WO2006048877A2 - Treatment of b-cell malignancies with fgfr3 inhibitors - Google Patents

Treatment of b-cell malignancies with fgfr3 inhibitors Download PDF

Info

Publication number
WO2006048877A2
WO2006048877A2 PCT/IL2005/001154 IL2005001154W WO2006048877A2 WO 2006048877 A2 WO2006048877 A2 WO 2006048877A2 IL 2005001154 W IL2005001154 W IL 2005001154W WO 2006048877 A2 WO2006048877 A2 WO 2006048877A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
molecule
seq
antigen
fgfr3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2005/001154
Other languages
French (fr)
Other versions
WO2006048877A3 (en
Inventor
Avner Yayon
Eran Rom
Suzanne Trudel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University Health Network
Fibron Ltd
Original Assignee
University Health Network
Fibron Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Health Network, Fibron Ltd filed Critical University Health Network
Priority to EP05802387A priority Critical patent/EP1824513A4/en
Priority to CA002595398A priority patent/CA2595398A1/en
Priority to JP2007539710A priority patent/JP2008519028A/en
Priority to US11/718,530 priority patent/US20090175866A1/en
Priority to AU2005302083A priority patent/AU2005302083A1/en
Publication of WO2006048877A2 publication Critical patent/WO2006048877A2/en
Priority to IL182972A priority patent/IL182972A0/en
Anticipated expiration legal-status Critical
Publication of WO2006048877A3 publication Critical patent/WO2006048877A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the present invention relates to a pharmaceutical composition and a method of preventing, attenuating and treating B-cell malignancies, in particular multiple myeloma (MM), by administering to an individual in need thereof at least one antibody to fibroblast growth factor receptor 3 (FGFR3).
  • FGFR3 fibroblast growth factor receptor 3
  • the at least one FGFR3 antibody induces apoptosis of myeloma cells expressing wild type FGFR3.
  • Fibroblast Growth Factors constitute a family of over twenty structurally related polypeptides that are developmentally regulated and expressed in a wide variety of tissues. FGFs stimulate proliferation, cell migration and differentiation and play a major role in skeletal and limb development, wound healing, tissue repair, hematopoiesis, angiogenesis, and tumorigenesis (reviewed in Oraitz and Itoh, Genome Biology 2001, 2 (3): reviews 3005.1-3005.12).
  • FGFs The biological action of FGFs is mediated by specific cell surface receptors belonging to the receptor protein tyrosine kinase (RPTK) family of protein kinases. These proteins consist of an extracellular ligand binding domain, a single transmembrane domain and an intracellular tyrosine kinase domain that undergoes phosphorylation upon binding of FGF.
  • the FGF receptor (FGFR) extracellular region contains three immunoglobulin-like (Ig-like) loops or domains (Dl, D2 and D3), an acidic box, and a heparin-binding domain.
  • Ig-like immunoglobulin-like loops or domains
  • B cell neoplasms include precursor B-lymphoblastic leukemia/lymphoma (precursor B- cell acute lymphoblastic leukemia), B-cell chronic lymphocytic leukemia/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, Lymphoplasmacytic lymphoma, Splenic marginal zone B-cell lymphoma, Hairy cell leukemia, Plasma cell myeloma/plasmacytoma, Extranodal marginal zone B-cell lymphoma of MALT type, Nodal marginal zone B-cell lymphoma , Follicular lymphoma, Mantle-cell lymphoma Diffuse large B-cell lymphoma, Monocytoid B-cell lymphoma and Multiple myeloma.
  • MM Multiple myeloma
  • Plasma cells that undergo IgH switch recombination typically home to the bone marrow, where they reside. Interaction with bone marrow stroma leads to proliferation of malignant plasma cells and tumor formation. Progression of intramedullary myeloma is associated with increasingly severe secondary features that include lytic bone disease and osteoporosis, hypercalcemia, anemia, immunodeficiency and renal impairment.
  • Multiple myeloma is the second most prevalent blood cancer after non-Hodgkin's lymphoma. It represents approximately 1% of all cancers and 2% of all cancer deaths. Although the peak age of onset of multiple myeloma is 65 to 70 years of age, recent statistics indicate both increasing incidence and earlier age of onset.
  • MM treatment has been based on cytotoxic chemotherapy, primarly standard-dose oral melphalan combined with prednisone.
  • High-dose melphalan therapy combined with autologous bone marrow transplantation to reduce myelotoxicity has also been evaluated and results in a modest increase in overall survival over standard dose chemotherapy.
  • FGFR3 has been validated by in vitro and in vivo animal studies as a therapeutic target for MM.
  • an ideal FGFR3 inhibitor useful for the treatment of MM will exhibit the following properties: Recognize FGFR3 and be able to inhibit the activated forms of wild type and mutated FGFR3.
  • FGFR3 specific i.e. does not inhibit other FGFR or tyrosine kinase proteins.
  • Biocompatible i.e. non-immunogenic and non-toxic to the patient. Long half-life in blood stream.
  • PEGylation has been employed to modify antibodies, both single chain and monoclonal to achieve greater solubility and longer circulating life in vivo.
  • PEG (40,000) was conjugated to the mabs, Nl 2 and L26, specific to the ErbB2 (HER2) oncoprotein (Hurwitz et al. (2000) Cancer Immunol. Immunother. 49 226-234).
  • Koumenis et al. (Int. J. Pharmaceut. 198 83-95 (2000)) also achieved an increase in the circulation half life of the F(ab')2 form of a humanized anti IL-8 by PEG conjugation.
  • the present invention provides for the first time a highly effective therapeutic agent for the treatment of B-cell malignancies, including multiple myeloma. Multiple myeloma is incurable and conventional therapy results in complete remission in only 5% of patients with overall median survival only about 36 months. It is now disclosed that a human recombinant antibody specific to a dimeric FGFR3 extracellular domain is highly effective in preventing, attenuating or treating certain subtypes of multiple myeloma.
  • the present invention relates to a method for the prevention, attenuation or treatment of multiple myeloma comprising administering a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, the myeloma cell expressing FGFR3 and a pharmaceutically acceptable carrier to a subject in need thereof.
  • Another aspect relates to the use of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, the myeloma cell expressing FGFR3, for the manufacture of a medicament for the treatment of multiple myeloma.
  • Another aspect of the present invention relates to a pharmaceutical composition for the prevention, attenuation or treatment of a B-cell malignancy comprising as an active ingredient a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for
  • the molecule that comprises the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 is selected from a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a single domain antibody, a recombinant antibody and fragments thereof.
  • a preferred antibody species is a recombinant antibody.
  • a more preferred antibody species is selected from a recombinant single chain antibody and a recombinant Fab antibody.
  • Single chain antibodies can be single chain composite polypeptides having antigen binding capabilities and comprising amino acid sequences homologous or analogous to the variable regions of an immunoglobulin light and heavy chain i.e. linked V H -V L or single chain Fv (scFv).
  • the present invention provides a method of preventing, attenuating or treating multiple myeloma comprising administering a pharmaceutical composition comprising a molecule comprising the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3), the molecule comprising a V H -CDR3 region having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 1-9 and a V L -CDR3 region having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 10-18, and a pharmaceutically acceptable carrier.
  • FGFR3 fibroblast growth factor receptor 3
  • V H -CDR3 and V L -CDR3 regions are set forth in SEQ ID NOS: 39-47 and SEQ ID NOS: 48-56, respectively. These sequences have been disclosed in WO 02/102972, assigned to some of the assignees of the present invention.
  • the molecule comprising the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 comprises a V H -CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 1 and a V L -CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 10, and a pharmaceutically acceptable carrier.
  • the corresponding polynucleotide sequences of the V H -CDR3 and V L -CDR3 regions are set forth in SEQ ID NO: 39 and SEQ ID NO: 48, respectively.
  • Another preferred embodiment of the present invention is a pharmaceutical composition for the prevention, attenuation or treatment of multiple myeloma comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3) comprising a V H -CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 1 and a V L -CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 10, and a pharmaceutically acceptable carrier (designated as PRO-OOl).
  • FGFR3 fibroblast growth factor receptor 3
  • the present invention provides a method of preventing, attenuating or treating a multiple myeloma comprising administering a composition comprising a therapeutically effective molecule comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3, the molecule comprising a V H domain having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 19-27 and the V L domains having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 28-36, and a pharmaceutically acceptable carrier.
  • the corresponding polynucleotide sequences of the V H and V L domains are set forth in SEQ ID NOS: 57-65 and SEQ ID NOS: 66-74, respectively.
  • the molecule comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 comprises a V H domain having a polypeptide sequence as set forth in SEQ ID NO: 19 and the V L domain having a polypeptide sequence as set forth in SEQ ID NO: 28, and a pharmaceutically acceptable carrier.
  • the corresponding polynucleotide sequences of the V H and V L domains are set forth in SEQ ID NO: 57 and SEQ ID NO: 66, respectively.
  • the pharmaceutical composition comprises a single chain Fv molecule (scFv) having a polypeptide sequence set forth in SEQ ID NO: 37 having corresponding polynucleotide sequence SEQ ID NO: 38, and a pharmaceutically acceptable carrier.
  • scFv single chain Fv molecule
  • the present invention also provides pharmaceutical compositions comprising one or more PEGylated antibodies and fragments thereof which immunospecifically bind to FGFR3. Wherein the PEGylated antibodies and fragments thereof retain the biological activity of the native molecules as determined by their ability to bind and neutralize FGFR3.
  • a pharmaceutical composition of the invention comprises a PEGylated single chain Fv molecule (scFv) having a polypeptide sequence set forth in SEQ ID NO: 37 wherein leucine, the original amino acid at the N-terminus is replaced with serine to allow targeted PEGylation.
  • the affinity of the molecule comprising an antigen binding domain of an antibody is measured by methods known in the art including binding assays and BIAcore (biomolecular interaction analyzing system).
  • affinity of the antigen binding domain of an antibody is less than about 30 nM as measured in a BIAcore reactor, preferably less than about 15 nm and more preferably less than about 5 nm.
  • the pharmaceutical composition of the present invention is administered to the patient in combination with another therapeutic agent.
  • another therapeutic agent may be an antibody or a chemotherapeutic agent.
  • Chemotherapeutic agents are commonly used in the treatment of multiple myeloma and may include (but are not limited to) melphalan, doxorubicin, carmustine, cyclophosphamide, thalidomide, bortezomib and lenalidomide.
