WO2006068668A2 - Compositions and methods for modulating calcium flux, glucose homeostasis and apoptosis - Google Patents

Compositions and methods for modulating calcium flux, glucose homeostasis and apoptosis Download PDF

Info

Publication number
WO2006068668A2
WO2006068668A2 PCT/US2005/025625 US2005025625W WO2006068668A2 WO 2006068668 A2 WO2006068668 A2 WO 2006068668A2 US 2005025625 W US2005025625 W US 2005025625W WO 2006068668 A2 WO2006068668 A2 WO 2006068668A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
agent
trpm2
puromycin
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/025625
Other languages
French (fr)
Other versions
WO2006068668A3 (en
Inventor
John M. Denu
Andrew M. Scharenberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oregon Health and Science University
Original Assignee
Oregon Health and Science University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oregon Health and Science University filed Critical Oregon Health and Science University
Priority to US11/658,069 priority Critical patent/US8440638B2/en
Publication of WO2006068668A2 publication Critical patent/WO2006068668A2/en
Publication of WO2006068668A3 publication Critical patent/WO2006068668A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • This invention relates to the fields of biochemistry, aging, diabetes and oncology. More specifically, the present invention provides compositions and methods for modulating cell death (e.g., apoptosis) in target cells, particularly cancer cells. The invention also provides compositions and methods for modulating calcium flux thereby maintaining glucose homeostasis.
  • cell death e.g., apoptosis
  • the invention also provides compositions and methods for modulating calcium flux thereby maintaining glucose homeostasis.
  • Silent information regulator 2 (Sir2) proteins are well conserved across all kingdoms of life and are implicated in the control of gene silencing, apoptosis, metabolism, and aging (1-6). Sir2 is required for life-span increases in yeast, flies and worms caused by caloric restriction or by natural antioxidants (e.g. resveratrol) (7, 8).
  • SIRT1/Sir2alpha regulates skeletal muscle differentiation (9), represses damage-responsive Forkhead transcription factors (3, 4), negatively controls p53 to promote cell survival under stress (reviewed in (10)), and promotes fat mobilization in white adipocytes (11).
  • Human SIRT2 is associated with microtubules in the cytoplasm and can deacetylate alpha-tubulin (12). Though the role of mitochrondrial SIRT3 is unknown (13, 14), variability of the human SIRT3 gene is associated with survivorship in the elderly (15).
  • Sir2 proteins catalyze a unique protein deacetylation reaction that requires the co-enzyme NAD + , a key intermediate in energy metabolism.
  • nicotinamide vitamin B3
  • the acetyl -group of substrate is transferred to cleaved NAD + , generating a novel metabolite O-acetyl-ADP ribose, OAADPr (16-20).
  • OAADPr might be a substrate for other linked enzymatic processes, an allosteric regulator, or a second messenger.
  • the first report of bio-activity came from the observation that OAADPr injected into starfish oocytes or blastomeres caused a block/delay in maturation and cell division, respectively (21). Enzymes capable of metabolizing OAADPr have been detected in several diverse cells (22).
  • select members of the ADP-ribose hydrolase (Nudix) family of enzymes e.g., mNudT5 and yeast YSAl
  • TRPM2 long transient receptor potential channel 2
  • TRPM2 has been shown to contain a C-terminal Nudix box (23). This Nudix motif is proposed to bind
  • materials and methods are provided for modulating calcium flux, glucose homeostasis and apoptosis.
  • a method for modulating glucose homeostasis in a patient in need thereof entails contacting an islet cell with an effective amount of an agent that increases intracellular levels of O-acetyl-ADP-ribose or inhibits the breakdown thereof, the increase O-acetyl ADP ribose concentration resulting in cellular depolarization and/or Ca2+ entry which modulates insulin secretion from said cell.
  • An agent suitable for use in the method comprises puromycin.
  • the agent may be a functional analog of O-acetyl -ADP-ribose.
  • the method further comprises administration of an agent which inhibits sirtuin activity thereby preventing islet cell death in the patient.
  • agents for this purpose comprise nicotinamide.
  • a composition comprising nicotinamide for inhibiting beta cell apoptosis induced by elevated levels of O-acetyl- ADP-ribose is provided.
  • a composition for modulating O-acetyl-ADP-ribose levels in a cell is disclosed.
  • An exemplary composition for this purpose comprises puromycin and nicotinamide in a pharmaceutically acceptable carrier.
  • Another embodiment of the invention entails a method for modulating cell death in a target cell.
  • An exemplary method entails contacting a cell comprising O-acetyl-ADP-ribose and the long transient receptor potential channel 2 (TRPM2) with an agent which inhibits breakdown or increases intracellular concentrations of said O-acetyl-ADP-ribose to levels sufficient to induce cell death in said target cell.
  • TRPM2 long transient receptor potential channel 2
  • the method optionally comprises contacting the cell with a second agent suspected of modulating TRPM2 activity, and assessing the effect of said agent on a said activity.
  • Activities that may be assessed in accordance with the invention include, without limitation, modulation of cell death induced by puromycin administration, ion transport, conductivity of plasma membrane, and intracellular calcium mobilization and insulin secretion.
  • the method may also entail contacting the cell with a second agent suspected of modulating TRPM2 channel activity and assessing the effect of said second agent on sirtuin-dependent cell death, the second agent optionally being nicotinamide.
  • siRNA molecules which are effective to downregulate sirtuin mRNA production.
  • a method for identifying agents which regulate TRPM2 channel opening comprises contacting a cell with an agent which modulates intracellular concentration of O-acetyl-ADP-ribose and determining the effect of said agen* on said channel opening as a function of ion flux into said cell, agents which alter said ion flux being effective to gate the TRPM2 channel.
  • the cell to be contacted is a beta islet cell and the method further comprises determining the effect of the agent on insulin secretion.
  • the cell is present in an animal and the method further comprises determining the effect of the agent on glucose homeostasis in the animal.
  • FIGS. 1 demonstrate that the TRPM2 channel is gated by OAADPr in tet- induced HEK-293 cells. Shown is the development of whole cell currents over time in TRPM2-expressing HEK-293 cells.
  • Bath solution was standard ringer's, and pipette solution was Cs-based and included 10 mM EGTA to buffer intracellular Ca 2+ to 10 nM.
  • the patch pipette contained various concentrations of (Fig. Ia) ADPr, (Fig. Ib) OAADPr (Fig. Ic) OAADPr and puromycin as indicated in the figure. Fig. Id.) Cytoplasmic OAADPr esterase activity is inhibited by puromycin.
  • Figures 2 a-c demonstrate that puromycin leads to cell death in TRPM2- expressing HEK-293 cells. Shown are HEK-293 cells (closed diamond) and HEK-293 cells stably transfected with a tet-controlled TRPM2 construct in the presence (open squares) or absence of (open diamor is) tetracycline. Cells incubated in the presence of 0-50 ⁇ M puromycin for 16 h were assayed for viability by measuring fluorescence of calcein in live cells, b.) Removal of calcium rescues cells from puromycin induced cell death.
  • TRPM2-expressing HEK-293 cells were grown in complete DMEM media and 1 ⁇ g/ml tetracycline until 80-90% confluent. One set of cells were re-fed with the same complete media (closed diamonds) and the other set of cells were rinsed with PBS and fed with modified media containing 1 ⁇ g/ml tetracycline, 5 niM EGTA and without calcium chloride (open squares). One hour after calcium removal, cells were incubated in 0-500 ⁇ M puromycin for 6 hours after which cell viability was measured, c.) TRPM2 expression in HEK-293 cells does not lead to preferential sensitivity to cycloheximide.
  • HEK-293 (close diamond) and TRPM2 expressing HEK-293 cells in the absence (open diamond) or presence of (closed square) tetracycline were exposed to 0-10 ⁇ g/ml cycloheximide for 16 h. Cell viability was determined as described in (a).
  • TRPM2-expressing HEK-293 cells were exposed to 0-50 ⁇ M puromycin for 16 h in the presence (open diamond) or absence (closed diamond) of 500 ⁇ M nicotinamide. Cell survival was determined by measuring fluorescence of calcein in live cells, b.) PARP inhibitor 3-amino-benzamide does not block puromycin induced cell death.
  • TRPM2-expressing HEK-293 cells were exposed to 0-50 ⁇ M puromycin for 16 h in the presence (open diamond) or absence (closed diamond) of 1.5 mM 3-aminobenzamide. Cell survival was determined as described in (a). Results (with standard deviations) are representative of two or more independent experiments.
  • Fig 4 a OAADPr gates the endogenous TRPM2 channel in CRI-Gl cells.
  • Right panel Representative leak subtracted whole cell I/V curves for peak currents observed in the absence (grey line) and presence (black line) of OAADPr.
  • CRI-Gl cells were maintained in the whole cell patch clamp configuration as previously described for HEK-293 cells (44).
  • Puromycin leads to cell death in CRI-Gl cells.
  • CRI-Gl cells were treated with 0-40 ⁇ M puromycin for 16 h.
  • Cell viability was assessed by measuring fluorescence of calcein in live cells. Data obtained from 4 independent experiments were plotted as a percent change in fluorescence compared to those of untreated cells set at a 100%. Error bars indicate the standard deviation from the mean.
  • FIG. 5 SiRNA knock down of endogenous SIRT2 and SIRT3 protein protects cells against puromycin-induced death.
  • TRPM2-expressing HEK-293 cells were transfected with 100 nM nonspecific control, SIRT2 or SIRT3 siRNA. After 48 h, cells were exposed to 0-50 ⁇ M puromycin for an additional 16 h. Cell survival was determined by measuring fluorescence of calcein in live cells, and plotted as a percent relative to the nonspecific siRNA control. Results are averages (with standard deviations) from 5 separate experiments, b-d). Detection of SIRT2 and SIRT3 expression in siRNA treated TRPM2-ex ⁇ ressing HEK-293 cells.
  • SIRT2 or SIRT3 siRNA were harvested and analyzed for knock down in SIRT2 and SIRT3 expression,
  • the presence of SIRT2 and SIRT3 transcripts was detected by RT-PCR.
  • the amount of total RNA used for RT-PCR was normalized to that of actin.
  • Endogenous SIRT2 protein levels were detected by Western blot using anti SIRT2 antibody
  • SIRT3 protein, detected by Western blot using anti SIRT3 antisera was detected in the mitochondrial but not the cytosolic fraction.
  • Nonselective cation channels like TRPM2, play a role in insulin secretion by regulating pancreatic beta-cell plasma membrane potential, Ca(2+) homeostasis, and thus glucose signaling and homeostasis (Qian F, Huang P, Ma L, Kuznetsov A, Tamarina N, Philipson LH. TRP genes: candidates for nonselective cation channels and store-operated channels in insulin-secreting cells. Diabetes. 2002 Feb;51 Suppl l:S183-9.) TRPM2 is expressed in human islets. As described herein, TRPM2 is activated by OAADPr in an insulinoma cell line.
  • TRPC-like channels and their activation by OAADPr-producing Sirtuin enzymes provide a mechanism for depolarization or Ca(2+) entry in beta-cells (insulin producing cells), which in turn modulates control of insulin secretion and overall glucose homeostasis.
  • the invention provides materials and methods for modulating glucose homeostasis.
