WO2006076007A2 - Methods of detecting coronavirus infections - Google Patents

Methods of detecting coronavirus infections Download PDF

Info

Publication number
WO2006076007A2
WO2006076007A2 PCT/US2005/013890 US2005013890W WO2006076007A2 WO 2006076007 A2 WO2006076007 A2 WO 2006076007A2 US 2005013890 W US2005013890 W US 2005013890W WO 2006076007 A2 WO2006076007 A2 WO 2006076007A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
coronavirus
antibody
infected
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/013890
Other languages
French (fr)
Other versions
WO2006076007A3 (en
Inventor
Mark Denison
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vanderbilt University
Original Assignee
Vanderbilt University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanderbilt University filed Critical Vanderbilt University
Publication of WO2006076007A2 publication Critical patent/WO2006076007A2/en
Anticipated expiration legal-status Critical
Publication of WO2006076007A3 publication Critical patent/WO2006076007A3/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses

Definitions

  • the present invention relates generally to the fields of microbiology, immunology and virology. More particularly, it concerns methods of identifying infections of cells and tissue samples by coronavirus using viral replicase proteins as targets.
  • Coronaviruses have been long known to cause important diseases in a wide variety of animal species, including humans, cattle, swine, chickens, dogs, cats and mice. Coronavirus diseases in non-human species may be quite severe, and devastating in domestic livestock such as pigs, cattle and chickens.
  • the characterized human coronaviruses - HCoV-229E and HCoV OC43 - are significant causes of upper respiratory infections, responsible for 10-35% of human colds.
  • Studies of human coronaviruses have been limited by their lack of growth in culture from primary isolates, and by the lack, until recently, of reverse genetic approaches for their study. Thus, while the human coronaviruses are arguably two of the most economically important viruses in humans, ongoing research has been pursued only by a handful of investigators.
  • SARS severe acute respiratory syndrome
  • coronaviruses have demonstrated the ability of coronaviruses to adapt for replication in cells of different species.
  • some studies have demonstrated that the murine coronaviruses may cause disease in primates following direct inoculation into brain.
  • coronaviruses have been proposed, based on evolutionary studies, to have acquired genes from other viruses or cells, probably by recombination events. The emergence of a new coronavirus pathogenic for humans, by either adaptation of an animal virus, or by recombination of two coronaviruses during a coinfection, is consistent with these features of coronavirus evolution, replication and maintenance in populations.
  • a method of detecting coronavirus infection of a cell comprising (a) contacting a cell with a first antibody against a coronavirus replicase protein; and (b) determining binding of said first antibody to a replicase protein, wherein binding of said first antibody identifies said cell as infected by a coronavirus.
  • the cell in step (a) maybe fixed, fixed and permeabilized, or unfixed.
  • the cell may be comprised within in culture, and may be cultured subsequent to step (b).
  • the cell may be derived from an animal biological sample, may be a Vero cell, a Vero E6 cell, a BHK cell or a DBT cell, or may be a cell lacks a determinant for natural coronavirus infection (or SARS-CoV), but supports viral protein expression, RNA synthesis, virus production and release.
  • the method may further comprise delivering to said cell a wild-type or mutant coronavirus genome or an expression cassette encoding one or more coronavirus proteins. Delivering may comprise transfection or electroporation.
  • the cell may be engineered to support coronavirus infection, such as with an ACE2 expression construct or a coronavirus receptor expression construct.
  • the coronavirus may be an avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), rabbit coronavirus, human coronavirus NL or human coronavirus NL63.
  • the coronavirus may be SARS virus.
  • the replicase protein may be selected from the group consisting of nspl, nsp2, nsp3, nsp4, nsp5, nsp ⁇ , nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nspl ⁇ .
  • the first antibody may be a monoclonal antibody or comprised within polyclonal antisera.
  • Step (b) may comprise an ELISA, immunofluorescence or FACS.
  • the first antibody may be labeled, or antibody binding may be detected binding of a second antibody to said first antibody, said second antibody being labeled.
  • the label may be fluorophore, a chromophore, a chemilluminescent molecule or an enzyme.
  • the first antibody may bind immunologically with multiple coronavirus species.
  • the cell may be suspected of being infected by a coronavirus, or known to be infected by a coronavirus.
  • the cell may have been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication.
  • the candidate substance may be a DNA molecule, and RNA molecule, a protein, a small molecule a proteinase inhibitor, a steroid, interferon ⁇ , ⁇ or ⁇ , a cytokine, or an immune mediator.
  • the cell may have been infected about 36 hours, about 24 hours, about 12 hours, about 6 hours, about 4 hours, about 3 hours, about 2 hours, or about 1 hour.
  • a method of detecting coronavirus infection of a cell culture comprising (a) collecting cell culture supernatant from a cell culture; (b) contacting said cell culture supernatant with a first antibody against a coronavirus replicase protein; and (c) determining binding of said first antibody to a replicase protein in said cell culture supernatant, wherein binding of said first antibody identifies said cell culture as infected by a coronavirus.
  • the cell may be a Vero cell, a Vero E6 cell, a BHK cell, a DBT cell, or cell that lacks a determinant for natural coronavirus infection, but supports viral protein expression, RNA synthesis, virus production and release.
  • the cell may be engineered to support coronavirus infection, for example, with an ACE2 expression construct or a coronavirus receptor expression construct.
  • the culture supernatant may be concentrated or purified prior to step (a).
  • the coronavirus may be an avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), or rabbit coronavirus.
  • SARS virus severe acute respiratory syndrome virus
  • the replicase protein may be selected from the group of nspl, nsp2, nsp3, nsp4, nsp5, nsp ⁇ , nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nspl 6.
  • the first antibody may be a monoclonal antibody or a comprised within polyclonal antisera.
  • the antibody is attached to a support, such as a column, a dipstick or a bead.
  • Antibody binding may be detected binding of a second antibody to said replicase protein, which may be labeled.
  • the label may be fluorophore, a chromophore, a chemilluminescent molecule or an enzyme.
  • Step (b) may comprise an ELISA.
  • the first antibody may be bind immunologically to multiple cor
  • the cell may be is suspected of being infected by a coronavirus, or known to be infected by a coronavirus.
  • the cell may have been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication.
  • the candidate substance may be a DNA molecule, and RNA molecule, a protein, a small molecule, a proteinase inhibitor, a steroid, interferon ⁇ , ⁇ , or ⁇ , a cytokine, or an immune mediator.
  • the cell may have been infected about 36 hours, about 24 hours, about 12 hours, about 6 hours, about 4 hours, about 3 hours, about 2 hours, or about 1 hour.
  • a method of detecting diagnosing a coronavirus infection in a subject comprising (a) obtaining a tissue sample from said subject; (b) contacting a cell or cell fragment from said tissue sample with an antibody against a coronavirus replicase protein; and (c) identifying the presence or absence of said coronavirus replicase protein in said tissue by determining binding of said antibody to a target in said cell or cell fragment, wherein the presence of said coronavirus replicase protein detects a coronavirus infection in said subject.
  • the tissue sample may be homogenized or intact and identified by in situ immunofluorescence.
  • FIG. 1 Predicted organization and proteolytic processing of the SARS-CoV replicase polyprotein.
  • the processing of the replicase polyprotein is mediated by two proteinases, the papain-like proteinase (PLP - gray box) and the 3Clike proteinase (3CL-pro - stippled box).
  • the cleavage activities of these proteinases are indicated by black arrows and the numerical designation of the non-structural proteins (nsp) is indicated above the diagram.
  • Two potential cleavage sites are present between nspl and nsp2 (indicated by gray arrows) at isoG ⁇ Am and at 227G ⁇ V228.
  • FIG. 1 Predicted organization and proteolytic processing of the SARS-CoV replicase polyprotein.
  • the processing of the replicase polyprotein is mediated by two proteinases, the papain-like proteinase (PLP - gray box) and the 3Clike proteinase (3CL-pro -
  • FIG. 3 Localization of SARS-CoV ORFIa replicase proteins in Vero cells. Vero cells were infected with SARS-CoV or were mock-infected for 12 h prior to fixation with cold methanol.
  • FIGS. 4A-B - FIG. 4A Time course of nspl expression- Vero cells were infected with SARS-CoV, fixed at the times indicated p.i., and stained with the nspl antibody.
  • FIG. 4B Timecourse of SARS-CoV growth in Vero cells.
  • FIGS. 5A-B Identification of ORFIb SARS-CoV replicase proteins by immunoblot and immunofluorescence.
  • FIG. 5A SARS-CoV infected (I) and mock-infected (M) cell lysates were separated by SDS-PAGE, transferred to nitrocellulose, and probed with the nspl2, nspl3, nspl4, nspl5, and nspl ⁇ antibodies. Additionally, preimmune (P) sera were used to probe infected lysates. Black circles indicate replicase proteins identified.
  • FIG. 5B Vero cells were infected with SARS-CoV or were mock-infected for 12 h prior to fixation with cold methanol. Cells were probed with the nspl 3 antibody and viewed as described in materials and methods.
  • FIGS. 6A-B - MHV antibodies are cross-reactive with SARS-CoV replicase proteins.
  • FIG. 6A Identification of replicase proteins by immunoblot. SARS-CoV infected (I) and mock-infected (M) cell lysates were separated by SDS-PAGE, transferred to nitrocellulose and probed with the MHV-pol and MHV antibodies. Additionally, preimmune (P) sera were used to probe infected lysates. Black circles indicate replicase proteins identified.
  • FIG. 6B Antibodies against MHV-pol, and MHV were used to stain Vero cells by immunofluorescence. Infected Vero cells stained with immune sera. Fluorescence was not detected in mock-infected cells with immune sera or in infected cells stained with pre-immune sera.
  • coronaviruses a numerous and can infect a wide variety of animal hosts, including humans.
  • the economic impact of coronavirus infections is extensive, and the recent SARS epidemic revealed how susceptible humans are to new variants of these viruses.
  • therapies continue to be developed, the number of weapons to combant coronavirus infections is limited, making prevention of the disease all that more critical.
  • In order to prevent disease it is important to be able to identify very early those individuals who are infected. It also is critical to be able to rapidly screen biological reagents, such as blood, for the presence of active coronavirus infections.
  • coronavirus replicase proteins are among the earliest that can be detected following infection of permissive cells. As discussed, there are numerous situations where early detection of coronavirus infection would be valuable. Obviously, where an individual may have been exposed to infectious coronavirus, the ability to determine whether that person has been infected prior to displaying symptoms (both for treatment and quarantine purposes) is important. In addition, the ability to identify coronavirus replication in biological samples (blood and plasma; organs for transplant; cells from screening assays) has value as well. Thus, the present invention contemplates the production of antibodies for a variety of replicase proteins from virtually any coronavirus.
  • the assays are designed to identify infections at time periods of less than 12 hr, less than 8 hr, less than six hours, and at about 4 hr.
  • the cells maybe fixed, and optionally permeabilized. In others, the cells are unfixed and remain viable following testing. The cells maybe intentionally infected, i.e., the detection may involve the screening of agents that inhibit replication following expression.
  • Coronaviridae Nidoviruses are positive-stranded RNA viruses infect a wide range of vertebrates.
  • the virions are enveloped, pleomorphic, spherical, or kidney-shaped. Surface projections of envelope distinct; club-shaped; dispersed evenly over all the surface.
  • Two families are established: Family Arteriviridae and Family Coronaviridae. Coronaviruses infects hosts in the Domain Eucarya, Kingdom Animalia, Phylum Chordata, Subphylum Vertebrata, Classes Mammalia and Aves, Orders Primates, Carnivora, Perissodactyla, Artiodactyla, Rodentia, and Lagomorphia. It is transmitted by means not involving a vector. World-wide distribution is likely.
  • Virions are enveloped, slightly pleomorphic, spherical or kidney shaped, and about 120-160 nm in diameter. Surface projections of envelope are distinct, club-shaped, spaced widely apart and dispersed evenly over all the surface. Nucleocapsids are rod-shaped (straight or bent), about 9-13 nm in diameter. Virions associated RNA nucleocapsids exhibit helical or tubular symmetry. Molecular mass (Mr) of the virion 400 x 106. Buoyant density is 1.23-1.24 g cm-3 in
  • virions are stable in acid environment (pH 3), relatively stable in presence of Mg ++ . Virions are sensitive to heat, lipid solvents, non-ionic detergents, formaldehyde, and oxidizing agents.
  • Virions contain one molecule of linear positive-sense single stranded RNA with a total genome length is 20,000-33,000 nt. The 5' end of the genome has a cap, and the 3' end has a poly(A) tract. Subgenomic mRNA is found in infected cells.
  • the S protein is responsible for attachment to cells, hemagglutination and membrane fusion. It has a carboxy-terminal half with a coiled-coil structure.
  • the second largest protein (30,000-35,000 Da) is the integral membrane protein (M) which spans the virus envelope three times, with only 10% protruding at the virion surface.
  • M integral membrane protein
  • N nucleocapsid protein
  • the fourth largest protein (65,000 Da) is the hemagglutinine-esterase protein (HE), which forms short surface projections, and can have receptor binding, hemagglutination and receptor destroying activities.
  • HE hemagglutinine-esterase protein
  • the fifth largest protein (10,000-12,000 Da) is tentatively designated as the small membrane protein (sM), detected in avian infectious bronchitis virus (IBV) and porcine transmissible gastroenteritis virus (TGEV).
  • the virus exhibits distinct antigen determinants on envelope and spikes, those corresponding to each of the major structural glycoproteins - S, HE, M, and N.
  • Antigenic specificity of virion can be determined by neutralization tests (S and HE), or complement fixation tests (M).
  • Protective immunity is induced in form of complement independent neutralizing antibodies.
  • the Coronaviridae family is split into two groups - coronavirus and torovirus.
  • Coronaviruses include avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus, rabbit coronavirus, or the recently identified SARS associated human coronavirus.
  • Toroviruses include Berne virus or Breda virus. The SARS virus is a member of Coronaviridae, and is subcategorized as a coronavirus.
  • Virions are enveloped, slightly pleomorphic, spherical or kidney shaped, and about 120-160 nm in diameter. Surface projections of envelope are distinct, club-shaped, spaced widely apart and dispersed evenly over all the surface. Nucleocapsids are rod-shaped (straight or bent), about 9-13 nm in diameter. Virions associated RNA nucleocapsids exhibit helical or tubular symmetry.
  • virions are stable in acid environment (pH 3), relatively stable in presence of Mg ++ . Virions are sensitive to heat, lipid solvents, non-ionic detergents, formaldehyde, and oxidizing agents.
  • Virions contain one molecule of linear positive-sense single stranded RNA with a total genome length is 20,000-33,000 nt. The 5' end of the genome has a cap, and the 3' end has a poly(A) tract. Subgenomic mRNA is found in infected cells. The SARS genomic sequence has been deposited into GenBank (accession numbers AY274119.3 and AY278741)
  • the coronavirus replicase gene (also known as gene 1 or the polymerase gene) comprises 22 kB of the coronavirus genome, corresponding to some 7800 amino acids, and is composed of two overlapping open reading frames - ORFIa and Ib. Following uncoating of the RNA genome in the cell cytoplasm, the replicase gene is translated as either an ORF Ia polyprotein (495 kD) or as an ORFl ab fusion polyprotein (803 kD), with translation of ORF Ib requiring a ribosomal frameshift event at the end of ORF Ia.
  • the intact replicase polyproteins are not detected during natural infection, since maturation proteolytic cleavages occur cotranslationally by three proteinase functions encoded in ORF Ia polyprotein.
  • the proteolytic processing results in 15 or 16 mature proteins, including the proteinases, an RNA helicase, and a putative RNA-dependent RNA polymerase.
  • the MHV proteins are set forth in Table 1, and SARS replicase proteins are set forth in Table 2.
  • the replicase gene expresses all of the viral factors required for all stages of MHV mRNA synthesis and replication. In addition, it has been shown that inhibition of polyprotein processing at any time during infection results in rapid shutoff of viral RNA synthesis, indicating that at least some of the proteolytic processing events are required for RNA synthesis. However there are differences in mature replicase proteins among different coronaviruses, particularly in the amino-terminal 100 kD of the polyproteins. IV. Culturing Coronavirus Host Cells
  • Coronaviruses can grow in a variety of transformed and primary mammalian cell lines.
  • a primary determinants of permissivity for infection is the expression of specific host proteins that function as receptors to bind the coronavirus S protein and initiate steps in virus entry and uncoating of genome RNA for replication in the host-cell cytoplasm.
  • methods to either express receptor in naturally non-permissive cells, mechanisms to bypass the receptor requirement, and virus adaptation have allowed coronaviurses to grow in a very wide variety of cell types of divergent species.
  • MHV can grow in murine cells (L2, 17CL1, DBT) because of natural CEACAM receptor expression.
  • receptor expression and direct electroporation of genome RNA have each allowed MHV to replicate efficiently in BHK and HeLa cells.
  • permissivity may be based on expression of a receptor, angiotensin converting enzyme 2 (ACE2).
  • ACE2 angiotensin converting enzyme 2
  • DMEM Dulbecco's Modified Essential Medium
  • FCS fetal calf serum
  • the primary cells for culture and testing are Vero Cells or Vero E6 cells. Following infection, cells can be lysed for immunoblot using standard lysis buffers containing Tris, NP-40, and SDS. For immunofluorescence, cells can be fixed and permealbilized with 100% methanol, 50% methanol/50% acetone, or fixed with paraformadehyde and permeabilized with Triton XlOO.
  • a host cell is modified to express (a) a coronavirus receptor, (b) a protein that supports coronavirus replication, or (c) a viral RNA.
  • a coronavirus receptor a protein that supports coronavirus replication
  • a viral RNA a viral RNA.
  • vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • An expression vector further comprises nucleic acid sequences that support the transcription, and optionally translation, of the vector-encoded material. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide.
  • Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell.
  • control sequences refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell.
  • vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs and BACs).
  • YACs and BACs artificial chromosomes
  • a “promoter” is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence.
  • the phrases "operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
  • a promoter generally comprises a sequence that functions to position the start site for RNA synthesis.
  • the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
  • a coding sequence "under the control of a promoter, one positions the 5" end of the transcription initiation site of the transcriptional reading frame "downstream" of (i.e., 3' of) the chosen promoter.
  • the "upstream" promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.
  • promoter elements frequently are flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
  • the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
  • individual elements can function either cooperatively or independently to activate transcription.
  • a promoter may or may not be used in conjunction with an "enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • a promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous.”
  • an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
  • certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment.
  • a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment.
  • promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
  • promoters that are most commonly used in recombinant DNA construction include the ⁇ -lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.
  • sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (see U.S. Patents 4,683,202 and 5,928,906, each incorporated herein by reference).
  • control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression.
  • Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et a 2001, incorporated herein by reference).
  • the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
  • the promoter may be heterologous or endogenous.
  • any promoter/enhancer combination could also be used to drive expression.
  • Use of a phage T3, T7 or SP6 cytoplasmic expression system is another possible embodiment.
  • Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • Table 3 lists non-limiting examples of elements/promoters that may be employed, in the context of the present invention, to regulate the expression of a RNA.
  • Table 3 provides non-limiting examples of inducible elements, which are regions of a nucleic acid sequence that can be activated in response to a specific stimulus.
  • tissue-specific promoters or elements as well as assays to characterize their activity, is well known to those of skill in the art.
  • Nonlimiting examples of such regions include the human LIMK2 gene (Nomoto et al 1999), the somatostatin receptor 2 gene (Kraus et al, 1998), murine epididymal retinoic acid-binding gene (Lareyre et al, 1999), human CD4 (Zhao-Emonet et al, 1998), mouse alpha2 (XI) collagen (Tsumaki et al, 1998), DlA dopamine receptor gene (Lee et al, 1997), insulin-like growth factor II (Wu et al, 1997), and human platelet endothelial cell adhesion molecule- 1 (Almendro et al, 1996).
  • promoters which are operative in bacterial cells include, a promoter of Bacillus stearothermophilus maltogenic amylase gene, Bacillus licheniformis ⁇ -amylase gene, Bacillus amyloliquefaciens BAN amylase gene, Bacillus subtilis alkaline protease gene, or Bacillus pumilus xylosldase gene; a P R or P L promoter of phage lambda; a lac, tip, or tac promoter of Escherichia coli; and the like.
  • promoters which are operative in insect cells include polyhedrin promoter, PlO promoter, basic protein promoter of Autographa californica nuclear polyhedrosis, baculovirus immediate early gene 1 promoter, baculovirus 39K delayed early gene promoter, and the like.
  • promoters which are operative in yeast host cells include a promoter derived from yeast glycolysis system genes, alcohol dehydrogenase gene promoter, TPIl promoter, ADH2-4c promoter, and the like.
  • a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements. In certain embodiments of the invention, the use of internal ribosome entry sites
  • IRES elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5'-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patents 5,925,565 and 5,935,819, each herein incorporated by reference). C. Multiple Cloning Sites
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al, 1999; Levenson et al, 1998; and Cocea, 1997, incorporated herein by reference.)
  • MCS multiple cloning site
  • Restriction enzyme digestion refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art.
  • a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector.
  • "Ligation” refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
  • RNA molecules will undergo RNA splicing to remove introns from the primary transcripts.
  • Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see, for example, Chandler et al, 1997, herein incorporated by reference.)
  • the vectors or constructs of the present invention will generally comprise at least one termination signal.
  • a “termination signal” or “terminator” is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.
  • the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 A residues (poly A) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently.
  • that terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message.
  • the terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator.
  • the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.
  • polyadenylation signal In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
  • Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
  • Origins of Replication In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.
  • ori origins of replication sites
  • ARS autonomously replicating sequence
  • cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector.
  • a selectable marker is one that confers a property that allows for selection.
  • a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
  • An example of a positive selectable marker is a drug resistance marker.
  • a drug selection marker aids in the cloning and identification of transformants
  • genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers.
  • markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated.
  • screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. Further examples of selectable markers are well known to one of skill in the art.
  • the present invention will be used to examine the properties of cells and viruses with regard to viral replication.
  • not all useful embodiments will be able to take advantage of natural modes of infection, i.e., binding of infectious virions to appropriate cell surface receptors, followed by internalization.
  • Suitable methods for delivery to cells of a coronavirus genome, a coronavirus expression cassette, or sequences capable of expressing a coronavirus receptor are believed to include virtually any method by which a nucleic acid (e.g. , DNA) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art.
  • a nucleic acid e.g. , DNA
  • Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson et al, 1989; Nabel et al, 1989), by injection (U.S.
  • organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • a nucleic acid may be delivered to an organelle, a cell, a tissue or an organism via one or more injections ⁇ i.e., a needle injection), such as, for example, subcutaneously, intradermally, intramuscularly, intervenously, intraperitoneally, etc.
  • injections i.e., a needle injection
  • Methods of injection of vaccines are well known to those of ordinary skill in the art ⁇ e.g., injection of a composition comprising a saline solution).
  • Further embodiments of the present invention include the introduction of a nucleic acid by direct microinjection. Direct microinjection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985).
  • a nucleic acid is introduced into an organelle, a cell, a tissue or an organism via electroporation.
  • EIectroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.
  • certain cell wall-degrading enzymes such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells (U.S. Patent 5,384,253, incorporated herein by reference).
  • recipient cells can be made more susceptible to transformation by mechanical wounding.
  • Mouse pre-B lymphocytes have been transfected with human kappa-immunoglobulin genes (Potter ed al, 1984), and rat hepatocytes have been transfected with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al, 1986) in this manner.
  • friable tissues such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly.
  • pectolyases pectolyases
  • mechanically wounding in a controlled manner.
  • pectolyases pectolyases
  • Patent 5,384,253 discloses a method for treating a plant disease.
  • D'Halluin et al, 1992 discloses a method for treating a plant disease.
  • wheat Zhou et al, 1993
  • tomato Hou and Lin, 1996)
  • soybean Choxistou et al, 1987
  • tobacco Lee et al, 1989.
  • One also may employ protoplasts for electroporation transformation of plant cells (Bates, 1994; Lazzeri, 1995).
  • protoplasts for electroporation transformation of plant cells
  • the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is described by Dhir and Widholm in International Patent Application No. WO 9217598, incorporated herein by reference.
  • Other examples of species for which protoplast transformation has been described include barley (Lazerri, 1995), sorghum (Battraw et al, 1991), maize (Bhattacharjee et al, 1997), wheat (He et al, 1994) and tomato (Tsukada, 1989).
  • a nucleic acid is introduced to the cells using calcium phosphate precipitation.
  • Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique.
  • mouse L(A9), mouse C127, CHO, CV-I, BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990).
  • a nucleic acid is delivered into a cell using DEAE-dextran followed by polyethylene glycol.
  • reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
  • Additional embodiments of the present invention include the introduction of a nucleic acid by direct sonic loading.
  • LTK fibroblasts have been transfected with the thymidine kinase gene by sonication loading (Fechheimer et al, 1987).
  • a nucleic acid may be entrapped in a lipid complex such as, for example, a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).
  • a liposome may be complexed with a hemagglutinating virus (HVJ).
  • HVJ hemagglutinating virus
  • a liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-I) (Kato et al, 1991).
  • HMG-I nuclear non-histone chromosomal proteins
  • a liposome may be complexed or employed in conjunction with both HVJ and HMG-I.
  • a delivery vehicle may comprise a ligand and a liposome.
  • a nucleic acid may be delivered to a target cell via receptor-mediated delivery vehicles.
  • receptor-mediated delivery vehicles take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in a target cell.
  • this delivery method adds another degree of specificity to the present invention.
  • Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a nucleic acid-binding agent.
  • Others comprise a cell receptor-specific ligand to which the nucleic acid to be delivered has been operatively attached.
  • ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987; Wagner et al., 1990; Perales e/ al, 1994; Myers, EPO 0273085), which establishes the operability of the technique. Specific delivery in the context of another mammalian cell type has been described (Wu and Wu, 1993; incorporated herein by reference).
  • a ligand will be chosen to correspond to a receptor specifically expressed on the target cell population.
  • a nucleic acid delivery vehicle component of a cell-specific nucleic acid targeting vehicle may comprise a specific binding ligand in combination with a liposome.
  • the nucleic acid(s) to be delivered are housed within the liposome and the specific binding ligand is functionally incorporated into the liposome membrane.
  • the liposome will thus specifically bind to the receptor(s) of a target cell and deliver the contents to a cell.
  • Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
  • EGF epidermal growth factor
  • the nucleic acid delivery vehicle component of a targeted delivery vehicle may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • lipids or glycoproteins that direct cell-specific binding.
  • lactosyl-ceramide, a galactose-terminal asialganglioside have been incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes (Nicolau et al, 1987). It is contemplated that the tissue-specific transforming constructs of the present invention can be specifically delivered into a target cell in a similar manner.
  • Microprojectile bombardment techniques can be used to introduce a nucleic acid into at least one, organelle, cell, tissue or organism (U.S. Patent 5,550,318; U.S. Patent 5,538,880; U.S. Patent 5,610,042; and PCT Application WO 94/09699; each of which is incorporated herein by reference). This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., 1987). There are a wide variety of microprojectile bombardment techniques known in the art, many of which are applicable to the invention.
  • Microprojectile bombardment may be used to transform various cell(s), tissue(s) or organism(s), such as for example any plant species.
  • species which have been transformed by microprojectile bombardment include monocot species such as maize (PCT Application WO 95/06128), barley (Ritala et al, 1994; Hensgens et al, 1993), wheat (U.S.
  • Patent 5,563,055, incorporated herein by reference rice (Hensgens et al, 1993), oat (Torbet et al, 1995; Torbet et al, 1998), rye (Hensgens et al, 1993), sugarcane (Bower et al, 1992), and sorghum (Hagio et al, 1991); as well as a number of dicots including tobacco (Tomes et al, 1990; Buising and Benbow, 1994), soybean (U.S.
  • Patent 5,322,783, incorporated herein by reference sunflower (Knittel et al 1994), peanut (Singsit et al, 1997), cotton (McCabe and Martinell, 1993), tomato (VanEck et al. 1995), and legumes in general (U.S. Patent 5,563,055, incorporated herein by reference).
  • one or more particles may be coated with at least one nucleic acid and delivered into cells by a propelling force.
  • Several devices for accelerating small particles have been developed.
  • One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold particles or beads.
  • Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
  • cells in suspension are concentrated on filters or solid culture medium.
  • immature embryos or other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
  • An illustrative embodiment of a method for delivering DNA into a cell (e.g., a plant cell) by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with cells, such as for example, a monocot plant cells cultured in suspension.
  • the screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large.
  • the present invention contemplates the use of various immunologic assays to assess coronavirus infection.
  • polyclonal or monoclonal antibodies that bind to coronavirus replicase proteins will have utilities in several applications.
  • the invention provides for the production of antibodies that bind immunologically to coronavirus replicase proteins.
  • Means for preparing and characterizing antibodies are well known in the art (See, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference).
  • Polyclonal antisera is prepared by immunizing an animal with an immunogenic composition in accordance with the present invention and collecting antisera from that immunized animal.
  • a wide range of animal species can be used for the production of antisera.
  • the animal used for production of anti-antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.
  • a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier.
  • exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers.
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers.
  • Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bis-biazotized benzidine.
  • the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants.
  • adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
  • the amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization.
  • a variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal).
  • the production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a suitable titer is achieved.
  • the immunized animal can be bled and the serum isolated and stored, or the animal can be used to generate mAbs (below).
  • the animal For production of rabbit polyclonal antibodies, the animal can be bled through an ear vein or alternatively by cardiac puncture.
  • the procured blood is allowed to coagulate and then centrifuged to separate serum components from whole cells and blood clots.
  • the serum may be used as is for various applications or else the desired antibody fraction may be purified by well-known methods, such as affinity chromatography using another antibody or a peptide bound to a solid matrix or protein A followed by antigen (peptide) affinity column for purification.
  • Monoclonal Antibodies mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified replicase protein, polypeptide or peptide. The immunizing composition is administered in a manner effective to stimulate antibody producing cells.
  • a selected immunogen composition e.g., a purified or partially purified replicase protein, polypeptide or peptide.
  • the immunizing composition is administered in a manner effective to stimulate antibody producing cells.
  • the methods for generating monoclonal antibodies generally begin along the same lines as those for preparing polyclonal antibodies.
  • Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep, goat, monkey cells also is possible.
  • the use of rats may provide certain advantages (Goding, 1986, pp. 60-61), but mice are preferred, with the BALB/c mouse being most preferred as this is most routinely used and generally gives a higher percentage of stable fusions.
  • the animals are injected with antigen, generally as described above.
  • the antigen may be coupled to carrier molecules such as keyhole limpet hemocyanin if necessary.
  • the antigen would typically be mixed with adjuvant, such as Freund's complete or incomplete adjuvant.
  • Booster injections with the same antigen would occur at approximately two-week intervals.
  • somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol.
  • These cells may be obtained from biopsied spleens or lymph nodes. Spleen cells and lymph node cells are preferred, the former because they are a rich source of antibody-producing cells that are in the dividing plasmablast stage.
  • a panel of animals will have been immunized and the spleen of animal with the highest antibody titer will be removed and the spleen lymphocytes obtained by homogenizing the spleen with a syringe.
  • a spleen from an immunized mouse contains approximately 5 x 10 7 to 2 x 10 8 lymphocytes.
  • the antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized.
  • Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas).
  • any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984; each incorporated herein by reference).
  • the immunized animal is a mouse
  • rats one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell fusions.
  • NS-I myeloma cell line also termed P3-NS-l-Ag4-l
  • Another mouse myeloma cell line that may be used is the 8-azaguanine-resistant mouse murine myeloma SP2/0 non-producer cell line.
  • Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2:1 proportion, though the proportion may vary from about 20:1 to about 1 :1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes.
  • Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977).
  • PEG polyethylene glycol
  • the use of electrically induced fusion methods also is appropriate (Goding pp. 71-74, 1986).
  • Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10-6 to 1 x 10-8. However, this does not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium.
  • the selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture media.
  • Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis.
  • the media is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium).
  • HAT medium a source of nucleotides
  • azaserine the media is supplemented with hypoxanthine.
  • the preferred selection medium is HAT. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium.
  • the myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive.
  • HPRT hypoxanthine phosphoribosyl transferase
  • the B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. This culturing provides a population of hybridomas from which specific hybridomas are selected.
  • hybridomas typically are performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity.
  • the assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, dot immunobinding assays, and the like.
  • the selected hybridomas would then be serially diluted and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for mAb production in two basic ways.
  • a sample of the hybridoma can be injected (often into the peritoneal cavity) into a histocompatible animal of the type that was used to provide the somatic and myeloma cells for the original fusion (e.g., a syngeneic mouse).
  • the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection.
  • a hydrocarbon especially oils such as pristane (tetramethylpentadecane) prior to injection.
  • the injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid.
  • the body fluids of the animal such as serum or ascites fluid, can then be tapped to provide mAbs in high concentration.
  • the individual cell lines could also be cultured in vitro, where the mAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations.
  • mAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography.
  • Fragments of the monoclonal antibodies of the invention can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction.
  • monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer.
  • a molecular cloning approach may be used to generate monoclonals.
  • combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells e.g., normal-versus-tumor cells.
  • the advantages of this approach over conventional hybridoma techniques are that approximately 10 4 times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.
  • the present invention thus concerns immunodetection methods for binding, quantifying or otherwise generally detecting coronavirus replicase proteins.
  • the steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al. (1987); incorporated herein by reference.
  • Immunoassays in their most simple and direct sense, are binding assays.
  • Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA) and immunobead capture assay.
  • ELISAs enzyme linked immunosorbent assays
  • RIA radioimmunoassays
  • detection is not limited to such techniques, and Western blotting, dot blotting, FACS analyses, and the like also may be used in connection with the present invention.
  • immunobinding methods include obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
  • the immunobinding methods of this invention include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process.
  • a sample suspected of being infected with a coronavirus and contact the sample with an antibody, and then detect or quantify the amount of immune complexes formed under the specific conditions.
  • the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody.
  • the second binding ligand may be linked to a detectable label.
