amount, including oral, inhalation, and parenteral routes.
  • compounds of Formula I can be administered orally, by inhalation of an aerosol or dry powder, subcutaneously, intramuscularly, intravenously, transdermally, intranasally, rectally, topically, and the like.
  • Oral or inhalation administration is generally preferred for treatment of respiratory diseases, e.g. asthma.
  • the compounds of the present invention can be administered alone or in the form of a pharmaceutical composition in combination with pharmaceutically acceptable carriers or excipients, the proportion and nature of which are determined by the solubility and chemical properties of the compound selected, the chosen route of administration, and standard pharmaceutical practice.
  • the compounds of the present invention while effective themselves, may be formulated and administered in the form of their pharmaceutically acceptable salts, such as acid addition salts or base addition salts, for purposes of stability, convenience of crystallization, increased solubility and the like.
  • compositions of the compounds of Formula I are prepared in a manner well known in the pharmaceutical art.
  • the carrier or excipient may be a solid, semi-solid, or liquid material, which can serve as a vehicle or medium for the active ingredient. Suitable carriers or excipients are well known in the art.
  • the pharmaceutical composition may be adapted for oral, inhalation, parenteral, or topical use and may be administered to the patient in the form of tablets, capsules, aerosols, inhalants, suppositories, solution, suspensions, or the like.
  • the compounds of the present invention may be administered orally, for example, with an inert diluent or with an edible carrier. They may be enclosed in gelatin capsules or compressed into tablets.
  • the compounds may be incorporated with excipients and used in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums and the like.
  • These preparations typically contain at least 4% of the compound of the present invention, the active ingredient, but may be varied depending upon the particular form and may conveniently be between 4% to about 70% of the weight of the unit.
  • the amount of the compound present in compositions is such that a suitable dosage will be obtained.
  • Preferred compositions and preparations according to the present invention may be determined by someone skilled in the art.
  • the tablets, pills, capsules, troches and the like may also contain one or more of the following adjuvants: binders such as microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch or lactose, disintegrating agents such as alginic acid, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; and sweetening agents such as sucrose or saccharin may be added or a flavoring agent such as peppermint, methyl salicylate or orange flavoring.
  • a liquid carrier such as polyethylene glycol or a fatty oil.
  • dosage unit forms may contain other various materials that modify the physical form of the dosage unit, for example, as coatings.
  • tablets or pills may be coated with sugar, shellac, or other enteric coating agents.
  • a syrup may contain, in addition to the present compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors. Materials used in preparing these various compositions should be pharmaceutically pure and non-toxic in the amounts used.
  • the compounds of the present invention may be incorporated into a solution or suspension. These preparations should contain at least 0.1 % of a compound of the invention, but may be varied to be between 0.1 and about 50% of the weight thereof. The amount of the compound of Formula I present in such compositions is such that a suitable dosage will be obtained. Preferred compositions and preparations can be determined by one of ordinary skill in the art.
  • the compounds of the present invention may also be administered by inhalation, such as by aerosol or dry powder. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the compounds of the present invention or a formulation thereof. Formulations for administration by inhalation of compounds of formula (I) may be delivered in single phase, bi-phasic, or tri-phasic systems. A variety of systems are available for the administration by aerosols of the compounds of formula (I). Dry powder formulations are prepared by either pelletizing or milling the compound of formula (I) to a suitable particle size or by admixing the pelletized or milled compound of formula (I) with a suitable carrier material, such as lactose and the like. Delivery by inhalation includes the necessary container, activators, valves, subcontainers, and the like. Preferred aerosols and dry powder formulations for administration by inhalation can be determined by one skilled in the art.
  • the compounds of the present invention may also be administered topically, and when done so the carrier may suitably comprise a solution, ointment or gel base.
  • the base for example, may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, bee wax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers.
  • Topical formulations may contain a concentration of the Formula I or its pharmaceutical salt from about 0.1 to about 10% w/v (weight per unit volume).
  • the solutions or suspensions may also include one or more of the following adjuvants: sterile diluents such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylene diaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

The present invention relates to novel tetralin ER-β agonist compounds, pharmaceutical compositions thereof, and use of these compounds to treat a ER-β mediated disease such as nocturia, obstructive uropathy, benign prostatic hypertrophy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis.