  • FIGURES Figure IA is a flow cytometry chart showing B9-FGFR WT (wild type) cells fluorescently labeled with PRO 001 followed by a PE-conjugated anti-human secondary antibody.
  • the filled histogram indicates parental B9 cells (lacking FGFR3 expression); the dotted light line, B9-FGFR WT without aFGF; the solid dark line, B9-WT in the presence of aFGF.
  • the Y axis represents counts indicating the amount of cells.
  • the X axis represents fluorescence intensity.
  • Figure IB is a graph showing viability of B9-FGFR WT cells treated with different concentrations of PRO-001.
  • the filled bars represent the control (no PRO-OOl).
  • the dotted bars represent PRO-001 treated cells.
  • Figure 1C is a photograph of a Western blot showing immune staining of RCJ-FGFR3 cell lysates.
  • RCJ cells were stimulated with FGF (+) with or without pre-incubation with a Fab.
  • Lane 1 no FGF stimulation and no pre-incubation with a Fab.
  • Lane 2 - FGF stimulation, no pre-incubation with a Fab.
  • Lane 3 FGF stimulation and pre incubation with a control (C) antibody.
  • the mid panel Phospho-JNK shows total cell lysates probed with anti- Phospho-JNK antibodies.
  • the upper panel (Phospho-FGFR3) shows cell lysates immunoprecipitated (IP) with anti-FGFR3 antibody and then analyzed by Western blot with anti-phosphotyrosine (4G10).
  • the lower panel (FGFR3) shows cell lysates immunoprecipitated (IP) with anti-FGFR3 antibody and then analyzed by Western blot with anti-FGFR3.
  • Figure ID is a graph showing proliferation of FGFR expressing FDCP cells in the presence of increasing concentrations of PRO-OOl as determined by XTT analysis. Data are the average of duplicate cultures.
  • the X axis represents concentration of PRO-OOl Fab.
  • the Y axis represents % inhibition.
  • Figure 2 is a graph showing the viability of human myeloma cell lines in the presence of PRO-OOl. Viability is reported as the ratio between the optical density (OD) in the presence of FGF + inhibitor and the OD in the absence of FGF.
  • Figure 3 is a flow cytometry chart showing phosphorylation of ERK (Extracellular signal-regulated protein kinase) in UTMC2 cells. The filled histogram represents UTMC2 without FGF stimulation (unstimulated); the light line represents cells stimulated with FGF and treated with a control antibody (FGF/vehicle); the dark line represents cells stimulated with FGF and treated with PRO-OOl (FGF/PRO-001).
  • ERK Extracellular signal-regulated protein kinase
  • Figure 4 is a graph showing viability of UTMC2 cells treated with FGF, IL6 or IGF-I.
  • the dark bars represent stimulated cells treated with a control antibody; the dotted bar represents stimulated cells treated with 5 ⁇ g/ml PRO-OOl; the square-filled bar represents stimulated cells treated with 10OnM PD 173074.
  • FIG 5 is a graph showing apoptosis of UTMC2 cells in response to treatment with PRO-OOl in the presence of BMSCs (stroma).
  • BMSCs alone (stroma) or BMSCs together with UTMC2 cells (stroma/UTMC2) were cultured with control antibody or 5 ⁇ g/ml PRO- 001 for 72 hours and apoptosis was assessed by means of a flow cytometry assay of annexin V binding and propidium iodide exclusion. Values represent means of quadruplicate cultures + SD.
  • Figures 6 A-B are flow cytometry charts of human primary myeloma cells treated with anti-FGFR antibody PRO-OOl.
  • FIG. 7 is a flow cytometry chart showing CD 138 positive primary MM cells stained with Annexin V. Primary myeloma cells were cultured in the presence of control Fab (lower panel) or 5 ⁇ g/ml PRO-001 (upper panel).
  • Figure 8A is a graph showing viability of FDCP-FGFR3 S249C .
  • Cells were cultured in the presence of increasing amounts of PRO-001 or a control antibody (C) for two days. Cell proliferation was determined by XTT analysis. Data are the average of duplicate cultures.
  • Figure 8B is a graph showing the effect of PRO-001 on an FGFR3-driven xenograft tumor model. Nude mice (3 in each group), were injected S.C. at 2 locations, one on each flank ( ⁇ - right flank, b- left flank), with 2x10 6 FDCP-FGFR3 S249C cells each. A week later, mice were randomized to receive PRO-001 by LP. injection according to the schedule described in Table I or PBS as control. Tumor volume was estimated from measurements in 3 dimensions at 22 or 29 days post cell injection.
  • Figure 9 is a graph showing FGFR3 binding activity of PRO-OO lSer scFv.
  • a MaxiSorp plate was coated with the indicated amount of single chain. Soluble FGFR3/Fc was added and bound receptor was measured with HRP-anti-Fc.
  • Figure 10 is a photograph of a coomassie stained SDS-PAGE showing specific FGFR3 binding of mPEG-HZ5K, mPEG-HZ20K and mPEG-HZ40K conjugated PRO-OO 1 Ser.
  • the PEGylation reaction mix (P) was incubated with FGFR3/Fc or FGFRl/Fc-protein A- sepharose beads.
  • the unbound material was collected and incubated consecutively 2 more times with fresh beads.
  • the bound fractions (Bl, B2 and B3) as well as the unbound material (U2) from the last binding cycle were analyzed by coomassie stained SDS-PAGE. U - unmodified single chain.
  • Figure 11 is a graph showing FGFR3 neutralizing activity of PRO-OOl-PEG conjugates.
  • PRO-001 Ser PEGylated with mPEG-HZ-5K, mPEG-HZ-20K or mPEG-HZ- 4OK were analyzed by XTT using FDCP-FGFR3 cells or FDCP-FGFRl cells as control.
  • the present invention is based on the discovery that an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3) induces apoptosis of myeloma cells, in vitro and in vivo.
  • FGFR3 fibroblast growth factor receptor 3
  • the present invention relates to a method of treating a B-cell malignancy comprising administering a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, and a pharmaceutically acceptable carrier to a subject in need thereof.
  • a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, and a pharmaceutically acceptable carrier to a subject in need thereof.
  • the B-cell malignancy is multiple myeloma.
  • the present invention further relates to the use of at least one anti-FGFR3 antibody for the manufacture of a medicament for the prevention, attenuation or treatment of a B-cell malignancy, preferably multiple myeloma.
  • the anti-FGFR3 antibody may interfere with adhesion between the stroma and the myeloma cell. This interaction is crucial for growth of the myeloma plasma cells and disease progression and results in local manifestations such as lytic bone disease and systemic manifestations such as immunocompromise and anemia.
  • Certain antibodies were shown to be specific for FGFR3 and useful to neutralize FGFR3 activity and for the treatment of skeletal dysplasias such as achondroplasia and proliferative diseases such as bladder cancer. Additional antibodies useful for blocking ligand-independent, or constitutive, activation were also identified and isolated.
  • the present inventors have now discovered that certain molecules disclosed in that application are highly effective in inducing apoptosis in FGFR3 expressing myeloma cells, in particular myeloma cells situated in the bone marrow stroma of a multiple myeloma patient. These molecules are now disclosed for the prevention, attenuation and treatment of multiple myeloma.
  • fibroblast growth factor receptor denotes a receptor specific for FGF which is necessary for transducing the signal exerted by FGF to the cell interior, typically comprising an extracellular ligand-binding domain, a single transmembrane helix, and a cytoplasmic domain having tyrosine kinase activity.
  • the FGFR extracellular domain consists of three immunoglobulin-like (Ig-like) domains (Dl, D2 and D3), a heparin binding domain and an acidic box.
  • Ig-like domains Dl, D2 and D3
  • FGFR3 specific refers to any effector that has higher affinity or activity or binding to FGFR3 polypeptide or to the polynucleotide encoding same, than to another FGF receptor protein or polynucleotide.
  • the effector can be any molecule including a ligand, an inhibitor, an antibody, a polypeptide, a polynucleotide or a small organic molecule such as a tyrosine kinase inhibitor. It is to be explicitly understood that the term “FGFR3 specific” does not exclude or preclude situations wherein the effector has some activity on another FGF receptor subtype. It is further to be understood that if the activity mediated via another receptor subtype is clinically important for the therapeutic utility observed, this is explicitly encompassed within the scope of the claimed invention.
  • affinity refers to the strength of the reaction of a single antigen- combining site with a monovalent antigenic determinant. Affinity is measured as the binding constant. Specificity of an antibody is the property of an antibody which enables it to react with some antigenic determinants and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.
  • multiple myeloma also known as plasma cell myeloma refers to the proliferative hematologic disease of the plasma cell. Multiple myeloma is characterized by excessive numbers of abnormal plasma cells in the bone marrow and overproduction of intact monoclonal immunoglobulin (IgG, IgA, IgD, or IgE) or Bence- Jones protein. Hypercalcemia, anemia, renal damage, increased susceptibility to bacterial infection, and impaired production of normal immunoglobulin are common clinical manifestations of multiple myeloma. It is often also characterized by diffuse osteoporosis and lytic bone lesions predominantly of the axial skeleton.
  • stroma refers to the cells and the supporting tissue around the myeloma cells in the bone marrow. Adhesion of the myeloma cells to the bone marrow enhances the growth of myeloma.
  • One aspect of the present invention is directed to a method of preventing, attenuating or treating multiple myeloma by administering a molecule comprising the antigen-binding portion of an antibody which diminishes or inhibits activation of FGFR3, and a pharmaceutically acceptable carrier.
  • the antigen-binding portion of an antibody is directed to the extracellular domain of the FGFR3.
  • One embodiment of the present invention is directed to molecules comprising an antigen binding domain which blocks ligand-dependent activation of FGFR3.
  • the molecule having the antigen-binding portion of an antibody according to the present invention is useful for blocking the ligand-dependent activation and/or ligand independent (constitutive) activation of FGFR3.
  • Preferred embodiments of such antibodies/molecules obtained from an antibody library designated as HuCAL ® (Human Combinatorial Antibody Library) clone, are presented in Table 1 with the unique VH-CDR3 and V L -CDR3 sequences presented in Table 2.
  • Table 1 Properties of antibodies useful for inhibiting, treating or attenuating multiple myeloma.
