WO2006066229A2 - Elicitation of antibodies to self peptides by immunization with dendritic cells - Google Patents

Abstract

Antibodies are produce by inoculating a host animal with dendritic cells in combination with a self peptide of interest. In one embodiment, antibodies are produce by incubating the dendritic cells with a self peptide of interest to form an immunogen, incubating B cells from an animal of a same or different species with a peptide homologous to the self peptide of interest, and immunizing the animal with the immunogen and loaded B cell. The self peptide of interest may be provided either as a recombinat protein, or in its native form (e,g., as appearing in the lysate of cells expressing such self peptides, or as the plasma membrane of cells expressing such membrane self peptides).

Description

Elicitation of Antibodies to Self Peptides by Immunization with Dendritic Cells

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S.S.N. 11/016,382, filed on December 17, 2004, which is a continuation-in-part of PCT/US04/30556, filed on September 18, 2004, which claims priority to and the benefit of U.S. Provisional Application Serial No. 60/503,738, filed on September 18, 2003, the contents of each of which are incorporated by reference herein in their entirety.

BACKGROUND OF THE INVENTION

1. Technical Field

The present disclosure relates to methods for rapidly raising antibodies to certain peptides, such as self peptides, using antigen presenting cells (APCs), such as dendritic cells and/or B-cells.

2. Background of Related Art

The major histocompatibility complex (MHC) is a series of genes that code for protein molecules responsible for cell-cell recognition and interaction. The MHC of mammalian species contains three groups of genes: class I, class II, and class III. Class I and class II genes code for cell surface recognition molecules. Class III genes code for certain complement components.

The ability of cells to recognize other cells as self or as originating from another genetically different individual (non-self) is an important property in maintaining the integrity of tissue and organ structure. Class I and class II MHC products control recognition of self and non- self. The major histocompatibility system thus prevents an individual from being invaded by cells from another individual. For example, transplants from one individual generally cannot survive in another individual because of histocompatibility differences.

Histocompatibility similarities are required for cellular cooperation in induction of the immune response, and they provide a mechanism to ensure that T cells and B cells of a given individual can recognize each other for cooperation, yet recognize foreign structures at the same time. In general, T lymphocytes recognize antigens and respond to them when they are presented on the surface of an antigen-presenting cell (APC).

Dendritic cells are one of the most potent groups of antigen-presenting cells. Dendritic cells (DCs) are highly specialized APCs, capable of activating naϊve and memory T lymphocytes. Dendritic cells are derived from bone marrow progenitor cells and monocytes. Immature dendritic cells (iDCs) are found under the skin and mucous membranes where they engulf microorganisms and antigenic molecules through phagocytosis and pinocytosis. Subsequently, the immature dendritic cells migrate to the follicles of secondary lymphoid organs such as lymph nodules, lymph nodes and the spleen and, in the process, mature into mature dendritic cells (mDCs), a class of professional APCs. Mature dendritic cells have numerous pseudopodia-like projections to increase their surface for antigen presentation. DCs degrade foreign microorganisms and other materials with their lysosomes.

DCs are unique in their ability to interact with and activate resting T cells. They are uniquely capable of sensitizing naϊve T cells to protein antigens and eliciting antigen specific immune responses. Peptides from microbial proteins are bound to MHC-II molecules, which are produced by macrophages, dendritic cells, and B-lymphocytes. The peptide epitopes bound to the MHC-II molecules are then placed on the surface of the dendritic cell where they can be presented to T4-lymphocytes. hi addition, dendritic cells can bind peptide epitopes to MHC-I molecules and present them to T8-lymphocytes. Dendritic cells also use toll-like receptors to recognize pathogen-associated molecular patterns. This interaction stimulates the production of co-stimulatory molecules that are also required for T-lymphocyte activation.

Naϊve T cells are characterized by a high expression of ICAM-3 which is a member of the IgG supergene family and is rapidly down-regulated after activation (Vazeux et al, Nature 360: 485, 1992). Studies of murine and human dendritic cells isolated from peripheral blood indicate that these cells can be used to stimulate and expand antigen specific CD4⁺ and CD8⁺ cells in vitro. Shen et al, "Cloned Dendritic Cells can Present Exogenous Antigens on Both MHC Class I and Class It Molecules," J Immunol. 158: 2723, 1997. Cancer vaccines have also been developed loading dendritic cells in vitro with tumor lysate, tumor proteins and/or tumor peptides. See, e.g., Ashely et al, "Bone Marrow-Generated Dendritic Cells Pulsed with Tumor Extracts or Tumor RNA Induce Antitumor Immunity Against Central Nervous System Tumors," J Exp. Med. 186: 1177, 1997; Avigan, "Dendritic Cells: Development, Function and Potential Use for Cancer Immunotherapy," Blood Rev. 13: 51, 1999; Zhou et al, "Current Methods for Loading Dendritic cells with Tumor Antigen for the Induction of Antitumor Immunity," J. Immunother. 25: 289, 2002.

A number of adhesive interactions between the DC and T lymphocyte are important during T lymphocyte activation. The DC-expressed beta-integrin, LFA-I, was originally described as the major ligand for intercellular adhesion molecule (ICAM-3) on T-lymphocytes. However, antibodies against LFA-I failed to abrogate T-cell-DC clustering, while anti-ICAM-3 completely abrogated this clustering. A search thus began for the dendritic cell expressed molecule responsible for this ICAM-3 -binding activity.

Recently, a novel ICAM-3 binding C-type lectin, known as DC-Specific ICAM-3 grabbing non-integrin, or DC-SIGN, was found. DC-SIGN is expressed on dendritic cells and appears to mediate adhesion between dendritic cells and ICAM-3 on naϊve T cells and to be essential for DC-induced T cell proliferation (See Geijtenbeek et al, Cell 100: 587-597, 2000).

WO 00/63251, the contents of which are incorporated by reference herein, describes the use of DC-SIGN to modulate immune responses and HIV-infection by affecting the interaction between dendritic cells and T cells. Immune responses can be inhibited or prevented by preventing the interaction of DC-SIGN on dendritic cells with receptors on T cells, e.g., by using antibodies specific for DC-SIGN. Alternatively, an immune response to an antigen can be potentiated by binding the antigen to DC-SIGN on dendritic cells such that the antigen plus DC- SIGN is taken up by dendritic cells and processed and presented to T cells.

Besides its prominent role in DC-T cell clustering and initiation of T cell responses, DC- SIGN is a major receptor involved in infection of DC and subsequent transmission to T cells of viruses such as HIV-I, HIV-2, SIV-I, hepatitis C virus (HCV), Ebola virus, SARS, cytomegalovirus (CMV), Sindbis, and Dengue virus; bacteria such as Helicobacter pylori, Klebsiella pneumoniae, and bacteria of the Mycobacterium genus, including M. tuberculosis and M. bovis; yeast such as Candida albicans; and parasites such as Leishmania pifanoi and Schistosoma mansoni.

For example, due to their position in the body surface as imrmmo-surveillance cells, it is likely that DCs are the first cells infected with HIV-I after mucosal exposure, and are therefore implicated to play an important role in the immuno-pathogenesis of HIV. It is now generally believed that HIV converts the normal trafficking process of DC to gain entry into lymph nodes and access to CD4⁺ T cells, as was demonstrated in vivo using primary simian immunodeficiency virus infection of macaque as a model system (Spira et al, J. Exp. Med. 183: 215, 1996) (Joag et al, J. Virol. 71: 4016, 1997). Productive infection of DC with HIV-I has been reported by several investigators (Granelli- Piperno et al, J. Virol. 72(4): 2733-7, 1998) (Blauvelt et al, Nat. Med. 3(12): 1369-75, 1997) and substantial evidence indicates that DC pulsed with HIV-I in vitro can induce a vigorous infection when co-cultured with T cells (Cameron et al, Science 257(5068): 383-7, 1992). Although it is still unclear whether a similar scenario occurs in HIV infected individuals, HIV-I transmission from DC to T cells could contribute to the CD4⁺ T cell depletion observed in AIDS. Studying HIV-DC interactions should contribute to the understanding of early events of HlV infection and will hopefully lead to strategies aimed at blocking early events in transmission. For a further discussion, reference is also made to WO 95/32734 and WO 96/23882.

Therefore, antibodies again certain antigens, such as DC-SIGN, are therapeutically useful for modulating immune-responses and a number of pathological infections in general and thus can be used to treat a broad spectrum of diseases / pathological conditions.

Phage libraries displaying antibody fragments are very useful for the discovery of specific antibodies directed against specific human proteins. It is highly desirable to identify antibodies from a library derived from an immunized individual. Since it is unethical to immunize humans except for approved vaccines, other mammals are used to produce such libraries. Frequently, rodents, such as mice, are the species of choice in producing such libraries. In certain applications, antibodies may be raised against specific peptides. In general, this is accomplished by linking peptides to carrier proteins such as KLH or BSA, since an immune response against the peptide alone may not be easily achieved in all instances. However, one potential disadvantage to this approach is that the immune response may be raised primarily against the carrier proteins. This is particularly true for certain self antigens, such as DC-SIGN, which tend not to illicit robust immune responses, hi addition, attempting to generate antibodies in a different species may also be problematic, partly because the human peptides or proteins are frequently highly homologous to rodent proteins. Thus immunizations with self proteins are typically unsuccessful, even in the presence of carrier proteins.

Thus improved methods for raising antibodies to peptides, especially self peptides, are desirable. Cytokines also play a role in directing the T cell response. Helper (CDA⁺) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells. Most mature CD4⁺ T helper cells express one of two cytokine profiles: ThI or Th2. ThI cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-IO, IL- 13, GM-CSF and low levels of TNF-α The ThI subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG2a. The Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgGl and IgE. Dendritic cells produce cytokines such as tumor necrosis factor-alpha (TNF-O!), interleukin-1 (IL-I), interleukin-6 (IL-6), and interleukin-8 (IL-8).

A number of bacterial products, such as lipopolysaccharide, are also known to stimulate mammalian immune responses. Recently, bacterial DNA itself has been reported to be one such molecule (e.g., Krieg et al, Nature 374: 546-9, 1995). One of the major differences between bacterial DNA, which has potent immunostimulatory effects, and vertebrate DNA, which does not, is that bacterial DNA contains a higher frequency of unmethylated CpG dinucleo tides than does vertebrate DNA. Select synthetic oligodeoxynucleotides (ODN) containing unmethylated CpG motifs (CpG ODN) have been shown to have an immunologic effects and can induce activation of B cells, NK cells and APCs such as monocytes and macrophages (Krieg et al, supra). They can also enhance production of cytokines known to participate in the development of an active immune response, including tumor necrosis factor-α, IL- 12 and IL-6 (e.g., Klinman et al, Proc. Natl. Acad. Sd. USA 93: 2879-83, 1996).

SUMMARY OF THE INVENTION

The present invention relates to novel methods for producing antibodies, especially antibodies to self peptides. The novel methods and antibodies produced by such methods are useful for the treatment of various conditions such as cancer, inflammation or infectious diseases.

In one embodiment, the method comprises the steps of obtaining dendritic cells from a host am^'mal; incubating the dendritic cells with a self peptide of interest to form an immunogen; obtaining B cells from a second animal of a different species than the host animal; incubating the B cells with a peptide from the second animal homologous to the self peptide of interest to form a loaded B cell; immunizing the host animal with the immunogen and the loaded B cell; and obtaining antibodies to the self peptide of interest.

Thus one aspect of the invention provides a method of producing an antibody, comprising the steps of: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a cell-derived material including a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; d) harvesting cells that produce antibodies to the self peptide of interest; and e) recovering one or more antibodies from the harvested cells. In certain cases, the dendritic cells are obtained by direct isolation of dendritic cells or by maturation of monocytes. Optionally, the antibody is a humanized antibody.

In one embodiment, the cell-derived material is a cell lysate. In another embodiment, the cell-derived material is a plasma membrane, when the self peptide is a plasma membrane protein.

