WO2006073839A2 - Acid fungal proteases - Google Patents
Acid fungal proteases Download PDFInfo
- Publication number
- WO2006073839A2 WO2006073839A2 PCT/US2005/046435 US2005046435W WO2006073839A2 WO 2006073839 A2 WO2006073839 A2 WO 2006073839A2 US 2005046435 W US2005046435 W US 2005046435W WO 2006073839 A2 WO2006073839 A2 WO 2006073839A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protease
- seq
- nsp24
- composition
- isolated
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L13/00—Meat products; Meat meal; Preparation or treatment thereof
- A23L13/40—Meat products; Meat meal; Preparation or treatment thereof containing additives
- A23L13/42—Additives other than enzymes or microorganisms in meat products or meat meals
- A23L13/424—Addition of non-meat animal protein material, e.g. blood, egg, dairy products, fish; Proteins from microorganisms, yeasts or fungi
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the invention relates to polynucleotides encoding acid proteases, designated NSB24 family proteases, NSP25 family proteases and PepA proteases; the NSP24 and NSP25 family protease polypeptides; compositions including said proteases and uses thereof.
- Proteases are enzymes capable of cleaving peptide bonds.
- Acid proteases e.g., proteases having an acidic pH optimum
- microbial acid proteases are produced -by bacterial strains such as strains of Bacillus sp. (JP 01240184) and fungal strains, such as strains of Rhizopus sp. (EP 72978), Schytalidi ⁇ m sp. (JP 48091273), Sulpholobus sp., Thermoplasma sp. (WO/90 10072) and Aspergillus sp. (JP 50121486 and €P 82 395).
- Berka et al. disclose a gene encoding the aspartic proteinase aspergillopepsin A from Aspergillus awamori.
- the cloning of a gene encoding the -aspartic proteinase aspergillopepsin O from Aspergillus oryzae is described by Berka e ⁇ al. (Gene (1993) 125:195-198).
- the cloning of a gene encoding the acid protease (PepA) from Aspergillus oryzae is disclosed by Gomi et al. (Biosci. Biotech. Biochem. (1993) 57(7):1O95- 1100).
- proteases and particualrly acid proteases are widely used in industrial applications, e.g., in the preparation of food and feed, in the leather industry (-e.g., to dehair hides), in the production of protein hydrolysates, and in the production of alcohols, sudi as etbanol production, wine production and brewing. Yet, there is a continuing need for proteases for many different applications, especially in the food and feed industry.
- novel protease genes which include a novel nsp24 gene that encodes an NSP24 protease (SEQ ID NO: 2 or SEQ ID NO: 10); a novel nsp25 gene that encodes an NSP25 protease (SEQ ID NO: 9); and a novel pepA variant gene that encodes a novel PepA protease (SEQ ID NO: 7).
- the invention features a recombinant or substantially pure preparation of an NSP24 protease, an NSP25 protease or a PepA protease and variants thereof.
- the protease is an NSP24 family protease polypeptide which includes an amino acid sequence essentially the same as an amino acid sequence in SEQ ID NO: 2 or SEQ ID NO: 10 (illustrated in Figure 6, infra).
- an NSP24 family protease polypeptide is encoded by the nucleic acid in SEQ ID NO: 8 (illustrated in Figure 5, infra), or by a nucleic acid having essentially the same nucleic acid sequence as with the nucleic acid from 'SEQ ID NO: 8.
- the NSP24 family protease polypeptide differs in amino acid sequence at up to 10 residues, from a sequence in SEQ ID NO: 10. In some embodiments, the NSP24 family protease polypeptide differs in amino acid sequence at up to 10 % of the residues from a sequence in SEQ ID NO: 10. In some embodiments, the differences are such that the NSP24 family protease polypeptide exhibits an NSP24 protease biological activity, e.g., the NSP24 protease retains a biological activity of a naturally occurring NSP24 protease.
- the NSP24 family protease polypeptide includes a NSP24 protease sequence described herein as well as other N-terminal and/or C-terminal amino acid sequences.
- the NSP24 family protease polypeptide includes all or a fragment of an amino acid sequence from SEQ ID NO: 2 or SEQ ID NO: 10, fused, in reading frame, to additional amino acid residues, preferably to residues encoded by genomic DNA 5' to the genomic DNA which encodes a sequence from SEQ ID NO: 1 or SEQ ID NO: 8.
- the NSP24 family protease is a recombinant fusion protein having a first NSP24 family protease portion and a second polypeptide portion, e.g., a second polypeptide portion having an amino acid sequence unrelated to an NSP24 family protease.
- the second polypeptide portion can be a DNA binding domain or a polymerase activating domain.
- Polypeptides of the invention include those which arise as a result of the existence of multiple genes, alternative transcription events, alternative RNA splicing events, and alternative translational and postranslational events.
- the polypeptide can be expressed in systems, e.g., cultured cells, which result in substantially the same postranslational modifications present when expressed NSP24 protease is expressed in a native cell, or in systems which result in the omission of postranslational modifications present when expressed in a native cell.
- the invention relates to an enzyme composition, which includes a NSP24 family protease and one or more additional components, e.g., a carrier, diluent, or solvent.
- the additional component can be one, which renders the composition useful for in vitro, in vivo, pharmaceutical, or veterinary use.
- the enzyme composition will include additional enzymes.
- the additional enzyme will be a glucoamylase, an alpha amylase or combinations thereof.
- the invention provides a substantially pure nucleic acid having or comprising a nucleotide sequence which encodes an NSP24 family protease polypeptide comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10.
- the NSP24 family protease nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence, operably linked to the NSP24 family protease -gene sequence, e.g., to render the NSP24 family protease gene sequence suitable for use as an expression vector.
- a transcriptional regulatory sequence e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence
- operably linked to the NSP24 family protease -gene sequence e.g., to render the NSP24 family protease gene sequence suitable for use as an expression vector.
- the nucleic acid which encodes an NSP24 protease -polypeptide of the invention hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides from SEQ ID NO: 8, more preferably to at least 20 consecutive nucleotides from SEQ ID NO: 8.
- NSP24 family protease e.g. NSP24
- the NSP24 family protease may be used to enzymatically breakdown agricultural wastes for production of alcohol fuels and other important industrial chemicals, for production of animal or human foodstuffs, or as a component in a detergent composition, for leather processing and protein based fiber processing (such as wool or silk), for biomass applications, for personal care applications (skin, hair, oral care, etc.) for pharmaceutical and health care applications and for production of novel peptides for use in applications above.
- NSP24 family protease may be used to enzymatically breakdown agricultural wastes for production of alcohol fuels and other important industrial chemicals, for production of animal or human foodstuffs, or as a component in a detergent composition, for leather processing and protein based fiber processing (such as wool or silk), for biomass applications, for personal care applications (skin, hair, oral care, etc.) for pharmaceutical and health care applications and for production of novel peptides for use in applications above.
- the invention relates to polynucleotides encoding a pepA variant protease, L388M having SEQ ID NO: 7.
- the polynucleotide has the sequence of SEQ ID NO: 5.
- the invention relates to NSP25 family proteases.
- the NSP25 family protease will have at least 85% sequence identity to SEQ ID NO: 9.
- the NSP25 family protease will be encoded by a polynucleotide having at least 85% sequence identity to SEQ ID NO: 4.
- the NSP25 family protease will be a biologically active fragment of a parent NSP25 family protease.
- FIG. 1 illustrates the sugar degradation (DP+3) % w/v using 1) NSP24, 2) a commercially available protease, GC106 and 3) DISTILLASE, which does not include a protease (see, Example 5).
- FIG. 2 depicts sugar degradation (DP2) % w/v using NSP24, GC106 and
- FIG. 3 illustrates glucose formation (DP1) using NSP24, ⁇ 3C106 and DISTILLASE.
- the amount of glucose remaining at the end of 40 hours is less than 0.2% w/v and less than 0.1% w/v at the end of 48 hours for both the NSP24 and GC106 -samples.
- the amount of glucose measured as % w/v at the end of 48 hours is slightly -greater than 1.0% w/v for DISTILLASE.
- FIG. 4 illustrates ethanol production (% v/v) for NSP24, GC106 and DISTILLASE.
- the rate and amount of ethanol produced by use of the two protease samples is essentially the same.
- DISTILLASE produced less ethanol and at a slower rate
- FIGS. 5A-D illustrate the nucleotide sequence (SEQ ID NO: 1) of a pTrex3g_NSP24 cDNA clone obtained from Trichoderma reesei.
- the NSP24 gene sequence is underlined, and the putative gene intron sequence is identified in bolded format.
- the nucleic acid sequence which encodes the protease is represented by the sequence of SEQ ID NO: 8.
- FIGS. 6A - B illustrates the predicted amino acid sequence (407 amino acids) (SEQ ID NO: 2) for NSP24 from Trichoderma reesei (FIG. 6A) and the NSP24 nucleotide sequence with the putative intron identified in bolded letters (Fig. 6B) (SEQ ID NO: 8).
- the signal peptide is in bold
- the prepro sequence is in bold and underlined
- the mature NSP24 protein starts with KYGAPIS... and is represented by SEQ ID NO: 10.
- FIG. 7 illustrates the pTrex3g_NSP24 vector and locations of restriction enzyme cleavage sites along the nucleotide sequence of FIO. 5.
- FIG. 8 illustrates the nucleic acid sequence (SEQ ID NO: 3) for a pepA protease. The putative introns are in bold.
- FIG. 9A-B illustrate the nucleic acid sequence (SEQ IO NO: 4) -encoding a novel NSP25 protease (399 amino acids) (SEQ ID NO: 9). The signal sequence is in bold.
- FIG. 10 illustrates the nucleic acid sequence (SEQ ID NO: 5) for a novel pepA protease variant (L388M) (SEQ ID NO: 7), wherein the underlined 'A' in the figure, is changed from a 'C in pepA, in Figure 8.
- FIG. 11 illustrates the expression vector, pSL899_pepA.
- FIGS. 12A-E illustrate the nucleotide sequence (SEQ ID NO: 6) of the expression vector pSL899_pepA.
- the Xho I cleavage site is indicated by ⁇ and the Xba I site is indicated by * .
- the coding sequence for pepA is shown in bold. The intr ⁇ ns are underlined.
- FIG. 13 illustrates the amino acid sequence of the PepA variant, L388M (SEQ ID NO: 7) for the protein encoded by SEQ ID NO: 5.
- Protease means a protein or polypeptide domain of a protein or polypeptide derived from a microorganism, e.g. a fungus, bacterium, or from a plant er animal, and that has the ability to catalyze cleavage of peptide -bonds at one or more of various positions of a protein backbone (e.g. E.C. 3.4).
- an “acid protease” refers to a protease having the ability to hydrolyze proteins under acid conditions.
- NSP24 family protease means an enzyme having protease activity in its native or wild type form, (e.g. the protein of FIG. 6), protease proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98% and at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10; a derivative of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 10, and biologically active fragments of a protease sequence.