  • Target cells for use in the disclosed methods include, without limitation, cancer cells, virally infected cells, B cells, T cells and macrophages.
  • Targeting immune cells for programmed cell death can have therapeutic value in the treatment of Alzheimer's disease, for example.
  • Silent information regulator 2 (Sir2) proteins or sirtuins are histone/protein deacetylases that regulate gene silencing, apoptosis, metabolism, and aging.
  • Sir2 proteins catalyze a unique protein deacetylation reaction that absolutely requires the co-enzyme NAD + and generates a novel metabolite O-acetyl-ADP ribose, OAADPr, whose function is unknown.
  • OAADPr directly activates the long transient receptor potential channel 2 (TRPM2), a Ca 2+ permeable nonselective ion channel.
  • TRPM2 channel over-stimulation by inhibiting the cellular breakdown of OAADPr leads to cell death, which is attenuated by a loss in endogenous levels of Sir2 homologues, SIRT2 and SIRT3.
  • SIRT2 and SIRT3 are attenuated by a loss in endogenous levels of Sir2 homologues, SIRT2 and SIRT3.
  • agents such as nicotinamide can be used effectively to reduce intracellular O-acetyl-ADP ribose levels. Nicotinamide or niacinamide is commercially available from Arco Pharmaceuticals Inc, Bohemia NY and from Sirius Laboratories Inc. Vernon HiIIs 5 IL.
  • nicotinamide or other inhibitors of sirtuin are also encompassed in the present invention.
  • Such methods effectively lower the production of O-acetyl-ADP ribose which in turn lowers activation of the TRPM2 channel thereby preventing beta-islet cell death.
  • agents which increase the intracellular concentration of O-acetyl-ADP -ribose i.e., prevent breakdown of endogenous O-acetyl-ADP-ribose or use of O- acetyl-ADP-ribose analogues acting as agonists or administration of purinomycin
  • Patch clamp electrophysiology was performed as previously described (23). Briefly, cells were patch clamped in the whole cell configuration at 25 0 C using pipettes with resistances ranging from 2-3 MOhms. Currents were recorded on an EPC9 patch clamp amplifier with automatic capacitance compensation using a protocol generating a 50 msec voltage ramp from -100 to +100 mv every two seconds at a holding potential of 0 mv (appropriately corrected for liquid junction potential). Bath solution included 150 mM NaCl, 2.8 mM KCl, 5 mM CsCl, 1 mM CaCl 2 , 2 mM MgCl 2 , and 10 mM Hepes (pH 7.2).
  • Pipette solution included 135 mM CsGlutamate, 1 mM MgCl 2 , 8 mM NaCl, 10 niM Hepes (pH 7.2), and 10 mM EGTA.
  • instantaneous currents at -80 mv were extracted from each ramp and plotted versus time.
  • HEK-293 and tetracycline (tet)-inducible HEK-293 TRPM2-ex ⁇ ressing cells (23) were cultured in DMEM and 10% FBS at 37°C, 5% CO 2 .
  • Media used to culture tet-inducible HEK-293 cells was supplemented with blasticidin (5 ⁇ g ml "1 ; Invitrogen) and zeocin (0.4 mg/ml; Invitrogen).
  • blasticidin 5 ⁇ g ml "1 ; Invitrogen
  • zeocin 0.4 mg/ml; Invitrogen
  • O-[ 3 H]AADPr was generated in a reaction including 50 mM Tris, 7.5, 1 mM DTT, 1 mM [ 3 H]-acetylated histone peptide, 700 ⁇ M NAD + , and Sir2 enzyme. After 60 min, NADase was added to degrade the remaining NAD + . The reaction was quenched in 1% TFA and O-[ 3 H]AADPr was separated from other components in the reaction by reversed phase HPLC (16, 19, 22, 26). Based on HPLC, MS and NMR analyses, the OAADPr is >95% pure.
  • Cytoplasmic and nuclear extracts were prepared from HEK-293 cells as previously described (22). To detect esterase activity (22), cytoplasmic extract was incubated with 200 ⁇ M O- [ 3 H]AADPr in the presence of 0-100 ⁇ M puromycin for 30 min. Activated charcoal slurry in PBS 5 pH 7.0 was added to quench the reaction and bind O- [ 3 H]AADPr. Samples were vortexed and centrifuged. Aliquots of the supernatant containing [ 3 H] acetate were removed and analyzed by liquid scintillation counting.
  • nuclear extract was incubated with 200 ⁇ M O-[ 3 H]AADPr in the presence or absence of 100 ⁇ M puromycin for 60 min. The reaction was terminated by addition of TFA to 1%. Samples were injected onto a Beckman Biosys 510 HPLC system and a Vydac Cl 8 (1.0 A- 25 mm) small pore preparative column (Vydac, Hesperia, CA) as previously described (22). Radioactivity in each elution fraction was measured by liquid scintillation counting.
  • HEK-293, tet-inducible HEK-293, and CRI-Gl cells were seeded into 6 well plates at a density of 500,000 cells per well. When cells were 50-70% confluent, puromycin was added to the media at various concentrations for 16 hours. Cell monolayers were rinsed with PBS, after which 0.5 ml of 2 ⁇ M calcein in PBS was added directly to the well for 10-20 minutes. Calcein is retained in living, but not dead cells, where it undergoes catalytic conversion into a fluorescent compound Fluorescence in each well was measured in a microplate reader using excitation and emission filters at 485/530 nm, respectively.
  • MALDI mass spectrometry was performed at the Environmental Health Sciences Center, Oregon State University as described previously (16). Cell monolayers were washed with PBS, pH 7.4 and scraped off the culture dish. Cells were sedimented, rinsed with PBS, and sedimented again at 16,000 x g for 20 s at 4°C. The pellet was resuspended in 0.05% TFA/H 2 O. The suspension was vortexed, and incubated on ice, interspersed by 5 quick bursts of sonication. Cellular debris was removed by centrifugation, and the supernatant stored at -20°C, prior to reverse phase HPLC analysis.
  • RNA was reverse transcribed using random hexamers and AMV-RT (Promega).
  • the RT reaction was used as a template for PCR amplification of SIRT2 or SIRT3 using primer pairs: 5 'CAGAAC ATAGATAC CCTGGAGCGAA (SEQ ID NO: 1) and 5 'AAGGTCCTCCAGCTCCTTCTTC (SEQ ID NO: 2); and 5'TGAGAGAGTGTCGGGC ATCCCTG (SEQ ID NO: 3) and 5'TCATCCTATTTGTCTGGTCCATCAA (SEQ ID NO: 4) , respectively.
  • 5'ATGTCACGCACGATTTCC (SEQ ID NO: 6) were used to amplify actin which served as an internal PCR co"trol.
  • SIRT2 and SIRTi protein were lysed in 50 mM Tris-HCl pH 8.0, 150 mM sodium chloride, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM PMSF 5 1 Oug/ml aprotinin and 1 Oug/ml leupeptin. Cytosolic and mitochondrial fractions were separated using a mito-chondrial isolation kit (Pierce) according to manufacturer's instructions. SIRT2 and SIRT3 protein was detected by standard Western blot protocol using chicken anti SIRT2 antibody (12) and rabbit anti SIRT3 antisera (14) respectively (Antibodies were felicitly provided by Dr. Eric Verdin, UCSF).
  • puromycin could substantially inhibit the cytosolic esterase activity in HEK-293 cells at 5 ⁇ M puromycin. By 80 ⁇ M the esterase activity was completely inhibited by puromycin. In contrast, 100 ⁇ M puromycin had no effect on the nuclear OAADPr-metabolizing activity in HEK-293 cells (Fig Ie), demonstrating the specificity of puromycin toward the OAADPr esterase. By inhibiting the cytoplasmic breakdown of OAADPr, puromycin provided a pharmalogical tool to elevate OAADPr levels and examine its effect on TRPM2 channel activity.
  • Sir2 homologs are expressed in HEK-293 cells, as protein extracts display NAD + -dependent histone deacetylase activity that is inhibited by nicotinamide (data not shown).
  • HEK-293 cells either treated or mock-treated with puromycin were analyzed for the presence of OAADPr, using HPLC fractionation and mass spectrometry. Detection of OAADPr in mock-treated cells was negligible, whereas puromycin-treated cells displayed significantly detectable levels of OAADPr (Fig If and Ig). Although direct quantitation was not possible, these results provide the first evidence that OAADPr is produced in cells.
  • TRPM2 expression When TRPM2 expression was not induced by tet, the cells exhibited nearly complete protection against puromycin-dependent cell death. Some cell death was observed at the highest puromycin level (50 ⁇ M), attributable to some leaky expression of the TRPM2 construct. Full activation of the TRPM2 channel was shown previously to be Ca 2+ dependent (29-31). To directly show that the observed cell death through TRPM2 was dependent on Ca 2+ , puromycin induced cell death was assessed in Ca 2+ -free media. The removal of Ca 2+ before puromycin treatment completely blocked puromycin-induced cell death in TRPM2 expressing cells (Fig 2b). These results demonstrate that TRPM2 and Ca 2+ are critical for puromycin-dependent cell death in our inducible TRPM2 expression HEK-293 system.
  • Nicotinamide (B3 vitamin) is a potent inhibitor of Sir2 homologues (14, 33, 34). The inhibition results from trapping an enzyme intermediate, a common step in the mechanism of all Sir2 enzymes (35, 36).
  • nicotinamide treatment or genetic manipulation of endogenous nicotinamide levels were shown to directly affect Sir2 function (37).
  • nicotinamide 500 ⁇ M could completely protect puromycin-induced cell death up to concentrations as high as 20 ⁇ M puromycin (Fig 3 a). Only at much higher puromycin (50 ⁇ M) could the protection afforded by nicotinamide be suppressed.
  • CRI-Gl cells are a rat beta-islet tumor cell line (insulinoma), where the endogenous TRPM2 channel has been well-characterized (29, 30, 39, 40).
  • insulinoma rat beta-islet tumor cell line
  • inclusion of OAADPr in the patch pipette induced evolution of average currents of c.a. 2 nA with a highly linear ITV relationship characteristic of TRPM2.
  • RNA interference was used to knockdown the endogenous messenger RNA and protein levels, and the resulting effect on puromycin-induced cell death was assessed.
  • the TRPM2 Ca 2+ -permeable channel can be activated by oxidative stress (H 2 O 2 ) (25, 42, 43) and ADP-ribose (24, 25, 44), and confers susceptibility to cell death (42).
  • TRPM2 is highly expressed in rat microglia (25), and has been described in neutrophil granulocytes, a monocytic cell line U937 (24, 44), rat insulinoma cell lines (39, 42) and pancreatic ⁇ -cells (45, 46).
  • puromycin treatment leads to specific pancreatic cell death, an effect that was not the result of inhibition of protein synthesis (47).
  • the molecular basis for this susceptibility was not knc TI.
  • puromycin selectively targets TRPM2 expressing cells, causing an influx of Na 2+ /Ca 2+ and subsequent cell death.
  • prophylactic treatment with nicotinamide has been shown to suppress the development of diabetes in several animal models by protecting insulin-producing ⁇ -cells from destruction by diabetogenic agents (alloxan and streptozotocin) that induce reactive oxygen species (48).
  • diabetogenic agents alloxan and streptozotocin
  • the susceptibility of ⁇ -cells to alloxan and other oxidative insults has been linked to the overactivation of TRPM2 channels (39). Oxidative stress or other cellular insults like puromycin could trigger a stress response through several mechanisms that utilimately lead to activation of the TRPM2 channel.
  • TRPM2 is expressed in human islets, and we have shown herein that TRPM2 is activated by OAADPr in an insulinoma cell line.
  • TRPC-like channels and their activation by 0 AADPr- producing Sirtuin enzymes provide ⁇ mechanism for depolarization or Ca 2+ entry in beta-cells (insulin producing cells), which could lead to the control of insulin secretion and overall glucose homeostasis.
  • the Sir2p homolog in the yeast K. lactis was shown to regulate either the intake or efflux of a subset of divalent metal cations, suggesting that Sir2p has a role in cation transport in that organism (5J).
  • OAADPr adds to the list of NAD + -derived second messengers (including ADPr, cyclic- ADPr and NAAD(P)) that regulate Ca 2+ signaling/release (55).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Compositions and methods are disclosed which are effective for modulating glucose homeostasis, calcium ion flux and cell death in target cells.