In one embodiment, step c) is repeated more than once before step d). In one embodiment, different cell-derived materials are used in step c).

In one embodiment, the cell-derived materials for different repeats in step c) are independently selected from: a recombinant self peptide of interest, a lysate from cells expressing the self peptide of interest, or a plasma membrane of cells expressing the self peptide of interest.

Another aspect of the invention provides a method of producing an antibody, comprising the steps of: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) obtaining B cells from a second animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; e) immunizing the host animal with the immunogen and the loaded B cell; f) harvesting cells that produce antibodies to the self peptide of interest; and g) recovering one or more antibodies from the harvested cells. In certain cases, the dendritic cells are obtained by direct isolation of dendritic cells or by maturation of monocytes. Optionally, the antibody is a humanized antibody.

In one embodiment, the second animal is of a different species than the host animal.

In one embodiment, the second peptide is at least about 60% homologous to the self peptide of interest, preferably 70%, 80%, 90%, 95%, 97%, 99%, or 100% homologous to the self peptide of interest. By homologous it is meant that the amino acid sequence of the second peptide is at least 60% identical to the amino acid sequence of the self peptide of interest, preferably 70%, 80%, 90%, 95%, 97%, 99% or 100% identical to the self peptide of interest.

In one embodiment, the second peptide is from the second animal, said second animal is of a different species than the host animal. Alternatively, said second animal is of the same species as the host animal.

In one embodiment, the second peptide is recombinantly produced.

In one embodiment, the host animal is a rodent, such as a mouse, a rat, a rabbit, or a hamster, etc.

In one embodiment, the second animal is a human or a rodent (a mouse, a rat, a rabbit, or a hamster, etc.).

In one embodiment, the step of obtaining dendritic cells comprises selecting dendritic cells utilizing antibodies to markers associated with dendritic cells, and the markers are selected from the group consisting of: cell surface molecules responsible for T cell activation, adhesion molecules, and co-stimulatory molecules.

In one embodiment, the step of obtaining dendritic cells comprises selecting dendritic cells utilizing antibodies to dendritic cell markers CD54 or CDIl.

In one embodiment, the step of obtaining dendritic cells comprises obtaining a tissue from the host animal and maturing dendritic cells using proper cytokines. For example, the dendritic cells may be obtained by isolating bone marrow from the host animal, lysing red blood cells in the bone marrow, and maturing the remaining cells with IL-4 and/or GM-CSF.

In one embodiment, the dendritic cells are incubated with a self peptide of interest obtained from a cell lysate of the host animal.

In one embodiment, the dendritic cells are incubated with a self peptide of interest obtained from a plasma membrane.

In one embodiment, the self peptide of interest is coated onto a polystyrene bead. hi one embodiment, step e) further comprises adding an adjuvant to the imniunogen and the loaded B cell. For example, the adjuvant may be selected from the group consisting of: IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon-γ, TNF-α, TGF-/3, Flt-3, and CD40 ligand. In a preferred embodiment, the adjuvant is a CpG oligonucleotide. In one embodiment, steps f) and g) comprise removing cells comprising antibodies from the host animal, isolating RNA from the removed cells, constructing an antibody library, and identifying one or more antibodies that bind to the self peptide of interest.

In one embodiment, the antibody library is an Fab library.

In one embodiment, the antibody library expresses antibodies on the surface of phages.

In one embodiment, the one or more antibodies that bind to the self peptide of interest are identified by panning the phages on cells expressing the self peptide of interest.

In one embodiment, the self peptide of interest is DC-SIGN (DC-Specific ICAM-3 grabbing non-integrin).

In one embodiment, the antibody cross-reacts with both human DC-SIGN and mouse DC-SIGN.

In one embodiment, the antibody has a higher affinity for human DC-SIGN than that for mouse DC-SIGN.

Another aspect of the invention provides an antibody produced in accordance with the method of invention.

In one embodiment, the host animal is a mouse, and the antibody is specific for human DC-SIGN.

Another aspect of the invention provides a pharmaceutical composition comprising the antibody of the invention.

Another aspect of the invention provides a fusion molecule comprising an antibody to DC-Specific ICAM-3 grabbing non-integrin (DC-SIGN) linked to a self peptide of interest. The antibody may be chemically linked to the self peptide of interest, or the antibody and the self peptide of interest may be encoded by a polynucleotide as a fusion protein.

In one embodiment, the self peptide of interest is a cancer antigen, such as gplOO, g250, p53, MAGE, BAGE, GAGE, MART 1, Tyrosinase related protein 11, or Tyrosinase related protein.

In another embodiment, human antibodies are produced using non-human hosts. In this embodiment, antibodies are produced by grafting human tissue into an immuno-deficient, non- human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and fetal liver to produce a human antibody; applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; obtaining human monocytes from a donor; maturing the human monocytes to dendritic cells; obtaining the dendritic cells; incubating the dendritic cells with a self polypeptide of interest to form an immunogen; immunizing the host with the immunogen; and harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies to the self polypeptide of interest.

In yet another embodiment, methods of producing human antibodies in vivo in non- human hosts are provided. This method includes grafting human tissue into an immuno-deficient, non-human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and/or fetal liver to produce a human antibody; applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; linking a self peptide of interest to an antibody to DC-Specific ICAM-3 grabbing non-integrin (DC-SIGN); immunizing the host with the self polypeptide of interest and antibody to DC-Specific ICAM-3 grabbing non-integrin (DC- SIGN); and harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies to the self polypeptide of interest.

Antibodies produced by the methods of the present disclosure are also provided. Compositions comprising the antibody of the present disclosure, such as an anti-DC-SIGN antibody, in a pharmaceutically acceptable carrier are also provided.

The present disclosure also provides a method of testing the effect of drugs comprising administering a drug to a non-human mammal having at least a sufficient portion of human thymus, spleen, bone marrow, skin, lymph nodes and/or fetal liver grafted therein to allow the development of one or more types of human immune cells selected from the group consisting of T cells, B cells and dendritic cells; and observing any effects of the drug on human antibody production.

In certain embodiments, the present invention provides a method of producing an antibody comprising the steps of: a) obtaining dendritic cells from a host animal; b) transfecting the dendritic cells with nucleic acid encoding a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; and d) harvesting cells that produce antibodies to the self peptide of interest. In certain embodiments, the present invention provides a method of producing a human antibody comprising the steps of: a) grafting human tissue into an immunodeficient, non-human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and fetal liver to produce a human antibody; b) applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; c) obtaining human monocytes from a donor; d) maturing the human monocytes to dendritic cells; e) obtaining the dendritic cells; fjincubating the dendritic cells with a self peptide of interest to form an immunogen; g) immunizing the host with the immunogen; and h)harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies. For example, the immunodeficient, non-human, mammalian host is a rodent (e.g., a SCID mouse). The method may optionally further comprise the step of irradiating the immunodefcient, non-human, mammalian host prior to said grafting step or further comprise the step of testing for the presence of human antibodies prior to said immunizing step. In certain cases, the step of obtaining human monocytes comprises obtaining monocytes from a donor selected from the group consisting of a donor of the human tissue and an HLA-matched human donor. Optionally, the step of harvesting cells comprises removing at least a portion of the human tissue from the host, isolating RNA from the removed human tissue, constructing an antibody library and identifying one or more antibodies that bind to the self peptide of interest. In certain embodiments, the present invention provides a human antibody produced in accordance with this method.

In certain embodiments, the present invention provides a method of producing a human antibody comprising the steps of: a) grafting human tissue into an immunodeficient, non-human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and fetal liver to produce a human antibody; b) applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; c) linking a self peptide of interest to an antibody to DC- Specific ICAM-3 grabbing non-integrin; d) immunizing the host with the self peptide of interest and antibody to DC-Specific ICAM-3 grabbing non-integrin; and e) harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies to the self peptide of interest. In certain aspects, the present invention provides a human antibody produced in accordance with this method. In certain embodiments, the present invention provides a method of producing a human antibody comprising the steps of: a) injecting CD34+ human cord blood into RAGAyc -/- mice to produce a human antibody; b)maturing the cells from CD34+ human cord blood to dendritic cells; c) obtaining the dendritic cells; d) incubating the dendritic cells with a self peptide of interest to form an immunogen; e) immunizing the injected RAGAγc -/- mice with the immunogen; and f) recovering human antibodies.

In certain embodiments, the present invention provides a method of producing an immune response in an animal wherein said immune response is production of an antibody to a self peptide, said method comprising: a) isolating dendritic cells from an animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) isolating B cells from said animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; and e) immunizing the animal with the immunogen and the loaded B cell.

In certain embodiments, the present invention provides a method of producing therapeutic antibodies, comprising: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a cell-derived material including a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; d) harvesting cells that produce antibodies to the self peptide of interest; e) recovering one or more antibodies from the harvested cells; and f) humanizing the antibodies from step (e) to produce therapeutic antibodies.

In certain embodiments, the present invention provides a method of producing therapeutic antibodies, comprising: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) obtaining B cells from a second animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; e) immunizing the host animal with the immunogen and the loaded B cell; f) harvesting cells that produce antibodies to the self peptide of interest; g) recovering one or more antibodies from the harvested cells; and h) humanizing the antibodies from step (g) to produce therapeutic antibodies. Optionally, such method may be used for producing cross-reactive antibodies. hi certain embodiments, the present invention provides a vaccine composition for treating cancer in a mammal, comprising a therapeutically effective amount of dendritic cells wherein said dendritic cells have been incubated with a cell-derived material including a self peptide of interest to form an immunogen.

It is contemplated that all embodiments of the invention described herein are applicable to all aspects of the invention, unless obviously inapplicable or otherwise expressly stated.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a graphical depiction of ELISA results demonstrating the binding of antibodies produced in accordance with the present disclosure to a self peptide of interest.

FIG. 2 is another graphical depiction of ELISA results demonstrating the binding of antibodies produced in accordance with the present disclosure to a self peptide of interest.

FIG. 3 shows antibody levels to the recombinant mouse DC-SIGNFc fusion protein. ELISA plates coated directly with either mouse DC-SIGNFc fusion protein or mouse IgG-Fc fragment were used to screen serum (1 :250 dilution) from mice immunized with mouse DCs, pulsed with mouse DC-SIGN transfected cell lysates and mouse B-cells loaded with human DC- SIGNFc fusion protein (mouse #2855 and #2856), and mice immunized with mouse DC-SIGN transfected cells and human DCs (mouse #2857 and #2858). Anti-mouse AP conjugate was used for detection.

FIG. 4 shows antibody levels to mouse dendritic cells. Mature mouse DCs (0.5 million) were stained with serum (1:10 dilution) from mice immunized with mouse DCs, pulsed with mouse DC-SIGN transfected cell lysates and mouse B-cells loaded with human DC-SIGNFc fusion protein (mouse #2855 and #2856); and mice immunized with mouse DC-SIGN transfected cells and human DCs (mouse #2857 and #2858). Anti-mouse PE conjugate was used for detection.

FIGs. 5 A-B show antibody response in mice immunized with a combination regimen of mouse and human DC-SIGN. ELISA plates were coated with either human DC-SIGN (Figure 5A) or mouse DC-SIGN (Figure 5B) Fc fusion proteins to detect antibodies in the serum of mice (#2855 and #2856) immunized with a combination of mouse and human DC-SIGN. Irrelevant isotype control proteins are mouse Fc FLJ and ICAM-3 human Fc.

FIG. 6 shows a representative result of FACS screening of clones.

FIG. 7 shows light chain sequence for human DC- SIGN reactive clones IBlO LC (represented by SEQ ID NO: 34) and 1F8 LC (represented by SEQ ID NO: 35). FIG. 8 shows heavy chain sequence for human DC-SIGN reactive clones 1F8 HC (represented by SEQ ID NO: 36) and IBlO HC (represented by SEQ ID NO: 37).