  • the second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody.
  • the primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes.
  • the secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.
  • Further methods include the detection of primary immune complexes by a two step approach.
  • a second binding ligand such as an antibody, that has binding affinity for the encoded protein, peptide or corresponding antibody is used to form secondary immune complexes, as described above.
  • the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes).
  • the third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.
  • ELISAs enzyme linked immunosorbent assays
  • antibodies binding to the encoded proteins of the invention are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition suspected of containing the replicase proteins is added to the wells. After binding and washing to remove non-specifically bound immunocomplexes, the bound antigen may be detected.
  • Detection is generally achieved by the addition of a second antibody specific for the target protein, that is linked to a detectable label.
  • This type of ELISA is a simple "sandwich ELISA.”
  • Detection also may be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
  • the samples suspected of containing replicase proteins are immobilized onto the well surface and then contacted with the antibodies of the invention. After binding and washing to remove non-specifically bound immunecomplexes, the bound antibody is detected. Where the initial antibodies are linked to a detectable label, the immunecomplexes may be detected directly. Again, the immunecomplexes may be detected using a second antibody that has binding affinity for the first antibody, with the second antibody being linked to a detectable label.
  • ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non-specifically bound species, and detecting the bound immunecomplexes.
  • coating incubating or binding, washing to remove non-specifically bound species, and detecting the bound immunecomplexes.
  • one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours.
  • the wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera.
  • nonspecific protein that is antigenically neutral with regard to the test antisera.
  • BSA bovine serum albumin
  • casein solutions of milk powder.
  • the coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface.
  • a secondary or tertiary detection means rather than a direct procedure.
  • the immobilizing surface is contacted with a control and sample to be tested under conditions effective to allow immunecomplex (antigen/antibody) formation. Detection of the immunecomplex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.
  • Under conditions effective to allow immunecomplex (antigen/antibody) formation means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.
  • the "suitable” conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hrs, at temperatures preferably on the order of 25°C to 27°C, or may be overnight at about 4°C or so.
  • the contacted surface is washed so as to remove non-complexed material.
  • a preferred washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immunecomplexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immunecomplexes may be determined.
  • the second or third antibody will have an associated label to allow detection.
  • this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate.
  • a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immunecomplex formation (e.g., incubation for 2 hrs at room temperature in a PBS-containing solution such as PBS-Tween).
  • the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea and bromocresol purple or
  • ABTS 2,2'-azido-di-3-ethyl-benzthiazoline-6-sulfonic acid
  • H 2 O 2 peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g. , using a visible spectra spectrophotometer.
  • Immunofluorescence uses an antigen-specific antibody conjugated with a fluorescent dye (direct), or the formation of antigen-antibody complex which is detected with fluorescent dye-conjugated antiimmunoglobulin antibody (indirect). The tissue is then examined by fluorescence microscopy.
  • direct an antigen-specific antibody conjugated with a fluorescent dye
  • indirect fluorescent dye-conjugated antiimmunoglobulin antibody
  • Typical dyes include fluorescein (488 nm argon laser; emission at 519 nm), R-Phycoerythrin (488 nm argon laser; emission at 578 nm), PE-Cy5 (488 nm argon laser; emission at 680 nm), PE-Cy5.5 (488 nm argon laser; emission at 694 nm), PE-Texas Red (488 nm argon laser; emission at 615 nm), PE-Cy7 (488 nm argon laser; emission at 767 nm), Allophyocyanin (633 nm argon laser; emission at 660 nm), CY5 (633 nm argon laser; emission at 670 nm), APC-Cy7 (633 nm argon laser; emission at 767 nm), APC-Cy5.5 (633 nm argon laser; emission at 694 nm), 7-AAD (488 nm argon laser; emission
  • tissue/cells is/are harvested, transferred into a receptacle (tube; well) allowing cells to be isolated by centrifugation.
  • the sample is resuspended Staining Buffer and a cell count is performed. Cells are spun again, the supernatant is discarded, and cells are resuspended in Staining Buffer at an appropriate concentration.
  • conjugated primary antibodies are used, the antibodies should be pre-incubated with the cells for 5-10 min on ice prior to staining.
  • Primary antibody should be diluted in Staining Buffer and dispensed to each test tube or well of a microtiter plate. Cell suspension (equal to 10 6 cells) is added to each tube or well and mixed gently.
  • the present invention further comprises methods for identifying inhibitors of coronavirus replication.
  • These assays may comprise random screening of large libraries of candidate substances; alternatively, the assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to act as viral inhibitors.
  • a method generally comprises:
  • the term “candidate substance” refers to any molecule or compound that may potentially inhibit the export of proteins from the nucleus of a cell.
  • the candidate substance may be a protein or fragment thereof, a peptide aptamer, a small molecule, or even a nucleic acid.
  • rational drug design includes not only comparisons with know inhibitors and activators, but predictions relating to the structure of target molecules.
  • the goal of rational drug design is to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs which are more active or stable than the natural molecules, which have different susceptibility to alteration, or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof. This could be accomplished by x-ray crystallography, computer modeling, or by a combination of both approaches.
  • Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.
  • Candidate compounds may include fragments or parts of naturally-occurring compounds, or may be found as active combinations of known compounds, which are otherwise inactive. It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators. Other suitable modulators include antisense molecules, ribozymes, and antibodies
  • an antisense molecule that bound to a translational or transcriptional start site, or splice junctions would be ideal candidate inhibitors.
  • the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators.
  • Such compounds which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators.
  • the present invention makes use of cysteine proteinase (CyP) inhibitors.
  • CyP cysteine proteinase
  • L-tr ⁇ «s-Epoxysuccinyl-leucylamido(4- guanido)butane, or E64
  • E64 was reported to be a cysteine proteinase inhibitor (Barrett et ah, 1982; Mehdi, 1991).
  • E64 rapidly inactivated cathepsins B, H and L as well as papain, yet had no effect on serine proteinases at concentrations 50-fold higher.
  • Ep-475 (L-tra «5-Epoxysuccinyl-leucylamido(3-methyl)butane) was more effective than E64 at inhibiting cathepsins B and L, but Dc 11 was about 100-fold less reactive.
  • Variants currently in use include E64c and E64d.
  • Grinde (1982) also reported the isolation of E64 as a thiol proteinase inhibitor of fungal origin, along with two synthetic analogs, Ep-459 and the above-noted Ep-475. All three inhibitors were found to act selectively on lysosomal protein degradation. Ep-475 and E64 were found to inhibit as much as 50% of total degradation (about 70% of lysosomal degradation) at concentrations which did not disturb protein synthesis.
  • cysteine proteinase inhibitors are known and some are described in
  • cysteine protease inhibitors include siRNA's, ribozymes and antisense molecules directed at cysteine protease sequences, proposed picornavirus 3CLpro and 2a proteinase inhibitors, Rhino virus proteinase inhibitors, and drugs designed around 3CLpro crystal structure.
  • corticosteroids are often utilized as adjunct therapy for viral infections.
  • ribavarin + corticosteroids is a typical treatment for SARS.
  • corticosteroids are similar to the natural hormone cortisone, and affect many body processes, including the breakdown of protein, fat, and carbohydrate; the activity of the nervous system; the balance of salt and water; and the regulation of blood pressure. Because of their widespread effects, these drugs are useful in treating many medical conditions. Examples include inhalant corticosteroids are used to prevent asthma attacks, as well as corticosteroid ointments, creams and gels are used to treat skin problems.
  • corticosteroids Some examples of corticosteroids are beclomethasone (Beconase, Vancenase, Vanceril), betamethasone (Diprolene, Lotrisone), hydrocortisone, mometasone (Elocon), prednisone (Deltasone, Orasone), and triamcinolone (Azmacort, Nasacort).
  • Interferons ⁇ , ⁇ or ⁇ The interferons are a group of proteins that are normally produced by cells in response to viral infection and other stimuli. They were first described in 1957, and were named for their ability to interfere with viruses that are replicating. There are three main types of interferon. Interferons ⁇ and ⁇ are produced mainly by white blood cells and certain connective tissue cells called fibroblasts. Interferon ⁇ is produced primarily by activated T cells-is a naturally-occurring substance in the body that promotes inflammation. Interferon ⁇ works to counteract the effects of interferon ⁇ .
  • cytokines may be assessed for their ability to inhibit coronavirus replication.
  • interleukins and cytokines include Interleukin 1 (IL-I), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, angiostatin, thrombospondin, endostatin, METH-I, METH-2, GM-CSF, G-CSF, M-CSF and tumor necrosis factor.
  • Vero cells were used in all assays in this report. Cells were passaged in OptiPROSFM supplemented with 4mM glutamine (Gibco).
  • the MHV-pol and MHV antibodies have been described previously (Brockway et al., 2003; Denison et al., 1999).
  • SARS- CoV genome was used as template for RT-PCR amplification of targeted areas, cloning into pET-23 protein expression vectors, and purification as previously described (Bost et al, 2000; Brockway et al, 2003; Denison et al, 1999; Lu et al, 1998) (Promega).
  • Proteins generated for antibody production were: nspl, nsp2, nsp3 nsp4, nsp5, nsp ⁇ , nsp7, nsp8, nsp9, nsplO, nspl 2, nspl 3, nspl 4, nspl 5 and nspl 6.
  • the specific nucleotides and amino-acids cloned are shown in Table 2, along with the stage of development and uses in detection of proteins in cells.
  • New Zealand White rabbits were immunized with the purified proteins for antibody production (Cocalico, Inc.). After initial inoculation, rabbits were boosted at day 14, day 21 and test bleeds were performed. Rabbits were boosted again at day 49 and serum from production bleeds on day 56 were used in the experiments in this report.
  • Primers. Primers used for SARS-CoV replicase protein RT-PCR were as follows
  • SARS-CoV infected cell lysates were generated by infecting Vero cell monolayers with SARS-CoV at a multiplicity of infection (MOI) of 1 TCIDso/cell for 24 hr, then lysing cells in NP40 lysis buffer. Lysates were heated to 65°C for 30 min to inactivate virus and SDS was added to a final concentration of 2%. 20 ⁇ l of lysate (equivalent of 2x10 5 cells) was electrophoresed on 4-20% gradient SDS-PAGE gels (Bio-Rad). Proteins were transferred to nitrocellulose (Protran - Schleicher and Schuell) according to manufacturers recommendations.
  • MOI multiplicity of infection
  • Membranes were incubated in blocking buffer (5% non-fat dried milk (NFDM) in TBS:Tween) for 1 h at room temperature (RT). Antibodies were diluted 1 :500 in blocking buffer and incubated with the membrane for 1 h at RT. Membranes were washed 3 x 15 min. at RT with TBS-Tween. Goat anti-rabbit horseradish peroxidase (HRP) conjugated antibodies (Promega) were diluted 1 :2000 in blocking buffer and incubated with the membrane for 1 h at RT. Membranes were washed 3 x 15 min. at RT with TBS:Tween. Antibody label was detected by chemilluminescence using Lumi-Light (Roche) per manufacturer's instructions.
  • HRP horseradish peroxidase
  • Antibodies were allowed to adsorb for 1 h at room temperature (RT), then washed 2 ⁇ with PBS/0.05%NP40/l%BSA. Cells were then incubated for 1 h at RT with a 1 :1000 dilution of anti-rabbit secondary antibodies conjugated to Alexa 488 (Molecular Probes, Eugene, OR). Cells were washed twice with PBS/0.05%NP40/l%BSA, then once with PBS prior to being rinsed in DI H 2 O and mounted onto glass slides with Aquapolymount (Polysciences, Inc.). Images were acquired on a Zeiss 510 LSM using a 4OX, oil immersion lens. A 488nm krypton-argon laser was used to stimulate the fluorophores. SARS-CoV growth analysis. Vero cells were infected at MOI of 1 TdD 50 /cell.
  • Inoculum was allowed to adsorb to cells for 1 h at 37°C. Inoculum was removed and cells were washed 3 times with pre-warmed media. Media samples were taken at 0, 1, 3, 6, 12 and 24 h p.i. Samples were serially diluted and titered on Vero cell monolayers.
  • the antigen purified for generation of the nspl antibody encoded aa 1-228 The antigenic regions expressed for generation of antibodies to the remaining replicase proteins were based on predicted cleavage sites (Snijder et al, 2003; Thiel et al, 2003). When possible, the entire predicted mature protein of interest was expressed as antigen for antibody production. For proteins with a predicated molecular mass of >30kDa or for proteins whose full-length expression in E. coli was toxic, fragments containing predicted antigenic regions were generated.
  • nspl antibodies against nspl, nsp2, nsp3, nsp4, nsp5, nsp8 and nsp9 were used in immunoblot and immunofluorescence studies.
  • the nspl antibody detected a 20 kDa protein in infected cells (FIG. 2). This is identical to the predicted mass for nspl protein cleaved at isoGJ ⁇ isi, whereas cleavage at 227RG4V228 would yield a protein with a predicted mass of 25 kDa.
  • the nspl serum also detected a discrete band of 35kDa, as well as more diffuse signal between 50 and 160 kDa.
  • the identity of these additional bands is unknown, but may represent oligomers of nspl. Proteins were not detected in the mock-infected cells or in infected cells probed with preimmune serum from the same animal indicating that the additional bands detected in infected cell lysates were not non-specifically detected viral or cellular proteins.
  • the nsp2 antibody detected a 70 kDa protein, consistent with the predicted size of nsp2 cleaved at isoG ⁇ Aisi and 818G4 ⁇ 819.
  • a protein with a molecular mass of ⁇ 48 kDa was also detected from infected cell lysates, although with less intensity than the 70 kDa product. Whether this represents a processing or degradation product of nsp2 could not be resolved by immunoblot (FIG. 2).
  • the nsp3 antibody detected a protein of 213 kDa from infected cell lysates, consistent with the predicted size of a protein spanning 819A to G27 40 . No immunoreactivity was detected from mock-infected lysates or from infected lysates probed with pre- immune serum, demonstrating the specificity of the immune serum (FIG. 2).
  • the nsp4 antibody detected a protein with a calculated mass of 35 kDa, compared with a predicted size of 55 kDa based on a putative cleavage at 2740G4K2741 and 324oQ>lS324i (FIG. 2).
  • Nsp4 predominantly contains hydrophobic amino acids, similar to the MHV MPl protein, which, despite a predicted mass of 56 kDa, has a calculated molecular weight of 44 kDa (Kanjanahaluethai et al, 2003).
  • the nsp5 antibody directed against the 3CLpro of SARS-CoV, detected a 30 kDa protein in infected cell lysates, but did not detect any proteins in mock-infected cells or in infected cells probed with pre-immune serum (FIG. 2).
  • the nsp8 antibody predominantly detected a 22 kDa protein, but also detected a protein of -15 kDa from infected lysates.
  • Nsp8 has been predicted to be cleaved from the replicase polyprotein at 39i9Q4 ⁇ 392o and 4ii7Q4-N4ii8 and have a mass of 22 kDa.
  • the nsp9 antibody detected a protein with mass of 12 kDa, consistent with a protein spanning 4iisN to Q4230 (FIG. 2).
  • the MHV proteins analogous to nsp8 and nsp9 (p22 and pi 2) are detected in an intermediate precursor with a mass of 150 kDa (Schiller et al, 1998).
  • Neither the nsp8 nor nsp9 antibodies detected a precursor of this size by immunoblot, suggesting either that the majority of the nsp8 and nsp9 in a SARS-CoV infected cell are cleaved and the analogous precursor was not present, or that precursors could not be recognized by these antibodies in immunoblot.
  • nspl, nsp2, nsp3, nsp4, nsp8 and nsp9 antibodies were used in IF assays (FIG. 3).
  • MOI 1 TCIDso/cell for 12 h
  • Diffuse fluorescence in the cytoplasm increased at 12 and 24 h p.i., suggesting a possible change in the distribution of nspl, or a breakdown of specific foci at later times of infection.
  • a virus growth curve was performed. As shown in figure 4B, at 6 h p.i., when nspl was readily detected by EF in Vero cells (FIG. 4A), only 1.6 loglO TCID50/ml of virus had been released from infected cells. By 9 h p.i., virus growth was 3.8 loglO TCID50/ml.
  • ORFIb replicase proteins by immunoblot and immunofluorescence. Having shown that ORFIa proteins were detectable by immunoblot and immunofluorescence analysis, we next generated antibodies against the putative mature ORFIb proteins, nspl2, nspl3, nspl4, nspl5, and nspl ⁇ . Expression of ORFIb proteins requires a -1 ribosomal frameshift at the 5' end of ORFIb. This frameshift has been predicted to be -40% efficient for other coronaviruses (Brierley et al, 1987; Brierley et al, 1989).
  • Nspl3 the RNA helicase (Thiel et al, 2003), predominantly detected a protein calculated to have a mass of 67 kDa, consistent with cleavage at 5 30iQiA5302 and but to a lesser extent also detected proteins of 22 and 15 kDa (FIG. 5A).
  • the nspl 4 protein has been reported to have distant homology with a cellular 3'-to-5' exonuclease of the DEDD superfamily (ExoN) (Snijder et al, 2003).
  • the nspl4 antibody detected a protein of 60 kDa, identical to the size predicted from the deduced amino-acid sequence.
  • a protein band of -38 kDa was also detected from infected cell lysates with nspl4 antisera, but neither the 38 kDa or 60 kDa proteins were detected in mock- infected cells or in infected cells probed with pre-immune serum (FIG. 5A).
  • the nspl5 antibody detected a 38 kDa protein from infected cell lysates and, to a lesser extent, several proteins of lower molecular weight.
  • the nspl5 protein was predicted to have a mass of 38 kDa and was reported to have domains of a polyU endoribonuclease (Snijder et al, 2003) (FIG. 5A).
  • the nspl ⁇ antibody strongly detected a 33 kDa protein in infected cells as well as some proteins of larger molecular weight (approximately 49 kDa, 60 kDa, and several proteins of >110 kDa) (FIG. 5A). Whether any of these proteins represent potential nspl ⁇ precursors could not be determined by immunoblot analysis.
  • nspl2-16 antibodies were next tested in immunofluorescence experiments to determine the subcellular localization of the proteins expressed from ORFIb. In these initial studies, only the nspl3 antibody stained infected cells. At 12 h p.i., nspl3 was detected exclusively in the cytoplasm in bright foci that were predominantly perinuclear, but also had foci throughout the cytoplasm, similar to the localizations demonstrated for the ORF la- expressed proteins. Fluorescence was not detected in mock-infected cells or in infected cells probed with pre-immune serum, demonstrating the specificity of the antibody in this assay (FIG. 5B).
  • ORFIb proteins did not strongly stain infected Vero cells for immunofluorescence; however, they were detected equivalently to nspl3 in immunoblot analysis, suggesting that protein abundance is not the reason for the lack of detection. Nonetheless, the immunoblot and immunofluorescence results demonstrate the first identification and detection of mature protein products encoded by ORFIb.
  • the MHV antiserum detects the MHV structural proteins Spike (S), membrane protein (M) and nucleocapsid (N) (Denison et al, 1999).
  • the MHV antiserum detected a 50 kDa protein, corresponding to the predicted size of the SARS-CoV nucleocapsid protein (FIG. 6A).
  • SARS-CoV and MHV nucleocapsid proteins share only 37% amino-acid identity; however, this protein was not detected when the membrane was probed with pre-immune serum or when mock-infected cells were probed with immune sera, suggesting that the detected protein was the SARS-CoV nucleocapsid protein (FIG. 6A).
  • compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the scope of the invention as defined by the appended claims.
  • Vasseur et al. Proc Natl Acad. ScL U.S.A., 77:1068, 1980.
  • Wagner et al Proc. Natl. Acad. ScL USA 87(9):3410-3414, 1990.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention provides methods for the early detection of cells infected by a coronavirus using immunological detection of viral replicase proteins. Also provided are methods of screening for inhibitors of coronavirus infection.