- derivative means a protein which is derived from a precursor or parent protein (e.g., the native protein) by addition of one or more amino acids to either or both the C- and N-terminal end, substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites in the amino acid sequence.
- a "native sequence NSP24" or “wildtype NSP24 sequence” includes a polypeptide having the same amino acid sequence as an NSP24 family protease derived from nature.
- a “biologically active fragment” (e.g., a biologically active fragment of the NSP24 family protease having the sequence of SEQ ID NO: 10) means an NSP24 family protease or an NSP25 family protease, having protease activity but comprising less than the full sequence of a NSP24 family protease or NSP25 family protease precursor or parent protein.
- isolated or “purified” refers to a protease that is altered from its natural state by virtue of separating the protease from one or more or all of the naturally occurring constituents with which it is associated in nature.
- PepA refers to an acid protease having at least 95% sequence identity to SEQ ID NO: 7.
- L388M refers to a variant PepA having the sequence of SEQ ID NO: 7.
- NSP25 family protease means a protease enzyme having at least
- Unrelated to an NSP24 family protease means having an amino acid sequence with less than 30% homology, less than 20% homology, or less than 10% homology with the NSP24 protease of SEQ ID NO: 10.
- the terms "peptides”, “proteins”, and “polypeptides” are used interchangeably herein.
- percent (%) sequence identity with respect to the amino acid or nucleotides sequences identified is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in a sequence of interest (e.g. a NSP24 family protease sequence), after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
- alpha-amylase e.g., E.G. class 3.2.1.1
- alpha-1 ,4-glucosidic linkages These enzymes have also been described as those effecting the exo or endohydrolysis of 1 ,4- ⁇ -D-glucosidic linkages in polysaccharides containing 1 ,4- ⁇ -linked D-glucose units.
- Another term used to describe these enzymes is "glycogenase”.
- Exemplary enzymes include alpha-1 , 4-glucan 4- glucanohydrase glucanohydrolase.
- glucoamylase refers to the amyloglucosidase class of enzymes (e.g., EC.3.2.1.3, glucoamylase, 1 , 4-alpha-D-glucan glucohydrolase). These are exo-acting enzymes, which release glucosyl residues from the non-reducing ends of amylose and amylopectin molecules. The enzyme also hydrolyzes alpha-1 , 6 and alpha -1 ,3 linkages although at much slower rate than alpha-1 , 4 linkages.
- promoter means a regulatory sequence involved in binding RNA polymerase to initiate transcription of a gene.
- heterologous promoter is a promoter which is not naturally associated with a gene or a purified nucleic acid.
- a “purified preparation” or a “substantially pure preparation” of a polypeptide, as used herein, means a polypeptide that has been separated from cells, other proteins, lipids or nucleic acids with which it naturally occurs.
- a “purified preparation of cells”, as used herein, refers to, in the case of plant or animal cells, an in vitro preparation of cells and not an entire intact plant or animal. In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells.
- a “substantially pure nucleic acid”, e.g., a substantially pure DNA, is a nucleic acid which is one or both of: not immediately contiguous with either one or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (e.g., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived.
- the term includes, for example, a recombinant DNA which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of -other DNA sequences.
- Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional NSP24 protease sequence.
- homologous refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position.
- the percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10, of the positions in two sequences are matched or homologous then the two sequences are 60% homologous.
- the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
- vector refers to a polynucleotide sequence designed to introduce nucleic acids into one or more cell types.
- Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.
- expression vector means a DNA construct including a DNA sequence which is operably linked to a suitable control sequence capable of affecting the expression of the DNA in a suitable host.
- expression means the process by which a polypeptide is produced based on the nucleic acid sequence of a gene.
- operably linked means that a regulatory region, such as a promoter, terminator, secretion signal or enhancer region is attached to or linked to a structural gene and controls the expression of that gene.
- a substance e.g. a polynucleotide or protein
- derived from a microorganism means that the substance is native to the microorganism.
- microorganism refers to a bacterium, a fungus, a virus, a protozoan, and other microbes or microscopic organisms.
- host strain or "host cell” means a suitable host for an expression vector including DNA according to the present invention and includes progeny of said cells.
- filamentous fungi refers to all filamentous forms of the subdivision
- Eumycotina See, Alexopoulos, C. J. (1962), INTRODUCTORY MYCOLOGY, Wiley, New York and AINSWORTH AND BlSBY DICTIONARY OF THE FUNGI, 9 th Ed. (2001) Kirk et al., EdS., CAB International University Press, Cambridge UK).
- These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides.
- the filamentous fungi of the present invention are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic.
- Trichoderma or “Trichoderma sp.” refer to any fungal genus previously or currently classified as Trichoderma.
- quadrete or “quad-deleted” host cells, refers to both the cells and protoplasts created from the cells of a Trichoderma host strain that lacks at least two genes coding for functional endoglucanases and at least two genes coding for functional cellobiohydrolases.
- culturing refers to growing a population of microbial cells under suitable conditions in a liquid or solid medium.
- culturing refers to fermentative bioconversion of a starch substrate, such as a substrate comprising granular starch, to an end-product (typically in a vessel or reactor).
- Fermentation is the enzymatic and anaerobic breakdown of organic substances by microorganisms to produce simpler organic compounds. While fermentation occurs under anaerobic conditions it is not intended that the term be solely limited to strict anaerobic conditions, as fermentation also occurs in the presence of oxygen.
- contacting refers to the placing of the respective enzyme(s) in sufficiently close proximity to the respective substrate to enable the enzyme(s) to convert the substrate to the end-product.
- Those skilled in the art will recognize that mixing solutions of the enzyme with ' the respective substrates can effect contacting.
- the term "introduced” in the context of inserting a nucleic acid -sequence into a cell means “transfection", or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be incorporated into the genome of the cell ⁇ e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
- the terms “transformed”, “stably transformed” and “transgenic” used in reference to a cell means the cell has a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained through multiple generations.
- heterologous with reference to a polypeptide or polynucleotide means a polypeptide or polynucleotide that does not naturally occur in a host cell.
- overexpression means the process of expressing a polypeptide in a host cell wherein a polynucleotide has been introduced into the host cell.
- one aspect of the invention features a "substantially pure” (or recombinant) nucleic acid that includes a nucleotide sequence encoding a NSP24 family protease or a NSP25 family protease, and/or equivalents of such nucleic acids.
- Equivalent refers to nucleotide sequences encoding functionally equivalent polypeptides.
- Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants.
- due to the degeneracy of the genetic code equivalent nucleotide sequences include sequences that differ from the nucleotide sequence of SEQ ID NO: 8, which encodes the NSP24 protease shown in SEQ ID NO: 2.
- sacharification refers to enzymatic conversion of starch to glucose.
- starch refers to any material comprised of the complex polysaccharide carbohydrates of plants comprised of amylase and amylopectin with the formula (C 6 H 10 O 5 ) X , wherein X can be any number.
- granular starch refers to uncooked (raw) starch (e.g. starch that has not been subject to gelatinization).
- gelatinization means solubilization of a starch molecule by cooking to form a viscous suspension.
- reaction refers to the stage in starch conversion in which gelatinized starch is hydrolyzed to give low molecular weight soluble dextrins.
- soluble starch hydrolyzate refers to soluble products resulting from starch hydrolysis, which may comprise mono-, di-, and oligosaccharides ⁇ -e.g. glucose, maltose and higher sugars).
- polysaccharide means a monomeric unit of a polymer such as starch wherein the degree of polymerization (DP) is 1 (e.g., glucose, mannose, fructose and galactose).
- disaccharide means a compound that comprises two covalently linked monosaccharide units (DP2) (e.g., sucrose, lactose and maltose).
- DP2 covalently linked monosaccharide units
- DP3+ means polymers with a degree of polymerization greater than 3.
- the invention relates to NSP24 family proteases, such as an acid protease and also an acid fungal protease, having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98% and at least 99% sequence identity to the protease of SEQ ID NO: 2 or the protease of SEQ ID NO: 10 (Fig. 6).
- the NSP24 family protease is designated NSP24 comprising the sequence of SEQ ID NO: 10 (the mature protein sequence) or also the preprotein sequence of SEQ ID NO: 2.
- the invention relates to biologically active fragments Of an NSP24 family protease.
- biologically active fragments include proteases having at least 250 amino acid residues, at least 300 amino acid residues, at least 350 amino acid residues, at least 375 amino acid residues, and also at least 400 amino acid residues.
- biologically active fragments include at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, at least 99% of a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98% and at least 99% sequence identity with the protein sequence in Figure 6 (SEQ ID NO: 2 or SEQ ID NO: 10).
- a biologically active fragment will comprise at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% and at least 98% of a polypeptide sequence having at least 95% sequence identity to the parent NSP24 protease having SEQ ID NO: 2 or SEQ ID NO: 10. In some embodiments, a biologically active fragment will comprise at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% and at least 98% of a polypeptide sequence having at least 99% sequence identity to the parent NSP24 protease having SEQ ID NO: 2 or SEQ ID NO: 10.
- biologically active fragments are fragments that exist in vivo, e.g., fragments which arise from post transcriptional processing or which arise from translation of alternatively spliced RNA's. Fragments include those expressed in native or endogenous cells, e.g., as a result of post-translational processing, e.g., as the result of the removal of an amino-terminal signal sequence, as well as those made in expression systems, e.g., in CHO cells. Some preferred fragments are fragments, e.g., active fragments, which are generated by proteolytic cleavage or alternative splicing events.
- a useful NSP24 family protease fragment or NSP24 family protease analog is one which exhibits a biological activity in any biological assay for NSP24 protease activity.
- a biologically active fragment will comprise at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, and at least 100% of the protease activity of the NSP24 having SEQ ID NO: 2 or SEQ ID NO: 10.
- a fragment or analog possesses at least 40% or at least 90% of the protease activity of NSP24 protease (SEQ ID NO: 2 or SEQ ID NO: 10), in any in vivo or in vitro NSP24 protease assay.
- NSP24 protease SEQ ID NO: 2 or SEQ ID NO: 10
- Fragments of an NSP24 family protease or an NSP25 family protease can be generated by methods known to those skilled in the art.
- the ability of a candidate fragment to exhibit a biological activity of a protease can be assessed by methods known to those skilled in the art as described herein.
- NSP24 family proteases and NSP25 family protease containing residues that are not required for biological activity of the peptide or that result from alternative mRNA splicing or alternative protein processing events are also included.
- the protease encompassed by the invention is a derivative of a protease having SSEQ ID NO: 2 or SEQ ID NO: 10.
- a derivative may have at least 80%, 85%, 90%, 93%, 95%, 97%, 98% and 99% sequence identity to SEQ ID NO: 10.
- the invention also includes protease analogs.
- the analogs are those with modifications which increase peptide stability; such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the peptide sequence.
- analogs that include residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., b or amino acids; and cyclic analogs.
- Analogs can differ from naturally occurring proteases, such as an NSP24 or NSP25 protein, in amino acid sequence or in ways that do not involve sequence, or both.