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

The present disclosure is directed to methods for rapidly raising antibodies, especially antibodies directed against self polypeptides using APCs, such as dendritic cells and/or B-cells. Preferably, a response is elicited to a self polypeptide localized on the cell surface, such as the cell surface of a dendritic cell. In a preferred embodiment, the self peptide is DC-SIGN. Phage libraries displaying antibodies or antibody fragments to these polypeptides may then be constructed and utilized to identify additional antibodies. In a preferred embodiment, antibody libraries are screened for those directed against human or mouse self polypeptides.

The term "self polypeptide" or "self peptide" as used herein means any polypeptide or peptide (including, but not limited to peptides, full length proteins, and truncated proteins) produced by a normal, healthy subject that does not elicit an immune response or a strong / substantial immune response within the subject. As will be evident to a skilled artisan, a self peptide may be produced at various levels in normal subjects, including zero, low or normal levels, in normal subjects; however, these self peptides may be produced at aberrant or high levels in certain disease states. In certain embodiments, the self peptides are peptides that are involved in the mediation of various disease conditions. Accordingly, in certain embodiments, the self peptides are peptides that are upregulated in the cancerous tissues in comparison to normal tissues, examples include but are not limited to Ras, CDC27, CDK4, prostate-specific antigen, alpha-fetoprotein, breast mucin, gplOO, g250, p53, MART-I, MAGE, BAGE, GAGE, tyrosinase, Tyrosinase related protein 11, Tyrosinase related protein, and RAD50. hi certain alternative embodiments, the self peptides are cell surface proteins expressed on immunoregulatory cells (e.g., T cells, B cells, and dendritic cells), including, but not limited to, DC-SIGN, L-SIGN, CD200, T1M-3, B7-H4, PD-Ll, PD-L2, and PD-I, wherein antibodies to the self peptides result in modulation of the immune response.

It should be understood that the self polypeptides can be naturally occurring or synthetically produced. It also should be understood that the self polypeptide need not be identical to the naturally produced polypeptide, but rather can include variations thereto having homology as low as 60%, provided the variation does not elicit an immune response or a substantial immune response within the subject. Preferably, the self polypeptide or variation thereof does not elicit an immune response within the subject.

Li accordance with the present disclosure, a suitable mammalian host for immunization is first identified. Preferably the host animal is a rodent, such as a rabbit, a rat, a hamster or a mouse. Most preferably a Swiss, Balb/c or NIH mouse is utilized as the host animal.

The dendritic cells may be obtained from a variety of different tissues from the host animal, such as (without limiting): bone marrow, blood, spleen, or any other source. Li one embodiment, the dendritic cells are obtained from the spleen of the host animal.

Methods for obtaining dendritic cells from a host are known to those skilled in the art. For example, where the source of the dendritic cells is the spleen, cells may be obtained by digesting the spleen with an enzyme such as collagenase, manually teasing the spleen apart, and then filtering the cells through a filter. Dendritic cells may be selected using methods known to those skilled in the art, and include the use of systems utilizing antibodies to markers associated with DCs. Such markers include, but are not limited to, cell surface molecules responsible for T cell activation such as class I and class II MHC, adhesion molecules (e.g., CD54 and CDl 1), and co-stimulatory molecules (e.g., CD40, CD80, CD86 and 4-1BB). Commercially available systems which may be utilized include StemCell Technologies' EasySep system, which involves labeling dendritic cells with anti-CDl Ic coated magnetic beads.

Once obtained, purified dendritic cells may be incubated in an appropriate incubator, such as a CO₂ incubator, for a period of time ranging from about 30 minutes to about 3 hours, more preferably from about 45 minutes to about 90 minutes with a polypeptide of interest. As used herein, a polypeptide of interest can be both haptens and antigens, where the haptens are modified to provide for an immune response. Most preferably, the peptide of interest is a self polypeptide. Preferably, the polypeptide of interest obtained from the host animal is homologous with a human polypeptide. The degree of homology between the polypeptide in the host animal and human can vary, preferably ranging from about 60% to about 100% homology, more preferably from about 90% to about 100% homology, with 100% homology between the human and host animal polypeptide being most preferred.

It is further contemplated that the polypeptide of interest can be immobilized on a substrate prior to contact with the dendritic cells. Any suitable substrate within the purview of those skilled in the art can be used to carry the polypeptide of interest. Typically, the substrate will be an inert synthetic material. In one embodiment, polystyrene beads are used as the substrate and are coated with the polypeptide of interest. The coated beads are then incubated with dendritic cells.

Since peptides do not always provide the desired conformational epitopes, in some embodiments it may be advantageous to load the dendritic cells with self peptides obtained from cell-derived material. For example, dendritic cells may be loaded with cell lysate by incubating dendritic cells at the immature stage (reached by culturing bone marrow cells for 7 days with GM-CSF and IL-4) with lysate prepared, e.g., by freeze-thawing target cells of interest, before maturing the dendritic cells with TNF-alpha for another 2 days. As another example, in other embodiments, dendritic cells can be loaded with plasma membranes. This is useful if the self peptide is known to be expressed on cell surface. Plasma membranes may be prepared, e.g., by coating polylysine beads with cells followed by lysis of the cells. After lysis has occurred, only plasma membranes will remain attached to the beads. The membrane-coated beads may then be presented to dendritic cells, which will engulf the particles and present the attached membrane proteins as the self peptide.

The dendritic cells and polypeptide of interest (alone or coated onto a substrate) may be placed in an appropriate medium for the growth of such cells including, but not limited to, Eagle's Minimal Essential Medium with Earle's salts (EMEM) (GIBCO, Grand Island, N. Y.). Where the source of the dendritic cells is murine, the incubation preferably occurs in media containing from about 1% to about 10% mouse serum, with a range of from about 2% to about 5% mouse serum preferred. The combination of dendritic cells and peptide of interest is sometimes referred to herein as an "immunogen."

Alternatively, the dendritic cells are transfected with nucleic acid encoding a polypeptide of interest {e.g., with RNA encoding a polypeptide of interest), and then cultured to activate the dendritic cells. Techniques for transfecting a dendritic cell with nucleic acid encoding a polypeptide of interest are within the purview of those skilled in the art.

In addition to loading dendritic cells with a polypeptide of interest, B cells can be incubated with the polypeptide of interest. Techniques for incubating B cells with a polypeptide of interest are within the purview of those skilled in the art. Both cell types (the dendritic cells and B cells) that have been contacted with the polypeptide of interest can be injected into a host animal at the same time.

For pre-clinical studies, it is desirable to have antibodies that react with the human target of interest, as well as with a rodent homologue (such as the mouse homologue). Thus, for example, to focus the immune response on epitopes homologous in human and mice, in some embodiments, B cells may be isolated from the spleen of mice or from human sources (such as PBMC), using, for example, negative selection. A commercially available apparatus, such as the magnetic bead separation apparatus from Miltenyi Biotec (Auburn, CA) may be used. B cells may be incubated with peptides homologous to the self peptides, DNA, RNA, cell lysates or membrane or peptide coated beads obtained from the species not used for dendritic cell loading, or recombinant peptides.

Thus, in one embodiment, the source of the self peptide may be murine, the source of the B cells may be human or mouse, and homologous peptide may be from human.

In other embodiments, any combinations may be used, e.g., wherein the source of the dendritic cells, the source of the self peptide, the source of the B cells, and the source of the homologous peptide may be from mouse or human.

Li certain embodiments, B cells may be cultured in vitro with soluble CD40L and IL-4 or any other B cell stimulant before adding the source of antigen, i.e., peptide homologous to the self peptide, to be loaded on the cells.

Immunizations with recombinant proteins may raise an immune response that does not recognize the native form of the protein. Immunizing with cells expressing the native form of the protein may raise an immune response against a large variety of antigens, and the antigen of interest might not be dominant. Although alternating immunizations of cells and recombinant proteins shows some success, it can be hampered by a strong response of dominant epitopes that are not of interest. This problem can be circumvented at least partially by injecting a mixture of dendritic cells loaded with self peptide and B cells loaded with the self peptide homo log. For example the mixture may include dendritic cells loaded with cell membranes coated on beads or loaded with cell lysate (where the peptides are more likely in their native forms), and B cells loaded with recombinant protein or peptides (where the peptides may or may not be in their native forms).

The immunogen together with B cells that have been incubated with a polypeptide of interest and its homologue can then be introduced into a host animal. The mixture may be injected, for example, subcutaneously, intravenously, intraperitoneally, or by any other suitable route. The entire culture medium (including unbound polypeptide, dendritic cells, culture medium, immunogen, etc.) can be administered to the host animal.

In certain embodiments, the cells can be washed and, optionally, an adjuvant may be added prior to introduction into a host animal. Suitable adjuvants include cytokines and similar compounds which help orchestrate an immune response to the peptide of interest on the dendritic cells. As used herein, the term "cytokine" is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to: IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-IO, IL-12, IL-15, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (GCSF), interferon-7 (γ-INF), tumor necrosis factor (TNF), TNF-α, TGF-ft Flt-3 ligand, and CD40 ligand. CpG oligonucleotide, which enhances antibody dependent cellular cytotoxicity, can also be used as an adjuvant in conjunction with peptide/antigen presentation. Other adjuvants include alum, REBI, complete Freund's adjuvant, specol, B. pertussis or its toxin, etc. Other art-recognized adjuvants may also be used.

Preferably, the adjuvant is a CpG oligonucleotide (e.g., those commercially available from Qiagen, Chatsworth, CA) or Flt-3 (U.S. Pat. No. 6,190,655). The combination of adjuvant and polypeptide of interest may enhance the production of an immune response against the polypeptide of interest.

As a negative control, pre-immunization serum may be obtained from the host prior to introduction of the immunogen and adjuvant, if any. The immunogen in combination with adjuvant, if any, may then be administered to the host. Administration will normally be by injection, either subcutaneous, intramuscular, intraperitoneal or intravascular.

It should be understood that one or more booster injections can be performed over a period of time, with or without adjuvant or cytokine stimulation, via the same or different administration routes. Where multiple injections are used, subsequent injections may be made, within 1 to 6, more usually 2 to 4 weeks of the previous injection. In subsequent injections, dendritic cells from the same subject, or a related subject can be used, either alone or conjugated to the polypeptide of interest. In addition, subsequent injections may include the same or different adjuvants.

After a time sufficient for the formation of antibodies, which can range from about 7 to about 21 days, preferably from about 7 to about 10 days from the last injection, a blood sample is taken and the sample is subjected to an assay for antibodies to the polypeptide of interest.

Various immunoassays known in the art can be used including, but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and Immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.

Once it is confirmed that the desired antibody is present in the immunized host animals, antibodies may be directly collected from the immunized host animals, optionally affinity purified using the antigens (e.g., the immunizing polypeptide). In other embodiments, the immunized host animals may be sacrificed for monoclonal antibody generation, or antibody library generation, using art-recognized technologies.

For example, for monoclonal antibody generation, mouse or rat spleen cells may be used to prepare hybridomas by standard procedures (see Zola, H., Ed., Monoclonal Antibodies, CRC Press Inc. 1987). Positive hybridomas can be cloned by the limited dilution method. Purification of monoclonal antibodies may be achieved by a number of conventional techniques, such as using ProsepA (Bio Processing, Consett, UK) chromatography according to the manufacturer's instructions. Purified monoclonal antibodies may be further isotyped by commercially available kits (e.g., Zymed, Amersham). In an alternative embodiment, human antibodies are produced by human tissue grafted into a non-human, mammalian recipient. Thus, in addition to raising mouse antibodies, it is also possible to raise human antibodies in mice grafted with components of the human immune system. The grafted tissue includes sufficient portions of one or more human immune organs to produce a fully human antibody.

The term "human immune organ" is intended to include human tissue from any organ that produces one or more molecules involved in the production of a human antibody. Thus, for example, tissues containing or capable of developing cell types that actually produce antibodies are included in the graft. In addition, tissue involved in the recognition, breakdown or presentation of an antigen to an antibody producing cell may also be included in the grafted tissue. Suitable tissue types which fall within the category of "human immune organ" include thymus, spleen, bone marrow, skin, lymph nodes and liver. Other suitable types of tissue will be readily apparent to those skilled in the art.