Description

DESCRIPTION
METHODS OF DETECTING CORONA VIRUS INFECTIONS
BACKGROUND OF THE INVENTION
The government owns rights in the present invention pursuant to grant number ROl Al 50083 of the National Institutes of Health and National Institute Allergy Infectious Disease.
1. Field of the Invention
The present invention relates generally to the fields of microbiology, immunology and virology. More particularly, it concerns methods of identifying infections of cells and tissue samples by coronavirus using viral replicase proteins as targets.
2. Description of Related Art
Coronaviruses have been long known to cause important diseases in a wide variety of animal species, including humans, cattle, swine, chickens, dogs, cats and mice. Coronavirus diseases in non-human species may be quite severe, and devastating in domestic livestock such as pigs, cattle and chickens. The characterized human coronaviruses - HCoV-229E and HCoV OC43 - are significant causes of upper respiratory infections, responsible for 10-35% of human colds. Studies of human coronaviruses have been limited by their lack of growth in culture from primary isolates, and by the lack, until recently, of reverse genetic approaches for their study. Thus, while the human coronaviruses are arguably two of the most economically important viruses in humans, ongoing research has been pursued only by a handful of investigators.
An outbreak of atypical pneumonia, designated "severe acute respiratory syndrome" or "SARS" was first identified in Guangdong Province, China, last year. It now has spread to several countries, including Canada and the United States, although it remains much more prevalent in China. The mortality rate appears to be as high as about 6%. Testing has identified the causative agent as a new human coronavirus. This occurrence surprised many scientists and public health officials, but has highlighted the potentially dangerous characteristics of coronaviruses well known to investigators: high rates of mutagenesis and homologous RNA recombination. In fact, template switching and recombination are essential to the normal life cycle of the viruses. In addition, the species barrier for coronaviruses has been predicted to be tenuous. Studies of coronaviruses in culture have demonstrated the ability of coronaviruses to adapt for replication in cells of different species. In addition, some studies have demonstrated that the murine coronaviruses may cause disease in primates following direct inoculation into brain. Finally, coronaviruses have been proposed, based on evolutionary studies, to have acquired genes from other viruses or cells, probably by recombination events. The emergence of a new coronavirus pathogenic for humans, by either adaptation of an animal virus, or by recombination of two coronaviruses during a coinfection, is consistent with these features of coronavirus evolution, replication and maintenance in populations.
To date, treatment protocols for coronaviruses are limited, and in any event do not address all coronavirus infections. Thus, there is an urgent need for methods to identify coronavirus infections, particularly early in the infectious cycle of the virus.
SUMMARY OF THE INVENTION
Thus, in accordance with the present invention, there is provided a method of detecting coronavirus infection of a cell comprising (a) contacting a cell with a first antibody against a coronavirus replicase protein; and (b) determining binding of said first antibody to a replicase protein, wherein binding of said first antibody identifies said cell as infected by a coronavirus. The cell in step (a) maybe fixed, fixed and permeabilized, or unfixed. The cell may be comprised within in culture, and may be cultured subsequent to step (b). The cell may be derived from an animal biological sample, may be a Vero cell, a Vero E6 cell, a BHK cell or a DBT cell, or may be a cell lacks a determinant for natural coronavirus infection (or SARS-CoV), but supports viral protein expression, RNA synthesis, virus production and release. The method may further comprise delivering to said cell a wild-type or mutant coronavirus genome or an expression cassette encoding one or more coronavirus proteins. Delivering may comprise transfection or electroporation. The cell may be engineered to support coronavirus infection, such as with an ACE2 expression construct or a coronavirus receptor expression construct. The
The coronavirus may be an avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), rabbit coronavirus, human coronavirus NL or human coronavirus NL63. The coronavirus may be SARS virus. The replicase protein may be selected from the group consisting of nspl, nsp2, nsp3, nsp4, nsp5, nspό, nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nsplό.
The first antibody may be a monoclonal antibody or comprised within polyclonal antisera. Step (b) may comprise an ELISA, immunofluorescence or FACS. The first antibody may be labeled, or antibody binding may be detected binding of a second antibody to said first antibody, said second antibody being labeled. The label may be fluorophore, a chromophore, a chemilluminescent molecule or an enzyme. The first antibody may bind immunologically with multiple coronavirus species.
The cell may be suspected of being infected by a coronavirus, or known to be infected by a coronavirus. The cell may have been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication. The candidate substance may be a DNA molecule, and RNA molecule, a protein, a small molecule a proteinase inhibitor, a steroid, interferon α, β or γ, a cytokine, or an immune mediator. The cell may have been infected about 36 hours, about 24 hours, about 12 hours, about 6 hours, about 4 hours, about 3 hours, about 2 hours, or about 1 hour.
In another embodiment, there is provided a method of detecting coronavirus infection of a cell culture comprising (a) collecting cell culture supernatant from a cell culture; (b) contacting said cell culture supernatant with a first antibody against a coronavirus replicase protein; and (c) determining binding of said first antibody to a replicase protein in said cell culture supernatant, wherein binding of said first antibody identifies said cell culture as infected by a coronavirus. The cell may be a Vero cell, a Vero E6 cell, a BHK cell, a DBT cell, or cell that lacks a determinant for natural coronavirus infection, but supports viral protein expression, RNA synthesis, virus production and release. The cell may be engineered to support coronavirus infection, for example, with an ACE2 expression construct or a coronavirus receptor expression construct. The culture supernatant may be concentrated or purified prior to step (a).
The coronavirus may be an avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), or rabbit coronavirus. The replicase protein may be selected from the group of nspl, nsp2, nsp3, nsp4, nsp5, nspό, nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nspl 6. The first antibody may be a monoclonal antibody or a comprised within polyclonal antisera. The antibody is attached to a support, such as a column, a dipstick or a bead. Antibody binding may be detected binding of a second antibody to said replicase protein, which may be labeled. The label may be fluorophore, a chromophore, a chemilluminescent molecule or an enzyme. Step (b) may comprise an ELISA. The first antibody may be bind immunologically to multiple coronavirus species.
The cell may be is suspected of being infected by a coronavirus, or known to be infected by a coronavirus. The cell may have been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication. The candidate substance may be a DNA molecule, and RNA molecule, a protein, a small molecule, a proteinase inhibitor, a steroid, interferon α, β, or γ, a cytokine, or an immune mediator. The cell may have been infected about 36 hours, about 24 hours, about 12 hours, about 6 hours, about 4 hours, about 3 hours, about 2 hours, or about 1 hour.
In another embodiment, there is provided a method of detecting diagnosing a coronavirus infection in a subject comprising (a) obtaining a tissue sample from said subject; (b) contacting a cell or cell fragment from said tissue sample with an antibody against a coronavirus replicase protein; and (c) identifying the presence or absence of said coronavirus replicase protein in said tissue by determining binding of said antibody to a target in said cell or cell fragment, wherein the presence of said coronavirus replicase protein detects a coronavirus infection in said subject. The tissue sample may be homogenized or intact and identified by in situ immunofluorescence.
It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein. The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." "About" means plus or minus 5% of the stated value. These, and other, embodiments of the invention will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following description, while indicating various embodiments of the invention and numerous specific details thereof, is given by way of illustration and not of limitation. Many substitutions, modifications, additions and/or rearrangements may be made within the scope of the invention without departing from the spirit thereof, and the invention includes all such substitutions, modifications, additions and/or rearrangements.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1 - Predicted organization and proteolytic processing of the SARS-CoV replicase polyprotein. The processing of the replicase polyprotein is mediated by two proteinases, the papain-like proteinase (PLP - gray box) and the 3Clike proteinase (3CL-pro - stippled box). The cleavage activities of these proteinases are indicated by black arrows and the numerical designation of the non-structural proteins (nsp) is indicated above the diagram. Two potential cleavage sites are present between nspl and nsp2 (indicated by gray arrows) at isoG^Am and at 227G^V228. FIG. 2 - Identification of ORFIa SARS-CoV replicase proteins by immunoblot SARSCoV infected (I) and mock-infected (M) cell lysates were separated by SDSPAGE, transferred to nitrocellulose and probed with the nspl, nsp2, nsp3, nsp4, nsp5, nsp8 and nsp9 antibodies. Additionally, pre-immune (P) sera were used to probe infected lysates. Black circles indicate replicase proteins identified. FIG. 3 - Localization of SARS-CoV ORFIa replicase proteins in Vero cells. Vero cells were infected with SARS-CoV or were mock-infected for 12 h prior to fixation with cold methanol. Cells were stained with the indicated antisera and imaged as described in materials and methods. FIGS. 4A-B - FIG. 4A. Time course of nspl expression- Vero cells were infected with SARS-CoV, fixed at the times indicated p.i., and stained with the nspl antibody. FIG. 4B. Timecourse of SARS-CoV growth in Vero cells.
FIGS. 5A-B - Identification of ORFIb SARS-CoV replicase proteins by immunoblot and immunofluorescence. FIG. 5A. SARS-CoV infected (I) and mock-infected (M) cell lysates were separated by SDS-PAGE, transferred to nitrocellulose, and probed with the nspl2, nspl3, nspl4, nspl5, and nsplό antibodies. Additionally, preimmune (P) sera were used to probe infected lysates. Black circles indicate replicase proteins identified. FIG. 5B. Vero cells were infected with SARS-CoV or were mock-infected for 12 h prior to fixation with cold methanol. Cells were probed with the nspl 3 antibody and viewed as described in materials and methods.
FIGS. 6A-B - MHV antibodies are cross-reactive with SARS-CoV replicase proteins. FIG. 6A. Identification of replicase proteins by immunoblot. SARS-CoV infected (I) and mock-infected (M) cell lysates were separated by SDS-PAGE, transferred to nitrocellulose and probed with the MHV-pol and MHV antibodies. Additionally, preimmune (P) sera were used to probe infected lysates. Black circles indicate replicase proteins identified. FIG. 6B. Antibodies against MHV-pol, and MHV were used to stain Vero cells by immunofluorescence. Infected Vero cells stained with immune sera. Fluorescence was not detected in mock-infected cells with immune sera or in infected cells stained with pre-immune sera.
DESCRIPTION QF ILLUSTRATIVE EMBODIMENTS
As discussed above, coronaviruses a numerous and can infect a wide variety of animal hosts, including humans. The economic impact of coronavirus infections is extensive, and the recent SARS epidemic revealed how susceptible humans are to new variants of these viruses. While therapies continue to be developed, the number of weapons to combant coronavirus infections is limited, making prevention of the disease all that more critical. In order to prevent disease, it is important to be able to identify very early those individuals who are infected. It also is critical to be able to rapidly screen biological reagents, such as blood, for the presence of active coronavirus infections. I. The Present Invention
The present invention derives from the inventor's observation that coronavirus replicase proteins are among the earliest that can be detected following infection of permissive cells. As discussed, there are numerous situations where early detection of coronavirus infection would be valuable. Obviously, where an individual may have been exposed to infectious coronavirus, the ability to determine whether that person has been infected prior to displaying symptoms (both for treatment and quarantine purposes) is important. In addition, the ability to identify coronavirus replication in biological samples (blood and plasma; organs for transplant; cells from screening assays) has value as well. Thus, the present invention contemplates the production of antibodies for a variety of replicase proteins from virtually any coronavirus. These antibodies will find use in a variety of different assay formats, including but not limited to ELISAs, RIAs, immunofluorescence and flow cytometry. In particular embodiments, the assays are designed to identify infections at time periods of less than 12 hr, less than 8 hr, less than six hours, and at about 4 hr. In some embodiments, the cells maybe fixed, and optionally permeabilized. In others, the cells are unfixed and remain viable following testing. The cells maybe intentionally infected, i.e., the detection may involve the screening of agents that inhibit replication following expression. These and other details of the invention are spelled out below.
II. Coronaviridae Nidoviruses are positive-stranded RNA viruses infect a wide range of vertebrates.
The virions are enveloped, pleomorphic, spherical, or kidney-shaped. Surface projections of envelope distinct; club-shaped; dispersed evenly over all the surface. Two families are established: Family Arteriviridae and Family Coronaviridae. Coronaviruses infects hosts in the Domain Eucarya, Kingdom Animalia, Phylum Chordata, Subphylum Vertebrata, Classes Mammalia and Aves, Orders Primates, Carnivora, Perissodactyla, Artiodactyla, Rodentia, and Lagomorphia. It is transmitted by means not involving a vector. World-wide distribution is likely.
Virions are enveloped, slightly pleomorphic, spherical or kidney shaped, and about 120-160 nm in diameter. Surface projections of envelope are distinct, club-shaped, spaced widely apart and dispersed evenly over all the surface. Nucleocapsids are rod-shaped (straight or bent), about 9-13 nm in diameter. Virions associated RNA nucleocapsids exhibit helical or tubular symmetry. Molecular mass (Mr) of the virion 400 x 106. Buoyant density is 1.23-1.24 g cm-3 in
CsCl, and 1.15-1.19 g cm-3 in sucrose. The sedimentation coefficient is 300-500S. Under in vitro conditions, virions are stable in acid environment (pH 3), relatively stable in presence of Mg++. Virions are sensitive to heat, lipid solvents, non-ionic detergents, formaldehyde, and oxidizing agents.
Virions contain one molecule of linear positive-sense single stranded RNA with a total genome length is 20,000-33,000 nt. The 5' end of the genome has a cap, and the 3' end has a poly(A) tract. Subgenomic mRNA is found in infected cells.
Five structural virion proteins found ranging is size between 18,0000 and 220,000 Da. The first is the surface glycoprotein or spike (S) protein. The S protein is responsible for attachment to cells, hemagglutination and membrane fusion. It has a carboxy-terminal half with a coiled-coil structure. The second largest protein (30,000-35,000 Da) is the integral membrane protein (M) which spans the virus envelope three times, with only 10% protruding at the virion surface. The third largest protein (50,000-60,000 Da) is the nucleocapsid protein (N). The fourth largest protein (65,000 Da) is the hemagglutinine-esterase protein (HE), which forms short surface projections, and can have receptor binding, hemagglutination and receptor destroying activities. The fifth largest protein (10,000-12,000 Da) is tentatively designated as the small membrane protein (sM), detected in avian infectious bronchitis virus (IBV) and porcine transmissible gastroenteritis virus (TGEV). The virus exhibits distinct antigen determinants on envelope and spikes, those corresponding to each of the major structural glycoproteins - S, HE, M, and N. Antigenic specificity of virion can be determined by neutralization tests (S and HE), or complement fixation tests (M). Protective immunity is induced in form of complement independent neutralizing antibodies. The Coronaviridae family is split into two groups - coronavirus and torovirus.
Coronaviruses include avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus, rabbit coronavirus, or the recently identified SARS associated human coronavirus. Toroviruses include Berne virus or Breda virus. The SARS virus is a member of Coronaviridae, and is subcategorized as a coronavirus. Virions are enveloped, slightly pleomorphic, spherical or kidney shaped, and about 120-160 nm in diameter. Surface projections of envelope are distinct, club-shaped, spaced widely apart and dispersed evenly over all the surface. Nucleocapsids are rod-shaped (straight or bent), about 9-13 nm in diameter. Virions associated RNA nucleocapsids exhibit helical or tubular symmetry.
Molecular mass (Mr) of the virion 400 x 106. Buoyant density is 1.23-1.24 g cm-3 in
CsCl, and 1.15-1.19 g cm-3 in sucrose. The sedimentation coefficient is 300-500S. Under in vitro conditions, virions are stable in acid environment (pH 3), relatively stable in presence of Mg++. Virions are sensitive to heat, lipid solvents, non-ionic detergents, formaldehyde, and oxidizing agents.
Virions contain one molecule of linear positive-sense single stranded RNA with a total genome length is 20,000-33,000 nt. The 5' end of the genome has a cap, and the 3' end has a poly(A) tract. Subgenomic mRNA is found in infected cells. The SARS genomic sequence has been deposited into GenBank (accession numbers AY274119.3 and AY278741)
(Rota et al, 2003; Marra et al, 2003).
At the 5' end of the genome, a putative 5' leader sequence with similarity to the conserved coronavirus core leader sequence, 5'-CUAAAC-3' was observed. Putative TRS sequences were identified and scored as strong, weak or absent based on inspection of the alignments. The 3' UTR sequence contained a 32 base-pair region corresponding to the conserved s2m motif, believed to be a universal feature of astroviruses.
Open reading frames were predicted by comparing sequences of known coronavirus proteins, resulting in putative identification of replicases Ia and Ib, S protein, E protein, M protein and N protein. Based on further comparison to known proteins of the three known coronaviral groups reveals that SARS proteins do not readily cluster more closely with any one group. As such, it has been proposed that SARS is the first representative of "Group 4" coronaviruses. The 29,751-base genome also encodes nine novel ORFs.
III. Replicase Polyproteins
The coronavirus replicase gene (also known as gene 1 or the polymerase gene) comprises 22 kB of the coronavirus genome, corresponding to some 7800 amino acids, and is composed of two overlapping open reading frames - ORFIa and Ib. Following uncoating of the RNA genome in the cell cytoplasm, the replicase gene is translated as either an ORF Ia polyprotein (495 kD) or as an ORFl ab fusion polyprotein (803 kD), with translation of ORF Ib requiring a ribosomal frameshift event at the end of ORF Ia. The intact replicase polyproteins are not detected during natural infection, since maturation proteolytic cleavages occur cotranslationally by three proteinase functions encoded in ORF Ia polyprotein. The proteolytic processing results in 15 or 16 mature proteins, including the proteinases, an RNA helicase, and a putative RNA-dependent RNA polymerase. The MHV proteins are set forth in Table 1, and SARS replicase proteins are set forth in Table 2.
TABLE 1 - MHV and SARS-CoV Replicase Protein Domains and Mature Proteins
Figure imgf000011_0001
TABLE 2- Antibodies to SARS-CoV Replicase Proteins
Figure imgf000012_0001
Details of replicase proteins cloned for generation of antibodies are shown in Table 2. Nucleotide and amino-acid numbers for cloning and expression of antigen were based on the published sequence of the Urbani strain of SARS-CoV from the Centers for Disease Control and Prevention (Atlanta, USA, Gen-Bank accession number AY278741). Antiserum designations represent the New Zealand White Rabbits immunized by Cocalico, Inc. Applications tested in this report include immunoblot (IB) and immunofluorescence (IF). Predictions of protein size were performed by MacVector software (Accelerys, Inc.) and calculation of molecular mass from immunoblots was performed as described previously (Denison et α/., 1992). The replicase gene expresses all of the viral factors required for all stages of MHV mRNA synthesis and replication. In addition, it has been shown that inhibition of polyprotein processing at any time during infection results in rapid shutoff of viral RNA synthesis, indicating that at least some of the proteolytic processing events are required for RNA synthesis. However there are differences in mature replicase proteins among different coronaviruses, particularly in the amino-terminal 100 kD of the polyproteins. IV. Culturing Coronavirus Host Cells
Coronaviruses can grow in a variety of transformed and primary mammalian cell lines. A primary determinants of permissivity for infection is the expression of specific host proteins that function as receptors to bind the coronavirus S protein and initiate steps in virus entry and uncoating of genome RNA for replication in the host-cell cytoplasm. However, methods to either express receptor in naturally non-permissive cells, mechanisms to bypass the receptor requirement, and virus adaptation have allowed coronaviurses to grow in a very wide variety of cell types of divergent species. For example, MHV can grow in murine cells (L2, 17CL1, DBT) because of natural CEACAM receptor expression. However adaptation, receptor expression and direct electroporation of genome RNA have each allowed MHV to replicate efficiently in BHK and HeLa cells. For SARS-CoV, permissivity may be based on expression of a receptor, angiotensin converting enzyme 2 (ACE2).
Coronaviruses grow well in culture under standard media, pH, temperature and supplement conditions. Growth of cells in Dulbecco's Modified Essential Medium (DMEM), 2% fetal calf serum (FCS), pH 7.4, at 370C, also supports virus growth to titers of 106 to 108 plaque forming units per ml of media supernatant. For SARS-CoV, the primary cells for culture and testing are Vero Cells or Vero E6 cells. Following infection, cells can be lysed for immunoblot using standard lysis buffers containing Tris, NP-40, and SDS. For immunofluorescence, cells can be fixed and permealbilized with 100% methanol, 50% methanol/50% acetone, or fixed with paraformadehyde and permeabilized with Triton XlOO.