- Non-sequence modifications include in vivo or in vitro chemical derivatization of the proteases encompassed by the invention.
- Non-sequence modifications include changes in acetylation, methylation, phosphorylation, carboxylation, or glycosylation.
- the invention includes NSP25 family proteases.
- NSP25 family proteases are acid proteases having at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, and at least 99% amino acid sequence identity to the mature protein sequence of SEQ ID NO: 9 (Fig. 9) or biologically active fragments thereof.
- One specific NSP25 family protease is the protease designated NSP25 having SEQ ID NO: 9.
- a NSP25 family protease will be a biologically active fragment of a protease comprising at least 75%, at least 80%, at least 85%, at least 90% and at least 95% of a sequence having at least 90% sequence identity to SEQ ID NO: 9.
- an NSP25 family protease will be a biologically active fragment of a protease comprising at least 75%, at least 80%, at least 85%, at least 90% and at least 95% of a sequence having at least 95% sequence identity to SEQ ID NO: 9.
- an optimum pH for protease activity is in the range of pH 3.0 to 5.5. In some embodiments, the optimum pH range for protease activity is between pH 3.0 and 5.0 and in other embodiments the optimum pH range for protease activity is between pH 3.0 and 4.5.
- a protease according to the invention, such as an NSP24 family protease or an NSP25 family protease may include an amino acid substitution such as a "conservative amino acid substitution" using L-amino acids, wherein one amino acid is replaced by another biologically similar amino acid.
- Conservative amino acid substitutions are those that preserve the general charge, hydrophobicity /hydrophilicity, and/or steric bulk of the amino acid being substituted. Examples of conservative substitutions are those between the following groups: Gly/Ala, Val/lle/Leu, Lys/Arg, Asn/Gln, Glu/Asp, Ser/Cys/Thr, and Phe/Trp/Tyr.
- a derivative may, for example, differ by as few as 1 to 10 amino acid residues, such as 6 -10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
- Table 1 illustrates exemplary amino acid substitutions that are recognized in the art.
- substitution may be by one or more non-conservative amino acid substitutions, deletions, or insertions that do not abolish the protease biological activity.
- the proteases of the invention are native sequences. Such a native sequence can be isolated from nature or can be produced by recombinant or synthetic means.
- the term "native sequence” specifically encompasses naturally-occurring truncated or secreted forms of an NSP24 or NSP25 family protease (e.g., biologically active fragments), and naturally-occurring variant forms (e.g., alternatively spliced forms).
- an acid protease of the invention is a PepA protease having at least 97%, at least 98%, and at least 99% sequence identity to SEQ ID NO: 7.
- the protease has the sequence of SEQ ID NO: 7 and is designated "L388M.
- the protease is encoded by a nucleotide sequence having the sequence of SEQ ID NO: 5 or SEQ JD NO: 3.
- the invention also relates to polynucleotide sequences encoding proteases encompassed by the invention.
- Some of these polynucleotides include: a) polynucleotides encoding an NSP24 family protease having at least 80% at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, and at least 99% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 10; b) polynucleotides encoding the sequence of SEQ ID NO: 2; c) a polynucleotide having the sequence of SEQ ID NO: 8; d) polynucleotides encoding a biologically active fragment of an NSP24 family protease; e) polynucleotides which have at least 80%, at least 85%, at least 90%, at least
- polynucleotides which hybridizes to a nucleic acid probe corresponding to the DNA sequence of SEQ ID NO: 4, SEQ ID NO: 8 or a fragment of SEQ ID NO: 4 or SEQ ID NO: 8, said fragment having at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or 150 consecutive nucleotides; g) polynucleotides encoding a NSP25 family protease having at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, and at least 99% sequence identity to SEQ ID NO: 4; h) polynucleotides encoding the protease of SEQ ID NO: 9; i) a polynucleotide having the sequence of SEQ ID NO: 4; j) polynucleotides encoding a biologically active
- the present invention encompasses polynucleotides which encode the same polypeptide.
- a nucleic acid is hybridizable to another nucleic acid sequence when a single stranded form of the nucleic acid can anneal to the other nucleic acid under appropriate conditions of temperature and solution ionic strength.
- Hybridization and washing conditions are well known in the art for hydridization under low, medium, high and very high stringency conditions (See, e.g., Sambrook (1989) supra, particularly chapters 9 and 11).
- hybridization involves a nucleotide probe and a homologous DNA sequence that from stable double stranded hybrids by extensive base-pairing of complementary polynucleotides (Also see, Chapter 8, Gene Cloning, An Introduction, T.A. Brown (1995) Chapman and Hall
- the filter with the probe and homologous sequence may be washed in 2x sodium chloride/sodium citrate (SSC), 0.5% SDS at about 6O 0 C (medium stringency), 65 0 C (medium/high stringency), 70 0 C (high stringency) and about 75°C (very high stringency) (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, 6.3.1 - 6.3.6, hereby incorporated by reference);
- SSC sodium chloride/sodium citrate
- allelic variations include allelic variations; natural mutants; induced mutants; proteins encoded by DNA that hybridizes under high or low stringency conditions to a nucleic acid which encodes a polypeptide of SEQ ID NO: 2, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 and polypeptides specifically bound by antisera to an NSP24 protease having SEQ ID NO: 2 or SEQ ID NO: 10, especially by antisera to an active site or binding domain of NSP24 protease.
- a nucleic acid which encodes a NSP24 family protease of the invention hybridizes under high stringency conditions to a nucleic acid corresponding to at least 12, 15 or 20 consecutive nucleotides from SEQ ID NO: 8.
- Nucleic acids and polypeptides of the invention include those that differ from the sequences disclosed herein by virtue of sequencing errors in the disclosed sequences.
- Homology of DNA sequences is determined by the degree of identity between two DNA sequences. Homology or percent identity may be determined for polypeptide sequences or nucleotides sequences using computer programs. Methods for performing sequence alignment and determining sequence identity are known to the skilled artisan, may be performed without undue experimentation, and calculations of identity values may be obtained with definiteness. See, for example, Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-lnterscience, New York); and the ALIGN program (Dayhoff (1978) in Atlas of Protein Sequence and Structure 5:Suppl. 3 (National Biomedical Research Foundation, Washington, D.C.).
- a number of algorithms are available for aligning sequences and determining sequence identity and include, for example, the homology alignment algorithm of Needleman et al. (1970) J. MoI. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the search for similarity method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. MoI. Biol. 70:173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. MoI. Biol. 215:403-410).
- Computerized programs using these algorithms are also available, and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wis., USA; and CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif. Those skilled in the art can determine appropriate parameters for measuring alignment, including algorithms needed to achieve maximal alignment over the length of the sequences being compared.
- GCG Genetics Computing Group
- sequence identity is determined using the default parameters determined by the program. Specifically, sequence identity can be determined by the Smith-Waterman homology search algorithm (Meth. MoI. Biol. 70:173-187 (1997)) as implemented in MSPRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1.
- paired amino acid comparisons can be carried out using the GAP -program of the GCG sequence analysis software package of Genetics Computer Group, Inc., Madison, Wis., employing the blosum62 amino acid substitution matrix, with a gap weight of 12 and a length weight of 2.
- the contiguous segment of the variant amino acid sequence may have additional amino acid residues or deleted amino acid residues with respect to the reference amino acid sequence.
- the contiguous segment used for comparison to the reference amino acid sequence will include at least 20 contiguous amino acid residues, and may be 30, 40, 50, or more amino acid residues. Corrections for increased sequence identity associated with inclusion of gaps in the derivative's amino acid sequence can be made by assigning gap penalties.
- the proteases encompassed by the invention is derived from a bacterium or a fungus, such as a filamentous fungus.
- a bacterium or a fungus such as a filamentous fungus.
- filamentous fungi include Aspergillus spp. and Trichoderma spp.
- Trichoderma spp. is T. reesei.
- the proteases and/or DNA encoding the proteases according to the instant invention may be derived from a fungus, such as, Absidia spp.; Acremonium spp.; Aga ⁇ cus spp.; Anaeromyces spp.; Aspergillus spp., including A. aculeatus, A. awamori, A. flavus, A. foetidus, A. fumaricus, A. fumigatus, A. nidulans, A. niger, A. oryzae, A. terreus and A.
- Neocallimastix spp. spp.
- Orpinomyces spp. Penicillium spp; Phanerochaete spp.; Phlebia spp.; Piromyces spp.; Rhizopus spp.; Schizophyllum spp.; Trametes spp.; Trichoderma spp., including T. reesei, T. reesei (longibrachiatum) and T. viride; and Zygorhynchus spp.
- this invention provides for host cells transformed with DNA constructs and vector as described herein.
- a polynucleotide encoding a protease encompassed by the invention e.g. a NSP24 family protease having at least 95% sequence identity to SEQ ID NO: 2
- a polynucleotide encoding a protease encompassed by the invention e.g. a NSP24 family protease having at least 95% sequence identity to SEQ ID NO: 2
- the polynucleotide codes for an endogenous protease which is overexpressed in the host cell.
- the invention provides for the expression of heterologous protease genes or overexpression of protease genes under control of gene promoters functional in host cells such as bacterial and fungal host cells.
- filamentous fungal host cells include Trichoderma spp. (e.g. T. viride and T. reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum), Penicillium spp., Humicola spp. (e.g. H. insolens and H. grisea), Aspergillus spp. (e.g., A. niger, A. nidulans, A. orzyae, and A. awamori), Fusarium spp. (F. graminum), Neurospora spp., Hypocrea spp.
- Trichoderma spp. e.g. T. viride and T. reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum
- Penicillium spp. e.g. H. insolens and H. grisea
- Further host cells may include Bacillus spp (e.g. B. subtilis, B. licheniformis, B. lent ⁇ s, B. stearothremophilus and B. brevis) and Str-eptomyces spp. (e.g., S coelicolor and S. lividans (TK23 and TK21)).
- Bacillus spp e.g. B. subtilis, B. licheniformis, B. lent ⁇ s, B. stearothremophilus and B. brevis
- Str-eptomyces spp. e.g., S coelicolor and S. lividans (TK23 and TK21)
- Heterologous genes comprising gene promoter sequences for example of filamentous fungi are typically cloned into intermediate vectors before transformation into host cells, such as Thchoderma reesei cells for replication and/or expression.
- These intermediate vectors are typically prokaryotic vectors, e.g., plasmids, or shuttle vectors.
- the heterologous gene is preferably positioned about the same distance from the promoter as is in the naturally occurring gene. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
- a natural promoter can be modified by replacement, substitution, addition or elimination of one or more nucleotides without changing its function.
- the practice of the invention encompasses and is not constrained by such alterations to the promoter.
- the expression vector/construct typically contains a transcription unit or expression cassette that contains all the additional elements r.equired for the expression of the heterologous sequence.
- a typical expression cassette thus -contains a promoter operably linked to the heterologous nucleic acid sequence and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination.
- Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.