The tissue to be grafted is preferably obtained from a fetal source, having a gestational age of at least four months, more usually in the range of 18 to 24 weeks and ranging up to neonate tissue, depending upon the nature of the tissue or organ. Tissue from a single donor is preferred. The use of fetal instead of adult tissues is preferred because it allows development of the immune system directly within the recipient. As the fetal cells develop they are exposed to proteins native to the recipient, and the immune organs become tolerant to the environment within the recipient. hi a particularly useful embodiment, thymus, spleen, bone marrow, skin, lymph nodes and fetal liver are all grafted into the recipient to ensure that all aspects of antibody production are provided. Transplanting bone, fetal liver and thymus allows the development of T and B cells, thereby providing a broad repertoire of potential antigen specificity. Addition of skin provides the site of immunogen injection (as described in more detail below) with the highest probability of human antigen presenting cells picking up the immunogen. Lymph nodes can be important for T/B cell interaction and the spleen is a potential resource of B cells to construct a display library.

The amount of tissue grafted into the recipient should be an amount sufficient to produce antibodies. The amount of tissue grafted can be as little as 1 mm³ of each type of tissue. On the other hand, grafts of 100 mm³ or more can be used, depending on the specific recipient chosen. The tissue may be fresh tissue, obtained within about 48 hours of death, or cryopreserved in a manner that maintains viability of the tissue.

The recipient can be any type of animal into which human tissue can be grafted and remain viable. Genetically immunocompromised mice are a particularly preferred recipient, especially NOD-SCE) mice. In such a case, a mouse having such human tissue grafted therein is sometimes referred to as a "humouse."

Where possible, it is preferred to irradiate the recipient before the human tissue is grafted therein. As those skilled in the art will appreciate, irradiation of the recipient will eliminate the native immune function of the recipient. The specific parameters for irradiation will depend on the particular type of recipient, especially the volume of the recipient. It should be understood, of course, that the conditions for irradiation should not be sufficiently severe as to kill the recipient. Irradiation conditions for various types of recipients are known to those skilled in the art. In general, the lowest dose of radiation necessary to cause loss of immune function should be applied. By starting low and applying progressively higher doses of radiation, an effective dosage of radiation can be determined without undue experimentation. SCID mice can be irradiated with gamma radiation in an amount ranging from 100 to 2000 RAD.

Grafting can be accomplished by simply making an incision in the skin of the recipient and placing the human tissue under the skin of the recipient. If desired, the grafted tissue can be secured to a desired location within the recipient's body such as, for example by sutures or staples. The location at which the human tissue is grafted is not critical. Considerations in choosing a location for the graft include the likelihood that the grafted tissue will be vascularized, the ease of implantation and the ease of retrieval of the implanted tissue. Preferably the grafting site is a highly vascularized location. The site of grafting can be downstream from a convenient site in the blood or lymphatic system for introduction of an antigen as described below. In particularly useful embodiments, primary lymph organs (e.g., bone, liver and thymus) are grafted at a location remote from the secondary lymph organs (e.g., spleen, lymph nodes and skin). Once the tissue is placed and/or secured within the recipient, the incision in the recipient's skin can be closed (e.g., by suturing, stapling or adhesive). While the human skin can be placed below the recipient's skin, it is preferred to remove a section of the recipient's skin and provide a surface graft of the human skin to allow injection of an immunogen directly through the human skin graft. Optionally, the mononuclear fraction of cord blood can be injected into the recipient's blood stream at or around the time of grafting.

At or after the placement of the graft, the immediate environment surrounding the graft is optionally treated to enhance lymphocyte development and antibody production. Suitable treatments include the application of compositions containing components known to enhance vascularization and cell growth, the differentiation of cells and/or the production of antibodies. Suitable compositions include gelling agents (such as, for example, methylcellulose or agar) containing growth factors (such as, for example, Stem Cell Factor, Granulocyte Macrophage- Stimulating Factor, IL-3, IL-6, Granulocyte-Colony Stimulating Factor, and erythropoietin). Commercially available products that can be used for this purpose include METHOCULT^® GF H4435 available from StemCell Technologies Inc. (Vancouver, British Columbia). Details regarding METHOCULT^® products are disclosed in the following articles: Conneally et al, "Rapid and efficient selection of human hematopoietic cells expressing murine heat-stable antigen as an indicator of retroviral-mediated gene transfer," Blood 87: 456, 1996; Eaves, "Assays of hemopoietic progenitor cells," Williams Hematology, 5 (eds. Beutler, Lichtman, Coller, & Kipps), McGraw-Hill, Inc., pp L22-6, 1995; Eaves & Lambie, "Atlas of Human Hematopoietic Colonies," StemCell Technologies Inc, 1995; Eaves & Eaves, Current Therapy in Hematology-Oncology 4: 159, 1992; Helgason et al, "Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro," Blood 87: 2740, 1996; Hogge et al., "Enhanced detection, maintenance and differentiation of primitive human hematopoietic cells in cultures containing murine fibroblasts engineered to produce human Steel factor, interleukin-3 and granulocyte colony-stimulating factor," Blood 88: 3765, 1996; Hough et al, "Reduction of early B lymphocyte precursors in transgenic mice overexpressing the murine heat-stable antigen," J. Immunol. 156: 479, 1996; Lemieux et al, "Characterization and purification of a primitive hematopoietic cell type in adult mouse marrow capable of lympho- myeloid differentiation in long-term marrow 'switch' cultures," Blood 86: 1339, 1995; Mayani et al, "Cytokine-induced selective expansion and maturation of erythroid versus myeloid progenitors from purified cord blood precursor cells," Blood 81: 3252, 1993; Petzer et al, "Self- renewal of primitive human hematopoietic cells (long-term culture-initiating cells) in vitro and their expansion in defined medium," Proc. Natl. Acad. ScL USA 93: 1470, 1996. The disclosure of each of these references is incorporated by reference herein.

Another useful composition that can be applied to the grafted human tissue is a composition capable of supporting cell growth. Suitable compositions in this category include basement-membrane-derived compositions containing a biologically active polymerizable extract containing laminin, collagen IV, nidogen, heparin sulfate proteoglycan and entactin. The term "biologically active" as used in connection with this basement-membrane-derived composition means capable of supporting normal growth and differentiation of various cell types when cultured including epithelial cells. One such composition is commercially available under the tradename MATRIGEL^® Basement Membrane Matrix available from Becton Dickinson Labware, Bedford, Mass. Details regarding MATRIGEL^® products are disclosed in U.S. Pat. No. 4,829,000, the disclosure of which is incorporated herein by reference. A combination of such materials can advantageously be employed.

The composition(s) can be applied directly to the location of grafted organ at the time of grafting and/or subsequent to grafting by injection to the site of grafting. The amount of the composition applied is not critical and will depend on such factors as the type(s) and amount of human tissue grafted, the specific composition employed, the specific recipient, and the location of the graft. Typically from about 100 μ\ to about 500 μ\ of the composition will be applied at the time of grafting. In particularly useful embodiments, the composition is re-applied after grafting at intervals of between seven and ten days until immunization, as discussed in more detail below.

After the grafting is accomplished, the recipient is monitored to ascertain whether human antibodies are being produced. Techniques for detection of human antibodies are within the purview of one skilled in the art. Kits for detecting the presence of human antibodies in an animal's serum such as, for example, Easy-Titer^® human IgG assay kit are commercially available from Pierce (Rockford, IL). Normally, by the point in time when human antibodies are detected, the grafted tissue remains viable, has vascularized and is believed to have lymphatic vessels connected thereto. Generally, at least one week will transpire, however anywhere from 2 to 20 weeks or more may be allowed to pass before the next step (immunization) is performed.

As an alternative to the NOD/SCID mouse system described above, the use of RAGAyc^'7' mice that have been injected with CD34⁺ human cord blood cells as described by Traggiai et al. (see Science 304(5667): 104-7, 2004, the disclosure of which is incorporated herein by this reference) is contemplated. As noted by Traggiai et al., intrahepatic injection of CD34⁺ human cord blood cells into conditioned newborn Rag2^{" "}7c^{" "} mice can lead to de novo development of B, T, and dendritic cells; formation of structured primary and secondary lymphoid organs; and production of functional immune responses. Some cord blood cells can be matured in vitro with GM-CSF and IL-4 to immature dendritic cells. At that point, cells can be either frozen or protein can be added and the cells matured with a cocktail of TNF-α, IL-6, PGE2 or similar dendritic cell maturation cocktails into mature dendritic cells and then injected into the mice. The frozen immature dendritic cells can be used at a later time. The frozen cells can be defrosted and matured in the presence of protein as described above and then injected into the mice between 2- 20 weeks of age.

Once it is detected that human antibodies are present in the recipient, the recipient is immunized with dendritic cells in combination with a polypeptide of interest, preferably a self polypeptide. Because of the grafting of human tissue, the self polypeptide of interest may be human. Preferably, dendritic cells are matured from monocytes obtained from a suitable human donor; most preferably the donor of the human tissue utilized in the graft or a human leukocyte antigen (HLA)-matched human donor. The monocytes are then allowed to mature to dendritic cells. Dendritic cells are isolated and incubated with a polypeptide of interest under conditions as described above to produce an immunogen. The immunogen may also be combined with a wide variety of adjuvants as described above. The immunogen may also be combined with B cells loaded with the peptide of interest, wherein the B cell may be isolated from human or a non- human species. The peptide of interest may be recombinantly prepared, or be provided in its native form (such as in cell lysates, or plasma membrane if the peptide is a cell surface protein).

In a preferred embodiment, an immunizing composition is prepared by culturing the mononuclear fraction of cord blood to grow dendritic cells. The dendritic cells are then stimulated with the self polypeptide. The resulting immunogen is then injected into the recipient to accomplish immunization.

The immunogen can be administered systemically to the recipient of the graft or injected locally at the site of the graft. Administration will normally be by injection, either subcutaneous or intravascular, preferably directly into the site of the grafted human tissue. In particularly useful embodiments, the recipient has received a human skin graft and the immunogen is injected through the grafted skin or adjacent to it. Considerations in determining how much immunogen should be administered include the nature of the immunogen, the amount of tissue grafted into the recipient and the desired degree and swiftness of the immune response sought. One or more booster injections maybe made, usually within 1 to 6, more usually 2 to 4 weeks of the previous injection. The booster injection may have the same composition or different composition than the prior injection. Immunization may also be accomplished by the RIMMS technique which is well known to those skilled in the art.

The recipient is then monitored to ascertain whether an immunogen-specific response has been mounted. Techniques for detection of antibodies specific to any given immunogen are within the purview of one skilled in the art. One suitable method of detecting the presence of human immunogen-specific antibodies in an animal's serum is disclosed in Current Protocols in Immunology, Coligan et al, Chapter 2.1 (John Wiley & Sons, 2000 ed.), the disclosure of which is incorporated herein by reference.

Once the immunogen-specific immune response is detected, at least a portion of the grafted tissue is removed from the recipient. Mouse tissue into which human cells may have migrated may also be extracted to maximize the amount of antibody-producing cells collected.

In yet another embodiment, antibody response may be elicited by targeting dendritic cells in vivo. It has been recently shown that antibodies directed against certain surface receptors on dendritic cells such as DC-SIGN are internalized and presented to T cells. See Engering et al, "The dendritic cell-specific adhesion receptor DC-SIGN internalizes antigen for presentation to T cells," J. Immunol. 168: 2118, 2002. Antibodies to DC-SIGN may be constructed as disclosed in WO/0063251 and linked to a peptide of interest using techniques known to those skilled in the art. The antibody and peptide of interest may then be injected into a mouse, preferably a humouse, to induce a strong antibody response against the peptide of interest. Antibodies are then obtained using techniques known to those skilled in the art as described above.