Description

SUBSTITUTED TETRALINS AS SELECTIVE ESTROGEN RECEPTOR-BETA AGONISTS
BACKGROUND QF THE INVENTION
The present invention relates to novel tetralin ER- β agonist compounds, pharmaceutical compositions thereof, and use of these compounds to treat a ER-β mediated disease such as benign prostatic hypertrophy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis.
Estrogens play important roles in the development and homeostasis of the reproductive, central nervous, skeletal, and cardiovascular systems of both males and females. Recently, a new estogen receptor ("ER") isoform, ER-β is cloned from a rat prostatic cDNA library and is present in murine and human prostates. Consequently, the previously known ER is now designated as ER-α. ER-α and ER-β share high amino acid homology, have similar 17-β Estradiol (E2) binding affinities, and can hetero- or homodimerize to form a signaling complex. See, e.g., Kuiper GG, et al., Endocrinol. 138: 863-70 (1997); and Kuiper GG et al., Proc. Natl. Acad. Sci. USA 93: 5925-30 (1996). Although E2 activates both ER-α and ER-β, tissue distribution and functional differences between the two have been noted, making subtype selective ligands more attractive for various disease targets. Interestingly, 3-beta, 17-beta-androstanediol and 5-alpha- androstane have been proposed to be endogenous ligands for ER-β. See e.g., Weihua Z. et al. PNAS 98: 6330-5 (2001). 3-Beta, 17-beta-androstanediol is a major metabolite of dihydrotestosterone (DHT), the 5-alpha-reduced active intracellular androgen in male accessory sex organs. ER-β activation also stimulates increased glutathione S-transferase and quinone reductase expression. These two enzymes have been shown to possess chemoprotective detoxification properties; Chang WY et al., Prostate 40: 115-24 (1999); Montano MM et al., J. Biol. Chem. 273: 25443-9 (1998).
With the recent identification of ER-β, and the recognition that ER-α and ER-β have different biological roles, ER-selective modulators would similarly possess significant clinical utility. Since ER-β is strongly expressed in a number of tissues including prostate, bladder, ovary, testis, lung, small intestine, vascular endothelium, and various parts of the brain, compounds that selectively modulate ER-β have been suggested as being useful in the treatment of a variety of disease conditions, such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, and arthritis. See e.g., J. Gustafsson, TIPS, 24 (9), p 479-485 (2003); and Endocrinology, 144, p. 4241-4249 (2003). Selective compounds should have minimal effect on tissues that contain ER-α, and thus exhibit different side-effect profiles. Thus, ER-β agonists will display different therapeutic profiles compared to ER-α antagonists or agonists, and would be preferentially beneficial in tissues relying on ER-β signaling.
The prostate gland produces components that are found in the semen and blood. Some of these are regulatory peptides. The prostate gland comprises stroma and epithelium cells, the latter group consisting of columnar secretory cells and basal non- secretory cells. The proliferation of these basal cells, as well as stroma cells gives rise to benign prostatic hyperplasia (BPH), which is one common prostate disease. BPH is a progressive condition that is characterized by the nodular enlargement of the prostatic tissue resulting in obstruction of the urethra. This results in increased frequency of urination, noncuria, poor urine stream, and hesitation or delay in starting the urine flow. Consequences of BPH can include hypertrophy of bladder smooth muscle, decompensated bladder, and increased incidence of urinary tract infection. The development of BPH is considered to be an inescapable phenomenon for the aging male population. BPH is observed in approximately 70% of males over the age of 70. Drag treatment for BPH currently employs alpha andrenergic antagonists for symptomatic relief or steroid 5-alpha reductase inhibitors to reduce hyperplastic tissue bulk. Because these approaches are of limited therapeutic benefit, new therapies are needed. BRIEF SUMMARY OF THE INVENTION In a 1st embodiment, the present invention provides a compound of Formula I:
Figure imgf000004_0001
Formula I wherein:
G is -CH2-, -CH2CH2-, -CH2C(CH3)2- or -O-;
R1 is hydrogen, hydroxy or amino;
R is hydrogen or hydroxy;
R3 is hydrogen, hydroxy, Br, methyl, n-propyl, i-propyl, n-butyl, hydroxymethyl, methoxy, CH3CH(OH)-, acetyl, CH3OCH2-, R7C(O)CH2CH2- Or R8CH2CH2CH2-; or R2 and R3 form a -CH2CH2-X-O- biradical, wherein the oxygen radical represents the R2 end and the methylene radical represents the R3 end;
X is -C(O)- or -CC=CH2)-;
R4 is hydrogen, hydroxy, cyano, R9-CH2-, vinyl, 4-chlorophenyl, carboxy, aminocarbonyl or methoxycarbonyl;
R5 is hydrogen, methyl, ethyl, R10-CH2-, CH3CH(OH)-, acetyl, carboxyl or methoxycarbonyl;
R6 is hydrogen or fluoro;
R7 is amino, methylamino, dimethylamino or piperidin-1-yl;
R is bromo, hydroxy, dimethylamino or methoxy;
R9 is bromo, cyano, hydroxy, methoxy or azido;
R10 is bromo, hydroxy, cyano, methoxy or pyrrolidin-1-yl; with the provisos that: at least one or R1, R2, R3 and R4 is hydroxy and at least three of R1, R2, R3, R4 and R5 are hydrogen and enantiomers thereof. A-
In a specific embodiment, the compound is of Formula Ia:
Figure imgf000005_0001
and enantiomers thereof.
In another specific embodiment, the compound is of formula Ia and G is -CH2-
In another specific embodiment, the compound is of formula Ia and G is -O-.
In another specific embodiment, the compound is of formula Ia and G is -CH2-CH2-:
In another specific embodiment, the compound is of formula Ia and G is -CH2C(CH3)2-.
In another specific embodiment, the compound is of formula Ib:
Figure imgf000005_0002
Formula Ib
and enantiomers thereof.
In another specific embodiment, the compound is of formula Ib and R3 is R7C(O)CH2CH2-.
In another specific embodiment, the compound is of formula Ib and R3 is R8CH2CH2CH2- or hydroxymethyl. In another specific embodiment, the compound is of Formula Ic:
Figure imgf000006_0001
Formula Ic and enantiomers thereof.
In another specific embodiment, the compound is of Formula Id:
Figure imgf000006_0002
Formula Id and enantiomers thereof.
In another specific embodiment, the compound is of Formula Ie:
Figure imgf000006_0003
Formula Ie and enantiomers thereof.
In another specific embodiment, the compound is of Formula If:
Figure imgf000007_0001
Formula If and enantiomers thereof.
In another specific embodiment, the compound is of formula Ig:
Figure imgf000007_0002
Formula Ig and enantiomers thereof.
In a 2nd embodiment, the present invention provides a pharmaceutical composition comprising: a compound of Formula I, or pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier, diluent or excipient.
In a 3rd embodiment, the present invention provides a method of treating nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or pharmaceutically acceptable salt thereof.
In a specific embodiment, the condition being treated is benign prostatic hypertrophy.
In another specific embodiment, the condition being treated is prostate cancer.
In a 4th embodiment, the present invention provides a method of treating nocturia, uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy in a patient, comprising: administering to said patient a pharmaceutical composition comprising a compound of Formula I, or pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable carrier, diluent or excipient.
In a specific embodiment, the condition being treated is benign prostatic hypertrophy.
In another specific embodiment, the condition being treated is prostate cancer.
In a 5th embodiment, the present invention provides the use of a compound, or pharmaceutically acceptable salt thereof, of Formula I for the manufacture of a medicament for the treatment of nocturia, uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
In a specific embodiment, the medicament is for the treatment of benign prostatic hypertrophy.
In another specific embodiment, the medicament is for the treatment of prostate cancer.
In a 6th embodiment, the present invention provides a method of agonizing ER-β receptor function, comprising: contacting the receptor with a compound of Formula I, or a pharmaceutically acceptable salt thereof.
In a 7th embodiment, the present invention provides a method of agonizing ER-β receptor function in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. In an 8th embodiment, the present invention provides a method of treating ER-β mediated disease condition in a patient, comprising: administering to said patient an effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.
In a specific embodiment, the condition is nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
In another specific embodiment, the condition is benign prostatic hypertrophy.
In another specific embodiment, the condition is prostate cancer.
DETAILED DESCRIPTION OF THE INVENTION As used herein: a) the term "C1-C4 alkyl" refers to a branched or straight chained alkyl radical containing from 1 to 4 carbon atoms, such as methyl (Me), ethyl (Et), n-propyl, isopropyl, n-butyl, isobutyl, sec butyl (s-Bu) or tert-butyl (t-Bu); b) the term "C2-C4 alkenyl" refers to a straight or branched hydrocarbon chain of 2 to 4 carbon atoms with at least one carbon-carbon double bond. Examples of C2-C4 alkenyl groups include, but are not limited to, ethenyl (vinyl), propen- 1-yl, propen-2-yl (isoprenyl), propen-3-yl (allyl), 2-methyl~propen-3-yl, 2-buten-4-yl, 2- methyl-propen-1-yl, and 1-buten-l-yl; c) the term "C2-C4 alkynyl" refers to a straight or branched hydrocarbon chain of 2 to 4 carbon atoms with at least one carbon-carbon triple bond. Examples of C2-C4 alkynyl groups include, but are not limited to, ethynyl, propyn-1-yl, propyn-2-yl (isoprynyl), propyn-3-yl, 2-methyl-propyn-3-yl, 2-butyn-4-yl, 2-methyl-propyn-l-yl, and 1-butyn-l-yl; d) the terms "halo" and "halide" refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom; e) the designation " "ΛΛΛ " refers to a bond for which the stereochemistry is not designated; f) the designation " ""* " refers to a bond that protrudes forward out of the plane of the page; g) the designation " ' refers to a bond that protrudes backward out of the plane of the page; h) as used in the preparations and examples the following terms have the indicated meanings; "ng" refers to nanograms; "μg" refers to micrograms; "mg" refers to milligrams; "g" refers to grams; "kg" refers to kilograms; "nmole" refers to nanomoles; "mmol" refers to millimoles; "mol" refers to moles; "μL" refers to microliters; "mL" refers to milliliters; "L" refers to liters; "Rf " refers to retention factor; "0C." refers to degrees Celsius; "bp" refers to boiling point; "mm of Hg" refers to pressure in millimeters of mercury; "mp" refers to melting point; "dec" refers to decomposition; "[α]2 D°" refer to specific rotation of the D line of sodium at 20°C obtained in a 1 decimeter cell; "c" refers to concentration in g/niL; "nM" refers to nanomolar; "μM" refers to micromolar; "mM" refers to millimolar; "M" refers to molar; "IQ" refers to inhibiton constant; "Kd" refers to dissociation constant; "psi" refers to pounds per square inch; "rpm" refers to revolutions per minute; "HPLC" refers to high performance liquid chromatography; "HRMS" refers to high resolution mass spectrum; "MS" refers to mass spectrum; "tetrahydrofuran" refers to tetrahydrofuran; "brine" refers to a saturated aqueous solution of sodium chloride; "L.O.D." refers to loss on drying; "μCi" refers to microcuries; "i.p." refers to intraperitoneally; "i.v." refers to intravenously; "DPM" refers to disintegrations per minute; DMSO refers to dimethylsulfoxide; ethyl acetate refers to ethyl acetate; "TLC" refers to thin layer chromatography, DMF refers to dimethylformamide; "DMSO" refers to dimethylsulfoxide; the term "enantiomeric excess" or "ee" refers to the percent by which one enantiomer, El, is in excess in a mixture of the two enantiomers, El plus E2, such that {(El-E2)÷(El+E2)}xl00=ee; j) the term "patient" refers to a warm blooded animal such as a mammal that is afflicted with a particular estrogen receptor-beta mediated disease. It is understood that guinea pigs, dogs, cats, rats, mice, horses, cattle, sheep, and humans are examples of animals within the scope of the meaning of the term; k) the terms "effective amount" and "therapeutically effective amount" of a compound of Formula (I) refer to an amount which is effective in controlling diseases and conditions associated with estrogen receptor-beta mediated diseases such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy;
1) the term "controlling diseases" is intended to refer to all processes wherein there may be a slowing, interrupting, arresting, or stopping of the progression of the diseases and conditions described herein, but does not necessarily indicate a total elimination of all disease and condition symptoms, but does include prophylactic treatment of the diseases and conditions associated with estrogen receptor-beta mediated diseases such as obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis or benign prostatic hypertrophy; m) the term "pharmaceutically acceptable salts thereof" refers to either an acid addition salt or a basic addition salt; n) the term "pharmaceutically acceptable acid addition salts" is intended to apply to any non-toxic organic or inorganic acid addition salt of the base compounds represented by formula (I). Illustrative inorganic acids that form suitable salts include hydrochloric, hydrobromic, sulphuric, and phosphoric acid and acid metal salts such as sodium monohydrogen orthophosphate, and potassium hydrogen sulfate. Illustrative organic acids that form suitable salts include the mono-, di~, and tricarboxylic acids. Illustrative of such acids are for example, acetic, glycolic, lactic, pyruvic, malonic, succinic, glutaric, fumaric, malic, tartaric, citric, ascorbic, maleic, hydroxymaleic, benzoic, hydroxy-benzoic, phenylacetic, cinnamic, salicyclic, 2-phenoxy-benzoic, p- toluenesulfonic acid, and sulfonic acids such as benzenesulfonic acid, methanesulfonic acid, and 2-hydroxyethanesulfonic acid. Such salts can exist in either a hydrated or substantially anhydrous form. In general, the acid addition salts of these compounds are soluble in water and various hydrophilic organic solvents, and which in comparison to their free base forms, generally demonstrate higher melting points. o) the term "pharmaceutically acceptable basic addition salts" is intended to apply to any non-toxic organic or inorganic basic addition salts of the compounds represented by formula (I). Illustrative bases which form suitable salts include alkali metal or alkaline-earth metal hydroxides such as sodium, potassium, calcium, magnesium, or barium hydroxides; ammonia, and aliphatic, alicyclic, or aromatic organic amines such as methylamine, dimethylamine, trimethylamine, and picoline. Either the mono- or di-basic salts can be formed with those compounds.
Compounds of Formula I may have one or more asymmetric centers. As a consequence of these chiral centers, the compounds of the present invention occur as racemates and as individual enantiomers, as well as diastereomers and mixtures of diastereomers. AU asymmetric forms, individual isomers and combinations thereof, are within the scope of the present invention.
In order to preferentially prepare one optical isomer over its enantiomer, a number of routes are available. As an example, a mixture of enantiomers may be prepared, and then the two enantiomers may be separated. A commonly employed method for the separation of a racemic mixture is the use of chiral high pressure liquid chromatography. Further details regarding resolution of enantiomeric mixtures may be found in J. Jacques, et al., Enantiomers, Racemates, and Resolutions, (1991).
Reaction Schemes
Compounds of Formula I, and intermediates thereof, can be prepared as described in Reaction Schemes 1-4 below. AU substituents, unless otherwise indicated, are as previously defined. The reagents and starting materials are readily available to one of ordinary skill in the art.
The skilled artisan will appreciate that the present invention contemplates all enantiomers and mixtures of enantiomers and stereoisomers, that is, both the stereomerically pure form (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures. Enantiomeric and stereoisomeric mixtures can be resolved into their component enantiomers or stereoisomers by well known methods, such as chiral phase gas chromatography, chiral- phase high performance liquid chromatography, or crystallizing the compound as a chiral salt complex, and resolutions may be performed at any stage or at the end of any step that is advantageous in the schemes below. Enantiomers and stereoisomers can also be obtained from stereomerically- or enantiomerically-pure intermediates, reagents, and catalysts by well known asymmetric synthetic methods.
Scheme 1
Figure imgf000013_0001
4-bromoanisole
NaOEt
NaBH,, (1-Bu3P)2Pd2Br2
Figure imgf000013_0004
Figure imgf000013_0002
Figure imgf000013_0003
Figure imgf000013_0005
In Scheme 1, starting materials A (G = CH2, CH2CH2, CH2C(CH3)2, O) are purchased or prepared by reaction of the corresponding cyclic epoxide and an appropriate aryl grignard reagent, followed by oxidation of the resulting alcohol, as would be known by one skilled in the art. Reaction of A with the phosphonium ylide results in the α,β-unsaturated ester, which is isomerized under basic conditions to B. Olefin hydrogenation under standard conditions (H2, Pd on C) gives the cis substituted product C. This material (or related acid chloride) is cyclized using standard Friedel-Crafts conditions (Lewis acid) to give the tricyclic tetralone D. This material is subjected to palladium catalyzed aryl coupling conditions to form the 2-aryl-l -tetralone E. Ketone reduction to give alcohol F, followed by dehydration gave olefin G. This material is reduced using catalytic hydrogenation to yield the all cis tetralin H. Demethylation using boron tribromide provides the product bis phenol I. AU products were isolated using techniques well known by those skilled in the art.
Scheme 2
Figure imgf000014_0001
BBr,
Figure imgf000014_0002
O
Figure imgf000014_0003
In Scheme 2, starting material E' is prepared according to Scheme 1, as previously described. Mono-demethylation is accomplished using boron trichloride to give J. Reduction give K, dehydration gives L and hydrogenation gives M, as previously described. Phenol M is converted to the aryl triflate N, which can be used to incorporate various R-substituted intermediates N through the use of palladium catalyzed coupling reactions, as are well known to those skilled in the art. Final bis phenols P are prepared by boron tribromide demethylation, as previously described. In several instances, functional group interconversions, known to those skilled in the art, are performed on intermediates O to prepare related compounds. These are described in the experimental section.
Scheme 3
Figure imgf000015_0001
In Scheme 3, starting material H' is prepared according to Scheme 1. This material is either brominated to produce Q, or acetylated to produce R. Q is further substituted by conversion to the aryl lithium, followed by reaction with various reactive electrophilic agents, as are known to one skilled in the art. Both Q and R were subjected to various other functional group interconversions, known to those skilled in the art, to produce related compounds. These procedures are described in the experimental section. Intermediates S are demethylated with boron tribromide, as previously described, to produce bis phenol T.
Scheme 4
Figure imgf000016_0001
MeOH
EtOAc/AoOH Pd-Black 50°C/100 psi H2
Figure imgf000016_0002
W
In Scheme 4, starting material E" is prepared according to Scheme 1. This material is converted to vinyl triflate U and then converted to ester V via palladium catalyzed carbonylation chemistry. Compound V is hydrogenated using palladium black to give W. The ester functionality in intermediate W is used to provide various substituted analogs X, using chemistry known to one skilled in the art. Final bis phenols Y were prepared using standard boron tribromide deniethylation conditions, as preciously described.
Preparation 1 [2-(3-Methoxy-phenyl)-cyclohexylidene]-acetic acid ethyl ester
Figure imgf000016_0003
Combine 2-(3-methoxyphenyl)-cyclohexanone (5.Og, 24.5 mmol), carbethoxymethylene triphenylphosphorane (15.4g, 44.1 mmol), and toluene (150 mL), stir and heat at reflux. After 22 hours, cool to ambient temperature and concentrate under vacuum. Add ether and filter off the triphenylphosphine oxide precipitate and concentrate the ether filtrate. Flash chromatograph with 0% to 10% ethyl acetate/hexanes to yield the titled compound (6.7 Ig, 99%) as a clear oil. TLC Rf=0.58 in 8:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.25 (m, IH), 6.81-6.79 (m, 3H), 6.73 (s, IH), 5.14 (s, IH), 4.07 (q, J= 14.4, 7.2, 2H), 3.80 (s, 3H), 3.80-3.69 (m, IH), 3.39-3.36 (m, IH), 2.20-2.16 (m, IH), 2.06-2.03 (m, IH), 1.96-1.87 (m, 3H), 1.65-1.54 (m, 2H), 1.2 (t, J= 1.2, 8, 3H).
Preparation 2 [2-(3-Methoxy-phenyl)-cyclohex-l-enyl]-acetic acid ethyl ester
Figure imgf000017_0001
Combine [2-(3-methoxy-phenyl)-cyclohexylidene]-acetic acid ethyl ester (839.4 mg, 3.06 mmol), sodium ethoxide (62.5 mg, 0.92 mmol), and DMSO (6.0 mL), stir, and heat at 1000C. After 2 hours, cool to ambient temperature and extract the organic layer with ethyl acetate. Wash the ethyl acetate layer 5X with brine and dry the organic layer over sodium sulfate, and concentrate in vacuo to yield the titled compound (769.6 mg, 92%) as a clear oil. TLC Rf=0.58 in 8: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.21 (m, IH), 6.75 (m, 3H), 4.11 (q, 2H, /=7.2 Hz), 3.79 (s, 3H), 2.91 (s, 2H), 2.28 (m, 2H), 2.12 (m, 2H), 1.72 (m, 4H), 1.24 (t, 3H, /=7.3 Hz).
Preparation 3 [2-(3-Methoxy-phenyl)-cyclohexyl]-acetic acid ethyl ester
Figure imgf000017_0002
Combine [2-(3-methoxy-phenyl)-cyclohex-l-enyl]-acetic acid ethyl ester (9.91g, 36.0 mmol), 10% Pd on carbon (2.06g, 14.4 mmol), and ethanol (90 mL) and tetrahydrofuran (5 mL), degas, and add 50 psi H2 at room temperature. After 18 hours, filter off the Pd catalyst over celite eluting with ethyl acetate. Concentrate and flash chromatograph with 0% to 20% ethyl acetate/hexanes to yield the titled compound (8.89g, 89%) as a clear oil. TLC Rf=0.42 in 6:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 1H NMR (CDCl3): 7.21 (t, IH, 7=8.1 Hz), 6.78 (d, 2H, J=7.5 Hz), 6.72 (s, IH), 3.98 (q, 2H, /=7.0 Hz), 3.80 (m, 3H), 2.89 (m, IH), 2.51 (m, IH), 2.31 (m, IH), 1.97 (m, IH), 1.88 (m, IH), 1.72 (m, 4H), 1.44 (m, 3H), 1.16 (t, 3H, /=6.6 Hz).
Preparation 4 2-(3-Methoxy-phenyl)-cyclohexane carboxylic acid
Figure imgf000018_0001
Combine [2-(3-methoxy-phenyl)-cyclohexyl]-acetic acid ethyl ester (13.3g, 48.1 mmol), ethanol (100.0 mL), and lithium hydroxide aqueous (24 mL), stir at reflux temperature. After 48 hours, add 5N HCl until reaction is acidic, then extract with ethyl acetate and wash with brine. Dry the organic phase with anhydrous sodium sulfate then concentrate to yield the titled compound (11.31g, 95%) as a white solid. TLC Rf=0.19 in 4: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.24 (m, IH), 6.80 (d, IH, /=7.9 Hz), 6.75 (m, 2H), 3.82 (s, 3H), 2.93 (m, IH), 2.53 (m, IH), 2.38 (m, IH), 2.04 (m, IH), 1.81 (m, 5H), 1.51 (m, 3H).
Preparation 5 6-Methoxy-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one
Figure imgf000018_0002
Combine 2-(3-methoxy-phenyl)-cyclohexane carboxylic acid (11.5Og, 46.3 mmol), methylene chloride (200 mL), catalytic DMF (4.0 mL) and slowly add oxalyl chloride (4.8 mL, 55.6 mmol), stir at room temperature. After 1.5 hours, at O0C add TiCl4 (12.7 mL, 115.78 mmol) and let reaction warm to room temperature. After 3.5 hours, quench reaction with ice water and add 5N HCl. Allow reaction mixture to stir for 30 minutes then extract with ethyl acetate and wash with sodium bicarbonate solution (aq), then Brine. Dry the organic phase with anhydrous sodium sulfate then concentrate and flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (9.91g, 93%) as a yellow oil. TLC Rf=0.26 in 5:1 hexanesrethyl acetate 1H NMR (CDCl3): 8.01 (d, IH, /=8.8 Hz), 6.83 (m, IH), 6.72 (m, IH), 3.86 (s, 3H), 2.89 (m, 2H), 2.45 (m, 2H), 1.60 (m, 8H).
Preparation 6
6-Methoxy-10-(4-methoxy-phenyl)-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9- one
Figure imgf000019_0001
Combine 6-methoxy-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one (1.Og, 4.3 mmol), 4-bromoanisole (0.81g, 4.3 mmol), palladium acetate (49.0 mg, 0.218 mmol), t- butyl phosphine (0.133g, 0.658 mmol), sodium t-butoxide (0.457g, 4.7 mmol), tetrahydrofuran (38.0 mL), and stir under nitrogen atmosphere at 8O0C in a glass bomb. After 18 hours, quench reaction with acetic acid (5 mL) in a glove box and extract with ethyl acetate. Wash the ethyl acetate with sodium bicarbonate solution and then brine, dry over sodium sulfate, and concentrate in vacuo. Add diethyl ether and collect precipitate to yield the titled compound (0.78g, 55%) as a white solid. TLC Rf=0.26 in 5:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 8.04 (d, IH, /=8.8 Hz), 7.06 (d, 2H, /=8.4 Hz), 6.86 (m, 3H), 6.75 (m, IH), 3.89 (m, 4H), 3.80 (s, 3H), 3.01 (m, IH), 2.65 (m, IH), 1.81 (m, 3H), 1.46 (m, 5H). Preparation 7 6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,,4a,9,10,10a-octahydro-phenanthren-9-ol
Figure imgf000020_0001
Combine 6-methoxy- 10-(4-methoxy-phenyl)-2,3,4,4a, 10, 10a-hexahydro- IH- phenanthren-9-one (58.0 mg, 0.17 mmol), sodium borohydride (52.0 mg, 1.40 mmol), ethanol (3.0 mL), tetrahydrofuran (3.0 mL), stir, and reflux under a nitrogen atmosphere. After 2 hours, cool to ambient temperature, and concentrate in vacuo. Add ethyl acetate to reaction mixture, wash with sat ammonium chloride solution(aq), Brine, and dry over sodium sulfate. Concentrate to yield the titled compound (57.0 mg, 99%) as a white solid. TLC Rf=O.12 in 6:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.50 (d, IH, 7=8.8 Hz), 7.20 (d, 2H, /=8.4 Hz), 6.93 (d, 2H, 7=8.4 Hz), 6.80 (dd, IH, 7=8.6, 2.4 Hz), 6.66 (m, IH), 4.77 (d, IH, 7=9.7 Hz), 3.82 (m, 6H), 3.05 (m, IH), 2.85 (m, IH), 2.35 (m, IH), 1.75 (m, 4H), 1.40 (m, 5H).
Preparation 8 6-Methoxy-10-(4-methoxy-phenyI)-l,2,3,4,4a,10a-hexahydro-phenanthrene
Figure imgf000020_0002
Combine 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-ol (184.3 mg, 0.54 mmol), p-toluene sulfonic acid (20.0 mg, 0.11 mmol), benzene (5 mL), stir, and reflux under nitrogen atmosphere. After 1.5 hours, cool reaction to ambient temperature, add ethyl acetate, wash sat sodium bicarbonate solution (aq), and then with brine, dry over sodium sulfate, and concentrate in vacuum. Flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (147.6 mg, 85%) as a clear oil. TLC Rf=0.51 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.53 (d, 2H, /=8.8 Hz), 7.10 (d, IH, J=7.9 Hz), 6.93 (m, 3H), 6.72 (m, 2H), 3.85 (m, 6H), 3.21 (m, IH), 2.79 (m, IH), 2.49 (m, IH), 1.80 (m, IH), 1.58 (m, 4H), 1.30 (m, 2H).
Preparation 9 6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthrene
Figure imgf000021_0001