- exemplary promoters are the Thchoderma r ⁇ ese/cbh1 ,.cbh2, eg1 , eg2, eg3, eg5, xln1 and xln2 promoters. Also promoters from A. awamori and A. niger glucoamylase genes (glaA) (Nunberg et al., (1984) MoI. Cell Biol. 4:2306 - 2315) and the promoter from A. nidulans acetamidase find use in the vectors.
- glaA A. awamori and A. niger glucoamylase genes
- a preferred promoter for vectors used in Bacillus subtilis is the AprE promoter; a preferred promoter used in E. coli is the Lac promoter, a preferred promoter used in Saccharomyces cerevisiae is PGK1 , a preferred promoter used in Aspergillus niger is glaA, and a preferred promoter for Trichoderma reesei is cbhl.
- the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination.
- the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
- terminators include: the terminator from Aspergillus nid ⁇ lans trpC gene (Yelton, M. et al. (1984) PNAS USA 81 :1470-1474, Mullaney, E.J. et al. (1985) MGG 199:37-45), the Aspergillus awamori or Aspergillus niger glucoamylase genes (Nunberg, J. H. et al. (1984) MoI. Cell Biol. 4:2306, Boel, E. et al.(1984) EMBO J. 3:1581-1585), the Aspergillus oryzae TAKA amylase gene, and the Mucor miehei carboxyl protease gene (EPO Publication No. 0 215 594).
- the particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include bacteriophages ⁇ and M13, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c- myc.
- Suitable expression and/or integration vectors are provided in Sambrook et al., (1989) supra, Bennett and Lasure (Eds.) More Gene Manipulations in Fungi, (1991) Academic Press pp. 70 - 76 and pp. 396 - 428 and articles cited therein; USP 5,874,276 and Fungal Genetic Stock Center Catalogue of Strains, (FGSC, www.fgsc.net.).
- Useful vectors may be obtained from Promega and Invitrogen. Some specific useful vectors include pBR322, pUC18, pUCIOO, pDONTM201 , pENTRTM, pGEN®3Z and pG'EN®4Z.
- the invention is intended to include other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.
- host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
- Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences such as various known derivatives of SV40 and known bacterial plasmids, e.g., plasmids from E.
- an expression vector includes a selectable marker.
- selectable markers include ones which confer antimicrobial resistance.
- Nutritional markers also find use in the present invention including those markers known in the art as amdS, argB and pyr4. Markers useful for the transformation of Trichoderma are known in the art (see, e.g., Finkelstein, chapter 6, in Biotechnology of Filamentous Fungi, Finkelstein et al., EDS Butterworth-Heinemann, Boston MA (1992) and Kinghorn et al.,
- the expression vectors will also include a replicon, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of heterologous sequences.
- antibiotic resistance gene chosen is not critical, any of the many resistance genes known in the art are suitable.
- the prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in Trichoderma reesei.
- the methods of transformation of the present invention may result in the stable integration of all or part of the transformation vector into the genome of a host cell, such as a filamentous fungal host cell.
- transformation resulting in the maintenance of a self-replicating extra-chromosomal transformation vector is also contemplated.
- any of the well-known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate - transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). Also of use is the Agrobacterium- mediated transfection method described in U.S. Patent No. 6,255,115. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the gene.
- the invention concerns a method for producing a protease encompassed by the invention (e.g. an NSP 24 family protease) which comprises introducing into a host cell a polynucleotide comprising a promoter operably linked to a nucleic acid encoding a protease, such as a NSP family protease, culturing the host cell under suitable culture conditions for the expression and production of the protease, and producing said protease.
- the protease is a NSP24 family protease having at least 95% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 10 or biologically active fragments thereof.
- the transfected or transformed cells are cultured under conditions favoring expression of genes under control of protease gene promoter sequences. Large batches of transformed cells can be cultured as described in Example 3, infra. Finally, product is recovered from the culture using standard techniques.
- the invention herein provides for the expression and enhanced secretion of desired polypeptides whose expression is under control of gene promoter sequences including naturally occurring protease genes, fusion DNA sequences, and various heterologous constructs.
- the invention also provides processes for expressing and secreting high levels of such desired polypeptides.
- Protein Expression Proteins of the present invention are produced by culturing cells transformed with a vector such as an expression vector containing genes whose expression is under control of gene promoter sequences.
- the present invention is particularly useful for enhancing the intracellular and/or extracellular production of proteins, such as proteases encompassed by the invention.
- the protein may be homologous or heterologous.
- Conditions appropriate for expression of said genes comprise providing to the culture an inducing feed composition of the instant invention. Optimal conditions for the production of the proteins will vary with the choice of the host cell, and with the choice of protease protein to be expressed. Such conditions will be easily ascertained by one skilled in the art through routine experimentation or optimization.
- the protease protein of interest is may be isolated or recovered and purified after expression.
- the protein of interest may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse- phase HPLC chromatography, and chromatofocusing.
- the protein of interest may be purified using a standard anti-protein of interest antibody column. Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful.
- suitable purification techniques see Scopes, Protein Purification (1982). The degree of purification necessary will vary depending on the use of the protein of interest. In some instances no purification will be necessary.
- Host cells and transformed cells can be cultured in conventional nutrient media.
- the culture media for transformed host cells may be modified as appropriate for activating promoters and selecting transformants.
- the specific culture conditions such as temperature, pH and the like, may be those that are used for the host cell selected for expression, and will be apparent to those skilled in the art.
- preferred culture conditions may be found in the scientific literature such as Sambrook, (1982) supra; Kieser, T, MJ. Bibb, MJ. Buttner, KF Chater, and D.A. Hopwood (2000) PRACTICAL STREPTOMYCES GENETICS. John lnnes Foundation, Norwich UK; Harwood.
- Stable transformants of fungal host cells such as Trichoderma cells can generally be distinguished from unstable transformants by their faster growth rate or the formation of circular colonies with a smooth rather than ragged outline on solid culture medium.
- a polypeptide encompassed by the invention such as a polypeptide having at least 80% sequence identity to SEQ ID NO: 10, produced by the transformed host cell may -be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, or if necessary, disrupting the cells and removing the supernatant from the cellular fraction and debris.
- a salt e.g., ammonium sulphate.
- the precipitated proteins are then solubilized and may be purified by a variety of chromatographic procedures, e.g., ion exchange chromatography, gel filtration chromatography, affinity chromatography, and other art- recognized procedures.
- Antibodies to the peptides and proteins can be made -by immunizing an animal, e.g., a rabbit or mouse, and recovering anti-NSP24 protease antibodies by prior art methods.
- Assays that find use in the present invention include, but are not limited to those described in WO 9934011 and USP 6,605,458.
- the present invention is directed to compositions comprising a protease of the invention as described herein.
- Some non-limiting examples of -proteases useful in compositions and applications according to the invention include for example an NSP24 family protease or a NSP25 family protease, more specifically an NSP24 family protease having at least 85% sequence identity to SEQ ID NO: 2 or biologically active fragments thereof, such as a protease having at least 90% sequence identity to the sequence of SEQ ID NO: 10.
- the enzyme composition is a single- component protease composition.
- the present invention is directed to methods of using the proteases of the invention in industrial and commercial applications. The following description of compositions and industrial applications is intended to be exemplary and non-inclusive.
- compositions comprising proteases of the invention may further include additional enzymes, such as, but not limited to, glucoamylases, alpha amylases, granular starch hydrolyzing enzymes, cellulases, lipases, xylanases, cutinases, hemicellulases, oxidases and combinations thereof.
- additional enzymes such as, but not limited to, glucoamylases, alpha amylases, granular starch hydrolyzing enzymes, cellulases, lipases, xylanases, cutinases, hemicellulases, oxidases and combinations thereof.
- the compositions will include a protease of the invention having at least 85% sequence identity to the sequence of SEQ ID NO: 10 and a . glucoamylase.
- the glucoamylase may be a wild type glucoamylase obtained from a filamentous fungal source, such as a strain of Aspergillus, Trichoderma or Bhizop ⁇ s ox the glucoamylase may be a protein engineered glucoamylase, such as a variant of an Aspergillus niger glucoamylase.
- a composition will include a protease of the invention and an alpha amylase.
- the alpha amylase may be obtained from a bacterial source such as a Bacillus spp or from a fungal source such as an Aspergillus spp.
- the compositions may include a protease according to the invention and both glucoamylase and alpha amylase enzymes. Commercially sources of these enzymes are known and available from, for example Genencor International, Inc. and Novozymes A/S.
- the present invention has contemplated use in ethanol production, baking, fruit juice production, brewing, distilling, wine making, leather, oils and fats, paper and pulp and the animal feed production.
- the present invention as contemplated is the active "biological" component of detergents and cleaning products.
- proteases, amylases and lipases are used to break down protein, starch and fatty stains.
- Embodiments of the invention include testing the compatibility of enzymes with detergent ingredients by doing stability studies and testing them in a variety of formulations.
- the present invention has contemplated enzymatic uses for the liquefaction and saccharification of starch into glucose and isomerisation into fructose.
- the present invention may be used to convert large volumes of plant substrates, such as grains, ⁇ e.g. corn, wheat, milo, rye and the like) into sweeteners, like high fructose corn syrup and maltose syrup.
- the enzyme(s) of the instant invention has application in the food and feed industry to improve the digestibility of proteins.
- the proteases also find uses in various industrial applications, particularly in the textile, lithographic, chemical arts, agriculture, environmental waste conversion, biopulp processing, biomass conversion , to fuel, and other chemical procedure(s). Further, the proteases have applications, which find use in healthcare and personal care products such as cosmetics, skin care, toothpaste and the like.
- the present enzymes described herein find use in animal feeds.
- the feeds may include plant material such as corn, wheat, sorghum, soybean, canola, sunflower or mixtures of any of these plant materials or plant protein sources for poultry, pigs, ruminants, aquaculture and pets. It is contemplated that the performance parameters, such as growth, feed intake and feed efficiency, but also improved uniformity, reduced ammonia concentration in the animal house and consequently improved welfare and health status of the animals will be improved.
- Dietary protein hydrolysates represent a small, but important market segment. Such preparations are used for postoperative patients or for individuals with an impaired digestive system.
- the hydrolysates may be administered as comparatively crude preparations per se (Clegg, 1978 In “Biochemical Aspects of New Protein Food", J, Adler-Nissen, B,O, Eggum, L, Munck & H.S. Olsen eds., p. 109-117, Pergamon, Oxford) or as highly purified mixtures of amino acids for intravenous administration. Enzyme hydrolysates of milk proteins have been applied as dietary preparations.
- Enzymatic tenderization of muscle foods, and in particular meat represents a large market segment, which is presently dominated by plant proteases and certain microbial enzymes. Enzymatic maturation and tenderization of fish muscle is also of considerable importance in many countries. Thus, the presently describe enzymes find use in various uses in food.
- the enzyme or enzyme compositions of the invention may be useful to make protein hydrolysates from, e.g., vegetable proteins like soy, pea, lupine or rape- ⁇ eed protein, milk like casein, meat proteins, or fish proteins.