  • affinity (nM) of the respective molecules to FGFR3 and FGFRl was measured by BIAcore and/or FACS.
  • IC 50 were determined for the dimeric dHLX format of certain molecule with antigen binding site in an FDCP-FGFR3 proliferation assay performed with FGF9.
  • Fab-dHLX refers to a Fab mini-antibody format where a dimer of the Fab monomer is produced as a fusion protein after insertion into an expression vector.
  • the values obtained by BIAcore demonstrated that the interactions between antibody and receptor are specific.
  • V H refers to the variable heavy chain
  • V L refers to the variable light chain
  • CDR3 refers to complementarity determining region 3.
  • the present invention provides a method of treating or preventing multiple myeloma comprising administering a composition comprising a therapeutically effective molecule comprising a V H -CDR3 region having a polypeptide sequence as set forth in any one of SEQ ID NOS: 1- 9 and a corresponding V L -CDR3 region having a polypeptide sequence as set forth in any one of SEQ ID NOS: 10-18, and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating or preventing multiple myeloma comprising administering a composition conrprising a therapeutically effective molecule comprising a V H domain having a polypeptide sequence as set forth in any one of SEQ ID NOS: 19-27 and the corresponding VL domains having a polypeptide sequence as set forth in any one of SEQ ID NOS: 28-36, and a pharmaceutically acceptable carrier.
  • a composition conrprising a therapeutically effective molecule comprising a V H domain having a polypeptide sequence as set forth in any one of SEQ ID NOS: 19-27 and the corresponding VL domains having a polypeptide sequence as set forth in any one of SEQ ID NOS: 28-36, and a pharmaceutically acceptable carrier.
  • the preferred VH and V L sequences are presented herein.
  • PRO-002-VH (SEQ ID NO: 20)
  • PRO-012-VH (SEQ ID NO: 21)
  • PRO- 024 -VH (SEQ ID NO: 23)
  • PRO-026-VH (SEQ ID NO: 24)
  • PRO-029-VH (SEQ ID NO: 25)
  • PRO-054-VH (SEQ ID NO: 26)
  • PRO-OOl-VL (SEQ ID NO: 28)
  • PRO-002-VL (SEQ ID NO: 29)
  • PRO- 021-VL ( SEQ ID NO : 31 )
  • PRO- 024 -VL SEQ ID NO : 32
  • PRO- 029 -VL ( SEQ ID NO : 34 )
  • PRO- 054 -VL ( SEQ ID NO : 35 )
  • PRO- 055 -VL ( SEQ ID NO : 36 )
  • the corresponding polynucleotide sequences of the V H and V L domains have SEQ ID NOS: 57-65 and SEQ ID NOS: 66-74, respectively.
  • the pharmaceutical composition comprises a single chain Fv molecule (scFv) set forth in SEQ ID NO:37, having corresponding polynucleotide sequence SEQ ID NO:38, and a pharmaceutically acceptable carrier.
  • scFv single chain Fv molecule
  • Natural antibodies, or immunoglobulins comprise two heavy chains linked together by disulfide bonds and two light chains, each light chain being linked to a respective heavy chain by disulfide bonds in a "Y" shaped configuration.
  • Proteolytic digestion of an antibody yields Fv (Fragment variable and Fc (fragment crystalline) domains.
  • the antigen binding domains, Fab include regions where the polypeptide sequence varies.
  • the term F(ab') 2 represents two Fab' arms linked together by disulfide bonds.
  • the central axis of the antibody is termed the Fc fragment.
  • Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains (C H ).
  • Each light chain has a variable domain (V L ) at one end and a constant domain (CL) at its other end, the light chain variable domain being aligned with the variable domain of the heavy chain and the light chain constant domain being aligned with the first constant domain of the heavy chain (CHl).
  • the variable domains of each pair of light and heavy chains form the antigen-binding site.
  • the domains on the light and heavy chains have the same general structure and each domain comprises four framework regions, whose sequences are relatively conserved, joined by three hypervariable domains known as complementarity determining regions (CDRl -3). These domains contribute specificity and affinity of the antigen-binding site.
  • the isotype of the heavy chain determines immunoglobulin class (IgG, IgA, IgD, IgE or IgM, respectively) .
  • the light chain is either of two isotypes (kappa, K or lambda, ⁇ ) found in all antibody classes.
  • antibody or "molecule having the antigen-binding portion of an antibody” refers to an immunoglobulin molecule able to bind to a specific epitope on an antigen, and which may be comprised of a polyclonal mixture, or be monoclonal in nature. Antibodies may be entire immunoglobulins or fragments thereof derived from natural sources, or from recombinant sources. An antibody according to the present invention may exist in a variety of forms including, for example, whole antibody, an antibody fragment, or another immunologically active fragment thereof, such as a complementarity determining region. Similarly, the antibody may be an antibody fragment having functional antigen-binding domains, that is, heavy and light chain variable domains.
  • the antibody fragment may also exist in a form selected from the group consisting of: Fv, Fab F(ab) 2 , scFv (single chain Fv), dAb (single domain antibody), bi-specific antibodies, diabodies and triabodies. Included within the scope of the invention are chimeric antibodies; human and humanized antibodies; single domain antibodies, recombinant and engineered antibodies, and fragments thereof. Furthermore, the DNA encoding the variable region of the antibody can be inserted into the DNA encoding other antibodies to produce chimeric antibodies (see, for example, US patent 4,816,567). Single chain antibodies fall within the scope of the present invention.
  • Single chain antibodies can be single chain composite polypeptides having antigen binding capabilities and comprising amino acid sequences homologous or analogous to the variable regions of an immunoglobulin light and heavy chain (linked V H - V L or single chain Fv (ScFv)). Both V H and V L may copy natural monoclonal antibody sequences or one or both of the chains may comprise a CDR-FIL construct of the type described in US patent 5,091,513, the entire contents of which are incorporated herein by reference. The separate polypeptides analogous to the variable regions of the light and heavy chains are held together by a polypeptide linker.
  • a "molecule having the antigen-binding portion of an antibody” as used herein is intended to include not only intact immunoglobulin molecules of any isotype and generated by any animal cell line or microorganism, but also the antigen-binding reactive fraction thereof, including, but not limited to, the Fab fragment, the Fab 1 fragment, the F(ab') 2 fragment, the variable portion of the heavy and/or light chains thereof, Fab miniantibodies (see WO 93/15210; US patent 5,910,573; WO 96/13583; WO 96/37621, the entire contents of which are incorporated herein by reference), dimeric bispecific miniantibodies (see Muller, et al, 1998 FEBS Letters, 432:45-49) and chimeric or single-chain antibodies incorporating such reactive fraction, as well as any other type of molecule or cell in which such antibody reactive fraction has been physically inserted, such as a chimeric T-cell receptor or a T-cell having such a receptor, or molecules developed to deliver therapeutic
  • Fc as used herein is meant as that portion of an immunoglobulin molecule (Fragment crystallizable) that mediates phagocytosis, triggers inflammation and targets Ig to particular tissues; the Fc portion is also important in complement activation.
  • a chimera comprising a fusion of the extracellular domain of the RPTK and an immunoglobulin constant domain can be constructed useful for assaying for ligands for the receptor and for screening for antibodies and fragments thereof
  • extracellular domain when used herein refers to the polypeptide sequence of the FGFR3 disclosed herein which are normally positioned to the outside of the cell.
  • the extracellular domain encompasses polypeptide sequences in which part of or all of the adjacent (C-terminal) hydrophobic transmembrane and intracellular sequences of the mature FGFR3 have been deleted.
  • the extracellular domain-containing polypeptide can comprise the extracellular domain and a part of the transmembrane domain.
  • the polypeptide comprises only the extracellular domain of the FGFR3.
  • the truncated extracellular domain is generally soluble.
  • the skilled practitioner can readily determine the extracellular and transmembrane domains of the FGFR3 by aligning it with known RPTK (receptor protein tyrosine kinases) amino acid sequences for which these domains have been delineated.
  • RPTK receptor protein tyrosine kinases
  • the hydrophobic transmembrane domain can be readily delineated based on a hydrophobicity plot of the polypeptide sequence.
  • the extracellular domain is N-terminal to the transmembrane domain.
  • epitope is meant to refer to that portion of any molecule capable of being bound by an antibody or a fragment thereof, which can also be recognized by that antibody.
  • Epitopes or antigenic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three-dimensional structural characteristics as well as specific charge characteristics.
  • an "antigen” is a molecule or a portion of a molecule capable of being bound by an antibody, which is additionally capable of inducing an animal to produce antibody capable of binding to an epitope of that antigen.
  • An antigen may have one or more than one epitope. The specific reaction referred to above is meant to indicate that the antigen will react, in a highly selective manner, with its corresponding antibody and not with the multitude of other antibodies, which may be evoked by other antigens.
  • neutralizing antibody refers to a molecule having an antigen-binding site to a specific receptor capable of reducing or inhibiting (blocking) activity or signaling through a receptor, as determined by in vivo or in vitro assays, as per the specification.
  • a “monoclonal antibody” or “mAb” is a substantially homogeneous population of antibodies to a specific antigen. mAbs may be obtained by methods known to those skilled in the art. See, for example Kohler and Milstein, Nature, 256(5517):495-497 (1975); US patent 4,376,110; Ausubel, et al (Eds), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (New York) (1987-1999) ; Harlow, et al, Antibodies: A Laboratory Manual, CSHL (Cold Spring Harbor, NY) (1988); and Colligan, et al (eds.), Current Protocols in Immunology, John Wiley & Sons, Inc.
  • the mAbs of the present invention may be of any immunoglobulin class including IgG, IgM, IgE, IgA, and any subclass thereof.
  • a hybridoma producing a mAb may be cultivated in vitro or in vivo. High titers of mAbs can be obtained by in vivo production where cells from the individual hybridomas are injected intraperitoneally into pristine-primed Balb/c mice to produce ascites fluid containing high concentrations of the desired mAbs.
  • mAbs of isotype IgM or IgG may be purified from such ascites fluids, or from culture supernatants, using column chromatography methods well known to those of skill in the art.
  • Chimeric antibodies are molecules, the different portions of which are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region.
  • Antibodies which have variable region framework residues substantially from human antibody (termed an acceptor antibody) and complementarity determining regions substantially from a mouse antibody (termed a donor antibody) are also referred to as humanized antibodies.