Once obtained, cells or genetic material from the host can be immortalized and/or cloned as desired. Thus, for example, RNA from the removed tissue is isolated using techniques well known to those skilled in the art. The recovered RNA is used to generate one or more antibody libraries and the libraries are screened to identify antibodies that bind to the peptide of interest or a component thereof. Li preferred embodiments, the screening process, also known as panning, is conducted to identify antibodies that have either an agonistic or antagonistic effect on the peptide of interest. Alternatively, cells of interest can be separated by fluorescence activated cell sorter (FACS) sorting or magnetic sorting. Techniques for producing and screening antibody libraries are well known to those skilled in the art. See, for example, U.S. Pat. No. 6,291,161 to Lerner et al., and U.S. patent application Serial Nos. 10/014,012 and 10/251,085, the disclosures of each of which are incorporated herein in their entirety.

In one embodiment, phage expressing antibody fragments on their surface can be produced and concentrated so that all members of a library can be allowed to bind to the peptide of interest. The peptide of interest can be immobilized on a microtiter dish, on whole cells, the membranes of whole cells, or present in solution. Non-specific Ab-phage are washed away, and bound phage particles are released from the peptide of interest, often by the use of low pH. The recovered Ab-phages are infectious and so can be amplified in a bacterial host. Typically, multiple rounds of this sort of selection are performed. Individual antibody fragment clones can then be analyzed as soluble Fabs or scFvs for identification of those that specifically recognize the peptide of interest. Additional methods for the construction of such phage display libraries, including those displaying Fab, and methods for panning are disclosed in U.S. patent application Serial Nos. 09/235,499 and 10/006,593, the contents of each of which are incorporated by reference herein.

As another example, antibody-producing cells can be selected and fused with non- antibody producing cells such as, for example, immortalized cell lines. These fusion partners are typically transformed human cells such as human myeloma cells. One suitable human myeloma cell line is disclosed by Karpas et ah, Proc. Natl. Acad. Sd. USA 94(4): 1799-1804, 2001. After fusion, fused cells are segregated into individual cultures and propagated, and hybridoma lines which express immunogen-specific monoclonal antibodies are selected. These cell lines can be maintained in culture or cryopreserved using techniques well known to those of ordinary skill in the art.

The hybridomas may then be introduced into host animals, e.g. mice or rats, to produce ascites fluid or mechanically expanded, using spinner flasks, roller bottles, etc., The host will be immunocompromised, so as to be able to accept the neoplastic graft.

In certain aspects, the present invention provides therapeutic antibodies, which as used herein, include polyclonal, monoclonal, chimeric and single chain antibodies, as well as fragments (e.g., F_ab, F(ab')₂, Fv, scFv, Fc) and Fab expression libraries. Such antibodies can be obtained as described herein below or in any other manner known per se, such as those described in WO 95/32734, WO 96/23882, WO 98/02456, WO 98/41633 and/or WO 98/49306.

In certain specific embodiments, the present invention provides humanized antibodies against self peptides. For example, a humanized antibody is an antibody that is derived from a non-human species, in which certain amino acids in the framework and constant domains of the heavy and light chains have been mutated so as to avoid or abrogate an immune response in humans. Alternatively, a humanized antibody may be produced by fusing the constant domains from a human antibody to the variable domains of a non-human species. Examples of how to make humanized antibodies may be found in U.S. Pat. Nos. 6,054,297, 5,886,152 and 5,877,293. A humanized antibody may comprise portions of immunoglobulins of different origin, wherein optionally at least one portion is of human origin. Accordingly, the present invention relates to a humanized immunoglobulin having binding specificity for an EphB4 (e.g., human EphB4), said immunoglobulin comprising an antigen binding region of nonhuman origin (e.g., rodent) and at least a portion of an immunoglobulin of human origin (e.g., a human framework region, a human constant region or portion thereof). For example, the humanized antibody can comprise portions derived from an immunoglobulin of nonhuman origin with the requisite specificity, such as a mouse, and from immunoglobulin sequences of human origin (e.g., a chimeric immunoglobulin), joined together chemically by conventional techniques (e.g., synthetic) or prepared as a contiguous polypeptide using genetic engineering techniques (e.g., DNA encoding the protein portions of the chimeric antibody can be expressed to produce a contiguous polypeptide chain). Another example of a humanized immunoglobulin of the present invention is an immunoglobulin containing one or more immunoglobulin chains comprising a CDR of nonhuman origin (e.g., one or more CDRs derived from an antibody of nonhuman origin) and a framework region derived from a light and/or heavy chain of human origin (e.g., CDR-grafted antibodies with or without framework changes).

Antibodies produced in accordance with the present disclosure may be used in a variety of ways, both diagnostic and therapeutic. For example, antibodies to the self polypeptide produced by the KIAA0746 gene can be produced in accordance with the present disclosure. These self polypeptides are up-regulated in patients suffering from colon cancer. Thus, antibodies to these self polypeptides can be used to diagnose colon cancer. Alternatively, the antibody can be used as targeting agent, and can be conjugated with therapeutic agents (such as those known to be useful for treating colon cancer) and administered to colon cancer patients as therapy. hi one embodiment, the subject antibodies may be used in the treatment of disease, neutralizing viruses or other pathogens, for in vivo diagnoses, for targeted toxicity against neoplastic cells or precursors to such cells, passive immunization, in conjunction with transplantation, and the like. The subject antibodies may be modified by radiolabeling, conjugation to other compounds, such as biotin, avidin, enzymes, cytotoxic agents, e.g. ricin, diphtheria toxin, arbin, etc., and the like.

For example, when the self polypeptide is DC-SIGN, WO 05/058244 A2 (incorporated herein by reference) describes various ways such DC-SIGN-specific antibodies may be used to modulate immune response.

Specifically, the antibodies can be used to influence the immunomodulatory ability of dendritic cells; to modulate, and in particular reduce, dendritic cell-mediated (primary) T cell responses, and/or generally to influence, and in particular inhibit, the immune system. The antibodies can be used for preventing and/or treating disorders of the immune system, as well as to prevent transplant rejection.

Some additional applications include preventing or inhibiting immune responses to specific antigens; inducing tolerance; immunotherapy; immunosuppression, i.e., to prevent transplant rejection; the treatment of auto-immune diseases such as thyroiditis, rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis and auto-immune diabetes; and the prevention or treatment of allergies.

The antibodies also constitute a very useful diagnostic and research tool, for use both in vitro as well as in vivo. Possible non-limiting fields of application include the study of dendritic cells and their function and interactions; the study of the immune system; the detection of dendritic cells and/or C-type lectins in cells, tissues or biological fluids such as synovial tissue and skin tissue/skin cells; as well as the study of the role dendritic cells play in biological processes or disease mechanisms, such as cancer and autoimmune diseases (including, e.g., rheumatoid arthritis).

The antibodies can also be used to detect the presence of (and thereby determine the expression of) DC-SIGN in or on tissues or whole cells, as well as detect the presence of DC- SIGN in other biological samples such as cell fragments or in cell preparations. The information thus obtained can then be used to determine whether the method or compositions of the present disclosure can be applied to such tissues or cells. The antibodies of the present disclosure could also be used to detect (qualitatively and/or quantitatively), isolate, purify and/or produce dendritic cells, for instance in/from biological samples, including biological fluids such as blood, plasma or lymph fluid; tissue samples or cell samples such as bone marrow, skin tissue, tumor tissues, etc.; or cell cultures or cultivating media. Detection can be by suitable assays.

Assays could be used in a manner known per se for the analysis of antibodies, such as competitive inhibition assays or ELISA-type immunoassays. For instance, the antibodies could be used in combination with microscopy techniques, cell sorting techniques including flow- cytometry and fluorescence activated cell sorting (FACS), techniques based upon solid supports and/or detectable labels or markers (which can be attached to the antibodies), techniques based upon (para)magnetic beads or any other detection or assay technique known to one skilled in the art in which antibodies can be used. Such assays and kits therefor, which besides the subject antibodies can contain additional components known for antibody-based assays, as well as manuals, etc., form a further aspect of the present. hi one embodiment, the anti-DC-SIGN antibodies interfere with the interaction of DC- SIGN expressing cells and ICAM-expressing cells. More specifically, in this embodiment, the anti-DC-SIGN antibodies reduce the adhesion of C-type lectin receptors on the surface of dendritic cells to ICAM receptors on the surface of T cells. By modulating this adhesion, dendritic cell-T cell interactions can be influenced. Such interactions include cluster formation and antigen presentation, as well as primary T cell responses dependent thereon, resulting in a modulation of the immune response.

In another embodiment, the anti-DC-SIGN antibodies influence the migration of DC- SIGN expressing cells.

In another embodiment, the anti-DC-SIGN antibodies act as an agonist, thereby enhancing T-cell response in an animal.

In another embodiment, the anti-DC-SIGN antibodies may also be used to enhance the immune response to specific peptides, especially antigens. In such a case the anti-DC-SIGN antibodies are attached to a peptide and the combination of the two are administered to an animal. The antibodies direct the peptide to dendritic cells, which internalize the peptide and then present it on the dendritic cell surface to T cells, thereby generating an immune response to the peptide. Li this case the antibodies can be useful as vaccines, including cancer vaccines. In general, using an antigen in combination with the anti-DC-SIGN antibodies may increase the potency of the antigen, i.e., provide a higher or stronger immune response per unit of antigen administered. In this way, antigens could be administered at a lower dosage and still provide sufficient immune response.

Examples of suitable antigens are cancer antigens, including gplOO, g250, p53, MAGE, BAGE, GAGE, MART 1, Tyrosinase related protein 11 or Tyrosinase related protein, all of which can be used to generate an immune response against the tumor cells that contain or express said antigen. Other types of antigens that can be used in the present disclosure include essentially all antigens used in vaccines against infectious diseases, such as influenza, mumps, measles, rubella, diphtheria, tetanus, diseases due to infection with micro-organisms such as Haemophilus influenzas (e.g. type b), Neisseria, Bordetella pertussis, Polyomyletus, Influenza virus and Pneumococcus, and generally any other infection or disease against which a vaccine can be developed or can be envisaged, including also parasite, protozoan and/or viral infections such as HIV and herpes. To provide serums or vaccines, the compounds of the present disclosure may further be combined with other antigens known per se.

In yet another embodiment, the anti-DC-SIGN antibodies can be labeled with a toxin to DC-SIGN expressing cells. Administration of the anti-DC-SIGN antibodies labeled with toxin can then be utilized to reduce the levels of DC-SIGN expressing cells which, in some instances, can be beneficial, such as in the treatment of autoimmune disease.

Any cytotoxic compound can be fused to the subject antibodies. The fusion can be achieved chemically or genetically (e.g., via expression as a single, fused molecule). The cytotoxic compound can be a biological, such as a polypeptide, or a small molecule. As those skilled in the art will appreciate, for small molecules, chemical fusion is used, while for biological compounds, either chemical or genetic fusion can be employed.

The antibodies of the present disclosure may be used to deliver a variety of cytotoxic drugs including therapeutic drugs; a compound emitting radiation; molecules of plant, fungal, or bacterial origin; biological proteins; and mixtures thereof.

The cytotoxic drugs can be intracellularly acting cytotoxic drugs, such as short-range radiation emitters, including, for example, short-range, high-energy α-emitters. Enzymatically active toxins and fragments thereof are exemplified by diphtheria toxin A fragment, nonbinding active fragments of diphtheria toxin, exotoxin A from Pseudomonas aeruginosa, ricin A chain, abrin A chain, modeccin A chain, α-sarcin, certain Aleurites fordii proteins, certain Dianthin proteins, Phytolacca americana proteins (PAP, PAPII and PAP-S), Morodica charantia inhibitor, curcin, cretin, Saponaria officinalis inhibitor, gelonin, mitogillin, restrictocin, phenomycin, and enomycin, for example. Procedures for preparing enzymatically active polypeptides of the immunotoxins are described in W085/03508, which are hereby incorporated by reference. Certain cytotoxic moieties are derived from adriamycin, chlorambucil, daunomycin, methotrexate, neocarzinostatin, and platinum, for example.