- the enzyme(s) described herein may be used for protein hydrolysates to improve the solubility, consistency or fermentability, to reduce antigenicity, to reduce bitter taste of hydrolysates or for other purposes to make food, feed or medical products.
- the enzyme(s) described herein may be used alone or together with other peptidases or together with other. enzymes like exopeptidases.
- the use of the enzyme(s) described herein together with exopeptidase rich enzyme preparations will improve the taste of the protein hydrolysates.
- the enzyme or enzyme compositions may be used in the processing of fish or meat, e.g. to change texture and/or viscosity.
- Wool and Silk - Proteases described herein find use in the industrial treatment of wool goods to impart desirable properties.
- the present invention provides compositions for the treatment of textiles.
- the composition can be used to treat for example silk or wool (See e.g., RE 216,034; EP 134,267; US 4,533,359; and EP 344,259).
- the method of this invention can be applied to treat protein containing fibers, for instance keratin fibers. It is suitable to treat wool, wool fiber or animal hair, such as -angora, mohair, cashmere, alpacca, or other commercially useful animal hair product, which may originate from sheep, goat, lama, camel, rabbit etc. Also silk, spidersilk or human hair can be treated with the method of this invention.
- the fibers may be in the form of fiber, top, yarn or woven or knitted fabric or garments.
- the present invention also relates to cleaning compositions containing the protease(s) of the invention.
- the cleaning compositions may additionally ⁇ ontain additives which are commonly used in cleaning compositions. These can be selected from, but not limited to, bleaches, surfactants, builders, enzymes and bleach catalysts. It would be readily apparent to one of ordinary skill in the art what additives are suitable for inclusion into the compositions. The list provided herein is by no means exhaustive and should be only taken as examples of suitable additives. It will also be readily apparent to one of ordinary skill in the art to only use those additives which are compatible with the enzymes and other components in the composition, for example, surfactant.
- Proteins, particularly those of the invention can be formulated into known powdered and liquid detergents having an acidic pH between 3.5 and 7.0 at levels of about .01 to about 5% (preferably 0.1 % to 0.5%) by weight.
- these detergent cleaning compositions further include other enzymes such as amylases, additional proteases, cellulases, lipases or endoglycosidases, as well as builders and stabilizers.
- the pH is between 4.0 and 6.5, preferably between 4.0 and 5.6.
- proteins to conventional cleaning compositions does not create any special use limitations.
- any temperature and pH suitable for the detergent are also suitable for the present compositions, as long as the pH is within the above range, and the temperature is below the described protein's denaturing temperature.
- proteins of the invention find use in cleaning compositions without detergents, again either alone or in combination with builders and stabilizers.
- the bitter peptides occurring in protein hydrolysates may represent a considerable practical problem, as is the case, e,g,, during the ripening of different types of cheese and in the production of dietary protein hydrolysates.
- the bitterness of hydrolysates is usually due to particular peptides, and especially those which contain a high proportion of hydrophobic amino acids. Bitterness can be effectively reduced by complete or partial hydrolyses of the bitter peptides.
- the enzymes described herein find use in debittering of foods.
- the enzyme or enzyme compositions of the invention may be used for reducing the bitterness of proteins and/or protein hydrolysate for foodstuff.
- Also contemplated according to the invention is the production of free amino acids from proteins and/or protein hydrolysates. In the case when the free amino acid is glutamine acid, it enhances the flavor of food products.
- Said protein or protein hydrolysate may be of animal or vegetable origin.
- the protein to be hydrolyzed is casein or soy protein.
- the protein may be use for producing foodstuff such as cheese and foodstuff containing cocoa.
- the enzyme(s) described herein and enzyme preparations enriched with an enzyme of the invention may be used especially advantageously in connection with producing proteins or protein hydrolysates without bitter taste
- the enzyme(s) described herein can be used for a number of industrial applications, including degradation or modification of protein containing substances, such cell walls.
- Some proteins, like extensins, are components of plant cell walls. The enzyme(s) described herein will therefore facilitate the degradation or modification of plant cell walls.
- the dosage of the enzyme preparation of the invention and other conditions under which the preparation is used may be determined on the basis of methods known in the art.
- Protein precipitates may also present a considerable problem in certain products such as e.g, beer, because the precipitate causes the product to be hazy, In beer the haziness arises when soluble proteins precipitate during chill storage of the beer, The problem is of considerable economic importance and, apart from selecting suitable raw materials for the manufacture of beer, the main way of avoiding the problem today is to add proteolytic enzymes to the beer.
- an effective amount is added to personal care composition(s) that find use in personal care products.
- personal care products can be classified/described as cosmetic, over-the-counter (“OTC") compounds that find use in personal care applications (e.g., cosmetics, skin care, oral care, hair care, nail care).
- OTC over-the-counter
- the proteases described herein are added to a personal care composition such as a hair care composition, a skin care composition, a nail care composition, a cosmetic composition, or any combinations thereof.
- the enzyme or enzyme preparation may be used, for example, in solutions for cleaning contact lenses, toothpaste, cosmetics and skin care products.
- Proteases described herein find use in the production of high maltose or high fructose syrups as well as other sweeteners.
- Raw materials that contain fermentable sugars or constituents which can be converted into sugars are usually starch -containing plant materials including but not limited to tubers, roots, stems, cobs and grains of cereal plants (e.g. corn, wheat, milo, barely, and rye) and sugar-containing raw materials such as sugar beet, sugar cane, fruit materials, and molasses.
- the enzyme preparation may be useful for production of peptides from proteins, where it is advantageous to use a cloned enzyme essentially free from other proteolytic activities.
- enzyme(s) e.g. purified enzymes
- hydrolyze a suitable protein source it is possible to produce a crude preparation of free amino acids and peptides which is highly suitable as a substrate for microorganisms that have a specific requirement for amino acids for growth.
- prebiotic refers to a food or feed ingredient that beneficially affects the host by selectively stimulating 4he growth and/or activity of one or a limited number of bacteria in the digestive track, preferably in the colon.
- Fermentation and Bioethanol - Production of alcohol from the fermentation of starch containing substrates using protease compositions of the invention may include the production of fuel alcohol or portable alcohol.
- the enzyme compositions may also be used to facilitate yeast fermentation of barley, malt and other raw materials for the production of e.g. beer.
- Amylases are enzymes fundamental to the brewing and baking industries. Amylases are required to break down starch in malting and in certain baking procedures carried out in the absence of added sugars or other carbohydrates. Obtaining adequate activity of these enzymes is problematic especially in the malting industry. A method of adequately increasing the activity of amylases with a physiologically acceptable system, leads to more rapid malting methods and, owing to increased sugar availability, to alcoholic beverages such as beers with reduced carbohydrate content. In some embodiments, the hydrolysis of starch containing substrates, such as grains
- the protease will be used in compositions with glucoamylase and optionally alpha amylases in a combined saccharification and fermentation step, also referred to as simultaneous saccharification and fermentation.
- USP 5,231 ,017 discloses a process for producing ethanol using a protease derived from Aspergillus niger which includes obtaining a liquefied mash and introducing the protease into the liquefied mash during the saccharification step which may be combined with a fermentation step
- the protease composition of the invention will be used to produce alcohol, e.g.
- the process in a no cook process with granular starch substrates, wherein the process is conducted at a temperature below the gelatinization temperature of the starch in the substrate used to produce the alcohol.
- the quantity of the protease used in the starch hydrolysis processes will depend on the enzymatic activity of the protease. In some embodiments, the amount will be in the range of 0.001 to 2.0 ml of a 2% solution of the protease added to 450 g of a slurry adjusted to 20 - 33% dry solids, wherein the slurry is the liquefied mash during the saccharification and/or in the hydrolyzed starch. Other useful ranges include 0.005 to 1.5 ml and also 0.01 to 1.0 ml.
- Seeds or grains treated with proteases provide advantages in the production of malt and beverages produced by a fermentation process. It is desirable also to use proteases during saccharification so as to hydrolyze the proteins in the flour and thus enrich the wort with soluble nitrogen in anticipation of the subsequent alcoholic fermentation stage. Enhanced activity of amylases in grain increases the speed and efficiency of germination, important in malting, where malt is produced having increased enzymatic activity resulting in enhanced hydrolysis of starch to fermentable carbohydrates, thereby, improving the efficiency of fermentation in the production of alcoholic beverages, for example, beer and scotch whiskey.
- SAPU spectrophotometric acid protease unit, wherein in 1 SAPU is the amount of protease enzyme activity that liberates one micromole of tyrosine per minute from a casein substrate under conditions of the assay
- GAU glucoamylase unit, which is defined as the amount of enzyme that will produce 1 g of reducing sugar calculated as glucose per hour from a soluble starch substrate at pH 4.2 and 60 0 C).
- Genomic DNA was extracted from T. reesei strain QM6a.
- PCR primers were designed, based on the putative protease sequence found in contig 1 -5500 of the T. reesei genome (Joint Genome Institute (JGI) T. reesei genome v1.0).
- the forward primer contained a motif for directional cloning into the pENTR/D vector (Invitrogen).
- the sequence of the afp6f primer was CACCATGCAGACCTTTGGAGCT (SEQ ID NO: 11), and the sequence of the afp7r primer was TTATTTCTGAGCCCAGCCCAG (SEQ ID NO: 12).
- the 1.3 kb 'PCPI product was purified by gel extraction (OeI Purification kit, Qiagen) and cloned into pENTR/D, according to the Invitrogen Gateway system protocol. The vector was then transformed into chemically competent Topi 0 E.coli (Invitrogen) with kanamycin selection. Plasmid DNA, from several independent clones, was digested with restriction enzymes to confirm the correct size insert.
- the protease gene insert was sequenced (Sequetech, Mountain View, CA) from several clones. Plasmid DNA from one clone, pENTR/D_55.3, was added to the LR clonase reaction (Invitrogen Gateway system) with pTrex3g/amdS destination vector DNA.
- the pTrex3g vector is based on the E. coli pSL1180 (Pharmacia Inc., NJ), which is a pUC118 phagemid based vector and is described in WO 05/001036. Recombination, in the LR clonase reaction, replaced the CmR and ccdB genes of the destination vector with the T.
- Plasmid DNA from clone, pTrex3g_55.3.1 was digested with Xbal to release the expression cassette including the cbhl promoter:NSP24 protease:terminator:amdS.
- This 5.8kb cassette was purified by agarose gel extraction, using standard techniques, and transformed into a strain of T. reesei derived from the publicly available strain QM6a (See, WO 05/001036).
- Genomic DNA was extracted from T. reesei strain QM6a.
- PCR primers were designed, based on the putative protease sequence found in contig 22-263400 of the T. reesei genome (JGI T. reesei genome v1.0).
- the forward primer contained a motif for directional cloning into the pENTR/D vector (Invitrogen).