Combine 6-methoxy-10-(4-methoxy-phenyl)~l,2,3,4,4a,10a-hexahydro- phenanthrene (48.5 mg, 0.15 mmol), 10% Pd-C (5.4 mg, 0.04 mmol), and ethanol (3 mL) and tetrahydrofuran (3 mL), degas, and add H2 at atmospheric pressure and at room temperature. After 18 hours, filter off the Pd catalyst over celite eluting with ethyl acetate. Concentrate and flash chromatograph with 0% to 20% ethyl acetate/hexanes to yield the titled compound (42.4 mg, 87%) as a clear oil. TLC Rf=0.51 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.25 (d, 2H, 7=8.4 Hz), 7.11 (d, IH, /=8.4 Hz), 6.97 (m, IH), 6.90 (d, 2H, /=7.9 Hz), 6.75 (m, IH), 3.82 (m, 6H), 3.19 (m, 3H), 2.87 (dd, IH, /=15.0, 4.0 Hz), 2.49 (m, IH), 2.04 (m, IH), 1.65 (m, 2H), 1.45 (m, IH), 1.29 (m, IH), 1.15 (m, 3H).
Preparation 10 trans-2-(3-Methoxyphenyl)-cyclopentanol
Figure imgf000021_0002
To a solution of 3-methoxyphenyl magnesium bromide 1.0M ( 59.4 ml, 59.4 mmoles) and copper(I) iodide (0.762g, 4.0 mmoles), add (dropwise) a solution of cyclopentene oxide (5.2 ml, 59.4 mmoles) in tetrahydrofuran (5 ml) over 40 minutes. The reaction is exothermic and the temperature rises to 450C. Cool the reaction to ambient temperature and quench with a 25% solution of ammonium chloride (40ml), extract with ether and shake with brine. Dry the organic layer over sodium sulfate and concentrate in vacuo to yield an oil which is flash chromatographed on silica with 14-25% ethyl acetate /hexanes to yield 6.43g of the titled compound. 1H NMR (CDCl3): 7.23 (d, J=8.4, IH), 6.86 (d, J= 7.6 Hz, IH), 6.81 (s, IH), 6.77 (m, IH), 4.15 (m, IH), 3.81 (s, 3H), 2.86 (m, IH), 2.18-2.04 (m, 2H), 1.9-1.6 (m, 5H).
Preparation 11 2-(3-Methoxyphenyl)-cyclopentanone
Figure imgf000022_0001
To a solution of 2-(3-methoxyphenyl)-cyclopentanol (6.4g, 0.033 mmoles) in 140 ml of methylene chloride, add a mixture of pyridine chlorochromate (14.4g, 0.066 mmoles), and silica gel (14.4g). After 1.5 hours, an equivalent amount of oxidizing agent and silica gel is added and the reaction is stirred an additional 3.5 hours. Reduce the solvent in half in vacuo at 350C and chromatograph on silica with 3-1 hexanes-ethyl acetate to yield 4.34g of the titled compound. 1H NMR (CDCl3): 7.25 (m, IH), 6.81-6.74 (m, 3H), 3.8 (s, 3H), 3.31 (m, IH), 2.5 (m, 2H), 2.3 (m, IH), 2.1 (m, 2H), 1.9 (m, IH).
Preparation 12 [2-(3-Methoxy-phenyl)-cyclopent-l-enyl]-acetic acid ethyl ester
Figure imgf000022_0002
Reflux a solution of 2-(3-methoxy-phenyl)-cyclopentanone (4.34g 22.8 mmoles), and (carboethoxymethylene)-triphenylphosphorane (14.31g, 41.1 mmoles) in 130 ml of xylenes for 15 hours. Concentrate in vacuo at 400C and slurry with ether. Remove triphenyl phosphine oxide by vacuum filtration, and chromatographed on silica with 14% ethyl acetate/ hexanes. to yield the 4.83g of the titled compound. 1H NMR (CDCl3): 7.26 (m, IH), 6.9 (m, 2H), 6.8 (m, IH), 4.17 (q, J= 7.2, 2H), 3.81 (s, 3H), 3.22 (s, 2H), 2.76 (m, 2H), 2.58 (m, 2H), 1.95 (m, 2H) 1.28 (m, 3H).
Preparation 13 [2-(3-Methoxy-phenyI)-cyclopentyl]-acetic acid ethyl ester
Figure imgf000023_0001
Preparation 13 is prepared from preparation 12 in a manner similar to preparation 3. 1H NMR (CDCl3): 7.2 (m, IH), 6.7 (m, 3H), 4.02 (q, J= 7.2, 2H), 3.8 (s, 3H), 3.27 (q, J= 7.2, IH), 2.64 (m, IH), 2.06 (m, IH), 1.9 (m, 5H), 1.7 (m, IH) 1.5 (m, IH) 1.18 (t, J= 7.2, 3H).
Preparation 14 8-Methoxy-l,2,3,3a,4,9b-hexahydro-cyclopenta[a]naphthalen-5-one
Figure imgf000023_0002
Heat a solution of [2-(3-methoxyphenyl)-cyclopentyl]-acetic acid ethyl ester (4.2g, 16.0 mmoles) in polyphosphoric acid (27g) at 1000C for 3.5 hours. Cool the reaction to r.t. and add ice, water and methylene chloride cautiously. Extract the aqueous layer was 2x with additional methylene chloride, combine the organic layers and dry over anhydrous sodium sulfate. Concentrate in vacuo at 400C. Chromatograph the crude product on silica with 11-17% ethyl acetate/ hexanes to yield the titled compound (2.8g, 81%) as a neat crystalline solid. 1H NMR (CDCl3): 7.95 (d, J= 8.8 Hz, IH), 6.8 (dd, J=2.8 Hz, 6.4 Hz, IH), 6.73(m, IH), 3.86 (s, 3H), 3.19 (m, IH), 2.72 (m, IH), 2.53 (m, 2H), 2.18 (m, IH), 2.0-1.75 (m, 5H).
Preparation 15
8-Methoxy-4-(4-methoxy-phenyl)-l,2,3,3a,4,9b-hexahydro-cyclopenta[a]naphthalen-
5-one
Figure imgf000024_0001
Preparation 15 is prepared from preparation 14 in a manner similar to preparation 6. 1H NMR (CDC13):8.O (d, J= 8.4 Hz, IH), 7.2 (d, J= 8.8 Hz, 2H), 6.9(d, J= 8.8 Hz, 2H), 6.83 (m, 2H), 4.19 (d, J= 4.8 Hz, IH), 3.88 (s, 3H), 3.81 (s, 3H), 3.62 (m, IH), 2.7 (m, IH), 2.15 (m, 2H), 1.75 (m, IH), 1.5 (m, 3H). MS calcd 322; MS (M+l) 323.
Preparation 16
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-5-ol
Figure imgf000024_0002
Preparation 16 is prepared from preparation 15 in a manner similar to preparation 7. 1H NMR (CDCl3): 7.53 (d, J= 8.8 Hz, IH), 7.21 (d, J= 8.8 Hz, 2H), 6.9(d, J= 8.4 Hz, 2H), 6.83 (m, 3H), 4.71 (d, J=10.1 Hz, IH), 3.82 (s, 3H), 3.81 (s, 3H), 3.2 (m, IH), 2.6 (m, IH), 2.45 (m, IH), 2.25 (m, IH), 1.6 (m, 5H).
Preparation 17
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,9b-tetrahydro-lH- cyclopenta [ajnaphthalene
Figure imgf000024_0003
Preparation 17 is prepared from preparation 16 in a manner similar to preparation 8. 1H NMR (CDCl3): 7.45 (d, J= 8.8 Hz, IH), 7.04 (d, J= 8.4 Hz, IH), 6.89(d, J= 8.8 Hz, 2H), 6.8 (s, IH), 6.7 (d, J=8 Hz, IH), 6.55 (s, IH), 3.83 (s, 3H), 3.82 (s, 3H), 3.39 (m, IH), 3.24 (m, IH), 2.15 (m, 2H), 2.0 (m, IH), 1.55 (m, 3H).
Preparation 18
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene
Figure imgf000025_0001
Preparation 18 is prepared from preparation 17 in a manner similar to preparation 9. 1H NMR (CDCl3): 7.2 (d, J= 8.4 Hz, 2H), 7.03 (d, J= 7.9 Hz, IH), 6.87(d, J= 7.9 Hz, 2H), 6.74 (d, J = 2.7 Hz, IH), 6.75 (d, J= 5.7 Hz, IH), 3.8 (s, 6H), 3.4 (m, IH), 3.1 (m, 2H), 2.68 (d, J = 13.2 Hz, IH), 2.56 (m, IH), 2.2 (m, IH), 1.2-1.6 (m, 5H).
Preparation 19 trans-2-(3,5-Dimethoxy-phenyl)-cyclopentanol
Figure imgf000025_0002
Preparation 19 is prepared from cyclopentene oxide and l-bromo-3, 5- dimethoxybenzene in a manner similar to preparation 10. 1H NMR (CDCl3): 6.41 (s, 2H), 6.33(s, IH), 4.15 (dd, J= 7.5 Hz, IH), 3.78 (s, 6H), 2.81 (dd, J=9.2 Hz, IH), 2.1 (m, 2H), 1.9-1.5 (m, 6H).
Preparation 20 2-(3,5-Dimethoxy-phenyl)-cyclopentanone
Figure imgf000026_0001
Preparation 20 is prepared from preparation 19 in a manner similar to preparation 11. 1H NMR (CDCl3): 6.34 (s, 3H), 4.15 (dd, J= 7.5 Hz, IH), 3.77 (s, 6H), 3.25 (dd, J=ILl, 8.3 Hz, IH), 2.45 (m, 2H), 2.3 (m, IH), 2.1 (m, 2H), 1.8 (m, IH).
Preparation 21 [2-(3,5-Dimethoxy-phenyl)-cyclopent-l-enyl]-acetic acid ethyl ester
Figure imgf000026_0002
Preparation 21 is prepared from preparation 20 in a manner similar to preparations 1 and 2. 1H NMR (CDCl3): 6.5 (s, 2H), 6.4 (s, IH), 4.16 (q, J=7 Hz, 2H), 3.8 (s, 6H), 3.22(s, 2H), 2.73 (m, 2H), 2.57 (m, 2H), 1.94 (m, 2H), 1.27 (t, J=7 Hz, 3H).
Preparation 22 [2-(3,5-Dimethoxy-phenyl)-cyclopentyl]-acetic acid ethyl ester
Figure imgf000026_0003
Preparation 22 is prepared from preparation 21 in a manner similar to preparation 3. 1H NMR (CDCl3): 6.3 (s, 3H), 4.03 (q, J=7 Hz, 2H), 3.77 (s, 6H), 3.21(dd, IH, J=7.5 Hz), 2.2-1.4 (m, 6H), 2.57 (m, 2H), 1.94 (m, 2H), 1.18 (t, J=7 Hz, 3H).
Preparation 23 όjδ-Dimethoxy-l^S^aj^b-hexahydro-cyclopentalalnaphthalen-S-one
Figure imgf000027_0001
Preparation 23 is prepared from preparation 22 in a manner similar to preparation 14. MS m/z 247 (M+l).
Preparation 24
6,8-Dimethoxy-4-(4-methoxy-phenyl)-l,2,3,3a,4,9b-hexahydro- cyclopenta[a]naphthalen-5-one
Figure imgf000027_0002
Preparation 24 is prepared from preparation 23 in a manner similar to preparation 6. MS m/z 353 (M+l).
Preparation 25
6,8-Dimethoxy-4-(4-methoxy-phenyl)-2,3j3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthaIen-5-ol
Figure imgf000027_0003
Preparation 25 is prepared from preparation 24 in a manner similar to preparation 7. 1H NMR (CDCl3): 7.45 (d, J=8.4 Hz, 2H), 6.95 (m, IH), 6.88 (d, J=8.8 Hz, IH), 6.64, 6.5(s, 1 H diasteromers), 6.4, 6.3( s, IH, diastereomers) 3.94 (d, J=9.3 Hz, 1H)3.82 (s, 9H), 3.33-3.1 (series of m, 2H), 2.2-1.9 (m, 2H), 1.56 (m, 5H). Preparation 26
6,8-Dimethoxy-4-(4-methoxy-phenyl)-2,3,3a,9b-tetrahydro-lH- cyclopenta[a]naphthalene
Figure imgf000028_0001
Preparation 26 is prepared from preparation 25 in a manner similar to preparation 8. MS m/z 337 (M+l).
Preparation 27
6,8-Dimethoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene
Figure imgf000028_0002
Preparation 27 is prepared from preparation 26 in a manner similar to preparation 9. 1H NMR (CDCl3): 7.24 (d, J=8.4 Hz, 2H), 6.86 (d, J=8.4 Hz, 2H), 6.34 (s, IH), 3.8 (s, 6H), 3.79 (s, 3H), 3.4 (m, IH), 3.19-2.95 (m, 2H), 2.64(dd, J=14.5, 14.1 IH) 2.5 (m, IH), 2.19 ( m, IH), 1.7-1.3 (m, 5H).
Preparation 28 4-(3-Methoxy-phenyl)-dihydro-furan-3-one
Figure imgf000028_0003
Combine 4-(3-methoxy-phenyl)-tetrahydro-furan-3-ol (10.58g, 54.0 mmol), pyridine chlorochromate (35.22g, 163.0 mmol), silica gel (35.Og), and dichloromethane (200 mL), stir at room temperature. After 3 hours, add ether and filter off the silica gel through a plug of Silica using 50% ethyl acetate/hexanes eluent. Concentrate and flash chromato graph with 10% to 40% ethyl acetate/hexanes to yield the titled compound (5.74g, 55%) as a clear oil. TLC Rf=0.23 in 3: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.30 (m, IH), 6.85 (m, 3H), 4.68 (t, IH, 7=9.0 Hz), 4.31 (t, IH, 7=8.8 Hz), 4.19 (d, IH, 7=17.2 Hz), 4.08 (d, IH, 7=17.2 Hz), 3.84 (s, 3H), 3.70 (t, IH, 7=8.1 Hz).
Preparation 29 [4-(3-Methoxy-phenyl)-2,5-dihydro-furan-3-yl]-acetic acid ethyl ester
Figure imgf000029_0001
Preparation 29 is prepared from preparation 28 in a manner similar to preparations 1 and 2. TLC Rf=0.25 in 4: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.32 (m, IH), 6.90 (m, 3H), 5.01 (m, 2H), 4.90 (m, 2H), 4.21 (q, 2H, 7=7.0 Hz), 3.86 (s, 3H), 3.32 (s, 2H), 1.31 (t, 3H, 7=7.3 Hz).
Preparation 30 [4-(3-Methoxy-phenyI)-tetrahydro-furan-3-yI]-acetic acid ethyl ester
Figure imgf000029_0002
Preparation 30 is prepared from preparation 29 in a manner similar to preparation 3. TLC Rf=O.13 in 6:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.25 (m, IH), 6.80 (m, 3H), 4.14 (m, 5H), 3.83 (s, 3H), 3.64 (t, IH, 7=8.4 Hz), 3.53 (dt, IH, 7=6.8, 3.8 Hz), 3.01 (dt, IH, 7=15.3, 7.6 Hz), 2.04 (m, 2H), 1.23 (t, 3H, 7=7.3 Hz).
Preparation 31 ^-(S-Methoxy-phenyO-tetrahydro-furan-S-yll-acetic acid
Figure imgf000030_0001
Preparation 31 is prepared from preparation 30 in a manner similar to preparation 4. TLC Rf=0.13 in 1:1 hexanes:ethyl acetate. 1H NMR (DMSO): 12.10 (s, IH), 7.25 (t, IH, /=7.9 Hz), 6.80 (m, 3H), 4.00 (m, 3H), 3.74 (s, 3H), 3.46 (m, 2H), 2.82 (m, IH), 1.87 (m, 2H).
Preparation 32 8-Methoxy-l,3a,4,9b-tetrahydro-3H-naphtho[l,2-c]furan-5-one
Figure imgf000030_0002
Preparation 32 is prepared from preparation 31 in a manner similar to preparation 5. TLC Rf=O.11 in 2: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 8.03 (d, IH, /=8.8 Hz), 6.89 (dd, IH, /=8.6, 2.4 Hz), 6.72 (d, IH, /=2.2 Hz), 4.34 (t, IH, /=8.4 Hz), 4.11 (dd, IH, /=8.6, 5.5 Hz), 3.91 (m, 4H), 3.76 (dd, IH, /=8.6, 3.3 Hz), 3.63 (q, IH, /=7.8 Hz), 3.04 (m, IH), 2.74 (m, 2H).
Preparation 33 8-Methoxy-4-(4-methoxy-phenyI)-l,3a,4,9b-tetrahydro-3H-naphtho[l,2-c]furan-5- one
Figure imgf000030_0003
Preparation 33 is prepared from preparation 32 in a manner similar to preparation 6. TLC Rf=O.16 in 2:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 8.06 (d, IH, /=8.8 Hz), 7.14 (d, 2H, 7=8.8 Hz), 6.93 (m, 3H), 6.79 (d, IH, /=1.8 Hz), 4.30 (m, 2H), 4.21 (m, IH), 3.87 (m, 9H), 3.22 (m, IH).
Preparation 34 8-Methoxy-4-(4-methoxy-phenyl)-l,3,3a,4,5,9b-hexahydro-naphtho[l,2-c]furan-5-ol
Figure imgf000031_0001
Preparation 34 is prepared from preparation 33 in a manner similar to preparation 7. TLC Rf=0.51 in 2:1 hexanesrethyl acetate. 1H NMR (CDCl3): 7.59 (m, IH), 7.26 (m, 2H), 6.89 (m, 3H), 6.66 (d, IH, J=2.6 Hz), 4.81 (d, IH, 7=10.1 Hz), 4.36 (t, IH, 7=8.4 Hz), 3.82 (m, 7H), 3.60 (m, 2H), 3.14 (m, IH), 2.87 (m, IH), 2.73 (t, IH, 7=11.2 Hz).
Preparation 35 8-Methoxy-4-(4-methoxy-phenyl)-l,3,3a,9b-tetrahydro-naphtho[l,2-c]furan
Figure imgf000031_0002
Preparation 35 is prepared from preparation 34 in a manner similar to preparation 8. TLC Rf=0.54 in 1:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.44 (d, 2H, 7=8.8 Hz), 7.14 (d, IH, 7=8.4 Hz), 6.94 (d, 2H, 7=9.2 Hz), 6.77 (m, 2H), 6.68 (s, IH), 4.37 (t, 2H, 7=7.7 Hz), 3.86 (m, 7H), 3.71 (m, 2H), 3.60 (t, IH, 7=7.3 Hz).
Preparation 36 8-Methoxy-4-(4-methoxy-phenyl)-l,3,3a,4,5,9b-hexahydro-naphtho[l,2-c]furan
Figure imgf000031_0003
Preparation 36 is prepared from preparation 35 in a manner similar to preparation 9. TLC Rf=0.31 in 2:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.22 (d, 2H, /=8.4 Hz), 7.12 (d, IH, J=8.4 Hz), 6.91 (d, 2H, /=8.8 Hz), 6.75 (m, 2H), 4.25 (t, IH, /=8.1 Hz), 3.84 (m, 6H), 3.67 (m, 3H), 3.57 (m, IH), 3.11 (m, 3H), 2.80 (d, IH, /=14.5 Hz).
Preparation 37
10-(3-FluoiO-4-methoxy-phenyl)-6-methoxy-2,3,4,4a,10,10a-hexahydro-l£f- phenanthren-9-one
Figure imgf000032_0001
Preparation 37 is prepared from preparation 5 and 4-bromo-2-fluoroanisol in a manner similar to preparation 6. TLC Rf=O.13 in 6:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 8.06 (d, IH, /=8.8 Hz), 6.93 (m, 4H), 6.78 (d, IH, /=2.6 Hz), 3.91 (m, 8H), 3.04 (m, IH), 2.67 (m, IH), 1.85 (m, 3H), 1.54 (m, 4H).
Preparation 38
10-(3-Fluoro-4-methoxy-phenyl)-6-methoxy-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-ol
Figure imgf000032_0002
Preparation 38 is prepared from preparation 37 in a manner similar to preparation 7. TLC Rf=0.20 in 4: 1 hexanes: ethyl acetate. 1H NMR (CDCl3): 7.53 (d, IH, /=8.8 Hz), 7.02 (m, 3H), 6.84 (dd, IH, /=8.8, 2.6 Hz), 6.69 (d, IH, /=2.6 Hz), 4.79 (d, IH, /=9.7 Hz), 3.94 (s, 3H), 3.84 (s, 3H), 3.09 (t, IH, /=11.0 Hz), 2.88 (m, IH), 2.35 (m, IH), 1.79 (m, 5H), 1.37 (m, 3H). Preparation 39
10-(3-Fluoro-4-methoxy-phenyl)-6-methoxy-l,2,3,4,4a,9,10a-hexahydro- phenanthrene
Figure imgf000033_0001
Preparation 39 is prepared from preparation 38 in a manner similar to preparation 8. TLC Rf=0.36 in 6:1 hexanesiethyl acetate. 1H NMR (CDCl3): 7.34 (m, 2H), 7.13 (d, IH, /=8.4 Hz), 6.99 (m, 2H), 6.76 (m, 2H), 3.95 (s, 3H), 3.88 (s, 3H), 3.23 (d, IH, /=4.0 Hz), 2.77 (m, IH), 2.52 (d, IH, /=14.1 Hz), 1.83 (m, IH), 1.61 (m, 4H), 1.30 (m, 2H).
Preparation 40
10-(3-Fluoro-4-methoxyφhenyl)-6-methoxy-l,2,3,4,4a.,9,10a-octahydro- phenanthrene
Figure imgf000033_0002
Preparation 40 is prepared from preparation 39 in a manner similar to preparation 9. TLC Rf=0.36 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.13 (m, 2H), 7.06 (m, IH), 6.97 (m, 2H), 6.78 (dd, IH, /=8.4, 2.6 Hz), 3.93 (s, 3H), 3.85 (s, 3H), 3.19 (m, 3H), 2.89 (d, IH, /=11.5 Hz), 2.52 (d, IH, /=14.5 Hz), 2.07 (m, IH), 1.69 (m, 3H), 1.48 (m, IH), 1.30 (d, IH, /=10.6 Hz), 1.16 (m, 2H).
Preparation 41 2-Hydroxy-cyclohex-l-enecarboxylic acid ethyl ester
Figure imgf000033_0003
Et Combine 2-oxo-cyclohexanecarboxylic acid ethyl ester (10.0 g, 55.0 mmol), Hunig's base (23.0 mL, 132.0 mmol), dichloromethane (100.0 mL), and trifluoromethane sulphonic anhydride (11.1 mL, 66.0 mmol) at ""780C and then stir at room temperarture for 18 hours under a nitrogen atmosphere. Add water, then wash with sat sodium bicarbonate solution, citric acid, then brine, and dry over sodium sulfate. Concentrate under vacuum and flash chromatograph using 10% to 40% DCM/hexanes eluent to yield the titled compound (13.6 g, 82%). TLC Rf=0.25in 40% DCM/hexanes. 1H NMR (CDCl3): 4.26 (q, 2H, 7=7.0 Hz), 2.5 (m, 2H), 2.4 (m, 2H), 1.8 (m, 2H), 1.7 (m, 2H), 1.3 (t, 3H, 7=7 Hz).
Preparation 42 2-(2-Methoxy-phenyl)-cycIohex-l-enecarboxyIic acid ethyl ester
Figure imgf000034_0001
Combine 2-hydroxy-cyclohex-l-enecarboxylic acid ethyl ester (8.92 g, 29.5 mmol), 2-methoxyphenylboronic acid (5.0 g, 32.4 mmol), DMF (60.0 mL), methanol (20.0 mL), and sodium carbonate in water (40.Og in 40 mL) at room temperature. Purge several times with nitrogen then add Pd(OAc)2 (72.0 mg, 1 mmol%) and l,4-bis(diphenyl phosphino)butane (170.0 mg) and purge again with nitrogen. Stir at 700C under nitrogen for 5 hours then filter reaction wash with Methanol and ethyl acetate. Concentrate reaction mixture on rotovap and add ethyl acetate. Wash 5 times with brine and dry over anhydrous sodium sulfate. Concentrate and flash chromatograph using 5 to 40% ethyl acetate/hexanes eluent to yield the titled compound (3.98 g, 52%). TLC Rf=0.25in 10% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.2 (t, IH, 7=6.0 Hz), 6.9 (m, 3H), ), 3.8 (m, 5H), 2.5 (m, 4H), 1.8 (m, 4H), 0.8 (t, 3H, 7=7 Hz).
Preparation 43 2-(2-Methoxy-phenyl)-cyclohexanecarboxylic acid ethyl ester
Figure imgf000035_0001
Preparation 43 is prepared from preparation 42 in a manner similar to preparation 3. TLC Rf=0.25 in 9: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.2 (d, IH, J=6.0 Hz), 7.1 (t, IH, /=8.0 Hz ), 6.9 (t, IH, 7=8.0 Hz), 6.8 (d, IH, /=7.0 Hz), 3.8 (m, 5H), 3.2 (m, IH), 3.1 (m, IH), 2.3 (m, IH), 2.0 (m, 2H), 1.7 (m, 4H), 1.4 (m, IH), 0.9 (t, 3H, J=I Hz).
Preparation 44 [2-(2-Methoxy-phenyl)-cyclohexyl]-methanol
Figure imgf000035_0002
Combine 2-(2-methoxy-phenyl)-cyclohexanecarboxylic acid ethyl ester (2.34 g, 8.9 mmol), lithium aluminum hydride (1.02 g, 26.7 mmol), and tetrahydrofuran (30.0 mL) at room temperature. Stir at rm temperature under nitrogen for 2 hours then add Rochelle's salt and ethyl acetate. Stir 18 hours then separate layers and wash with brine then dry over anhydrous sodium sulfate. Concentrate to yield the titled compound (1.86 g, 95%). TLC Rf=0.08 in 10% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.2 (m, 2H), 6.9 (m, 2H), 3.8 (s, 3H), 3.5 (m, IH), 3.4 (m, IH), 3.3 (m, IH), 2.3 (m, IH), 1.8 (m, 2H), 1.5 (m, 6H).
Preparation 45 Methanesulfonic acid 2-(2-methoxy-phenyl)-cycIohexylmethyl ester
Figure imgf000035_0003
Combine [2-(2-methoxy-phenyl)-cyclohexyl]-methanol (0.725 g, 3.29 mmol), methanesulfonyl chloride (0.415 g, 3.62 mmol), 2,6-dimethylaminopyridine (80.0 mg, 0.66 mmol), Et3N (1.0 mL, 7.24 mmol), and dichloromethane (30.0 mL) at O0C. After 20 min stir at room temperature under nitrogen. Reaction stirred for 18 hours then add water and brine. Separate layers and dry over anhydrous sodium sulfate. Concentrate and flash chromatography using 5 to 30% ethyl acetate/hexanes to yield the titled compound (0.810 g, 83%). TLC Rf=0.25 in 30% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.2 (m, IH), 7.1 (m, IH), 6.9 (m, 2H), 4.3 (t, IH, 7=10.0 Hz), 3.9 (m, 4H), 3.3 (m, IH), 2.8 (s, 3H), 2.6 (m, IH), 1.8 (m, 6H), 1.5 (m, 2H).
Preparation 46 [2-(2-Methoxy-phenyI)-cyclohexyl]-acetonitriIe
Figure imgf000036_0001
Combine 2-[2-(2-methoxy-phenyl)-cyclohexylmethoxy]-l,3,5-trimethyl-benzene (0.810 g, 2.71 mmol), sodium cyanide (2.13 g, 43.4 mmol), and d6-DMSO (10.0 mL) at rm temperature. Heat and stir at 1000C under nitrogen for 18 hours. Cool to room temperature and add ethyl acetate then add water and wash 5X with brine. Separate layers and dry over anhydrous sodium sulfate. Concentrate and flash chromatography using 0 to 30% ethyl acetate/hexanes to yield the titled compound (0.346 g, 56%). TLC Rf=0.43 in 20% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.2 (m, IH), 7.0 (m, IH), 6.9 (m, 2H), 3.8 (s, 3H), 3.3 (m, IH), 2.5 (m, IH), 2.3 (m, IH), 2.1 (m, IH), 1.8 (m, 6H), 1.4 (m, 2H).
Preparation 47 [2-(2-Methoxy-phenyI)-cyclohexyl]-acetaldehyde
Figure imgf000036_0002
Combine [2-(2-methoxy-phenyl)-cyclohexyl]-acetonitrile (0.346 g, 1.51 mmol), diisobutylaluminum hydride (2.7 mL, 2.72 mmol), and ether (8.0 mL) at 1O0C. After 1 hour quenched reaction at O0C with IN HCl and added ethyl acetate. Separate layers, wash with brine, and dry over anhydrous sodium sulfate. Concentrate to yield the titled compound (0.336 g, 96%). TLC Rf=0.08 in 5% ethyl acetate/hexanes. 1H NMR (CDCl3): 9.3 (s, IH), 7.2 (m, IH), 7.0 (m, IH), 6.9 (m, 2H), 3.8 (s, 3H), 3.3 (m, IH), 2.8 (m, IH), 2.3 (m, IH), 2.2 (m, 2H), 1.6 (m, 7H).
Preparation 48 [2-(2-Methoxy-phenyI)-cyclohexyl] -acetic acid
Figure imgf000037_0001
Combine [2-(2-methoxy-phenyl)-cyclohexyl]-acetaldehyde (0.336g, 1.45 mmol), and acetone (10.0 niL). Add dropwise Jones reagent until color goes from green to orange and persists for several minutes (approximately 1.0 mL). Then concentrate on rotovap then add ethyl acetate and wash excess chromium away with brine washes. Dry over anhydrous sodium sulfate, concentrate to yield the titled compound (0.301 g, 84%). TLC Rf=O.13 in 20% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.2 (m, IH), 7.0 (m, IH), 6.8 (m, 2H), 3.8 (s, 3H), 3.3 (m, IH), 2.6 (m, IH), 2.3 (m, IH), 2.0 (m, IH), 1.6 (m, 8H).
Preparation 49 5-Methoxy-2,3,4,4a,10,10a-hexahydrolH-phenanthren-9-one
Figure imgf000037_0002
Combine [2-(2-methoxy-phenyl)-cyclohexyl]-acetic acid (0.300 g, 1.21 mmol), oxalyl chloride (0.13 mL, 1.45 mmol), and dichloromethane (6.0 mL) and catalytic DMF (0.1 mL) at room temperature. After 1 hour at O0C added TiCl4 (0.33 mL, 3.0 mmol) and reaction gradually warmed to room temperature. After 3 hours, quenched reaction with 5N HCl and added ethyl acetate. Separate layers, wash with brine, and dry over anhydrous sodium sulfate. Concentrate and flash chromatograph using 0 to 20% ethyl acetate/hexanes eluent to yield the titled compound (0.198 g, 72%). TLC Rf=0.4 in 20% ethyl acetate/hexanes. 1H NMR (CDCl3): 7.6 (d, IH, 7=7.0 Hz), 7.3 (m, IH), 7.0 (m, IH), 3.8 (s, 3H), 3.2 (m, IH), 2.9 (m, IH), 2.4 (m, 2H), 1.9 (m, IH), 1.6 (m, 7H).
Preparation 50 5-Methoxy-10-(4-methoxy-phenyl)-2,3,4,4a,10,10a-hexahydro-lfir-phenanthren-9- one
Figure imgf000038_0001
Preparation 50 is prepared from preparation 49 in a manner similar to preparation 6. TLC Rf=0.4 in 4:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.6 (d, IH, /=7.0 Hz),
7.3 (m, IH), 7.1 (m, 3H), 6.9 (m, 2H), 4.0 (d, IH, 7=13.0 Hz), 3.9 (s, 3H), 3.8 (s, 3H),
3.4 (m, IH), 2.6 (m, IH), 2.0 (m, IH), 1.9 (m, IH), 1.5 (m, 6H).
Preparation 51 5-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9-oI
Figure imgf000038_0002
Preparation 51 is prepared from preparation 50 in a manner similar to preparation 7. TLC Rf=0.22 in 4:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.2 (m, 4H), 6.9 (m, 2H), 6.8 (m, IH), 4.8 (d, IH, 7=9.4 Hz), 3.8 (s, 6H), 3.2 (m, 2H), 2.2 (m, IH), 2.0 (m, IH), 1.9 (m, IH), 1.5 (m, 6H).
Preparation 52 5-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,10a-hexahydro-phenanthrene
Figure imgf000039_0001
Preparation 52 is prepared from preparation 51 in a manner similar to preparation 8. TLC Rf=0.41 in 9:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.3 (m, 2H), 7.2 (m, IH), 6.9 (m, 2H), 6.7 (m, 2H), 6.4 (d, IH, 7=2.7 Hz), 3.9 (s, 3H), 3.8 (s, 3H), 3.3 (m, IH), 3.2 (m, IH), 2.1 (m, IH), 1.4 (m, 7H).
Preparation 53 5-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a -octahydro-phenanthrene
Figure imgf000039_0002
Preparation 53 is prepared from preparation 52 in a manner similar to preparation 9. TLC Rf=0.41 in 9:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.2 (m, 3H), 6.8 (m, 4H), 3.8 (s, 6H), 3.3 (m, 2H), 3.1 (m, IH), 2.9 (m, 2H), 2.1 (m, IH), 1.4 (m, 7H).
Preparation 54 2-(4-Methoxyphenyl)-cyclohexanone
Figure imgf000039_0003
Combine 4-bromoanisole (19.6 g, 104 mmol), cyclohexanone (13.2 g, 136 mmol), sodium tert-butoxide (11.8 g, 120 mmol), palladium acetate (0.47 g, 2.1 mmol), (oxy-di- 2,l-phenylene)bis-diphenylphosphine (2.28 g, 4.1 mmol) and toluene (240 niL) and heated at 90oC under nitrogen. After 18 hours, cool to room temperature and add IN HCl (120 mL). Extract with methylene chloride and wash the combined extracts with brine. Dry the organic layer over sodium sulfate and concentrate in vacuo. Purify by flash chromatography using silica gel and 10% ethyl acetate-hexanes to yield the titled compound (8.15 g, 38%) as a white solid: 1H NMR (CDCl3) δ 7.12 (d, 2H, J=7.5 Hz), 6.92 (d, 2H, J=7.5 Hz), 3.84 (s, 3 H), 3.59 (dd, IH, J=8.0 and 3.5 Hz), 2.60-2.45 (m, 2H), 2.29 (m, IH), 2.18 (m, IH), 2.04 (m, 2H), 1.85 (m, 2H). MS m/z 205 (M+l).
Preparation 55 [2-(4-Methoxy-phenyl)-cycIohexylidene]-acetic acid ethyl ester
Figure imgf000040_0001
Preparation 55 is prepared from preparation 54 in a manner similar to preparation 1. 1H NMR (CDCl3) 67.15 (d, 2H, J=7.5 Hz), 6.92 (d, 2H, J=7.5 Hz), 5.15 (s, IH), 4.11 (q, 2H, J=7.2 Hz), 3.83 (s, 3H), 3.75 (m, IH), 3.39 (dd, IH, J=8.0 and 3.5 Hz), 2.20 (m, IH), 2.04 (m, IH), 1.95-1.88 (m, 3H), 1.75-1.50 (m, 2H), 1.22 (t, 3H, J=7.2 Hz).
Preparation 56 [2-(4-Methoxy-phenyl)-cycIohex-l-enyl]-acetic acid ethyl ester
Figure imgf000040_0002
Preparation 56 is prepared from preparation 55 in a manner similar to preparation 2. 1H NMR (CDCl3) δ 7.15 (d, 2H, J=7.5 Hz), 6.87 (d, 2H, J=7.5 Hz), 4.16 (q, 2H, J=7.2 Hz), 3.83 (s, 3H), 2.95 (s, 2H), 2.30 (m, 2H), 2.16 (m, 2H), 1.80-1.70 (m, 4H), 1.25 (t, 3H, J=7.2 Hz).
Preparation 57 [2-(4-Methoxy-phenyl)-cyclohexyl]-acetic acid ethyl ester
Figure imgf000041_0001
Preparation 57 is prepared from preparation 56 in a manner similar to preparation 3. 1H NMR (CDCl3) δ 7.14 (d, 2H, J=7.5 Hz), 6.85 (d, 2H, J=7.5 Hz), 4.02 (q, 2H, J=7.2 Hz), 3.81 (s, 3H), 2.89 (m, IH), 2.53 (m, IH), 2.34 (dd, IH, J=12.0 and 6.5 Hz), 1.98 (dd, IH, J=12.0 and 2.0 Hz), 1.90 (m, IH), 1.80-1.65 (m, 4H), 1.60-1.38 (m, 3H), 1.21 (t, 3H, J=7.2 Hz).
Preparation 58 [2-(4-Methoxy-phenyl)-cycϊohexyI]-acetic acid
Figure imgf000041_0002
Preparation 58 is prepared from preparation 57 in a manner similar to preparation 4. 1H NMR (CDCl3) δ 7.12 (d, 2H, J=7.5 Hz), 6.86 (d, 2H, J=7.5 Hz), 3.81 (s, 3H), 2.91 (m, IH), 2.48 (m, IH), 2.36 (dd, IH, J=12.0 and 6.5 Hz), 2.01 (dd, IH, J=12.0 and 2.0 Hz), 1.90-1.40 (m, 8H).
Preparation 59 7-Methoxy-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one
Figure imgf000041_0003
Preparation 59 is prepared from preparation 58 in a manner similar to preparation 5. 1H NMR (CDCl3): 7.54 (d, IH, 7=1.5 Hz), 7.22 (d, IH, J=8.0 Hz), 7.13 (dd, IH, J=8.0 and 1.5 Hz), 3.85 (s, 3H), 2.95-2.82 (m, 2H), 2.58-2.45 (m, 2H), 1.80-1.25 (m, 8H). Preparation 60
7-Methoxy-10-(4-methoxy-phenyl)-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9- one
Figure imgf000042_0001
Preparation 60 is prepared from preparation 59 in a manner similar to preparation 6. 1H NMR (CDCl3): 7.57 (d, IH, J=I.5 Hz), 7.22 (d, IH, J=8.0 Hz), 7.15 (dd, IH, J=8.0 and 1.5 Hz), 7.09 (d, 2H, J=7.5 Hz), 6.93 (d, 2H, J=7.5 Hz), 3.95 (d, IH, J=9.5 Hz), 3.88 (s, 3H), 3.82 (s, 3H), 3.04 (m, IH), 2.68 (m, IH), 1.81 (m, 3H), 1.55-1.42 (m, 5H).
Preparation 61 7-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9-ol
Figure imgf000042_0002
Preparation 61 is prepared from preparation 60 in a manner similar to preparation 7. 1H NMR (CDCl3): 7.24 (d, 2H, J=7.5 Hz), 7.18 (d, IH, J=I.5 Hz), 7.10 (d, IH, J=8.0 Hz), 6.95 (d, 2H, J=7.5 Hz), 6.84 (dd, IH, J=8.0 and 1.5 Hz), 4.81 (d, IH, J=9.5 Hz), 3.85 (s, 3H), 3.82 (s, 3H), 3.12 (m, IH), 2.87 (m, IH), 2.39 (m, IH), 1.95-1.75 (m, 2H), 1.67 (m, IH), 1.50-1.22 (m, 5 H).
Preparation 62 7-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,10a-hexahydro-phenanthrene
Figure imgf000042_0003
Preparation 62 is prepared from preparation 61 in a manner similar to preparation 8. 1H NMR (CDCl3): 7.58 (d, 2H, 1=7.5 Hz), 7.25 (d, IH, J=8.0 Hz), 6.96 (d, 2H, J=7.5 Hz), 6.80 (dd, IH, J=8.0 and 1.0 Hz), 6.76 (d, IH, J=I.0 Hz), 6.71 (s, IH), 3.86 (s, 3H), 3.82 (s, 3H), 3.20 (m, IH), 2.81 (m, IH), 2.52 (m, IH), 1.97 (m, IH), 1.70 (m, 2H), 1.70- 1.50 (m, 4 H).
Preparation 63 7-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthrene
Figure imgf000043_0001