  • Chimeric antibodies are primarily used to reduce immunogenicity in application and to increase yields in production, for example, where murine mAbs have higher yields from hybridomas but higher immunogenicity in humans, such that human/murine chimeric mAbs are used.
  • antibodies can be generated in vitro using phage display technology. Such a production of recombinant antibodies is much faster compared to conventional antibody production and they can be generated against an enormous number of antigens. In contrast, in the conventional method, many antigens prove to be non-immunogenic or extremely toxic, and therefore cannot be used to generate antibodies in animals. Moreover, affinity maturation (i.e., increasing the affinity and specificity) of recombinant antibodies is very simple and relatively fast. Finally, large numbers of different antibodies against a specific antigen can be generated in one selection procedure.
  • phage display libraries To generate recombinant monoclonal antibodies one can use various methods all based on phage display libraries to generate a large pool of antibodies with different antigen recognition sites.
  • a library can be made in several ways: One can generate a synthetic repertoire by cloning synthetic CDR3 regions in a pool of heavy chain germ line genes and thus generating a large antibody repertoire, from which recombinant antibody fragments with various specificities can be selected.
  • One can use the lymphocyte pool of humans as starting material for the construction of an antibody library. It is possible to construct naive repertoires of human IgM antibodies and thus create a human library of large diversity. This method has been widely used successfully to select a large number of antibodies against different antigens.
  • the present invention also contemplates pharmaceutical formulations, both for veterinary and for human medical use, which comprise as the active agent one or more of the molecules having specificity and affinity to FGFR3, the molecule inducing apoptosis of myeloma cells for the manufacture of a medicament for the treatment or propliylaxis of the conditions variously described herein.
  • the active agent preferably is utilized together with one or more pharmaceutically acceptable carrier(s) therefore and optionally any other therapeutic ingredients.
  • the carrier(s) must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not unduly deleterious to the recipient thereof.
  • the active agent is provided in an amount effective to achieve the desired pharmacological effect, as described above, and in a quantity appropriate to achieve the desired daily dose.
  • the molecules of the present invention comprising the antigen binding portion of an antibody or comprising another polypeptide including a peptidomimetic, antagonistic ligand or soluble receptor or an organic molecule or polynucleotide will be suspended in a sterile saline solution for therapeutic uses.
  • the pharmaceutical compositions may alternatively be formulated to control release of active ingredient (molecule comprising the antigen binding portion of an antibody) or to prolong its presence in a patient's system.
  • suitable drug delivery systems include, e.g., implantable drug release systems, hydrogels, hydroxymethylcellulose, microcapsules, liposomes, microemulsions, microspheres, and the like.
  • Controlled release preparations can be prepared through the use of polymers to complex or adsorb the molecule according to the present invention.
  • biocompatible polymers include matrices of poly (ethylene-co- vinyl acetate) and matrices of a polyanhydride copolymer of a stearic acid dimer and sebaric acid.
  • the rate of release of the molecule according to the present invention, i.e., of an antibody or antibody fragment, from such a matrix depends upon the molecular weight of the molecule, the amount of the molecule within the matrix, and the size of dispersed particles (Saltzman et al, Biophys.
  • composition of this invention may be administered by any suitable means, such as orally, topically, intranasally, subcutaneously, intramuscularly, intravenously, intra-arterially, intraarticulary, intralesionally or parenterally. Ordinarily, intravenous (i.v.), intraarticular, topical or parenteral administration will be preferred.
  • the therapeutically effective amount of the molecule according to the present invention will depend, inter alia upon the administration schedule, the unit dose of molecule administered, whether the molecule is administered in combination with other therapeutic agents, the immune status and health of the patient, the therapeutic activity of the molecule administered and the judgment of the treating physician.
  • a "therapeutically effective amount” refers to the amount of a molecule required to alleviate one or more symptoms associated with a disorder being treated over a period of time.
  • the daily dosage can generally be between about 0.0 lmg to about 500 mg, preferably about 0.0 lmg to about 50 mg, more preferably about O.lmg to about 10 mg, per kg body weight.
  • the daily dosage can generally be between about O.OOlmg to about 100 mg, preferably about O.OOlmg to about 10 mg, more preferably about O.Olmg to about 1 mg, per kg body weight.
  • the daily dosage can be administered, for example in regimens typical of 1-4 individual administration daily.
  • Other preferred methods of administration include intraarticular administration of about O.Olmg to about 100 mg per kg body weight.
  • Various considerations in arriving at an effective amount are described, e.g., in Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa., 1990.
  • the molecules of the present invention as active ingredients are dissolved, dispersed or admixed in an excipient that is pharmaceutically acceptable and compatible with the active ingredient as is well known.
  • excipients are, for example, water, saline, phosphate buffered saline (PBS), dextrose, glycerol, ethanol, or the like and combinations thereof.
  • PBS phosphate buffered saline
  • dextrose glycerol
  • ethanol ethanol
  • suitable carriers are well known to those in the art.
  • the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents.
  • the combined treatment of one or more of the molecules of the invention with an anti- inflammatory drug such as methotrexate or glucocorticoids may provide a more efficient treatment for inhibiting FGFR3 activity.
  • the pharmaceutical composition comprises the antibody, an anti-inflammatory drug and a pharmaceutically acceptable carrier.
  • nucleic acid and “polynucleotides” refers to molecules such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as equivalents, analogs of RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
  • nucleic acid molecule encoding an anti- FGFR3 antibody useful for the preparation of a medicament for the treatment of multiple myeloma.
  • the nucleic acid molecule contains a nucleotide sequence having at least 75% sequence identity, preferably about 90%, and more preferably about 95% identity to the above encoding nucleotide sequence set forth in any one of SEQ ID NOS: 57-74, as would be well understood by those of skill in the art.
  • the nucleic acid molecule contains a nucleotide sequence having at least 50% sequence identity, preferably about 70% and more preferably about 80% identity to the molecules set forth in any one of SEQ ID NOs: 39-56.
  • the invention also provides nucleic acids that hybridize under high stringency conditions to polynucleotides set forth in any one of SEQ ID NOs: 57-74 or the complement thereof.
  • highly stringent conditions are those which are tolerant of up to about 5%-25% sequence divergence, preferably about 5%-15%.
  • examples of highly stringent (-1O 0 C below the calculated Tm of the hybrid) conditions use a wash solution of 0.1 X SSC (standard saline citrate) and 0.5% SDS at the appropriate Ti below the calculated Tm of the hybrid.
  • the ultimate stringency of the conditions is primarily due to the washing conditions, particularly if the hybridization conditions used are those which allow less stable hybrids to form along with stable hybrids.
  • a common hybridization condition that can be used with the highly stringent to moderately stringent wash conditions described above is hybridization in a solution of 6 X SSC (or 6 X SSPE), 5 X Denhardt's reagent, 0.5% SDS, 100 ⁇ g/ml denatured, fragmented salmon sperm DNA at an appropriate incubation temperature Ti. See generally Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d edition, Cold Spring Harbor Press (1989)) for suitable high stringency conditions.
  • Stringency conditions are a function of the temperature used in the hybridization experiment and washes, the molarity of the monovalent cations in the hybridization solution and in the wash solution(s) and the percentage of formamide in the hybridization solution.
  • sensitivity by hybridization with a probe is affected by the amount and specific activity of the probe, the amount of the target nucleic acid, the detectability of the label, the rate of hybridization, and the duration of the hybridization.
  • the hybridization rate is maximized at a Ti (incubation temperature) of 20-25 0 C below Tm for DNA: DNA hybrids and 10-15 0 C below Tm for DNA: RNA hybrids. It is also maximized by an ionic strength of about 1.5M Na + .
  • the rate is directly proportional to duplex length and inversely proportional to the degree of mismatching.
  • Hybrid stability is a function of duplex length, base composition, ionic strength, mismatching, and destabilizing agents (if any).
  • the Tm of a perfect hybrid may be estimated for DNA: DNA hybrids using the equation of Meinkoth and Wahl (Anal. Biochem. 138 (2): 267-84 (1984)), as
  • Tm 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L and for DNA:RNA hybrids, as
  • Tm 79.8°C + 18.5 (log M) + 0.58 (%GC) - 11.8 (%GC) 2 - 0.56(% form) - 820/L
  • M molarity of monovalent cations, 0.01-0.4 M NaCl
  • %GC percentage of G and C nucleotides in DNA, 30%-75%, % form, percentage formamide in hybridization solution, and L, length hybrid in base pairs.
  • Tm is reduced by 0.5-1.5 0 C (an average of I 0 C can be used for ease of calculation) for each 1% mismatching.
  • the Tm may also be determined experimentally. As increasing length of the hybrid (L) in the above equations increases the Tm and enhances stability, the full-length rat gene sequence can be used as the probe.
  • Filter hybridization is typically carried out at 68°C, and at high ionic strength (e.g., 5 - 6 X SSC), which is non-stringent, and followed by one or more washes of increasing stringency, the last one being of the ultimately desired high stringency.
  • high ionic strength e.g., 5 - 6 X SSC
  • the equations for Tm can be used to estimate the appropriate Ti for the final wash, or the Tm of the perfect duplex can be determined experimentally and Ti then adjusted accordingly.
  • the invention also provides for conservative amino acid variants of the molecules. Variants according to the invention also may be made that conserve the overall molecular structure of the encoded proteins. Given the properties of the individual amino acids comprising the disclosed protein products, some rational substitutions will be recognized by the skilled worker. Amino acid substitutions, i.e. "conservative substitutions,” may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. Many therapeutic human proteins suffer from short half life and low stability in the circulation, and therefore require the use of high doses to maintain therapeutic efficacy.
  • PEGylation is a method for the covalent attachment of PEG to proteins (reviewed in Greenwald et al. (2003) Advanced Drug Delivery Reviews 55 217-250).
  • PEG Poly ethylene glycol
  • a PEGylated protein usually has significantly increased half life in the blood circulation, reduced immunogenicity and antigenicity while retaining its bioactivity.
  • the invention therefore also provides for PEGylated versions of the molecules of the invention.
  • the invention encompasses PEGylated monoclonal antibodies or fragments thereof having specificity and affinity for FGFR3 that have increased in vivo half-lives allowing to reduce the dosage and/or frequency of administration of said antibodies or fragments thereof to a subject.