- the sequence of the afp ⁇ f primer was CACCATGCAGCCCTCATTTGGCAG (SEQ
- the 1.2 kb PCR product was purified by gel extraction (Gel Purification kit, Qiagen) and cloned into pENTR/D, according to the Invitrogen Gateway system protocol. The vector was then transformed into chemically competent Top10 E.coli (Invitrogen) with kanamycin selection. Plasmid DNA, from several independent clones, was digested with restriction enzymes to confirm the correct size insert. The protease gene insert was sequenced (Sequetech, Mountain View, CA) from several clones.
- Plasmid DNA from one clone, pENTR/D_22.2 was added to the LR clonase reaction ( I nvitrogen Gateway system) with pTrex3g/amdS destination vector DNA. Recombination, in the LR clonase reaction, replaced the CmR and ccdB genes of the destination vector with the T. reese/protease from pENTR/D_22.2. This recombination directionally inserted protease between the cbhl promoter and terminator of the destination vector. Recombination site sequences of 44 and 50 bp remained upstream and downstream, respectively, of the protease gene.
- Plasmid DNA from several clones was digested with restriction enzymes to confirm the correct insert size. Plasmid DNA from clone, pTrex3g_22.2#1 was digested with Xbal (and EcoRI to digest the bacterial backbone into small fragments, which migrated away from the cassette during electrophoresis) to release the expression cassette including the cbhl promoter: NSP25 protease:terminator:amc ( S. This 5.7 kb cassette was purified by agarose gel extraction, using standard techniques, and transformed into a strain of T. reesei derived from the publicly available strain QM6a. The plasmid used for transformation was essentially the same as the plasmid illustrated in Figure 7 except, the NSP24 insert was replaced with the NSP25 sequence.
- Trichoderma PEG Fungal Transformation A 2 cm 2 agar plug from a plate of sporulated mycelia was inoculated into 50ml of
- the mycelia were recovered by transferring liquid volume into 50ml conical tubes and spun at 2500 rpm for 10 minutes. The supernatant was aspirated off.
- the mycelial pellet was transferred into a 250ml, 0.22 ⁇ m CA Corning filter bottle containing 40ml of filter- sterilized ⁇ -D-glucanase (InterSpex Products, Inc.) solution and incubated at 3O 0 C, 200rpm for 2 hours.
- the mycelia were harvested through sterile Miracloth (CalBiochem, LaJoIIa, CA) into a 50 ml conical centrifuge tube, centrifuged at 2000 rpm for 5 minutes, aspirated. The pellet was washed once with 50 ml of 1.2M sorbitol, centrifuged again, aspirated, and washed with 25 ml of sorbitol/CaCI 2 . The protoplasts were counted using a hemocytometer, centrifuged, aspirated, and resuspended in a volume of sorbitol/CaCI 2 sufficient to generate a protoplast concentration of 1.25 x 10 8 AnI. Aliquots of 200 ⁇ l were used per transformation reaction.
- Acetamide Sorbitol Agar (Plates and top agar)
- Acetamide (Aldrich 99% sublimed) - 0.6 g/L; CsCI - 1.68 g/L; Glucose - 20 g/L; KH 2 PO 4 - 20 g/L; MgSO 4 * 7H 2 O - 0.6 g/L; CaCI 2 * 2H 2 O - 0.6 g/L; 1000X salts (see below) - 1 ml. pH adjusted to 5.5 and volume brought to 300 ml. Filter sterilized with 0.22 micron filter and warmed to 55 0 C in an oven.
- T. reesei culture media (Davis, et al., (1970) Methods Enzymol. 17:79 - 143) was inoculated with an agar plug. Cultures were incubated for 3 days at 3O 0 C, with shaking. Culture broth was passed through a 0.22 micron filter, and the filtrate spotted onto 1 % Skim milk agar. Clearing zones were observed following overnight incubation at room temperature.
- the pH-activity profiles of PepA (Wild type and L388M), NSP24 and NSR25 all of which were overexpressed in a strain of Trichoderma reesei were determined using a fluorescently labeled casein assay obtained from Molecular Probes (EnzChek Portease Kit- Green fluorescence).
- the PepA (wildtype and L388M) and NSP were whole fermentation samples and NSP24 was a purified protein stabilized in 50% glycerol.
- the enzymes were diluted to 1.0 mg/ml, 0.5 mg/ml and 0.25 mg/ml. Fluorescently labeled substrate was diluted to 0.1 mg/ml in Dl H 2 0.
- NSP24 has optimal activity at pH 3.7
- wild-type PepA has optimal activity at pH 3.4
- L388M pepA has optimal pH at 3.5
- NSP25 has optimal activity at pH 4.6.
- a standard protease used in the ethanol industry today is the protease GC106 sold commercially by Genencor International, Inc.
- the functionality of NSP24 to GC 106 was compared with respect to sugar degradation, glucose formation, and ethanol production.
- Mash and thin stillage also referred to as backset, prior to fermentation
- the pH was adjusted to pH 4.3 using 1 N HCL. Samples were then divided into 3-300 gram aliquots and placed into a 32 C C water bath. After equilibration, the following enzyme combinations were added:
- DISTILLASEL-400 is a liquid glucoamylase derived from Aspergillus niger which can be obtained from Genencor International Inc. After enzyme addition, 1.00 gram/flask of Red Star Red yeast was added. Samples were taken at 16, 24, 40, and 48 hours and centrifuged. 500 ul of each sample was placed into a test tube with 50 ul of a 1.1 NH 2 SO 4 to stop the reaction. After 2 minutes, the samples were diluted with 4.5 ml of Dl H 2 O and mixed. After mixing, the samples were run through a 0.45-micron filter and placed into HPLC vials for analysis. The samples were analyzed by HPLC (Phenomenex Ftezex ⁇ u). Results are illustrated in Figures 1 - 4. NSP24 performed similarly to GC 106.
- a 30% DS slurry of ground corn was made up with Dl H 2 O.
- the ground corn was a typical sample of #2 Yellow dent corn used in the ethanol industry, which was ground so that greater than 70% would pass thru a 30 mesh screen.
- the moisture content of the grain was measured using an OHAUS, MB 35 Halogen moisture balance (NJ).
- the pH was adjusted to 4.2 using 6N H 2 SO 4 . Fermentations were conducted in 125 ml flasks containing 100 g mash with STARGEN 001 dosed at 1.0 GAU/g and with or without NSP24 dosed at 0.5kg/MT.
- Red Star Ethanol Red dry yeast (Lesaffre yeast Corporation, Milwaukee, Wl) in 45 mis of water was prepared and mixed in a 32°C water bath one hour prior to inoculating the fermenters. 0.5 ml of the yeast slurry was added to each 125 ml flask. The flasks were placed in a 32°C water bath and the mash mixed gently.
- a 29.5 % DS mash using endosperm (degermed corn, 75.8% starch, particle size of 99.5% ⁇ 30 mesh) as a granular starch substrate was prepared.
- One hundred grams of each mash was transferred to a 125 ml flask, and the pH of the medium was adjusted to pH 4.5.
Abstract
Description
Claims
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05855059A EP1831362B1 (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases |
DK05855059.1T DK1831362T3 (en) | 2004-12-30 | 2005-12-20 | Acidic fungal proteases |
CN200580045498.2A CN101094918B (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases |
MX2007007862A MX2007007862A (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases. |
CA2593080A CA2593080C (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases |
MX2010001481A MX2010001481A (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases. |
BRPI0519766-0A BRPI0519766A2 (en) | 2004-12-30 | 2005-12-20 | Authentic acid proteases |
AT05855059T ATE530643T1 (en) | 2004-12-30 | 2005-12-20 | ACID-ACTIVE FUNGAL PROTEASE |
JP2007549480A JP5087407B2 (en) | 2004-12-30 | 2005-12-20 | Acid fungal protease |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US64039904P | 2004-12-30 | 2004-12-30 | |
US60/640,399 | 2004-12-30 | ||
US64823305P | 2005-01-27 | 2005-01-27 | |
US60/648,233 | 2005-01-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2006073839A2 true WO2006073839A2 (en) | 2006-07-13 |
WO2006073839A3 WO2006073839A3 (en) | 2006-11-23 |
Family
ID=36298718
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2005/046435 WO2006073839A2 (en) | 2004-12-30 | 2005-12-20 | Acid fungal proteases |
PCT/US2005/046474 WO2006073843A2 (en) | 2004-12-30 | 2005-12-21 | Acid fungal protease in fermentation of insoluble starch substrates |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2005/046474 WO2006073843A2 (en) | 2004-12-30 | 2005-12-21 | Acid fungal protease in fermentation of insoluble starch substrates |
Country Status (13)
Country | Link |
---|---|
US (6) | US7429476B2 (en) |
EP (3) | EP2363460A3 (en) |
JP (1) | JP5087407B2 (en) |
CN (1) | CN101094918B (en) |
AT (2) | ATE530643T1 (en) |
BR (1) | BRPI0519766A2 (en) |
CA (1) | CA2593080C (en) |
DE (1) | DE602005011486D1 (en) |
DK (1) | DK1831362T3 (en) |
ES (1) | ES2318590T3 (en) |
MX (2) | MX2010001481A (en) |
PL (1) | PL1831386T3 (en) |
WO (2) | WO2006073839A2 (en) |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006073843A2 (en) * | 2004-12-30 | 2006-07-13 | Genencor International, Inc. | Acid fungal protease in fermentation of insoluble starch substrates |
WO2009052101A1 (en) | 2007-10-18 | 2009-04-23 | Danisco Us, Inc. | Enzyme blends for fermentation |
WO2011003968A1 (en) | 2009-07-08 | 2011-01-13 | Ab Enzymes Oy | A fungal protease and use thereof |
WO2011075677A2 (en) | 2009-12-18 | 2011-06-23 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of trichoderma |
US8603795B2 (en) | 2009-04-30 | 2013-12-10 | Ab Enzymes Oy | Fungal protease and use thereof |
US8609390B2 (en) | 2009-04-30 | 2013-12-17 | Ab Enzymes Oy | Fungal serine protease and use thereof |
US8945900B2 (en) | 2010-10-29 | 2015-02-03 | Ab Enzymes Oy | Variants of fungal serine protease |
US9404164B2 (en) | 2011-03-31 | 2016-08-02 | Ab Enzymes Oy | Protease enzyme and uses thereof |