Description

COMPOSITIONS AND METHODS FOR
MODULATING CALCIUM FLUX, GLUCOSE HOMEOSTASIS AND APOPTOSIS By John M. Denu
Andrew M. Scharenberg
This application claims priority to US Provisional Application 60/589,269 filed July 20, 2004, the entire disclosure of which is incorporated herein by reference.
Pursuant to 35 U.S.C. §202(c), it is acknowledged that the U.S. Government has certain rights in the invention described herein, which was made in part with funds from the National Institutes of Health, Grant Number GM65386 and GM64091.
FIELD OF THE INVENTION
This invention relates to the fields of biochemistry, aging, diabetes and oncology. More specifically, the present invention provides compositions and methods for modulating cell death (e.g., apoptosis) in target cells, particularly cancer cells. The invention also provides compositions and methods for modulating calcium flux thereby maintaining glucose homeostasis.
BACKGROUND OF THE INVENTION
Several publications are referenced in this application by numbers in parentheses in order to more fully describe the state of the art to which this invention pertains. The disclosure of each of these publications is incorporated by reference herein. Silent information regulator 2 (Sir2) proteins (also referred to as sirtuins) are well conserved across all kingdoms of life and are implicated in the control of gene silencing, apoptosis, metabolism, and aging (1-6). Sir2 is required for life-span increases in yeast, flies and worms caused by caloric restriction or by natural antioxidants (e.g. resveratrol) (7, 8). Among the i seven mammalian Sir2 homologs, SIRT1/Sir2alpha regulates skeletal muscle differentiation (9), represses damage-responsive Forkhead transcription factors (3, 4), negatively controls p53 to promote cell survival under stress (reviewed in (10)), and promotes fat mobilization in white adipocytes (11). Human SIRT2 is associated with microtubules in the cytoplasm and can deacetylate alpha-tubulin (12). Though the role of mitochrondrial SIRT3 is unknown (13, 14), variability of the human SIRT3 gene is associated with survivorship in the elderly (15).
Sir2 proteins catalyze a unique protein deacetylation reaction that requires the co-enzyme NAD+, a key intermediate in energy metabolism. In this reaction, nicotinamide (vitamin B3) is liberated from NAD+ and the acetyl -group of substrate is transferred to cleaved NAD+, generating a novel metabolite O-acetyl-ADP ribose, OAADPr (16-20). Although genetic studies have linked Sir2 to diverse phenotypes, few reports have investigated the biological function(s) of OAADPr and its possible connection with the observed Sir2-dependent biology. It has been suggested that OAADPr might be a substrate for other linked enzymatic processes, an allosteric regulator, or a second messenger. The first report of bio-activity came from the observation that OAADPr injected into starfish oocytes or blastomeres caused a block/delay in maturation and cell division, respectively (21). Enzymes capable of metabolizing OAADPr have been detected in several diverse cells (22). In vitro, select members of the ADP-ribose hydrolase (Nudix) family of enzymes (e.g., mNudT5 and yeast YSAl) are capable of efficient hydrolysis of OAADPr, while others like human Nudt9 are not (22). Interestingly, the long transient receptor potential channel 2 (TRPM2) has been shown to contain a C-terminal Nudix box (23). This Nudix motif is proposed to bind
ADP-ribose, stimulating the Ca channel activity of TRPM2 by initiating conformational changes leading to the opening of the channel pore (23-25). These findings prompted us to examine whether the TRPM2 ADP ribose gated Ca2+ channel could be activated/regulated by OAADPr. SUMMARY OF THE INVENTION
In accordance with the present invention, materials and methods are provided for modulating calcium flux, glucose homeostasis and apoptosis.
In one embodiment, a method for modulating glucose homeostasis in a patient in need thereof is provided. An exemplary method entails contacting an islet cell with an effective amount of an agent that increases intracellular levels of O-acetyl-ADP-ribose or inhibits the breakdown thereof, the increase O-acetyl ADP ribose concentration resulting in cellular depolarization and/or Ca2+ entry which modulates insulin secretion from said cell. An agent suitable for use in the method comprises puromycin.
Alternatively, the agent may be a functional analog of O-acetyl -ADP-ribose. In an alternative embodiment, the method further comprises administration of an agent which inhibits sirtuin activity thereby preventing islet cell death in the patient. Exemplary agents for this purpose comprise nicotinamide. In yet another embodiment of the invention, a composition comprising nicotinamide for inhibiting beta cell apoptosis induced by elevated levels of O-acetyl- ADP-ribose is provided. Additionally, a composition for modulating O-acetyl-ADP-ribose levels in a cell is disclosed. An exemplary composition for this purpose comprises puromycin and nicotinamide in a pharmaceutically acceptable carrier.
Another embodiment of the invention entails a method for modulating cell death in a target cell. An exemplary method entails contacting a cell comprising O-acetyl-ADP-ribose and the long transient receptor potential channel 2 (TRPM2) with an agent which inhibits breakdown or increases intracellular concentrations of said O-acetyl-ADP-ribose to levels sufficient to induce cell death in said target cell. It has been discovered in accordance with the present invention that the increase in the intracellular concentration of O-acetyl-ADP-ribose induces persistent opening of the long transient receptor potential channel 2 (TRPM2) and thereby disrupts intracellular calcium homeostasis and inducing cell death in the target cell. The method optionally comprises contacting the cell with a second agent suspected of modulating TRPM2 activity, and assessing the effect of said agent on a said activity. Activities that may be assessed in accordance with the invention include, without limitation, modulation of cell death induced by puromycin administration, ion transport, conductivity of plasma membrane, and intracellular calcium mobilization and insulin secretion. The method may also entail contacting the cell with a second agent suspected of modulating TRPM2 channel activity and assessing the effect of said second agent on sirtuin-dependent cell death, the second agent optionally being nicotinamide.
Also encompassed within the present invention are siRNA molecules which are effective to downregulate sirtuin mRNA production.
In yet another aspect, a method for identifying agents which regulate TRPM2 channel opening is provided. An exemplary method comprises contacting a cell with an agent which modulates intracellular concentration of O-acetyl-ADP-ribose and determining the effect of said agen* on said channel opening as a function of ion flux into said cell, agents which alter said ion flux being effective to gate the TRPM2 channel. In a preferred embodiment, the cell to be contacted is a beta islet cell and the method further comprises determining the effect of the agent on insulin secretion. Optionally, the cell is present in an animal and the method further comprises determining the effect of the agent on glucose homeostasis in the animal.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1. a-c demonstrate that the TRPM2 channel is gated by OAADPr in tet- induced HEK-293 cells. Shown is the development of whole cell currents over time in TRPM2-expressing HEK-293 cells. Bath solution was standard ringer's, and pipette solution was Cs-based and included 10 mM EGTA to buffer intracellular Ca2+ to 10 nM. The patch pipette contained various concentrations of (Fig. Ia) ADPr, (Fig. Ib) OAADPr (Fig. Ic) OAADPr and puromycin as indicated in the figure. Fig. Id.) Cytoplasmic OAADPr esterase activity is inhibited by puromycin. 200 μM O- [3H]AADPr and 0-100 μM puromycin were added to cytoplasmic HEK-293 extract for 30 min. Percent hydrolysis of O-[3H]AADPr to [3H]acetate was measured as described hereinbelow. Fig. Ie.) Nuclear OAADPr acetyltransferase activity is not inhibited by puromycin. HEK-293 nuclear extract was incubated with 200 μM O-[3H]AADPr in the presence or absence of 100 μM puromycin for 60 min. The reactions were quenched and resolved by HPLC. The radioactivity in collected fractions was determined by liquid scintillation counting. Figs. lf-g.) In vivo detection of OAADPr. Mass spectrum of HEK-293 generated OAADPr (peak m/z of 602.0894; the theoretical m/z for OAADPr is 602.0895) after puromycin treatment, with authentic [13C]-OAADPr (peak m/z of 603.0851 and isotopic distribution of 604.0878 and 605.0928) as a standard. Peak 599.3691 is from the matrix. Figure \g shows two control data sets (no puromycin added), where the 602 peak is not distinguishable above the background.
Figures 2 a-c demonstrate that puromycin leads to cell death in TRPM2- expressing HEK-293 cells. Shown are HEK-293 cells (closed diamond) and HEK-293 cells stably transfected with a tet-controlled TRPM2 construct in the presence (open squares) or absence of (open diamor is) tetracycline. Cells incubated in the presence of 0-50 μM puromycin for 16 h were assayed for viability by measuring fluorescence of calcein in live cells, b.) Removal of calcium rescues cells from puromycin induced cell death. TRPM2-expressing HEK-293 cells were grown in complete DMEM media and 1 μg/ml tetracycline until 80-90% confluent. One set of cells were re-fed with the same complete media (closed diamonds) and the other set of cells were rinsed with PBS and fed with modified media containing 1 μg/ml tetracycline, 5 niM EGTA and without calcium chloride (open squares). One hour after calcium removal, cells were incubated in 0-500 μM puromycin for 6 hours after which cell viability was measured, c.) TRPM2 expression in HEK-293 cells does not lead to preferential sensitivity to cycloheximide. HEK-293 (close diamond) and TRPM2 expressing HEK-293 cells in the absence (open diamond) or presence of (closed square) tetracycline were exposed to 0-10 μg/ml cycloheximide for 16 h. Cell viability was determined as described in (a).