Preparation 63 is prepared from preparation 62 in a manner similar to preparation 9. 1H NMR (CDCl3): 7.35 (d, IH, J=7.5 Hz), 7.28 (d, 2H, J=7.5 Hz), 6.92 (d, 2H, J=7.5 Hz), 8.82 (dd, IH, J=7.5 and 1.0 Hz), 6.76 (d, IH, J=I.0 Hz), 3.85 (s, 3H), 3.83 (s, 3H), 3.35-3.18 (m, 3H), 2.91 (dd, IH), 2.50 (m, IH), 2.05 (m, IH), 1.80-1.40 (m, 4H), 1.30 (m, IH), 1.18 (m, 2H).
Preparation 64 2-(3-Methoxy-phenyl)-4,4-dimethyl-cycIohex-2-enone
Figure imgf000043_0002
Dissolve 2-iodo-4,4-dimethyl-cyclohex-2-enone(Tetrahedron Letters (1994),35(37),6787-90)(l lg, 44mmol) in tetrahydrofuran(200 ml). Add 3-methoxyphenyl boronic acid (1Og, 65,8mmol), triphenyl arsine (808mg, 2.64 mmol), silver oxide (15.3g, 66mmol) in water (25ml), bis(benzonitrile)dichloropalladium(II)(506mg, 1.32mmol). Stir at room temperature for Ih. Quench with saturated aqueous ammonium chloride (200 ml), and stir Ih. Filter reaction mixture through a bed of celite rinsing celite with ether (200 ml). Separate filtrate layers and extract the aqueous layer with additional ether (200 ml), combine organic extracts, and wash with water 2x(200 ml), brine(100 ml), dry, and concentrate. Chromatograph residue on a Biotage eluting with 10% ethyl acetate in hexanes to give (lO.lg, 99%) of the title compound as a yellow oil: 1H NMR (CDCl3) δ 7.26-7.23 (m, IH), 6.88-6.84 (m, 3H), 6.69 (s, IH), 3.81 (s, 3H), 2.62 (t, 2H), 1.96 (t, 2H), 1.25 (s, 6H).
Preparation 65 2-(3-Methoxy-phenyl)-4,4-dimethyl-cyclohexanone
Figure imgf000044_0001
Dissolve 2-(3-methoxy-phenyl)~4,4-dimethyl-cyclohex-2-enone (13g, 56.4mmol) in ethanol (500ml), exchange with N2 3x, and add 10% palladium on activated carbon (0.3g, 2.82mmol). Stir under atmospheric pressure of H2 over night. Filter off catalyst and concentrate to give the title compound (13.1g, 99%): 1H NMR (CDCl3) δ 7.24-7.19 (m, IH), 6.85-6.64 (m, 3H), 3.78 (s, 3H), 1.97-1.89 (m, IH), 1.82-1.75 (m, 3H), 1.64-1.55 (m, IH), 1.25-1.14 (m, 2H), 1.0 (s, 3H), 0.96 (s,3H).
Preparation 66 [2-(3-Methoxy-phenyl)-4,4-dimethyl-cyclohexylidene]-acetic acid methyl ester
Figure imgf000044_0002
Dissolve 2-(3-methoxy-phenyl)-4,4-dimethyl-cyclohexanone (13. Ig, 56.4mmol) in toluene (135 ml), add (triphenyl-λ5-phosphanylidene)-acetic acid methyl ester (28.3g, 84.6mmol. Heat reaction mixture at reflux stirring over night. Dilute with ether, filter and concentrate. Chromatograph on a biotage eluting with 10% ethyl acetate in hexanes to give the title compound (5.3g 33%): 1H NMR (CDCl3) δ 7.27-7.23(m, IH), 6.88-6.77 (m, 3H),5.01 (s, IH), 3.77 (s, 3H), 3.56 (s, 3H), 3.53-3.48 (rn, IH), 2.19-2.10 (m, IH), 1.78- 1.58 (m, 3H), 1.46-1.38 (m, IH), 1.25-1.20 (m, IH), 1.11 (s, 3H), 0.96 (s, 3H).
Preparation 67 [2-(3-Methoxy-phenyI)-4,4-dimethyl-cycIohex-l-enyl]-acetic acid methyl ester
Figure imgf000045_0001
Dissolve sodium methoxide (0.99g, 18.4mmol) in DMSO(37 ml) add methyl acetate(l ml), add [2-(3-methoxy-phenyl)-4,4-dimethyl-cyclohexylidene]-acetic acid methyl ester (5.3g, 18mmol). Heat at 10O0C stirring over night. Dilute with ethyl acetate (50ml), wash with brine 4x (30 ml), dry, and concentrate to give the title compound (5.2g 98%): 1H NMR (CDCl3) 87.24-7.18 (m, IH), 6..78-6.68 (m, 3H), 3.79 (s, 3H), 3.65 (s, 2H), 3.59 (s,lH), 2.95 (s,lH), 2.15-2.07 (m, 3H), 1.55(s, 3H), 1.49-1.46 (m,lH), 0.98 (s, 6H).
Preparation 68 [2-(3-Methoxy-phenyl)-4,4-dimethyl-cyclόhexyl]-acetic acid methyl ester
Figure imgf000045_0002
Dissolve [2-(3-methoxy-phenyl)-4,4-dimethyl-cyclohex- 1 -enyl] -acetic acid methyl ester (4.3g, 15mmol) in methanol (135 ml), exchange with N2 3x, add palladium hydroxide 20% on activated carbon (.84g, 5.9mmol). Add 60 psi of H2 at room temperature for 18h. Filter off catalyst rinsing with methanol, concentrate filtrate to give the title compound (3.8g, 88%): 1H NMR (CDCl3) δ 7.23-7.17 (m, IH), 6.79-6.71 (m, 3H), 3.80 (s, 3H), 3.55-3.49 (t, 3H), 2.52-2.19 (m, IH), 1.95-1.83 (m, 2H), 1.72-1.21 (m, 6H), 1.02 (s,3H), 0.99, (s, 3H), 0.93 (s, IH). Preparation 69 [2-(3-Methoxy-phenyl)-4,4-dimethyl-cyclohexyl]-acetic acid
Figure imgf000046_0001
Preparation 69 is prepared from preparation 68 in a manner similar to preparation 4. (3.3g, 91%): 1H NMR (CDCl3) δ 7.22-7.17 (m, IH), 6.79-6.71 (m, 3H), 3.79 (s, 3H), 2.50-2.22 (m, IH), 1.95-1.77 (m, 2H), 1.67-1.21 (m, 6H), 1.02 (s, 3H), 0.99 (s, 3H), 0.93 (s, IH).
Preparation 70 6-Methoxy-3,3-dimethyl-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one
Figure imgf000046_0002
Preparation 70 is prepared from preparation 69 in a manner similar to preparation 5. (1.3g, 41%): 1H NMR (CDCl3) δ 8.01-7.99 (d, IH), 6.83-6.78 (dd, IH), 6.66-6.65 (d, IH), 3.86 (s, 3H), 3.03-2.98 (m, IH), 2.89-2.82 (m, IH), 2.52-2.49 (m, IH), 2.32-2.26 (m, IH), 1.94-1.87 (m, IH), 1.53-1.37 (m, 4H), 1.30-1.24 (m, IH), 1.09 (s, 3H), 0.94 (s, 3H).
Preparation 71
6-Methoxy-10-(4-methoxy-phenyl)-3,3-dimethyI-2,3,4,4a,10,10a-hexahydro-lH- phenanthren-9-one
Figure imgf000046_0003
Using a 2 neck v shaped flask, combine 6-Methoxy-3,3-dimethyl-2,3,4,4a,10,10a- hexahydro-lH-phenanthren-9-one (1.3g, 4.9mmol),and 4 bromoanisole(0.16ml, 4.9mmol) in dioxane (40 ml) exchange with N2 add sodium t-butoxide, Add Pd[P(C4Hg)3J2 exchange with N2. Heat at 80° stirring over night. Keeping reaction under N2 quench with acetic acid (6 ml). Dilute with ethyl acetate (50 ml), wash with saturated aqueous sodium bicarbonate 3x (50 ml), with brine (40 ml), dry, and concentrate. Chromatograph residue on an biotage eluting with 0-10% ethyl acetate in hexanes to give the title compound (1.6g, 90%): 1H NMR (CDCl3) δ 8.02-7.99 (d, IH), 7.07-7.05 (d, 2H), 6.9-6.88 (d, 2H), 6.85-6.82 (dd, IH), 6.69-6.68 (d, IH), 3.88 (s, 3H), 3.81 (s, 3H), 3.17-3.12 (m, IH), 2.68- 2.62 (m, IH), 1.68-1.60 (m, IH), 1.52-1.44 (m, 3H), 1.41-1.37 (m, IH), 1.30-1.24 (m, IH), 1.18-1.13 (m, IH), 1.1 (s, 3H), 0.99 (s, 3H).
Preparation 72
6-Methoxy-10-(4-methoxy-phenyl)-3,3-dimethyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-ol
Figure imgf000047_0001
Preparation 72 is prepared from preparation 71 in a manner similar to preparation 7. (0.8g, 72%): 1H NMR (CDCl3) 67.51-7.49 (d, IH), 7.12-7.19 (d, 2H), 6.94-6.91 (d, 2H), 6.81-6.78 (dd, IH), 3.83 (s, 3H), 3.81 (s,3H), 3.07-2.98 (m, IH), 1.65-1.49 (m, 7H), 1.43-1.18 (m, 3H), 1.03 (s, 3H), 0.93 (s, 3H).
Preparation 73
6-Methoxy-10-(4-methoxy-phenyl)-3,3-dimethyl-l,2,3,4,4a,10a-hexahydro- phenanthrene
Figure imgf000048_0001
Preparation 73 is prepared from preparation 72 in a manner similar to preparation 8. (0.7g, 92%)%): 1H NMR (CDCl3) δ 7.33-7.31 (d, 2H), 7.02-6.99 (d, IH), 6.90-6.88 (d, 2H), 6.79 (m, IH), 6.70-6.67 (dd, IH), 6.47 (bs, IH), 3.83 (s, 3H), 3.82 (s, 3H), 3.09-2.99 (m, IH), 1.45-1.25 (m, 3H), 1.06-1.03 (m, 2H), 1.0 (s, 3H), 0.95-.89 (m, 2H), 082 (s 3H).
Preparation 74
6-Methoxy-10-(4-methoxy-phenyl)-3,3-dimethyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000048_0002
Preparation 74 is prepared from preparation 73 in a manner similar to preparation 9. (0.38g, 54%): 1H NMR (CDCl3) δ 7.24-7.22 (d,2H), 7.11-7.05 (m, IH), 6.98-6.97 (m, IH), 6.90-6.88 (d, 2H), 6.72-6.69 (dd, IH), 3.82 (s,3H), 3.81 (s, 3H), 3.3-3.26 (m, IH), 2.81-2.75 (m, IH), 1.43-1.17 (m, 6), 1.11-.99 (m, 3H), 0.88 (s, 3H), 0.49 (s, 3H).
Preparation 75 5,5-Dimethyl-cyclohex-2-enone
Figure imgf000048_0003
Dissolve 3-methoxy-5,5-dimethyl-cyclohex-2-enone (Tetrahedron 57 (2001) 217- 225)(10.6g, 68.7 mmol) in ether (500 ml)cool to O0C, add dropwise a 1.5M solution of diisobutyl aluminum hydride (68.7 ml, 103mmol), and stir for 30 minutes. Add saturated aqueous ammonium chloride (25ml), stir lhour, add anhydrous magnesium sulfate (1Og), stir 1 hour. Filter through celite and concentrate. Dissolve the residue in ether (500ml), add toluene-4-sulfonic acid monohydrate (650 mg, 3.44mmol) and water (6.2ml), and stir 1 hour. Wash with saturated aqueous sodium bicarbonate, brine, dry and concentrate to give the title compound as a clear oil (5.Og, 58%): 1H NMR (CDCl3) δ 6.89-6.84 (m, IH), 2.28 (s, 2H), 2.26-2.24 (q, 2H), 1.06 (s, 6H).
Preparation 76 2-(3-Methoxy-phenyI)-5,5-dimethyl-cyclohex-2-enone
Figure imgf000049_0001
Preparation 76 is prepared from preparation 75 in a manner similar to preparation 64. (6.6g, 43 mmol)to give the title compound (5.8g, 87%) : 1H NMR (CDCl3) δ 7.27- 7.24 (m, IH), 6.92-6.84 (m, 4H), 3.81 (s,3H), 2.45 (s, 2H), 2.43-2.42 (d, 2H), 1.11 (s, 6H).
Preparation 77 2-(3-Methoxy-phenyl)-5,5-dimethyl-cyclohexanone
Figure imgf000049_0002
Preparation 77 is prepared from preparation 76 in a manner similar to preparation 65. (5.8g, 99%): 1H NMR (CDCl3) δ 7.27-7.24 (m, IH), 6.82-6.79 (dd, IH), 6.75-6.73 (d, IH), 6.70-6.69 (m, IH), 3.79 (s, 3H),3.53-3.48 (m, IH), 2.37-2.24 (m, 2H), 2.19-2.13 (m, 2H), 1.83-1.69 (m, 2H), 1.11 (s, 3H), 1.00 (s, 3H).
Preparation 78 [2-(3-Methoxy-phenyl)-5,5-dimethyl-cyclohexylidene]-acetic acid methyl ester
Figure imgf000050_0001
Preparation 78 is prepared from preparation 77 in a manner similar to preparation 66. (5.3g, 74%): 1H NMR (CDCl3) δ 7.24-7.20 (m, IH), 6.77-6.69 (m, 3H), 5.19 (s, IH), 3.77 (s, 3H), 3.58 (s, 3H), 3.47-3.43 (d, IH), 3.28-3.24 (dd, IH), 2.06-2.01 (m, 2H), 1.94- 1.87(m, IH), 1.56-1.51(m, 2H), 1.03 (s, 3H), 0.91 (s, 3H).
Preparation 79 [2-(3-Methoxy-phenyl)-5,5-dimethyl-cyclohex-l-enyl]-acetic acid methyl ester
Figure imgf000050_0002
Preparation 79 is prepared from preparation 78 in a manner similar to preparation 67. (4.8g, 100%): 1B NMR (CDCl3) 67.20-7.17 (m, IH), 6.76-6.68 (m, 3H), 3.76 (s, 3H), 3.61 (s, 3H), 2.89 (s, 2H), 2.29-2.26 (t, 2H), 1.86 (s, 2H), 1.46-1.43(t, 2H), 0.95 (s, 6H).
Preparation 80 [2-(3-Methoxy-phenyI)-5,5-dimethyl-cycIohexyl]-acetic acid methyl ester
Figure imgf000050_0003
Preparation 80 is prepared from preparation 79 in a manner similar to preparation 3. (2g, 99%): 1H NMR (CDCl3) δ 7.21-7.17 (t, IH), 6.83-6.81 (d, IH), 6.79-6.79 (t, IH), 6.75-6.73 (dd, IH), 2.96-2.92 (m, IH), 2.56-2.48 (m, IH), 2.09-2.07 (d, 2H), 1.92-173 (m, 2H), 1.66-1.52 (m, 3H), 1.43-1.39 (m, IH), 1.33-1.26 (m, IH), 1.02 (s, 3H), 1.0 (s, 3H).
Preparation 81 [2-(3-Methoxy-phenyl)-5,5-dimethyl-cycIohexyl]-acetic add
Figure imgf000051_0001
Preparation 81 is prepared from preparation 80 in a manner similar to preparation 4. (O.95g, 99%): 1H NMR (CDCl3) 6 7.21-7.17 (t, IH), 6.84-6.82 (d, IH), 6.79-6.78 (t, IH), 676-6.73 (dd, IH), 3.79 (s, 3H), 2.98-2.93 (q, IH), 2.55-2.46 (m, IH), 2.13-2.09 (dd, 2H), 1.93-1.73 (m, 2H), 1.66-1.55 (m, 2H), 1.46-1.41 (m, IH), 1.33-1.27 (m, IH), 1.04 (s, 3H), 1.00 (s, 3H).
Preparation 82 6-Methoxy-2,2-dimethyl-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one
Figure imgf000051_0002
Preparation 82 is prepared from preparation 81 in a manner similar to preparation 5. (.72g, 81%): 1H NMR (CDCl3) δ 8.06-8.04 (d, IH), 6.87 (s, IH), 6.84-6.81 (dd, IH), 3.87 (s, 3H), 3.21-3.17 (m, IH), 2.77-2.72 (m, IH), 2.55-2.47 (m, 2H), 2.28-2.22 (m, IH), 1.98-1.88 (m, IH), 1.21-1.13 (m, 4H), 0.98 (s, 3H), 0.79 (s, 3H).
Preparation 83
6-Methoxy-10-(4-niethoxy-phenyl)-2,2-dimethyl-2,3,4,4a,10,10a-hexahydro-lH- phenanthren-9-one
Figure imgf000052_0001
Preparation 83 is prepared from preparation 82 in a manner similar to preparation 6. (.43g 49%): 1H NMR (CDCl3) δ 8.16-8.14 (d, IH), 7.01-6.99 (d, 2H), 6.89-6.86 (m, 2H), 6.80-6.78 (d, 2H), 3.89 (s, 3H), 3.75 (s, 3H), 3.61-3.60 (m, IH), 3.13-3.11 (m, IH), 2.56-2.51 (m, IH), 2.23-2.18 (m, IH), 1.84-1.77 (m, IH), 1.49-1.46 (d, 2H), 1.33-1.21 (m, 2H), 0.98 (s, 3H), 0.82 (s, 3H).
Preparation 84
6-Methoxy-10-(4-methoxy-phenyl)-2,2-dimethyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-oI
Figure imgf000052_0002
Preparation 84 is prepared from preparation 83 in a manner similar to preparation 7. (.34g, 55%): 1H NMR (CDCl3) δ 7.51-7.49 (d, IH), 7.19-7.17 (d, 2H), 6.93-6.88 (m, 3H), 6.83-6.78 (m, 2H), 4.63-4.59 (m, IH), 3.83 (s, 3H), 3.82 (s, 3H), 2.90-2.85 (m, IH), 2.78-2.73 (m, IH), 2.43-2.40 (m,lH), 2.04-1.96 (m, IH), 1.52-1.45 (m, 2H), 1.38-1.34 (m, 2H), 1.26-1.24 (m, 2H), 0.82 (s, 3H), 0.79 (s,3H).
Preparation 85
6-Methoxy-10-(4-methoxy-phenyl)-2,2-dimethyl-l,2,3,4,4a,10a-hexahydro- phenanthrene
Figure imgf000053_0001
Preparation 85 is prepared from preparation 84 in a manner similar to preparation 8. (.3g 93%): 1H NMR (CDCl3) δ 7.49-7.46 (d, 2H), 7.05-7.03 (d, IH), 6.89-6.86 (m, 3H) 6.69-6.66 (m, 2H), 3.80 (s, 3H), 3.79 (s, 3H), 3.15-3.12 (m, IH), 2.98-2.92 (m, IH), 2.33-2.28 (m, IH), 2.0-1.92 (m, Ih), 1.47-1.39 (m, 2H), 1.23-1.12 (M, 2H), 1.04 (s, 3H), 0.74 (s, 3H).
Preparation 86
6-Methoxy-10-(4-methoxy-ρhenyl)-2,2-dimethyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000053_0002
Preparation 86 is prepared from preparation 85 in a manner similar to preparation 9. (.3g, 99%): 1H NMR (CDCl3) δ 7.17-7.15 (d, 2H), 7.03-7.01 (d, IH), 6.88-6.87 (m, IH), 6.83-6.81 (d, 2H), 6.80-6.65 (dd, IH), 3.75 (s, 3H), 3.74 (s, 3H), 3.10-3.08 (m, 3H), 2.83-2.76 (m, IH), 2.24-2.16 (m, 2H), 1.91-1.83 (m, IH), 1.04-1.0 (m, 2H), 0.94-0.80 (m, 2H), 0.76 (s, 3H), 0.66 (s, 3H).
Preparation 87 2-(2,5-Dimethoxy-phenyl)-cyclopentanecarboxylic acid ethyl ester
Figure imgf000053_0003
Dissolve 2-(2,5-dimethoxy-phenyl)-cyclopent-l-enecarboxylic acid ethyl ester (5g, 18mmol) in methanol (150 ml) exchange with N2 3X, add platinum oxide (l,6g 7.2 mmol), add 60 psi of H2 for 24 hours at room temperature. Filter off catalyst, concentrate the filtrate to give the title compound (4.5 g, 89%): 1H NMR (CDCl3) δ 6.77-6.67 (m, 3H), 3.81 (s, 3H), 3.74 (s, 3H), 3.71-3.57 (m, 3H), 3.32-3.27 (m, IH), 2.13-1.96 (m, 4H), 1.89-1.83 (m, IH), 1.70-1.62 (m, IH), 0.83-0.79 (t, 3H).
Preparation 88 [2-(2,5-Dimethoxy-phenyI)-cyclopentyl]-methanol
Figure imgf000054_0001
Dissolve 2-(2,5-dimethoxy-phenyl)-cyclopentanecarboxylic acid ethyl ester (4.5g, 16mmol) in tetrahydrofuran (80 ml), add a 1.0M solution of lithium aluminum hydride in tetrahydrofuran (49 ml, 49mmol), and stir at room temperature for 1 hour. Pour slowly into a mixture of ether and aqueous Rochelle's Salt, stir over night, separate layers, wash organic with brine, dry and concentrate to give the title compound (3.6g, 94%): 1H NMR (CDCl3) δ 6.82-6.70 (m, 3H), 3.82 (s, 3H), 3.77 (s,"3H), 3.66-3.60 (m, IH), 3.30-3.23 (m, IH), 3.07-3.01 (m, IH), 2.53-2.43 (m, IH), 2.14-2.11 (m, IH), 2.03-1.98 (m, IH), 1.94- 1.89 (m, 2H), 1.81-1.71 (m, 2H), 1.43-1.38 (m, IH).
Preparation 89 Methanesulfonic acid 2-(2,5-dimethoxy-phenyl)-cyclopentylmethyl ester
Figure imgf000054_0002
Dissolve [2-(2,5-dimethoxy-phenyl)-cyclopentyl]-methanol (3.6g, 15mmol) in dichloromethane (94 ml), add 2,6-dimethylaminopyridine (0.4g, .31 mmol), add triethylamine (4.7ml, 33.5mmol), cool to O0C, add methanesulfonyl chloride(1.9g, 17mmol), remove ice bath and stir 2 hours at room temperature. Quench with water and ethyl acetate, separate layers, wash with brine, dry and concentrate to give the title compound (4.8g, 100%): 1H NMR (CDCl3) δ 6.78-6.69 (m, 3H), 3.86-3.82 (m, IH), 3.79 (s, 3H), 3.76 (s, 3H), 3.68-3.64 (m,lH), 3.53-3.47 (m, IH), 2.83-2.76 (m, IH), 2.69 (s,3H), 1.97-1.88 (m, 3H), 1.67-1.60 (m,3H).
Preparation 90 [2-(2,5-Dimethoxy-phenyl)-cycIopentyl]-acetonitrile
Figure imgf000055_0001
Dissolve methanesulfonic acid 2-(2,5-dimethoxy-phenyl)-cyclopentylmethyl ester (4.8g, 15mmol) in DMSO (25ml), add sodium cyanide (12g, 16mmol), and heat at 1000C over night. Cool to room temperature and quench with water and ethyl acetate. Separate layers, wash organic with water 3x, brine 2x, dry and concentrate to give the title compound (3.4g 91%): 1H NMR (CDCl3) δ 6.79-6.72 (m,3H), 3.79 (s, 3H), 3.77 (s, 3H), 3.54-3.48 (m, IH), 2.77-2.70 (m, IH), 2.17-2.09 (m, IH), 1.96-1.89 (m, 4H), 1.78-1.59 (m, 3H).
Preparation 91 [l-φjS-Dimethoxy-phenyty-cyclopentyrj-acetaldehyde
Figure imgf000056_0001
Dissolve [2-(2,5-dimethoxy-phenyl)-cyclopentyl]-acetonitrile (3.9g, lόmmol) in ether (85ml), cool to -1O0C, add diisobutylaluminum hydride 1.5M in toluene (19ml, 29mmol), and stir at -100C for 1 hour. Quench with IN hydrochloric acid, and add ethyl acetate. Separate layers, wash organic with brine, dry, and concentrate to give the title compound (3g, 76%): 1H NMR (CDCl3) 69.50-9.49 (m, IH), 6.77-6.69 (m, 3H), 3.77 (s, 3H), 3.76 (s, 3H), 3.58-3.54 (m, IH), 2.88-2.83 (m, IH), 2.08-1.87 (m, 5H), 1.74-1.65 (m, 2H), 1.44-1.39 (m, IH).
Preparation 92 [2-(2,5-Dimethoxy-phenyl)-cyclopentyl] -acetic acid
Figure imgf000056_0002
Prepare according to: Organic letters (2003) Vol.5, No.7 1031-1034 using [2- (2,5-Dimethoxy-phenyl)-cyclopentyl]-acetaldehyde (Ig, 4mmol) and Oxone (2.5g, 4mmol) to give the title compound (Ig, 94%): 1H NMR (CDCl3) δ 6.77-6.67 (m, 3H), 3.76 (s, 3H), 3.75 (s, 3H), 3.59-3.53 (m, IH), 2.79-2.73 (m, IH), 2.0-1.81 (m, 5H), 1.73- 1.66 (m, 2H), 1.50-1.43 (m, IH).
Preparation 93 6,9-Dimethoxy-l,2,3,3a,4,9b-hexahydro-cycIopenta[a]naphthalen-5-one
Figure imgf000057_0001
Preparation 93 is prepared from preparation 92 in a manner similar to preparation 5. (0.9g, 97%): 1H NMR (CDCl3) δ 6.99-6.96 (d, IH), 6.78-6.76 (d, IH), 3.84 (s, 3H), 3.82 (s, 3H), 3.41-3.35 (q, IH), 2.73-2.65 (m, IH), 2.6-2.46 (m, 2H), 2.44-2.36 (m, IH), 1.97-1.88 (m, IH), 1.85-1.69 (m, 2H), 1.55-1.47 (m, IH).
Preparation 94
6,9-Dimethoxy-4-(4-methoxy-phenyl)-l,2,3,3a,4,9b-hexahydro- cyclopenta[a]naphthalen-5-one
Figure imgf000057_0002
Preparation 94 is prepared from preparation 93 in a manner similar to preparation 71. (0.79g, 61%) : 1H NMR (CDCl3) δ 7.08-7.06 (d, 2H), 6.97-6.95 (d, IH), 6.87-6.85 (d, 2H), 6.77-6.75 (d, IH), 3.83 (s, 3H), 3.79 (s, IH), 3.72-3.69 (d, IH), 3.54-3.48 (q, IH), 2.93-2.86 (m, IH), 2.56-2.47 ((m, IH), 1.85-1.58 (m, 4H), 1.5-1.4 (m, IH).
Preparation 95
6,9-Dimethoxy-4-(4-niethoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-5-ol
Figure imgf000057_0003
Preparation 95 is prepared from preparation 94 in a manner similar to preparation 7. (0.57g, 72%) : 1H NMR (CDCl3) δ 7.30-7.23 (m, 2H), 6.92-6.89 (m, 2H), 6.78-6.68 (m, 2H), 4.97-4.95 (m, IH), 4.03-3.98 (m, IH), 3.82 (s, 3H), 3.81 (s, 3H), 3.78 (s, 3H), 3.34-3.28 (m, IH), 3.0-2.93 (m, IH), 2.78-2.66 (m, IH), 2.50-2.38 (m, 2H), 1.83-1.76 (m, IH), 1.68-1.62 (m, 2H), 1.43-1.36 (m, IH).
Preparation 96
6,9-Dimethoxy-4-(4-methoxy-phenyl)-2,3,3a,9b-tetrahydro-lH- cyclopenta[a]naphthalene
Figure imgf000058_0001
Preparation 96 is prepared from preparation 95 in a manner similar to preparation 8. (0.2Og, 37%): 1H NMR (CDCl3) δ 7.41-7.39 (d, 2H), 6.92-6.87 (m, 3H), 6.67-6.66 (d, 2H), 3.83 (s, 3H), 3.82 (s, 3H), 3.79 (s, 3H), 3.48-3.46 (m, 2H), 2.89-2.22 (m, IH), 2.14- 2.06 (m, IH), 1.67-1.60 (m, IH), 1.53-1.42 (m, 4H).
Preparation 97
6,9-Dimethoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene
Figure imgf000058_0002
Preparation 97 is prepared from preparation 96 in a manner similar to preparation 9. (0.19g, 94%): 1H NMR (CDCl3) δ 7.24-07.22 (d, 2H), 6.88-6.85 (d, 2H), 6.66-6.65 (d, 2H), 3.81 (s, 3H), 3.80 (s, 3H), 3.78 (s, 3H), 3.62-3.56 (m, IH), 3.13-3.08 (m, IH), 3.02- 2.97 (m, IH), 2.71-2.64 (m, IH), 2.60-2.52 (m, IH), 2.40-2.33 (m, IH), 1.53-1.23 (m, 5H). Preparation 98
6-Hydroxy-8-methoxy-4-(4-methoxy-phenyl)-l,2,3,3a,4,9b-hexahydro- cyclopenta [a]naphthaIen-5-one
Figure imgf000059_0001
Combine 6,8-Dimethoxy-4-(4-methoxy-phenyl)-l,2,3,3a,4,9b-hexahydro- cyclopenta[a]naphthalen-5-one (0.15g, 0.43mmol), boron trichloride (2.1 ml, l.OM in methylene chloride), and Ch2Cl2 ( 10ml). Stir 3.5 hours at r.t. Quench with methanol, add water and extract with ethyl acetate. Wash with water, dry and concentrate in vacuo to give the titled compound (0.148g, 100%). MS m/z 339 (M-I).
Preparation 99
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,9b-tetrahydro-lH-cyclopenta[a]naphthalen-
6-ol
Figure imgf000059_0002
Preparation 99 is prepared from preparation 98 in a manner similar to preparations 7 and 8. 1H NMR (CDCl3): 7.43 (m, 2H), 6.9 (d, J=8.8 Hz, 2H), 6.85 (m, IH), 6.45(m, IH), 6.2 ( s, IH), 3.83 (s, 3H), 3.8 (m, 3H), 3.4-3 (m, IH), 2.2-1.95 (m, 3H), 1.7-1.4 (m, 4H).
Preparation 100
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta [a]naphthalen-6-ol
Figure imgf000060_0001
Preparation 100 is prepared from preparation 99 in a manner similar to preparation 9. 1H NMR (CDCl3): 7.23 (d, J=8.8 Hz, 2H), 6.87 (d, J=8.8 Hz, 2 H), 6.38 (s, IH), 6.24 (s, 1 H ), 3.81 (s, 3H), 3.78( s, 3H), 3.4 (m, IH), 3.1 (m, IH), 2.85(m, IH), 2.7 (m, IH), 2.5 ( m, IH), 2.19 (m, IH), 1.7-1.1 (m, 5H).
Preparation 101
Trifluoromethanesulfonic acid 8-methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b- hexahydro-lH-cyclopenta[a]naphthalen-6-yl ester
Figure imgf000060_0002
Combine 8-Methoxy-4~(4-memoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-6-ol (0.43g, 1.33mmol), triflic anyhydride (0.56 ml, 3.31 ml), 2,6-di-t-butyl-4-methylpyridine (1.36g, 6.63 mmol) in methylene chloride (40 ml) and stir 15 hours at r.t. Wash 2X with IN HCl, 2X with water, dry over anhydrous sodium sulfate and concentrate to a residue which is chromatographed on silica gel with hexanes/ ethyl acetate, 9-1 to yield the titled compound (0.38g, 63%). 1H NMR (CDCl3): 7.2 (d, J=8.8 Hz, 2H), 6.88 (d, J=8.8 Hz, 2 H), 6.77 (s, IH), 6.65 (s, 1 H ), 3.81 (s, 6H), 3.45 (m, IH), 3.1 (m, IH), 2.95(m, IH), 2.85 (m, IH), 2.59 ( m, IH), 2.21 (m, IH), 1.6-1.35 (m, 5H).
Preparation 102
6-(4-ChIoro-phenyl)-8-methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene
Figure imgf000061_0001
Combine trifluoro-methanesulfonic acid 8-methoxy-4-(4-methoxy-phenyl)- 2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalen-6-yl ester (0.046g, 0.1 mmol), 4- chlorophenyboronic acid (0.019g, 0.12 mmol), tetrakis(triphenylphosphine)palladium(0) (0.006g, 5 mole%), sodium carbonate (0.12 ml 2N), and toluene/ethanol (4-1). Purge in vacuo briefly, and heat at 900C for 12 hours. Remove solvent, take in ethyl acetate and wash with water. Dry over anhydrous sodium sulfate and chromatograph the residue on silica gel with 5% ethyl acetate in hexanes to yield the titled compound (0.13g, 31%). 1H NMR (CDCl3): 7.34 (d, J=8.8 Hz, 2H), 7.26 (d, J=8.8 Hz, 2 H), 7.1 (d, J=8.87 Hz, 2H), 6.8 (d, J=8.8 Hz, 2H ), 6.78 (s, IH), 6.62 (s, IH), 3.82 (s, 3H), 3.77 (s, 3H), 3.45 (m, IH), 2.98 (m, IH), 2.85(m, IH), 2.57 (m, IH), 2.3 ( m, IH), 2.21 (m, IH), 1.65-1.2 (m, 5H).
Preparation 103
8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene-6-carboxylic acid methyl ester
Figure imgf000061_0002
Combine trifluoro-methanesulfonic acid 8-methoxy-4-(4-methoxy-phenyl)- 2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalen-6-yl ester (O. Ig, 0.22 mmol), palladium acetate (0.0393g, 0.18 mmol), 1,3 — bis(diphenylphosphino)-propane (0.0723g, 0.18 mmol), with dDMSO (6 ml) and methanol (2 m), and heat at 80-850C for 12 hours under an atmosphere of carbon monoxide. Remove solvent in vacuo, take in ethyl acetate and wash 5X with water. Dry over anhydrous sodium sulfate and chromatograph the residue on silica gel with 10% ethyl acetate in hexanes to yield the titled compound (0.07g, 88%). 1H NMR (CDCl3): 7.21 (d, J=7.9, Hz, 2H), 7.19 (s, IH), 6.9(s, IH), 6.86 (d, J=7.9 Hz, 2H ), 3.86 (s, 3H), 3.82 (s, 3H), 3.8 (s, 3H), 3.45 (m, IH), 3.22 (m, IH), 3.1 (m, 2H), 2.58 (m, IH), 2.2 (m, IH), 1.6-1.3 (m, 5H).
Preparation 104
[8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-6-yl]-methanol
Figure imgf000062_0001
Combine 8-Methoxy-4-(4-methoxy-phenyl)~2,3,3a,4,5,9b-hexahydro~lH- cyclopenta[a]naphthalene-6-carboxylic acid methyl ester (0.16g, 0.44 mmol), lithium aluminum hydride (0.08g, 1.31 mmol) in tetrahydrofuran (10 ml) and stir for 2.5 hours. Add water ( 0.05g), add 15% NaOH ( 0.05g), add water ( 0.15g) and stir 30 minutes. Add EtOAC, filter ppt. Rinse organic layer with water, then In HCl, then water. Dry over anhydrous sodium sulfate and remove solvent in vacuo to yield the titled compound (0.153g, 100%). H NMR (CDCl3): 7.22 (d, J=8.8, Hz, 2H), 6.87 (d, J=8.4 Hz, 2H), 6.82 (s, IH), 6.71(s, IH), 4.7 (s, 2H), 3.81 (s, 3H), 3.45 (m, IH), 3.1 (m, IH), 2.85 (m, 2H), 2.55 (m, IH), 2.2 (m, IH), 1.6-1.3 (m, 5H).
Preparation 105
8-Hydroxy-4-(4-hydroxy-phenyl)-2,3,3aj4,5,9b-hexahydro-lH- cydopenta[a]naphthalene-6-carbaldehyde
Figure imgf000062_0002
Combine 6-Bromomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol (0.037g, 0.1 mmol), trimethylamine N-oxide (0.03g, 0.4 mmol), DMSO (1.5 ml), and methylene chloride (0.5 ml) and stir at 0-50C for 30 minutes. Add water and ethyl acetate. Wash organic layer 5X with water, dry over anhydrous sodium sulfate and concentrate to a residue which yields after separation on silica gel with 33% EtOAC/hexanes, the titled compound (0.12g, 39%). 1H NMR (CD3OD) 10.26 (s, IH), 7.18 (d, J=8.4, Hz, 2H), 7.12 (s, IH), 6.97 (s, IH), 6.77 (d, J=7.9 Hz, 2H), 3.4 (m, IH), 3.15 (m, IH), 3.0 (m, 2H), 2.55(m, IH) 2.2 (m, IH), 1.6-1.2. MS m/z 307 (M-I).
Preparation 106 2-(3,5-Dimethoxy-phenyl)-cyclohexanol
Figure imgf000063_0001
Preparation 106 is prepared from cyclohexene oxide and l-bromo-3,5- dimethoxybenzene in a manner similar to preparation 10. 1H NMR (CDCl3): 6.41 (s, 2H), 6.35(s, IH), 3.79 (s, 6H), 3.65 (m, IH), 2.37 (m, IH), 2.1 (m, IH), 1.85 (m, 2H), 1.75 (m, lH)1.6-1.2 (m, 4H).
Preparation 107 2-(3,5-Dimethoxy-phenyl)-cyclohexanone
Figure imgf000063_0002
Preparation 107 is prepared from preparation 106 in a manner similar to preparation 11. 1H NMR (CDCl3): 6.4 (s, IH), 6.33(s, 2H), 3.81 (s, 6H), 3.59 (m, IH), 2.5 (m, 2H), 2.3 (m, IH), 2.2-1.95 (m, 3H), 1.85 (m, 2H).
Preparation 108 [2-(3,5-Dimethoxy-phenyl)-cyclopent-l-enyl]-acetic acid ethyl ester
Figure imgf000064_0001
Preparation 108 is prepared from preparation 107 in a manner similar to preparations 1 and 2. 1H NMR (CDCl3): 6.38 (s, 3H), 4.14 (q, J= 7 Hz, 2H), 3.8 (s, 6H), 3-2.8 (m, 2H), 2.3 (s, 2H), 2.15 (s, 2H), 1.75 (m, 4H), 1.6 (s, 2H), 1.25 (q, J=7 Hz, 3H).
Preparation 109 [2-(3,5-Dimethoxy-phenyl)-cyclopentyl]-acetic acid ethyl ester
Figure imgf000064_0002
Preparation 109 is prepared from preparation 108 in a manner similar to preparation 3. 1H NMR (CDCl3) ): 6.38 (s, 2H), 6.33 (s, IH), 4.04 (q, J= 7 Hz, 2H), 3.81 (s, 6H), 2.9 (m, IH), 2.55 (m, IH), 2.35 (m, IH), 2.3-1.3 (series of m, 9H), 1.25 (q, J=7 Hz, 3H).
Preparation 110 6,8-Dimethoxy-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one
Figure imgf000064_0003
Preparation 110 is prepared from preparation 109 in a manner similar to preparation 5. MS m/z 261 (M+ 1).
Preparation 111
6,8-Dimethoxy-10-(4-methoxy-phenyI)-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-
9-one
Figure imgf000065_0001
Preparation 111 is prepared from preparation 110 in a manner similar to preparation 6. MS m/z 367 (M+ 1).
Preparation 112
8-Hydroxy-6-methoxy-10-(4-methoxy-phenyl)-2,3,4,4a,10,10a-hexahydro-lH- phenanthren-9-one
Figure imgf000065_0002
Preparation 112 is prepared from preparation 111 in a manner similar to preparation 98. MS m/z 353 (M+l).
Preparation 113
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l,10- diol
Figure imgf000065_0003
Preparation 113 is prepared from preparation 112 in a manner similar to preparation 7. MS m/z 353 (M-I).
Preparation 114 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a-hexahydro-phenanthren-l-ol
Figure imgf000066_0001
Preparation 114 is prepared from preparation 113 in a manner similar to preparation 8. MS m/z 335 (M-I).
Preparation 115 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-l-ol
Figure imgf000066_0002
Preparation 115 is prepared from preparation 114 in a manner similar to preparation 9. MS m/z 337 (M-I).
Preparation 116
Trifluoro-methanesulfonic acid 3-methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10- octahydro-phenanthren-1-yl ester
Figure imgf000066_0003