EP3277103B1 (en) | 2015-03-30 | 2020-11-11 | Société des Produits Nestlé S.A. | Milk-based protein hydrolysates and compositions made thereof |
Families Citing this family (36)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104694595A (en) * | 2005-02-07 | 2015-06-10 | 诺维信北美公司 | Process for producing fermentation product |
UA100673C2 (en) | 2006-07-21 | 2013-01-25 | Ксилеко, Инк. | Method for processing of cellulose or lignocellulose biomass (variants) |
US7659098B2 (en) * | 2006-09-12 | 2010-02-09 | Masahiro Yamamoto | Method of treating waste from alcohol production |
WO2008100837A2 (en) * | 2007-02-13 | 2008-08-21 | Renessen Llc | Fermentation process for the preparation of ethanol from a corn fraction having low oil content |
US8093016B2 (en) * | 2007-05-21 | 2012-01-10 | Danisco Us Inc. | Use of an aspartic protease (NS24) signal sequence for heterologous protein expression |
WO2009048917A2 (en) * | 2007-10-12 | 2009-04-16 | Archer-Daniels-Midland Company | Increased fiber hydrolysis by protease addition |
EP2203556A1 (en) * | 2007-11-01 | 2010-07-07 | Danisco US Inc. | Signal sequences and co-expressed chaperones for improving protein production in a host cell |
JP5594899B2 (en) | 2007-11-20 | 2014-09-24 | ダニスコ・ユーエス・インク | Glucoamylase variants with altered properties |
MX2007016073A (en) * | 2007-12-14 | 2009-06-15 | Itesm | Improved method for obtaining bioethanol from sorghum grain (sorghum bicolor l. moench), comprising steps involving decortication and hydrolysis with proteases. |
MX2010009652A (en) | 2008-03-11 | 2010-09-30 | Danisco Us Inc | Glucoamylase and buttiauxiella phytase during saccharification. |
DK2276848T3 (en) * | 2008-04-30 | 2015-03-09 | Danisco Us Inc | Improved fermentation using molasses |
US8252566B2 (en) * | 2008-05-20 | 2012-08-28 | Jj Florida Properties Llc | Ethanol production from citrus waste through limonene reduction |
WO2009143059A1 (en) * | 2008-05-20 | 2009-11-26 | Inventus Holdings, Llc | Removal of fermentation inhibiting compounds from citrus waste using solvent extraction and production of ethanol |
CA2725737A1 (en) * | 2008-05-29 | 2009-12-10 | Danisco Us Inc. | Process for alcohol and co-product production from grain sorghum |
CN102083991A (en) * | 2008-06-23 | 2011-06-01 | 诺维信公司 | Processes for producing fermentation products |
PE20121504A1 (en) | 2009-08-19 | 2012-11-05 | Dupont Nutrition Biosci Aps | GLUCOAMYLASE VARIANTS |
EP2467475A1 (en) | 2009-08-19 | 2012-06-27 | Danisco US Inc. | Combinatorial variants of glucoamylase with improved specific activity and/or thermostability |
NZ604846A (en) * | 2010-07-19 | 2014-11-28 | Xyleco Inc | Processing biomass |
US9175316B2 (en) * | 2012-12-12 | 2015-11-03 | Ebio, Llc | Efficient production of biofuels from cells carrying a metabolic-bypass gene cassette |
US9677058B2 (en) | 2011-12-22 | 2017-06-13 | Dupont Nutrition Biosciences Aps | Polypeptides having glucoamylase activity and method of producing the same |
EP2800809B1 (en) | 2012-01-05 | 2018-03-07 | Glykos Finland Oy | Protease deficient filamentous fungal cells and methods of use thereof |
EP2852610B1 (en) | 2012-05-23 | 2018-07-11 | Glykos Finland Oy | Production of fucosylated glycoproteins |
WO2013181647A2 (en) | 2012-06-01 | 2013-12-05 | Danisco Us Inc. | Compositions and methods of producing isoprene and/or industrrial bio-products using anaerobic microorganisms |
MX2015002099A (en) | 2012-08-22 | 2015-05-11 | Dupont Nutrition Biosci Aps | Wave energy conversion. |
US20140134684A1 (en) * | 2012-11-09 | 2014-05-15 | The United States Of America, As Represented By The Secretary Of Agriculture | Methods For Obtaining Oil From Maize Using Acid Protease and Cell-wall Polysaccharide-degrading Enzymes |
CN105518130A (en) | 2013-06-21 | 2016-04-20 | 丹尼斯科美国公司 | Compositions and methods for clostridial transformation |
DK3019602T3 (en) | 2013-07-10 | 2018-11-12 | Glykos Finland Oy | MULTIPLE PROTEASE-DEFECTED FILAMENTARY FUNGAL CELLS AND PROCEDURES FOR USE THEREOF |
CA2954974A1 (en) | 2014-07-21 | 2016-01-28 | Glykos Finland Oy | Production of glycoproteins with mammalian-like n-glycans in filamentous fungi |
US11680278B2 (en) | 2014-08-29 | 2023-06-20 | Lee Tech Llc | Yeast stage tank incorporated fermentation system and method |
US9180463B1 (en) | 2014-08-29 | 2015-11-10 | Joseph R. Fitzgerald | Method for fractionation of dry material using accelerators |
US11427839B2 (en) | 2014-08-29 | 2022-08-30 | Lee Tech Llc | Yeast stage tank incorporated fermentation system and method |
EP3353292A4 (en) * | 2015-09-25 | 2019-04-03 | Novozymes A/S | Use of serine proteases for improving ethanol yield |
US11166478B2 (en) | 2016-06-20 | 2021-11-09 | Lee Tech Llc | Method of making animal feeds from whole stillage |
WO2018005229A1 (en) | 2016-06-30 | 2018-01-04 | Dupont Nutrition Biosciences Aps | In feed assay of microbial proteases using peptide substrates |
US11422911B2 (en) | 2019-03-14 | 2022-08-23 | International Business Machines Corporation | Assisted smart device context performance information retrieval |
WO2022159719A1 (en) | 2021-01-22 | 2022-07-28 | Lee Tech Llc | System and method for improving the corn wet mill and dry mill process |
Family Cites Families (65)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
USRE21604E (en) | 1940-10-22 | Harvester | ||
JPS5519598B2 (en) | 1972-03-10 | 1980-05-27 | ||
JPS5626396B2 (en) | 1974-03-11 | 1981-06-18 | ||
JPS5646831B2 (en) * | 1974-11-26 | 1981-11-05 | ||
JPS5534046A (en) * | 1978-09-01 | 1980-03-10 | Cpc International Inc | Novel glucoamyrase having excellent heat resistance and production |
GB2089836B (en) * | 1980-12-16 | 1984-06-20 | Suntory Ltd | Process for producing alcohol by fermentation without cooking |
DE3132936A1 (en) | 1981-08-20 | 1983-03-03 | Henkel KGaA, 4000 Düsseldorf | "METHOD FOR PRODUCING ACID PROTEASE AND THESE FORMING MUTANTS OF THE RHIZOPUS GENUS" |
DE3149457A1 (en) | 1981-12-14 | 1983-06-23 | Henkel KGaA, 4000 Düsseldorf | METHOD FOR PRODUCING ACID PROTEASE AND THESE FORMING MUTANTS OF MUSHROOMS OF THE GENUS ASPERGILLUS |
JPS58144105A (en) | 1982-02-12 | 1983-08-27 | Kurabo Ind Ltd | Production of descaled animal fiber |
NO840200L (en) | 1983-01-28 | 1984-07-30 | Cefus Corp | GLUCOAMYLASE CDNA. |
US4587215A (en) * | 1984-06-25 | 1986-05-06 | Uop Inc. | Highly thermostable amyloglucosidase |
ATE95837T1 (en) | 1984-08-06 | 1993-10-15 | Genencor Inc | ENZYMATIC HYDROLYSIS OF GRANULAR STARCH DIRECTLY TO GLUCOSE. |
JPH0630586B2 (en) * | 1984-12-15 | 1994-04-27 | サントリー株式会社 | Glucoamylase gene |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
EP0208491B1 (en) * | 1985-07-03 | 1993-08-25 | Genencor International, Inc. | Hybrid polypeptides and process for their preparation |
EP0215594B2 (en) | 1985-08-29 | 2003-10-15 | Genencor International, Inc. | Heterologous polypeptide expressed in filamentous fungi, processes for their preparation, and vectors for their preparation |
US5278059A (en) * | 1985-12-04 | 1994-01-11 | Kabushiki Kaisha Hayashibara Seibutsu Kagaki Kenkyujo | Polypeptide possessing cyclomaltodextrin glucanotransferase activity |
EP0344259A4 (en) | 1987-10-30 | 1991-04-24 | Lsi Logic Corporation | Method and means of fabricating a semiconductor device package |
JPH01240184A (en) | 1988-03-18 | 1989-09-25 | Ikeda Shiyokuken Kk | Thermostable acidic protease |
CA1333777C (en) * | 1988-07-01 | 1995-01-03 | Randy M. Berka | Aspartic proteinase deficient filamentous fungi |
US5173403A (en) | 1989-02-24 | 1992-12-22 | Oklahoma Medical Research Foundation | Thermostable acid protease from sulfolobus acidocaldarius and gene |
US5162210A (en) | 1990-06-29 | 1992-11-10 | Iowa State University Research Foundation | Process for enzymatic hydrolysis of starch to glucose |
FR2666590A1 (en) * | 1990-09-11 | 1992-03-13 | Sanofi Sa | RECOMBINANT DNA ENCODING AN ENDOTHIAPEPSIN PRECURSOR, EXPRESSION VECTOR, BACTERIA AND PROCESSED EUKARYOTIC CELLS. |
DE69133100T3 (en) | 1990-12-10 | 2015-09-03 | Danisco Us Inc. | IMPROVED SACCHARIFICATION OF CELLULOSE BY CLONING AND REPRODUCTION OF THE BETA-GLUCOSIDASE GENE FROM TRICHODERMA REESEI |
US5231017A (en) * | 1991-05-17 | 1993-07-27 | Solvay Enzymes, Inc. | Process for producing ethanol |
US5861271A (en) | 1993-12-17 | 1999-01-19 | Fowler; Timothy | Cellulase enzymes and systems for their expressions |
BE1008738A3 (en) | 1994-06-17 | 1996-07-02 | Solvay | Expression system, integration and vector cell transformed by the vector integration. |
CN100419076C (en) | 1995-02-03 | 2008-09-17 | 诺沃奇梅兹有限公司 | Method for disigning alpha-amylase mutants with predetermined properties |
US6093562A (en) * | 1996-02-05 | 2000-07-25 | Novo Nordisk A/S | Amylase variants |
US5736499A (en) | 1995-06-06 | 1998-04-07 | Genencor International, Inc. | Mutant A-amylase |
EP0904360B1 (en) * | 1996-04-30 | 2013-07-31 | Novozymes A/S | alpha-AMYLASE MUTANTS |
US5958739A (en) * | 1996-06-06 | 1999-09-28 | Genencor International Inc. | Mutant α-amylase |
US6255515B1 (en) * | 1997-01-21 | 2001-07-03 | Mitsubishi Chemical Corporation | Processes for producing silicon- or germanium-containing organic compound, transition metal complex, catalyst for polymerization of α-olefin and α-olefin polymer |
BR9807941A (en) | 1997-04-07 | 2000-02-22 | Unilever Nv | Processes for production and for growing a processed mold, and, processed mold |
EP1032655B1 (en) * | 1997-11-21 | 2005-06-29 | Novozymes A/S | Protease variants and compositions |
DE19752855C2 (en) | 1997-11-28 | 2003-04-03 | Bundesrepublik Deutschland Let | Retroviral pseudotype vectors with modified surface envelope proteins and packaging cells for their production for selective gene transfer |