Procedures for conjugating the antibodies with the cytotoxic agents have been previously described.

Alternatively, the antibodies of the present disclosure can be coupled to high energy radiation emitters, for example, a radioisotope, such as ¹³¹I γ-emitter, which, when localized at the tumor site, results in a killing of several cell diameters. See, e.g., S. E. Order, "Analysis, Results, and Future Prospective of the Therapeutic Use of Radiolabeled Antibody in Cancer Therapy," in Monoclonal Antibodies for Cancer Detection and Therapy, R. W. Baldwin et al. (eds.), pp. 303-316 (Academic Press 1985), which is hereby incorporated by reference. Other suitable radioisotopes include α-emitters, such as ^{2 2}Bi, ²¹³Bi, and ²¹¹At, and β-emitters, such as ¹⁸⁶Re and ⁹⁰Y. Radiotherapy is expected to be particularly effective in connection with prostate cancer, because prostate cancer is a relatively radiosensitive tumor.

In another embodiment, the antibodies of the present disclosure (e.g., anti-DC-SIGN antibodies) inhibit infection of dendritic cells by viruses, such as HIV-I, HIV-2, SIV-I, hepatitis C virus (HCV), Ebola, SARS, cytomegalovirus (CMV), Sindbis, and Dengue, bacteria such as Helicobacter pylori, Klebsiella pneumoniae, and bacteria of the genus Mycobacterium, including M. tuberculosis and M. bovis; yeast such as Candida albicans; and parasites such as Leishmania pifanoi and Schistosoma mansoni. m some embodiments, the antibodies of the present disclosure (e.g., anti-DC-SIGN antibodies) can be utilized as vaccines to diseases caused by the above-referenced viruses.

In a further embodiment, the antibodies of the present disclosure (e.g., anti-DC-SIGN antibodies) can be used in the treatment of HTV-infections and similar disorders of the immune system, as well as to modulate the immune response to grafts or after transplant. The antibodies of the present disclosure (e.g., anti-DC-SIGN antibodies) may also be utilized as routine diagnostics for tumor types associated with a self peptide (e.g., DC-SIGN) expression and, in some embodiments, may be provided as part of diagnostic kits.

The antibodies of the present disclosure (e.g., anti-DC-SIGN antibodies) may also be utilized as therapeutics for the treatment of cancer and tumor types associated with a self peptide (e.g., DC-SIGN) expression. In some embodiments, the antibodies can be a humanized antibody. In other embodiments, the antibodies can be an scFv, or any other functional fragments of a whole antibody or derivatives thereof, such as Fab, F(ab')₂, part of a multi-specific antibody, etc.

In certain specific embodiments, the present invention provides anti-DC-SIGN antibodies. These DC-SIGN antibodies are used to inhibit the interaction of dendritic cells and T cells, hi other embodiments, the antibodies are combined with peptides which are internalized in dendritic cells and presented to T cells, thereby generating an immune response to the peptide. In yet other embodiments, the antibodies are used to block viral binding, infection, and transmission. Optionally, anti-DC-SIGN antibodies may also bind to L-SIGN.

Where the antibodies are produced in a mouse, the non-human recipients of the grafted human immune organ can be used in methods for testing of the effects of drugs on the human immune system, hi these mέthods, a drug is administered to the non-human mammal host having at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and/or fetal liver grafted therein to produce a human antibody. After a period of time, any effects of the drug on human antibody production are observed. Techniques for determining the effects of a drug on a human immune system are known to and within the purview of those skilled in the art.

As understood by one skilled in the art, the subject methods are useful for many clinical applications, for example, for vaccine-therapy (such as antigen pulsed dendritic cells reinjected into the patient). The vaccine compositions of the present invention can also be used for treating diseases such as cancer. For example, a self peptide as a cancer specific antigen is incubated with dendritic cells so as to stimulate host immunity to the cancer when the vaccine composition is administered to a mammal. The cancer can be any type of cancer, e.g., a solid tumor, e.g., B-cell lymphoma. "Mammal" is meant to include human as well as non-human mammals. "Treating" is meant to include, e.g., preventing, treating, reducing the symptoms of, or curing the cancer. Incubation of the dendritic cells with the cancer-specific antigen can be by any method which results in the dendritic cells presenting the antigen so as to stimulate host immunity when the vaccine composition is administered to the mammal, e.g., by pulsing or culturing the dendritic cells in the presence of the antigen prior to administration of the vaccine composition to the mammal. Optionally, the vaccine composition can include any pharmaceutically acceptable carrier known in the art. Further, the vaccine composition can include any adjuvant known in the art, e.g., Freund's complete or incomplete adjuvant.

The following non-limiting examples are provided to illustrate the methods described herein.

EXAMPLE l

Dendritic cells from mouse spleen were isolated by first digesting the spleen with 1 mg/ml collagenase for 1 hour, teasing the spleen apart and filtering the cells through a mesh 40 filter. Dendritic cells were positively selected using StemCell Technologies' EasySep system labeling the cells with anti-CDllc coated magnetic beads. Purified dendritic cells (1.74 x 10⁶ total) were incubated for 1 hour at 37 ⁰C in a CO₂ incubator in EMEM containing 10% mouse serum with 1 mM of a cell surface peptide with 100% homology between human and mouse (Peptide #2) and having the following sequence

CYYiTGNLETFPRDPEK (SEQ ΓD NO-, l)

After washing the cells, CpG oligonucleotide (Qiagen) was added as adjuvant and the mixture was injected intradermally into one Balb/c mouse. Pre-immune serum had previously been obtained before the injection. Another bleed was obtained after 7 days and tested using ELISA.

EXAMPLE 2

Mouse dendritic cells were generated in vitro by isolating monocytes from bone marrow and maturing them in the presence of IL-4, GM-CSF, and TNF-alpha to dendritic cells in 7 days. Peptide #2 was added at day 5. After washing the cells, CpG oligonucleotide (Qiagen) was added as adjuvant and the mixture was injected intradermally into one Balb/c mouse. Serum was obtained after 7 days and tested using ELISA.

EXAMPLE 3 Antibodies in serum obtained from the immunized mouse of Example 1 were detected by ELISA. Two peptides, Peptide #2 and a control peptide having the following sequence:

CTKTPLDQHTLQGDQA (SEQ ID NO: 2)

(referred to herein as "Peptide #1"), were dissolved in PBS followed by dilution to a final concentration of 4 microgram/ml in 0.1 M sodium carbonate buffer having a pH of 8.6. Each well was coated with 25 microliters of peptide solution (100 ng per well) and the plate was incubated at 4°C overnight. The wells were washed 3 times with nanopure water and subsequently blocked with 1% BSA in PBS for 1 hour at 37 ⁰C. Dilutions of serum, both pre- immune and immune, were performed in 1% BSA/PBS. The primary incubation was for 1.5 hours at 37 °C followed by incubation with alkaline phosphatase-conjugated anti-mouse whole IgG (1:1000) dilution in 1% BSATPBS.

Absorbance was measured at 405 nm to determine the concentration of antibodies. For each peptide, Peptides #1 and #2, measurements were made of the peptide alone, pre-immune serum containing the peptide, pre-immune serum containing conjugated peptide, and serum containing conjugated peptide, at dilutions of 1:20, 1:100, 1:1,000 and 1:10,000. The results of this experiment are set forth in FIG. 1. As can be seen in FIG. 1, the mouse immunized with peptide loaded splenic dendritic cells developed antibodies against Peptide #2, whereas the irrelevant peptide, Peptide # 1, was not recognized.

EXAMPLE 4

Dendritic cells from mouse spleen were isolated by first digesting the spleen with 1 mg/ml collagenase for 1 hour, teasing the spleen apart and filtering the cells through a mesh 40 filter. Dendritic cells were positively selected using StemCell Technologies' EasySep system labeling the cells with anti-CDllc coated magnetic beads. Purified dendritic cells (1.5 x 10⁶ total) were incubated for 1 hour at 37 °C in a CO₂ incubator in EMEM containing 10% mouse serum with 10 μg mSIGKRl, the mouse homologue of human L-SIGN (CD209L).

CpG oligonucleotides (Qiagen) were added as adjuvant and the mixture was injected subcutaneously into two Balb/c mice. Pre-immune serum had previously been obtained before the injection. Another bleed was obtained after 7 days and tested using ELISA.

EXAMPLE 5 Antibodies in serum obtained from the immunized mouse of Example 4 were detected by ELISA. Anti-human Fc antibodies were coated at 4 μg/ml in PBS on ELISA plates and incubated overnight at 4 °C. The next day, plates were blocked for 1 hour with 1% BSA in PBS, followed by 3 PBS washes. Recombinant mSIGNRlFc fusion protein was added at 500 ng/ml and incubated on the plates for 2 h at 37 °C. Control plates were incubated with 1% BSA in PBS without mSIGNRl. After 3 PBS washes, serum obtained before and after immunization was added at 1 :20 in PBS containing 1% BSA. Bound anti-mSIGNRl antibody was detected with alkaline phosphatase-conjugated anti-mouse IgG followed by SigmaS substrate addition.

Absorbance was measured at 405 nm to determine the concentration of antibodies. The results of this experiment are set forth in FIG. 2. The OD on the BSA control wells was below 0.1 in all cases.

EXAMPLE 6

Method to obtain antibodies cross-reactive with a self peptide and a homologous peptide of another species. Dendritic cells maybe loaded with self protein (murine) by incubating dendritic cells at the immature stage (reached by culturing bone marrow cells for 7 days with GM-CSF and IL-4) with lysate prepared, e.g., by freeze-thawing target cells of interest, before maturing the dendritic cells with TNF-alpha for another 2 days. Alternatively, dendritic cells may be loaded with plasma membranes obtained by coating polylysine beads with cells followed by lysis of the cells. The dendritic cells are thus loaded with peptides, DNA, RNA, cell lysates or beads coated with cell membranes or peptides.

To focus the immune response on epitopes homologous in human and mice, B cells are isolated from the spleen of mice or PBMC from human sources using negative selection, such as a commercially available magnetic bead separation apparatus from Miltenyi Biotec (Auburn, CA) according to the manufacturer's instructions. B cells are incubated with homologous peptides, DNA, RNA, cell lysates or membrane or peptide coated beads from the species not used for dendritic cell loading, i.e., dendritic cells are loaded with self peptide, and B cells are loaded with peptide homologous to the self peptide from the species that served as the source of the B cells.

Alternatively, B cells are cultured in vitro with soluble CD40L and IL-4 or any other B cell stimulant before adding the peptide homologous to the self peptide. EXAMPLE 7

Methods to obtain antibodies to native form of self proteins. The mixture of dendritic cells loaded with self peptides obtained from cell membranes coated on beads, or loaded with cell lysate, and B cells loaded with homologous recombinant proteins or peptides of Example 6 are injected subcutaneously, intravenously, or intraperitoneally into an animal in combination with an appropriate adjuvant such as CpG oligonucleotide. This allows an immune response to common epitopes between cell expressed proteins and recombinant proteins. Antibodies are harvested from the immunized animal.

EXAMPLE 8

Mouse dendritic cells were obtained by removing bone marrow from 4 Balb/c mice. Red blood cells were lysed using ammonium chloride, and the remaining cells were matured with 1000 U/ml murine IL-4 and 100 U/ml murine GM-CSF. On day 2, non- adherent cells were removed, and the medium was replaced. Additional medium containing IL-4 and GM-CSF was added on day 5. On day 7 of the culture, the cells were fed with cell lysate from murine DC- SIGN transfected cells. Cell lysates were prepared by freeze thawing 10 million cells. On day 9 of the culture, the cells were harvested.

B cells were isolated from 2 Balb/c spleens using Miltenyi's B cell isolation kit. Ten million B cells were incubated with 50 μg human DC-SIGNFc for 30 min at 37 °C. B cells and dendritic cells were combined in a total volume of 800 μl, and 50 μl ImmunEasy adjuvant (Qiagen) was added. Two mice (#2255 and #2256) were immunized by injecting 200 μl of the cell suspension z.v. and 200 μl s.c. The antibody levels to mouse DC-SIGN were assessed by FACS staining of mouse dendritic cells, and by ELISA plates coated with mouse DC-SIGNFc fusion protein.