Preparation 116 is prepared from preparation 115 in a manner similar to preparation 101. 1H NMR (CDCl3): 7.26 (d, J=8.4 Hz, 2H), 7.03 (s, IH), 6.94 (d, J=8.8 Hz, 2H), 6.74 (s, IH), 3.86 (s, 6H), 3.25(s, IH), 3.1 (m, 3H), 2.5 (m, IH), 2.1 (m, IH), 1.8-0.9 (m, 7H). Preparation 117
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carboxylic acid methyl ester
Figure imgf000067_0001
Preparation 117 is prepared from preparation 116 in a manner similar to preparation 103. 1H NMR (CDCl3): 7.3 (m, 2H), 7.2 (s, IH), 6.93 (d, J=8.4 Hz, 2H), 3.92 (s, 3H), 3.88(s, 3H), 3.85 (s, 3H), 3.5-3.05 (m, 4H), 2.5 (m, IH), 2.05 (m, IH), 1.75 (m, IH), 1.7-1.05 (m, 6H).
Preparation 118
[3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-l-yl]- methanol
Figure imgf000067_0002
Preparation 118 is prepared from preparation 117 in a manner similar to preparation 104. 1H NMR (CDCl3) : 7.3 (m, 2H), 6.95 (m, 4H), 4.77 (s, 2H), 3.87 (s, 3H), 3.88(s, 3H), 3.85 (s, 3H), 3.25 (s, IH), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.5 (m, IH), 2.05 (m, IH), 1.8-1.05 (m, 7H).
Preparation 119
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carboxylic acid
Figure imgf000068_0001
Preparation 119 is prepared from preparation 117 in a manner similar to example 13. MS m/z 365 (M-I).
Preparation 120
3-Methoxy-9-(4-methoxy-phenyI)-4b,556,7,8,8a,9,10-octahydro-phenanthrene-l- carbonyl chloride
Figure imgf000068_0002
Combine 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octaliydro- phenanthrene-1-carboxylic acid (0.12g, 0.33mmol) and thionyl chloride ( 4 ml) and heat at 600C for 2 hours. Remove thionyl chloride in vacuo at 400C. Take the residue into ethyl acetate and wash with sodium bicarbonate solution IX, followed by water. Dry the organic layer over anhydrous sodium sulfate and remove solvent in vacuo at 400C to yield preparation 120 (O.133g, 100%). 1H NMR (CDCl3) : 7.62 (s, IH), 7.3 (m, 3H), 6.93 (d, J=8.4, 2H), 3.92 (s, 3H), 3.85 (s, 3H), 3.3(m, 2H), 3.1 (m, 2H), 3.05 (m, IH), 2.5 (m, IH), 2.1 (m, IH), 1.8 (m, IH), 1.5 (m, IH), 1.4-0.8 (m, 4H).
Preparation 121
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carboxylic acid amide
Figure imgf000068_0003
Combine S-Methoxy-Q-C^methoxy-pheny^^b.S.όJ.δ^a^.lO-octahydro- phenanthrene-1-carbonyl chloride ( 0.08g, 0.18 mmol), NH4OH ( 2 ml), and diethyl ether ( 1 ml) at 0-50C and stir as such 2 hours. Dilute with ethyl acetate and wash with water. Dry over anhydrous sodium sulfate, and remove solvent in vacuo at 400C to yield preparation 121 (0.069g, 100%). MS m/z 366 (M+l).
Preparation 122
3-Methoxy-9-(4-methoxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carbonitrile
Figure imgf000069_0001
Combine 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthrene-1-carboxylic acid amide ( 0.69g, 0.19 mmol), and triethylamine (0.038g, 0.38 mmol) in methylene chloride ( 2.5 ml) at 0-50C and add trifluoroacetic anhydride (0.044g, 0.21 mmol). Let stir at r.t. for 15 minutes. Add water, separate organic layer. Dry over anhydrous sodium sulfate and remove solvent in vacuo to yield preparation 122 ( 0.066g, 100%). 1H NMR (CDCl3): 7.24 (d, J=8.8 Hz, 2H), 7.22 (s, IH), 7.06 (s, IH), 6.94 (d, J=8.8, 2H), 3.86 (m, 6H), 3.2 (m, 4H), 2.5 (m, IH), 2.1 (m, IH), 1.8-0.8 (m, 7H).
Preparation 123
7-Bronio-6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000069_0002
Combine 6-Methoxy- 10-(4-methoxy-phenyl)- 1 ,2,3 ,4,4a,9, 10, 1 Oa-octahydro- phenanthrene (chiral) (0.02g, 0.32 mmol) and methylene chloride (10 ml) and add bromine (0.0162 ml, 0.32 mmol) at 0-50C over 15 minutes. Stir as such one hour. Remove volatiles in vacuo at 400C to yield the titled compound (0.16g, 100%). 1H NMR (CDCl3): 7.38 (s, IH), 7.25 (d, J=8.8 Hz, 2H), 6.9 (m, 3H), 3.93 (s, 3H), 3.85 (s, 3H), 3.2 (m, 3H), 2.85 (dd, J=4 and 11, IH), 2.48 (d, J=14 Hz, IH), 2.06 (m, IH), 1.8-0.8 (m, 7H).
Preparation 124 l-[3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yl]- ethanone
Figure imgf000070_0001
Combine 6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene (0.13g, 0.4mmol) and methylene chloride (6 ml). Cool to -50C and add aluminum chloride (0.11, 0.81 mmol) followed by acetyl chloride (0.032g, 0.4 mmol). After 2 hours, add ice, water and IN HCl. Filter precipitate and rinse filtrate with sodium bicarbonate solution solution followed by brine. Remove solvent in vacuo, and chromatograph on silica gel with 17% ethyl acetate/ hexanes to yield the titled compound (0.08 Ig, 55%). 1H NMR (CDCl3). MS m/z 365, (M+l).
Preparation 125 6,7-Dimethoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthrene
Figure imgf000070_0002
Combine 7-Bromo-6-methoxy- 10-(4-methoxy-phenyl)- 1 ,2,3,4,4a,9, 10, 10a- octahydro-phenanthrene (chiral) (0.025g, O.Oόmmol), NaOMe 5N (1.4 ml, 7 mmol), CuIBr ( 0.005g, 0.034 mmol) and ethyl acetate (0.005 ml, 0.05 mmol) and heat at 1150C for 1.5 hours. Cool, and add IN HCl and extract with ethyl acetate. Wash organic layer with water, dry over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph on silica gel with 9% ethyl acetate/ hexanes to yield the titled compound (0.012g, 55%). 1H NMR (CDCl3). MS m/z 352.9 (M+l).
Preparation 126
6-Methoxy-10-(4-methoxy-phenyl)-7-methyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000071_0001
At -780C, combine 7-Bromo-6-methoxy-10-(4-methoxy-phenyl)- l,2,3,4,4a,9,10,10a-octahydro-phenanthrene (chiral) (0.027g, 0.067 mmol), and CH3Li (0.09 ml, 1.6M), then add t-BuLi (0.1 ml, 1.7M). After 30 minutes add CH3I ( 0.04 ml, 0.61 mmol) and remove cooling. After 1 hour at r.t., add ammonium chloride solution solution and ethyl acetate. Wash organic layer with water, dry over anhydrous sodium sulfate, remove solvent in vacuo to yield the titled compound (0.026g, 100%). 1H NMR (CDCl3): ): 7.27 (d, J=8.8 Hz, 2H), 6.99 (s, IH), 6.93 (d, J=8.8 HZ, 2H), 6.89 (s, IH), 3.87 (s, 3H), 3.86 (s, 3H), 3.2 (m, 2H), 2.85 (dd, J=4 and 11, IH), 2.48 (d, J=14 Hz, IH), 2.06 (m, IH), 1.8-0.8 (m, 8H).
Preparation 127
6-Methoxy-10-(4-methoxy-phenyl)-7-propyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000071_0002
Preparation 127 is prepared from preparation 123 in a manner similar to preparation 126. 1H NMR (CDCl3): 7.2 (d, J=8.8 Hz, 2H), 6.99 (s, IH), 6.93 (d, J=8.8 Hz, 2H), 6.89 (s, IH) 3.87 (s, 3H), 3.86 (s, 3H), 3.2 (m, 3H), 2.85 (m, IH), 2.65 (m, IH), 2.5 (m, 2H), 2.06 (m, 2H), 1.8-1.1 (m, 8H), 1.05 (t, J=7.5 and 5.7 Hz, 3H).
Preparation 128
7-Isopropenyl-6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000072_0001
Preparation 128 is prepared from preparation 124 in a manner similar to example 18. MS m/z 363(M+1).
Preparation 129
7-Isopropyl-6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000072_0002
Combine 7-Isopropenyl-6-methoxy- 10-(4-methoxy-phenyl)- 1 ,2,3 ,4,4a,9, 10, 1 Oa- octahydro-phenanthrene (0.14g, 0.39 mmol) and 10% Pd/C (0.13g) and reduce at 50 psi of H2 O.N. Filter catalyst and remove solvent in vacuo to yield the titled compound (0.13g, 93%). 1H NMR (CDCl3): 7.28 (d, J=8.4 Hz, 2H), 7.02 (s, IH), 6.92 (d, J=8.8 HZ, 2H), 6.89 (s, IH), 3.87 (s, 3H), 3.85 (s, 3H), 3.25 (m, 4H), 2.85 (m, IH), 2.5 (m, IH), 2.06 (m, IH), 1.8-1.1 (m, 13H). Preparation 130
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-2- carbaldehyde
Figure imgf000073_0001
Preparation 130 is prepared from preparation 123, using dimethylformamide as the electrophile, in a manner similar to preparation 126. MS m/z 351 (M+l).
Preparation 131
3-[3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8!,8a,9,10-octahydro-phenanthren-2-yl]- acrylic acid ethyl ester
Figure imgf000073_0002
Combine 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octaliydro- phenanthrene-2-carbaldehyde (1.77g, 5.13 mmol), carboethoxy-methylene triphenylphosphorane (03.19g, 9.03 mmol) in toluene (53ml) and reflux 15 hours. Remove solvent in vacuo, slurry with diethyl ether and chromatograph the residue from the concentrated filtrate on silica gel with 20% ethyl acetate/hexanes, then 25% ethyl acetate/ hexanes to yield the titled compound (1.61g, 76%). MS m/z 421(M+1).
Preparation 132
3-[3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yl]- propionic acid ethyl ester
Figure imgf000074_0001
Preparation 132 is prepared from preparation 131 in a manner similar to preparation 129. 1H NMR (CDCl3) 7.27 (d, J=7.1 Hz, 2H), 6.98 (s, IH), 6.93 (d, J=7 HZ, 2H), 6.88 (s, IH) 4.19 (q, J=5 and 7 Hz, 2H), 3.86 (s, 6H), 3.2 (m, 3H), 2.95 (m, IH), 2.85 (m, IH), 2.65 (m, 3H), 2.55 (m, IH), 2.06 (m, IH), 1.8-1.1 (m, 10H).
Preparation 133
Methanesulfonic acid 9-(4-methanesulfonyloxy-phenyl)-2-(3-methanesulfonyloxy- propyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yI ester
Figure imgf000074_0002
Combine 9-(4-Hydroxy-phenyl)-2-(3-hydroxy-propyl)-4b,5,6,7,8,8a,9,10- octahydro-phenanthren-3-ol (O.lg, 0.284 mmol), methanesulfonyl chloride (0.1 Ig, 0.94 mmol), triethylamine(0.19g, 1.9 mmol), 2,6-dimethylaminopyridine (0.02g, cat.) and methylene chloride (5 ml) and stir 15 hours. Remove solvent in vacuo and add ethyl acetate and water. Wash IX with sodium bicarbonate solution solution followed by water. Dry over anhydrous sodium sulfate and remove solvent in vacuo to yield preparation 133 (0.16g, g, 96 %). 1H NMR (CDCl3): 7.34 (d, J= 8.8 Hz, 2H), 7.28 ( d, J= 8Hz, 2H), 7.26 (s, IH), 7.09 (s, IH), 4.28 ( t, J=7.1 and 6.2 Hz, 2H), 3.24 (m, 6H), 3.16 (s, 3H), 3.03 (s, 3H), 2.9 (d, J= 11.9 Hz, IH), 2.82 (t, J=7.5 and 8.4 Hz, 3H), 2.45 (d, J= 13.7 Hz, IH), 2.1 (m, 3H), 1.8-1.0 (m, 6H).
Preparation 134
Methanesulfonic acid 9-(4-methanesulfonyloxy-phenyl)-2-(3-methoxy-propyl)- 4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yl ester
Figure imgf000075_0001
Preparation 134 is prepared in a manner similar to Example 16. MS m/z 523 (M+l).
Preparation 135
3-Methoxy-9-(4-methoxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-2- carboxylic acid methyl ester
Figure imgf000075_0002
At -780C, combine 7-Bromo-6-methoxy-10-(4-methoxy-phenyl)- l,2,3,4,4a,9,10,10a-octahydro-phenanthrene (0.2g, 0.5 mmol), tetrahydrofuran (4ml), CH3Li (0.623 ml, 1.6M), then add t-BuLi (0.59 ml, 1.7M). After 30 minutes add methyl chloroformate ( 0.19g, 2.0 mmol) and remove cooling. After 2 hours at r.t., add ammonium chloride solution solution and ethyl acetate. Wash organic layer with water, dry over anhydrous sodium sulfate, remove solvent in vacuo to yield the titled compound (0.21g, 100%). MS m/ζ 381 (M-I).
Preparation 136
3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-2- carboxylic acid
Figure imgf000075_0003
Preparation 136 is prepared from preparation 135 in a manner similar to Example 1. MS m/z 337 (M-I). Preparation 137
3-Hydroxy-9-(4-methoxy-phenyl)-4b,5,6,7,8|)8a,9,10-octahydro-phenanthrene-2- carbaldehyde
Figure imgf000076_0001
Preparation 137 is prepared from preparation 130 in a manner similar to Example 1. MS m/z 321 (M-I).
Preparation 138
Trifluoro-methanesulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,10a- hexahydro-phenanthren-9-yl ester
Figure imgf000076_0002
Combine 6-methoxy~10-(4-methoxy-phenyl)-2,3,4,4a,10,10a-hexahydro-lH- phenanthren-9-one (l.llg, 3.18 mmol), 2,6-di-tert-butyl-(4-methylpyridine) (1.34g, 6.54 mmol), triflic anhydride (1.0 mL, 5.94 mmol), and methylene chloride (30.0 mL), and stir under nitrogen atmosphere at room temperature. After 18 hours, quench reaction with IN HCl (5 mL) and extract with ethyl acetate. Wash the ethyl acetate with brine, then dry the organic phase with anhydrous sodium sulfate and concentrate. Flash chromatograph using 0% to 30% ethyl acetate/hexanes to yield the titled compound (1.33g, 89%) as a yellow foam. TLC Rf=0.24 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.44 (d, IH, /=8.8 Hz), 7.37 (d, 2H, 7=8.4 Hz), 6.96 (m, 3H), 6.84 (d, IH, 7=8.4 Hz), 3.88 (m, 6H), 3.38 (s, IH), 2.78 (m, IH), 2.50 (d, IH, 7=13.7 Hz), 1.82 (m, IH), 1.57 (m, 3H), 1.36 (m, 2H), 1.24 (m, 2H), 1.10 (m, IH), 1.23 (m, IH). Preparation 139
6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,10a-hexahydro-phenanthren-9- carboxylic acid methyl ester
Figure imgf000077_0001
Combine trifluoro-methanesulfonic acid 6-methoxy-10-(4-methoxy-phenyl)- l,2,3,4,4a,10a-hexahydro-phenanthren-9-yl ester (19.83g, 42.3 mmol), palladium acetate (1.93g), dppb (4.58g), Et3N (60.0 niL), methanol (265 mL), and DMSO (400.0 mL), and stir under 100 psi of CO atmosphere at 8O0C. After 18 hours, add ethyl acetate and wash the ethyl acetate 5X with brine, then dry the organic phase with anhydrous sodium sulfate and concentrate. Flash chromatograph using 5% to 30% ethyl acetate/hexanes to yield the titled compound (10.06g, 63%) as a pinkish-white solid. TLC Rf=0.25 in 6:1 hexanes-.ethyl acetate. 1H NMR (CDCl3): 7.31 (m, 2H), 7.25 (d, IH, /=8.4 Hz), 6.92 (m, 3H), 6.76 (dd, IH, 7=8.6, 2.4 Hz), 3.86 (m, 6H), 3.60 (s, 3H), 3.25 (d, IH, /=4.4 Hz), 2.70 (m, IH), 2.40 (m, IH), 1.75 (m, IH), 1.53 (m, 4H), 1.31 (m, 2H).
Preparation 140
6-Methoxy-10-(4-methoxy-phenyI)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- carboxylic acid methyl ester
Figure imgf000077_0002
Combine 6-methoxy-10-(4-methoxy-phenyl)-l ,2,3,4,4a, lOa-hexahydro- phenanthren-9-carboxylic acid methyl ester (10.06g, 26.6 mmol), 10% Pd-C (1.014g), acetic acid (100 mL), methanol (150 mL), and ethyl acetate (150 mL), and stir under 100 psi of hydrogen atmosphere at 5O0C. After 18 hours, filter reaction through Celite using ethyl acetate and concentrate to yield the titled compound (9.97g, 99%) as a white solid. TLC Rf=0.25 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.28 (m, IH), 7.22 (d, 2H, /=8.8 Hz), 6.98 (d, IH, 7=2.2 Hz), 6.84 (d, 2H, 7=8.8 Hz), 6.80 (d, IH, 7=2.6 Hz), 4.33 (d, IH, 7=7.9 Hz), 3.86 (s, 3H), 3.82 (s, 3H), 3.55 (m, IH), 3.51 (s, 3H), 3.06 (m, IH), 2.36 (m, 2H), 1.78 (m, 3H), 1.38 (m, 4H).
Preparation 141
6-Methoxy-10-(4-methoxy-phenyI)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- carboxylic acid methyl ester
Figure imgf000078_0001
Combine memoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-carboxylic acid methyl ester (9.95g,26.15 mmol), NaOMe (0.283g, 5.23 mmol), methanol (32 mL), and tetrahydrofuran (125 mL), and stir under nitrogen atmosphere at 4O0C. After 3 hours, concentrate reaction to dryness and add ethyl acetate. Wash with water and then brine, dry the organic phase with anhydrous sodium sulfate and concentrate to yield the titled compound (10.03g, 99%) as a yellow-white solid. TLC Rf=0.25 in 6: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.27 (d, 2H, 7=8.8 Hz), 7.20 (d, IH, 7=8.4 Hz), 6.99 (m, IH), 6.90 (d, 2H, 7=8.4 Hz), 6.77 (dd, IH, 7=8.4, 2.6 Hz), 4.36 (d, IH, 7=12.3 Hz), 3.84 (m, 6H), 3.60 (s, 3H), 3.54 (dd, IH, 7=12.6, 2.9 Hz), 3.36 (s, IH), 2.51 (d, IH, 7=14.1 Hz), 2.01 (m, IH), 1.72 (m, 2H), 1.45 (m, 2H), 1.11 (m, 3H).
Preparation 142
[6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- yl] -methanol
Figure imgf000079_0001
Combine 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-carboxylic acid methyl ester (4.25g, 11.17 mmol), lithium aluminum hydride (1.2Og, 32.39 mmol), and tetrahydrofuran (150 mL), and reflux under nitrogen atmosphere. After 3 hours, quench reaction by adding reaction to a stirred solution of Rochelle's salt (Na K Tartrate) and ethyl acetate. After several hours, separate the organic phase and wash with brine. Dry the organic phase with anhydrous sodium sulfate and flash chromatograph using 5% to 30% ethyl acetate/hexanes to yield the titled compound (3.54g, 90%) as a white solid. TLC Rf=O.13 in 4:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.43 (d, IH, 7=8.8 Hz), 7.26 (d, 2H, 7=8.4 Hz), 7.00 (m, IH), 6.93 (d, 2H, 7=8.8 Hz), 6.84 (dd, IH, 7=8.4, 2.6 Hz), 4.05 (dd, IH, 7=11.2, 3.3 Hz), 3.86 (m, 6H), 3.62 (dd, IH, 7=11.0, 2.6 Hz), 3.34 (m, 3H), 2.49 (d, IH, 7=13.7 Hz), 1.95 (m, IH), 1.65 (m, 2H), 1.45 (m, 2H), 1.30 (m, IH), 1.16 (m, 2H).
Preparation 143
Toluene-4-sulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a- octahydro-phenanthren-9-ylmethyl ester
Figure imgf000079_0002
Combine [6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- ρhenanthren-9-yl] -methanol (1.45g, 3.81 mmol), TosCl (0.8Og, 4.19 mmol), Et3N (1.2 mL, 8.38 mmol), 2,6-dimethylaminopyridine (140.0 mg, 1.14 mmol), and methylene chloride (30 mL), and stir under nitrogen atmosphere at room temperature. After 18 hours, concentrate reaction under vacuum and add ethyl acetate. Wash with water and then brine. Dry the organic phase with anhydrous sodium sulfate and concentrate to yield the titled compound (1.83g, 95%) as a yellowish-white solid. TLC Rf=0.30 in 2:1 hexanesrethyl acetate. 1H NMR (CDCl3): 7.53 (d, 2H, 7=8.4 Hz), 7.22 (d, 2H, /=8.4 Hz), 7.16 (d, IH, 7=8.8 Hz), 7.06 (d, 2H, 7=8.8 Hz), 6.92 (d, IH, 7=2.2 Hz), 6.83 (d, 2H, 7=8.4 Hz), 6.66 (dd, IH, 7=8.8, 2.6 Hz), 4.34 (dd, IH, 7=9.7, 2.6 Hz), 4.03 (dd, IH, 7=9.7, 4.0 Hz), 3.85 (s, 6H), 3.48 (d, IH, 7=11.9 Hz), 3.20 (s, IH), 3.09 (dd, IH, 7=12.1, 3.3 Hz), 2.46 (s, 3H), 1.89 (m, IH), 1.61 (m, 3H), 1.41 (d, 2H, 7=9.7 Hz), 1.14 (m, 3H).
Preparation 144
6-Methoxy-10-(4-methoxy-phenyl)-9-methyl-l,2,3,4,4a,9, 10,10a-octahydro- phenanthrene
Figure imgf000080_0001
Combine toluene-4-sulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthren-9-ylmethyl ester (0.47 Ig, 0.93 mmol), lithium aluminum hydride (0.069g, 1.86 mmol), and tetrahydrofuran (8.0 mL), and reflux under nitrogen atmosphere. After 5 hours, quench reaction by adding reaction to a stirred solution of Rochelle's salt (Na K Tartrate) and ethyl acetate. After several hours, separate the organic phase and wash with brine. Dry the organic phase with anhydrous sodium sulfate and flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (0.267g, 85%) as a white solid. TLC Rf=0.43 in 3:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.35 (d, IH, 7=8.4 Hz), 7.23 (d, 2H, 7=8.4 Hz), 6.94 (m, 3H), 6.82 (dd, IH, 7=8.8, 2.6 Hz), 3.86 (s, 6H), 3.31 (m, 2H), 2.82 (dd, IH, 7=11.9, 2.6 Hz), 2.50 (d, IH, 7=13.7 Hz), 1.89 (m, IH), 1.64 (m, 2H), 1.44 (m, 2H), 1.16 (m, 6H).
Preparation 145
6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthrene-9- carboxylic acid
Figure imgf000081_0001
Combine 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-carboxylic acid methyl ester (1.03g, 2.71 mmol), Methanol (20.0 mL), tetrahydrofuran (2 mL), and lithium hydroxide aqueous (5 mL), stir at reflux. After 18 hours, add 5N HCl until reaction is acidic, then extract with ethyl acetate and wash with brine. Dry the organic phase with anhydrous sodium sulfate then concentrate to yield the titled compound (0.97g, 97%) as a white solid. TLC Rf =0.41 in 3% methanol in DCM. 1H NMR (DMSO): 12.30 (s, IH), 7.25 (m, 3H), 6.92 (m, 3H), 6.82 (dd, IH, /=8.6, 2.4 Hz), 4.18 (d, IH, J=12.3 Hz), 3.76 (m, 6H), 3.42 (dd, IH, 7=12.6, 2.4 Hz), 3.27 (s, IH), 2.50 (m, IH), 1.89 (m, IH), 1.59 (m, 2H), 1.40 (m, IH), 1.23 (m, IH), 0.99 (m, 3H); MS mlz 322 (M-44, decarbonylation).
Preparation 146
[6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- yl] -methanol
Figure imgf000081_0002
Preparation 146 is prepared from preparation 140 in a manner similar to preparation 142. TLC Rf=O.17 in 4:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.33 (d, IH, /=8.4 Hz), 7.00 (m, 3H), 6.81 (m, 3H), 3.93 (dd, IH, /=10.8, 5.9 Hz), 3.87 (s, 3H), 3.78 (m, 4H), 3.56 (t, IH, /=6.4 Hz), 3.37 (dd, IH, /=12.6, 5.9 Hz), 3.05 (m, IH), 2.52 (m, IH), 2.28 (m, IH), 1.79 (m, IH), 1.39 (m, 4H), 1.05 (m, 2H). Preparation 147
[6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- yl]-acetonitrile
Figure imgf000082_0001
Combine toluene-4-sulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthren-9-ylmethyl ester (0.224g, 0.44 mmol), KCN (0.172g, 2.65 mmol), and DMF (4 mL), and stirr under nitrogen atmosphere at 100° C. After 2 hours, add ethyl acetate and water. Separate the organic phase and wash with brine. Dry the organic phase with anhydrous sodium sulfate and flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (0.139g, 87%) as a white foam. TLC Rf=0.46 in 4:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.31 (m, IH), 7.24 (d, 2H, /=8.8 Hz), 6.96 (m, 3H), 6.84 (dd, IH, /=8.4, 2.6 Hz), 3.86 (m, 6H), 3.59 (m, IH), 3.34 (s, IH), 3.18 (dd, IH, /=12.3, 3.1 Hz), 2.90 (dd, IH, /=17.2, 4.4 Hz), 2.51 (m, 2H), 1.98 (m, IH), 1.66 (m, 2H), 1.48 (m, 2H), 1.14 (m, 3H).
Preparation 148 l-[6-Methoxy-10-(4-methoxy-phenyI)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- ylmethyl] -pyrrolidine
Figure imgf000082_0002
Combine toluene-4-sulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthren-9-ylmethyl ester (0.087g, 0.175 mmol), pyrrolidine (0.09 mL, 1.05 mmol), and benzene (5 mL), and reflux under nitrogen atmosphere. After 18 hours, concentrate reaction under vacuum then add ethyl acetate and wash with sodium bicarbonate solution (aq). Separate the organic phase and wash with brine. Dry the organic phase with anhydrous sodium sulfate and flash chromatograph using 2% to 4% (2M NH3 methanol)/methylene chloride to yield the titled compound (0.060 g, 86%) as a white solid. TLC Rf=0.25 in 4% 2M NH3 methanol: DCM. 1H NMR (CDCl3): 7.95 (d, IH, 7=8.4 Hz), 7.24 (d, 2H, 7=8.4 Hz), 6.91 (m, 3H), 6.79 (dd, IH, /=8.6, 2.4 Hz), 3.85 (s, 6H), 3.34 (t, IH, J=9.2 Hz), 3.22 (s, IH), 3.07 (dd, IH, 7=11.7, 3.3 Hz), 2.74 (dd, IH, 7=12.3, 7.5 Hz), 2.42 (m, 4H), 2.20 (m, 2H), 1.89 (m, IH), 1.66 (m, 6H), 1.43 (m, 2H), 1.17 (m, 3H); MS m/z 406 (M+l).
Preparation 149
9-Ethyl-6-methoxy-10-(4-methoxy-phenyl)-l,2,3,,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000083_0001
Combine toluene-4-sulfonic acid 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthren-9-ylmethyl ester (0.15 Ig, 0.30 mmol), methyl magnesium bromide (0.46 mL, 1.40 mmol), Li2CuCl4 (150 uL), and tetrahydrofuran (3 niL), and stir under nitrogen atmosphere. After 18 hours, concentrate reaction under vacuum and flash chromatograph using 0% to 10% ethyl acetate/hexanes to yield the titled compound (0.085 g, 81 %) as a white foam. TLC Rf=0.60 in 8: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.32 (s, IH), 7.24 (d, 2H, 7=8.4 Hz), 6.94 (m, 3H), 6.81 (dd, IH, 7=8.4, 2.6 Hz), 3.86 (m, 6H), 3.42 (m, IH), 3.23 (s, IH), 3.08 (dd, IH, 7=12.1, 3.3 Hz), 2.49 (d, IH, 7=13.7 Hz), 1.93 (m, 2H), 1.67 (m, IH), 1.57 (m, 2H), 1.44 (d, 2H, 7=8.8 Hz), 1.19 (m, 3H), 0.62 (t, 3H, 7=7.3 Hz).
Preparation 150
6-Benzyloxy-10-(4-benzyIoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthrene-9- carboxylic acid benzyl ester
Figure imgf000084_0001
Combine 6-hydroxy-10-(4-hydroxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro- phenanthrene-9-carboxylic acid (0.627g, 1.71 mmol), benzyl bromide (0.73 mL, 6.67 mmol), potassium carbonate (0.992 g, 7.18 mmol), TBAI (2.46 g, 6.67 mmol), and DMF (40.0 mL), and reflux under nitrogen atmosphere. After 18 hours, add ethyl acetate and water, separated the organic phase and wash 4X with brine. Dry the organic phase over anhydrous sodium sulfate. Concentrate the organic phase under vacuum and flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (0.550 g, 53%) as a white solid. TLC Rf=O.17 in 8:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.44 (m, 10H), 7.27 (m, 5H), 7.18 (d, IH, 7=8.4 Hz), 7.08 (m, 3H), 6.96 (d, 2H, /=8.4 Hz), 6.81 (dd, IH, /=8.6, 2.4 Hz), 5.06 (m, 6H), 4.41 (d, IH, /=12.3 Hz), 3.58 (dd, IH, /=12.3, 2.6 Hz), 3.36 (s, IH), 2.47 (d, IH, /=14.1 Hz), 2.02 (m, IH), 1.70 (m, IH), 1.46 (m, 2H), 1.11 (m, 4H).
Preparation 151
[6-Benzyloxy-10-(4-benzyloxy-phenyl)-l,2,3,4,4a,10,10a-octahydro-phenanthrene-9- yl] -methanol
Figure imgf000084_0002
Combine 6-benzyloxy-10-(4-benzyloxy-phenyl)- 1 ,2,3,4,4a,9, 10, 10a-octahydro- phenanthrene-9-carboxylic acid benzyl ester (0.129g, 0.212 mmol), lithium aluminum hydride (0.024g, 0.64 mmol), and tetrahydrofuran (4 mL), and stir under nitrogen atmosphere. After 2 hours, quench reaction by adding reaction to a stirred solution of Rochelle's salt (Na K Tartrate) and ethyl acetate. After several hours, separate the organic phase and wash with Brine. Dry the organic phase with anhydrous sodium sulfate and flash chromatograph using 5% to 50% ethyl acetate/hexanes to yield the titled compound (0.07 Ig, 66%) as a white solid. TLC Rf=0.43 in 1:1 hexanesiethyl acetate. 1H NMR (CDCl3): 7.42 (m, HH), 7.25 (d, 2H, /=8.8 Hz), 7.06 (s, IH), 7.00 (d, 2H, /=8.8 Hz), 6.91 (dd, IH, /=8.6, 2.4 Hz), 5.11 (m, 4H), 4.74 (s, IH), 4.06 (dd, IH, /=11.2, 3.3 Hz), 3.63 (dd, IH, /=11.2, 2.4 Hz), 3.33 (m, 3H), 2.44 (d, IH, /=14.1 Hz), 1.92 (m, IH), 1.63 (m, 2H), 1.43 (m, 2H), 1.11 (m, 2H).
Preparation 152
6-Methoxy-9-methoxymethyl-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000085_0001
Combine [6-methoxy- 10-(4-methoxy-phenyl)- 1 ,2,3 ,4,4a,9, 10, 1 Oa-octahydro- phenanthren-9-yl] -methanol (0.084g, 0.24 mmol), NaH (0.014 mg, 0.29 mmol), and DMF (3.0 mL) and stir under nitrogen atmosphere at -1O0C. After 1 hour, add MeI (50 uL, 0.072 mmol) and stir at room temperature for 18 hours. Concentrate reaction under vacuum then add ethyl acetate and water, separated the organic phase and wash 2X with brine. Dry the organic phase over anhydrous sodium sulfate. Concentrate the organic phase under vacuum and flash chromatograph using 0% to 25% ethyl acetate/hexanes to yield the titled compound (0.057 g, 65%) as a white solid. TLC Rf=0.40 in 3: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.58 (d, IH, /=8.8 Hz), 7.25 (d, 2H, /=8.8 Hz), 6.93 (m, 3H), 6.81 (dd, IH, /=8.4, 2.6 Hz), 3.85 (m, 6H), 3.66 (m, IH), 3.38 (m, 2H), 3.23 (m, 4H), 3.11 (dd, IH, /=11.9, 3.1 Hz), 2.48 (d, IH, /=13.7 Hz), 1.92 (m, IH), 1.42 (m, 2H), 1.18 (m, 3H), 1.77 (m, 2H).
Preparation 153 l-[6-Methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthren-9- yl]-ethanone
Figure imgf000086_0001
Combine 6-methoxy- 10-(4-methoxy-phenyl)- 1 ,2,3 ,4,4a,9, 10,1 Oa-octahydro- phenanthren-9-carboxylic acid methyl ester (0.252 g, 0.662 mmol), methyl magnesium Bromide (1.76 mL, 5.3 mmol), and tetrahydrofuran (8 mL), and reflux under nitrogen atmosphere. After 18 hours, cool the reaction to room temperature and add ethyl acetate, wash with sat ammonium chloride solution (aq), then brine. Concentrate, and chromatograph eluting with 0% to 20% ethyl acetate/hexanes to yield the titled compound (O.O68g, 28%) as a white solid. TLC Rf=O.19 in 8:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.26 (d, 2H, /=8.8 Hz), 7.04 (s, IH), 7.01 (d, IH, /=8.8 Hz), 6.91 (d, 2H, /=7.9 Hz), 6.77 (dd, IH, /=8.4, 2.6 Hz), 4.31 (d, IH, /=12.8 Hz), 3.84 (m, 6H), 3.37 (m, 2H), 2.53 (d, IH, /=14.1 Hz), 2.05 (m, IH), 1.92 (s, 3H), 1.74 (m, IH), 1.62 (m, 2H), 1.47 (m, 2H), 1.31 (m, 2H).
Preparation 154 6-Methoxy-10-(4-methoxy-phenyI)-9-methyl-l,2,3,4,4a,10a-hexahydro-phenanthrene
Figure imgf000086_0002
Combine trifluoro-methanesulfonic acid 6-methoxy- 10-(4-methoxy-phenyl)~ 1, 2,3,4,4a, 10a-hexahydro-phenanthren-9-yl ester (0.523g, 1.12 mmol), Pd-tetrakis (45.0 mg, 0.04 mmol), and tetrahydrofuran (10.0 mL), and stir under nitrogen atmosphere at O0C. After 15 minutes, add dimethylzinc (3.5 mL, 3.44 mmol) dropwise. Allow the reaction to warm to room temperature and stir for 18 hours, then heat reaction at 400C for 3 hours. Add ethyl acetate and water. Wash the organic phase with brine, dry over anhydrous sodium sulfate, concentrate, and chromatograph eluting with 0% to 20% ethyl acetate/hexanes to yield the titled compound (0.224g, 60%) as a white solid. TLC Rf=0.30 in 5: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.32 (s, IH), 7.20 (d, 2H, 7=8.8 Hz), 6.95 (m, 3H), 6.79 (m, IH), 3.88 (m, 6H), 3.21 (m, IH), 2.46 (m, 2H), 1.97 (s, 3H), 1.74 (m, IH), 1.55 (m, 3H), 1.38 (m, IH), 1.15 (m, 2H).
Preparation 155