  • the molecules may be PEGylated by any of the PEGylation methods which are well known in the art (Lee et al. (1999) Bioconjugate Chem. 10 973-981) using PEG molecules of different molecular weights ranging from Mw 5,000 to Mw 40,000, but preferably using PEG molecules of Mw 5, 000 to 20, 000.
  • the PEG moiety may be appended at the N-terminus of the molecule.
  • the scFv molecule of the invention (SEQ ID: 37) was generated wherein the amino acid at the N-terminus (position 2) is serine instead of leucine, thus allowing targeted PEGylation.
  • Non-transformed rat chondrocyte cell line expressing FGFR3 in an inducible manner has been described previously (Rauchenberger R. et al. J Biol. Chem. 2003; 278:38194-205).
  • Cells were maintained in ⁇ - Minimum Essential Media supplemented with 15% fetal calf serum (FCS), 2mM L-Glutamine, 100 U/ml penicillin, lOO ⁇ g/ml streptomycin, 600 ⁇ g /ml G418 (Gibco BRL, Ontario, Canada), 2 ⁇ g /ml Tetracyclin (Sigma, Ontario, Canada), and 50 ⁇ g/ml HygromycinB (Gibco BRL).
  • FCS fetal calf serum
  • 2mM L-Glutamine 100 U/ml penicillin
  • lOO ⁇ g/ml streptomycin 600 ⁇ g /ml G418
  • 2 ⁇ g /ml Tetracyclin Sigma, Ontario, Canada
  • FGFR3 expression was induced by removal of tetracyclin and serum starvation.
  • the mouse myeloid progenitor cell line (FDCP-I) was transfected with full length FGFRl (FDCP-FGFRl), FGFR2 (FDCP-FGFR2), FGFR3 (FDCP-FGFR3) or FGFR3 S249C mutant cDNAs and cultured in Iscove's medium (GibcoBRL) with 10% FCS, 100 ⁇ g/ml penicillin, 100 ⁇ g/ml streptomycin, 10 ng/ml FGF and 5 ⁇ g/ml heparin (Sigma).
  • Human myeloma cell lines (UTMC2, H929, KMSI l, KMS 18, 8226) were maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 2.5% FCS and penicillin-streptomycin (Hyclone, Logan, UT).
  • IMDM Iscove's Modified Dulbecco's Medium
  • BMSCs bone marrow stroma cells
  • Immunoprecipitation and immunobloting Cells were lysed in lysis buffer (50 mM Tris/HCl, pH 8.0, 150 mM NaCl 2 , 0.1 mM ZnCl 2 , 0.5% Nonidet NP-40, 1 mg/ml, complete protease inhibitor mix (Roche Molecular Biochemicals, Mannheim, Germany)), and clarified by centrifugation at 12,000 x g for 15 minutes.
  • lysis buffer 50 mM Tris/HCl, pH 8.0, 150 mM NaCl 2 , 0.1 mM ZnCl 2 , 0.5% Nonidet NP-40, 1 mg/ml, complete protease inhibitor mix (Roche Molecular Biochemicals, Mannheim, Germany)
  • the lysates were subjected to immunoprecipitation for 16 hours at 4°C with anti- FGFR3 (C 15) and analyzed by 7.5% sodium dodecyl-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot with anti-phosphotyrosine (4G10 from R&D). Protein bands were visualized using secondary antibodies coupled to horseradish peroxidase and the ECL kit from Pierce according to the manufacturer's instructions.
  • Cell viability was assessed by 3-(4, 5-dimethylthiazol)-2,5-diphenyl tetrazolium (MTT) or (2,3-bis (2-methoxy-4-nitro-5-sulphophenyl)-5-[(phenylamino) carbonyl]-2H- tetrazolium hydroxide (XTT) dye absorbance where indicated.
  • MTT 3-(4, 5-dimethylthiazol)-2,5-diphenyl tetrazolium
  • XTT (2,3-bis (2-methoxy-4-nitro-5-sulphophenyl)-5-[(phenylamino) carbonyl]-2H- tetrazolium hydroxide
  • Cells were incubated in the absence or presence of one of the following cytokines: 10 ng/ml FGF9 and 5 ⁇ g/ml heparin, 1% murine IL-6, 50 ng/ml IGF-I or 50 ng/ml human IL-6 where indicated and increasing concentrations of PRO-001, control antibody (purified human Fab) or 100 nM PD173074. Plates were incubated for 48 or 72 h at 37 0 C, 5% CO 2 . MTT and XTT assays were performed according to the manufacturer's instruction (Boehringer Mannheim, Mannheim, Germany and Biological
  • UTMC2 cells (20,000 cells/well) were incubated at 37 0 C in 96-well plates in the presence of vehicle control or 5 ⁇ g/ml PRO-001.
  • [ 3 H]-thymidine (0.5 ⁇ Ci) was added to each well for 8 h. Cells were harvested onto glass filters with an automatic cell harvester and counted by PACKARD TOP counter (CANBERPA PACKARD, Canada).
  • the cells were permeabilized h»y adding ice-cold methanol (to a final concentration of 90%) while vortexing and incubated on ice for 30 minutes.
  • Cells were washed with PBS plus 4% FCS, stained with anti-ERKIl/2 (Cell Signaling Technology, Beverly, MA) for 15 minutes and then labeled with fluorescein isothiocyanate (FITC) conjugated goat anti-rabbit and anti-CD 138-PE (PharMinogen, San Diego, CA) where indicated.
  • FITC fluorescein isothiocyanate
  • Malignant cells were identified as cells that express high levels of CD 138.
  • Flow cytometry was performed on a FACSCaliber® flow cytorneter (BD Biosciences, San Jose, CA) and analyzed using Cellquest® software (Becton Dickinson).
  • Apoptosis analysis For studies of apoptosis, cells were seeded at an initial density of 2.5 x 10 5 /mL in 6 well plates coated with BMSCs and supplemented with control (vehicle or antibody) or 5 ⁇ g/ml PRO-001 and cultured for 48 h. Apoptosis was determined by Annexin V staining (Boehringer Mannheim, Indianapolis, IN) and analyzed by flow cytometry. AnnexinV is a protein that binds specifically to phosphotidyl-serine in the cell membrane. Binding occurs once the membrane has started to break down and the phospholipids are released into the extracellular media. Primary patient samples
  • FISH fluorescence in situ hybridization
  • t(4;14) positive samples were further analyzed for the presence of FGFR3 mutations.
  • Four pairs of primers were designed to amplify the regions of FGFR3 containing codons of the extracellular (EC) domain, transmembrane (TM) domain tyrosine kinase (TK) domain and stop codon (SC), known hot spots for activating mutations.
  • EC extracellular
  • TM transmembrane
  • TK tyrosine kinase
  • SC stop codon
  • mononuclear cells freshly isolated from bone marrow aspirates were separated by Ficoll-Hipaque gradient sedimentation and plated at a cell density of 5 x 10 5 cells/ml in IMDM supplemented with 20% FCS, 1% glutamine, penicillin-streptomycin and 30 ng/ml aFGF and 10 ⁇ g/ml heparin.
  • Cells were cultured in the presence of control or 5 ⁇ g/ml PRO-001 for up to 12 days. The medium, aFGF/heparin and drug were replenished every 3 days.
  • Xenograft mouse model FDCP-FGFR3 S249C cells were washed 3 times in PBS then resuspended at 2x 10 6 cells/200 ⁇ l PBS.
  • the cells were injected subcutaneously (S. C.) to CDl nude adult females (Harlan, Laboratories, Israel) with a 25 G needle at one or both mouse flanks.
  • Treatment was initiated one week post cell inoculation at which time mice were randomized to receive PRO-OOl or an equal volume of PBS alone. Dosing was preformed twice weekly by intraperitoneal (LP.) injection for 3 weeks. Mice were followed every 2-4 days and developing tumors were measured at 3 dimensions using a caliper. Tumor volume was estimated by multiplying these 3 values.
  • RPO-OO lSer scFv was diluted 5 times in PBS to 1 mg/ml and was oxidized at room temperature with 10 fold excess periodate over 10 minutes. The reaction was terminated by the addition of 10 fold excess diaminopropanol over the oxidizing agent for a further 15 minutes. The oxidized material was dialyzed 2 hours at room temperature against PBS then the pH was lowered by further dialysis at room temperature against 50 mM NaOAc pH 5.3. mPEG-HZ-5K and mPEG-HZ-20K (purchased from IDB) were dissolved in acetate pH 5.3 and added to oxidized PRO59scSer at 10 and 2.5 fold molar excess, respectively. mPEG-HZ-40K (purchased from Nektar), dissolved in water was added 1.3 equivalents to the oxidized single chain. The reaction products were analyzed 24 hours later by coomassie stained SDS-PAGE.
  • Example 1 Blocking activity of PRO-001 and selectivity for FGFR3
  • the human anti-FGFR3 Fab PRO-001 was isolated from the Hu-CAL®-Fab-1 human combinatorial library using a differential whole cell panning approach (Rauchenberger R, et al. J Biol Chem. 2003;278:38194-205). FACS analysis revealed that PRO-001 Fab binds to WT FGFR3 and that binding to B9-FGFR3 WT cells can be reduced by addition of FGF, supporting the notion that PRO-001 and FGF share a common epitope (Figure IA).
  • Figure IB shows that PRO-001 inhibits growth of FGF stimulated B9-FGFR3 WT cells. The growth inhibition is dose dependent. One microgram antibody per millilitre (1 ⁇ g/ml) inhibits growth by about 25% while 5 ⁇ g/ml antibody inhibits growth by more than 60%.
  • PRO-001 also inhibits the FGF-stimulated growth of B9 cells expressing the FGFR3 mutant F384L (a non-transforming polymorph of FGFR3), as well as the FGF- stimulated growth of cells expressing G394D and Y373C-FGFR3 (constitutively activated FGFR3 mutants identified in MM patients) in a dose-dependent inanner with an IC 5 O of approximately 3 ⁇ g/ml consistent with its ability to inhibit FGF binding.
  • F384L a non-transforming polymorph of FGFR3
  • FDCP-I Cell growth of FDCP-I is normally dependent on the presence of IL-3.
  • IL-3 can be substituted by FGF ligand in cells expressing the cognate RTK.
  • FGF stimulated proliferation of FDCP-FGFR3 cells was potently inhibited by PRO-001, with IC 50 (concentration that inhibits 50% of the cells) of 0.5 ⁇ g/ml ( Figure ID).