V. Vectors
In one aspect of the invention, a host cell is modified to express (a) a coronavirus receptor, (b) a protein that supports coronavirus replication, or (c) a viral RNA. In order to express these heterologous proteins, one will utilize an expression vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. An expression vector further comprises nucleic acid sequences that support the transcription, and optionally translation, of the vector-encoded material. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs and BACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al, 1988 and Ausubel et al, 1994, both incorporated herein by reference).
A. Promoters and Enhancers
A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence. The phrases "operatively positioned," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
A promoter generally comprises a sequence that functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well. To bring a coding sequence "under the control of a promoter, one positions the 5" end of the transcription initiation site of the transcriptional reading frame "downstream" of (i.e., 3' of) the chosen promoter. The "upstream" promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.
The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
A promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. For example, promoters that are most commonly used in recombinant DNA construction include the β-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Patents 4,683,202 and 5,928,906, each incorporated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et a 2001, incorporated herein by reference). The promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous. Additionally any promoter/enhancer combination (as per, for example, the Eukaryotic Promoter Data Base EPDB, www.epd.isb-sib.ch/) could also be used to drive expression. Use of a phage T3, T7 or SP6 cytoplasmic expression system is another possible embodiment. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
Table 3 lists non-limiting examples of elements/promoters that may be employed, in the context of the present invention, to regulate the expression of a RNA. Table 3 provides non-limiting examples of inducible elements, which are regions of a nucleic acid sequence that can be activated in response to a specific stimulus.
Figure imgf000016_0001
Figure imgf000017_0001
Figure imgf000018_0001
The identity of tissue-specific promoters or elements, as well as assays to characterize their activity, is well known to those of skill in the art. Nonlimiting examples of such regions include the human LIMK2 gene (Nomoto et al 1999), the somatostatin receptor 2 gene (Kraus et al, 1998), murine epididymal retinoic acid-binding gene (Lareyre et al, 1999), human CD4 (Zhao-Emonet et al, 1998), mouse alpha2 (XI) collagen (Tsumaki et al, 1998), DlA dopamine receptor gene (Lee et al, 1997), insulin-like growth factor II (Wu et al, 1997), and human platelet endothelial cell adhesion molecule- 1 (Almendro et al, 1996).
Examples of promoters which are operative in bacterial cells include, a promoter of Bacillus stearothermophilus maltogenic amylase gene, Bacillus licheniformis α-amylase gene, Bacillus amyloliquefaciens BAN amylase gene, Bacillus subtilis alkaline protease gene, or Bacillus pumilus xylosldase gene; a PR or PL promoter of phage lambda; a lac, tip, or tac promoter of Escherichia coli; and the like.
Examples of promoters which are operative in insect cells include polyhedrin promoter, PlO promoter, basic protein promoter of Autographa californica nuclear polyhedrosis, baculovirus immediate early gene 1 promoter, baculovirus 39K delayed early gene promoter, and the like. Examples of promoters which are operative in yeast host cells include a promoter derived from yeast glycolysis system genes, alcohol dehydrogenase gene promoter, TPIl promoter, ADH2-4c promoter, and the like.
B. Initiation Signals and Internal Ribosome Binding Sites
A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements. In certain embodiments of the invention, the use of internal ribosome entry sites
(IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5'-methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patents 5,925,565 and 5,935,819, each herein incorporated by reference). C. Multiple Cloning Sites
Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al, 1999; Levenson et al, 1998; and Cocea, 1997, incorporated herein by reference.) "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
D. Splicing Sites
Most transcribed eukaryotic RNA molecules will undergo RNA splicing to remove introns from the primary transcripts. Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see, for example, Chandler et al, 1997, herein incorporated by reference.)
E. Termination Signals
The vectors or constructs of the present invention will generally comprise at least one termination signal. A "termination signal" or "terminator" is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.
In eukaryotic systems, the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 A residues (poly A) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently. Thus, in other embodiments involving eukaryotes, it is preferred that that terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message. The terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences. Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator. In certain embodiments, the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.
F. Polyadenylation Signals
In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
G. Origins of Replication In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.
H. Selectable Markers In certain embodiments of the invention, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.
Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. Further examples of selectable markers are well known to one of skill in the art.
VI. Vector Delivery and Cell Transformation
In certain embodiment, the present invention will be used to examine the properties of cells and viruses with regard to viral replication. However, not all useful embodiments will be able to take advantage of natural modes of infection, i.e., binding of infectious virions to appropriate cell surface receptors, followed by internalization. For example, one may wish to assess the growth of mutant viruses that have lost host range determinants, or similarly, cells types that lack the viral host range determinants. One may also wish to compare replication in different cells types, regardless of the presence of host range determinants. Further studies to define mechanisms of trans-species adaptation, to study the virus in cells that cannot fuse or do not undergo the cytopathic effect of naturally-permissive, receptor bearing lines, and to directly compare stages of virus replication of MHV and SARS-CoV, to study determinants of coronavirus recombination, and to rescue chimeric MHV-SARS-CoV mutant viruses. In these embodiments, it will be necessary to transfer coronavirus nucleic acids into such cells by artificial means.
Suitable methods for delivery to cells of a coronavirus genome, a coronavirus expression cassette, or sequences capable of expressing a coronavirus receptor are believed to include virtually any method by which a nucleic acid (e.g. , DNA) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson et al, 1989; Nabel et al, 1989), by injection (U.S. Patents 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent 5,384,253, incorporated herein by reference; Tur-Kaspa et al., 1986; Potter et al., 1984); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al, 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al, 1991) and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Patent Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al, 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); by PEG-mediated transformation of protoplasts (Omirulleh et al, 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al, 1985), and any combination of such methods. Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
A. Injection In certain embodiments, a nucleic acid may be delivered to an organelle, a cell, a tissue or an organism via one or more injections {i.e., a needle injection), such as, for example, subcutaneously, intradermally, intramuscularly, intervenously, intraperitoneally, etc. Methods of injection of vaccines are well known to those of ordinary skill in the art {e.g., injection of a composition comprising a saline solution). Further embodiments of the present invention include the introduction of a nucleic acid by direct microinjection. Direct microinjection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985).
B. EIectroporation
In certain embodiments of the present invention, a nucleic acid is introduced into an organelle, a cell, a tissue or an organism via electroporation. EIectroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge. In some variants of this method, certain cell wall-degrading enzymes, such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells (U.S. Patent 5,384,253, incorporated herein by reference). Alternatively, recipient cells can be made more susceptible to transformation by mechanical wounding.
Transfection of eukaryotic cells using electroporation has been quite successful. Mouse pre-B lymphocytes have been transfected with human kappa-immunoglobulin genes (Potter ed al, 1984), and rat hepatocytes have been transfected with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al, 1986) in this manner.
To effect transformation by electroporation in cells such as, for example, plant cells, one may employ either friable tissues, such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly. In this technique, one would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wounding in a controlled manner. Examples of some species which have been transformed by electroporation of intact cells include maize (U.S. Patent 5,384,253; Rhodes et al, 1995; D'Halluin et al, 1992), wheat (Zhou et al, 1993), tomato (Hou and Lin, 1996), soybean (Chxistou et al, 1987) and tobacco (Lee et al, 1989).
One also may employ protoplasts for electroporation transformation of plant cells (Bates, 1994; Lazzeri, 1995). For example, the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is described by Dhir and Widholm in International Patent Application No. WO 9217598, incorporated herein by reference. Other examples of species for which protoplast transformation has been described include barley (Lazerri, 1995), sorghum (Battraw et al, 1991), maize (Bhattacharjee et al, 1997), wheat (He et al, 1994) and tomato (Tsukada, 1989).
C. Calcium Phosphate hi other embodiments of the present invention, a nucleic acid is introduced to the cells using calcium phosphate precipitation. Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique. Also in this manner, mouse L(A9), mouse C127, CHO, CV-I, BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990).
D. DEAE-Dextran
In another embodiment, a nucleic acid is delivered into a cell using DEAE-dextran followed by polyethylene glycol. In this manner, reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985). E. SonicatioD Loading
Additional embodiments of the present invention include the introduction of a nucleic acid by direct sonic loading. LTK" fibroblasts have been transfected with the thymidine kinase gene by sonication loading (Fechheimer et al, 1987).
F. Liposome-Mediated Transfection hi a further embodiment of the invention, a nucleic acid may be entrapped in a lipid complex such as, for example, a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is an nucleic acid complexed with Lipofectamine (Gibco BRL) or Superfect (Qiagen). Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987). The feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells has also been demonstrated (Wong et al, 1980). hi certain embodiments of the invention, a liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, a liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-I) (Kato et al, 1991). In yet further embodiments, a liposome may be complexed or employed in conjunction with both HVJ and HMG-I. In other embodiments, a delivery vehicle may comprise a ligand and a liposome.
G. Receptor Mediated Transfection
Still further, a nucleic acid may be delivered to a target cell via receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in a target cell. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention. Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a nucleic acid-binding agent. Others comprise a cell receptor-specific ligand to which the nucleic acid to be delivered has been operatively attached. Several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987; Wagner et al., 1990; Perales e/ al, 1994; Myers, EPO 0273085), which establishes the operability of the technique. Specific delivery in the context of another mammalian cell type has been described (Wu and Wu, 1993; incorporated herein by reference). In certain aspects of the present invention, a ligand will be chosen to correspond to a receptor specifically expressed on the target cell population. In other embodiments, a nucleic acid delivery vehicle component of a cell-specific nucleic acid targeting vehicle may comprise a specific binding ligand in combination with a liposome. The nucleic acid(s) to be delivered are housed within the liposome and the specific binding ligand is functionally incorporated into the liposome membrane. The liposome will thus specifically bind to the receptor(s) of a target cell and deliver the contents to a cell. Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
In still further embodiments, the nucleic acid delivery vehicle component of a targeted delivery vehicle may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding. For example, lactosyl-ceramide, a galactose-terminal asialganglioside, have been incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes (Nicolau et al, 1987). It is contemplated that the tissue-specific transforming constructs of the present invention can be specifically delivered into a target cell in a similar manner.
H. Microprojectile Bombardment
Microprojectile bombardment techniques can be used to introduce a nucleic acid into at least one, organelle, cell, tissue or organism (U.S. Patent 5,550,318; U.S. Patent 5,538,880; U.S. Patent 5,610,042; and PCT Application WO 94/09699; each of which is incorporated herein by reference). This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., 1987). There are a wide variety of microprojectile bombardment techniques known in the art, many of which are applicable to the invention. Microprojectile bombardment may be used to transform various cell(s), tissue(s) or organism(s), such as for example any plant species. Examples of species which have been transformed by microprojectile bombardment include monocot species such as maize (PCT Application WO 95/06128), barley (Ritala et al, 1994; Hensgens et al, 1993), wheat (U.S. Patent 5,563,055, incorporated herein by reference), rice (Hensgens et al, 1993), oat (Torbet et al, 1995; Torbet et al, 1998), rye (Hensgens et al, 1993), sugarcane (Bower et al, 1992), and sorghum (Hagio et al, 1991); as well as a number of dicots including tobacco (Tomes et al, 1990; Buising and Benbow, 1994), soybean (U.S. Patent 5,322,783, incorporated herein by reference), sunflower (Knittel et al 1994), peanut (Singsit et al, 1997), cotton (McCabe and Martinell, 1993), tomato (VanEck et al. 1995), and legumes in general (U.S. Patent 5,563,055, incorporated herein by reference).
In this microprojectile bombardment, one or more particles may be coated with at least one nucleic acid and delivered into cells by a propelling force. Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold particles or beads. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
For the bombardment, cells in suspension are concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
An illustrative embodiment of a method for delivering DNA into a cell (e.g., a plant cell) by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with cells, such as for example, a monocot plant cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large.
VI. Immunoassays
The present invention contemplates the use of various immunologic assays to assess coronavirus infection. Thus, it will be understood that polyclonal or monoclonal antibodies that bind to coronavirus replicase proteins will have utilities in several applications. Thus, in one aspect, the invention provides for the production of antibodies that bind immunologically to coronavirus replicase proteins. Means for preparing and characterizing antibodies are well known in the art (See, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference).
A. Polyclonal Antisera
Polyclonal antisera is prepared by immunizing an animal with an immunogenic composition in accordance with the present invention and collecting antisera from that immunized animal. A wide range of animal species can be used for the production of antisera. Typically the animal used for production of anti-antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.
As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bis-biazotized benzidine.
As also is well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, or the animal can be used to generate mAbs (below).
For production of rabbit polyclonal antibodies, the animal can be bled through an ear vein or alternatively by cardiac puncture. The procured blood is allowed to coagulate and then centrifuged to separate serum components from whole cells and blood clots. The serum may be used as is for various applications or else the desired antibody fraction may be purified by well-known methods, such as affinity chromatography using another antibody or a peptide bound to a solid matrix or protein A followed by antigen (peptide) affinity column for purification.
B. Monoclonal Antibodies mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified replicase protein, polypeptide or peptide. The immunizing composition is administered in a manner effective to stimulate antibody producing cells.
The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep, goat, monkey cells also is possible. The use of rats may provide certain advantages (Goding, 1986, pp. 60-61), but mice are preferred, with the BALB/c mouse being most preferred as this is most routinely used and generally gives a higher percentage of stable fusions.
The animals are injected with antigen, generally as described above. The antigen may be coupled to carrier molecules such as keyhole limpet hemocyanin if necessary. The antigen would typically be mixed with adjuvant, such as Freund's complete or incomplete adjuvant.
Booster injections with the same antigen would occur at approximately two-week intervals. Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol.
These cells may be obtained from biopsied spleens or lymph nodes. Spleen cells and lymph node cells are preferred, the former because they are a rich source of antibody-producing cells that are in the dividing plasmablast stage.
Often, a panel of animals will have been immunized and the spleen of animal with the highest antibody titer will be removed and the spleen lymphocytes obtained by homogenizing the spleen with a syringe. Typically, a spleen from an immunized mouse contains approximately 5 x 107 to 2 x 108 lymphocytes. The antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas).
Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984; each incorporated herein by reference). For example, where the immunized animal is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NSl/l.Ag 4 1, Sp210-Agl4, FO, NSO/U, MPC-I l, MPC11-X45-GTG 1.7 and S194/5XX0 BuI; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell fusions.
One preferred murine myeloma cell is the NS-I myeloma cell line (also termed P3-NS-l-Ag4-l), which is readily available from the NIGMS Human Genetic Mutant Cell Repository by requesting cell line repository number GM3573. Another mouse myeloma cell line that may be used is the 8-azaguanine-resistant mouse murine myeloma SP2/0 non-producer cell line.
Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2:1 proportion, though the proportion may vary from about 20:1 to about 1 :1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods also is appropriate (Goding pp. 71-74, 1986).
Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10-6 to 1 x 10-8. However, this does not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture media. Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the media is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium). Where azaserine is used, the media is supplemented with hypoxanthine.
The preferred selection medium is HAT. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. This culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, dot immunobinding assays, and the like. The selected hybridomas would then be serially diluted and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for mAb production in two basic ways.
A sample of the hybridoma can be injected (often into the peritoneal cavity) into a histocompatible animal of the type that was used to provide the somatic and myeloma cells for the original fusion (e.g., a syngeneic mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide mAbs in high concentration.
The individual cell lines could also be cultured in vitro, where the mAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations. mAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography. Fragments of the monoclonal antibodies of the invention can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer.
It also is contemplated that a molecular cloning approach may be used to generate monoclonals. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells e.g., normal-versus-tumor cells. The advantages of this approach over conventional hybridoma techniques are that approximately 104 times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.
C. Immunoassays
In still further embodiments, the present invention thus concerns immunodetection methods for binding, quantifying or otherwise generally detecting coronavirus replicase proteins. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al. (1987); incorporated herein by reference. Immunoassays, in their most simple and direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA) and immunobead capture assay. However, it will be readily appreciated that detection is not limited to such techniques, and Western blotting, dot blotting, FACS analyses, and the like also may be used in connection with the present invention.
In general, immunobinding methods include obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
The immunobinding methods of this invention include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of being infected with a coronavirus, and contact the sample with an antibody, and then detect or quantify the amount of immune complexes formed under the specific conditions.