AU2207099A (en) | 1997-12-24 | 1999-07-19 | Genencor International, Inc. | An improved method of assaying for a preferred enzyme and/or preferred detergentcomposition |
JPH11328408A (en) * | 1998-05-12 | 1999-11-30 | Advantest Corp | Device for processing data and information storage medium |
US6352851B1 (en) * | 1998-07-15 | 2002-03-05 | Novozymes A/S | Glucoamylase variants |
US6268328B1 (en) | 1998-12-18 | 2001-07-31 | Genencor International, Inc. | Variant EGIII-like cellulase compositions |
US6254914B1 (en) * | 1999-07-02 | 2001-07-03 | The Board Of Trustees Of The University Of Illinois | Process for recovery of corn coarse fiber (pericarp) |
NZ520022A (en) | 1999-12-30 | 2005-01-28 | Genencor Int | Protein and DNA sequences for XYL-IV from Trichoderma reesei |
US6566125B2 (en) * | 2000-06-02 | 2003-05-20 | The United States Of America As Represented By The Secretary Of Agriculture | Use of enzymes to reduce steep time and SO2 requirements in a maize wet-milling process |
US6936294B2 (en) * | 2001-12-04 | 2005-08-30 | Satake Usa, Inc. | Corn degermination process |
CN100564534C (en) | 2002-02-08 | 2009-12-02 | 金克克国际有限公司 | Produce the alcoholic acid method with carbon substrate |
CN1330770C (en) | 2002-02-14 | 2007-08-08 | 诺维信公司 | Starch process |
CN1788083B (en) * | 2003-03-10 | 2011-10-05 | 诺维信公司 | Alcohol product processes |
CN102210376B (en) | 2003-03-10 | 2014-12-31 | 波伊特研究股份有限公司 | Method for producing ethanol using raw starch |
WO2004087889A1 (en) * | 2003-04-04 | 2004-10-14 | Novozymes A/S | Mash viscosity reduction |
EP1862626B1 (en) | 2003-05-29 | 2011-09-14 | Genencor International, Inc. | Novel trichoderma genes |
EP1633878A1 (en) | 2003-05-30 | 2006-03-15 | Novozymes A/S | Alcohol product processes |
US6899910B2 (en) * | 2003-06-12 | 2005-05-31 | The United States Of America As Represented By The Secretary Of Agriculture | Processes for recovery of corn germ and optionally corn coarse fiber (pericarp) |
EP1633874A2 (en) | 2003-06-13 | 2006-03-15 | Novozymes A/S | Method for producing glucoamylases and their uses |
US7306935B2 (en) | 2003-06-25 | 2007-12-11 | Novozymes North America, Inc | Polypeptides having alpha-amylase activity and polypeptides encoding same |
EP1675941B1 (en) | 2003-06-25 | 2013-05-22 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
US20070148287A1 (en) | 2003-07-01 | 2007-06-28 | Novozymes A/S | Cgtase variants |
US6936110B2 (en) * | 2003-07-08 | 2005-08-30 | Biorefining, Inc. | Grain fractionation |
BRPI0416762A (en) | 2003-11-21 | 2007-02-27 | Genencor Int | Granular starch hydrolyzing enzyme expression in trinchoderma and process for producing glucose from granular starch substrates |
US20080113418A1 (en) * | 2004-01-16 | 2008-05-15 | Novozymes A/S | Processes for Producing a Fermantation Product |
WO2005087938A2 (en) | 2004-03-10 | 2005-09-22 | Broin And Associates, Inc. | Methods and systems for producing ethanol using raw starch and fractionation |
CN1981037B (en) * | 2004-05-27 | 2011-08-31 | 金克克国际有限公司 | Heterologous expression of an aspergillus kawachi acid-stable alpha amylase and applications in granular starch hydrolysis |
CA2567485C (en) * | 2004-05-27 | 2015-01-06 | Genencor International, Inc. | Acid-stable alpha amylases having granular starch hydrolyzing activity and enzyme compositions |
EP2363460A3 (en) * | 2004-12-30 | 2011-12-28 | Genencor International, Inc. | Acid fungal proteases |
US8093016B2 (en) * | 2007-05-21 | 2012-01-10 | Danisco Us Inc. | Use of an aspartic protease (NS24) signal sequence for heterologous protein expression |
US8048657B2 (en) * | 2007-10-18 | 2011-11-01 | Danisco Us Inc. | Enzyme compositions comprising a glucoamylase, an acid stable alpha amylase, and an acid fungal protease |
-
2005
- 2005-12-20 EP EP10011492A patent/EP2363460A3/en not_active Withdrawn
- 2005-12-20 MX MX2010001481A patent/MX2010001481A/en active IP Right Grant
- 2005-12-20 EP EP05855059A patent/EP1831362B1/en active Active
- 2005-12-20 US US11/312,290 patent/US7429476B2/en active Active
- 2005-12-20 WO PCT/US2005/046435 patent/WO2006073839A2/en active Application Filing
- 2005-12-20 CN CN200580045498.2A patent/CN101094918B/en active Active
- 2005-12-20 MX MX2007007862A patent/MX2007007862A/en active IP Right Grant
- 2005-12-20 DK DK05855059.1T patent/DK1831362T3/en active
- 2005-12-20 CA CA2593080A patent/CA2593080C/en active Active
- 2005-12-20 BR BRPI0519766-0A patent/BRPI0519766A2/en not_active Application Discontinuation
- 2005-12-20 AT AT05855059T patent/ATE530643T1/en not_active IP Right Cessation
- 2005-12-20 JP JP2007549480A patent/JP5087407B2/en active Active
- 2005-12-21 AT AT05857167T patent/ATE416258T1/en not_active IP Right Cessation
- 2005-12-21 EP EP05857167A patent/EP1831386B1/en active Active
- 2005-12-21 DE DE602005011486T patent/DE602005011486D1/en active Active
- 2005-12-21 PL PL05857167T patent/PL1831386T3/en unknown
- 2005-12-21 WO PCT/US2005/046474 patent/WO2006073843A2/en active Application Filing
- 2005-12-21 US US11/314,987 patent/US7563607B2/en active Active
- 2005-12-21 ES ES05857167T patent/ES2318590T3/en active Active
-
2008
- 2008-07-02 US US12/167,092 patent/US7629451B2/en active Active
-
2009
- 2009-06-16 US US12/485,767 patent/US8075694B2/en active Active
- 2009-10-20 US US12/582,606 patent/US8173409B2/en active Active
-
2012
- 2012-04-06 US US13/441,731 patent/US8288517B2/en active Active
Non-Patent Citations (1)
Title |
---|
None |
Cited By (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006073843A3 (en) * | 2004-12-30 | 2007-04-05 | Genencor Int | Acid fungal protease in fermentation of insoluble starch substrates |
WO2006073843A2 (en) * | 2004-12-30 | 2006-07-13 | Genencor International, Inc. | Acid fungal protease in fermentation of insoluble starch substrates |
US8075694B2 (en) | 2004-12-30 | 2011-12-13 | Danisco Us Inc. | Acid fungal protease in fermentation of insoluble starch substrates |
US8048657B2 (en) | 2007-10-18 | 2011-11-01 | Danisco Us Inc. | Enzyme compositions comprising a glucoamylase, an acid stable alpha amylase, and an acid fungal protease |
WO2009052101A1 (en) | 2007-10-18 | 2009-04-23 | Danisco Us, Inc. | Enzyme blends for fermentation |
JP2011500058A (en) * | 2007-10-18 | 2011-01-06 | ダニスコ・ユーエス・インク | Enzyme blend for fermentation |
US8937170B2 (en) | 2009-04-30 | 2015-01-20 | Ab Enzymes Oy | Nucleic acids encoding fungal protease |
US8603795B2 (en) | 2009-04-30 | 2013-12-10 | Ab Enzymes Oy | Fungal protease and use thereof |
US8609390B2 (en) | 2009-04-30 | 2013-12-17 | Ab Enzymes Oy | Fungal serine protease and use thereof |
US8877912B2 (en) | 2009-04-30 | 2014-11-04 | Ab Enzymes Oy | Nucleic acids encoding fungal serine protease |
WO2011003968A1 (en) | 2009-07-08 | 2011-01-13 | Ab Enzymes Oy | A fungal protease and use thereof |
US8362222B2 (en) | 2009-07-08 | 2013-01-29 | Ab Enzymes Oy | Fungal protease and use thereof |
EP3000871A1 (en) | 2009-12-18 | 2016-03-30 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of trichoderma |
US8986974B2 (en) | 2009-12-18 | 2015-03-24 | Novozymes, Inc. | Methods for producing polypeptidies in protease-deficient mutants of trichoderma |
WO2011075677A2 (en) | 2009-12-18 | 2011-06-23 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of trichoderma |
US10400260B2 (en) | 2009-12-18 | 2019-09-03 | Novozymes, Inc. | Protease-deficient mutants of trichoderma for producing polypeptides |
US11001869B2 (en) | 2009-12-18 | 2021-05-11 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of Trichoderma |
US11078510B2 (en) | 2009-12-18 | 2021-08-03 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of Trichoderma |
US11078509B2 (en) | 2009-12-18 | 2021-08-03 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of Trichoderma |
US11078508B2 (en) | 2009-12-18 | 2021-08-03 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of trichoderma |
US11427847B2 (en) | 2009-12-18 | 2022-08-30 | Novozymes, Inc. | Methods for producing polypeptides in protease-deficient mutants of Trichoderma |
US8945900B2 (en) | 2010-10-29 | 2015-02-03 | Ab Enzymes Oy | Variants of fungal serine protease |
US9404164B2 (en) | 2011-03-31 | 2016-08-02 | Ab Enzymes Oy | Protease enzyme and uses thereof |
US10221377B2 (en) | 2011-03-31 | 2019-03-05 | Ab Enzymes Oy | Protease enzyme and uses thereof |
EP3277103B1 (en) | 2015-03-30 | 2020-11-11 | Société des Produits Nestlé S.A. | Milk-based protein hydrolysates and compositions made thereof |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7429476B2 (en) | Acid fungal proteases | |
JP5463146B2 (en) | Starch hydrolysis using phytase with alpha-amylase | |
RU2394101C2 (en) | Glucoamylase trichoderma reesei and its homologues | |
US8349601B2 (en) | Trichoderma reesei glucoamylase and homologs thereof | |
US7723079B2 (en) | Trichoderma reesei glucoamylase and homologs thereof | |
CA3032736A1 (en) | Leader-modified glucoamylase polypeptides and engineered yeast strains having enhanced bioproduct production | |
EP3274461A1 (en) | Glucoamylase-modified yeast strains and methods for bioproduct production | |
JP2023527266A (en) | Glucoamylase and method of use thereof | |
AU2011205074B2 (en) | Trichoderma reesei glucoamylase and homologs thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200580045498.2 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2593080 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/007862 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005855059 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007549480 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: PI0519766 Country of ref document: BR |