  • IC 50 concentration that inhibits 50% of the cells
  • PRO-001 is a highly specific and potent inhibitor of FGFR3.
  • PRO-001 was tested against t (4; 14) myeloma cell lines expressing FGFR3: UTMC2 cells - expressing WT FGFR3, and H929 cells - expressing WT FGFR3 but harboring a downstream activating mutation of N-Ras.
  • Cell growth in the presence of FGF and PRO- 001 (5 ⁇ g/ml), control antibody (isotype) or 100 nM PD 173074 was determined by MTT assay. Proliferation of FGF-stimulated UTMC2 cells was significantly inhibited by PRO- 001 ( Figure 2).
  • PRO-001 Inhibition of FGF-stimulated growth of UT1VEC2 by PRO-001 was comparable to that induced by PD 173074 (An ATP analog which binds and inhibits the kinase domain).
  • PD 173074 An ATP analog which binds and inhibits the kinase domain.
  • 8226 cells, which lack FGFR3 expression and H929 cells were resistant to both PRO-001 and PD 173074, indicating that both reagents act upstream of Ras and target selectively FGFR3.
  • PRO-001 failed to inhibit the viability of KMSl 1 (FGFR3-Y373C) and KMS18 (FGFR3- G384D), cells that express mutant FGFR3 and grow independent of FGF.
  • Figure 3 shows the inhibition of Extracellular signal-regulated protein kinase (ERK) 1/2 phosphorylation upon incubation of aFGF-stimulated UTMC2 cells with the anti- FGFR3 antibody of the present invention, as detected by flow cytometry.
  • the levels of phosphorylated ERK return to those of unstimulated cells upon incubation with the anti- FGFR3 antibody of the invention.
  • Example 4 IL-6 and IGF-I do not Confer Resistance to Anti-FGFR3
  • Figure 4 shows viability of cells stimulated with FGF9 (30ng/ml), IL6 (50ng/ml), or IGF-I (50ng/ml), and treated with the anti-FGFR3 antibody.
  • IL6 and IGF-I stimulate the myeloma cells, which remain sensitive to treatment with the anti-FGFR3 antibody.
  • Example 5 Anti-FGFR3 Induces Apoptosis of UTMC2 cells Co-cultured with Bone Marrow Stroma Cells
  • Anti-FGFR3 induces a high level of apoptosis of the UTMC2 cells when co cultured with bone marrow stroma cells, BMSC, thus mimicking the milieu of the myeloma cells (Figure 5).
  • the antibody had no direct toxicity on the BMSC.
  • FDCP-FGFRS 82490 an animal model comprising nude mice injected with FDCP cells that express the constitutive mutant FGFR3 S249C (FDCP-FGFRS 82490 ).
  • FDCP-FGFR3 S249C proliferate in the absence of IL-3 and FGF and rapidly (within 2-3 weeks) form tumors upon injection to nude mice.
  • PRO-OOl efficiently blocked FGF-independent proliferation of FDCP- FGFR3 S249C in vitro (Fig. 8A).
  • mice were injected subcutaneously at 2 locations; one on each flank, with 2x10 FDCP-FGFR3 S249C cells each.
  • One week post cell injection mice were treated with PRO- 001 Fab.
  • mice received a relatively high dose of about lmg Fab per mouse in order to saturate FGFR3. This was followed by slightly reduced doses during the following 12 days of Fab delivery (Table II). Mice were treated every 3 days on average, as we found no significant difference in efficacy of this schedule in comparison to daily injections (not shown).
  • PRO-OOl dramatically reduced tumor growth to 10% in average of that in the control mice (Fig. 8B). No major toxicities or significant weight loss was observed over the treatment period.
  • the present invention is exemplified by certain animal disease models. These models are intended as a non-limitative example used for illustrative purposes of the principles of the present invention.
  • a PEG moiety was appended at the amino-terminus of the single chain antibody of the invention (PRO-001 scFv) through a serine residue.
  • a scFv (SEQ ID No: 37) was generated having the amino acid serine at position 2 to allow PEGylation.
  • PRO-001 scFv with a serine at the N-terminus was generated by PCR and confirmed by sequencing as previously describe (WO 02/102972). Briefly, the inclusion bodies were washed in PBS, PBS+0.1% triton, and 3M urea. The washed pellet was dissolved in PBS+5M urea, GSH/GSSG (0.5 mM each) redox potential was added and then gradually dialyzed against urea step gradient. The binding activity of the refolded PRO-OO lser scFv to FGFR3 was compared by ELISA showing similar activity as the parental single chain (Fig. 9).
  • PRO-001 was added at increasing levels to FDCP-FGFR3 or FDCP-FGFRl cells and cell proliferation was measured.
  • PRO-001 PEGylated with mPEG-HZ-5K retained full FGFR3 neutralizing activity (Fig. 11). Conjugation to mPEG-HZ-20K reduced the antibody activity by 5 fold and to mPEG-HZ-40K by approximately 40 fold.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

The present invention generally relates to a pharmaceutical composition and to an improved method of preventing, attenuating and treating multiple myeloma (MM) by administering to an individual in need thereof at least one antibody to fibroblast growth factor receptor 3 (FGFR3). In particular, the at least one FGR3 antibody induces apoptosis of myeloma cells expressing wild type FGFR3.

Description

TREATMENT OF B-CELL MALIGNANCIES
FIELD OF THE INVENTION The present invention relates to a pharmaceutical composition and a method of preventing, attenuating and treating B-cell malignancies, in particular multiple myeloma (MM), by administering to an individual in need thereof at least one antibody to fibroblast growth factor receptor 3 (FGFR3). In particular, the at least one FGFR3 antibody induces apoptosis of myeloma cells expressing wild type FGFR3.
BACKGROUND OF THE INVENTION Fibroblast Growth Factors
Fibroblast Growth Factors (FGFs) constitute a family of over twenty structurally related polypeptides that are developmentally regulated and expressed in a wide variety of tissues. FGFs stimulate proliferation, cell migration and differentiation and play a major role in skeletal and limb development, wound healing, tissue repair, hematopoiesis, angiogenesis, and tumorigenesis (reviewed in Oraitz and Itoh, Genome Biology 2001, 2 (3): reviews 3005.1-3005.12).
The biological action of FGFs is mediated by specific cell surface receptors belonging to the receptor protein tyrosine kinase (RPTK) family of protein kinases. These proteins consist of an extracellular ligand binding domain, a single transmembrane domain and an intracellular tyrosine kinase domain that undergoes phosphorylation upon binding of FGF. The FGF receptor (FGFR) extracellular region contains three immunoglobulin-like (Ig-like) loops or domains (Dl, D2 and D3), an acidic box, and a heparin-binding domain. Four FGFR genes encoding for multiple receptor variants have been identified to date.
B-cell Associated Malignancies
B cell neoplasms include precursor B-lymphoblastic leukemia/lymphoma (precursor B- cell acute lymphoblastic leukemia), B-cell chronic lymphocytic leukemia/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, Lymphoplasmacytic lymphoma, Splenic marginal zone B-cell lymphoma, Hairy cell leukemia, Plasma cell myeloma/plasmacytoma, Extranodal marginal zone B-cell lymphoma of MALT type, Nodal marginal zone B-cell lymphoma , Follicular lymphoma, Mantle-cell lymphoma Diffuse large B-cell lymphoma, Monocytoid B-cell lymphoma and Multiple myeloma.
Multiple Myeloma
Multiple myeloma (MM) is a fatal hematopoietic malignancy of plasma cells. Plasma cells that undergo IgH switch recombination typically home to the bone marrow, where they reside. Interaction with bone marrow stroma leads to proliferation of malignant plasma cells and tumor formation. Progression of intramedullary myeloma is associated with increasingly severe secondary features that include lytic bone disease and osteoporosis, hypercalcemia, anemia, immunodeficiency and renal impairment. Multiple myeloma is the second most prevalent blood cancer after non-Hodgkin's lymphoma. It represents approximately 1% of all cancers and 2% of all cancer deaths. Although the peak age of onset of multiple myeloma is 65 to 70 years of age, recent statistics indicate both increasing incidence and earlier age of onset.
For decades, MM treatment has been based on cytotoxic chemotherapy, primarly standard-dose oral melphalan combined with prednisone. . High-dose melphalan therapy combined with autologous bone marrow transplantation to reduce myelotoxicity (Child et al. (2003) NEJM 348; 19 1875-1883) has also been evaluated and results in a modest increase in overall survival over standard dose chemotherapy.
Several genetic determinants have been shown to be responsible for the onset and progression of MM. Approximately 15%-20% of the MM cases are associated with a chromosomal translocation, t(4;14)(pl6.3;q32), that deregulates the expression of MMSET from der (4) and FGFR3 from der(14). In particular, wild type FGFR3 becomes ectopically expressed at very high levels and induces proliferative signals in myeloma cells. This translocation has been shown to be a primary event in MM and in some cases activating mutations of FGFR3 are acquired as the disease progresses.. Recent studies demonstrate that patients with t(4;14) have a particularly poor prognosis.
FGFR3 has been validated by in vitro and in vivo animal studies as a therapeutic target for MM. In principle, an ideal FGFR3 inhibitor useful for the treatment of MM will exhibit the following properties: Recognize FGFR3 and be able to inhibit the activated forms of wild type and mutated FGFR3. FGFR3 specific, i.e. does not inhibit other FGFR or tyrosine kinase proteins. Biocompatible; i.e. non-immunogenic and non-toxic to the patient. Long half-life in blood stream.
International patent application publication WO 02/102973, co-assigned to some of the assignees of the present invention, discloses antibodies to receptor tyrosine kinases, specifically anti-Fibroblast Growth Factor Receptor 3 (FGFR3) antibodies. Certain antibodies shown to be specific for FGFR3 neutralize FGFR3 activity and are useful for treating skeletal dysplasias such as achondroplasia and proliferative diseases such as bladder cancer. That disclosure notes a list of proliferative diseases in which FGF receptors are known to be involved including inter alia multiple myeloma.
International patent application publication WO 03/004056 teaches a method of treating multiple myeloma using a Kl 21 -like antibody that induces apoptosis in myeloma cells.