Figure 3. a.) Nicotinamide blocks puromycin induced cell death in TRPM2 expressing cells. TRPM2-expressing HEK-293 cells were exposed to 0-50 μM puromycin for 16 h in the presence (open diamond) or absence (closed diamond) of 500 μM nicotinamide. Cell survival was determined by measuring fluorescence of calcein in live cells, b.) PARP inhibitor 3-amino-benzamide does not block puromycin induced cell death. TRPM2-expressing HEK-293 cells were exposed to 0-50 μM puromycin for 16 h in the presence (open diamond) or absence (closed diamond) of 1.5 mM 3-aminobenzamide. Cell survival was determined as described in (a). Results (with standard deviations) are representative of two or more independent experiments.
Fig 4 a) OAADPr gates the endogenous TRPM2 channel in CRI-Gl cells. Left panel: Evolution of currents in CRI-Gl cells in the absence (grey squares) or presence (black circles) of OAADPr (120-250 μM). Shown are average leak subtracted currents from n=3 cells for each condition. Right panel: Representative leak subtracted whole cell I/V curves for peak currents observed in the absence (grey line) and presence (black line) of OAADPr. For the above measurements, CRI-Gl cells were maintained in the whole cell patch clamp configuration as previously described for HEK-293 cells (44). b) Puromycin leads to cell death in CRI-Gl cells. CRI-Gl cells were treated with 0-40 μM puromycin for 16 h. Cell viability was assessed by measuring fluorescence of calcein in live cells. Data obtained from 4 independent experiments were plotted as a percent change in fluorescence compared to those of untreated cells set at a 100%. Error bars indicate the standard deviation from the mean. (Inset) Nicotinamide rescues puromycin-induced death in CRI-Gl cells. CRI-Gl monolayers were treated with 0, 0.5, 2, 4, 10 or 20 mM nicotinamide. After 30 minutes, puromycin was added to the media at a final concentration of 20 μM. Cell viability was assessed 16 h later as described above. Data are representative of two independent experiments performed in duplicate.
Figure 5. a.) SiRNA knock down of endogenous SIRT2 and SIRT3 protein protects cells against puromycin-induced death. TRPM2-expressing HEK-293 cells were transfected with 100 nM nonspecific control, SIRT2 or SIRT3 siRNA. After 48 h, cells were exposed to 0-50 μM puromycin for an additional 16 h. Cell survival was determined by measuring fluorescence of calcein in live cells, and plotted as a percent relative to the nonspecific siRNA control. Results are averages (with standard deviations) from 5 separate experiments, b-d). Detection of SIRT2 and SIRT3 expression in siRNA treated TRPM2-exρressing HEK-293 cells. Cells treated for 48 h with 100 nM control, SIRT2 or SIRT3 siRNA were harvested and analyzed for knock down in SIRT2 and SIRT3 expression, (b) The presence of SIRT2 and SIRT3 transcripts was detected by RT-PCR. The amount of total RNA used for RT-PCR was normalized to that of actin. (c) Endogenous SIRT2 protein levels were detected by Western blot using anti SIRT2 antibody, (d) SIRT3 protein, detected by Western blot using anti SIRT3 antisera, was detected in the mitochondrial but not the cytosolic fraction.
DETAILED DESCRIPTION OF THE INVENTION
Nonselective cation channels, like TRPM2, play a role in insulin secretion by regulating pancreatic beta-cell plasma membrane potential, Ca(2+) homeostasis, and thus glucose signaling and homeostasis (Qian F, Huang P, Ma L, Kuznetsov A, Tamarina N, Philipson LH. TRP genes: candidates for nonselective cation channels and store-operated channels in insulin-secreting cells. Diabetes. 2002 Feb;51 Suppl l:S183-9.) TRPM2 is expressed in human islets. As described herein, TRPM2 is activated by OAADPr in an insulinoma cell line. TRPC-like channels and their activation by OAADPr-producing Sirtuin enzymes provide a mechanism for depolarization or Ca(2+) entry in beta-cells (insulin producing cells), which in turn modulates control of insulin secretion and overall glucose homeostasis. Thus, in one aspect the invention provides materials and methods for modulating glucose homeostasis.
In yet another aspect, it has been discovered that elevation in O-acetyl-ADP ribose to toxic levels triggers apoptotic cell death. The methods described herein are useful for inducing cell death in targeted cell types and should have therapeutic value in treating disorders associated with aberrant cell proliferation, such as cancer. Target cells for use in the disclosed methods include, without limitation, cancer cells, virally infected cells, B cells, T cells and macrophages. Targeting immune cells for programmed cell death can have therapeutic value in the treatment of Alzheimer's disease, for example.
Silent information regulator 2 (Sir2) proteins or sirtuins are histone/protein deacetylases that regulate gene silencing, apoptosis, metabolism, and aging. Sir2 proteins catalyze a unique protein deacetylation reaction that absolutely requires the co-enzyme NAD+ and generates a novel metabolite O-acetyl-ADP ribose, OAADPr, whose function is unknown. Here we show that OAADPr directly activates the long transient receptor potential channel 2 (TRPM2), a Ca2+ permeable nonselective ion channel. TRPM2 channel over-stimulation by inhibiting the cellular breakdown of OAADPr leads to cell death, which is attenuated by a loss in endogenous levels of Sir2 homologues, SIRT2 and SIRT3. These data provide the further evidence for the existence of cellular OAADPr and its potential role in controlling the TRPM2 channel, whose activity is known to confer susceptibility to cell death by oxidative stress and diabetogenic agents. Notably, agents such as nicotinamide can be used effectively to reduce intracellular O-acetyl-ADP ribose levels. Nicotinamide or niacinamide is commercially available from Arco Pharmaceuticals Inc, Bohemia NY and from Sirius Laboratories Inc. Vernon HiIIs5IL. Thus, methods for preventing of the onset of Type I Diabetes by use of nicotinamide or other inhibitors of sirtuin (e.g., Sir SiRNAs) are also encompassed in the present invention. Such methods effectively lower the production of O-acetyl-ADP ribose which in turn lowers activation of the TRPM2 channel thereby preventing beta-islet cell death. On the other hand, if insufficient insulin production is due to abnormally low TRPM2 activity in beta cells, then agents which increase the intracellular concentration of O-acetyl-ADP -ribose (i.e., prevent breakdown of endogenous O-acetyl-ADP-ribose or use of O- acetyl-ADP-ribose analogues acting as agonists or administration of purinomycin) would be useful for modulating insulin secretion by these cells and maintaining proper blood glucose levels.
The following materials and methods are provided to facilitate the practice of the present invention.
Channel gating. Patch clamp electrophysiology was performed as previously described (23). Briefly, cells were patch clamped in the whole cell configuration at 25 0C using pipettes with resistances ranging from 2-3 MOhms. Currents were recorded on an EPC9 patch clamp amplifier with automatic capacitance compensation using a protocol generating a 50 msec voltage ramp from -100 to +100 mv every two seconds at a holding potential of 0 mv (appropriately corrected for liquid junction potential). Bath solution included 150 mM NaCl, 2.8 mM KCl, 5 mM CsCl, 1 mM CaCl2, 2 mM MgCl2, and 10 mM Hepes (pH 7.2). Pipette solution included 135 mM CsGlutamate, 1 mM MgCl2, 8 mM NaCl, 10 niM Hepes (pH 7.2), and 10 mM EGTA. For low-resolution presentation of current development over the course of the experiment, instantaneous currents at -80 mv were extracted from each ramp and plotted versus time.
Cell culture. HEK-293 and tetracycline (tet)-inducible HEK-293 TRPM2-exρressing cells (23) were cultured in DMEM and 10% FBS at 37°C, 5% CO2. Media used to culture tet-inducible HEK-293 cells was supplemented with blasticidin (5 μg ml"1; Invitrogen) and zeocin (0.4 mg/ml; Invitrogen). To induce expression of TRPM2 in recombinant HEK-293 cells, tetracycline was added to the media at 1 μg ml"1 (Invitrogen) 24 h prior to experiments. The CRI-Gl rat β-islet tumor cell line was obtained from EACC and cultured in DMEM, 10% FBS and 2 mM glutamine.
Synthesis and Purification Of O-[3H]AADPr. As previously described (16, 19, 22, 26), O-[3H]AADPr was generated in a reaction including 50 mM Tris, 7.5, 1 mM DTT, 1 mM [3H]-acetylated histone peptide, 700 μM NAD+, and Sir2 enzyme. After 60 min, NADase was added to degrade the remaining NAD+. The reaction was quenched in 1% TFA and O-[3H]AADPr was separated from other components in the reaction by reversed phase HPLC (16, 19, 22, 26). Based on HPLC, MS and NMR analyses, the OAADPr is >95% pure.
Conversion assays with 0 AADPr. Cytoplasmic and nuclear extracts were prepared from HEK-293 cells as previously described (22). To detect esterase activity (22), cytoplasmic extract was incubated with 200 μM O- [3H]AADPr in the presence of 0-100 μM puromycin for 30 min. Activated charcoal slurry in PBS5 pH 7.0 was added to quench the reaction and bind O- [3H]AADPr. Samples were vortexed and centrifuged. Aliquots of the supernatant containing [3H] acetate were removed and analyzed by liquid scintillation counting. To detect nuclear OAADPr metabolizing activity (22), nuclear extract was incubated with 200 μM O-[3H]AADPr in the presence or absence of 100 μM puromycin for 60 min. The reaction was terminated by addition of TFA to 1%. Samples were injected onto a Beckman Biosys 510 HPLC system and a Vydac Cl 8 (1.0 A- 25 mm) small pore preparative column (Vydac, Hesperia, CA) as previously described (22). Radioactivity in each elution fraction was measured by liquid scintillation counting.
Cell viability assays. HEK-293, tet-inducible HEK-293, and CRI-Gl cells were seeded into 6 well plates at a density of 500,000 cells per well. When cells were 50-70% confluent, puromycin was added to the media at various concentrations for 16 hours. Cell monolayers were rinsed with PBS, after which 0.5 ml of 2 μM calcein in PBS was added directly to the well for 10-20 minutes. Calcein is retained in living, but not dead cells, where it undergoes catalytic conversion into a fluorescent compound Fluorescence in each well was measured in a microplate reader using excitation and emission filters at 485/530 nm, respectively.