Contacting the chosen biological sample with the antibody or antisera under conditions effective and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with replicase proteins. After this time, the sample-antibody composition will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any radioactive, fluorescent, biological or enzymatic tags or labels of standard use in the art. U.S. Patents concerning the use of such labels include 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241, each incorporated herein by reference.
In certain embodiments, the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.
Further methods include the detection of primary immune complexes by a two step approach. A second binding ligand, such as an antibody, that has binding affinity for the encoded protein, peptide or corresponding antibody is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.
Of particular interest in the present invention are enzyme linked immunosorbent assays, known as ELISAs. In one exemplary ELISA, antibodies binding to the encoded proteins of the invention are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition suspected of containing the replicase proteins is added to the wells. After binding and washing to remove non-specifically bound immunocomplexes, the bound antigen may be detected.
Detection is generally achieved by the addition of a second antibody specific for the target protein, that is linked to a detectable label. This type of ELISA is a simple "sandwich ELISA." Detection also may be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
In another exemplary ELISA, the samples suspected of containing replicase proteins are immobilized onto the well surface and then contacted with the antibodies of the invention. After binding and washing to remove non-specifically bound immunecomplexes, the bound antibody is detected. Where the initial antibodies are linked to a detectable label, the immunecomplexes may be detected directly. Again, the immunecomplexes may be detected using a second antibody that has binding affinity for the first antibody, with the second antibody being linked to a detectable label.
Irrespective of the format employed, ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non-specifically bound species, and detecting the bound immunecomplexes. For example, in coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder. The coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface.
In ELISAs, it is more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of a protein or antibody to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with a control and sample to be tested under conditions effective to allow immunecomplex (antigen/antibody) formation. Detection of the immunecomplex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.
"Under conditions effective to allow immunecomplex (antigen/antibody) formation" means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background. The "suitable" conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hrs, at temperatures preferably on the order of 25°C to 27°C, or may be overnight at about 4°C or so.
Following all incubation steps in an ELISA, the contacted surface is washed so as to remove non-complexed material. A preferred washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immunecomplexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immunecomplexes may be determined.
To provide a detecting means, the second or third antibody will have an associated label to allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact and incubate the first or second immunecomplex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immunecomplex formation (e.g., incubation for 2 hrs at room temperature in a PBS-containing solution such as PBS-Tween).
After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea and bromocresol purple or
2,2'-azido-di-3-ethyl-benzthiazoline-6-sulfonic acid (ABTS) and H2O2, in the case of peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g. , using a visible spectra spectrophotometer.
D. Immunofluorescence
Immunofluorescence uses an antigen-specific antibody conjugated with a fluorescent dye (direct), or the formation of antigen-antibody complex which is detected with fluorescent dye-conjugated antiimmunoglobulin antibody (indirect). The tissue is then examined by fluorescence microscopy. The use of multiple antibodies with different specificities and distinct labels allows one to detect mutiple targets in a single sample at the same time. Typical dyes include fluorescein (488 nm argon laser; emission at 519 nm), R-Phycoerythrin (488 nm argon laser; emission at 578 nm), PE-Cy5 (488 nm argon laser; emission at 680 nm), PE-Cy5.5 (488 nm argon laser; emission at 694 nm), PE-Texas Red (488 nm argon laser; emission at 615 nm), PE-Cy7 (488 nm argon laser; emission at 767 nm), Allophyocyanin (633 nm argon laser; emission at 660 nm), CY5 (633 nm argon laser; emission at 670 nm), APC-Cy7 (633 nm argon laser; emission at 767 nm), APC-Cy5.5 (633 nm argon laser; emission at 694 nm), 7-AAD (488 nm argon laser; emission at 647 nm), Propium Iodide (488 nm argon laser; emission at 617 nm) and Cascade Blue (408 nm argon laser; emission at 423 nm). Typically, tissue/cells is/are harvested, transferred into a receptacle (tube; well) allowing cells to be isolated by centrifugation. The sample is resuspended Staining Buffer and a cell count is performed. Cells are spun again, the supernatant is discarded, and cells are resuspended in Staining Buffer at an appropriate concentration. If conjugated primary antibodies are used, the antibodies should be pre-incubated with the cells for 5-10 min on ice prior to staining. Primary antibody should be diluted in Staining Buffer and dispensed to each test tube or well of a microtiter plate. Cell suspension (equal to 106 cells) is added to each tube or well and mixed gently. Incubation for 20 min in the dark on an ice bath or in a refrigerator is suggested (longer for lower avidity antibodies). After the incubation, more Staining Buffer is added and cell are centrifuged. The supernatant is removed; the washing process is repeated 2 times for a total of 3 washes. If using directly-conjugated antibodies, the stained cell pellet is resuspended in Staining Buffer and subjected to flow cytometry or microscopy. If secondary detection is used, add the secondary antibody in Staining Buffer, incubate in the dark for 15-30 min on an ice bath or in a refrigerator, wash 2 times as above, and resuspend stained cell pellet in Staining Buffer, followed by detection. For discrimination of viable and dead cells, stain with a viability dye.
VII. Screening Methods
The present invention further comprises methods for identifying inhibitors of coronavirus replication. These assays may comprise random screening of large libraries of candidate substances; alternatively, the assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to act as viral inhibitors.
To identify an inhibitor of coronavirus replication according to the present invention, one will determine the existence of a replicase protein in an infected or putatively infected sample. For example, a method generally comprises:
(a) providing a host cell;
(b) infecting said host cell with a coronavirus; (c) contacting said infected cell with a candidate inhibitor substance; and
(d) assessing replicase protein production in said cell;
wherein a decrease in the amount of replicase protein, as compared to the amount of replicase protein in an untreated cell, identifies the candidate substance as an inhibitor of coronavirus replication. It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them.
As used herein the term "candidate substance" refers to any molecule or compound that may potentially inhibit the export of proteins from the nucleus of a cell. The candidate substance may be a protein or fragment thereof, a peptide aptamer, a small molecule, or even a nucleic acid. Using lead compounds to help develop improved compounds is known as "rational drug design" and includes not only comparisons with know inhibitors and activators, but predictions relating to the structure of target molecules. The goal of rational drug design is to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs which are more active or stable than the natural molecules, which have different susceptibility to alteration, or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof. This could be accomplished by x-ray crystallography, computer modeling, or by a combination of both approaches.
It also is possible to use antibodies to ascertain the structure of a target compound, activator, or inhibitor. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of anti-idiotype would be expected to be an analog of the original antigen. The anti-idiotype could then be used to identify and isolate peptides from banks of chemically- or biologically-produced peptides. Selected peptides would then serve as the pharmacore. Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.
On the other hand, one may simply acquire, from various commercial sources, small molecular libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds. Screening of such libraries, including combinatorially-generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity. Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third, and fourth generation compounds modeled on active, but otherwise undesirable compounds.
Candidate compounds may include fragments or parts of naturally-occurring compounds, or may be found as active combinations of known compounds, which are otherwise inactive. It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators. Other suitable modulators include antisense molecules, ribozymes, and antibodies
(including single chain antibodies), each of which would be specific for the target molecule.
Such compounds are described in greater detail elsewhere in this document. For example, an antisense molecule that bound to a translational or transcriptional start site, or splice junctions, would be ideal candidate inhibitors.
In addition to the modulating compounds initially identified, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators. Such compounds, which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators.
A. Cysteine Proteinase Inhibitors
The present invention makes use of cysteine proteinase (CyP) inhibitors. A variety of these inhibitors are known. One example, L-trα«s-Epoxysuccinyl-leucylamido(4- guanido)butane, or E64, was reported to be a cysteine proteinase inhibitor (Barrett et ah, 1982; Mehdi, 1991). At lOμm, E64 rapidly inactivated cathepsins B, H and L as well as papain, yet had no effect on serine proteinases at concentrations 50-fold higher. The analog variant Ep-475 (L-tra«5-Epoxysuccinyl-leucylamido(3-methyl)butane) was more effective than E64 at inhibiting cathepsins B and L, but Dc 11 was about 100-fold less reactive. Variants currently in use include E64c and E64d. Grinde (1982) also reported the isolation of E64 as a thiol proteinase inhibitor of fungal origin, along with two synthetic analogs, Ep-459 and the above-noted Ep-475. All three inhibitors were found to act selectively on lysosomal protein degradation. Ep-475 and E64 were found to inhibit as much as 50% of total degradation (about 70% of lysosomal degradation) at concentrations which did not disturb protein synthesis. A variety of other cysteine proteinase inhibitors are known and some are described in
U.S. Patents 6,331,542; 6,297,277; 6,287,840; 6,284,777; 6,232,342; 6,180,402; 6,162,791; 6,147,188; 6,057,362; 6,034,066; 6,004,933; 5,998,470; 5,976,858; 5,925,772; 5,776,718; 5,766,609; 5,714,484; 5,663,380; 5,618,966; 5,486,623; 5,317,086; and 4,891,356. Each of the foregoing patents is hereby incorporated by reference in their entirety. Other types of cysteine protease inhibitors include siRNA's, ribozymes and antisense molecules directed at cysteine protease sequences, proposed picornavirus 3CLpro and 2a proteinase inhibitors, Rhino virus proteinase inhibitors, and drugs designed around 3CLpro crystal structure. B. Steroids
Oral corticosteroids are often utilized as adjunct therapy for viral infections. For example, ribavarin + corticosteroids is a typical treatment for SARS. Thus, in accordance with the present invention, one may screen the ability of corticosteroids to affect viral replication, either alone or in conjunction with other drugs. Corticosteroids are similar to the natural hormone cortisone, and affect many body processes, including the breakdown of protein, fat, and carbohydrate; the activity of the nervous system; the balance of salt and water; and the regulation of blood pressure. Because of their widespread effects, these drugs are useful in treating many medical conditions. Examples include inhalant corticosteroids are used to prevent asthma attacks, as well as corticosteroid ointments, creams and gels are used to treat skin problems. Some examples of corticosteroids are beclomethasone (Beconase, Vancenase, Vanceril), betamethasone (Diprolene, Lotrisone), hydrocortisone, mometasone (Elocon), prednisone (Deltasone, Orasone), and triamcinolone (Azmacort, Nasacort).
C. Interferons α, β or γ The interferons are a group of proteins that are normally produced by cells in response to viral infection and other stimuli. They were first described in 1957, and were named for their ability to interfere with viruses that are replicating. There are three main types of interferon. Interferons β and α are produced mainly by white blood cells and certain connective tissue cells called fibroblasts. Interferon γ is produced primarily by activated T cells-is a naturally-occurring substance in the body that promotes inflammation. Interferon β works to counteract the effects of interferon γ.
D. Interleukins and Cytokines
Various cytokines may be assessed for their ability to inhibit coronavirus replication. Examples of interleukins and cytokines include Interleukin 1 (IL-I), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, angiostatin, thrombospondin, endostatin, METH-I, METH-2, GM-CSF, G-CSF, M-CSF and tumor necrosis factor.
VIII. Examples
The following examples are included to further illustrate various aspects of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques and/or compositions discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1 - Materials and Methods
Antibodies and cells. Vero cells were used in all assays in this report. Cells were passaged in OptiPROSFM supplemented with 4mM glutamine (Gibco). The MHV-pol and MHV antibodies have been described previously (Brockway et al., 2003; Denison et al., 1999). For generation of antibodies against putative SARS-CoV replicase proteins, SARS- CoV genome was used as template for RT-PCR amplification of targeted areas, cloning into pET-23 protein expression vectors, and purification as previously described (Bost et al, 2000; Brockway et al, 2003; Denison et al, 1999; Lu et al, 1998) (Promega). Proteins generated for antibody production were: nspl, nsp2, nsp3 nsp4, nsp5, nspό, nsp7, nsp8, nsp9, nsplO, nspl 2, nspl 3, nspl 4, nspl 5 and nspl 6. The specific nucleotides and amino-acids cloned are shown in Table 2, along with the stage of development and uses in detection of proteins in cells. New Zealand White rabbits were immunized with the purified proteins for antibody production (Cocalico, Inc.). After initial inoculation, rabbits were boosted at day 14, day 21 and test bleeds were performed. Rabbits were boosted again at day 49 and serum from production bleeds on day 56 were used in the experiments in this report. Primers. Primers used for SARS-CoV replicase protein RT-PCR were as follows
(underlined sequence represents restriction endonuclease site): Nsp l
Left: 5' CATGCCATGGAGAGCCTTGTT 3' (Ncol) (SEQ ID NO: 1) Right: 5' TTGCTCGAGACCTCTCTTCGACTC 3' (Xhol) (SEQ ID NO:2) Nsp 2
Left: 5' TTGGATCCATGGTCTACTGCTGCCGT 3' (BamHI) (SEQ ID NO:3)
Right: 5' CGCAAGCTTACCCCCTTTTAAGCG 3' (Hind III) (SEQ ED NO:4) Nsp3
Left: 5' CGCCCATGGCACCAATTAAAGGT 3' (Ncol) (SEQ ID NO:5) Right: 5' CGCCTCGAGTGCAAT AT AAACCTG 3' (Xhol) (SEQ ID NO:6) Nsp 4
Left: 5' CGCCCATGGTACATACATTGTCA 3' (Ncol) (SEQ ID NO:6) Right: 5' CTTCTCGAGAGCTCTGTAATGCTC 3' (Xhol) (SEQ ID NO:7) Nsp5 Left: 5' CGCCCATGGGTGGTTTTAGGAAAA 3' (Ncol) (SEQ ID NO:8)
Right: 5' CGCCTCGAGTAATGTTATGGTTGT 3'(XhoI) (SEQ ID NO:9) Nsp8
Left: 5' CGCCCATGGCTATTGCTTCAGAA 3' (Ncol) (SEQ ID NO: 10) Right: 5' CCTCTCGAGCTGT AGTTT AACAGC 3' (Xhol) (SEQ ID NO: 11) Nsp 9
Left: 5' GCGCCATGGATAATGAACTGAGTCCA 3' (Ncol) (SEQ ID NO: 12)
Right: 5' CTTCTCGAGCTGAAGACGTACTGT 3' (Xhol) (SEQ ID NO: 13) Nsp l2 Left: 5' CCTCCATGGTTCCACCTACAAGTT 3' (Ncol) (SEQ ID NO: 14)
Right: 5' CGCCTCGAGTATCCT AAGCATGTT 3' (Xhol) (SEQ ID NO: 15) Nsp l3
Left: 5' CATCCATGGCTCTCTATTACCCA 3' (Ncol) (SEQ ID NO: 16) Right: 5' CCTCTCGAGTTGTAATGTAGCCAC 3' (Xhol) (SEQ ID NO: 17) Nspl4
Left: 5' CCACCATGGACAAACGTGCAACT 3' (Ncol) (SEQ ID NO: 18) Right: 5' CCTCTCGAGTCGGTACTCATTTGC 3' (Xhol) (SEQ ID NO: 19) Nspl5
Left: 5' CTTCCATGGTGCCAGAGATTAAG 3' (Ncol) (SEQ ED NO:20) Right: 5' CGCAAGCTTCACAGAACACACACA 3' (Hindlll) (SEQ ID
NO:21)
Nspl6
Left: 5' CGCCCATGGATTATGGTGAAAATGC 3' (Ncol) (SEQ ID NO:22) Right: 5' CGCCTCGAGGTTGTTAACAAGAAT 3' (Xhol) (SEQ ID NO:23)
Immunoblot. SARS-CoV infected cell lysates were generated by infecting Vero cell monolayers with SARS-CoV at a multiplicity of infection (MOI) of 1 TCIDso/cell for 24 hr, then lysing cells in NP40 lysis buffer. Lysates were heated to 65°C for 30 min to inactivate virus and SDS was added to a final concentration of 2%. 20<χl of lysate (equivalent of 2x105 cells) was electrophoresed on 4-20% gradient SDS-PAGE gels (Bio-Rad). Proteins were transferred to nitrocellulose (Protran - Schleicher and Schuell) according to manufacturers recommendations. Membranes were incubated in blocking buffer (5% non-fat dried milk (NFDM) in TBS:Tween) for 1 h at room temperature (RT). Antibodies were diluted 1 :500 in blocking buffer and incubated with the membrane for 1 h at RT. Membranes were washed 3 x 15 min. at RT with TBS-Tween. Goat anti-rabbit horseradish peroxidase (HRP) conjugated antibodies (Promega) were diluted 1 :2000 in blocking buffer and incubated with the membrane for 1 h at RT. Membranes were washed 3 x 15 min. at RT with TBS:Tween. Antibody label was detected by chemilluminescence using Lumi-Light (Roche) per manufacturer's instructions.
Immunofluorescence. Vero cell monolayers on glass coverslips were infected with SARS-CoV at an MOI of 1 TCIDso/cell. Inoculum was removed at 1 h p.i., and replaced with fresh OptiPRO SFM. At the indicated times p.i., cells were fixed and permeabilized by addition of cold 100% methanol. Cells were re-hydrated in phosphate buffered saline (PBS) containing 5% bovine serum albumin (BSA). The primary antibody was diluted 1 :500 (except MHV pol (VUl 45, used at 1:1000) in PBS/2% goat serum/0.05%NP40/l%BSA. Antibodies were allowed to adsorb for 1 h at room temperature (RT), then washed 2χ with PBS/0.05%NP40/l%BSA. Cells were then incubated for 1 h at RT with a 1 :1000 dilution of anti-rabbit secondary antibodies conjugated to Alexa 488 (Molecular Probes, Eugene, OR). Cells were washed twice with PBS/0.05%NP40/l%BSA, then once with PBS prior to being rinsed in DI H2O and mounted onto glass slides with Aquapolymount (Polysciences, Inc.). Images were acquired on a Zeiss 510 LSM using a 4OX, oil immersion lens. A 488nm krypton-argon laser was used to stimulate the fluorophores. SARS-CoV growth analysis. Vero cells were infected at MOI of 1 TdD50/cell.
Inoculum was allowed to adsorb to cells for 1 h at 37°C. Inoculum was removed and cells were washed 3 times with pre-warmed media. Media samples were taken at 0, 1, 3, 6, 12 and 24 h p.i. Samples were serially diluted and titered on Vero cell monolayers.
Comparison of SARS-CoV and MHV replicase proteins. Deduced amino-acid sequences from the replicase genes of SARS-CoV and MHV were compared using pairwise alignment in Mac Vector with a Blosum 30 matrix, an open gap penalty of 10 and an extend gap penalty of 0.1 in ClustalW alignment. Sequences of predicted mature proteins were based on published bioinformatics analysis (Snijder et al., 2003; Thiel et al, 2003)). Example 2 - Results
Generation of antibodies to predicted mature SARS-CoV replicase proteins.
Comparison of the SARS-CoV deduced replicase polyprotein with known coronavirus cleavage sites, processing steps, and mature replicase proteins has led to predicted models of polyprotein processing (FIG. 1) (Snijder et al, 2003). These putative cleavage sites were used as a template for cloning and expression of the predicted mature SARS-CoV replicase proteins to generate specific antibodies in rabbits (Table T). Published bioinformatic analyses predicted the first polyprotein cleavage site (CSl) at i8oG4<Ai8i (Thiel et al, 2003). However, the inventos identified 3 aa sequence identical to the MHV CSl, at 227RGNI V228, suggesting a possible alternative CSl site. Thus, the antigen purified for generation of the nspl antibody encoded aa 1-228. The antigenic regions expressed for generation of antibodies to the remaining replicase proteins were based on predicted cleavage sites (Snijder et al, 2003; Thiel et al, 2003). When possible, the entire predicted mature protein of interest was expressed as antigen for antibody production. For proteins with a predicated molecular mass of >30kDa or for proteins whose full-length expression in E. coli was toxic, fragments containing predicted antigenic regions were generated.
Detection of ORFIa mature protein products by immunoblot and immunofluorescence. To determine the identity and intracellular localization of ORFIa- encoded mature replicase proteins, antibodies against nspl, nsp2, nsp3, nsp4, nsp5, nsp8 and nsp9 were used in immunoblot and immunofluorescence studies. By immunoblot, the nspl antibody detected a 20 kDa protein in infected cells (FIG. 2). This is identical to the predicted mass for nspl protein cleaved at isoGJΑisi, whereas cleavage at 227RG4V228 would yield a protein with a predicted mass of 25 kDa. The nspl serum also detected a discrete band of 35kDa, as well as more diffuse signal between 50 and 160 kDa. The identity of these additional bands is unknown, but may represent oligomers of nspl. Proteins were not detected in the mock-infected cells or in infected cells probed with preimmune serum from the same animal indicating that the additional bands detected in infected cell lysates were not non-specifically detected viral or cellular proteins. The nsp2 antibody detected a 70 kDa protein, consistent with the predicted size of nsp2 cleaved at isoG^Aisi and 818G4Α819. A protein with a molecular mass of ~48 kDa was also detected from infected cell lysates, although with less intensity than the 70 kDa product. Whether this represents a processing or degradation product of nsp2 could not be resolved by immunoblot (FIG. 2). The nsp3 antibody detected a protein of 213 kDa from infected cell lysates, consistent with the predicted size of a protein spanning 819A to G2740. No immunoreactivity was detected from mock-infected lysates or from infected lysates probed with pre- immune serum, demonstrating the specificity of the immune serum (FIG. 2). The nsp4 antibody detected a protein with a calculated mass of 35 kDa, compared with a predicted size of 55 kDa based on a putative cleavage at 2740G4K2741 and 324oQ>lS324i (FIG. 2). Nsp4 predominantly contains hydrophobic amino acids, similar to the MHV MPl protein, which, despite a predicted mass of 56 kDa, has a calculated molecular weight of 44 kDa (Kanjanahaluethai et al, 2003). The nsp5 antibody, directed against the 3CLpro of SARS-CoV, detected a 30 kDa protein in infected cell lysates, but did not detect any proteins in mock-infected cells or in infected cells probed with pre-immune serum (FIG. 2). The nsp8 antibody predominantly detected a 22 kDa protein, but also detected a protein of -15 kDa from infected lysates. Nsp8 has been predicted to be cleaved from the replicase polyprotein at 39i9Q4Α392o and 4ii7Q4-N4ii8 and have a mass of 22 kDa. The nsp9 antibody detected a protein with mass of 12 kDa, consistent with a protein spanning 4iisN to Q4230 (FIG. 2). The MHV proteins analogous to nsp8 and nsp9 (p22 and pi 2) are detected in an intermediate precursor with a mass of 150 kDa (Schiller et al, 1998). Neither the nsp8 nor nsp9 antibodies detected a precursor of this size by immunoblot, suggesting either that the majority of the nsp8 and nsp9 in a SARS-CoV infected cell are cleaved and the analogous precursor was not present, or that precursors could not be recognized by these antibodies in immunoblot.