PEGylation has been employed to modify antibodies, both single chain and monoclonal to achieve greater solubility and longer circulating life in vivo. PEG (40,000) was conjugated to the mabs, Nl 2 and L26, specific to the ErbB2 (HER2) oncoprotein (Hurwitz et al. (2000) Cancer Immunol. Immunother. 49 226-234). Koumenis et al. (Int. J. Pharmaceut. 198 83-95 (2000)) also achieved an increase in the circulation half life of the F(ab')2 form of a humanized anti IL-8 by PEG conjugation.
Traditional methods of treating B-cell malignancies, including chemotherapy and radiotherapy, have limited utility due to toxic side effects. The use of monoclonal antibodies restricts their toxicity to cells expressing the target antigen. The art has not yet identified an effective anti-FGFR3 antibody for the prevention or treatment of multiple myeloma.
Citation of any document herein is not intended as an admission that such document is pertinent prior art, or considered material to the patentability of any claim of the present application. SUMMARY OF THE INVENTION
The present invention provides for the first time a highly effective therapeutic agent for the treatment of B-cell malignancies, including multiple myeloma. Multiple myeloma is incurable and conventional therapy results in complete remission in only 5% of patients with overall median survival only about 36 months. It is now disclosed that a human recombinant antibody specific to a dimeric FGFR3 extracellular domain is highly effective in preventing, attenuating or treating certain subtypes of multiple myeloma.
In one aspect the present invention relates to a method for the prevention, attenuation or treatment of multiple myeloma comprising administering a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, the myeloma cell expressing FGFR3 and a pharmaceutically acceptable carrier to a subject in need thereof.
Another aspect relates to the use of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, the myeloma cell expressing FGFR3, for the manufacture of a medicament for the treatment of multiple myeloma.
Another aspect of the present invention relates to a pharmaceutical composition for the prevention, attenuation or treatment of a B-cell malignancy comprising as an active ingredient a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for
FGFR3.
Some of the molecules and compositions thereof described herein have been disclosed in International patent application WO 02/102972, the teachings of which are incorporated by reference as if fully set forth herein, co-assigned to some of the applicants of the present invention. These compositions were disclosed previously as being useful for treating skeletal dysplasias and proliferative diseases. The molecules were shown to be effective in inhibiting both the wild type and constitutively activated forms of FGFR3. WO 02/102972 is a disclosure that does not anticipate the present claims for specific compounds useful for treating a specific indication. It is now disclosed that certain of said known compositions are especially effective in treating and attenuating multiple myeloma. According to one embodiment of the present invention the molecule that comprises the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3), is selected from a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a single domain antibody, a recombinant antibody and fragments thereof. A preferred antibody species is a recombinant antibody. A more preferred antibody species is selected from a recombinant single chain antibody and a recombinant Fab antibody. Single chain antibodies can be single chain composite polypeptides having antigen binding capabilities and comprising amino acid sequences homologous or analogous to the variable regions of an immunoglobulin light and heavy chain i.e. linked VH-VL or single chain Fv (scFv).
In certain embodiments the present invention provides a method of preventing, attenuating or treating multiple myeloma comprising administering a pharmaceutical composition comprising a molecule comprising the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3), the molecule comprising a VH-CDR3 region having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 1-9 and a VL-CDR3 region having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 10-18, and a pharmaceutically acceptable carrier. The corresponding polynucleotide sequences of the VH-CDR3 and VL-CDR3 regions are set forth in SEQ ID NOS: 39-47 and SEQ ID NOS: 48-56, respectively. These sequences have been disclosed in WO 02/102972, assigned to some of the assignees of the present invention.
According to one preferred embodiment the molecule comprising the antigen-binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3) comprises a VH-CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 1 and a VL-CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 10, and a pharmaceutically acceptable carrier. The corresponding polynucleotide sequences of the VH-CDR3 and VL-CDR3 regions are set forth in SEQ ID NO: 39 and SEQ ID NO: 48, respectively.
Another preferred embodiment of the present invention is a pharmaceutical composition for the prevention, attenuation or treatment of multiple myeloma comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3) comprising a VH-CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 1 and a VL-CDR3 region having a polypeptide sequence as set forth in SEQ ID NO: 10, and a pharmaceutically acceptable carrier (designated as PRO-OOl).
According to various additional embodiments the present invention provides a method of preventing, attenuating or treating a multiple myeloma comprising administering a composition comprising a therapeutically effective molecule comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3, the molecule comprising a VH domain having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 19-27 and the VL domains having a polypeptide sequence as set forth in anyone of SEQ ID NOS: 28-36, and a pharmaceutically acceptable carrier. The corresponding polynucleotide sequences of the VH and VL domains are set forth in SEQ ID NOS: 57-65 and SEQ ID NOS: 66-74, respectively.
According to certain preferred embodiments the molecule comprising the antigen- binding portion of an antibody having specificity and affinity for fibroblast growth factor receptor 3 comprises a VH domain having a polypeptide sequence as set forth in SEQ ID NO: 19 and the VL domain having a polypeptide sequence as set forth in SEQ ID NO: 28, and a pharmaceutically acceptable carrier. The corresponding polynucleotide sequences of the VH and VL domains are set forth in SEQ ID NO: 57 and SEQ ID NO: 66, respectively.
In yet another preferred embodiment the pharmaceutical composition comprises a single chain Fv molecule (scFv) having a polypeptide sequence set forth in SEQ ID NO: 37 having corresponding polynucleotide sequence SEQ ID NO: 38, and a pharmaceutically acceptable carrier.
The present invention also provides pharmaceutical compositions comprising one or more PEGylated antibodies and fragments thereof which immunospecifically bind to FGFR3. Wherein the PEGylated antibodies and fragments thereof retain the biological activity of the native molecules as determined by their ability to bind and neutralize FGFR3.
In one embodiment, a pharmaceutical composition of the invention comprises a PEGylated single chain Fv molecule (scFv) having a polypeptide sequence set forth in SEQ ID NO: 37 wherein leucine, the original amino acid at the N-terminus is replaced with serine to allow targeted PEGylation. In certain embodiments the affinity of the molecule comprising an antigen binding domain of an antibody is measured by methods known in the art including binding assays and BIAcore (biomolecular interaction analyzing system). According to certain embodiments, affinity of the antigen binding domain of an antibody is less than about 30 nM as measured in a BIAcore reactor, preferably less than about 15 nm and more preferably less than about 5 nm.
In another embodiment the pharmaceutical composition of the present invention is administered to the patient in combination with another therapeutic agent. Such other therapeutic agent may be an antibody or a chemotherapeutic agent. Chemotherapeutic agents are commonly used in the treatment of multiple myeloma and may include (but are not limited to) melphalan, doxorubicin, carmustine, cyclophosphamide, thalidomide, bortezomib and lenalidomide.
BRIEF DESCRIPTION OF THE FIGURES Figure IA is a flow cytometry chart showing B9-FGFR WT (wild type) cells fluorescently labeled with PRO 001 followed by a PE-conjugated anti-human secondary antibody. The filled histogram indicates parental B9 cells (lacking FGFR3 expression); the dotted light line, B9-FGFR WT without aFGF; the solid dark line, B9-WT in the presence of aFGF. The Y axis represents counts indicating the amount of cells. The X axis represents fluorescence intensity.
Figure IB is a graph showing viability of B9-FGFR WT cells treated with different concentrations of PRO-001. The filled bars represent the control (no PRO-OOl). The dotted bars represent PRO-001 treated cells.
Figure 1C is a photograph of a Western blot showing immune staining of RCJ-FGFR3 cell lysates. RCJ cells were stimulated with FGF (+) with or without pre-incubation with a Fab. Lane 1 - no FGF stimulation and no pre-incubation with a Fab. Lane 2 - FGF stimulation, no pre-incubation with a Fab. Lane 3 - FGF stimulation and pre incubation with a control (C) antibody. Lane 4 - FGF stimulation and pre-incubation with an anti- FGFR3 (001) Fab. The mid panel (Phospho-JNK) shows total cell lysates probed with anti- Phospho-JNK antibodies. The upper panel (Phospho-FGFR3) shows cell lysates immunoprecipitated (IP) with anti-FGFR3 antibody and then analyzed by Western blot with anti-phosphotyrosine (4G10). The lower panel (FGFR3) shows cell lysates immunoprecipitated (IP) with anti-FGFR3 antibody and then analyzed by Western blot with anti-FGFR3.
Figure ID is a graph showing proliferation of FGFR expressing FDCP cells in the presence of increasing concentrations of PRO-OOl as determined by XTT analysis. Data are the average of duplicate cultures. The X axis represents concentration of PRO-OOl Fab. The Y axis represents % inhibition.
Figure 2 is a graph showing the viability of human myeloma cell lines in the presence of PRO-OOl. Viability is reported as the ratio between the optical density (OD) in the presence of FGF + inhibitor and the OD in the absence of FGF. Figure 3 is a flow cytometry chart showing phosphorylation of ERK (Extracellular signal-regulated protein kinase) in UTMC2 cells. The filled histogram represents UTMC2 without FGF stimulation (unstimulated); the light line represents cells stimulated with FGF and treated with a control antibody (FGF/vehicle); the dark line represents cells stimulated with FGF and treated with PRO-OOl (FGF/PRO-001). Figure 4 is a graph showing viability of UTMC2 cells treated with FGF, IL6 or IGF-I. The dark bars represent stimulated cells treated with a control antibody; the dotted bar represents stimulated cells treated with 5μg/ml PRO-OOl; the square-filled bar represents stimulated cells treated with 10OnM PD 173074.
Figure 5 is a graph showing apoptosis of UTMC2 cells in response to treatment with PRO-OOl in the presence of BMSCs (stroma). BMSCs alone (stroma) or BMSCs together with UTMC2 cells (stroma/UTMC2) were cultured with control antibody or 5 μg/ml PRO- 001 for 72 hours and apoptosis was assessed by means of a flow cytometry assay of annexin V binding and propidium iodide exclusion. Values represent means of quadruplicate cultures + SD. Figures 6 A-B are flow cytometry charts of human primary myeloma cells treated with anti-FGFR antibody PRO-OOl. A: Freshly isolated BMSCs were stained with PRO-OOl (black line) or control antibody (grey line) and then stained with PE-conjugated anti-human secondary antibody. B: Primary myeloma cells were incubated in the absence (filled) or presence of FGF (light line) or pre-incubated with 5 μg/ml PRO-OOl (dark line) for 2 h and then stimulated with FGF. ERKl/2 phosphorylation was assessed by flow cytometry analysis. Figure 7 is a flow cytometry chart showing CD 138 positive primary MM cells stained with Annexin V. Primary myeloma cells were cultured in the presence of control Fab (lower panel) or 5μg/ml PRO-001 (upper panel). Cells were harvested after 7 days, stained with annexin V-FITC and analyzed by flow cytometry. Myeloma cells were identified as CD138++. The total percentage of CD138++ cells is shown in the upper left quadrant. Shown is a representative experiment.