Matrix-assisted Laser Desorption ionization Mass Spectrometry Analyses. MALDI mass spectrometry was performed at the Environmental Health Sciences Center, Oregon State University as described previously (16). Cell monolayers were washed with PBS, pH 7.4 and scraped off the culture dish. Cells were sedimented, rinsed with PBS, and sedimented again at 16,000 x g for 20 s at 4°C. The pellet was resuspended in 0.05% TFA/H2O. The suspension was vortexed, and incubated on ice, interspersed by 5 quick bursts of sonication. Cellular debris was removed by centrifugation, and the supernatant stored at -20°C, prior to reverse phase HPLC analysis.
Knockdown of SIRT2 and SIRT3 transcription using siRNA. Tet- inducible HEK-293 cells were transfected with 100 nM control, SIRT2 or SIRT3 siRNA (Dharmacon) using Trans-IT TKO transfection reagent (Minis). After 24 hours, TRPM2 expression was induced by adding tetracycline to the media. 48 hours post transfection, one set of cells was harvested and analyzed for SIRT expression as described below, and the rest were treated with puromycin for an additional 16 h and assayed for viability. Analysis ofSIRT2 and SIRT3 transcripts by RT-PCR. Total RNA was isolated from harvested cells using TRIzol Reagent (Invitrogen). RNA was reverse transcribed using random hexamers and AMV-RT (Promega). The RT reaction was used as a template for PCR amplification of SIRT2 or SIRT3 using primer pairs: 5 'CAGAAC ATAGATAC CCTGGAGCGAA (SEQ ID NO: 1) and 5 'AAGGTCCTCCAGCTCCTTCTTC (SEQ ID NO: 2); and 5'TGAGAGAGTGTCGGGC ATCCCTG (SEQ ID NO: 3) and 5'TCATCCTATTTGTCTGGTCCATCAA (SEQ ID NO: 4) , respectively. Primers 5'GGCACCA CACCTTATACAAT (SEQ ID NO: 5) and
5'ATGTCACGCACGATTTCC (SEQ ID NO: 6) were used to amplify actin which served as an internal PCR co"trol.
Detection ofSIRT2 and SIRTi protein by Western blot analysis. Cells were lysed in 50 mM Tris-HCl pH 8.0, 150 mM sodium chloride, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM PMSF5 1 Oug/ml aprotinin and 1 Oug/ml leupeptin. Cytosolic and mitochondrial fractions were separated using a mito-chondrial isolation kit (Pierce) according to manufacturer's instructions. SIRT2 and SIRT3 protein was detected by standard Western blot protocol using chicken anti SIRT2 antibody (12) and rabbit anti SIRT3 antisera (14) respectively (Antibodies were graciously provided by Dr. Eric Verdin, UCSF).
The following example is provided to illustrate an embodiment of the invention. It is not intended to limit the invention in any way.
EXAMPLE 1
To test whether OAADPr could indeed regulate the TRPM2 channel, electrophysiology studies were performed in TRPM2-expressing HEK-293 cells. We found that inclusion of OAADPr in the patch pipette solution induces TRPM2 gating with similar kinetics and dose dependence to that of ADP-ribose in whole cell recordings (Fig. Ia and Ib). It is important to note that OAADPr exists in an -50:50 equilibrium between 2'-OAADPr and 3'- OAADPr (18, 19). If TRPM2 exhibits regio-selective binding for just one of the OAADPr forms, then the dosage-dependence for that form would be twice as potent as that observed in Fig 1. The spontaneous breakdown of OAADPr to ADPr in the patch pipette was <5-10 % in multiple experiments. These results provide initial evidence that OAADPr is capable of acting as a physiological regulator of TRPM2.
In an effort to identify pharmacological compounds that could inhibit the breakdown of cellular OAADPr and provide a physiological link between channel activity and OAADPr levels, we searched for compounds structurally similar to OAADPr. We identified (Fig Id) the anti-tumor antibiotic puromycin (27, 28). In mammalian cells, at least two major OAADPr metabolizing activities have been reported, a cytosolic esterase and a nuclear acety ^transferase (22). Using these previously described OAADPr-consuming activity assays (22), we found that puromycin was a potent inhibitor of the OAADPr esterase, but not of the nuclear acetyltransferase activity (Fig Id and Ie). As shown in Fig 2d, puromycin could substantially inhibit the cytosolic esterase activity in HEK-293 cells at 5 μM puromycin. By 80 μM the esterase activity was completely inhibited by puromycin. In contrast, 100 μM puromycin had no effect on the nuclear OAADPr-metabolizing activity in HEK-293 cells (Fig Ie), demonstrating the specificity of puromycin toward the OAADPr esterase. By inhibiting the cytoplasmic breakdown of OAADPr, puromycin provided a pharmalogical tool to elevate OAADPr levels and examine its effect on TRPM2 channel activity. Sir2 homologs are expressed in HEK-293 cells, as protein extracts display NAD+-dependent histone deacetylase activity that is inhibited by nicotinamide (data not shown). To demonstrate that puromycin could increase the cellular levels of OAADPr, HEK-293 cells either treated or mock-treated with puromycin were analyzed for the presence of OAADPr, using HPLC fractionation and mass spectrometry. Detection of OAADPr in mock-treated cells was negligible, whereas puromycin-treated cells displayed significantly detectable levels of OAADPr (Fig If and Ig). Although direct quantitation was not possible, these results provide the first evidence that OAADPr is produced in cells.
Next, using an inducible tetracycline (tet) expression system for TRPM2 stably transfected HEK-293 cells (23), we examined whether puromycin could activate the channel through the accumulation of OAADPr. To verify that puromycin did not directly gate the TRPM2 channel, whole cell channel recordings were performed with 100 μM puromycin alone, which showed no affect on channel activity (data not shown). Also, there was no significant enhancement of OAADPr gated TRPM2 channel activity in whole cell recordings when 125-250 μM puromycin was included in the patch pipette (Fig Ic). In addition to demonstrating that puromycin does not directly gate TRPM2, this result further supports the contention that OAADPr, and not the breakdown product ADPr, is the direct ligand in the recordings obtained in the absence of puromycin (Fig Ib).
We predicted that if the TRPM2 channel exhibited sustained activation in HEK-293 cells treated with puromycin, then the influx of Na+ and Ca2+ should result in cell death through the loss of ionic homeostasis. To examine this prediction, we performed a series of cell survival studies with the TRPM2 stably transfected HEK-293 cells following puromycin treatment. Parental HEK-293 cells showed no significant cell death following puromycin treatment (5-50 μM) (Fig 2a). In contrast, HEK-293 cells harboring the TRPM2 channel from tet-induced expression displayed a profound sensitivity to cell death with as little as 5 μM puromycin (Fig 2a), following a strong dose-dependence up to 50 μM puromycin. When TRPM2 expression was not induced by tet, the cells exhibited nearly complete protection against puromycin-dependent cell death. Some cell death was observed at the highest puromycin level (50 μM), attributable to some leaky expression of the TRPM2 construct. Full activation of the TRPM2 channel was shown previously to be Ca2+ dependent (29-31). To directly show that the observed cell death through TRPM2 was dependent on Ca2+, puromycin induced cell death was assessed in Ca2+-free media. The removal of Ca2+ before puromycin treatment completely blocked puromycin-induced cell death in TRPM2 expressing cells (Fig 2b). These results demonstrate that TRPM2 and Ca2+ are critical for puromycin-dependent cell death in our inducible TRPM2 expression HEK-293 system.
Because puromycin is known to also inhibit protein translation, we examined whether inhibition of protein synthesis is responsible for the TRPM2-dependent cell death, perhaps through the loss of a protein involved in negatively regulating the channel. We tested whether cycloheximide, a strong inhibitor of translation, had the same effect as puromycin. As displayed in Fig 2c, cells expressing TRPM2 exhibited no significant increased sensitivity to cycloheximide compared to the same cells that did not over-express the channel. Parental HEK-293 cells showed a similar dose- dependence of cell death to cycloheximide treatment (Fig 2c). These data suggest that channel activation following puromycin treatment is not due to inhibition of translation, but rather, that puromycin leads to an accumulation of OAADPr levels, which can activate the TRPM2 channel.
Human cells contain the genes for at least 7 Sir2 homologs (52). To evaluate a link between Sir2 activity and TRPM2, we sought an approach that could down-regulate the activity of all Sir2-like proteins. Nicotinamide (B3 vitamin) is a potent inhibitor of Sir2 homologues (14, 33, 34). The inhibition results from trapping an enzyme intermediate, a common step in the mechanism of all Sir2 enzymes (35, 36). In yeast, nicotinamide treatment or genetic manipulation of endogenous nicotinamide levels were shown to directly affect Sir2 function (37). We investigated whether nicotinamide could protect TRPM2 expressing cells from puromycin-induced cell death, by preventing the production of OAADPr from endogenous Sir2 proteins.
Indeed, nicotinamide (500 μM) could completely protect puromycin-induced cell death up to concentrations as high as 20 μM puromycin (Fig 3 a). Only at much higher puromycin (50 μM) could the protection afforded by nicotinamide be suppressed. These results suggest that the gating of the TRPM2 channel by OAADPr is a Sir2-dependent event. Although nicotinamide is also reported to inhibit PARP (38), the PARP inhibitor 3- aminobenzamide had no effect on the puromycin-induced cell death (Fig 3 b).
Next, we sought to substantiate our observations of OAADPr-gated TRPM2 activity using the genetically unmodified cell line, CRI-Gl. CRI-Gl cells are a rat beta-islet tumor cell line (insulinoma), where the endogenous TRPM2 channel has been well-characterized (29, 30, 39, 40). As shown in Fig 4a (left and right panels), inclusion of OAADPr in the patch pipette induced evolution of average currents of c.a. 2 nA with a highly linear ITV relationship characteristic of TRPM2. Importantly, essentially no current evolution occurred in the absence of (9AADPr, and the evolution of the OAADPr-induced currents occurred over a time course consistent with diffusional equilibration of OAADPr into the cell from the patch pipette. Overall, these results are most simply interpreted as due to direct OAADPr- mediated gating of endogenous TRPM2 channels in CRI-Gl cells. Supporting the physiologic relevance of OAADPr in inducing TRPM2 gating, puromycin treatment of CRI-Gl cells lead to their dose-dependent death which could be blocked by the Sir2 inhibitor nicotinamide (Fig 4B). To identify which Sir2 enzymes were involved in production of