As illustrated in Figure 3, very good levels of antibodies were induced against mouse DC-SIGN₅ and the serum stained mouse dendritic cells (Figure 4). The mice received a second immunization three weeks after the first immunization. Murine dendritic cells were prepared and cultured as described above. They were fed murine dendritic cell lysate on day 7, and were harvested on day 9. B cells were isolated and loaded with human DC-SIGNFc as described above, and injected together with the dendritic cells. Antibody titers against human and mouse DC-SIGN were evaluated by ELISA. As shown in Figures 5A-B, very high titers against human DC-SIGN (Figure 5A) and modest titers against mouse DC-SIGNs (Figure 5B) were detected. The mice were sacrificed and spleens and bone marrow were removed for library construction.

EXAMPLE 9 Library Construction

To construct the antibody library, total RNA was isolated from the bone marrow and spleen cells of #2856 mouse in TRI reagent according to the manufacturer's protocol (Molecular Research Center, Cincinnati, OH).

Messenger RNA (mRNA) was then purified using Oligotex (QIAGEN) according to the manufacturer's manual. First strand complementary DNA (cDNA) was synthesized from 250 ng of bone marrow mRNA and 250 ng of spleen mRNA, using Superscript II RTase (Invitrogen Life Technologies) according to the manufacturer's protocol. First strand cDNA was digested with restriction endonuclease, and second strand cDNA was synthesized according to the method fully described in WO 03/025202 A2 (Bowdish K, Frederickson S, Maruyama T, Lin Y-C, Renshaw M: Engineered Templates And Their Use hi Single Primer Amplification, incorporated herein by reference).

In this experiment, 16 μl of 1st strand cDNA was mixed with 1 μl of restriction oligonucleotide (20 μM) (see table below) (Operon, HPLC purified) and 2 μl of 10 x NEBuffer (New England Biolabs, Beverly, MA) or 10 x A buffer (Roche Applied Science, Indianapolis, ESf) as shown in the table below. The mixture was heat denatured at 95 ⁰C for 2 min. Annealing was done at 64 °C for 2 min. After the mixture was cooled down to 37 ⁰C for Xcm I and Hpa I digestion, and 60 ⁰C for BsaJ I digestion, 1 μl of restriction endonuclease was added as shown in the table below.

Table 1 Restriction oligonucleotide and restriction endonuclease for restriction endonuclease digestion of first strand cDNA

The mixture was incubated at 37 °C for 60 min, 65 ⁰C for 20 min, and 4 °C for Xcm I and Hpa I digestions; and 60 ⁰C for 60 min, 80 ⁰C for 20 min, and 4 ⁰C for BsaJ I digestion.

The quality of the digested cDNA was checked by PCR, with a set of primers that amplify both digested and undigested cDNA, and a set of primers that only amplify undigested cDNA.

Digested cDNA was mixed with 10 x reaction buffer, dNTP (0.2 mM), primers, and AmpliTaq (Applied Biosystems, Foster City, CA). The second strand cDNA reaction was performed with 1 cycle of denaturing at 94 ⁰C for 1 min., followed by 20 cycles of PCR: denaturing at 94 ⁰C for 5 seconds, annealing at 56 ⁰C for 10 seconds, and extension at 68 ⁰C for 2 min. The nested oligonucleotide reaction was performed by adding the oligonucleotide to 0.2 μM final concentration, and denaturing at 94 ⁰C for 1 min., followed by annealing and extension at 68 ⁰C for 2 min.

Second strand cDNA was cleaned up with PCR purification kit (QIAGEN). Single primer amplification was performed by adding 10 x reaction buffer, dNTP (0.2 mM), the TMX24mH or TMX24mK primer, and Advantage 2 polymerase mix (BD Biosciences Clontech, Palo Alto, CA), with 1 cycle of denaturation at 95 °C for 1 min, 25 cycles of PCR for kappa light chain, 30 cycles of PCR for IgGl and IgG2a heavy chains: denaturing at 95 °C for 5 seconds, annealing and extension at 72 ⁰C for 1 min., followed by 1 cycle of 72 ⁰C for 3 min, and stored at 4 ⁰C.

Amplified products were pooled and purified with PCR purification kit. Kappa light chain was digested with Xba I and BspE I. IgGl and IgG2a heavy chains were digested with Xho I and Bin I. Digested fragments were purified from the agarose gel using the Gel extraction kit (QIAGEN), and cloned into an Fab expression vector - PAX313m/hG vector (RD Data Binder AAT-0073).

The exemplary libraries constructed using the above methods had sizes of 1.05 x 10¹⁰ for the IgGl K library, and 1 x 10¹⁰ for the IgG2a K library. The light chain and heavy chain inserts were transferred to another set of Fab expression vectors, PAX356mGlK and PAX356mG2aK, by EcoR I / Bin I digestion. The final library sizes after the transfer were 6 x 10¹⁰ for the IgGl K library, and 2.3 x 10¹⁰ for the IgG2a K library.

Oligonucleotides used for restriction endonuclease digestions were: mCGlXcm I 5^I-CTAACTCCATGGTGACCCTGGGATG-3^I (SEQ ID NO: 3) mCG2aBsaJ I 5^l-CAACTGGCTCCTCGGTGACTCTAG-3¹ (SEQ ID NO: 4) mCKHpa I S'-CAGTGAGCAGTTAACATCTGGAGG-S' (SEQ ID NO: 5) Primers used to check PCR were:

TMX24mVHIIBshort

S'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTCCAACTGCAGCAGYC-S' (SEQ ID NO: 6) mCGl 5^I-CATGGAGTTAGTTTGGGCAGCAG-3^I (SEQ ID NO: 7) mCGlB S'-CAACGTTGCAGGTGACGGTCTC-S' (SEQ ID NO: 8) mCG2a 5'-CGAGGAGCCAGTTGTATCTCCAC-S' (SEQ ID NO: 9) mCG2aB 5'-CCACATTGCAGGTGATGGACTG-S' (SEQ ID NO: 10)

TMX24mVKTVshort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGAAAWTGTGCTCACCCAGTCTC-S' (SEQ ID NO: 11) mCKO 5'-CTGCTCACTGGATGGTGGGAAG-S' (SEQ ID NO: 12) mCKB 5'-GAGTGGCCTCACAGGTATAGCTG-S' (SEQ ID NO: 13)

Heavy Chain Framework 1 Specific Primers were:

TMX24mVHIAshorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTGCAGCTTCAGSAGTC-S' (SEQ ID NO: 14)

TMX24mVHBshorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTGCAGCTGAAGSAGTC-S' (SEQ ID NO: 15)

TMX24mVHIIAshorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTYCAGCTGCARCARTC-S' (SEQ ID NO: 16) TMX24mVHIffishorter

5^I-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTCCAACTGCAGCAGYC-3^I (SEQ ID NO: 17)

TMX24mVHIICshorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTTCAGCTGCAGCAGTC-S' (SEQ JD NO: 18)

TMX24mVHIIIAshorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTGAAGCTGGTGGAGWC-S' (SEQ ID NO: 19)

TMX24mVHIIIBsliorter

5'-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTGAAGCTTCTGGAGTC-S' (SEQ ID NO: 20)

TMX24mVHIIIDshorter

5^I-GACGTGGCCGTTGGAAGAGGAGTGCTCGAGGTGMAGCTGGTGGAGTC-3^I (SEQ ID NO: 21)

(R is A+G, M is A+C, Y is C+T, and S is C+G) Kappa Framework 1 Specific Primers were:

TMX24mVKIshort

5'- GACGACCGGCTACCAAGAGGAGTGTCTAGAGACATTGTGATGWCACAGTCTC-S' (SEQ ID NO: 22)

TMX24mVKIIashort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGATGTTKTGATGACCCARACTC-3^t (SEQ ID NO: 23)

TMX24mVKIIbshort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGACATTGTGATGACKCAGGCTG-S' (SEQ ID NO: 24)

TMX24mVKIIIshort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGACAWTGTGCTGACCCARTCTC-3^I (SEQ ID NO: 25)

TMX24mVKTVshort 5¹-GACGACCGGCTACCAAGAGGAGTGTCTAGAGAAAWTGTGCTCACCCAGTCTC-3^t (SEQIDNO:26)

TMX24mVKVashort

5^I-GACGACCGGCTACCAAGAGGAGTGTCTAGAGACATCCAGATGACMCAGTCTC-3¹ (SEQIDNO:27)

TMX24mVKVbshort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGATATCCAGATGACACAGACTAC-S' (SEQIDNO:28)

TMX24mVKVcshort

5'-GACGACCGGCTACCAAGAGGAGTGTCTAGAGACATTGTSATGACCCAGTC-S'(SEQ IDNO:29)

TMX24mVKVIshort

S'-GACGACCGGCTACCAAGAGGAGTGTCTAGACAAATTGTTCTCACCCAGTCTC-S' (SEQIDNO:30)

(R is A+G, M is A+C, K is G+T, W is A+T, and S is C+G) Oligonucleotides used for Nested Oligonucleotide Extension Reaction were:

TM24mCGlnoer

5'-GACGTGGCCGTTGGAAGAGGAGTGCCTAGGGTTACCATGGAGTTAGTTTGGGCA GCAGA2'OMe[U(ps)C(ps)A(ps)](propyl)3'(SEQIDNO:31)

TMX24mCG2anoer

5'-GACGTGGCCGTTGGAAGAGGAGTGCCTAGGGTCATCGAGGAGCCAGTTGTATCT CCACA2'OMe[C(ps)A(ps)U(ps)](propyl)3'(SEQIDNO:32)

TMX24mCKnoer

5'-GACGACCGGCTACCAAGAGGAGTGTCCGGATGTTAACTGCTCACTGGATGGTGG GAAGATGG2'OMe[A(ps)U(ps)U(ps)](propyl)3'(SEQIDNO: 33)

EXAMPLE 10 Panning the DC-SIGN Library on the Human DC-SIGN Receptor

The libraries were transformed into ER2738 bacterial cells, which were grown in 100 mL cultures. Phage from each culture was pelleted by centrifugation and resuspended in 1 mL of 1% BSA / PBS, with 0.9 mM CaCl₂ to maintain the DC-SIGN receptor conformation. Fifty microliters of phage from each library was exposed for two hours to 6 x 10⁶ K562 cells (human erythroid cells) stably transfected with the human DC-SIGN receptor. The cells had been resuspended in 2 niL of IMDM buffer (Invitrogen, Carlsbad, California) with 10% FCS and 0.1% NaN₃. The eluted phage were then infected into ER2738 cells. In the next 3 rounds of panning, 50 μl of the phage were exposed for one hour to untransfected K562 cells as negative panning, before the unbound phage supernatant was transferred to human DC-SIGN-transfected K562 cells for two hours.

For panning of the DC-SIGN library on the mouse DC-SIGN receptor, the steps were carried out in essentially the same manner as described immediately above, except that panning was done on 293 cells (human epithelial kidney) that were or were not transfected with the mouse DC-SIGN receptor cloned into the expression vector pcDNA4.

EXAMPLE 11 Flow Cytometry

The library from round four of the anti-human DC-SIGN panning was isolated as plasmid DNA, and cloned into expression vector pAEVl. The library was then transformed into BL21 bacterial cells, and individual colonies were grown in 1 mL cultures for screening of supernatants. During FACS staining, the concentration of CaCl₂ was kept between 0.9 niM and 2 mM for the maintenance of the DC-SIGN receptor conformation. Sixty microliters of supernatant from each clone was blocked for 30 minutes in duplicate with 2% milk in PBS. Supernatant was then incubated with 100,000 of either untransfected K562 cells or human DC- SIGN-transfected K562 cells for 30 minutes. After washing, cells were then stained with Goat anti-mouse PE-conjugated antibody (Sigma) at a dilution of 1:100 for 30 minutes. Cells were washed again and read for the geometric mean of PE signal. The signals of the untransfected and transfected duplicates were compared.