6-Methoxy-10-(4-methoxy-phenyl)-9-methyl-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene
Figure imgf000087_0001
Combine 6-methoxy- 10-(4-methoxy-phenyl)-9-methyl- 1 ,2,3 ,4,4a, 1 Oa-hexahydro- phenanthrene (0.116g, 0.347 mmol), Pd-Black (14.7 mg, 0.139 mmol) and acetic acid/methanol/tetrahydrofuran (1.0 mL, 10.0 mL, 3.0 mL) at 50 psi Hydrogen pressure. After 18 hours, filter off the Pd catalyst over celite eluting with ethyl acetate. Concentrate and flash chromatograph with 0% to 10% ethyl acetate/hexanes to yield the titled compound (0.108g, 93%) as a clear oil. TLC Rf=0.30 in 5:1 hexanes:ethyl acetate. 1H NMR (CDCl3).: 7.26 (d, IH, /=8.4 Hz), 7.03 (m, 3H), 6.83 (m, 3H), 3.90 (s, 3H), 3.83 (s, 3H), 3.36 (m, 2H), 3.12 (m, IH), 2.52 (m, IH), 2.35 (m, IH), 1.87 (m, IH), 1.51 (m, 4H), 1.30 (m, 2H), 1.18 (d, 3H, 7=6.6 Hz).
Preparation 156 6-Methoxy-5-nitro-2,3,4,4a,10,10a-hexahydro-lfiT-phenanthren-9-one
Figure imgf000087_0002
Combine 6-methoxy-2,3,4,4a,10,10a-hexahydro-lH-phenanthren-9-one (0.936 g, 4.06 mmol), Ac2O (5.0 mL), and a solution of 90% HNO3/acetic acid (0.8 mL), and stir under Nitrogen atmosphere at O0C. After 3 hours, add ethyl acetate. Wash the ethyl acetate with sodium bicarbonate solution and then brine, dry over sodium sulfate, and concentrate in vacuum. Flash chromatograph using dichloromethane (isocratic) to yield the titled compound (0.378 g, 34%) as a solid. TLC Rf=0.25 in dichlormethane. 1H NMR (CDCl3): 8.22 (d, IH, /=8.8 Hz), 7.04 (d, IH, /=8.8 Hz), 3.99 (s, 3H), 2.96 (m, 2H), 2.49 (m, 2H), 1.63 (m, 8H).
Preparation 157
6-Methoxy-10-(4-methoxy-phenyl)-5-nitro-2,3,4,4a,10,10a-hexahydro-lHr- phenanthren-9-one
Figure imgf000088_0001
Combine 6-Methoxy-5-nitro-2,3 ,4,4a, 10, 1 Oa-hexahydro- lH-phenanthren-9-one (0.377 g, 1.37 mmol), 4-bromoanisole (0.258 g, 1.37 mmol), palladium acetate (15.5 mg, 0.07 mmol), t-butyl phosphine (0.042 g, 0.208 mmol), sodium t-butoxide (0.145 g, 1.51 mmol), tetrahydrofuran (12.0 mL), and stir under nitrogen atmosphere at 8O0C in a glass bomb. After 18 hours, quench reaction with acetic acid (5 mL) in a glove box and extract with ethyl acetate. Wash the ethyl acetate with sodium bicarbonate solution and then brine, dry over sodium sulfate, and concentrate in vacuum. Flash chromatograph using 0% to 20% ethyl acetate/hexanes to yield the titled compound (0.455 g, 87%) as a yellow foam. TLC Rf=O.16 in 6:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 8.23 (d, IH, /=8.8 Hz), 7.06 (m, 3H), 6.92 (m, 2H), 4.01 (m, 4H), 3.83 (s, 3H), 3.10 (dt, IH, /=8.4, 4.3 Hz), 2.76 (m, IH), 1.82 (m, 4H), 1.47 (m, 4H).
Preparation 158
6-Methoxy-10-(4-methoxy-phenyI)-5-nitro-l,2,3,4,4a,9,10,10a-octahydro- phenanthren-9-oI
Figure imgf000089_0001
Combine 6-methoxy- 10-(4-methoxy-phenyl)-5-nitro-2,3 ,4,4a, 10, 1 Oa-hexahydro- lH-phenanthren-9-one (455.0 mg, 1.19 mmol), sodium borohydride (130.0 mg, 3.46 mmol), ethanol (7.0 mL), tetrahydrofuran (2.0 niL), stir, and reflux under a nitrogen atmosphere. After 3 hours, cool to ambient temperature, and concentrate in vacuo. Add ethyl acetate to reaction mixture, wash with sat ammonium chloride solution(aq), brine, and dry over sodium sulfate. Concentrate to yield the titled compound (378.0 mg, 83%). TLC Rf=O.18 in 2:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.68 (m, IH), 7.26 (m, IH), 7.08 (m, IH), 6.94 (m, 2H), 6.81 (m, IH), 3.89 (m, 6H), 3.30 (m, IH), 2.90 (m, IH), 2.51 (m, 2H), 1.64 (m, 8H).
Preparation 159 6-Methoxy-10-(4-methoxy-phenyl)-5-nitro-l,2,3,4,4a,10a-hexahydro-phenanthrene
Figure imgf000089_0002
Combine 6-methoxy-10-(4-methoxy-phenyl)-5-nitro-l,2,3,4,4a,9,10,10a- octahydro-phenanthren-9-ol (378.6 mg, 0.987 mmol), p-toluene sulfonic acid (38.0 mg, 0.197 mmol), toluene (8 mL), stir, and reflux under nitrogen atmosphere. After 1 hour, cool reaction to ambient temperature, add ethyl acetate, wash sat sodium bicarbonate solution (aq), and then with brine, dry over sodium sulfate, and concentrate in vacuum. Flash chromatograph using 0% to 30% ethyl acetate/hexanes to yield the titled compound (234.5 mg, 68%) as a clear oil. TLC Rf=0.40 in 2: 1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.25 (d, 2H, J=8.4 Hz), 6.91 (d, 2H, /=8.4 Hz), 6.67 (d, IH, /=8.4 Hz), 6.58 (d, IH, /=8.4 Hz), 6.37 (d, IH, /=2.6 Hz), 3.88 (m, 6H), 3.18 (s, IH), 2.90 (m, IH), 2.19 (d, IH, /=14.1 Hz), 1.60 (m, 4H), 1.33 (m, 2H), 0.99 (m, IH). Preparation 160
3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9!)10-octahydro-phenanthren-4- ylamine
Figure imgf000090_0001
Preparation 160 is prepared from preparation 159 in a manner similar to preparation 9. (0.689g, 46%) TLC Rf=0.55 in 2:1 hexanes: ethyl acetate. 1H NMR (CDCl3): 7.24 (d, 2H, J=8.8 Hz), 6.87 (d, 2H, 7=8.8 Hz), 6.70 (m, 2H), 3.86 (m, 7H), 3.31 (m, IH), 3.09 (m, 2H), 2.90 (m, IH), 2.33 (m, 2H), 1.53 (m, 6H).
Example 1 9-(4-Hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-oI
Figure imgf000090_0002
Combine 6-methoxy-10-(4-methoxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro- phenanthrene (132.1 mg, 0.41 mmol), methylene chloride (4.0 mL), boron tribromide (0.16 mL, 1.64 mmol) at O0C, and stir under a nitrogen atmosphere. After 1.5 hours, add ethyl acetate to reaction mixture, quench reaction with sat ammonium chloride solution(aq). Wash organic layer with brine, dry over sodium sulfate, and concentrate in vacuo. Flash chromatograph to yield the titled compound (86.7 mg, 72%) as a white solid. 1H NMR (DMSO): 9.15 (s, IH), 9.00 (s, IH), 7.08 (d, 2H, /=8.8 Hz), 6.93 (d, IH, 7=8.4 Hz), 6.70 (m, 3H), 6.52 (dd, IH, /=8.4, 2.2 Hz), 3.05 (m, 3H), 2.65 (m, IH), 2.34 (d, IH, /=12.8 Hz), 1.88 (m, IH), 1.55 (m, 2H), 1.37 (m, IH), 1.05 (m, 4H); MS mlz 293 (M-I). Examples IA and IB
Figure imgf000091_0001
(R, R, R) (S, S, S)
Using Standard HPLC equipment, chromatograph the product of Example 1 (86.7 mg, Chiralpak AD 0.46 x 25 cm column, 85% Heptane/Ethanol eluent, 1.0 mL/min, 225 nm). Concentration of pure fractions yields (R,R,R) (33.0mg, 100% ee, 6.3 min) and (S,S,S) (48.0mg, 100% ee, 9.6 min) as white solids.
Example 2 4-(4-Hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalen-8-ol
Figure imgf000091_0002
Example 2 is prepared from preparation 18 in a manner similar to example 1. 1H NMR (DMSO): 9.11 (s, IH), 8.98 (s, IH), 7.06 (d, 2H, J=8.4 Hz), 6.86 (d, IH, J=7.9 Hz), 6.67 (d, 2H, J=7.9 Hz), 6.53 (s, IH), 6.46 (m, IH), 2.89 (m, 2H), 2.49 (m, 2H), 2.07 (m, 2H), 1.36 (m, 4H), 1.16 (m, IH). MS m/z (279 (M-I).
Separate example 2 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB). Example 3
4-(4-Hydroxy-phenyI)-2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthaIene-6,8- diol
Figure imgf000092_0001
Example 3 is prepared from preparation 27 in a manner similar to example 1. 1H NMR (DMSO-J6) 9.09( s, IH), 8.98 (s, IH), 8.77 (s, IH), 7.06 (d, J=8.4 HZ, 2H), 6.66 (d, J=8.4 Hz, 2H), 6.06 (s, IH), 6.02 (s, IH), 3.15 (m, 2H), 2.85 (m, IH), 2.64(dd, J=14.4, 14, IH) 2.35 (m, IH), 2.05 ( m, IH), 1.5-1.1 (m, 5H)MS mZz 295 (M-I).
Separate example 3 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 4 4-(4-Hydroxy-phenyl)-l,3,3a,4,5,9b-hexahydro-naphtho[l,2-c]furan-8-ol
Figure imgf000092_0002
Example 4 is prepared from preparation 36 in a manner similar to example 1. TLC Rf=0.24 in 1 : 1 hexanesxthyl acetate. 1H NMR (d-methanol): 7.13 (d, 2H, J=8.4 Hz), 6.99 (d, IH, J=8.4 Hz), 6.77 (d, 2H, J=8.8 Hz), 6.62 (m, 2H), 4.17 (m, IH), 3.68 (t, IH, J=8.8 Hz), 3.55 (m, 3H), 3.04 (m, 3H), 2.69 (m, IH).
Separate example 4 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB). Example 5 P-CS-Fluoro^-hydroxy-phenyO-^jSyojT^S^a^jlO-octahydro-phenanthren-S-ol
Figure imgf000093_0001
Example 5 is prepared from preparation 40 in a manner similar to example 1. 1H NMR (d-methanol): 6.95 (m, 5H), 6.61 (m, IH), 3.12 (m, 3H), 2.78 (dd, IH, /=14.5, 3.5 Hz), 2.51 (d, IH, /=14.1 Hz), 1.73 (m, IH), 1.63 (m, IH), 1.46 (m, IH), 1.19 (m, 5H); MS mlz 313 (M+l), 311 (M-I).
Example 6 9-(4-Hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-4-ol
Figure imgf000093_0002
Example 6 is prepared from preparation 53 in a manner similar to example 1. 1H NMR (d-methanol): 7.1 (d, 2H, /=6.4 Hz), 6.9 (t, IH, /=6.9 Hz), 6.7 (m, 3H), 6.6 (d, IH, /=7.9 Hz), 3.3 (m, 2H), 3.1 (m, IH), 3.0 (m, IH), 2.7 (dd, IH, /=11.4, /=5.3 Hz), 2.1 (m, IH), 1.5 (m, 2H), 1.3 (m, 3H), 1.1 (m, 2H).
Separate example 6 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 7 9-(4-Hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-ol
Example 7 is prepared from preparation 63 in a manner similar to example 1. 1H 1H NMR (DMSO): 9.18 (s, IH), 9.02 (s, IH), 7.17 (d, IH, J=8.8 Hz), 7.12 (d, 2H, J=8.5 Hz), 6.71 (d, 2H, J=8.5 Hz), 6.60 (dd, IH, J=8.8 and 2.4 Hz), 6.58 (d, IH, J=2.4 Hz), 3.08 (m, 3H), 2.69 (dd, IH, J=15.8 and 4.8 Hz), 2.42 (m, IH), 1.91 (m, IH), 1.65-1.55 (m, 2H), 1.38 (m, IH), 1.16 (m, IH), 1.02 (m, 3H).
Separate example 7 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 8 9-(4-Hydroxy-phenyl)-6,6-dimethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000094_0002
Example 8 is prepared from preparation 74 in a manner similar to example 1. (0.162g, 46%): 1H NMR (DMSO) δ 9.15 (s, IH), 8.92 (s,lH) 7.11-7.09 (d, 2H), 6.93-6.90 (d,lH), 6.81 (s, IH), 6.72-6.69 (d, 2H), 6.52-6.49 (dd, IH), 3.17-3.12 (m, 2H), 3.0-2.96 (d, IH), 2.63-2.57 (dd, IH), 2.21-2.17 (d, IH), 1.87-1.81 (m, IH), 1.57-1.52 (dd, IH), 1.28-1.21 (t, 2H), 1.08-1.03 (t, 2H), 0.86 (s, 3H), 0.44 (s, 3H), Mass spectrum (apci neg) m/z=321.3 (M-H), HPLC (25 to 95) Rt (Purity at 220 nm)= 2.82 min (100%).
Separate example 8 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB). Example 9 9-(4-Hydroxy-phenyl)-7,7-dimethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000095_0001
Example 9 is prepared from preparation 86 in a manner similar to example 1. (.055g, 20%) : 1H NMR (CDCl3) 67.19-7.16 (d,2H), 7.04-7.02 (d, IH), 6.87 (s, IH), 6.83-6.81 (d, 2H) 6.66-6.64 (dd, IH), 4.56 (s, IH), 4.49 (s, IH), 3.15-3.13 (m, 3H), 2.85- 2.82 (d, lH),2.25-2.22 (d, 2H), 1.97-1.89 (m, IH), 1.3-1.25 (m, 2H), 1.11-1.07 (m, 2H), 0.82 (s, 3H), 0.73 (3, H), Mass spectrum (apci neg) m/z=321.3 (M-H), HPLC (5 to 95) Rt (Purity at 220 nm)= 3.2 min (100%).
Separate example 9 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 10
4-(4-Hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalene-6,9- diol
Example 10 is prepared from preparation 97 in a manner similar to example 1. (0.067g, 40%): 1H NMR (CDCl3) δ 7.19-7.17 (d, 2H), 6.82-6.79 (d, 2H), 6.55-6.54 (d, 2H), 4.59 (s, IH), 4.37 (s, IH), 3.55-3.49 (m, IH), 3.08-3.02 (m, IH), 2.98-2.93 (m, IH), 2.78-2.71 (m, IH), 2.65-2.57 (m, IH), 2.43-2.35 (m, IH), 1.48-1.25 (m, 5H). Separate example 10 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 11
6-(4-Chloro-phenyl)-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol
Figure imgf000096_0001
Example 11 is prepared from preparation 102 in a manner similar to Example 1. 1H NMR (CDCl3): 7.34 (d, J=7.9 Hz, 2H), 7.25 (d, J=IO.1 Hz, 2H), 7.04 (d, J=8.4 Hz, 2H), 6.74 (s, IH ), 6.72 (d, J=6.2 Hz, 2H), 6.56 (s, IH), 3.4 (m, IH), 2.95 (m, IH), 2.8 (dd, J=15 and 13 Hz, IH) 2.55 (m, 2H), 2.25 (m, IH), 1.7-1.2 (m, 5H). MS m/z 389 (M-I).
Example 12
8-Hydroxy-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene-6-carboxylic acid methyl ester
Figure imgf000096_0002
Example 12 is prepared from preparation 103 in a manner similar to Example 1. 1H NMR (DMSO-J6) 9.43( s, IH), 9.13 (s, IH), 7.04 (d, J=7.9 Hz, 2H), 6.95 (s, IH), 6.78 (s, IH), 6.67 (d, J=8.3 Hz, 2H), 3.75 (s, 3H), 3.0 (m, IH), 2.85 (m, 2H), 2.43(m, 2H) 2.1 (m, IH), 1.5-1.1 (m, 5H). MS m/z 337 (M-I). Example 13
8-Hydroxy-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene-6-carboxylic acid
Figure imgf000097_0001
Combine 8-Hydroxy-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalene-6-carboxylic acid methyl ester (0.013g, 0.038 mmol), ethanol (3ml), and NaOH (1.5 ml, 2N) and heat at 450C for 1.5 hours. Acidify with 1 N HCl and extract with ethyl acetate. Wash IX with water, dry over anhydrous sodium sulfate and concentrate in vacuo to yield the titled compound ( 0.01Og, 84%) as a white residue. 1H NMR (CD3OD) 7.1 (d, J=7.5 Hz, 2H), 7.08 (s, IH), 6.8 (s, IH), 6.7 (d, J=7.5 Hz, 2H), 3.4 (m, IH), 3.15 (m, IH), 3.0 (m, 2H), 2.55(m, IH) 2.2 (m, IH), 1.6-1.2. MS m/z 323 (M-I).
Example 14
6-Bromomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol
Figure imgf000097_0002
Combine [8-Methoxy-4-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-6-yl] -methanol (0.025g, 0.074 mmol), boron tribromide (0.1 Ig, 0.44 mmol), and methylene chloride (1.5 ml) and stir 3 hours. Add water, ethyl acetate and IN HCl. Rinse organic layer with water, dry over anhydrous sodium sulfate and remove solvent to yield the titled compound ( 0.023g, 84%). 1H NMR (DMSO-J6) 9.18( s, IH), 9.14 (s, IH), 7.1 (d, J=7.9 Hz, 2H), 6.7 (d, J=7.9 Hz, 2H), 6.62 (s, IH), 6.56 (s, IH), 4.68 (d, J=IO.1 Hz, IH), 4.58 (d, J=9.6 Hz, IH), 3.4 (m, IH presumed), 2.95 (m, IH), 2.8 (m, 2H), 2.45(m, IH) 2.1 (m, IH), 1.6-1.1 (m, 5H). MS m/z 371 (M-2). Example 15
[8-Hydroxy-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-6-yl]-acetonitriIe
Figure imgf000098_0001
Combine 6-Bromomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cycloρenta[a]naphthalen-8-ol (0.037g, 0.1 mmol), KCN (0.01Og, 0.15 mmol), and 18- crown-6 (0.043g, 0.16 mmol) and heat at 8O0C for 2 hours. Cool, add ice and extract with ethyl acetate. Wash organic layer with sodium bicarbonate solution sat., then water. Dry over anhydrous sodium sulfate and concentrate to a residue which yields, after separation on silica gel with 33% EtOAC/hexanes, the titled compound (0.022g, 70%). 1H NMR (DMSO-J6) 9.27( s, IH), 9.18 (s, IH), 7.13 (d, J=8.4 Hz, 2H), 6.73 (d, J=7.9 Hz, 2H), 6.66 (s, IH), 6.59 (s, IH), 3.95 (s, 2H), 3.4 (m, IH presumed), 3.0 (m, IH), 2.76 (m, IH), 2.65 (m, IH), 2.45(m, IH) 2.15 (m, IH), 1.6-1.2 (m, 5H). MS w/z 318 (M-I).
Example 16
4-(4-Hydroxy-phenyl)-6-methoxymethyl-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol
Figure imgf000098_0002
Combine Na (0.013g, 0.53 mmol) and methanol ( 2 ml) at 0-50C and stir until solution forms. Add 6-Bromomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol (0.037g, 0.1 mmol) and stir for 3 hours. Remove solvent in vacuo. Take into ethyl acetate and IN HCl. Separate organic layer and wash with water. Dry over anhydrous sodium sulfate and remove solvent in vacuo. The redidue is chromatographed on silica gel with 25% ethyl acetate/hexanes to yield the titled compound ( 0.012g, 37%). 1H NMR (DMSO-J6): 9.16( s, IH), 9.04 (s, IH), 7.11 (d, J=7.9 Hz, 2H), 6.71 (d, J=8.8 Hz, 2H), 6.58 (s, IH), 6.53 (s, IH), 4.35 (dd, j=16 and 7 Hz, 2H), 3.4 (m, IH presumed), 3.0 (m, IH), 2.76 (m, IH), 2.65 (m, IH), 2.45(m, IH) 2.15 (m, IH), 1.6-1.2 (m, 5H). MS m/z 323 (M-I).
Example 17
6-Azidomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,,9b-hexahydro-lH- cyclopenta [a]naphtha!en-8-ol
Figure imgf000099_0001
Combine 6-Bromomethyl-4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH- cyclopenta[a]naphthalen-8-ol (0.037g, 0.1 mmol), LiN3 (0.0213g, 0.43 mmol), and DMF ( 1.5 ml) and heat at 900C for 3 hours. Cool, add ice and extract with ethyl acetate. Wash organic layer with 3X with water. Dry over anhydrous sodium sulfate and concentrate to a residue which yields after separation on silica gel with 20% EtOAC/hexanes, the titled compound (O.Olg, 34%). 1H NMR (CDCl3) 7.2 (d, J=8.4 Hz, 2H), 6.85 (d, J=8.4 Hz, 2H), 6.73 (s, IH), 6.68 (s, IH ), 4.35 (s, 2H), 3.45 (m, IH), 3.15 (m, IH), 2.95 (m, IH), 2.85 (m, IH) 2.55 (m, IH), 2.25 (m, IH), 1.7-1.2 (m, 5H). MS m/z 334 (M-I).
Example 18
4-(4-Hydroxy-phenyl)-6-vinyl-2;,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalen-
8-ol (racemic)
Figure imgf000099_0002
Combine BuLi (0.1 ml, 1.6M, 0.16 mmol), methyltriphenylphosphonium bromide (0.063g, 0.175 mmol) and tetrahydrofuran (1.0 ml) and stir 15 minutes. Add 8-Hydroxy- 4-(4-hydroxy-phenyl)-2,3,3a,4,5,9b-hexahydro-lH-cyclopenta[a]naphthalene-6- carbaldehyde (0.012g, 0.04 mmol) in tetrahydrofuran ( 1.0 ml) and stir 30 minutes. Take into ethyl acetate and wash with ammonium chloride solution solution, then brine. Dry over anhydrous sodium sulfate and concentrate to a residue which yields after separation on silica gel with 33% EtOAC/hexanes, the titled compound (O.OOόg, 50%). 1H NMR (CD3OD) 7.15 (d, J=8.4, Hz, 2H), 7.04 (dd, J=Il and 6 Hz, IH), 6.75 (m, 3H), 3.4 (m, IH), 3.0 (m, IH), 2.85 (m, 2H), 2.55(m, IH) 2.2 (m, IH), 1.6-1.2. MS m/z 305 (M-I).
Example 19 9-(4-Hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l,3-dioI (racemic)
Figure imgf000100_0001
Example 19 is prepared from preparation 115 in a manner similar to Example 1. 1H NMR (DMSOd6): 9.17 (s, IH), 9.06 (s, IH), 8.83 (s, IH), 7.12 (d, J=8.4 Hz, 2H), 6.73 (d, J=8.8 Hz, 2H), 6.27 (s, IHO, 6.17 (s, IH), 3.05 (s, IH), 2.95 (m, IH), 2.65 (m, 2H), 2.3 (d, J=13 Hz, IH), 1.9 (m, IH), 1.55 (m, 2H), 1.38 (m, IH), 1.2-0.9 (m, 4H). MS m/z 309 (M-I).
Separate example 19 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 20 l-BromomethyI-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3- ol
Figure imgf000100_0002
Example 20 is prepared from preparation 118 in a manner similar to example 14. MS m/z 387, 385 (M+).
Separate example 20 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 21
9-(4-Hydroxy-phenyI)-l-methoxymethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-
3-ol
Figure imgf000101_0001
Example 21 is prepared from example 20 in a manner similar to example 16. 1H NMR (DMSO-dβ): 9.19 (s, IH), 9.03 (s, IH), 7.14 (d, J=8.4 Hz, 2H), 6.74 (m , 3H), 6.66 (s, IH), 4.38 (dd, J= 19 and 12 Hz, 2H), 3.15 (s, IH), 3.0 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.9 (m, IH), 1.7-0.9 (m, 7H). MS m/z 337 (M-I).
Separate example 21 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 22
3-Hydroxy-9-(4-hydroxyφhenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carboxylic acid methyl ester
Figure imgf000101_0002
Example 22 is prepared from preparation 117 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.47 (s, IH), 9.21 (s, IH), 7.11 (d, J=8.4 Hz, 2H), 7.04 (s, IH), 6.74 (d, J=8.4 Hz, 2H), 3.8 (s, 3H), 3.32 (m, Ih), 3.18 (m, 2H), 2.95 (m, 2H), 3.0 (m, IH), 2.4 (m, IH), 1.95 (m, IH), 1.65 (m, IH), 1.55 (m, IH), 1.4 (m, IH), 1.3-0.9 (m, 2H). US m/z 351 (M-I).
Separate example 22 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 23 l-Hydroxymethyl-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-
3-ol
Figure imgf000102_0001
Example 23 is prepared from example 22 in a manner similar to preparation 104. 1HNMR (DMSO-J6): 9.18 (s, IH), 8.95 (s, IH), 7.14 (d, J=8.8 Hz, 2H), 6.75 (m, 3H), 6.69 (s, IH), 4.45 (m, 2H), 3.15 (m, IH), 3.0 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.9 (m, IH), 1.7-0.9 (m, 7H). MS m/z 323 (M-I).
Separate example 23 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 24
[3-Hydroxy-9-(4-hydroxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-l-yl]- acetonitrile
Figure imgf000103_0001
Example 24 is prepared from example 20 in a manner similar to example 15. 1H NMR (DMSOd6): 9.28 (s, IH), 9.21 (s, IH), 7.16 (d, J=8.4 Hz, 2H), 6.8 (s, IH), 6.74 (m, 3H), 3.97 (s, 2H), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.95 (m, IH), 1.65 (m, IH), 1.55 (m, IH), 1.4 (m, IH), 1.3-0.8 (m, 4H). MSm/z 332 (M- 1).
Separate example 24 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 25
3-Hydroxy-9-(4-hydroxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carbonitrile (racemic)
Figure imgf000103_0002
Combine 3-Methoxy-9-(4-methoxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthrene-1-carbonitrile ( 0.066g, 0.19 mol) and pyridine hydrochloride ( 6.5g) and heat at 200-2150C for 30 minutes. Cool to r.t. and dilute with 2N HCl and ethyl acetate. Wash organic layer with water and dry over anhydrous sodium sulfate. Remove solvent in vacuo and chromatograph on silica gel with 20% ethyl acetate/hexanes to yield Example 25 ( 0.03g, 49%). 1H NMR (DMSOd6): 9.88 (s, IH), 9.25 (s, IH), 7.14 (m, 3H), 7.0 (s, IH), 6.75 (d, J=8.4 Hz, 2H), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.95 (m, IH), 1.65 (m, IH), 1.55 (m, IH), 1.4 (m, IH), 1.3-0.8 (m, 4H). MS m/z 318 (M-I). Separate example 25 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 26
3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-l- carboxylic acid amide
Figure imgf000104_0001
Example 26 is prepared from preparation 121 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.28 (s, IH), 9.21 (s, IH), 7.7 (s, IH), 7.29 (s, IH), 7.12 (d, J=8.4 Hz, 2H), 6.86 (s, IH), 6.74 (d, J=7.9 Hz, 2H), 3.15 (m, IH), 3.05 (m, IH), 2.9 (m, IH), 2.65 (m, IH), 2.4 (m, IH), 1.95 (m, IH), 1.65 (m, IH), 1.55 (m, IH), 1.4 (m, IH), 1.3-0.8 (m, 4H). MS m/z 336 (M-I).
Example 27 2-Bromo-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000104_0002
Example 27 is prepared from preparation 123 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.83 (s, IH), 9.2 (s, IH), 7.27 (s, IH), 7.1 (d, J=8.8 Hz, 2H), 6.97 (s, IH), 6.73 (d, J=8.4Hz, 2H), 3.1 (m, 4H), 2.7 (dd, J= 11 and 4Hz, IH), 2.34 (m, IH), 1.92 (m, IH), 1.8-0.8 (m, 6H). MS m/z 373, 371 (M, M-2). Example 28 l-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yI]- ethanone
Figure imgf000105_0001
Example 28 is prepared from preparation 124 in a manner similar to example 1. 1H NMR (DMSO-J6): 11.77 (s, IH), 9.23 (s, IH), 7.72 (s, IH), 7.14 (d, J=8.8 Hz, 2H), 6.97 (s, IH), 6.74 (d, J=8.8 Hz, 2H), 3.1 (m, 3H), 2.9 (dd, J= 11, IH), 2.64 (s, 3H), 2.34 (m, IH), 1.92 (m, IH), 2.5 -0.8 (m, 7H). MS/n/z 335 (M-I).
Example 29
2-(l-Hydroxy-ethyl)-9-(4-hydroxy-phenyl)-4b,5,6,7.8,8a,9,10-octahydro- phenanthren-3-ol
Figure imgf000105_0002
Combine l-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-2-yl]-ethanone (0.013g, 0.04 mmol) and NaBH4 (0.016g, 0.42 mmol) in ethanol (1.5 ml) and heat at 600C for 30 minutes. Remove solvent in vacuo and take into ethyl acetate, water, and sodium bicarbonate solution solution. Separate organic layer and wash with water. Dry over anhydrous sodium sulfate and remove solvent in vacuo to yield the titled compound (0.014g, 100%). 1H NMR (CD3OD): 7.16 (d, J=7.9 Hz, 2H), 7.1 (s, IH), 6.78 (d, J=8.4 Hz, 2H), 5.12 (m, IH), 3.2 (m, 3H), 2.8 (dd, J= 10.5 and 7.5 Hz, IH), 2.5 (m, IH), 2.34 (m, IH), 2.05 (m, IH), 1.8-1.6 (m, 2H), 1.48 (m, 3H), 1.4 -0.8 (m, 4H). MS /n/z 337 (M-I). Example 30 9-(4-Hydroxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-2,3-diol
Figure imgf000106_0001
Example 30 is prepared from preparation 125 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.17 (s, IH), 8.58 (s, IH), 8.54 (s, IH), 7.1 (d, J=8.4 Hz, 2H), 6.5 (m, 3H), 3.05 (m, 3H), 2.6 (d, J= 12.3, IH), 2.34 (m, IH), 1.86 (m, IH), 1.5 (m, IH), 1.39 (m, IH), 1.3-0.8 (m, 5H). MS m/z 309 (M-I).
Separate example 30 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 31 9-(4-Hydroxy-phenyl)-2-methoxy-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000106_0002
Combine 2-Bromo-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-ol (chiral) (O.O33g, 0.09 mmol), CuCl2 (0.008g, 0.06 mmol), 5 M NaOMe (in methanol, 1.5 ml), DMF (0.5 ml) and heat 15 hours at HO0C. Cool, add ethyl acetate and wash with IN HCl, then water. Dry organic layer over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph over silica gel 2X first with 20% ethyl acetate/hexanes, then 5-20% ethyl acetate/ hexanes to yield the titled compound (O.OlOg, 100%). 1H NMR (CDCl3): 7.21 (d, J=8.4 Hz, 2H), 7.0 (s, IH), 6.85 (d, J=8.8 Hz, 2H), 6.69 (s, IH), 3.91 (s, 3H), 3.2 (m, 4H), 2.85 (dd, J=4 and 11 Hz, IH), 2.45 (d, J=14.9 Hz, IH), 2.1-0.8 (m, 7H). MS m/z 323(M-I). Separate example 31 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 32 9-(4-Hydroxy-phenyl)-2-methyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000107_0001
Example 32 is prepared from preparation 126 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.18 (s, IH), 8.89 (s, IH), 7.1 (d, J=8.4 Hz, 2H), 6.84 (s, IH), 6.78 (s, IH), 6.72 (d, J=8.8 Hz, 2H), 3.05 (m, 4H), 2.65 (dd, J= 11 and 4Hz, 1H),2.35 (m, IH), 2.08 (s, 3H), 1.9 (m, IH), 1.7-0.9 (m, 6H). MS m/z 307 (M-I).
Separate example 32 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 33 9-(4-Hydroxy-phenyl)-2-propyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000107_0002
Example 33 is prepared from preparation 127 in a manner similar to example 1. 1H NMR (DMSO-J6): 9.18 (s, IH), 8.85 (s, IH), 7.1 (d, J=8.8 Hz, 2H), 6.82 (s, IH), 6.78 (s, IH), 6.72 (d, J=8.4 Hz, 2H), 3.05 (m, 3H), 2.65 (dd, J= 11 and 4Hz, IH), 2.45 (m, 2H), 2.35 (m, IH), 2.08 (s, 3H), 1.95 (m, IH), 1.8-0.95 (m, 6H), 0.92 (t, J=7.5 and 5.7 Hz, 3H). MS m/z 335 (M-I) Separate example 33 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 34 9-(4-Hydroxy-phenyl)-2-isopropyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-oI
Figure imgf000108_0001
Example 34 is prepared from preparation 129 in a manner similar to example 1. 1H NMR (DMSO-J6) 9.18 (s, IH), 8.89 (s, IH), 7.12 (d, J=8.4 Hz, 2H), 6.89 (s, IH), 6.78 (s, IH), 6.73 (d, J=8.8 Hz, 2H), 3.1 (m, 4H), 2.68 (dd, J= 11 and 4Hz, IH), 2.45 (m, 2H), 2.33 (d, J=12.7 Hz, IH), 1.9 (m, IH), 1.6 (m, 2H), 1.4 (m,lH), 1.25-0.9 (m, 8H). MS m/z 335 (M-I).
Separate example 34 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 35
5-(4-Hydroxy-phenyl)-l,2,3,4,4a,5,6,8,9,12b-decahydro-ll-oxa-benzo[a]anthracen-
10-one
Figure imgf000108_0002
Example 35 is prepared from preparation 132 in a manner similar to example 1. 1H NMR (DMSO-J6)- 9.21 (s, IH), 7.13 (d, J=8.4 Hz, 2H), 7.1 (s, IH), 7.05 (s, IH), 6.74 (d, J=8.4 Hz, 2H), 3.15 (m, 3H), 2.95 (m, 2H), 2.8 (m, 2H), 2.5 (m, IH), 1.95 (m, IH), 1.6 (m, 2H), 1.4 (m, IH), 1.75-0.9 (m, 5H). MS m/z 347 (M-I). Example 36
3-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yl]-
N-methyl-propionamide
Figure imgf000109_0001
Combine 5-(4-Hydroxy-ρhenyl)-l,2,3,4,4a,5,6,8,9,12b-decahydro-l l-oxa- benzo[a]anthracen-10-one (0.014g, 0.04 mmol) and excess methylamine ( 40% in water) in tetrahydrofuran (1 ml). After 30 minutes, remove solvent in vacuo, dissolve in ethyl acetate and dry over anhydrous sodium sulfate. Remove solvent in vacuo to yield the titled compound (0.014g, 92%). 1H NMR (DMSO-J6) 9.19 (s, IH), 9.02 (s, IH), 7.11 (d, J=8.8 Hz, 2H), 6.83 (s, IH), 6.79 (s, IH), 6.73 (d, J=8.4 Hz, 2H), 3.1 (m, 3H), 2.7 (m, 3H), 2.58 (s, 3H), 2.35 (m, 2H), 1.9 (m, IH), 1.6 (m, 2H), 1.4 (m,lH), 1.75-0.9 (m, 5H). MS m/z 378 (M-I).
Example 37
3-[3-Hydroxy-9-(4-hydroxy-phenyI)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yl]-
1 -piperidin-l-yI-propan-1 -one
Figure imgf000109_0002
Example 37 is prepared from example 35 in a manner similar to example 36. 1H NMR (DMSO-J6). 1H NMR (DMSO-J6): 9.19 (s, IH), 9.1 (s, IH), 7.1 (d, J=8.8 Hz, 2H), 6.85 (s, IH), 6.79 (s, IH), 6.73 (d, J=8.4 Hz, 2H), 3.5 (m, IH), 3.4 (m, 2H), 3.1 (m, 3H), 2.8-2.4 (m, 5H), 2.35 (m, IH), 1.9 (m, IH), 1.7-0.8 (m, 14H). MS m/z 432(M-I). Example 38
3-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yl]-
N,N-dimethyl-propionamide
Figure imgf000110_0001
Example 38 is prepared from example 35 in a manner similar to example 36. 1H NMR (DMSO-J6): 9.15 (s, IH), 9.07 (s, IH), 7.09 (d, J=8.8 Hz, 2H), 6.83 (s, IH), 6.75 (s, IH), 6.69 (d, J=8.8 Hz, 2H), 3.0 (m, 3H), 2.95 (s, 3H), 2.8 (s, 3H), 2.65 (m, 3H),2.55 (m, 3H), 2.3 (m, IH), 1.8 (m, IH), 1.75 (m, IH), 1.65-0.8 (m, 5B)MS mZz 392(M-I).
Example 39
3-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-2-yI]- propionamide
Figure imgf000110_0002
Example 38 is prepared from example 35 in a manner similar to example 36. 1H NMR (DMSO-J6): 9.14 (s, IH), 8.98 (s, IH), 7.28 (s, IH), 7.07 (d, J=8.4 Hz, 2H), 6.81 (s, IH), 6.75 (s, IH), 6.69 (d, J=8.4 Hz, 2H), 3.0 (m, 3H), 2.63 (m, 3H), 2.3 (m, 3H), 1.9 (m, IH), 1.7-0.8 (m, 7H). MS m/z 364(M-I).
Example 40
9-(4-Hydroxy-phenyl)-2-(3-hydroxy-propyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-ol
Figure imgf000111_0001
Combine 5-(4-Hydroxy-phenyl)-l,2,3,4,4a,5,6,8,9,12b-decahydro-ll-oxa- benzo[a]anthracen-10-one (0.05g, 0.143 mmol), lithium aluminum hydride 0.05g, 1.43 mmol), and tetrahydrofuran (10 ml) and stir 1.5 hours. Add ethyl acetate followed by IN HCl. Filter precipitate and wash organic layer water, dry over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph the residue on silica gel with ethyl acetate/ hexanes 1/1 to yield Example 40 (0.032g, 63%). 1H NMR (DMSCM6): 9.14 (s, IH), 8.84 (s, IH), 7.07 (d, J= 8.4 Hz, 2)H), 6.79 (s, IH), 6.74 (s, IH), 6.69 (d, J=8.4 Hz, 2H), 3.4 (q, J= 7 and 5 Hz, 2H), 3.0 (m, 3H), 2.63 (m, 2H), 2.3 (m, IH), 1.9 (m, IH), 1.7-0.8 (m, 10H). MS m/z 351 (M-I).
Separate example 40 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 41
2-(3-DimethyIamino-propyl)-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-ol
Figure imgf000111_0002
Combine 3-[3-Hydroxy-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-2-yl]-N,N-dimethyl-propionamide (0.009g, 0.023 mmol), lithium aluminum hydride ( 0.04 mmol), and tetrahydrofuran (1 ml) and stir 3 hours. Add ethyl acetate and water. Dry organic layer over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph the residue over silica gel to yield Example 40 (0.0036g, 42%). 1H NMR (CD3OD): 7.11 (d, J= 8.4 Hz, 2H), 6.86 (s, IH), 6.81 (s, IH), 6.73 (d, J=8.4 Hz, 2H), 3.1 (m, 3H), 2.7 (dd, J= 11 and 5 Hz, IH), 2.6 ( t, J= 7 and 7.5 Hz, 2H), 2.45 (t, J= 7.5 and 7 Hz, 3H), 2.35 (s, 6H), 2.0-0.8 (m, 10H). MS tn/z 380 (M+l).
Example 42
9-(4-Hydroxy-phenyl)-2-(3-methoxy-propyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-oI
Figure imgf000112_0001
Combine Methanesulfonic acid 9-(4-methanesulfonyloxy~phenyl)-2-(3~methoxy- propyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-yl ester (0.044g, 0.084 mmol), 5N KOH ( 2Ml), and methanol (2 ml) and heat at 8O0C for 2 hours. Remove solvent in vacuo. Add ethyl acetate and 6N HCl. Wash organic layer with water, dry over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph the residue on silica gel with 25% ethyl acetate/ hexanes to yield Example 42 (0.008g, 26%). 1H NMR (CDCl3): 7.17 (d, J= 8.4 Hz, 2H), 6.91 (s, IH), 6.87 (s, IH), 6.8 (d, J=8.4 Hz, 2H), 3.4 (s, 4H), 3.15 (m, 3H), 2.7 ( m, 3H), 2.45 (m, IH), 2.1-1.0(m, HH). MS /n/z 365 (M-I).
Example 43
2-(3-Bromo-propyl)-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-ol
Figure imgf000112_0002
Example 43 is prepared from Example 40 in a manner similar to Example 1. 1H NMR (CDCl3): 7.17 (d, J= 8.4 Hz, 2H), 6.92 (s, IH), 6.81 (d, J=8.8 Hz, 2H), 6.78 (s, IH), 3.47 (t, J= 6.7 and 6.6 Hz, 2H), 3.1 (m, 4H), 2.78 ( m, 3H), 2.4 (m, IH), 2.1-1.0(m, 9H). MS m/z 365 (M-I). Example 44
2-HydroxymethyI-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-
3-ol
Figure imgf000113_0001
Example 44 is prepapred from preparation 136 in a manner similar to preparation 104. NMR (CD3OD): 7.12 (d, J=8.4 Hz, 2H), 7.04 (s, IH), 6.83 (s, IH), 6.74 (d, J= 8.4 Hz, 2H), 4.61 (s, 2H), 3.25-3.0 (m, 4H), 2.75 (dd, J= 4.8 and 11 Hz, IH), 2.47 ( d, J= 14.6 Hz, IH), 2.0 (m, IH), 1.8-0.8 (m, 6H), MS m/z 337 (M-I).
Example 45
9-(4-Hydroxy-phenyl)-2-methoxymethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-
3-ol
Figure imgf000113_0002
Combine 3-Hydroxy-9-(4-methoxy~phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthrene-2-carbaldehyde (0.098g, 0.29 mmol), decaborane(14) (0.021g, 0.16 mmol) and methanol (5 ml) and stir for 21 hours. Remove solvent in vacuo. Add ethyl acetate wash with IN HCl then water. Dry over anhydrous sodium sulfate and remove solvent in vacuo. Chromatograph the residue on silica gel with 20% ethyl acetate/ hexanes to yield Example 44 (0.037g, 36%). 1H NMR (CD3OD): 7.13 (d, J=8.4 Hz, 2H), 7.01 (s, IH), 6.85 (s, IH), 6.74 (d, J= 8.8 Hz, 2H), 4.46 (s, 2H), 3.38 (s, 3H), 3.25-3.0 (m, 4H), 2.75 (dd, J= 4.8 and 11 Hz, IH), 2.45 ( m, IH), 2.0 (m, IH), 1.8-0.8 (m, 6H), MS m/z 337 (M-I). Separate example 45 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 46 9-(4-Hydroxy-phenyl)-10-methyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000114_0001
Example 46 is prepared from preparation 144 in a manner similar to example 1. TLC Rf=0.47 in 1:1 hexanes:ethyl acetate. 1H NMR (d-methanol): 7.22 (d, IH, /=8.8 Hz), 7.11 (d, 2H, /=8.4 Hz), 6.83 (m, IH), 6.78 (d, 2H, /=8.4 Hz), 6.64 (dd, IH, /=8.4, 2.2 Hz), 3.24 (m, IH), 2.73 (dd, IH, /=11.7, 2.4 Hz), 2.48 (d, IH, /=13.7 Hz), 1.83 (m, IH), 1.63 (m, 2H), 1.41 (d, 2H, /=10.1 Hz), 1.15 (m, 7H); MS mlz 307(M-I).
Separate example 46 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 47
6-Hydroxy-10-(4-hydroxy-phenyI)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthrene-9- carboxylic acid
Figure imgf000114_0002
Example 47 is prepared from preparation 145 in a manner similar to example 1. TLC Rf=O.11 in 3:7 (10%methanol/ethyl acetate):(50% hexanes:DCM). 1H NMR (DMSO): 7.18 (m, 3H), 6.91 (s, IH), 6.77 (d, 2H, /=8.4 Hz), 6.65 (dd, IH, /=8.4, 1.8 Hz), 4.26 (d, IH, /=12.3 Hz), 3.47 (m, 2H), 3.31 (m, IH), 2.52 (d, IH, /=14.1 Hz), 1.96 (m, IH), 1.68 (m, 2H), 1.43 (m, 2H), 1.11 (m, 2H); MS mlz 337 (M-I). Example 48
6-Hydroxy-10-(4-hydroxy-phenyl)-l,2,3,4,4a,9, 10,10a-octahydro-phenanthrene-9- carboxylic acid methyl ester
Figure imgf000115_0001
Combine 6-hydroxy- 10-(4-hydroxy-phenyl)- 1 ,2,3 ,4,4a,9, 10,1 Oa-octahydro- phenanthrene-9-carboxylic acid (O.9O3g, 2.67 mmol), AcCl (2 niL), and methanol (20.0 niL), and reflux under nitrogen atmosphere. After 72 hours, concentrate reaction to dryness under vacuum, add ethyl acetate and water. Separate the organic phase and wash with brine. Dry the organic phase with anhydrous sodium sulfate and concentrate to yield the titled compound (0.98Og, 99%) as a brown solid. 1H NMR (d-methanol): 7.15 (d, 2H, /=8.4 Hz), 7.04 (d, IH, /=8.8 Hz), 6.91 (s, IH), 6.77 (d, 2H, /=8.4 Hz), 6.64 (m, IH), 4.32 (d, IH, /=12.8 Hz), 3.58 (s, 3H), 3.45 (dd, IH, /=12.6, 2.4 Hz), 3.34 (s, IH), 2.52 (d, IH, /=14.1 Hz), 1.97 (m, IH), 1.68 (m, 2H), 1.44 (m, 2H), 1.11 (m, 3H); MS mlz 351 (M-I).
Example 49
10-Bromomethyl-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-
3-ol
Figure imgf000115_0002
Example 49 is prepared from preparation 142 in a manner similar to example 1. 1H NMR (d-methanol): 7.24 (d, IH, /=8.4 Hz), 7.13 (d, 2H, /=8.4 Hz), 6.85 (m, IH), 6.81 (d, 2H, /=8.4 Hz), 6.68 (dd, IH, /=8.4, 2.6 Hz), 4.02 (dd, IH, /=10.3, 2.9 Hz), 3.60 (d, IH, 7=11.5 Hz), 3.49 (m, IH), 3.31 (dd, IH, 7=11.7, 2.9 Hz), 3.17 (s, IH), 2.48 (d, IH, 7=13.7 Hz), 1.89 (m, IH), 1.64 (m, 2H), 1.45 (m, 2H), 1.14 (m, 3H); MS m/z 385, 387 (M-I).
Example 50
10-BromomethyI-9-(4-hydroxy-phenyl)-4b,5,6,7|)8,8a,9,10-octahydro-phenanthrene-
3-ol
Figure imgf000116_0001
Example 50 is prepared from preparation 146 in a manner similar to example 1. 1H NMR (d-methanol): 7.29 (d, IH, 7=8.4 Hz), 6.84 (m, 3H), 6.68 (dd, IH, 7=8.4, 2.2 Hz), 6.60 (d, 2H, 7=8.8 Hz), 3.77 (dd, IH, 7=10.3, 7.3 Hz), 3.57 (dd, IH, 7=10.6, 4.4 Hz), 3.45 (t, IH, 7=6.4 Hz), 3.23 (dd, IH, 7=11.9, 6.6 Hz), 2.99 (m, IH), 2.49 (m, IH), 2.23 (m, IH), 1.80 (m, IH), 1.50 (m, 2H), 1.39 (m, IH), 1.26 (m, 2H), 1.02 (m, IH); MS m/z 385,387(M-I).
Example 51
[6-Hydroxy-10-(4-hydroxy-phenyl)-l,2,3,4,4a,9,10,10a-octahydro-phenanthrene-9- yl]-acetonitrile
Figure imgf000116_0002
Example 51 is prepared from preparation 147 in a manner similar to example 1. TLC Rf=O.10 in 1: 1 hexanes: ethyl acetate. 1H NMR (d-methanol): 7.27 (d, IH, 7=8.4 Hz), 7.16 (d, 2H, 7=8.4 Hz), 6.90 (s, IH), 6.83 (d, 2H, 7=7.9 Hz), 6.72 (d, IH, 7=8.4 Hz), 3.60 (d, IH, 7=11.9 Hz), 3.26 (s, IH), 3.08 (m, 2H), 2.49 (m, 2H), 1.93 (m, IH), 1.66 (m, 2H), 1.45 (m, 2H), 1.15 (m, 3H); MS m/z 332 (M-I). Separate example 51 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 52
9-(4-Hydroxy-phenyl)-10-pyrrolidin-l-yImelthyI-4b,5,6,7,8,8a,9,10-octahydro- phenanthrene-3-ol
Figure imgf000117_0001
Example 52 is prepared from preparation 148 in a manner similar to example 1. TLC Rf=0.09 in 4% 2M NH3 methanol: DCM. 1H NMR (d-methanol): 7.57 (d, IH, 7=8.4 Hz), 7.13 (d, 2H, 7=8.4 Hz), 6.82 (s, IH), 6.77 (d, 2H, /=8.8 Hz), 6.63 (dd, IH, 7=8.4, 2.2 Hz), 3.34 (m, IH), 3.16 (m, 2H), 2.76 (dd, IH, 7=12.8, 5.7 Hz), 2.61 (dd, IH, 7=12.3, 2.6 Hz), 2.40 (m, 3H), 2.24 (m, 2H), 1.88 (m, IH), 1.66 (m, 4H), 1.55 (m, IH), 1.40 (m, 2H), 1.26 (m, 2H), 1.12 (m, 2H); MS m/z 378 (M+l).
Separate example 52 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 53 10-Ethyl-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro-phenanthrene-3-ol
Figure imgf000117_0002
Example 53 is prepared from preparation 149 in a manner similar to example 1. TLC Rf=0.21 in 1:1 hexanes:ethyl acetate. 1H NMR (d-methanol): 7.19 (d, IH, 7=8.8 HZ), 7.12 (d, 2H, 7=8.4 Hz), 6.84 (s, IH), 6.78 (d, 2H, 7=8.8 Hz), 6.65 (m, IH), 3.36 (m, IH), 3.16 (s, IH), 3.03 (dd, IH, /=12.1, 2.9 Hz), 2.48 (d, IH, 7=14.1 Hz), 1.88 (m, 2H), 1.60 (m, 3H), 1.41 (d, 2H, 7=7.9 Hz), 1.18 (m, 3H), 0.58 (t, 3H, 7=7.3 Hz).
Example 54
10-Hydroxymethyl-9-(4-hydroxy-phenyl)-4b,5,6,7;,8,8a,9,10-octahydro-phenanthren-
3-oI
Figure imgf000118_0001
Combine [6-benzyloxy-10-(4-benzyloxy-phenyl)- 1 ,2,3,4,4a, 10, 10a-octahydro- ρhenanthrene-9-yl]-methanol (0.071 g, 0.14 mmol), 10% Pd-C (0.005 g, 0.04 mmol), ethanol (10 mL), and tetrahydrofuran (2 mL), and stir under 50 psi of hydrogen atmosphere at room temperature. After 18 hours, filter reaction through celite using ethyl acetate, concentrate, and flash chromatograph eluting with 20% to 75% ethyl acetate/hexanes to yield the titled compound (0.027g, 60%) as a white solid. TLC Rf=0.23 in 1:1 hexanes:ethyl acetate. 1H NMR (CDCl3): 7.43 (d, IH, 7=8.4 Hz), 7.15 (d, 2H, 7=8.8 Hz), 6.85 (s, IH), 6.79 (d, 2H, 7=8.4 Hz), 6.68 (dd, IH, 7=8.6, 2.0 Hz), 3.98 (dd, IH, 7=11.0, 2.2 Hz), 3.53 (dd, IH, 7=11.0, 3.5 Hz), 3.33 (m, 2H), 3.18 (m, 2H), 2.49 (d, IH, 7=13.2 Hz), 1.89 (m, IH), 1.64 (m, 2H), 1.40 (s, IH), 1.20 (m, 2H), 1.20 (m, IH); MS m/z 323 (M-I).
Example 55
9-(4-Hydroxy-phenyl)-10-methoxymethyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-
3-ol
Figure imgf000118_0002
Combine 6-methoxy-9-methoxymethyl-10-(4-methoxy-ρhenyl)- l,2,3,4,4a,9,10,10a-octahydro-phenanthrene (0.050 g, 0.14 mmol), sodium ethanethiolate (0.037 g, 0.44 mmol), and DMF (4 mL), and reflux under nitrogen atmosphere. After 18 hours, cool the reaction to room temperature and add ethyl acetate, wash with sat ammonium chloride solution (aq), then brine several times. Concentrate, and purify using reverse phase chromatography (5% to 95% 0.001% TFA buffer in acetonitrile/water) to yield the titled compound (0.015g, 33%) as a white solid. TLC Rf=0.27 in 3: 1 hexanes:ethyl acetate. 1H NMR (d-methanol): 7.42 (d, IH, /=8.4 Hz), 7.13 (d, 2H, 7=8.4 Hz), 6.84 (s, IH), 6.79 (d, 2H, 7=8.4 Hz), 6.65 (dd, IH, 7=7.9, 1.8 Hz), 3.70 (d, IH, 7=7.0 Hz), 3.35 (m, 3H), 3.17 (s, 3H), 3.07 (m, IH), 2.48 (d, IH, 7=14.1 Hz), 1.87 (m, IH), 1.64 (m, 2H), 1.41 (m, 2H), 1.16 (m, 3H).
Example 56 l-[6-Hydroxy-10-(4-hydroxy-phenyl)-l,2,3,4,4a,9,10jl0a-octahydro-phenanthren-9- yl]-ethanone
Figure imgf000119_0001
Example 56 is prepared from preparation 153 in a manner similar to example 1. 1H NMR (d-methanol): 7.16 (d, 2H, 7=8.8 Hz), 6.96 (m, IH), 6.83 (d, IH, 7=8.4 Hz), 6.77 (d, 2H, 7=8.8 Hz), 6.64 (dd, IH, 7=8.4, 2.2 Hz), 4.26 (d, IH, 7=12.8 Hz), 3.35 (m, 2H), 2.53 (d, IH, 7=14.5 Hz), 1.98 (m, IH), 1.90 (s, 3H), 1.74 (m, IH), 1.61 (s, IH), 1.44 (m, 2H), 1.12 (m, 3H); MS mlz 335 (M-I).
Example 57
10-(l-Hydroxy-ethyl)-9-(4-hydroxy-phenyl)-4b,5,6,7,8,8a,9,10-octahydro- phenanthren-3-ol
Figure imgf000120_0001
Combine 1 -[6-hydroxy- 10-(4-hydroxy-phenyl)- 1 ,2,3 ,4,4a,9, 10, 1 Oa-octahydro- phenanthren-9-yl]-ethanone (0.027 g, 0.08 mmol), NaBH4 (0.010 g, 0.24 mmol), and ethanol (4 mL), and reflux under nitrogen atmosphere. After 72 hours, cool the reaction to room temperature, concentrate, and add ethyl acetate. Wash with sat ammonium chloride solution (aq), then brine, and purify using reverse phase chromatography (5% to 95% 0.001% TFA buffer in acetonitrile/water) to yield the titled compound (0.003g, 11%) as a white solid. 1H NMR (d-methanol): 7.62 (d, IH, /=8.4 Hz), 7.15 (m, 2H), 6.84 (s, IH), 6.78 (m, 2H), 6.64 (m, IH), 3.94 (m, IH), 3.49 (d, IH, J=I 1.5 Hz), 3.33 (m, IH), 3.13 (s, IH), 2.91 (dd, IH, 7=11.5, 3.5 Hz), 2.47 (m, IH), 1.86 (m, IH), 1.68 (m, IH), 1.52 (m, IH), 1.30 (m, 3H), 1.05 (m, 4H), 0.83 (d, 2H, /=6.2 Hz); MS mlz 337 (M-I).
Example 58 9-(4-Hydroxy-phenyl)-10-methyl-4b,5,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000120_0002
Example 58 is prepared from preparation 155 in a manner similar to example 1. TLC Rf=0.30 in 1:9 (10% methanol/ethyl acetate):(50% hexanes/DCM). 1H NMR (CDCl3): 7.18 (d, IH, /=8.4 Hz), 6.97 (d, 2H, /=8.4 Hz), 6.90 (d, IH, /=2.6 Hz), 6.74 (m, 3H), 3.31 (m, 2H), 3.05 (m, IH), 2.50 (m, IH), 2.29 (m, IH), 1.79 (m, IH), 1.49 (m, 4H), 1.25 (m, 2H), 1.13 (d, 3H, /=6.6 Hz). Separate example 58 into its enantiomers using the conditions described for the separation of example 1 into its enantiomers (examples IA and IB).
Example 59 4-Amino-9-(4-hydroxy-phenyI)-4b,5:,6,7,8,8a,9,10-octahydro-phenanthren-3-ol
Figure imgf000121_0001
Example 59 is prepared from preparation 160 in a manner similar to example 1. (15.8 mg, 49%). 1H NMR (d-methanol): 7.14 (m, 2H), 7.03 (t, IH, 7=7.5 Hz), 6.87 (d, IH, /=8.4 Hz), 6.76 (d, 2H, /=8.4 Hz), 3.43 (m, IH), 3.32 (m, IH), 3.04 (m, IH), 2.84 (dd, IH, /=16.3, 4.8 Hz), 2.25 (m, IH), 1.97 (m, IH), 1.73 (m, IH), 1.48 (m, 4H), 1.21 (m, 2H); MS mlz 310(M+l).
Test Procedures
ER Binding Assay
The competition ER binding assay is run in a buffer containing 50 mM N-[2- hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid (Hepes) pH 7.5, 1.5 mM EDTA, 150 mM NaCl, 10% glycerol, 1 mg/mL ovalbumin, 5mM DTT, 0.025 μCi per well of 3H- Estradiol (New England Nuclear #NET517 at 118 Ci/mmol, 1 mCi/mL), and 10 ng/well ER-α or ER-β Receptor (Pan Vera). Competing compounds are added at 10 different concentrations. Non-specific binding is determined in the presence of 1 μM of E2 (17-β Estradiol, Sigma, St. Louis, MO). The binding reaction (140 μL) is incubated for 4 hours at room temperature, then 70 μL of cold dextran coated charcoal (DCC) buffer is added to each reaction (DCC buffer is prepared by adding 0.75g of charcoal [Sigma] and 0.25g of dextran [Pharmacia] per 50 mL of assay buffer). The incubation plates are mixed for 8 minutes on an orbital shaker at 4°C and then centrifuged at 3,000 rpm for 10 minutes at 4°C. An aliquot of 120 μl of the mix is transferred to another 96-well, white flat bottom plate (Costar) and 175 μl of Wallac Optiphase Hisafe 3 scintillation fluid is added to each well. The plates are sealed and then shaken vigorously on an orbital shaker. After an incubation of 2.5hrs, the radioactivity is counted in a Wallac Microbeta counter. The IC50 and percent inhibition at lOμM are calculated. The Kd for 3H-Estradiol is determined by saturation binding to ER-α and ER-β receptors. The IC50 values for compounds are converted to Kj values using the Cheng-Prusoff equation and the Kd values are determined by saturation binding assay.
Preferred compounds bind to the ER-β receptor with a Kj of less than 20 nM. More preferred compounds bind to the ER-β receptor with a Kj of less than 1 nM. Compounds that are selective to binding to the ER-β receptor compared to the ER-α receptor bind to the ER-β receptor with a lower Kj compared to the Ki for the ER-α receptor.
As determined by the above assay, the compounds of examples 1-59 exhibit binding affinities (Ki) at the ER-α subtype in the range approximately 4->1000 nM and to the ER-β subtype in the range of approximately 0.2-500 nM.
ER Agonist Assay
The agonist activity of the compounds of the invention can be determined from assay(s) described in Harris, H. A.; Katzenellenbogen, J. A.; Katzenellenbogen, B. S. Endocrinology, 143, p. 4172-4177 (2002).
LNCaP Human PCa Xenograft Assay
ER-β agonists are evaluated for their effects on the growth of androgen-sensitive LNCaP human prostatic cancer (PCa) xenografts grown in intact sexually mature (5-6 weeks old) Hsd: Athymic Nude-nu (Athymic Nude) male mice. 2.0x10^ LNCaP tumor cells are injected bilaterally by the subcutaneous route into the pre-tracheal region of testicular intact male mice. Mice are castrated via the scrotal route to serve as the positive control group. Test compounds are administered once per day by subcutaneous or gavage administration at multiple dose levels in a volume of 0.2 ml to xenograft- bearing mice starting on the day following tumor injection. Test compounds are reformulated weekly based on average group mean body weights. The vehicle for these studies is 1% carboxymethyl cellulose (CMC) with 0.25% Tween 80. Body weights and tumor measurements are recorded on a weekly basis and entered directly into a JMP™ (SAS; Cary, NC) spreadsheet from electronic caliper measurement. Tumor volumes in mm^ are calculated in JMP using the following formula: L x W x H x 0.5236. Tumor and body weight responses for individual mice are recorded on a weekly basis. When LNCaP tumor volumes enter log-phase expansion, lesions are measured every 3-4 days. Growth rates are determined using linear modeling of the log tumor values and time-to- treatment failure (tumor vol= 1300- 1500 mm^) are determined using a linear extrapolation model (SAS; Cary, NC). Because of humane animal use considerations, animals are sacrificed when their tumor volumes approach 1200-1400 mirA At necropsy, final tumor measurement and body weights are recorded and whole blood is obtained via cardiac puncture and allowed to clot on ice. Serum is transferred to appropriately labeled 0.5 ml Eppendorf micro tubes, and samples are stored at -800C for biomarker analysis.
Benign Prostatic Hypertrophy (BPH)Assay
A mouse BPH study is essentially performed as a modified version of the rat BPH study as described earlier (Eur J Endocrinol. 2004 Apr;150(4):591-60313). Thirteen week CD-I male mice are single caged and housed for 1 week and treated with vehicle or compounds at various daily doses, given orally in a 1% Carboxymethylcellulose (CMC) + 0.25% Tween 80 in PBS, pH 6.8 formulation. At the end of the study, the animals are sacrificed using CO2, followed by blood collection using cardiac puncture. The animals are then subjected to necropsy to collect intact ventral prostate, seminal vesicle and/or testes to measure organ wet weight changes between treatment groups. Significant lowering of ventral prostate weights compared to vehicle control is determined using the Dunnet's test. The plasma derived from these animals are used to measure hormone changes and subsequently compared to vehicle control. The prostate tissue is snap-cooled in RNA later ™ solution, and total RNA is obtained using the RNeasy kit (Qiagen Corp.). Specific Taqman primers (see list below) for SGP-2 or clusterin, 18S ribosomal RNA (Applied Biosystems, Foster City, CA, Catalog # 4310893E) and smooth muscle myosin heavy chain (derived from Genebank sequence for rat NMJ313607) are used to quantify biomarker changes in these prostate tissues using real time PCR.
PCR primers: mouse SGP-2 gi 192149 -6 IF CGCAGACCGGACTCCAGAT mouse SGP-2 gi 192149 -121R CCACGCACAGCAGGAGAAT mouse SGP-2 TaqMan" probe: mouse SGP-2 gi 192149 -81T CCAAGGAGGCCACGCCATGAA While the exemplified compounds of the present invention demonstrate significant lowering of ventral prostate weights compared to vehicle control according to this test, preferred compounds demonstrate a significant lowering in prostate weight at doses of 10 mg/kg/day or less.
Therapeutic Methods of Use and Dosages
The various diseases and conditions described herein are well known and appreciated by those skilled in the art. It is also recognized that one skilled in the art may affect the associated diseases and conditions by treating a patient presently afflicted with the diseases or conditions or by prophylactically treating a patient afflicted with the diseases or conditions with a therapeutically effective amount of the compounds of Formula I.
A therapeutically effective amount can be readily determined by the attending diagnostician, as one skilled in the art, by the use of conventional techniques and by observing results obtained under analogous circumstances. In determining the therapeutically effective amount, the dose, a number of factors are considered by the attending diagnostician, including, but not limited to: the species of mammal; its size, age, and general health; the specific disease involved; the degree of or involvement or the severity of the disease; the response of the individual patient; the particular compound administered; the mode of administration; the bioavailability characteristic of the preparation administered; the dose regimen selected; the use of concomitant medication; and other relevant circumstances. A therapeutically effective amount of a compound of Formula I is expected to vary from about 0.001 milligram per kilogram of body weight per day (mg/kg/day) to about 100 mg/kg/day. Preferred amounts can be determined by one skilled in the art.
In effecting treatment of a patient afflicted with the diseases and conditions described above, a compound of Formula I can be administered in any form or mode which makes the compound bioavailable in a therapeutically effective amount, including oral, inhalation, and parenteral routes. For example, compounds of Formula I can be administered orally, by inhalation of an aerosol or dry powder, subcutaneously, intramuscularly, intravenously, transdermally, intranasally, rectally, topically, and the like. Oral or inhalation administration is generally preferred for treatment of respiratory diseases, e.g. asthma. One skilled in the art of preparing formulations can readily select the proper form and mode of administration depending upon the particular characteristics of the compound selected, the disease or condition state to be treated, the stage of the disease or condition, and other relevant circumstances. (Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co. (1990)).
The compounds of the present invention can be administered alone or in the form of a pharmaceutical composition in combination with pharmaceutically acceptable carriers or excipients, the proportion and nature of which are determined by the solubility and chemical properties of the compound selected, the chosen route of administration, and standard pharmaceutical practice. The compounds of the present invention, while effective themselves, may be formulated and administered in the form of their pharmaceutically acceptable salts, such as acid addition salts or base addition salts, for purposes of stability, convenience of crystallization, increased solubility and the like.
Pharmaceutical compositions of the compounds of Formula I are prepared in a manner well known in the pharmaceutical art. The carrier or excipient may be a solid, semi-solid, or liquid material, which can serve as a vehicle or medium for the active ingredient. Suitable carriers or excipients are well known in the art. The pharmaceutical composition may be adapted for oral, inhalation, parenteral, or topical use and may be administered to the patient in the form of tablets, capsules, aerosols, inhalants, suppositories, solution, suspensions, or the like. The compounds of the present invention may be administered orally, for example, with an inert diluent or with an edible carrier. They may be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the compounds may be incorporated with excipients and used in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums and the like. These preparations typically contain at least 4% of the compound of the present invention, the active ingredient, but may be varied depending upon the particular form and may conveniently be between 4% to about 70% of the weight of the unit. The amount of the compound present in compositions is such that a suitable dosage will be obtained. Preferred compositions and preparations according to the present invention may be determined by someone skilled in the art.
The tablets, pills, capsules, troches and the like may also contain one or more of the following adjuvants: binders such as microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch or lactose, disintegrating agents such as alginic acid, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; and sweetening agents such as sucrose or saccharin may be added or a flavoring agent such as peppermint, methyl salicylate or orange flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as polyethylene glycol or a fatty oil. Other dosage unit forms may contain other various materials that modify the physical form of the dosage unit, for example, as coatings. Thus, tablets or pills may be coated with sugar, shellac, or other enteric coating agents. A syrup may contain, in addition to the present compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors. Materials used in preparing these various compositions should be pharmaceutically pure and non-toxic in the amounts used.
For the purpose of parenteral therapeutic administration, the compounds of the present invention may be incorporated into a solution or suspension. These preparations should contain at least 0.1 % of a compound of the invention, but may be varied to be between 0.1 and about 50% of the weight thereof. The amount of the compound of Formula I present in such compositions is such that a suitable dosage will be obtained. Preferred compositions and preparations can be determined by one of ordinary skill in the art.
The compounds of the present invention may also be administered by inhalation, such as by aerosol or dry powder. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the compounds of the present invention or a formulation thereof. Formulations for administration by inhalation of compounds of formula (I) may be delivered in single phase, bi-phasic, or tri-phasic systems. A variety of systems are available for the administration by aerosols of the compounds of formula (I). Dry powder formulations are prepared by either pelletizing or milling the compound of formula (I) to a suitable particle size or by admixing the pelletized or milled compound of formula (I) with a suitable carrier material, such as lactose and the like. Delivery by inhalation includes the necessary container, activators, valves, subcontainers, and the like. Preferred aerosols and dry powder formulations for administration by inhalation can be determined by one skilled in the art.
The compounds of the present invention may also be administered topically, and when done so the carrier may suitably comprise a solution, ointment or gel base. The base, for example, may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, bee wax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. Topical formulations may contain a concentration of the Formula I or its pharmaceutical salt from about 0.1 to about 10% w/v (weight per unit volume).
The solutions or suspensions may also include one or more of the following adjuvants: sterile diluents such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylene diaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.