To determine the intracellular localization of SARS-CoV ORFIa replicase proteins, the nspl, nsp2, nsp3, nsp4, nsp8 and nsp9 antibodies were used in IF assays (FIG. 3). Vero cells cultured on glass coverslips were mock-infected or infected with SARS-CoV at an MOI = 1 TCIDso/cell for 12 h, followed by fixation with -20°C methanol and processing for immunofluorescence. When infected cells were stained with pre-immune sera and mock- infected cells were stained with immune sera, a barely detectable, diffuse background fluorescence was observed in all cells (FIG. 3, columns 3 and 4). In contrast, when SARS- CoV-infected cells were stained with immune sera against ORFIa proteins, discrete cytoplasmic foci of bright fluorescence were observed (FIG. 3, column 1). For all immune sera except nsp4, the cytoplasmic foci of fluorescence were both perinuclear and distributed throughout the cytoplasm, but were not detected in the cell nuclei. With the nsp4 antibody, fluorescence was detected in the nucleoli of infected cells in addition to the cytoplasmic foci. When infected cells monolayers were imaged at higher magnification, the cytoplasmic foci resolved into discrete, small structures characteristic of endoplasmic reticulum or of small vesicles (FIG. 3, column 2).
Timing of replicase protein expression and virus release. To determine the timing of replicase protein expression, SARS-CoV infected Vero cells on replicate coverslips were fixed at 3, 6, 9, 12 and 24 h p.i. and stained with nspl antibody (FIG. 4A). No specific nspl fluorescence was detected at 3 h p.i., but at 6 h, 9 h, 12 h, and 24 h p.i., perinuclear and cytoplasmic foci were detected. At 6 h p.i., nearly all Vero cells stained for nspl, demonstrating that infection and replicase protein expression was efficient and rapid in these cells. Diffuse fluorescence in the cytoplasm increased at 12 and 24 h p.i., suggesting a possible change in the distribution of nspl, or a breakdown of specific foci at later times of infection. To determine the relationship of the timing of replicase protein detection to that of virus release, a virus growth curve was performed. As shown in figure 4B, at 6 h p.i., when nspl was readily detected by EF in Vero cells (FIG. 4A), only 1.6 loglO TCID50/ml of virus had been released from infected cells. By 9 h p.i., virus growth was 3.8 loglO TCID50/ml. After 9 h p.i., the rate of virus growth decreased with little additional virus being released by 12 and 24 h p.i. The results demonstrated that SARS-CoV replicase proteins are detected by immunofluorescence early in infection and suggested that the SARS-CoV lifecycle is of similar duration to those of other coronaviruses, like MHV.
Identification of ORFIb replicase proteins by immunoblot and immunofluorescence. Having shown that ORFIa proteins were detectable by immunoblot and immunofluorescence analysis, we next generated antibodies against the putative mature ORFIb proteins, nspl2, nspl3, nspl4, nspl5, and nsplό. Expression of ORFIb proteins requires a -1 ribosomal frameshift at the 5' end of ORFIb. This frameshift has been predicted to be -40% efficient for other coronaviruses (Brierley et al, 1987; Brierley et al, 1989). To determine the expression pattern of the ORFIb proteins, we performed immunoblot and immunofluorescence experiments in SARS-CoV-infected Vero cells. The nspl 2 antibody, directed against the putative RNA-dependent RNA polymerase (RdRp or pol), detected a single protein with a calculated mass of 106 kDa, identical to the predicted mass of a protein cleaved at
Figure imgf000046_0001
and 53OIQ>IΆ53O2 (FIG. 5A). Nspl3, the RNA helicase (Thiel et al, 2003), predominantly detected a protein calculated to have a mass of 67 kDa, consistent with cleavage at 530iQiA5302 and
Figure imgf000046_0002
but to a lesser extent also detected proteins of 22 and 15 kDa (FIG. 5A). The nspl 4 protein has been reported to have distant homology with a cellular 3'-to-5' exonuclease of the DEDD superfamily (ExoN) (Snijder et al, 2003). The nspl4 antibody detected a protein of 60 kDa, identical to the size predicted from the deduced amino-acid sequence. A protein band of -38 kDa was also detected from infected cell lysates with nspl4 antisera, but neither the 38 kDa or 60 kDa proteins were detected in mock- infected cells or in infected cells probed with pre-immune serum (FIG. 5A). The nspl5 antibody detected a 38 kDa protein from infected cell lysates and, to a lesser extent, several proteins of lower molecular weight. The nspl5 protein was predicted to have a mass of 38 kDa and was reported to have domains of a polyU endoribonuclease (Snijder et al, 2003) (FIG. 5A). The nsplό antibody strongly detected a 33 kDa protein in infected cells as well as some proteins of larger molecular weight (approximately 49 kDa, 60 kDa, and several proteins of >110 kDa) (FIG. 5A). Whether any of these proteins represent potential nsplό precursors could not be determined by immunoblot analysis.
The nspl2-16 antibodies were next tested in immunofluorescence experiments to determine the subcellular localization of the proteins expressed from ORFIb. In these initial studies, only the nspl3 antibody stained infected cells. At 12 h p.i., nspl3 was detected exclusively in the cytoplasm in bright foci that were predominantly perinuclear, but also had foci throughout the cytoplasm, similar to the localizations demonstrated for the ORF la- expressed proteins. Fluorescence was not detected in mock-infected cells or in infected cells probed with pre-immune serum, demonstrating the specificity of the antibody in this assay (FIG. 5B). The remaining ORFIb proteins (nspl2, nspl4, nspl5, and nsplό), did not strongly stain infected Vero cells for immunofluorescence; however, they were detected equivalently to nspl3 in immunoblot analysis, suggesting that protein abundance is not the reason for the lack of detection. Nonetheless, the immunoblot and immunofluorescence results demonstrate the first identification and detection of mature protein products encoded by ORFIb.
Conservation of replicase protein epitopes between SARS-CoV and MHV. The predicted organization and mature products of the SARS-CoV replicase polyproteins most closely resembles that of the group II coronaviruses, such as MHV (Snijder et al, 2003). Comparison of the predicted mature replicase proteins of SARS-CoV and MHV reveals a significant amino acid identity near the carboxy-terminus of ORFIa and throughout ORFIb. The highest level of conservation was found in the predicted RNAdependent RNA polymersase (pol) and RNA helicase (hel), which were 66% and 67% identical between SARS-CoV and MHV. Overall, ORFIa had 31% identity, while ORFIb was 61% identical. In contrast, the structural proteins, S, M, and N were 32, 19, and 37% identical. This analysis demonstrated that there was strong conservation of protein identity between SARS-CoV and MHV, particularly in proteins that have been demonstrated or predicted to serve functions in RNA synthesis or processing.
To determine if the conservation of proteins between SARS-CoV and MHV was reflected in their antigenic specificity, antibodies generated against the putative MHV RdRp (pol, analog of SARS-CoV nsp 12), and against MHV virions, were used in immunoblot and immunofluorescence assays in SARS-Co V-infected Vero cells. Using immune serum, the MHV pol antiserum detected a protein with a calculated mass of 106 kDa in SARS-CoV- infected lysates (FIG. 6A). The mass of this protein was identical to the predicted mass (106 kDa) of the putative RNA-dependent RNA polymerase (nsp 12 - pol). This result demonstrates that the putative RdRps of MHV and SARS-CoV share conserved epitopes. The MHV antiserum detects the MHV structural proteins Spike (S), membrane protein (M) and nucleocapsid (N) (Denison et al, 1999).
In lysates of SARS-CoV infected Vero cells, the MHV antiserum detected a 50 kDa protein, corresponding to the predicted size of the SARS-CoV nucleocapsid protein (FIG. 6A). This result was interesting because SARS-CoV and MHV nucleocapsid proteins share only 37% amino-acid identity; however, this protein was not detected when the membrane was probed with pre-immune serum or when mock-infected cells were probed with immune sera, suggesting that the detected protein was the SARS-CoV nucleocapsid protein (FIG. 6A).
For immunofluorescence studies, SARS-CoV infected Vero cells on coverslips were stained with the MHV antibodies as above. While no fluorescence was detected in mock- infected cells or with preimmune sera, the MHV-pol and MHV antibodies specifically stained SARS-CoV infected Vero cells, in punctate perinuclear and cytoplasmic foci (FIG. 6B). A bright, diffuse fluorescence was observed throughout the monolayer with the MHV antisera, similar to the pattern of SARS-CoV antibody labeling at 24 h p.i.. The immunoblot and immunofluorescence results suggest significant crossreactivity and epitope conservation between the putative RdRps and nucleocapsid (N) proteins of SARS-CoV and MHV.
All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the scope of the invention as defined by the appended claims.
IX. References
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference:
U.S. Patent 3,817,837
U.S. Patent 3,850,752
U.S. Patent 3,939,350
U.S. Patent 3,996,345
U.S. Patent 4,196,265 U.S. Patent 4,275,149
U.S. Patent 4,277,437
U.S. Patent 4,366,241
U.S. Patent 4,683,202
U.S. Patent 4,684,611 U.S. Patent 4,891,356
U.S. Patent 4,952,500
U.S. Patent 5,302,523
U.S. Patent 5,317,086
U.S. Patent 5,322,783 U.S. Patent 5,384,253
U.S. Patent 5,384,253
U.S. Patent 5,384,253
U.S. Patent 5,464,765
U.S. Patent 5,486,623 U.S. Patent 5,538,877
U.S. Patent 5,538,880
U.S. Patent 5,538,880
U.S. Patent 5,550,318
U.S. Patent 5,550,318 U.S. Patent 5,563,055
U.S. Patent 5,563,055
U.S. Patent 5,563,055
U.S. Patent 5,580,859 U.S. Patent 5,589,466
U.S. Patent 5,610,042
U.S. Patent 5,610,042
U.S. Patent 5,618,966 U.S. Patent 5,656,610
U.S. Patent 5,663,380
U.S. Patent 5,702,932
U.S. Patent 5,714,484
U.S. Patent 5,736,524 U.S. Patent 5,766,609
U.S. Patent 5,776,718
U.S. Patent 5,780,448
U.S. Patent 5,789,215
U.S. Patent 5,925,565 U.S. Patent 5,925,772
U.S. Patent 5,928,906
U.S. Patent 5,935,819
U.S. Patent 5,945,100
U.S. Patent 5,976,858 U.S. Patent 5,981,274
U.S. Patent 5,994,624
U.S. Patent 5,998,470
U.S. Patent 6,004,933
U.S. Patent 6,034,066 U.S. Patent 6,057,362
U.S. Patent 6,147,188
U.S. Patent 6,162,791
U.S. Patent 6,180,402
U.S. Patent 6,232,342 U.S. Patent 6,284,777
U.S. Patent 6,287,840
U.S. Patent 6,297,277
U.S. Patent 6,331,542
U.S. Patent 5,322,783 Almendro et al, J. Immunol, 157(12):5411-5421, 1996.
Angel et al, MoI Cell. Biol, 7:2256, 1987.
Angel et al., Cell, 49:729, 1987b.
Angel et al, MoI Cell. Biol, 7:2256, 1987a. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, Cold Spring Harbor, New York, 1988.
Atchison and Perry, Cell, 46:253, 1986.
Atchison and Perry, Cell, 48:121, 1987.
Ausubel et al, In: Current Protocols in Molecular Biology, John, Wiley & Sons, Lie, New York, 1994.
Banerji et al, Cell, 27(2 Pt l):299-308, 1981.
Banerji et al, Cell, 33(3):729-740, 1983.
Barrett et al, Biochem. J, 201 :189-198, 1982.
Bates, MoI Biotechnol, 2(2):135-145, 1994. Battraw and Hall, Theor. App. Genet, 82(2):161-168, 1991.
Berkhout et al, Cell, 59:273-282, 1989.
Bhattacharjee et al., J. Plant Bioch. Biotech., 6(2):69-73. 1997.
Blmar et al, EMBO J, 8:1139, 1989.
Bodine and Ley, EMBO J., 6:2997, 1987. Boshart et α/., Cell, 41 :521, 1985.
Bost et al, J. Virol, 74:3399-3403, 2000.
Bosze et al, EMBOJ., 5(7):1615-1623, 1986.
Bower et al, J. Plant, 2:409-416. 1992.
Braddock et al, Cell, 58:269, 1989. Brierley et al, Cell, 57:537-47, 1989.
Brierley et al, EMBO J, 6:3779-3785, 1987.
Brockway et al, J. Virol, 77:10515-10527, 2003.
Buising and Benbow, MoI Gen. Genet., 243(\):71-S\, 1994.
Bulla and Siddiqui, J. Virol, 62:1437, 1986. Campbell and Villarreal, MoI Cell. Biol, 8: 1993, 1988.
Campbell, In: Monoclonal Antibody Technology, Laboratory Techniques in Biochemistry and Molecular Biology, Burden and Von Knippenberg (Eds.), Elseview, Amsterdam, 13:71-74/75-83, 1984.
Campere and Tilghman, Genes andDev., 3:537, 1989. Campo et al, Nature, 303:77, 1983.
Carbonelli et al, FEMS Microbiol. Lett., 177(l):75-82, 1999.
Celander and Haseltine, J. Virology, 61 :269, 1987.
Celander ef α/., J. Virology, 62:1314, 1988. Chandler et al, Cell, 33:489, 1983.
Chandler et al, Proc. Natl. Acad. ScL USA, 94(8):3596-601, 1997.
Chang et al., Mol Cell. Biol, 9:2153, 1989.
Chatterjee et al, Proc. Natl Acad. Sci. USA, 86:9114, 1989.
Chen and Okayama, MoI. Cell Biol, 7(8):2745-2752, 1987. Choi et al, Cell, 53:519, 1988.
Christou et al, Proc. Natl. Acad. ScL USA, 84(12):3962-3966, 1987.
Cocea, Biotechniques, 23(5):814-816, 1997.
Cohen et al, J. Cell Physiol, 5:75, 1987.
Costa et al, MoI. Cell. Biol, 8:81, 1988. Cήpe et al, EMBO J, 6:3745, 1987.
Culotta and Hamer, MoI Cell. Biol, 9:1376, 1989.
Dandolo e/ α/., J. Virology, 47:55-64, 1983.
De Villiers et al, Nature, 312(5991):242-246, 1984.
Denison et al, J. Virology, 73:6862-71, 1999. Denison et al, Virology, 189:274-284, 1992.
Deschamps et al, Science, 230:1174-1177, 1985.
DΗalluin et al, Plant Cell, 4(12):1495-1505, 1992.
Edbrooke et al, MoI. Cell. Biol, 9:1908, 1989.
Edlund et al, Science, 230:912-916, 1985. European Patent 0273085
Fechheimer, et al, Proc Natl Acad. ScL USA, 84:8463-8467, 1987.
Feng and Holland, Nature, 334:6178, 1988.
Firak and Subramanian, MoI Cell. Biol, 6:3667, 1986.
Foecking and Hofstetter, Gene, 45(1): 101-105, 1986. Fraley et al, Proc. Natl Acad. ScL USA, 76:3348-3352, 1979.
Fujita et al, Cell, 49:357, 1987.
Gefter, et al, Somatic Cell Genet., 3:231-236, 1977.
Ghosh and Bachhawat, hi: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors andLigands, Wu et al (Eds.), Marcel Dekker, NY, 87-104, 1991. Gilles et al, Cell, 33:717, 1983.
Gloss et al., EMBO J, 6:3735, 1987.
Godbout et α/., MoL Cell. Biol, 8:1169, 1988.
Goding, In: Monoclonal Antibodies: Principles and Practice, 2d ed., Academic Press, FL., 60-66, and 71-74, 1986.
Goodboum and Maniatis, Proc. Natl. Acad. ScL USA, 85:1447, 1988.
Goodbourn et al., Cell, 45:601, 1986.
Gopal, MoL CellBiol, 5:1188-1190, 1985.
Graham and Van Der Eb, Virology, 52:456-467, 1973. Greene et al. , Immunology Today, 10:272, 1989
Grinde, Biochim. Biophys. Acta, 701:328-333, 1982.
Grosschedl and Baltimore, Cell, 41 :885, 1985.
Hagio et al., Plant Cell Rep., 10(5):260-264, 1991.
Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, 1985. Haslinger and Karin, Proc. Natl. Acad. ScL USA, 82:8572, 1985.
Hauber and Cullen, J. Virology, 62:673, 1988.
He et al., Plant Cell Reports, 14 (2-3): 192- 196, 1994.
Hen et al., Nature, 321:249, 1986.
Hensel et al., Lymphokine Res., 8:347, 1989. Hensgens et al., Plant MoL Biol., 22(6):1101-1127, 1993.
Herr and Clarke, Cell, 45:461, 1986.
Hirochika et al., J. Virol., 61 :2599, 1987. nirsch et al., MoI. Cell. Biol., 10:1959, 1990.
Holbrook e^/., Virology, 157:211, 1987. Horlick and Benfield, MoL Cell. Biol. , 9:2396, 1989.
Hou and Lin, Plant Physiology, 111 :166, 1996.
Huang et al., Cell, 27:245, 1981.
Hug et al., MoL Cell. Biol., 8:3065, 1988.
Hwang et al., MoL Cell. Biol., 10:585, 1990. Imagawa et al. , Cell, 51 :251, 1987.
Imbra and Karin, Nature, 323:555, 1986. hnler et al., MoL Cell. Biol., 7:2558, 1987.
Imperiale and Nevins, MoL Cell. Biol, 4:875, 1984.
Jakobovits et α/., M?/. Cell. Biol, 8:2555, 1988. Jameel and Siddiqui, MoI Cell Biol, 6:710, 1986.
Jaynes et al, Mol Cell Biol, 8:62, 1988.
Johnson et al, MoI Cell Biol, 9:3393, 1989.
Kadesch and Berg, MoI Cell Biol, 6:2593, 1986. Kaeppler et al , Plant Cell Reports, 9:415-418, 1990.
Kaneda et al, Science, 243:375-378, 1989.
Kanjanahaluethai et al, J. Virol, 11:1316-13S2, 2003.
Karin et al, MoI Cell. Biol, 7:606, 1987.
Karin et al, Mol Cell. Biol, 7:606, 1987. Katinka et al, Cell, 20:393, 1980.
Kato et al, J. Biol. Chem., 266:3361-3364, 1991.
Kawamoto et al, MoI Cell. Biol, 8:267, 1988.
Kiledjian et al, MoI Cell. Biol, 8:145, 1988.
Kim et al, Virology, 208:1-8, 1995 Klamut et al, MoI Cell. Biol, 10:193, 1990.
Klein et al, Nature, 327:70-73, 1987.
Knittel et al, Plant Cell Reports, 14(2-3):81-86, 1994.
Koch et al, MoI Cell Biol, 9:303, 1989.
Kohler and Milstein, Eur. J. Immunol, 6:511-519, 1976. Kohler and Milstein, Nature, 256:495-497, 1975.
Kraus et al FEBS Lett., 428(3):165-170, 1998.
Kriegler and Botchan, In: Eukaryotic Viral Vectors, Gluzman (Ed.), Cold Spring Harbor: Cold Spring Harbor Laboratory, NY, 1982.
Kriegler and Botchan, MoI Cell. Biol, 3:325, 1983. Kriegler et al, Cell, 38:483, 1984.
Kriegler et al, Cell, 53:45, 1988.
Kuhl et al, Cell, 50:1057, 1987.
Kunz et al., Nucl Acids Res., 17:1121, 1989.
Lareyre et al, J. Biol. Chem., 274(12):8282-8290, 1999. Larsen et al, Proc Natl. Acad. Sci. USA., 83:8283, 1986.
Laspia et al, Cell, 59:283, 1989. aXimex et al, MoI. Cell Biol, 10:760, 1990.
Lazzeri, Methods MoI Biol, 49:95-106, 1995.
Lee et al, DNA Cell Biol, 16(11):1267-1275, 1997. Lee et ai, Environ. MoI Mutagen., 13(l):54-59, 1989.
Lee et al, Nature, 294:228, 1981.
Lee et al, Nucleic Acids Res., 12:4191-206, 1984.
Levenson et al., Hum. Gene Ther., 9(8):1233-1236, 1998. Levinson et al, Nature, 295:79, 1982.
Lin et al, MoI. Cell. Biol, 10:850, 1990.
Lu et al, J. Virology, 72:2265-2271, 1998.
Luria et al., EMBO J., 6:3307, 1987.
Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, 1986. Lusky et al, MoI. Cell Biol, 3:1108, 1983.
Macejak and Sarnow, Nature, 353:90-94, 1991.
Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, 1983.
Maniatis et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold
Spring Harbor, N. Y., 1988. Marra et al, Science, 300:1399-1404, 2003.
Marra et al, Sciencexpress, 1085953, 1 May 2003.
McCabe and Martinell, Bio-Technology, l l(5):596-598, 1993.
McNeall et al, Gene, 76:81, 1989.
Mehdi, Trends Biochem. ScL, 16:150-153, 1991. Miksicek et al, Cell, 46:203, 1986.
Mordacq and Linzer, Genes and Dev., 3:760, 1989.
Moreau et al, Nucl Acids Res., 9:6047, 1981.
Muesing et al, Cell, 48:691, 1987.
Nabel et al, Science, 244(4910): 1342-1344, 1989. Nakamura et al, In: Handbook of Experimental Immunology (4th Ed.), Weir et al (Eds), 1:27, Blackwell Scientific Publ., Oxford, 1987.
Ng et al, Nuc. Acids Res., 17:601, 1989.
Nicolau and Sene, Biochim. Biophys. Acta, 721 :185-190, 1982.
Nicolau et al, Methods Enzymol, 149:157-176, 1987. Nomoto et al, Gene, 236(2):259-271, 1999.
Omirulleh et al, Plant MoI. Biol, 21(3):415-28, 1993.
Ondek et al, EMBO J., 6:1017, 1987.
Ornitz et al, MoI. Cell. Biol, 7:3466, 1987.
Palmiter et al, Nature, 300:611, 1982. PCT Appln. WO 9217598
PCT Appln. WO 94/09699
PCT Appln. WO 94/09699
PCT Appln. WO 95/06128 PCT Appln. WO95/06128
Pech et al., Mol. Cell. Biol., 9:396, 1989.
Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988.
Perales et al, Proc. Natl. Acad. Sci. USA, 91 :4086-4090, 1994.
Perez-Stable and Constantini, MoI. Cell. Biol., 10:1116, 1990. Picard and Schaffher, Nature, 307:83, 1984.
Pinkert et α/., Genes and Dev., 1 :268, 1987.
Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985.
Porton et al, MoI. Cell. Biol, 10:1076, 1990.
Potrykus et al, MoI Gen. Genet, 199:183-188, 1985. Potter et al, Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984.
Queen and Baltimore, Cell, 35:741, 1983.
Quinn et al, MoI Cell. Biol, 9:4713, 1989.
Redondo et al, Science, 247:1225, 1990.
Reisman and Rotter, MoI Cell. Biol, 9:3571, 1989. Resendez Jr. et al. , MoI Cell. Biol , 8 :4579, 1988.
Rhodes et α/., Methods MoI Biol, 55:121-131, 1995.
Ripe et al, MoI Cell Biol, 9:2224, 1989.
Rippe et al, MoI Cell Biol, 10:689-695, 1990.
Ritala et al, Plant MoI Biol, 24(2):317-325, 1994. Rittling et al, Nuc. Acids Res., 17:1619, 1989.
Rosen et al, Cell, 41:813, 1988.
Rota et al, Science, 300:1394-1399, 2003.
Rota et al, Sciencexpress, 1085952, 1 May 2003.
Sakai et al, Genes and Dev., 2:1144, 1988. Sambrook et al, In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001.
Satake e? α/., J. Virology, 62:970, 1988.
Schaffher et al, J. MoI Biol, 201 :81, 1988.
Schiller et al, Virology, 242:288-302, 1998. Searle et al, MoI Cell. Biol, 5:1480, 1985.
Sharp and Marciniak, Cell, 59:229, 1989.
Shaul and Ben-Levy, EMBO J., 6:1913, 1987.
Sherman et al, MoI Cell Biol, 9:50, 1989. Singsit et al, Transgenic Res., 6(2): 169-176, 1997.
Sleigh and Lockett, J. EMBO, 4:3831, 1985.
Snijder et al, J. MoI. Biol, 331:991-1004, 2003.
Spalholz et al, Cell, 42:183, 1985.
Spandau and Lee, J. Virology, 62:427, 1988. Spandidos and Wilkie, £M50J, 2:1193, 1983.
Stephens and Hentschel, Biochem. J, 248:1, 1987.
Stuart et al, Nature, 317:828, 1985.
Sullivan and Peterlin, MoI. Cell Biol, 7:3315, 1987.
Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975. Takebe et al, Mol Cell. Biol, 8:466, 1988.
Tavernier et al, Nature, 301 :634, 1983.
Taylor and Kingston, MoI. Cell. Biol, 10:165, 1990a.
Taylor and Kingston, MoI Cell. Biol, 10:176, 1990b.
Taylor et al, J. Biol. Chem., 264:15160, 1989. Thiel et al, J. Gen. Virol, 84:2305-2315, 2003.
Thiesen etf α/., J. Virology, 62:614, 1988.
Tomes et al, Plant. MoI. Biol, 14(2):261-268, 1990.
Torbet et al, Crop Science, 38(1):226-231, 1998.
Torbet et al, Plant Cell Reports, 14(10):635-640, 1995. Treisman, Cell, 42:889, 1985.
Tronche et al, MoI. Biol. Med., 7:173, 1990.
Trudel and Constantini, Genes andDev. 6:954, 1987.
Tsukada et al, Plant Cell Physiol, 30(4)599-604, 1989.
Tsumaki et al, J. Biol. Chem., 273(36):22861-22864, 1998. Tur-Kaspa et al, MoI. Cell Biol, 6:716-718, 1986.
Tyndell et al, Nuc. Acids. Res., 9:6231, 1981.
Van Eck et al, Plant Cell Reports, 14(5):299-304, 1995.
Vannice and Levinson, J. Virology, 62:1305, 1988.
Vasseur et al., Proc Natl Acad. ScL U.S.A., 77:1068, 1980. Wagner et al, Proc. Natl. Acad. ScL USA 87(9):3410-3414, 1990.
Wang and Calame, Cell, 47:241, 1986.
Weber et al, Cell, 36:983, 1984.
Weinberger et al. MoI. Cell. Biol, 8:988, 1984. Wilson et al, Science, 244:1344-1346, 1989.
Winoto and Baltimore, Cell 59:649, 1989.
Wong et al., Gene, 10:87-94, 1980.
Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.
Wu and Wu, Biochemistry, 27:887-892, 1988. Wu and Wu, J Biol. Chem., 262:4429-4432, 1987.
Wxi et al, Biochem. Biophys. Res. Commun., 233(l):221-6, 1997.
Yang and Russell, Proc. Natl. Acad. ScL USA, 87:4144-4148, 1990.
Yutzey et al MoI. Cell. Biol, 9:1397, 1989.
Zhao-Emonet et al, Biochim. Biophys. Acta, 1442(2-3):109-119, 1998. Zhou et al, Exp. Hematol, 21 :928-933, 1993.