An initial FACS analysis screening identified multiple clones that stained DC-SIGN- transfected-K562 cells positively compared to untransfected K562 cells. Sequencing data showed that there were actually just two clones. These clones, lBlO-1 and 1F8-1, bound to DC- SIGN-transfected K562 cells 12-fold, and 6-fold, respectively, over untransfected K562 cells by FACS analysis (see Figure 6). Though their sequences are different, they encode the same protein (see Figures 7 and 8). In addition, 26 additional clones were identified as positively staining DC-SIGN- transfected K562 cells over untransfected K562 cells, between 1.39 and 6.33 fold increase. However, these clones were not sequenced.

The two libraries were panned for four rounds on mouse DC-SIGN transfected 293 cells with the following panning titers:

These titer numbers indicate that positive binders amplified between rounds 3 and 4. This panned library is screened on mouse DC-SIGN transfected 293 cells and read with FACS analysis.

EQUIVALENTS

While the above description contains many specific details of methods in accordance with this invention, these specific details should not be construed as limitations on the scope of the invention, but merely as exemplifications of preferred embodiments thereof. Those skilled in the art will envision many other possible variations that fall within the scope and spirit of the invention as defined by the claims appended hereto.

Claims

CLAMS:

1. A method of producing an antibody, comprising the steps of: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a cell-derived material including a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; d) harvesting cells that produce antibodies to the self peptide of interest; and e) recovering one or more antibodies from the harvested cells.

2. The method of claim 1, wherein the cell-derived material is a cell lysate.

3. The method of claim 1 , wherein the cell-derived material is a plasma membrane.

4. The method of claim 1, wherein step c) is repeated more than once before step d).

5. The method of claim 4, wherein different cell-derived materials are used in step c).

6. The method of claim 5, wherein the cell-derived materials for different repeats in step c) are independently selected from: a recombinant self peptide of interest, a lysate from cells expressing the self peptide of interest, or a plasma membrane of cells expressing the self peptide of interest.

7. The method of claim 1, further comprising humanizing said antibody.

8. The method of claim 1, wherein the dendritic cells are obtained by maturation of monocytes.

9. The method of claim 1, wherein the dendritic cells are isolated from said host animal.

10. A method of producing an antibody, comprising the steps of: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) obtaining B cells from a second animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; e) immunizing the host animal with the immunogen and the loaded B cell; f) harvesting cells that produce antibodies to the self peptide of interest; and g) recovering one or more antibodies from the harvested cells.

11. The method of claim 10, wherein the second animal is a different species than the host animal.

12. The method of claim 10, wherein the second animal is the same species as the host animal.

13. The method of claim 10, wherein the second peptide is at least about 60% homologous to the self peptide of interest.

14. The method of claim 13, wherein the second peptide is from the second animal, further wherein said second animal is of a different species than the host animal.

15. The method of claim 14, wherein the second peptide is recombinantly produced.

16. The method of claim 10, wherein the host animal is a rodent.

17. The method of claim 10, wherein the second animal is a human.

18. The method of claim 10, wherein the step of obtaining dendritic cells comprises selecting dendritic cells utilizing antibodies to markers associated with dendritic cells, said markers selected from the group consisting of: cell surface molecules responsible for T cell activation, adhesion molecules, and co-stimulatory molecules.

19. The method of claim 10, wherein the step of obtaining dendritic cells comprises selecting dendritic cells utilizing antibodies to dendritic cell markers CD54 or CDl 1.

20. The method of claim 10, wherein the step of obtaining dendritic cells comprises obtaining bone marrow from the host animal, lysing red blood cells in the bone marrow, and maturing the remaining cells with IL-4 and/or GM-CSF.

21. The method of claim 10, wherein the dendritic cells are incubated with a self peptide of interest obtained from a cell lysate of the host animal.

22. The method of claim 10, wherein the dendritic cells are incubated with a self peptide of interest obtained from a plasma membrane.

23. The method of claim 10, wherein the self peptide of interest is coated onto a polystyrene bead.

24. The method of claim 10, wherein step e) further comprises adding an adjuvant to the immunogen and the loaded B cell.

25. The method of claim 24, wherein the adjuvant is selected from the group consisting of: IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-IO, IL-12, IL-15, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon- γ, TNF-α, TGF-/3, Flt-3, and CD40 ligand.

26. The method of claim 24, wherein the adjuvant is a CpG oligonucleotide.

27. The method of claim 10, wherein steps f) and g) comprise removing cells comprising antibodies from the host animal, isolating RNA from the removed cells, constructing an antibody library, and identifying one or more antibodies that bind to the self peptide of interest.

28. The method of claim 27, wherein the antibody library is an Fab library.

29. The method of claim 27, wherein the antibody library expresses antibodies on the surface of phages.

30. The method of claim 29, wherein the one or more antibodies that bind to the self peptide of interest are identified by panning the phages on cells expressing the self peptide of interest.

31. The method of claim 10, wherein the self peptide of interest is DC-SIGN (DC-Specific ICAM-3 grabbing non-integrin).

32. The method of claim 10, wherein the antibody is a humanized antibody.

33. An antibody produced in accordance with the method of claim 1.

34. An antibody produced in accordance with the method of claim 10.

35. The antibody of claim 34, wherein the host animal is a mouse, and the antibody is specific for human DC-SIGN.

36. The antibody of claim 34, wherein the antibody cross-reacts with both human DC-SIGN and mouse DC-SIGN.

37. The antibody of claim 36, wherein the antibody has a higher affinity for human DC- SIGN than that for mouse DC-SIGN.

38. A pharmaceutical composition comprising the antibody of any one of claims 33-37.

39. A fusion molecule comprising an antibody to DC-Specific ICAM-3 grabbing non- integrin (DC-SIGN) linked to a self peptide of interest.

40. The fusion molecule of claim 38, wherein the antibody is chemically linked to the self peptide of interest.

41. The fusion molecule of claim 38, wherein the antibody and the self peptide of interest are encoded by a polynucleotide as a fusion protein.

42. The fusion molecule of claim 38, wherein the self peptide of interest is a cancer antigen.

43. The fusion molecule of claim 38, wherein the cancer antigen is gplOO, g250, p53, MAGE, BAGE, GAGE, MART 1, Tyrosinase related protein 11, or Tyrosinase related protein.

44. A method of producing an antibody comprising the steps of: a) obtaining dendritic cells from a host animal; b) transfecting the dendritic cells with nucleic acid encoding a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; and, d) harvesting cells that produce antibodies to the self peptide of interest.

45. A method of producing a human antibody comprising the steps of: a) grafting human tissue into an immunodeficient, non-human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and fetal liver to produce a human antibody; b) applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; c) obtaining human monocytes from a donor; d) maturing the human monocytes to dendritic cells; e) obtaining the dendritic cells; f) incubating the dendritic cells with a self peptide of interest to form an immunogen; g) immunizing the host with the immunogen; and, h) harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies.

46. A method as in claim 45 where the immunodeficient, non-human, mammalian host is a rodent.

47. A method as in claim 45 where the immunodeficient, non-human, mammalian host is a SCID mouse.

48. A method as in claim 45 further comprising the step of irradiating the immunodefcient, non-human, mammalian host prior to said grafting step.

49. A method as in claim 45 further comprising the step of testing for the presence of human antibodies prior to said immunizing step.

50. A method as in claim 45 wherein the step of obtaining human monocytes comprises obtaining monocytes from a donor selected from the group consisting of a donor of the human tissue and an HLA-matched human donor.

51. A method as in claim 45 wherein said step of harvesting cells comprises removing at least a portion of the human tissue from the host, isolating RNA from the removed human tissue, constructing an antibody library and identifying one or more antibodies that bind to the self peptide of interest.

52. A human antibody produced in accordance with the method of claim 45.

53. A method of producing a human antibody comprising the steps of: a) grafting human tissue into an immunodeficient, non-human, mammalian host animal, the human tissue comprising at least a sufficient portion of thymus, spleen, bone marrow, skin, lymph nodes and fetal liver to produce a human antibody; b) applying a composition to the grafted human tissue, the composition including at least one growth factor and a material to support cell growth; c) linking a self peptide of interest to an antibody to DC-Specific ICAM-3 grabbing non-integrin; d) immunizing the host with the self peptide of interest and antibody to DC-Specific ICAM-3 grabbing non-integrin; and, e) harvesting at least a portion of the grafted tissue that includes cells that produce human antibodies to the self peptide of interest.

54. A human antibody produced in accordance with the method of claim 48.

55. A method of testing the effect of drugs comprising: administering a drug to a non-human mammalian having at least a sufficient portion of human thymus, spleen, bone marrow, skin, lymph nodes and fetal liver grafted therein to allow the development of one or more types of human immune cells selected from the group consisting of T cells, B cells and dendritic cells; and observing any effects of the drug on human antibody production.

56. A method of producing a human antibody comprising the steps of: a) injecting CD34+ human cord blood into RAGAyc -/- mice to produce a human antibody; b) maturing the cells from CD34+ human cord blood to dendritic cells; c) obtaining the dendritic cells; d) incubating the dendritic cells with a self peptide of interest to form an immunogen; e) immunizing the injected RAGAyc -/- mice with the immunogen; and, f) recovering human antibodies.

57. A method of producing an immune response in an animal wherein said immune response is production of an antibody to a self peptide, said method comprising: a) isolating dendritic cells from an animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) isolating B cells from said animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; and e) immunizing the animal with the immunogen and the loaded B cell.

58. A method of producing therapeutic antibodies, comprising: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a cell-derived material including a self peptide of interest to form an immunogen; c) immunizing the host animal with the immunogen; d) harvesting cells that produce antibodies to the self peptide of interest; e) recovering one or more antibodies from the harvested cells; and f) humanizing the antibodies from step (e) to produce therapeutic antibodies.

59. A method of producing therapeutic antibodies, comprising: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) obtaining B cells from a second animal; d) incubating the B cells with a second peptide homologous to the self peptide of interest to form a loaded B cell; e) immunizing the host animal with the immunogen and the loaded B cell; f) harvesting cells that produce antibodies to the self peptide of interest; g) recovering one or more antibodies from the harvested cells; and

(h) humanizing the antibodies from step (g) to produce therapeutic antibodies.

60. A method of producing cross-reactive antibodies, comprising: a) obtaining dendritic cells from a host animal; b) incubating the dendritic cells with a self peptide of interest to form an immunogen; c) obtaining B cells from a second animal; d) incubating the B cells with a second peptide at least 90% homologous to the self peptide of interest to form a loaded B cell; e) immunizing the host animal with the immunogen and the loaded B cell; f) harvesting cells that produce antibodies to the self peptide of interest; g) recovering one or more antibodies from the harvested cells; wherein said antibodies recognize epitopes on both the self peptide and the second peptide.

61. The method of any one of claims 1, 10, 58, or 59, wherein said self peptide is apeptide that is upregulated in cancerous tissue.

62. The method of any one of claims 1, 10, 58, or 59, wherein said self peptide is a peptide that is expressed on immunoregulatory cells.

63. The method of claims 62, wherein said immunoregulatory cell is selected from the group consisting of L-SIGN, DC-SIGN, CD200, TIM-3, B7-H4, PD-L1,PD-L2 and PD-I.

64. The method of claim 61, wherein the self-peptide is selected from the group consisting of Ras, CDC27, CDK4, prostate-specific antigen, alpha-fetoprotein, breast mucin, gplOO, g250, p53, MART-I, MAGE, BAGE, GAGE, tyrosinase, Tyrosinase related protein 11, Tyrosinase related protein, and RAD50.

65. A vaccine composition for treating cancer in a mammal, comprising a therapeutically effective amount of dendritic cells wherein said dendritic cells have been incubated with a cell-derived material including a self peptide of interest to form an immunogen.