Claims

WE CLAM:
1. A compound of formula I:
Figure imgf000128_0001
Formula I wherein:
G is -CH2-, -CH2CH2-, -CH2C(CH3)2- or -O-;
R1 is hydrogen, hydroxy or amino;
R2 is hydrogen or hydroxy;
R3 is hydrogen, hydroxy, Br, methyl, n-propyl, i-propyl, n-butyl, hydroxymethyl, methoxy, CH3CH(OH)-, acetyl, CH3OCH2-, R7C(O)CH2CH2- Or R8CH2CH2CH2-, or R2 and R3 form a -CH2CH2-X-O- biradical, wherein the oxygen radical represents the R2 end and the methylene radical represents the R3 end;
X is -C(O)- or -C(=CH2)-;
R4 is hydrogen, hydroxy, cyano, R9-CH2-, vinyl, 4-chlorophenyl, carboxy, aminocarbonyl or methoxycarbonyl;
R5 is hydrogen, methyl, ethyl, R10-CH2-, CH3CH(OH)-, acetyl, carboxyl or methoxycarbonyl;
R6 is hydrogen or fluoro;
R7 is amino, methylamino, dimethylamino or piperidin-1-yl;
R8 is bromo, hydroxy, dimethylamino or methoxy;
R9 is bromo, cyano, hydroxy, methoxy or azido;
R10 is bromo, hydroxy, cyano, methoxy or pyrrolidin-1-yl; with the provisos that: at least one or R1, R2, R3 and R4 is hydroxy and at least three of R1, R2, R3, R4 and R5 are hydrogen and enantiomers thereof.
2. The compound of claim 1 of formula Ia:
Figure imgf000129_0001
Formula Ia and enantiomers thereof.
3. The compound of claim 2 wherein G is -CH2-.
4. The compound of claim 2 wherein G is -O-.
5. The compound of claim 2 wherein G is -CH2-CH2-:
6. The compound of claim 2 wherein G is -CH2C(CH3)2-.
7. The compound of claim 1 of formula Ib:
Figure imgf000129_0002
Formula Ib
and enantiomers thereof.
8. The compound of claim 7 wherein Ic 3 i •s r R>77,C(O)CH2CH2-.
9. The compound of claim 7 wherein R3 is R8CH2CH2CH2-, CH3OCH2-, or hydroxymethyl.
10. The compound of claim 1 of formula Ic:
Figure imgf000130_0001
Formula Ic and enantiomers thereof.
11. The compound of claim 1 of formula Id:
Figure imgf000130_0002
Formula Id and enantiomers thereof.
12. The compound of claim 1 of formula Ie:
Figure imgf000131_0001
Formula Ie and enantiomers thereof.
13. The compound of claim 1 of formula If:
Figure imgf000131_0002
Formula If and enantiomers thereof.
14. The compound of claim 1 of formula Ig:
Figure imgf000132_0001
Formula Ig and enantiomers thereof.
15. A pharmaceutical composition comprising: a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14 together with a pharmaceutically acceptable carrier, diluent or excipient.
16. A method of treating nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia inflammatory bowel disease, arthritis, or benign prostatic hypertrophy in a patient, comprising: administering to said patient an effective amount of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
17. A method of treating benign prostatic hypertrophy in a patient, comprising: administering to said patient an effective amount of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
18. A method of treating prostate cancer in a patient, comprising: administering to said patient an effective amount of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
19. The method according to any one of Claims 16 to 18, wherein the patient is a human.
20. Use of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
21. Use of a compound, or pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14 for the manufacture of a medicament for the treatment of benign prostatic hypertrophy.
22. Use of a compound, or pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14 for the manufacture of a medicament for the treatment of prostate cancer.
23. A method of treating a patient with an estrogen receptor beta mediated disease condition, comprising: administering to said patient a therapeutically effective amount of a compound according to any one of Claims 1 to 14.
24. The method of Claim 23, wherein the condition is prostate cancer.
25. The method of Claim 23, wherein the condition is benign prostatic hyperplasia.
26. The method according to any one of Claims 23 to 25, wherein the patient is a human.
27. Use of a compound according to any one of Claims 1 to 14 in the manufacture of a medicament for the treatment of an estrogen receptor beta mediated disease condition.
28. The use of claim 27, wherein the condition is prostate cancer.
29. The use of claim 27, wherein the condition is benign prostatic hyperplasia.
30. A method of agonizing estrogen receptor beta function, comprising: contacting the receptor with a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
31. A method of agonizing estrogen receptor beta function in a patient, comprising: administering to said patient an effective amount of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
32. A method of treating an estrogen receptor beta mediated disease condition in a patient, comprising: administering to said patient an effective amount of a compound, or a pharmaceutically acceptable salt thereof, according to any one of Claims 1 to 14.
33. The method of Claim 32, wherein the condition is nocturia, obstructive uropathy, obesity, dementia, hypertension, incontinence, colon cancer, prostate cancer, infertility, depression, leukemia, inflammatory bowel disease, arthritis, or benign prostatic hypertrophy.
34. The method of Claim 32 or 33, wherein the condition is benign prostatic hypertrophy.
35. The method of Claim 32 or 33, wherein the condition is prostate cancer.
36. The method according to any one of Claims 31 to 35, wherein the patient is a human.
PCT/US2006/004540 2005-02-15 2006-02-10 Substituted tetralins as selective estrogen receptor-beta agonists WO2006088716A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/814,806 US8093302B2 (en) 2005-02-15 2006-02-10 Substituted tetralins as selective estrogen receptor-β agonists
EP06720533A EP1853578A1 (en) 2005-02-15 2006-02-10 Substituted tetralins as selective estrogen receptor-beta agonists

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US65287305P 2005-02-15 2005-02-15
US60/652,873 2005-02-15

Publications (1)

Publication Number Publication Date
WO2006088716A1 true WO2006088716A1 (en) 2006-08-24

Family

ID=36284352

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/004540 WO2006088716A1 (en) 2005-02-15 2006-02-10 Substituted tetralins as selective estrogen receptor-beta agonists

Country Status (3)

Country Link
US (1) US8093302B2 (en)
EP (1) EP1853578A1 (en)
WO (1) WO2006088716A1 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009047791A2 (en) * 2007-09-24 2009-04-16 Reliance Life Sciences Pvt. Ltd. Toll like receptor (tlr) signaling antagonist
US7585985B2 (en) 2003-04-21 2009-09-08 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists
WO2010103095A1 (en) 2009-03-13 2010-09-16 N.V. Organon Tetrahydronaphthalen-2-ol derivatives
US8063102B2 (en) 2009-03-13 2011-11-22 N.V. Organon Tetrahydronaphthalen-2-ol derivatives
JP2013545731A (en) * 2010-10-27 2013-12-26 シグマ−タウ・インドゥストリエ・ファルマチェウチケ・リウニテ・ソシエタ・ペル・アチオニ Diterpenoid derivatives with biological properties
EP2786991A3 (en) * 2008-08-27 2014-11-12 Corning Incorporated Photochromic 2h-chromenes annelated at c5-c6 and their methods of preparation
US9078888B2 (en) 2007-01-22 2015-07-14 Gtx, Inc. Nuclear receptor binding agents
US9604931B2 (en) 2007-01-22 2017-03-28 Gtx, Inc. Nuclear receptor binding agents
US9623021B2 (en) 2007-01-22 2017-04-18 Gtx, Inc. Nuclear receptor binding agents
US9974776B2 (en) 2013-12-05 2018-05-22 Karo Pharma Ab Estrogen receptor beta agonists for use in treating mesothelioma
US10154988B2 (en) 2012-11-14 2018-12-18 The Johns Hopkins University Methods and compositions for treating schizophrenia
US20230210826A1 (en) * 2022-01-06 2023-07-06 The Curators Of The University Of Missouri Drug combination for treating obesity
WO2024126650A1 (en) 2022-12-15 2024-06-20 Syngenta Crop Protection Ag Novel bicyclic-carboxamide compounds useful as pesticides

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201113538D0 (en) 2011-08-04 2011-09-21 Karobio Ab Novel estrogen receptor ligands

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003044006A1 (en) * 2001-11-19 2003-05-30 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6593322B1 (en) * 1999-03-17 2003-07-15 Signal Pharmaceuticals, Inc. Compounds and methods for modulation of estrogen receptors
CA2367895A1 (en) * 1999-03-17 2000-09-21 Signal Pharmaceuticals, Inc. Compounds and methods for modulation of estrogen receptors
TR200102992T2 (en) * 1999-04-16 2004-12-21 Astrazeneca Ab ß estrogen receptor ligands.
UA83620C2 (en) * 2001-12-05 2008-08-11 Уайт Substituted benzoxazoles and analogues as estrogenic agents
US6630508B1 (en) * 2002-02-11 2003-10-07 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor β agonists
ES2338119T3 (en) 2003-04-21 2010-05-04 Eli Lilly And Company BENZOPIRANOS SUBSTITUTED AS SELECTIVE AGONISTS OF THE RECEPTOR-BETA DE ESTROGENO.
DE602004016150D1 (en) 2003-04-21 2008-10-09 Lilly Co Eli SUBSTITUTED BENZOPYRANES AS SELECTIVE ANTAGONISTS ON THE OSTROGEN RECEPTOR BETA
ES2361031T3 (en) 2004-10-18 2011-06-13 Eli Lilly And Company BENZOPIRANOS REPLACED AS SELECTIVE AGONISTS OF THE BETA DE ESTRÓGEN RECEIVER.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003044006A1 (en) * 2001-11-19 2003-05-30 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SUN J ET AL: "NOVEL LIGANDS THAT FUNCTION AS SELECTIVE ESTROGENS OR ANTIESTROGENSFOR ESTROGEN RECEPTOR-A OR ESTROGEN RECEPTOR-SS", ENDOCRINOLOGY, BALTIMORE, MD, US, vol. 140, no. 2, February 1999 (1999-02-01), pages 800 - 804, XP000905566, ISSN: 0013-7227 *
YANG, X.; REINHOLD, A.R.; ROSATI, R.L.; LIU, K.K.-C.: "Enzyme-catalyzed asymmetric deacylation for the preparation of Lasofoxifene (CP-336156), a selective estrogen receptor modulator", ORGANIC LETTERS, vol. 2, no. 25, 2000, pages 4025 - 4027, XP002381347 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7585985B2 (en) 2003-04-21 2009-09-08 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists
US7842822B2 (en) 2003-04-21 2010-11-30 Eli Lilly And Company Substituted benzopyrans as selective estrogen receptor-beta agonists
US9623021B2 (en) 2007-01-22 2017-04-18 Gtx, Inc. Nuclear receptor binding agents
US9604931B2 (en) 2007-01-22 2017-03-28 Gtx, Inc. Nuclear receptor binding agents
US9078888B2 (en) 2007-01-22 2015-07-14 Gtx, Inc. Nuclear receptor binding agents
WO2009047791A3 (en) * 2007-09-24 2009-08-06 Reliance Life Sciences Pvt Ltd Toll like receptor (tlr) signaling antagonist
WO2009047791A2 (en) * 2007-09-24 2009-04-16 Reliance Life Sciences Pvt. Ltd. Toll like receptor (tlr) signaling antagonist
EP2786991A3 (en) * 2008-08-27 2014-11-12 Corning Incorporated Photochromic 2h-chromenes annelated at c5-c6 and their methods of preparation
US8063102B2 (en) 2009-03-13 2011-11-22 N.V. Organon Tetrahydronaphthalen-2-ol derivatives
CN102272081B (en) * 2009-03-13 2014-04-30 默沙东有限责任公司 Tetrahydronaphthalen-2-ol derivatives
JP2012520265A (en) * 2009-03-13 2012-09-06 エム・エス・ディー・オス・ベー・フェー Tetrahydronaphthalen-2-ol derivative
CN102272081A (en) * 2009-03-13 2011-12-07 欧加农股份有限公司 Tetrahydronaphthalen-2-ol derivatives
WO2010103095A1 (en) 2009-03-13 2010-09-16 N.V. Organon Tetrahydronaphthalen-2-ol derivatives
JP2013545731A (en) * 2010-10-27 2013-12-26 シグマ−タウ・インドゥストリエ・ファルマチェウチケ・リウニテ・ソシエタ・ペル・アチオニ Diterpenoid derivatives with biological properties
US10154988B2 (en) 2012-11-14 2018-12-18 The Johns Hopkins University Methods and compositions for treating schizophrenia
EP3610890A1 (en) 2012-11-14 2020-02-19 The Johns Hopkins University Methods and compositions for treating schizophrenia
US10624875B2 (en) 2012-11-14 2020-04-21 The Johns Hopkins University Methods and compositions for treating schizophrenia
US9974776B2 (en) 2013-12-05 2018-05-22 Karo Pharma Ab Estrogen receptor beta agonists for use in treating mesothelioma
US20230210826A1 (en) * 2022-01-06 2023-07-06 The Curators Of The University Of Missouri Drug combination for treating obesity
WO2024126650A1 (en) 2022-12-15 2024-06-20 Syngenta Crop Protection Ag Novel bicyclic-carboxamide compounds useful as pesticides

Also Published As

Publication number Publication date
US8093302B2 (en) 2012-01-10
US20100249075A1 (en) 2010-09-30
EP1853578A1 (en) 2007-11-14

Similar Documents

Publication Publication Date Title
WO2006088716A1 (en) Substituted tetralins as selective estrogen receptor-beta agonists
US20080255078A1 (en) Triphenylethylene Compounds Useful as Selective Estrogen Receptor Modulators
US20080306036A1 (en) Triphenylethylene Compounds Useful as Selective Estrogen Modulators
JP2009292824A (en) Non-steroidal, tetracyclic compound for estrogen-related treatment
HU228683B1 (en) Benzene derivatives, preparation method and pharmaceutical compositions containing same
US7354951B2 (en) Substituted benzopyrans as selective estrogen receptor-beta agonists
WO2008128431A1 (en) L-stepholidine (l-spd) derivatives, preparation method and usage thereof
NO884008L (en) PROCEDURE FOR PREPARING 3,7-DIAZABICYCLO (3,3,1) NON-COMPOUNDS.
CN111757770B (en) 3-Phenyl-4-hexynoic acid derivatives as GPR40 agonists
NZ531850A (en) Substituted benzopyrans as selective estrogen receptor-beta agonists
TW200524941A (en) Novel derivatives of 4a,5,9,10,11,12-hexahydro-benzofuro[3a,3,2] [2]benzazepine
JP2009067794A (en) New estrogen receptor ligand
KR100760446B1 (en) Antipsychotic Cyclic ?-Aralkyl Amines
US8063102B2 (en) Tetrahydronaphthalen-2-ol derivatives
JP5212931B2 (en) Method for producing lasofoxifene and its analogs
JP5570535B2 (en) Tetrahydronaphthalen-2-ol derivative
US4301290A (en) Organic compounds
FR2744444A1 (en) NOVEL BIPHENYL COMPOUNDS, PROCESS AND PREPARATION INTERMEDIATES, MEDICAMENT APPLICATION AND PHARMACEUTICAL COMPOSITIONS COMPRISING THE SAME
US20040082642A1 (en) Novel estrogen receptor ligands and method III
JP2004515485A6 (en) Novel estrogen receptor ligands and methods III
IE64195B1 (en) New benzocycloheptene derivatives process for the preparation thereof and pharmaceutical compositions containing them
WO2007114223A1 (en) Method for producing carboxylic acid compound
JP2010070452A (en) New trifluoromethylphenyltetrahydrocinnoline derivative and its use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006720533

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 11814806

Country of ref document: US