OAADPr mediating puromycin-induced TRPM2 channel gating, we examined whether two likely candidates, cytoplasmic SIRT2 and mitochondrial SIRT3, were involved. The basis for choosing SIRT3 comes from a recent report indicating that mitochondria are a source of cytoplasmic ADPr, which activates the TRPM2 channel in response to oxidative stress (41). Although the enzymatic source of the ADPr or OAADPr was not addressed in that study, these observations give credence to the possibility that mitochrondrial SIRT3 could generate OAADPr to activate the TRPM2 channel. RNA interference (siRNA) was used to knockdown the endogenous messenger RNA and protein levels, and the resulting effect on puromycin- induced cell death was assessed. In these experiments, a nonspecific siRNA control and siRNAs specific for SIRT2 and SIRT3 were used (Fig 5). Each siRNA demonstrated strict specificity, only knocking down its corresponding RNA and protein, while having no effect on the other (Fig 5). After siRNA treatment, endogenous levels of SIRT3 protein in whole cell extracts could no longer be detected. Similar knockdown was seen with SIRT2 siRNA treatment. Relative to non-specific siRNA transfection, cells transfected with either SIRT2 or SIRT3 siRNAs displayed significant resistance to puromycin-induced cell death in TRPM2 expressing HEK-293 cells (Fig 5). The data presented in Fig 5 a are the averages of five separate experiments (including standard deviations) with five different concentrations of puromycin. At 20 μM puromycin, loss of SIRT2 or SIRT3 increased cell survival by 2-3 fold, and by 50 μM puromycin, -30% of the original cell number had survived, whereas control siRNA-treated cell survival was negligible (Fig 5A). These results suggest that both SIRT2 and SIRT3 may contribute to the accumulation of cellular OAADPr, leading to TRPM2- dependent cell death. The TRPM2 Ca2+-permeable channel can be activated by oxidative stress (H2O2) (25, 42, 43) and ADP-ribose (24, 25, 44), and confers susceptibility to cell death (42). TRPM2 is highly expressed in rat microglia (25), and has been described in neutrophil granulocytes, a monocytic cell line U937 (24, 44), rat insulinoma cell lines (39, 42) and pancreatic β-cells (45, 46). In whole rat studies, puromycin treatment leads to specific pancreatic cell death, an effect that was not the result of inhibition of protein synthesis (47). The molecular basis for this susceptibility was not knc TI. In light of our data, it is likely that puromycin selectively targets TRPM2 expressing cells, causing an influx of Na2+/Ca2+ and subsequent cell death. Consistent with this idea and the involvement of Sir2 proteins, prophylactic treatment with nicotinamide has been shown to suppress the development of diabetes in several animal models by protecting insulin-producing β-cells from destruction by diabetogenic agents (alloxan and streptozotocin) that induce reactive oxygen species (48). The susceptibility of β-cells to alloxan and other oxidative insults has been linked to the overactivation of TRPM2 channels (39). Oxidative stress or other cellular insults like puromycin could trigger a stress response through several mechanisms that utilimately lead to activation of the TRPM2 channel. It is possibile that both ADPr and OAADPr are physiologically important in regulating the channel, but are generated from diverse cellular stimuli and/or different pathways. Here we provide evidence suggesting that Sir2 enzymes may play an important role in mediating the cytotoxic effects of certain pharmacological agents. Furthermore, these results have an important impact on the use of puromycin for the treatment of cancer because of its potential destruction of cells expressing TRPM2, particularly insulin-producing cells.
An emerging picture of Sir2 function in diverse organisms is the regulation of responses to cellular stress that include protein oxidation (49),
DNA damage (50), caloric restriction (57), among others (52). Here, we provide the first evidence that OAADPr, the product of the Sir2 reaction, can modulate cellular responses by regulating the opening of the TRPM2 Ca2+- permeable channel. Although puromycin treatment and subsequent accumulation of OAADPr causes susceptibility to cell death, these data suggest that at lower levels of OAADPr, Sir2-like enzymes could modulate diverse cellular events by mediating cellular Ca2+ entry. Nonselective cation channels, like TRPM2, appear to play a role in insulin secretion by regulating pancreatic beta-cell plasma membrane potential, Ca2+ homeostasis, and thus glucose signaling and homeostasis (46). TRPM2 is expressed in human islets, and we have shown herein that TRPM2 is activated by OAADPr in an insulinoma cell line. TRPC-like channels and their activation by 0 AADPr- producing Sirtuin enzymes provide ~ mechanism for depolarization or Ca2+ entry in beta-cells (insulin producing cells), which could lead to the control of insulin secretion and overall glucose homeostasis. Consistent with our findings, the Sir2p homolog in the yeast K. lactis was shown to regulate either the intake or efflux of a subset of divalent metal cations, suggesting that Sir2p has a role in cation transport in that organism (5J). The dichotomy OfCa2+ as a survival factor and as mediator of apoptotic and necrotic cell death reflects the importance of tightly controlling the entry and the sub- cellular compartmentalization of calcium (54). OAADPr adds to the list of NAD+-derived second messengers (including ADPr, cyclic- ADPr and NAAD(P)) that regulate Ca2+ signaling/release (55).
References
1. D. Moazed, Curr. opin. Cell Biol. 13, 232-238 (2001).
2. S. M. Gasser, M. M. Cockell, Gene 279, 1-16 (Nov 14, 2001).
3. A. Brunet et al. , Science (Feb 19, 2004).
4. M. C. Motta et al, Cell 116, 551-63 (Feb 20, 2004). 5. V. J. Starai, H. Takahashi, J. D. Boeke, J. C. Escalante-
Semerena, Curr Opin Microbiol 7, 115-9 (Apr, 2004).
6. S. Hekimi, L. Guarente, Science 299, 1351-4 (Feb 28, 2003).
7. K. T. Howitz et al, Nature 425, 191-6 (Sep 11, 2003). 8. J. G. Wood et al. , Nature in press (2004).
9. M. Fulco et al. , MoI Cell 12, 51 -62 (M, 2003).
10. J. Smith, Trends Cell Biol 12, 404-6 (Sep, 2002).
11. F. Picard et al. , Nature 429, 771 -6 (Jun 17, 2004). 12. B. J. North, B. L. Marshall, M. T. Borra, J. M. Denu, E.
Verdin, MoI CeIU, 437-44 (Feb, 2003).
13. P. Onyango, I. Celic, J. M. McCaffery, J. D. Boeke, A. P. Feinberg, ProcNatl Acad Sci USA 99, 13653-8 (Oct 15, 2002). 14. B. Schwer, B. J. North, R. A. Frye, M. Ort, E. Verdin, J Cell
Biol 158, 647-57 (Aug 19, 2002).
15. G. Rose et al. , Exp Gerontol 38, 1065-70 (Oct, 2003).
16. K. G. Tanner, J. Landry, R. Sternglanz, J. M. Denu, Proc Natl Acad Sci USA. 97, 14178-82 (2000). 17. J. C. Tanny, D. Moazed, Proc. Natl. Acad. Sci. USA 98, 415-
420 (2001).
18. A. A. Sauve et al. , Biochemistry 40, 15456-15463 (2001).
19. M. D. Jackson, J. M. Denu, The Journal of Biological Chemistry 211, 18535-18544 (2002). 20. J. M. Denu, TIBS 28, 41-48 (2003).
21. M. T. Borra et al., JBiol Chem 111, 12632-41 (Apr 12, 2002).
22. L. A. Rafity, M. T. Schmidt, A.-L. Perraud, A. M. Scharenberg, J. M. Denu, Journal of Biological Chemistry 277, 47114-47 '122 (2002). 23. A.-L. Perraud et al, Nature 411, 595-599 (2001).
24. Y. Sano et al. , Science 293, 1327-30 (Aug 17, 2001).
25. R. Kraft et al. , Am J Physiol Cell Physiol 286, C129-37 (Jan, 2004).
26. M. T. Borra, J. M. Denu, Methods Enzymol 316, 171 -87 (2004).
27. A. B. Pardee, R. Dubrow, Cancer 39, 2747-54 (Jun, 1977).
28. R. Schlapbach, A. Fontana, Biochim Biophys Acta 1359, 174- 80 (Nov 27, 1997). 29. P. S. Herson, M. L. Ashford, J Physiol 514 ( Pt 1), 47-57 (Jan 1, 1999).
30. P. S. Herson, K. Lee, R. D. Pinnock, J. Hughes, M. L. Ashford, J Biol Chem 274, 833-41 (Jan 8, 1999). 31. D. McHugh, R. Flemming, S. Z. Xu, A. L. Perraud, D. J.
Beech, J Biol Chem 278, 11002-6 (Mar 28, 2003).
32. R. A. Frye, Biochem. Biophys. Res. Commun. 273, 793-798 (2000).
33. K. J. Bitterman, R. M. Anderson, H. Y. Cohen, M. Latorre- Esteves, D. A. Sinclair, Journal of Biological Chemistry 277,
45099-107 (2002).
34. J. Landry, J. T. Slama, R. Sternglanz, Biochem. Biophys. Res. Commun. 30, 685-690 (2000).
35. M. D. Jackson, M. T. Schmidt, N. J. Oppenheimer, J. M. Denu, J Biol Chem 278, 50985-98 (Dec 19, 2003).
36. A. A. Sauve, V. L. Schramm, Biochemistry 42, 9249-56 (Aug 12, 2003).
37. R. M. Anderson, K. J. Bitterman, J. G. Wood, O. Medvedik, D. A. Sinclair, Nature 423, 181-5 (May 8, 2003). 38. G. J. Southan, C. Szabo, Curr Med Chem 10, 321-40 (Feb,
2003).
39. P. S. Herson, M. L. Ashford, J Physiol 501 ( Pt 1), 59-66 (May 15, 1997).
40. K. Inamura et al. , JMembr Biol 191, 201-7 (Feb 1 , 2003). 41. A. L. Perraud et al. , J Biol Chem in press (2004).
42. Y. Hara et al. , MoI Cell 9, 163-73 (Jan, 2002).
43. E. Wehage et al. , J Biol Chem 111, 23150-6 (Jun 28, 2002).
44. A. L. Perraud et al., Nature 411, 595-9 (May 31, 2001).
45. P. Krippeit-Drews et al., J Physiol 514 ( Pt 2), 471-81 (Jan 15, 1999).
46. F. Qian et al. , Diabetes 51 Suppl 1, S 183-9 (Feb, 2002).
47. D. S. Longnecker, Lab Invest 26, 459-64 (Apr, 1972).
48. H. KoIb, V. Burkart, Diabetes Care 22 Suppl 2, B 16-20 (Mar, 1999).
49. H. Aguilaniu, L. Gustafsson, M. Rigoulet, T. Nystrom, Science 299, 1751-3 (Mar 14, 2003).
50. J. Luo et al, Cell 107, 137-48 (Oct 19, 2001). 51. S. J. Lin, P. A. Defossez, L. Guarente, Science 289, 2126-8
(Sep 22, 2000).
52. M. Kaeberlein, A. A. Andalis, G. R. Fink, L. Guarente, MoI Cell Biol 22, 8056-66 (Nov. 2002).
53. S. U. Astrom, A. Kegel, J. O. Sjostrand, J. Rine, Genetics 156, 81-91 (Sep, 2000).
54. S. Orrenius, B. Zhivotovsky, P. Nicotera, Nat Rev MoI Cell Biol 4, 552-65 (JuI, 2003).
55. F. Berger, M. H. Ramirez-Hernandez, M. Ziegler, Trends Biochem Sci 29, 111-8 (Mar, 2004). 56. Elliott, R.B., Pilcher CC, Fergusson DM, Stewart AW.J
Pediatr Endocrinology Metab. 9:501-509 (Sept-Oct,
1996). 57. Elliott RB, Chase HP Diahetologia 34:362-365 (May 1991).
While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

What is claimed is:
1. A method for modulating glucose homeostasis in a patient in need thereof comprising: a) contacting an islet cell with an effective amount of an agent that increases intracellular levels of 0-acetyl-ADP-ribose, said increase in concentration resulting in cellular depolarization and/or Ca2+ entry which modulates insulin secretion from said cell.
2. The method of claim 1, wherein said agent comprises puromycin.
3. The method of claim 1, wherein said agent is a functional analog of 0- acetyl-ADP-ribose.
4. The method of claim 1 , wherein said patient is a diabetic patient.
5. The method of claim 1, wherein said agent increases insulin secretion from said cell.
6. The method of claim 1, wherein said agent decreases insulin secretion from said cell.
7. The method of claim 1, further comprising administration of an agent which inhibits sirtuin activity thereby preventing islet cell death in said patient.
8. The method of claim 7, wherein said second agent is nicotinamide.
9. A composition for inhibiting beta cell apoptosis induced by elevated levels of O-acetyl-ADP-ribose, said composition comprising an effective amount of an agent which inhibits sirtuin activity in a pharmaceutically acceptable carrier.
10. The composition of claim 9, wherein said agent is nicotinamide.
11. A composition for modulating O-acetyl- ADP-ribose levels in a cell, said composition comprising puromycin and nicotinamide in a pharmaceutically acceptable carrier.
12. A method for modulating cell death in a target cell comprising: a) contacting a cell comprising 0-acetyl-ADP-ribose and the long transient receptor potential channel 2 (TRPM2) with an agent which inhibits breakdown or increases intracellular concentrations of said O-acetyl- ADP- ribose to levels sufficient to induce cell death in said target cell.
13. The method of claim 12, wherein said increase in said intracellular concentration of 0-acetyl-ADP-ribose induces persistent opening of the long transient receptor potential channel 2 (TRPM2) thereby disrupting intracellular calcium homeostasis and inducing cell death in said target cell.
14. The method of claim 12, wherein the agent comprises puromycin.
15. The method of claim 12, comprising further contacting said cell with a second agent suspected of modulating TRPM2 activity, and assessing the effect of said agent on a said activity.
16. The method of claim 15, wherein said TRPM2 activity is selected from the group consisting of modulation of puromycin-mediated cell death, ion transport, conductivity of plasma membrane, and intracellular calcium mobilization and insulin secretion.
17. The method of claim 12, comprising further contacting said cell with a second agent suspected of modulating TRPM2 channel activity and assessing the effect of said second agent on sirtuin-mediated cell death, said second agent optionally being nicotinamide.
18. The method of claim 13, comprising further contacting said cell with a second agent suspected of modulating TRPM2 channel activity and assessing the effect of said second agent on sirtuin-mediated cell death, said second agent optionally being nicotinamide.
19. The method of claim 14, comprising further contacting said cell with a second agent suspected of modulating TRPM2 channel activity and assessing the effect of said second agent on sirtuin mediated cell death, said second agent optionally being nicotinamide.
20. The method of claim 12, wherein said cell is selected from the group consisting of a B cell, a T cell, a cancer cell, a virally infected cell and a macrophage.
21. The method of claim 17, wherein said cell is a macrophage.
22. A siRNA molecule which downregulates SIRT2 mRNA production.
23. A siRNA molecule which downregulates SIRT3 mRNA production.
24. A method for identifying agents which regulate TRPM2 channel opening, comprising: a) contacting a cell with an agent which modulates intracellular concentration of O-acetyl-ADP-ribose; b) determining the effect of said agent on said channel opening as a function of ion influx into said cell, agents which alter said ion influx being effective to gate said TRPM2 channel.
25. The method of claim 24, wherein said agent stimulates ion influx.
26. The method of claim 24 wherein said agent inhibits ion influx.
27. The method of claim 24, wherein said cell is a beta islet cell and said method further comprises determining the effect of said agent on insulin secretion.
28. The method of claim 27 , wherein said cell is present in an animal and said method further comprising determining the effect of said agent on glucose homeostasis in said animal.
29. The method of claim 12, wherein said cell is a pancreatic tumor cell.
30. The method of claim 29, optionally comprising administration of an effective amount of nicotinamide for preventing destruction of beta cells during treatment.
PCT/US2005/025625 2004-07-20 2005-07-20 Compositions and methods for modulating calcium flux, glucose homeostasis and apoptosis Ceased WO2006068668A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/658,069 US8440638B2 (en) 2004-07-20 2005-07-20 Compositions and methods for modulating calcium flux, glucose homeostasis and apoptosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US58926904P 2004-07-20 2004-07-20
US60/589,269 2004-07-20

Publications (2)

Publication Number Publication Date
WO2006068668A2 true WO2006068668A2 (en) 2006-06-29
WO2006068668A3 WO2006068668A3 (en) 2006-12-14

Family

ID=36602180

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/025625 Ceased WO2006068668A2 (en) 2004-07-20 2005-07-20 Compositions and methods for modulating calcium flux, glucose homeostasis and apoptosis

Country Status (2)

Country Link
US (1) US8440638B2 (en)
WO (1) WO2006068668A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008109475A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting sirt2 gene expression and uses thereof
EP2566966A4 (en) * 2010-05-03 2013-12-11 Curna Inc Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
CN109206464A (en) * 2017-07-07 2019-01-15 北京大学 A kind of adenosine diphosphate core saccharide compound and preparation method thereof and bioactivity

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE CAPLUS [Online] ANTOINE ET AL.: 'Tricyclic antidepressant impramine reduces the insulin secretory rate in islet cells of wistar albino rats through a calcium antagonistic action', XP003006324 Retrieved from STN Database accession no. (2004:455165) & DIABETOLOGIA vol. 47, no. 5, 2004, pages 909 - 916 *
DATABASE MEDLINE [Online] O'BRIEN ET AL.: 'Nicotiamide prevents the development of diabetes in the cyclophosphamide-induced NOD mouse model by reducing beta-cell apoptosis', XP003006325 Retrieved from STN Database accession no. (NLM10767724) & THE JOURNAL OF PATHOLOGY vol. 191, no. 1, May 2000, pages 86 - 92 *
JACKSON ET AL.: 'Structural Identification of 2'- and 3'-O-Acetyl-ADP-ribose as Novel Metabolites Derived from the Sir2 Family of beta-NAD+-dependent Histone/Protein Deacetylases' THE JOURNAL OF BIOLOGICAL CHEMISTRY vol. 277, no. 21, 2002, pages 18535 - 18544, XP003006327 *
MOAZED D.: 'Enzymatic activities of Sir2 and chromatin silencing' CURRENT OPINION IN CELL BIOLOGY vol. 13, 2001, pages 232 - 238, XP003006326 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008109475A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting sirt2 gene expression and uses thereof
EP2566966A4 (en) * 2010-05-03 2013-12-11 Curna Inc Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
US9089588B2 (en) 2010-05-03 2015-07-28 Curna, Inc. Treatment of sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a sirtuin (SIRT)
US11408004B2 (en) 2010-05-03 2022-08-09 Curna, Inc. Treatment of Sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a Sirtuin (SIRT)
CN109206464A (en) * 2017-07-07 2019-01-15 北京大学 A kind of adenosine diphosphate core saccharide compound and preparation method thereof and bioactivity
CN109206464B (en) * 2017-07-07 2020-12-11 北京大学 A kind of adenosine diphosphate ribose compound and its preparation method and biological activity

Also Published As

Publication number Publication date
WO2006068668A3 (en) 2006-12-14
US20080249059A1 (en) 2008-10-09
US8440638B2 (en) 2013-05-14

Similar Documents

Publication Publication Date Title
Yang et al. NAD metabolism and sirtuins: metabolic regulation of protein deacetylation in stress and toxicity
Soriano et al. Induction of sulfiredoxin expression and reduction of peroxiredoxin hyperoxidation by the neuroprotective Nrf2 activator 3H‐1, 2‐dithiole‐3‐thione
Sasaki et al. cADPR is a gene dosage-sensitive biomarker of SARM1 activity in healthy, compromised, and degenerating axons
Haigis et al. Mammalian sirtuins: biological insights and disease relevance
Ahuja et al. Regulation of insulin secretion by SIRT4, a mitochondrial ADP-ribosyltransferase
Grubisha et al. Metabolite of SIR2 reaction modulates TRPM2 ion channel
Hwang et al. Glucosamine exerts a neuroprotective effect via suppression of inflammation in rat brain ischemia/reperfusion injury
Yun et al. AMP‐activated protein kinase mediates the antioxidant effects of resveratrol through regulation of the transcription factor FoxO1
Terunuma et al. GABAA receptor phospho-dependent modulation is regulated by phospholipase C-related inactive protein type 1, a novel protein phosphatase 1 anchoring protein
Li et al. Regulation of WRN protein cellular localization and enzymatic activities by SIRT1-mediated deacetylation
Saunders et al. Sirtuins: critical regulators at the crossroads between cancer and aging
Jin et al. Lipid raft redox signaling: molecular mechanisms in health and disease
Siddiqui et al. Complex molecular and functional outcomes of single versus sequential cytokine stimulation of rat microglia
Komatsu et al. Mastoparan stimulates exocytosis at a Ca (2+)-independent late site in stimulus-secretion coupling. Studies with the RINm5F beta-cell line.
Liu et al. Role of protein transamidation in serotonin-induced proliferation and migration of pulmonary artery smooth muscle cells
Cen et al. Advances in characterization of human sirtuin isoforms: chemistries, targets and therapeutic applications
Korashy et al. Transcriptional regulation of the NAD (P) H: quinone oxidoreductase 1 and glutathione S-transferase ya genes by mercury, lead, and copper
Miyashita et al. Evaluation and mechanistic analysis of the cytotoxicity of the acyl glucuronide of nonsteroidal anti-inflammatory drugs
Fiorentino et al. SRT1720 counteracts glucosamine-induced endoplasmic reticulum stress and endothelial dysfunction
Mattioli et al. Statins and histone deacetylase inhibitors affect lamin A/C–histone deacetylase 2 interaction in human cells
Miguez et al. O-Glycosylation with O-linked β-N-acetylglucosamine increases vascular contraction: Possible modulatory role on Interleukin-10 signaling pathway
Ranganna et al. Involvement of glutathione/glutathione S‐transferase antioxidant system in butyrate‐inhibited vascular smooth muscle cell proliferation
Rinne et al. Pharmacological characterization of the orexin/hypocretin receptor agonist Nag 26
Ben‐Amor et al. A role for 5, 6‐epoxyeicosatrienoic acid in calcium entry by de novo conformational coupling in human platelets
Tuncay et al. The cardioprotective role of sirtuins is mediated in part by regulating KATP channel surface expression

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 11658069

Country of ref document: US