Claims

1. A method of detecting coronavirus infection of a cell comprising:
(a) contacting a cell with a first antibody against a coronavirus replicase protein; and
(b) determining binding of said first antibody to a replicase protein,
wherein binding of said first antibody identifies said cell as infected by a coronavirus.
2. The method of claim 1, wherein said cell in step (a) is fixed.
3. The method of claim 1, wherein said cell in step (a) is fixed and permeabilized.
4. The method of claim 1, wherein said cell in step (a) is unfixed.
5. The method of claim 4, wherein said cell is comprised within in culture.
6. The method of claim 4, wherein said cell is cultured subsequent to step (b).
7. The method of claim 1, wherein said cell is derived from an animal biological sample.
8. The method of claim 1, wherein said cell is a Vero cell, a Vero E6 cell, a BHK cell or a DBT cell.
9. The method of claim 1, wherein said cell lacks a determinant for natural coronavirus infection, but supports viral protein expression, RNA synthesis, virus production and release.
10. The method of claim 1, wherein said cell lacks a determinant for natural SARS-CoV infection, but supports viral protein expression," RNA synthesis, virus production and release.
11. The method of claim 9, further comprising delivering to said cell a wild-type or mutant coronavirus genome or an expression cassette encoding one or more coronavirus proteins.
12. The method of claim 10, further comprising delivering to said cell a wild-type or mutant SARS-CoV genome or an expression cassette encoding one or more SARS- CoV proteins.
13. The method of claim 11, wherein delivering comprises transfection or electroporation.
14. The method of claim 12, wherein delivering comprises transfection or electroporation.
15. The method of claim 1, wherein said cell is engineered to support coronavirus infection.
16. The method of claim 15, wherein said cell is engineered with an ACE2 expression construct or a coronavirus receptor expression construct.
17. The method of claim 1, wherein said coronavirus is avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), rabbit coronavirus, human coronavirus NL or human coronavirus NL63.
18. The method of claim 17, wherein said coronavirus is SARS virus.
19. The method of claim 18, wherein said replicase protein is selected from the group consisting of nspl, nsp2, nsp3, nsp4, nsp5, nspβ, nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nsplβ.
20. The method of claim 1, wherein said first antibody is a monoclonal antibody.
21. The method of claim 1, wherein said first antibody is comprised within polyclonal antisera.
22. The method of claim 1, wherein step (b) comprises ELISA.
23. The method of claim 1, wherein step (b) comprises immunofluorescence.
24. The method of claim 1, wherein step (b) comprises FACS.
25. The method of claim 1, wherein said first antibody is labeled.
26. The method of claim 1, wherein antibody binding is detected binding of a second antibody to said first antibody, said second antibody being labeled.
27. The method of claim 25, wherein said label is fluorophore, a chromophore, a chemilluminescent molecule or an enzyme.
28. The method of claim 26, wherein said label is fluorophore, a chromophore, a chemilluminescent molecule or an enzyme.
29. The method of claim 1, wherein said first antibody binds immunologically with multiple coronavirus species.
30. The method of claim 1, wherein said cell is suspected of being infected by a coronavirus.
31. The method of claim 1 , wherein said cell is known to be infected by a coronavirus.
32. The method of claim 31, wherein said cell has been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication.
33. The method of claim 32, wherein said candidate substance is a DNA molecule, and RNA molecule, a protein or a small molecule.
34. The method of claim 32, wherein said candidate substance is a proteinase inhibitor, a steroid, interferon α, β or γ, a cytokine, or an immune mediator.
35. The method of claim 1, wherein said cell has been infected about 36 hours.
36. The method of claim 1, wherein said cell has been infected about 24 hours.
37. The method of claim 1, wherein said cell has been infected about 12 hours.
38. The method of claim 1, wherein said cell has been infected about 6 hours.
39. The method of claim 1, wherein said cell has been infected about 4 hours.
40. The method of claim 1, wherein said cell has been infected about 3 hours.
41. The method of claim 1, wherein said cell has been infected about 2 hours.
42. The method of claim 1, wherein said cell has been infected about 1 hour.
43. A method of detecting coronavirus infection of a cell culture comprising:
(a) collecting cell culture supernatant from a cell culture;
(b) contacting said cell culture supernatant with a first antibody against a coronavirus replicase protein; and
(c) determining binding of said first antibody to a replicase protein in said cell culture supernatant,
wherein binding of said first antibody identifies said cell culture as infected by a coronavirus.
44. The method of claim 43, wherein said cell is a Vero cell, a Vero E6 cell, a BHK cell, a DBT cell, or a cell that lacks a determinant for natural coronavirus infection, but supports viral protein expression, RNA synthesis, virus production and release.
45. The method of claim 43, wherein said cell is engineered to support coronavirus infection.
46. The method of claim 45, wherein said cell is engineered with an ACE2 expression construct or a coronavirus receptor expression construct.
47. The method of claim 40, wherein said coronavirus is avian infectious bronchitis virus, bovine coronavirus, canine coronavirus, feline infectious peritonitis virus, human coronavirus 229E, human coronavirus OC43, murine hepatitis virus, porcine epidemic diarrhea virus, porcine hemagglutinating encephalomyelitis virus, porcine transmissible gastroenteritis virus, rat coronavirus, turkey coronavirus, severe acute respiratory syndrome virus (SARS virus), or rabbit coronavirus.
48. The method of claim 47, wherein said coronavirus is SARS coronavirus.
49. The method of claim 48, wherein said replicase protein is selected from the group of nspl, nsp2, nsp3, nsp4, nsp5, nspβ, nsp7, nsp8, nsp9, nsplO, nspl l, nspl2, nspl3, nspl4, nspl5 and nsplβ.
50. The method of claim 43, wherein said first antibody is a monoclonal antibody.
51. The method of claim 43, wherein said first antibody is comprised within polyclonal antisera.
52. The method of claim 43, wherein said antibody is attached to a support
53. The method of claim 52, wherein said support is a column, a dipstick or a bead.
54. The method of claim 53, wherein antibody binding is detected binding of a second antibody to said replicase protein.
55. The method of claim 54, wherein said second antibody is labeled.
56. The method of claim 55, wherein said label is fluorophore, a chromophore, a chemilluminescent molecule or an enzyme.
57. The method of claim 56, wherein step (b) comprises ELISA.
58. The method of claim 43, wherein said first antibody binds immunologically to multiple coronavirus species.
59. The method of claim 43, wherein said cell is suspected of being infected by a coronavirus.
60. The method of claim 43, wherein said cell is known to be infected by a coronavirus.
61. The method of claim 60, wherein said cell has been treated with a candidate substance, and said method comprises measuring the effect of said candidate substance on coronavirus replication.
62. The method of claim 61, wherein said candidate substance is a DNA molecule, and RNA molecule, a protein or a small molecule.
63. The method of claim 61, wherein said candidate substance is a proteinase inhibitor, a steroid, interferon α, β or γ, a cytokine, or an immune mediator.
64. The method of claim 43, wherein said cell has been infected about 36 hours.
65. The method of claim 43, wherein said cell has been infected about 24 hours.
66. The method of claim 43, wherein said cell has been infected about 12 hours.
67. The method of claim 43, wherein said cell has been infected about 6 hours.
68. The method of claim 43, wherein said cell has been infected about 4 hours.
69. The method of claim 43, wherein said cell has been infected about 3 hours.
70. The method of claim 43, wherein said cell has been infected about 2 hours.
71. The method of claim 43, wherein said cell has been infected about 1 hours.
72. The method of claim 43, wherein said culture supernatant is concentrated or purified prior to step (a).
73. A method of detecting diagnosing a coronavirus infection in a subject comprising:
(a) obtaining a tissue sample from said subject;
(b) contacting a cell or cell fragment from said tissue sample with an antibody against a coronavirus replicase protein; and
(c) identifying the presence or absence of said coronavirus replicase protein in said tissue by determining binding of said antibody to a target in said cell or cell fragment,
wherein the presence of said coronavirus replicase protein detects a coronavirus infection in said subject.
74. The method of claim 73, wherein said tissue sample is homogenized.
75. The method of claim 73, wherein said tissue sample is intact and identifying comprises in situ immunofluorescence.
PCT/US2005/013890 2004-04-22 2005-04-22 Methods of detecting coronavirus infections Ceased WO2006076007A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US56462604P 2004-04-22 2004-04-22
US60/564,626 2004-04-22

Publications (2)

Publication Number Publication Date
WO2006076007A2 true WO2006076007A2 (en) 2006-07-20
WO2006076007A3 WO2006076007A3 (en) 2007-04-05

Family

ID=36678026

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/013890 Ceased WO2006076007A2 (en) 2004-04-22 2005-04-22 Methods of detecting coronavirus infections

Country Status (1)

Country Link
WO (1) WO2006076007A2 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009124178A1 (en) * 2008-04-02 2009-10-08 Cornell Research Foundation, Inc. Method for prophylaxis or treatment of feline infectious peritonitis
CN108715857A (en) * 2018-06-07 2018-10-30 西南民族大学 A kind of bovine coronavirus VPN genes, the recombinant protein of coding and application
CN111273026A (en) * 2020-02-21 2020-06-12 无锡市人民医院 A rapid detection test strip for novel coronavirus pneumonia and its application
WO2021165940A1 (en) * 2020-02-21 2021-08-26 Idea Bio-Medical Ltd. Method and kit for virus identification
WO2021218250A1 (en) * 2020-04-28 2021-11-04 江苏省农业科学院 Rapid test card for simultaneously detecting pedv and tgev, and preparation method and use method therefor
CN113607941A (en) * 2020-10-22 2021-11-05 广州中医药大学顺德医院(佛山市顺德区中医院) Novel coronavirus pneumonia severe illness distinguishes and curative effect evaluation system
WO2022037699A1 (en) * 2020-08-21 2022-02-24 Westlake University Engineered ace2 oligomers and uses thereof
WO2022099260A1 (en) * 2020-11-05 2022-05-12 Vanderbilt University Compositions and methods for targeting the interaction of host myo5b+d and coronavirus m proteins
CN114773458A (en) * 2022-04-19 2022-07-22 军事科学院军事医学研究院军事兽医研究所 Polyclonal antibody of porcine epidemic diarrhea virus Nsp15 protein and preparation method thereof
CN117388500A (en) * 2023-08-03 2024-01-12 暨南大学 Application of TRPV4 as drug target in coronavirus infection anti-inflammatory drug

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0217434D0 (en) * 2002-07-27 2002-09-04 Royal Vetinary College Biological material
AU2004228584A1 (en) * 2003-04-08 2004-10-21 Coronovative B.V. Severe acute respiratory syndrome (SARS) causing coronavirus
EP1508615A1 (en) * 2003-08-18 2005-02-23 Amsterdam Institute of Viral Genomics B.V. Coronavirus, nucleic acid, protein, and methods for the generation of vaccine, medicaments and diagnostics
US20050100883A1 (en) * 2003-11-12 2005-05-12 Wang Chang Y. Peptide-based diagnostic reagents for SARS
EP1533370A1 (en) * 2003-11-18 2005-05-25 ViroNovative B.V. Novel atypical pneumonia-causing virus

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009124178A1 (en) * 2008-04-02 2009-10-08 Cornell Research Foundation, Inc. Method for prophylaxis or treatment of feline infectious peritonitis
US9044486B2 (en) 2008-04-02 2015-06-02 Cornell University Method for prophylaxis or treatment of feline infectious peritonitis
CN108715857A (en) * 2018-06-07 2018-10-30 西南民族大学 A kind of bovine coronavirus VPN genes, the recombinant protein of coding and application
CN111273026A (en) * 2020-02-21 2020-06-12 无锡市人民医院 A rapid detection test strip for novel coronavirus pneumonia and its application
WO2021165940A1 (en) * 2020-02-21 2021-08-26 Idea Bio-Medical Ltd. Method and kit for virus identification
WO2021218250A1 (en) * 2020-04-28 2021-11-04 江苏省农业科学院 Rapid test card for simultaneously detecting pedv and tgev, and preparation method and use method therefor
WO2022037699A1 (en) * 2020-08-21 2022-02-24 Westlake University Engineered ace2 oligomers and uses thereof
CN113607941A (en) * 2020-10-22 2021-11-05 广州中医药大学顺德医院(佛山市顺德区中医院) Novel coronavirus pneumonia severe illness distinguishes and curative effect evaluation system
WO2022099260A1 (en) * 2020-11-05 2022-05-12 Vanderbilt University Compositions and methods for targeting the interaction of host myo5b+d and coronavirus m proteins
CN114773458A (en) * 2022-04-19 2022-07-22 军事科学院军事医学研究院军事兽医研究所 Polyclonal antibody of porcine epidemic diarrhea virus Nsp15 protein and preparation method thereof
CN117388500A (en) * 2023-08-03 2024-01-12 暨南大学 Application of TRPV4 as drug target in coronavirus infection anti-inflammatory drug
CN117388500B (en) * 2023-08-03 2024-06-04 暨南大学 TRPV4 as a drug target in anti-inflammatory drugs for coronavirus infection

Also Published As

Publication number Publication date
WO2006076007A3 (en) 2007-04-05

Similar Documents

Publication Publication Date Title
Chen et al. Identification of two auto-cleavage products of nonstructural protein 1 (nsp1) in porcine reproductive and respiratory syndrome virus infected cells: nsp1 function as interferon antagonist
US7776340B2 (en) Canine respiratory coronavirus (CRCV) spike protein, polymerase and hemagglutinin/esterase
CN103751774B (en) The recombinant cell lines of stably express CSFV E 2 protein and in the application of preparing in subunit vaccine for swine fever and diagnostic reagent
US8772022B2 (en) Hepatitis C virus expressing reporter tagged NS5A protein
US8569472B2 (en) Efficient cell culture system for hepatitis C virus genotype 6A
US8663653B2 (en) Efficient cell culture system for hepatitis C virus genotype 2B
WO2006076007A2 (en) Methods of detecting coronavirus infections
US8506969B2 (en) Efficient cell culture system for hepatitis C virus genotype 7a
EP3131918B1 (en) Development of methods for production of a whole hcv vaccine candidate stock
Keep et al. Porcine respiratory coronavirus as a model for acute respiratory coronavirus disease
US20170240950A1 (en) Infectious Hepatitis C Viruses of Genotype 3A and 4A and Uses Thereof
US9993544B2 (en) Recombinant classical swine fever virus (CSFV) comprising substitution in the TAV epitope of the E2 protein
KR20200014269A (en) Coronaviruses, vaccines and methods for preventing the disease comprising the same
CN101835896A (en) Production and use of epitope-tagged hepatitis c virus particle
Li et al. Infection of common marmosets with hepatitis C virus/GB virus‐B chimeras
CN113677792A (en) CSFV subunit vaccine
WO2008141438A1 (en) Gabaergic modulators for treating airway conditions
CA2125701A1 (en) Hepatitis e virus vaccine and method
US9388389B2 (en) JFH-1 based HCV cell culture systems for NS5A of genotypes 1-7
KR20070105965A (en) Porcine Genital Respiratory Syndrome Isolates and Methods of Use
Lv et al. Heme oxygenase‐1 alleviates allergic airway inflammation by suppressing NF‐κB‐mediated pyroptosis of bronchial epithelial cells
US20150150962A1 (en) Chicken Astrovirus Responsible for Runting Stunting Syndrome
WO2000014263A9 (en) Recombinant hepatitis a virus (hav), hav variants, hav-based vaccines and methods of producing them
WO2007101103A2 (en) Compositions and assays for inhibiting hcv infection
CN117838847A (en) Application of live attenuated Japanese encephalitis virus vaccine strain SA14-14-2 and its NS2B protein in preventing Zika virus infection

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase