WO2006067602A2 - Process for cell surface expression of human alpha id adrenergic receptor - Google Patents

Process for cell surface expression of human alpha id adrenergic receptor Download PDF

Info

Publication number
WO2006067602A2
WO2006067602A2 PCT/IB2005/003865 IB2005003865W WO2006067602A2 WO 2006067602 A2 WO2006067602 A2 WO 2006067602A2 IB 2005003865 W IB2005003865 W IB 2005003865W WO 2006067602 A2 WO2006067602 A2 WO 2006067602A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hek
clones
process according
cdnas
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2005/003865
Other languages
French (fr)
Other versions
WO2006067602A3 (en
Inventor
Sunil Kumar Khattar
Roop Singh Bora
Priyanka Priyadarsiny
Kulvinder Singh Saini
Kasim Mookhtiar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ranbaxy Laboratories Ltd
Original Assignee
Ranbaxy Laboratories Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ranbaxy Laboratories Ltd filed Critical Ranbaxy Laboratories Ltd
Publication of WO2006067602A2 publication Critical patent/WO2006067602A2/en
Publication of WO2006067602A3 publication Critical patent/WO2006067602A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor

Definitions

  • the present invention relates to a process for the stable expression and cellular localization of human alpha ID adrenergic receptor using charcoal/dextran treated fetal bovine serum (FBS), which greatly increases the receptor binding sites for interaction with the ligand.
  • FBS charcoal/dextran treated fetal bovine serum
  • the ⁇ -Adrenergic receptors are members of the seven transmembrane G protein coupled receptors (GPCRs) super family, mediating various sympathetic nervous system responses, such as smooth muscle contractions, arterial blood pressure and cell growth.
  • GPCRs G protein coupled receptors
  • the OC 1 -ARs couple predominantly via G q to stimulate phospholipase C- ⁇ resulting in formation of inositol 1, 4, 5-triphosphate that leads to the mobilization of calcium from intracellular stores and ultimately to muscle contraction.
  • MoI. Pharmacol. 44 (1993) 76- 86; Proc. West. Pharmacol. Soc. 37 (1994) 163-167.
  • Alterations in normal Ct 1 -AR functions may contribute to the pathophysiology of diseases, such as hypertension, congestive heart failure and benign prostatic hyperplasia.
  • non-subtype selective Cc 1 -AR antagonists such as prazosin, tetrazosin, doxazosin and alfuzosin were originally introduced as antihypertensive agents but have been increasingly important for the treatment of lower urinary tract symptoms (LUTS)/BPH.
  • LUTS lower urinary tract symptoms
  • J.Urol.154 (1995) 923-934; Pharmacol. Res.33 (1996) 145-160; J.Med.Chem. 40(1997) 1293-1315.
  • These compounds reduce smooth muscle tone in the prostate and lower urinary tract, thereby relaxing the bladder outlet and increasing urinary flow.
  • the major disadvantages of non selective OC 1 -AR antagonists are their adverse side effects, such as postural hypotension, dizziness, asthenia and syncope. J. Androl.
  • Cc 1 -ARs are present in the human prostate and are functionally active. Whereas Cc 1A -AR subtype is involved in contraction of smooth muscles resulting in dynamic obstruction and related voiding symptoms, Ci 1D -AR subtype is present in human detrusor region and plays a role in storage and irritative symptoms. Eur Urol. 40 Supp 4 (2001) 5-11.
  • Ot 1 -AR subtypes Three Ot 1 -AR subtypes have been cloned and pharmacologically characterized, the Ot 1A -AR (J. Biol. Chem. 265, (1990) 8183-8189, MoI. Pharmacol. 46, (1994) 823-831), the Ct 1B -AR (Proc. Natl. Acad. Sci. U S A. 85 (1988) 7159-7163), and the ⁇ 1D -AR (J. Biol. Chem. 266 (1991) 6365-6369; MoI. Pharmacol. 40 (1991) 876-883.). These subtypes couple to a variety of second messengers and G proteins to modulate multiple signaling mechanisms in different cells. Pharmacol. Rev.
  • G protein-coupled receptors can exist as homo- or hetero-dimers or as a part of larger oligomeric complexes. Subtype specific homo- and hetero-dimerization between Oc 1 -AR subtypes has also been reported. Cc 1B -AR has been reported to interact with ⁇ 1A or ⁇ 1D -ARs. MoL Pharmacol. 64 (2003) 1379-1390. Further, heterodimerization of CC 1B -AR with ⁇ m-AR is associated with increased surface expression and coupling efficiency of Oc 1D -AR. [MoI. Pharmacol. 64 (2003) 1379-1390; J. Biol. Chem. 279 (2004) 15541-15549.
  • the OC 1 -ARs have been thought to be expressed predominantly on the cell surface, where they are accessible to water soluble ligands.
  • heterologous expression of recombinant Oc 1 -ARs in various cell lines has shown that cellular localization of OC 1 -ARs is more complicated. Results obtained over the last several years have shown that Oc 1 A- and OC 1B -ARs are predominantly localized on the cell surface, whereas Ct 1D -AR is mainly intracellular.
  • MoI. Pharmacol. 52 (1997) 52764-52770; J. Pharmacol. Exp. Ther. 290 (1999) 452-463; MoI Pharmacol. 57 (2000) 659-666; J. Pharmacol. Exp. Ther. 298 (2001) 403-410.
  • the process described herein provides an approach for cell surface expression of Ct 1D receptor thereby facilitating the high throughput Ct 1 D dual antagonists.
  • a process for stable cell surface expression of human alpha ID adrenergic receptors includes: a) PCR amplificating and cloning of one or more adrenergic receptor cDNAs; b) sub cloning the one or more cDNAs into one or more mammalian expression vectors; c) transfecting the one or more expression vectors comprising the one or more cDNAs into one or more human cell lines to create clones; d) selecting one or more stable clones with puromycin; e) culturing the one or more clones overexpressing the one or more human alpha ID adrenergic receptors by growing the cells in media comprising charcoal and dextran treated fetal bovine serum; and, f) analyzing the one or more clones for cell surface expression of the one or more human alpha ID adrenergic receptors.
  • Embodiments of the present invention may include one or more of the following features.
  • the one or more adrenergic receptor cDNAs may include subtypes OC 1D -ARs and N-terminal 19 amino acids deletion mutant of am- AR ( ⁇ 1'79 Oc 1D -AR). and the one or more cDNAs subcloned may be OC 1D -AR and ⁇ 1'79 OC 1D -AR.
  • the one or more mammalian expression vectors may be recombinant pIRESpuro plasmid vectors.
  • the one or more human cell lines may include HEK 293 cells, HeLa cells, CHO cells or NIH3T3 cells.
  • the media may include 10% charcoal and dextran treated fetal bovine serum.
  • the clones may be analysed by immunofluorescence, flow cytometry, western blotting and radio ligand bind assays to detect the cell surface expression of the one or more adrenergic receptors
  • Figure 1 is a Western Blot analysis of ocl-AR subtypes expressed in HEK 293 cells. Membranes from the cells expressing each subtypes were solubilized with 2% DBS. The samples were run on SDS-PAGE, transferred to nitrocellulose membranes and Western blotted with anti goat polyclonal Gc 1A IgG (A) or Oc 1B IgG (B) or anti rabbit polyclonal OC 1D IgG (C, D). Signals were detected using chemiluminescence kit. Arrows indicate apparent monomers and dimers of each subtype.
  • FIG. 2 shows the cellular localization of GC 1 -ARs in HEK293 cells in the presence of 10% FBS.
  • HEK293 cells were stably transfected with either pIRESpuro vector (A) or ⁇ 1A -AR (B) or CC 1B -AR (C) or Oc 1 D-AR (D) cDNAs, and were analyzed by immunoflourescence. Staining of the cells was performed as described under "Materials and Methods.”
  • Figure 3 shows the cellular localization of am- ARs in HEK 293 cells in the presence of 10% FBS (A, D) or 10% charcoal/dextran treated FBS (B, C, E, F).
  • FBS FBS
  • B charcoal/dextran treated FBS
  • HEK-293 cells stably transfected with either full-length ⁇ 1D -AR (A-C) or ⁇ 1"79 ⁇ 1D -AR (D-F) cDNAs, were analyzed by immunofluorescence.
  • HEK- ⁇ m and HEK- ⁇ 1"79 am were treated with lOO ⁇ M phenylepherine for 30 min. (C, F).
  • Figure 4a is a Flow Cytometry Analysis of ⁇ l-AR subtypes expressed in HEK293 cells.
  • Cells were stained with l ⁇ M BODIPY Prazosin in presence (+PZN) and absence (PZN-FL) of l ⁇ M cold Prazosin in blocking buffer (1% BSA, 0.1% Pluoronic F127, l ⁇ M Cold prazosin in PBS) and incubated for 30 minutes at room temperature. Cells were resuspended in 500 ⁇ l of PBS and analyzed by FACScan flow cytometer.
  • Figure 4b shows the effect of charcoal/dextran treated FBS on expression of full-length (panel A) and ⁇ 1"79 (panel B) Cc 1D -ARs.
  • HEK-Ct 1D and HEK- ⁇ 1"79 cells were grown in the presence of FBS or charcoal/dextran treated FBS.
  • Cells were treated with l ⁇ M BODIPY prazosin in 100 ⁇ l of blocking buffer and incubated for 30 minute at room temperature. Cells were resuspended in 500 ⁇ l of PBS and analyzed by FACScan flow cytometer.
  • the present invention is directed to a process for the isolation of adrenergic receptor cDNA encoding the three subtypes Ot 1A -, Ot 1B - and Oc 1D -ARs and N- terminal 79 amino acids deletion mutant of Ot 1D -AR ( ⁇ 1"79 Ot 1D -AR) by the polymerase chain reaction (PCR) cloning.
  • PCR polymerase chain reaction
  • the invention is directed to a process for generating stable cell lines for expression of Ot 1 -AR wherein HEK 293 cells are transfected with the pIRESpuro plasmid harboring Ct 1 -AR cDNAs (Ot 1A , Ot 1 B and Ot 1D )- Puromycin resistant clones for each receptor cDNA were isolated and recombinant cell lines, thus generated, were termed as HEK- ⁇ 1A , HEK- ⁇ 1B , HEK- ⁇ 1D and HEK- ⁇ 1"79 ot 1D -AR. These cell lines were analyzed at various passages by Western blotting.
  • DU 145, SK-N-MC and HEK-293 cells were obtained from American Type
  • Dulbecco's modified Eagle's medium DMEM
  • Dulbecco's phosphate buffer saline DPBS
  • FBS fetal bovine serum
  • charcoal/dextran treated FBS were obtained from Hyclone, Logan, UT;
  • Penicillin, Streptomycin, Lipofectamine 2000 were obtained from Invitrogen
  • Goat polyclonal ⁇ u IgG, goat polyclonal ⁇ 1B IgG , rabbit polyclonal ⁇ 1D IgG, rabbit anti-goat polyclonal IgG, donkey anti-rabbit polyclonal IgG were obtained from Santa Cruz Biotechnology, Lie, Santacruz, CA;
  • BODIPY-FL labeled prazosin were obtained from Molecular Probes, Eugene, Oregon;
  • Prazosin was obtained from Perkin Elmer LAS, Boston, MA; Chemiluminiscence assay kit was obtained from Amersham Biosciences, Lie,
  • Nitrocellulose membrane, electrophoresis reagents were obtained from Bio-Rad
  • pIRESpuro expression vector was obtained from BD Biosciences Clontech, Palo
  • RNA isolation and PCR Total RNA was extracted from DUl 45 (for isolation of human Cc 1A - and Cc 1B -ARs) or SK-N-MC (for isolation of human Oc 1D -AR) cells using Trizol (Invitrogen).
  • First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of each gene was amplified by PCR using gene specific primers.
  • Two overlapping PCR fragments spanning 1-714 base pairs (bp) and 712- 1401 bp were amplified by two gene specific primer pairs.
  • the primers corresponding to bases 1- 714 were forward AGAATTCGCACCATGGTGTTTCTCTCGGGA and reverse CCGATGG ATGCGGAGCGTCACTTGC.
  • the primers corresponding to bases 712- 1401 were forward AGCAAGTGACGCTCCGCATCCATC and reverse AAGAATTCCTAGA CTTCCTCCCCGTTCTCACT.
  • the full length coding region was amplified by fusion PCR using these two fragments and 5' and 3' end primer pairs.
  • the full length product was cloned in to the EcoRI site of pBluescript II KS vector (Stratagene).
  • Two overlapping PCR fragments spanning 1-771 bp (EcoRI-BamHI) and 745- 1560 bp (BamHI-EcoRI) were amplified by two primer pairs.
  • the primers corresponding to bases 1-771 were forward ATGGAGGGAATTCGCCACCATGAATCCCGACCTG GACAC and reverse GGAATGGATCCTCAGGGTCAGCTCCTTGGAGTTG.
  • the primers corresponding to bases 745-1560 were forward AAGGAGCTGA CCCTGAGGATCCATTCCAAGAAC and reverse TGCGCACGGAATTCCTAAAACT GCCCGGGCG.
  • the full length clone was constructed by three way ligation of EcoRI and Bam HI digested PCR products and EcoRI digested pBluescript II KS vector. Amplification of human am- AR cDNA
  • Two overlapping PCR fragments spanning 376-870 bp (Pstl-Xho I) and 850-1719 bp (XhoI-EcoRI) were amplified by two primer pairs.
  • the primers corresponding to bases 376-870 were forward CACCTGCAGACCGTCACCAACTATTTCATC and reverse TGCCTCGAGGCTGCGCGTGGT.
  • the primers corresponding to bases 850-1719 were forward ACCACGCGCAGCCTCGAGGCAG and reverse CTAGCTCTGGAATTCTTA AATATCGGTCTCCCGTAG.
  • the partial cDNA clone spanning 376-1719 bp was amplified by fusion PCR using these two fragments and primers binding at positions 376 and 1719.
  • the coding region from 1-384 bp (EcoRI-Pstl) was synthesized by Microsynth GmbH (Switzerland).
  • the full length coding region was amplified by fusion PCR of 1- 384 bp and 376-1719 bp overlapping fragments using specific primers (forward CCGACGGGAATTCGCCGCCATGACTTTCCGCGA TCTCCT and reverse CTAGCTCTGGAATTCTTAAATATCGGTCTCCCGTAG).
  • the full length product was cloned in to the EcoRI site of pBluescript II KS vector.
  • Ci 1D mutant was generated by PCR using gene specific primers (forward GTGAGATATCGCCACCATGGACGTGAATGGCACGGCG and reverse
  • HEK-293 cells were propagated in Dulbecco's modified Eagle's Medium supplemented with 10% of either heat inactivated or charcoal/dextran treated FBS, 100 ⁇ g/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CO 2 .
  • Stable cell lines were obtained by transfection of expression vector pIRESpuro containing the cDNA constructs of each of the human Ci 1 -ARs into HEK-293 cells using Lipofectamine 2000 reagent. Stable clones were selected for resistance to puromycin (3 ⁇ g/ml). Cells were harvested and membrane preparations were analyzed by western blotting and radioligand binding assays.
  • the cell pellets were lysed with lysis buffer (5OmM Tris pH 7.8,15OmM NaCl, 1% NP-40) and membrane fractions were solubilized with 2% n-Dodecyl- ⁇ -D-maltoside (D ⁇ M).
  • lysis buffer 5OmM Tris pH 7.8,15OmM NaCl, 1% NP-40
  • membrane fractions were solubilized with 2% n-Dodecyl- ⁇ -D-maltoside (D ⁇ M).
  • D ⁇ M n-Dodecyl- ⁇ -D-maltoside
  • Ci 1 -AR specific proteins were detected using a chemiluminescence kit after incubating the membranes with goat polyclonal Ci 1 A IgG or am IgG at 1 :500 dilution or rabbit polyclonal Ci 1D IgG at 1 : 1000 dilution followed by incubation with secondary rabbit anti goat polyclonal IgG at 1 :5000 dilution or donkey anti rabbit polyclonal IgG at 1 : 2000 dilution.
  • Transfected cells from culture flasks were detached into 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and re-suspended in 4 ml of homogenizing buffer (5mM Tris-HCl, 5mm EDTA pH 7.4) supplemented with protease inhibitors and homogenized for 30 sec with a polytron homogenizer PT 1300D (Kinematica AG, Switzerland) at 14000 to 20000 rpm. The homogenate was centrifuged at 30000 rpm for 30 min at 4°C.
  • homogenizing buffer 5mM Tris-HCl, 5mm EDTA pH 7.4
  • PT 1300D Polytron homogenizer
  • the membrane pellet was re-suspended in 500 ⁇ l assay buffer (50 mM Tris-HCl, ImM MgCl 2 pH 7.4). The membranes were rehomogenized for 30 sec with polytron homogenizer at 14000 to 20000 rpm. The protein estimation of homogenized membrane was done using a protein assay kit from Bio-Rad. Radioligand binding assays were conducted in 250 ⁇ l of assay buffer using 96 well plates. The assay wells contained 5-10 ⁇ g of membrane protein and varying concentration (0.5nM to 5nM) of [ 3 H] Prazosin ligand and were incubated for 2 h at 22-25°C.
  • Stable HEK-293 cell lines expressing Ot 1 -AR were grown in four well Lab-Tek chamber slides for 24 h at 37°C.
  • the cells were fixed with 2% paraformaldehyde/0.1% Triton X-100 for 20 min at room temperature.
  • the cells were blocked in 10% FBS for 20 min at room temperature.
  • the cells were incubated with 1 : 100 dilution of appropriate primary antibody followed by incubation with 1 :500 diluted Alexa- conjugated secondary antibody.
  • To study the effect of phenylephrine on the cellular localization of Ci 1D -AR cells were incubated with 100 ⁇ M phenylephrine for 30 min. at 37°C. Cells were analyzed under a fluorescent microscope TE 2000-E (Nikon Instech CO. LTD., Japan).
  • Stable HEK-293 cells expressing Oc 1 -AR were detached in o 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and washed twice in DPBS pH 7.4. Cells were incubated for 30 min at room temperature in 100 ⁇ l of blocking buffer containing BODIPY-FL labeled prazosin ( 1% BSA, 0.1% Pluoronic F127, l ⁇ M BODIPY prazosin in DPBS). Cells were washed and resuspended in 500 ⁇ l of DPBS. Cells were acquired and analyzed by cell quest program of FACS CALIBUR Flow cytometer (BD Biosciences, San Jose, CA). Results
  • the cDNA encoding three subtypes of Oc 1A -, OC 1B - and Oc 1D -ARs and N-terminal 79 amino acids deletion mutant of am- AR ( ⁇ 1"79 CC 1D -AR) were isolated by PCR cloning.
  • High GC-content at the 5 'end of the Oc 1 D-AR gene causes the amplification of this gene to be quite cumbersome.
  • the first 375 base pairs of Cc 1D -AR cDNA were chemically synthesized, wherein 24 G or C nucleotides were changed to A or T nucleotide to reduce the G + C contents.
  • Ci 1 A-, OC 1 B-, OC 1 D and ⁇ 1"79 CC 1 D-ARs were detected in the immunoblot as shown in Fig. 1.
  • the three Ci 1- AR subtypes were observed as monomeric and /or dimeric forms.
  • HEK-Oc 1A exhibited specific bands of monomer at 55 kDa and dimer at 110 kDa (Fig. IA).
  • HEK- OC 1B a band of 65 kDa, corresponding to monomeric form was detected (Fig. IB).
  • HEK-Oc 1D showed protein bands of 70 kDa and 140 kDa corresponding to monomeric and dimeric forms (Fig. 1C).
  • HEK- ⁇ 1"79 am showed a protein band of 65 kDa corresponding to the monomeric form only (Fig. ID). All the three subtypes showed expected band sizes with the subtype specific antibodies without any cross reactivity. In control HEK293 cells, no signal was detected.
  • the binding site densities (B max ) for ⁇ i A - AR in the recombinant cell line was 2030 fmol/mg of protein with a K & value of 0.28nM, for Ot 1B was 2007 fmol/mg of protein with a K & value of 0.14nM and for am was 1003 fmol/mg of protein with a K & value of OJnM at passage 5 as revealed by radioligand binding assay using [ 3 H] Prazosin as ligand as shown in Table 1.
  • the binding site density for Oc 1A and CC 1B -ARs in recombinant cell line at passage 35 was 3933 and 3400 miol/mg of protein, respectively, as revealed by radioligand binding assay suggesting that recombinant cell lines expressing Cc 1A and Oc 1B -AR are highly stable. Unlike the other two subtypes, expression of am- AR was found to be very unstable. Radioligand binding assay revealed that there was a decrease in the binding site density in the recombinant cell line expressing full-length am- AR with B max of 110 fmol/mg of protein at passage 15.
  • the stable cell line for N-terminal deletion mutant of Cc 1D -AR was generated.
  • the expression level of this deletion derivative of Ot 1D -AR was found to be slightly lower at passage 5 (900 fmol/mg of protein) as compared to the full-length receptor (1003 fmol/mg of protein) [Table 1], it was found to be relatively more stable with subsequent passages ⁇ B max of 500 fmol/mg for ⁇ 1"79 am as compared to 110 fmol/mg for full length a ⁇ -AR at passage 15).
  • ⁇ x ⁇ A - and ⁇ -AR were found to be predominantly localized at the cell membrane in recombinant HEK 293 cells, as shown in the accompanying drawing (Fig. 2B and 2C), by immunocytochemical analysis at passage 15 using commercially available antibodies.
  • expression of am- AR was predominantly intracellular as shown in the accompanying drawing (Fig. 2D) by punctate staining, suggesting that this receptor protein does not get properly folded and has problems in translocation to the cell
  • BODIPY-FL prazosin was used as a specific fluorescent ligand for ⁇ l-AR, although the Kd value of BODIPY-FL prazosin is approximately 100 times higher than that of the original unlabelled prazosin.
  • FACS Fluorescence-activated flow cytometry
  • the fluorescent intensity of 60% cell population showed a significant shift in HEK- ⁇ as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel A).
  • 60% and 40% cell population showed a significant shift in fluorescence intensity respectively as shown in the accompanying drawing (Fig. 4a, panel B and C)
  • HEK- ⁇ 1"79 am 60% cell population exhibited significant shift in fluorescence intensity as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel D).
  • the fluorescent intensity of the cells expressing N-terminal deleted OC 1D -AR was found to be slightly higher than that of the cells expressing full-length CC 1D - AR. This may be due to the better stability of N-terminal deleted ccm-AR at higher passages as compared to the full-length receptor. These data also suggest that the truncated Oc 1D -AR is more exposed to the cell surface compared to full-length Oc 1D -AR. hi order to improve the localization and expression of CC 1D -AR, HEK-OC 1D -AR recombinant cell line was cultured under different conditions.
  • the HEK 293 cells expressing OC 1D -AR were grown in the presence of 10% charcoal/dextran treated FBS instead of 10% FBS and immunocytochemical analysis was performed. After culturing cells in the presence of 10% charcoal/dextran treated FBS, there was dramatic change in the localization of CC 1D -AR in HEK 293 cells. As shown in the accompanying drawing (Fig. 3B), most of the OC 1D -AR protein was localized on the cell membrane in case of full- length OC 1D -AR. Binding site density of am- AR at passage 35 was found to be 355 miol/mg of protein as shown in Table 1.
  • HEK-Oc 1 D cells cultured in the presence of charcoal/dextran treated FBS when analyzed by FACS showed an increase in the fluorescent intensity (around 60% shift) as compared to the cells cultured in the presence of FBS (40% shift) as shown in the accompanying drawing [Fig. 4b, panel A].

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a process for the stable expression and cellular localization of human alpha 1D adrenergic receptor using charcoal and dextran treated fetal bovine serum, which greatly increases the receptor binding sites for interaction with the ligand.

Description

PROCESS FORCELL SURFACE EXPRESSION OFHUMANALPHAID
ADRENERGIC RECEPTOR
Field of the Invention
The present invention relates to a process for the stable expression and cellular localization of human alpha ID adrenergic receptor using charcoal/dextran treated fetal bovine serum (FBS), which greatly increases the receptor binding sites for interaction with the ligand.
Background of the Invention
The ^-Adrenergic receptors ((X1-ARs) are members of the seven transmembrane G protein coupled receptors (GPCRs) super family, mediating various sympathetic nervous system responses, such as smooth muscle contractions, arterial blood pressure and cell growth. Pharmacol. Rev. 45 (1993) 147-175; Eur. J. Pharmacol. 375, (1999) 261-276. The OC1-ARs couple predominantly via Gqto stimulate phospholipase C-β resulting in formation of inositol 1, 4, 5-triphosphate that leads to the mobilization of calcium from intracellular stores and ultimately to muscle contraction. MoI. Pharmacol. 44 (1993) 76- 86; Proc. West. Pharmacol. Soc. 37 (1994) 163-167. Alterations in normal Ct1-AR functions may contribute to the pathophysiology of diseases, such as hypertension, congestive heart failure and benign prostatic hyperplasia.
Several non-subtype selective Cc1-AR antagonists, such as prazosin, tetrazosin, doxazosin and alfuzosin were originally introduced as antihypertensive agents but have been increasingly important for the treatment of lower urinary tract symptoms (LUTS)/BPH. J.Urol.154 (1995) 923-934; Pharmacol. Res.33 (1996) 145-160; J.Med.Chem. 40(1997) 1293-1315. These compounds reduce smooth muscle tone in the prostate and lower urinary tract, thereby relaxing the bladder outlet and increasing urinary flow. The major disadvantages of non selective OC1-AR antagonists are their adverse side effects, such as postural hypotension, dizziness, asthenia and syncope. J. Androl. 12 (1991) 389-394. Besides relaxing smooth muscles in the prostate, nonselective Cc1-AR antagonists also cause relaxation of blood vessels, which can lead to orthostatic hypotension. Selective Ct1-ARs, on the other hand, affect only the tissues around the prostate and have minimal effect on lowering blood pressure. Studies have indicated that Cc1-ARs are present in the human prostate and are functionally active. Whereas Cc1A-AR subtype is involved in contraction of smooth muscles resulting in dynamic obstruction and related voiding symptoms, Ci1D-AR subtype is present in human detrusor region and plays a role in storage and irritative symptoms. Eur Urol. 40 Supp 4 (2001) 5-11. Since there may be an increase in vascular Ot1B-AR subtype expression with aging, the blockade of this receptor should be avoided to minimize interference with blood pressure regulation. Treatment of LUTS/BPH with super-selective ai/Jctw -AR antagonists such as tamsulosin is being used to reduce obstruction and both voiding and storage symptoms with minimal risk of cardiovascular side effects. Prostate Cancer Prostatic Dis. 2 (1999) 110-119; Eur. Urol. 29 (1996) 145-154. Clearly, there is a great need to develop αiA/otiD-AR selective antagonists. To screen such compounds, recombinant cell lines over-expressing Ot1A, Ct1B and Ot1 D-ARs are required. These cell lines should be stable for various passages for high throughput screening of large number of compounds. With this approach we may be able to synthesize a candidate with minimum adverse effects.
Three Ot1-AR subtypes have been cloned and pharmacologically characterized, the Ot1A-AR (J. Biol. Chem. 265, (1990) 8183-8189, MoI. Pharmacol. 46, (1994) 823-831), the Ct1B-AR (Proc. Natl. Acad. Sci. U S A. 85 (1988) 7159-7163), and the α1D-AR (J. Biol. Chem. 266 (1991) 6365-6369; MoI. Pharmacol. 40 (1991) 876-883.). These subtypes couple to a variety of second messengers and G proteins to modulate multiple signaling mechanisms in different cells. Pharmacol. Rev. 40 (1988) 87-119;Mol. Pharmacol. 44 (1993) 784-795; J. Pharmacol. Exp. Ther. 284 (1998) 576-585; J. Neurochem. 72 (1999) 2388-2396. However, the coupling efficiencies of these three subtypes vary in transfected cells. The expression level and coupling efficiency of Ci1D-AR is quite low compared to Ct1A-AR and α1B-AR subtypes. MoI. Pharmacol. 50 (1996) 1376-1387. hi addition, attempts to detect Ot1D-AR protein in vivo in different tissues have proven difficult. Arch. Pharmacol. 355 (1997) 438-446.
It is now generally accepted that G protein-coupled receptors (GPCRs) can exist as homo- or hetero-dimers or as a part of larger oligomeric complexes. Subtype specific homo- and hetero-dimerization between Oc1-AR subtypes has also been reported. Cc1B-AR has been reported to interact with α1A or α1D-ARs. MoL Pharmacol. 64 (2003) 1379-1390. Further, heterodimerization of CC1B-AR with α m-AR is associated with increased surface expression and coupling efficiency of Oc1D-AR. [MoI. Pharmacol. 64 (2003) 1379-1390; J. Biol. Chem. 279 (2004) 15541-15549.
The OC1-ARs have been thought to be expressed predominantly on the cell surface, where they are accessible to water soluble ligands. However, heterologous expression of recombinant Oc1-ARs in various cell lines has shown that cellular localization of OC1-ARs is more complicated. Results obtained over the last several years have shown that Oc1A- and OC1B-ARs are predominantly localized on the cell surface, whereas Ct1D-AR is mainly intracellular. MoI. Pharmacol. 52 (1997) 52764-52770; J. Pharmacol. Exp. Ther. 290 (1999) 452-463; MoI Pharmacol. 57 (2000) 659-666; J. Pharmacol. Exp. Ther. 298 (2001) 403-410. Thus, it is less available on the cell surface for ligand interaction. The process described herein provides an approach for cell surface expression of Ct1D receptor thereby facilitating the high throughput
Figure imgf000005_0001
Ct1D dual antagonists.
Summary of the Invention
In one general aspect there is provided a process for stable cell surface expression of human alpha ID adrenergic receptors. The process includes: a) PCR amplificating and cloning of one or more adrenergic receptor cDNAs; b) sub cloning the one or more cDNAs into one or more mammalian expression vectors; c) transfecting the one or more expression vectors comprising the one or more cDNAs into one or more human cell lines to create clones; d) selecting one or more stable clones with puromycin; e) culturing the one or more clones overexpressing the one or more human alpha ID adrenergic receptors by growing the cells in media comprising charcoal and dextran treated fetal bovine serum; and, f) analyzing the one or more clones for cell surface expression of the one or more human alpha ID adrenergic receptors. Embodiments of the present invention may include one or more of the following features. For example, the one or more adrenergic receptor cDNAs may include subtypes OC1D-ARs and N-terminal 19 amino acids deletion mutant of am- AR (Δ1'79 Oc1D-AR). and the one or more cDNAs subcloned may be OC1D-AR and Δ1'79 OC1D-AR. The one or more mammalian expression vectors may be recombinant pIRESpuro plasmid vectors. The one or more human cell lines may include HEK 293 cells, HeLa cells, CHO cells or NIH3T3 cells.
The media may include 10% charcoal and dextran treated fetal bovine serum.
The clones may be analysed by immunofluorescence, flow cytometry, western blotting and radio ligand bind assays to detect the cell surface expression of the one or more adrenergic receptors
Detailed Description of the Figures
Figure 1 is a Western Blot analysis of ocl-AR subtypes expressed in HEK 293 cells. Membranes from the cells expressing each subtypes were solubilized with 2% DBS. The samples were run on SDS-PAGE, transferred to nitrocellulose membranes and Western blotted with anti goat polyclonal Gc1A IgG (A) or Oc1B IgG (B) or anti rabbit polyclonal OC1D IgG (C, D). Signals were detected using chemiluminescence kit. Arrows indicate apparent monomers and dimers of each subtype.
Figure 2 shows the cellular localization of GC1-ARs in HEK293 cells in the presence of 10% FBS. HEK293 cells were stably transfected with either pIRESpuro vector (A) or α1A-AR (B) or CC1B-AR (C) or Oc1D-AR (D) cDNAs, and were analyzed by immunoflourescence. Staining of the cells was performed as described under "Materials and Methods."
Figure 3 shows the cellular localization of am- ARs in HEK 293 cells in the presence of 10% FBS (A, D) or 10% charcoal/dextran treated FBS (B, C, E, F). HEK-293 cells, stably transfected with either full-length α1D-AR (A-C) or Δ1"79 α1D-AR (D-F) cDNAs, were analyzed by immunofluorescence. HEK-αm and HEK-Δ1"79 am were treated with lOOμM phenylepherine for 30 min. (C, F). Staining of the cells was performed as described under "Materials and Methods." Figure 4a is a Flow Cytometry Analysis of αl-AR subtypes expressed in HEK293 cells. Cells were stained with lμM BODIPY Prazosin in presence (+PZN) and absence (PZN-FL) of lμM cold Prazosin in blocking buffer (1% BSA, 0.1% Pluoronic F127, lμM Cold prazosin in PBS) and incubated for 30 minutes at room temperature. Cells were resuspended in 500 μl of PBS and analyzed by FACScan flow cytometer.
Figure 4b shows the effect of charcoal/dextran treated FBS on expression of full-length (panel A) and Δ1"79 (panel B) Cc1D-ARs. HEK-Ct1D and HEK-Δ1"79 cells were grown in the presence of FBS or charcoal/dextran treated FBS. Cells were treated with lμM BODIPY prazosin in 100 μl of blocking buffer and incubated for 30 minute at room temperature. Cells were resuspended in 500 μl of PBS and analyzed by FACScan flow cytometer.
Detailed Description of the Invention hi one embodiment, the present invention is directed to a process for the isolation of adrenergic receptor cDNA encoding the three subtypes Ot1A-, Ot1B- and Oc1D-ARs and N- terminal 79 amino acids deletion mutant of Ot1D-AR (Δ1"79 Ot1D-AR) by the polymerase chain reaction (PCR) cloning. hi another embodiment, the invention is directed to a process for generating stable cell lines for expression of Ot1-AR wherein HEK 293 cells are transfected with the pIRESpuro plasmid harboring Ct1-AR cDNAs (Ot1A, Ot1B and Ot1D)- Puromycin resistant clones for each receptor cDNA were isolated and recombinant cell lines, thus generated, were termed as HEK-α1A, HEK-α1B, HEK-α1D and HEK-Δ1"79 ot1D-AR. These cell lines were analyzed at various passages by Western blotting. Specific protein bands of Ot1A-, Ot1B-, Ct1D- and Δ1"79 Ct1D-ARs were detected in the immunoblot as shown in Figure 1 of the accompanying drawing. The stability of these recombinant clones and expression of Ot1- AR subtypes in recombinant cell lines was monitored by Western blotting, flow cytometry and radioligand binding assays for up to 35 passages. hi yet another embodiment, the invention provides the effect of charcoal/dextran treated FBS on the cellular localization of am -AR. Materials and Methods
DU 145, SK-N-MC and HEK-293 cells were obtained from American Type
Culture Collection, Manassas, VA;
Dulbecco's modified Eagle's medium (DMEM), Dulbecco's phosphate buffer saline (DPBS), fetal bovine serum (FBS), and charcoal/dextran treated FBS were obtained from Hyclone, Logan, UT;
Penicillin, Streptomycin, Lipofectamine 2000 were obtained from Invitrogen
Corporation, Carlsbad, CA;
Goat polyclonal αu IgG, goat polyclonal α1B IgG , rabbit polyclonal α1D IgG, rabbit anti-goat polyclonal IgG, donkey anti-rabbit polyclonal IgG were obtained from Santa Cruz Biotechnology, Lie, Santacruz, CA;
Alexa-conjugated secondary antibody, BODIPY-FL labeled prazosin were obtained from Molecular Probes, Eugene, Oregon;
[3H] Prazosin was obtained from Perkin Elmer LAS, Boston, MA; Chemiluminiscence assay kit was obtained from Amersham Biosciences, Lie,
Chicago, IL;
Puromycin was obtained from Calbiochem EMD Biosciences Lic.,SanDiego,CA;
Nitrocellulose membrane, electrophoresis reagents were obtained from Bio-Rad
Laboratories, Hercules, CA; pIRESpuro expression vector was obtained from BD Biosciences Clontech, Palo
Alto, CA; and pBluescript II KS vector was obtained from Stratagene, La Jolla, CA.
Cloning of Human cti-AR Subtypes
RNA isolation and PCR Total RNA was extracted from DUl 45 (for isolation of human Cc1A - and Cc1B -ARs) or SK-N-MC (for isolation of human Oc1D-AR) cells using Trizol (Invitrogen). First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of each gene was amplified by PCR using gene specific primers.
Figure imgf000009_0001
Two overlapping PCR fragments spanning 1-714 base pairs (bp) and 712- 1401 bp were amplified by two gene specific primer pairs. The primers corresponding to bases 1- 714 were forward AGAATTCGCACCATGGTGTTTCTCTCGGGA and reverse CCGATGG ATGCGGAGCGTCACTTGC. The primers corresponding to bases 712- 1401 were forward AGCAAGTGACGCTCCGCATCCATC and reverse AAGAATTCCTAGA CTTCCTCCCCGTTCTCACT. The full length coding region was amplified by fusion PCR using these two fragments and 5' and 3' end primer pairs. The full length product was cloned in to the EcoRI site of pBluescript II KS vector (Stratagene).
Amplification of human am- AR cDNA
Two overlapping PCR fragments spanning 1-771 bp (EcoRI-BamHI) and 745- 1560 bp (BamHI-EcoRI) were amplified by two primer pairs. The primers corresponding to bases 1-771 were forward ATGGAGGGAATTCGCCACCATGAATCCCGACCTG GACAC and reverse GGAATGGATCCTCAGGGTCAGCTCCTTGGAGTTG. The primers corresponding to bases 745-1560 were forward AAGGAGCTGA CCCTGAGGATCCATTCCAAGAAC and reverse TGCGCACGGAATTCCTAAAACT GCCCGGGCG. The full length clone was constructed by three way ligation of EcoRI and Bam HI digested PCR products and EcoRI digested pBluescript II KS vector. Amplification of human am- AR cDNA
Two overlapping PCR fragments spanning 376-870 bp (Pstl-Xho I) and 850-1719 bp (XhoI-EcoRI) were amplified by two primer pairs. The primers corresponding to bases 376-870 were forward CACCTGCAGACCGTCACCAACTATTTCATC and reverse TGCCTCGAGGCTGCGCGTGGT. The primers corresponding to bases 850-1719 were forward ACCACGCGCAGCCTCGAGGCAG and reverse CTAGCTCTGGAATTCTTA AATATCGGTCTCCCGTAG. The partial cDNA clone spanning 376-1719 bp was amplified by fusion PCR using these two fragments and primers binding at positions 376 and 1719. We were not able to amplify 1-375 bp of α1D-AR as this region is highly GC rich. The coding region from 1-384 bp (EcoRI-Pstl) was synthesized by Microsynth GmbH (Switzerland). The full length coding region was amplified by fusion PCR of 1- 384 bp and 376-1719 bp overlapping fragments using specific primers (forward CCGACGGGAATTCGCCGCCATGACTTTCCGCGA TCTCCT and reverse CTAGCTCTGGAATTCTTAAATATCGGTCTCCCGTAG). The full length product was cloned in to the EcoRI site of pBluescript II KS vector.
Δ1"79 Ci1D mutant was generated by PCR using gene specific primers (forward GTGAGATATCGCCACCATGGACGTGAATGGCACGGCG and reverse
CCGGAATTCTTAAATATCGGTCTCCCGTAGGTTGC). After sequence confirmation, the full length coding regions of Ot1A, OC1B and Ci1D and N-truncated coding region of Gi1D- ARs were subcloned into pIRESpuro (BD Biosciences Clontech) expression vector.
Cell Culture and Transfections HEK-293 cells were propagated in Dulbecco's modified Eagle's Medium supplemented with 10% of either heat inactivated or charcoal/dextran treated FBS, 100 μg/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CO2. Stable cell lines were obtained by transfection of expression vector pIRESpuro containing the cDNA constructs of each of the human Ci1-ARs into HEK-293 cells using Lipofectamine 2000 reagent. Stable clones were selected for resistance to puromycin (3 μg/ml). Cells were harvested and membrane preparations were analyzed by western blotting and radioligand binding assays.
Western Blotting
The cell pellets were lysed with lysis buffer (5OmM Tris pH 7.8,15OmM NaCl, 1% NP-40) and membrane fractions were solubilized with 2% n-Dodecyl-β-D-maltoside (DβM). The protein samples were separated on 7.5 % SDS PAGE. The separated proteins were transferred to nitrocellulose membranes. Ci1-AR specific proteins were detected using a chemiluminescence kit after incubating the membranes with goat polyclonal Ci1A IgG or am IgG at 1 :500 dilution or rabbit polyclonal Ci1D IgG at 1 : 1000 dilution followed by incubation with secondary rabbit anti goat polyclonal IgG at 1 :5000 dilution or donkey anti rabbit polyclonal IgG at 1 : 2000 dilution.
Radioligand Binding Assays
Transfected cells from culture flasks were detached into 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and re-suspended in 4 ml of homogenizing buffer (5mM Tris-HCl, 5mm EDTA pH 7.4) supplemented with protease inhibitors and homogenized for 30 sec with a polytron homogenizer PT 1300D (Kinematica AG, Switzerland) at 14000 to 20000 rpm. The homogenate was centrifuged at 30000 rpm for 30 min at 4°C. The membrane pellet was re-suspended in 500 μl assay buffer (50 mM Tris-HCl, ImM MgCl2 pH 7.4). The membranes were rehomogenized for 30 sec with polytron homogenizer at 14000 to 20000 rpm. The protein estimation of homogenized membrane was done using a protein assay kit from Bio-Rad. Radioligand binding assays were conducted in 250 μl of assay buffer using 96 well plates. The assay wells contained 5-10 μg of membrane protein and varying concentration (0.5nM to 5nM) of [3H] Prazosin ligand and were incubated for 2 h at 22-25°C.
Incubations were terminated by harvesting the plate with ice-cold Tris -HCl buffer pH 7.4 using 96 well Skatron harvester on a filter mat (the filter mat was presoaked in 0.1% polyethylene amine for 2 h and dried before using). The filter mat was dried and the bound radioactivity was determined by scintillation counting using Wallac Liquid
Scintillation Counter. All the assays were conducted in triplicate. The data was analyzed by nonlinear one site binding hyperbola curve using GraphPad Prism software.
Immunocytochemistry
Stable HEK-293 cell lines expressing Ot1-AR were grown in four well Lab-Tek chamber slides for 24 h at 37°C. The cells were fixed with 2% paraformaldehyde/0.1% Triton X-100 for 20 min at room temperature. The cells were blocked in 10% FBS for 20 min at room temperature. The cells were incubated with 1 : 100 dilution of appropriate primary antibody followed by incubation with 1 :500 diluted Alexa- conjugated secondary antibody. To study the effect of phenylephrine on the cellular localization of Ci1D-AR, cells were incubated with 100 μM phenylephrine for 30 min. at 37°C. Cells were analyzed under a fluorescent microscope TE 2000-E (Nikon Instech CO. LTD., Japan).
Flow Cytometry
Stable HEK-293 cells expressing Oc1-AR were detached in o 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and washed twice in DPBS pH 7.4. Cells were incubated for 30 min at room temperature in 100 μl of blocking buffer containing BODIPY-FL labeled prazosin ( 1% BSA, 0.1% Pluoronic F127, lμM BODIPY prazosin in DPBS). Cells were washed and resuspended in 500 μl of DPBS. Cells were acquired and analyzed by cell quest program of FACS CALIBUR Flow cytometer (BD Biosciences, San Jose, CA). Results
The cDNA encoding three subtypes of Oc1A-, OC1B- and Oc1D-ARs and N-terminal 79 amino acids deletion mutant of am- AR (Δ1"79 CC1D-AR) were isolated by PCR cloning. High GC-content at the 5 'end of the Oc1D-AR gene causes the amplification of this gene to be quite cumbersome. Thus, the first 375 base pairs of Cc1D-AR cDNA were chemically synthesized, wherein 24 G or C nucleotides were changed to A or T nucleotide to reduce the G + C contents. This change in the nucleotide sequence did not alter the amino acid sequence or the frequency score of these codon triplets in mammalian cells. These three cloned receptor cDNAs were confirmed by restriction mapping and DNA sequencing, and were sub cloned into pIRESpuro mammalian expression vector. The Puromycin resistant clones for each receptor cDNA were isolated and recombinant cell lines thus generated were termed as HEK-Cc1A, HEK-OC1B, HEK-CC1D and HEK-Δ1'79 αm-AR and the expression of each receptor was analyzed at various passages by Western blot analysis. Specific protein bands of Ci1A-, OC1B-, OC1D and Δ1"79 CC1D-ARs were detected in the immunoblot as shown in Fig. 1. The three Ci1-AR subtypes were observed as monomeric and /or dimeric forms. HEK-Oc1A exhibited specific bands of monomer at 55 kDa and dimer at 110 kDa (Fig. IA). For HEK- OC1B, a band of 65 kDa, corresponding to monomeric form was detected (Fig. IB). HEK-Oc1D showed protein bands of 70 kDa and 140 kDa corresponding to monomeric and dimeric forms (Fig. 1C). HEK-Δ1"79 am showed a protein band of 65 kDa corresponding to the monomeric form only (Fig. ID). All the three subtypes showed expected band sizes with the subtype specific antibodies without any cross reactivity. In control HEK293 cells, no signal was detected.
The pharmacological properties of the three subtypes were studied by radioligand- binding assay using [ H] Prazosin as non-selective ligand for αi-AR. Non-specific binding was estimated using lOμM terazosin. The binding site densities (Bmax) for αiA- AR in the recombinant cell line was 2030 fmol/mg of protein with a K& value of 0.28nM, for Ot1B was 2007 fmol/mg of protein with a K& value of 0.14nM and for am was 1003 fmol/mg of protein with a K& value of OJnM at passage 5 as revealed by radioligand binding assay using [3H] Prazosin as ligand as shown in Table 1.
Table 1
Maximum binding site density (BmcVζ) and equilibrium density constant (Ka) values of specific [3HJ Prazosin binding to HEK-293 cell membranes expressing cci-ARs.
Figure imgf000013_0001
Saturation analysis of specific binding was used to determine Bmax and Kd values for [3H] Prazosin. Each value represents mean ± S.E.M. of at least three experiments performed in triplicate. * These values were obtained after growing recombinant cell lines in presence of charcoal/ dextr an treated FBS.
The heterologous expression of GPCRs in mammalian cell lines is generally unstable, as with the subsequent cell division and passaging, expression of these proteins tends to go down. In order to check the stability of our recombinant clones, expression of αi-AR subtypes in recombinant cell lines was monitored by Western blotting and radioligand binding assay for up to 35 passages. Western blot analysis revealed that there was no change in the expression level of αu and OC1B-ARs even at passage 35. The binding site density for Oc1A and CC1B-ARs in recombinant cell line at passage 35 was 3933 and 3400 miol/mg of protein, respectively, as revealed by radioligand binding assay suggesting that recombinant cell lines expressing Cc1A and Oc1B-AR are highly stable. Unlike the other two subtypes, expression of am- AR was found to be very unstable. Radioligand binding assay revealed that there was a decrease in the binding site density in the recombinant cell line expressing full-length am- AR with Bmax of 110 fmol/mg of protein at passage 15.
The stable cell line for N-terminal deletion mutant of Cc1D-AR was generated. The expression level of this deletion derivative of Ot1D-AR was found to be slightly lower at passage 5 (900 fmol/mg of protein) as compared to the full-length receptor (1003 fmol/mg of protein) [Table 1], it was found to be relatively more stable with subsequent passages {Bmax of 500 fmol/mg for Δ1"79 am as compared to 110 fmol/mg for full length a^-AR at passage 15).
The <x\A- and α^-AR were found to be predominantly localized at the cell membrane in recombinant HEK 293 cells, as shown in the accompanying drawing (Fig. 2B and 2C), by immunocytochemical analysis at passage 15 using commercially available antibodies. On the other hand, expression of am- AR was predominantly intracellular as shown in the accompanying drawing (Fig. 2D) by punctate staining, suggesting that this receptor protein does not get properly folded and has problems in translocation to the cell
1 VQ membrane. Analysis of HEK-Δ " am by immunocytochemical analysis revealed that N- terminus deleted am- AR was primarily localized on the cell membrane, though some intracellular expression was also observed, as shown in the accompanying drawing (Fig. 3D).
The expression of the three subtypes was detected by Fluorescence-activated flow cytometry (FACS) at passage 15. BODIPY-FL prazosin was used as a specific fluorescent ligand for αl-AR, although the Kd value of BODIPY-FL prazosin is approximately 100 times higher than that of the original unlabelled prazosin. FEBS Lett. 386,(1996) 141- 148; Life Sciences 70,(2002), 2113-2124. All the recombinant cell lines expressing αl- AR subtype were positively stained by BODIPY-FL prazosin as shown in the accompanying drawing (Fig. 4a). The fluorescent intensity of 60% cell population showed a significant shift in HEK-α^ as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel A). In case of recombinant cell lines HEK- αm and HEK-αm, 60% and 40% cell population showed a significant shift in fluorescence intensity respectively as shown in the accompanying drawing (Fig. 4a, panel B and C), whereas in HEK-Δ1"79 am, 60% cell population exhibited significant shift in fluorescence intensity as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel D). The fluorescent intensity of the cells expressing N-terminal deleted OC1D-AR was found to be slightly higher than that of the cells expressing full-length CC1D- AR. This may be due to the better stability of N-terminal deleted ccm-AR at higher passages as compared to the full-length receptor. These data also suggest that the truncated Oc1D-AR is more exposed to the cell surface compared to full-length Oc1D-AR. hi order to improve the localization and expression of CC1D-AR, HEK-OC1D-AR recombinant cell line was cultured under different conditions. The HEK 293 cells expressing OC1D-AR were grown in the presence of 10% charcoal/dextran treated FBS instead of 10% FBS and immunocytochemical analysis was performed. After culturing cells in the presence of 10% charcoal/dextran treated FBS, there was dramatic change in the localization of CC1D-AR in HEK 293 cells. As shown in the accompanying drawing (Fig. 3B), most of the OC1D-AR protein was localized on the cell membrane in case of full- length OC1D-AR. Binding site density of am- AR at passage 35 was found to be 355 miol/mg of protein as shown in Table 1. HEK-Oc1 D cells cultured in the presence of charcoal/dextran treated FBS when analyzed by FACS showed an increase in the fluorescent intensity (around 60% shift) as compared to the cells cultured in the presence of FBS (40% shift) as shown in the accompanying drawing [Fig. 4b, panel A].
Similarly, in the case of HEK-Δ1"79 CC1D there was marked improvement in the cellular localization of N-terminal deleted Cc1D-AR after culturing cells in the presence of 10% charcoal/dextran treated FBS as compared to FBS. Most of the N-terminal deleted CC1D-AR was localized on the cell membrane, which is shown in the accompanying drawing (Fig. 3E). hi order to see the reversal of the effect of charcoal/dextran treated FBS, HEK-OC1D and HEK-Δ1"79 am cells grown in the presence of charcoal/dextran treated FBS were incubated with αi-AR selective agonist phenylepherine. Agonist activation promoted a significant degree of αio and Δ1"79 αio -AR internalization, as most of the fluorescence was detected in cytosol as shown in the accompanying drawing (Fig 3 C and F). While the present invention has been described in terms of its specific embodiments, certain modifications and equivalents will be apparent to those skilled in the art and are included within the scope of the present invention.

Claims

In the Claim: 1. A process for stable cell surface expression of human alpha ID adrenergic receptors, the process comprising: a) PCR amplification and cloning of one or more adrenergic receptor cDNAs; b) sub cloning the one or more cDNAs into one or more mammalian expression vectors; c) transfecting the one or more expression vectors comprising the one or more cDNAs into one or more human cell lines to create clones; d) selecting one or more stable clones with puromycin; e) culturing the one or more clones overexpressing the one or more human alpha ID adrenergic receptors by growing the cells in media comprising charcoal and dextran treated fetal bovine serum; and, f) analyzing the one or more clones for cell surface expression of the one or more human alpha ID adrenergic receptors. 2. The process according to claim 1, wherein the one or more adrenergic receptor cDNAs comprise subtypes OC1D-ARs and N-terminal 79 amino acids deletion mutant of am- AR (A1^ a10-AR). 3. The process according to claim 1, wherein the one or more cDNAs subcloned are OC1D-AR and Δ1'79 α1D-AR. 4. The process according to claim 1, where the one or more mammalian expression vectors comprise recombinant pIRESpuro plasmid vectors. 5. The process according to claim 1, wherein the one or more human cell lines comprise HEK 293 cells, HeLa cells, CHO cells or NIH3T3 cells. 6. The process according to claim 1, wherein the media comprises 10% charcoal and dextran treated fetal bovine serum. 7. The process according to claim 1, wherein the clones are analysed by one or more of immunofluorescence, flow cytometry, western blotting and radio ligand bind assays to detect the cell surface expression of the one or more adrenergic receptors.
PCT/IB2005/003865 2004-12-23 2005-12-22 Process for cell surface expression of human alpha id adrenergic receptor Ceased WO2006067602A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN2552DE2004 2004-12-23
IN2552/DEL/2004 2004-12-23

Publications (2)

Publication Number Publication Date
WO2006067602A2 true WO2006067602A2 (en) 2006-06-29
WO2006067602A3 WO2006067602A3 (en) 2007-01-25

Family

ID=36602129

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2005/003865 Ceased WO2006067602A2 (en) 2004-12-23 2005-12-22 Process for cell surface expression of human alpha id adrenergic receptor

Country Status (1)

Country Link
WO (1) WO2006067602A2 (en)

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHALOTHORN DAN ET AL: "Differences in the cellular localization and agonist-mediated internalization properties of the alpha1-adrenoceptor subtypes" MOLECULAR PHARMACOLOGY, vol. 61, no. 5, May 2002 (2002-05), pages 1008-1016, XP002403119 ISSN: 0026-895X *
GARCIA-SAINZ J A ET AL: "Modulation of basal intracellular calcium by inverse agonists and phorbol myristate acetate in rat-1 fibroblasts stably expressing alpha1d-adrenoceptors" FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 443, no. 3, 29 January 1999 (1999-01-29), pages 277-281, XP004259159 ISSN: 0014-5793 *
HAGUE CHRIS ET AL: "The N terminus of the human alpha1D-adrenergic receptor prevents cell surface expression" JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 309, no. 1, 1 April 2004 (2004-04-01), pages 388-397, XP002403120 ISSN: 0022-3565 *
HROMETZ SANDRA L ET AL: "Expression of multiple alpha1-adrenoceptors on vascular smooth muscle: Correlation with the regulation of contraction" JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 290, no. 1, July 1999 (1999-07), pages 452-463, XP002402990 ISSN: 0022-3565 cited in the application *
KHATTAR SUNIL K ET AL: "Molecular cloning, stable expression and cellular localization of human alpha1-adrenergic receptor subtypes: effect of charcoal/dextran treated serum on expression and localization of alpha(1D )-adrenergic receptor." BIOTECHNOLOGY LETTERS. NOV 2006, vol. 28, no. 21, November 2006 (2006-11), pages 1731-1739, XP002402988 ISSN: 0141-5492 *
LINDQUIST D L ET AL: "CHARCOAL-DEXTRAN TREATMENT OF FETAL BOVINE SERUM REMOVES AN INHIBITOR OF HUMAN CFU-MEGAKARYOCYTES" EXPERIMENTAL HEMATOLOGY (CHARLOTTESVILLE), vol. 15, no. 3, 1987, pages 234-238, XP009073783 ISSN: 0301-472X cited in the application *
MCCUNE DAN F ET AL: "Regulation of the cellular localization and signaling properties of the alpha1B- and alpha1D-adrenoceptors by agonists and inverse agonists" MOLECULAR PHARMACOLOGY, vol. 57, no. 4, April 2000 (2000-04), pages 659-666, XP002402986 ISSN: 0026-895X *
PIASCIK M T ET AL: "alpha1-Adrenergic receptors: New insights and directions" JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, AMERICAN SOCIETY FOR PHARMACOLOGY AND, US, vol. 298, no. 2, August 2001 (2001-08), pages 403-410, XP002259217 ISSN: 0022-3565 cited in the application *
TSANG L L ET AL: "EFFECT OF PHENOL RED AND STEROID HORMONES ON CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR IN MOUSE ENDOMETRIAL EPITHELIAL CELLS" CELL BIOLOGY INTERNATIONAL, ACADEMIC PRESS, GB, vol. 25, no. 10, 2001, pages 1021-1024, XP001084495 ISSN: 1065-6995 *

Also Published As

Publication number Publication date
WO2006067602A3 (en) 2007-01-25

Similar Documents

Publication Publication Date Title
Gottardi et al. E-cadherin suppresses cellular transformation by inhibiting β-catenin signaling in an adhesion-independent manner
Xiang et al. Neoplasia driven by mutant c-KIT is mediated by intracellular, not plasma membrane, receptor signaling
Kertesz et al. The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth
Cohen et al. Transformation-specific interaction of the bovine papillomavirus E5 oncoprotein with the platelet-derived growth factor receptor transmembrane domain and the epidermal growth factor receptor cytoplasmic domain
Ye et al. Bone morphogenetic protein-9 induces apoptosis in prostate cancer cells, the role of prostate apoptosis response-4
Mo et al. Identification of murine p120 cas isoforms and heterogeneous expression of p120 cas isoforms in human tumor cell lines
Kobayashi et al. The c‐Cbl/CD2AP complex regulates VEGF‐induced endocytosis and degradation of Flt‐1 (VEGFR‐1)
EP0694042B1 (en) Inhibitor of vascular endothelial cell growth factor
US5820859A (en) Method of targeting a therapeutic agent to cells expressing the erb B-3 receptor
Wang et al. The Grb2 binding domain of mSos1 is not required for downstream signal transduction
HU215581B (en) A method of producing fibroblast growth factor receptors and their therapeutic use
Fournier et al. Nuclear translocation of integrin cytoplasmic domain-associated protein 1 stimulates cellular proliferation
Heidecker et al. Role of raf and myc oncogenes in signal transduction
Lin et al. Identifying a neuromedin U receptor 2 splice variant and determining its roles in the regulation of signaling and tumorigenesis in vitro
Cohen et al. Etk/Bmx regulates proteinase-activated-receptor1 (PAR1) in breast cancer invasion: signaling partners, hierarchy and physiological significance
Huang et al. CCDC134, a novel secretory protein, inhibits activation of ERK and JNK, but not p38 MAPK
You et al. Differential expression of IL-17RC isoforms in androgen-dependent and androgen-independent prostate cancers
Wen et al. Lipocortin V may function as a signaling protein for vascular endothelial growth factor receptor-2/Flk-1
CN102134275B (en) Epidermal growth factor receptor variant
Parkinson et al. Identification of PKCζII: an endogenous inhibitor of cell polarity
Gesbert et al. Ubiquitination of the common cytokine receptor γc and regulation of expression by an ubiquitination/deubiquitination machinery
Sirinian et al. Alternative splicing generates a truncated isoform of human TNFRSF11A (RANK) with an altered capacity to activate NF-κB
Villa-Morales et al. A role for the Fas/FasL system in modulating genetic susceptibility to T-cell lymphoblastic lymphomas
WO2006067602A2 (en) Process for cell surface expression of human alpha id adrenergic receptor
Dye et al. hShroom1 links a membrane bound protein to the actin cytoskeleton

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase in:

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 05814652

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 05814652

Country of ref document: EP

Kind code of ref document: A2