Figure 8A is a graph showing viability of FDCP-FGFR3S249C. Cells were cultured in the presence of increasing amounts of PRO-001 or a control antibody (C) for two days. Cell proliferation was determined by XTT analysis. Data are the average of duplicate cultures. Figure 8B is a graph showing the effect of PRO-001 on an FGFR3-driven xenograft tumor model. Nude mice (3 in each group), were injected S.C. at 2 locations, one on each flank (α - right flank, b- left flank), with 2x106 FDCP-FGFR3S249C cells each. A week later, mice were randomized to receive PRO-001 by LP. injection according to the schedule described in Table I or PBS as control. Tumor volume was estimated from measurements in 3 dimensions at 22 or 29 days post cell injection.
Figure 9 is a graph showing FGFR3 binding activity of PRO-OO lSer scFv. A MaxiSorp plate was coated with the indicated amount of single chain. Soluble FGFR3/Fc was added and bound receptor was measured with HRP-anti-Fc.
Figure 10 is a photograph of a coomassie stained SDS-PAGE showing specific FGFR3 binding of mPEG-HZ5K, mPEG-HZ20K and mPEG-HZ40K conjugated PRO-OO 1 Ser. The PEGylation reaction mix (P) was incubated with FGFR3/Fc or FGFRl/Fc-protein A- sepharose beads. The unbound material was collected and incubated consecutively 2 more times with fresh beads. The bound fractions (Bl, B2 and B3) as well as the unbound material (U2) from the last binding cycle were analyzed by coomassie stained SDS-PAGE. U - unmodified single chain.
Figure 11 is a graph showing FGFR3 neutralizing activity of PRO-OOl-PEG conjugates. PRO-001 Ser PEGylated with mPEG-HZ-5K, mPEG-HZ-20K or mPEG-HZ- 4OK were analyzed by XTT using FDCP-FGFR3 cells or FDCP-FGFRl cells as control. DETAILED DESCRIPTION OF THE INVENTION
The present invention is based on the discovery that an antibody having specificity and affinity for fibroblast growth factor receptor 3 (FGFR3) induces apoptosis of myeloma cells, in vitro and in vivo.
The present invention relates to a method of treating a B-cell malignancy comprising administering a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, and a pharmaceutically acceptable carrier to a subject in need thereof. In one preferred embodiment the B-cell malignancy is multiple myeloma.
The present invention further relates to the use of at least one anti-FGFR3 antibody for the manufacture of a medicament for the prevention, attenuation or treatment of a B-cell malignancy, preferably multiple myeloma.
Without wishing to be bound to any particular theory, the anti-FGFR3 antibody may interfere with adhesion between the stroma and the myeloma cell. This interaction is crucial for growth of the myeloma plasma cells and disease progression and results in local manifestations such as lytic bone disease and systemic manifestations such as immunocompromise and anemia.
International patent application WO 02/102972, co-assigned to some of the assignees of the present invention, discloses monoclonal antibodies to receptor protein tyrosine kinases, including specific anti-Fibroblast Growth Factor Receptor 3 (FGFR3) antibodies. Utilizing a soluble dimeric form of the extracellular domain of the FGFR3 receptor to screen for antibodies (e.g., Fabs) from a phage display antibody library yielded numerous high affinity (KD < 50 nM) antibodies (Fabs) that bind FGFR3 and interfere with ligand binding, thereby blocking ligand-dependent activation of FGFR3. Certain antibodies were shown to be specific for FGFR3 and useful to neutralize FGFR3 activity and for the treatment of skeletal dysplasias such as achondroplasia and proliferative diseases such as bladder cancer. Additional antibodies useful for blocking ligand-independent, or constitutive, activation were also identified and isolated.
The present inventors have now discovered that certain molecules disclosed in that application are highly effective in inducing apoptosis in FGFR3 expressing myeloma cells, in particular myeloma cells situated in the bone marrow stroma of a multiple myeloma patient. These molecules are now disclosed for the prevention, attenuation and treatment of multiple myeloma.
For convenience certain terms employed in the specification, examples and claims are described herein. The term "fibroblast growth factor receptor" or "FGFR" denotes a receptor specific for FGF which is necessary for transducing the signal exerted by FGF to the cell interior, typically comprising an extracellular ligand-binding domain, a single transmembrane helix, and a cytoplasmic domain having tyrosine kinase activity. The FGFR extracellular domain consists of three immunoglobulin-like (Ig-like) domains (Dl, D2 and D3), a heparin binding domain and an acidic box. Four FGFR genes that encode for multiple receptor protein variants are known. Alternative splicing of the FGFR3 mRNAs generates at least two known isoforms of the receptors, FGFR3IIIc and FGFR3IIIb.
Throughout the specification and the claims that follow, the term "FGFR3 specific" refers to any effector that has higher affinity or activity or binding to FGFR3 polypeptide or to the polynucleotide encoding same, than to another FGF receptor protein or polynucleotide. The effector can be any molecule including a ligand, an inhibitor, an antibody, a polypeptide, a polynucleotide or a small organic molecule such as a tyrosine kinase inhibitor. It is to be explicitly understood that the term "FGFR3 specific" does not exclude or preclude situations wherein the effector has some activity on another FGF receptor subtype. It is further to be understood that if the activity mediated via another receptor subtype is clinically important for the therapeutic utility observed, this is explicitly encompassed within the scope of the claimed invention.
As used herein, "affinity" refers to the strength of the reaction of a single antigen- combining site with a monovalent antigenic determinant. Affinity is measured as the binding constant. Specificity of an antibody is the property of an antibody which enables it to react with some antigenic determinants and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.
As used herein "multiple myeloma" also known as plasma cell myeloma refers to the proliferative hematologic disease of the plasma cell. Multiple myeloma is characterized by excessive numbers of abnormal plasma cells in the bone marrow and overproduction of intact monoclonal immunoglobulin (IgG, IgA, IgD, or IgE) or Bence- Jones protein. Hypercalcemia, anemia, renal damage, increased susceptibility to bacterial infection, and impaired production of normal immunoglobulin are common clinical manifestations of multiple myeloma. It is often also characterized by diffuse osteoporosis and lytic bone lesions predominantly of the axial skeleton.
As used herein "stroma" refers to the cells and the supporting tissue around the myeloma cells in the bone marrow. Adhesion of the myeloma cells to the bone marrow enhances the growth of myeloma. One aspect of the present invention is directed to a method of preventing, attenuating or treating multiple myeloma by administering a molecule comprising the antigen-binding portion of an antibody which diminishes or inhibits activation of FGFR3, and a pharmaceutically acceptable carrier. According to one embodiment of the present invention the antigen-binding portion of an antibody is directed to the extracellular domain of the FGFR3.
One embodiment of the present invention is directed to molecules comprising an antigen binding domain which blocks ligand-dependent activation of FGFR3.
The molecule having the antigen-binding portion of an antibody according to the present invention is useful for blocking the ligand-dependent activation and/or ligand independent (constitutive) activation of FGFR3. Preferred embodiments of such antibodies/molecules, obtained from an antibody library designated as HuCAL® (Human Combinatorial Antibody Library) clone, are presented in Table 1 with the unique VH-CDR3 and VL-CDR3 sequences presented in Table 2. Table 1 : Properties of antibodies useful for inhibiting, treating or attenuating multiple myeloma.
Figure imgf000014_0001
Key: affinity (nM) of the respective molecules to FGFR3 and FGFRl was measured by BIAcore and/or FACS. IC50 were determined for the dimeric dHLX format of certain molecule with antigen binding site in an FDCP-FGFR3 proliferation assay performed with FGF9. Fab-dHLX refers to a Fab mini-antibody format where a dimer of the Fab monomer is produced as a fusion protein after insertion into an expression vector. The values obtained by BIAcore demonstrated that the interactions between antibody and receptor are specific.
Table 2: VH-CDR3 and corresponding VL-CDR3 polypeptide sequences
Figure imgf000015_0001
VH refers to the variable heavy chain, VL refers to the variable light chain, CDR3 refers to complementarity determining region 3. In certain preferred embodiments the present invention provides a method of treating or preventing multiple myeloma comprising administering a composition comprising a therapeutically effective molecule comprising a VH-CDR3 region having a polypeptide sequence as set forth in any one of SEQ ID NOS: 1- 9 and a corresponding VL-CDR3 region having a polypeptide sequence as set forth in any one of SEQ ID NOS: 10-18, and a pharmaceutically acceptable carrier. The corresponding polynucleotide sequences of the VH-CDR3 and VL-CDR3 regions as set forth in any one of SEQ ID NOS: 39-47 and SEQ ID NOS: 48-56, respectively. The polynucleotide sequences are presented in Table 3.
According to certain embodiments the present invention provides a method of treating or preventing multiple myeloma comprising administering a composition conrprising a therapeutically effective molecule comprising a VH domain having a polypeptide sequence as set forth in any one of SEQ ID NOS: 19-27 and the corresponding VL domains having a polypeptide sequence as set forth in any one of SEQ ID NOS: 28-36, and a pharmaceutically acceptable carrier. The preferred VH and VL sequences are presented herein. PRO-OOl-VH (SEQ ID NO: 19)
1 QVQLQQSGPG LVKPSQTLSL TCAISGDSVS SNSAAWNWIR QSPGRGLEWL 51 GRTYYRSKWY NDYAVSVKSR ITINPDTSKN QFSLQLNSVT PEDTAVYYCA 101 RSYYPDFDYW GQGTLVTVSS
PRO-002-VH (SEQ ID NO: 20)
1 QVQLVQSGAE VKKPGASVKV SCKASGYTFT SYYMHWVRQA PGQGLEWMGW 51 INPNSGGTNY AQKFQGRVTM TRDTSISTAY MELSSLRSED TAVYYCARDF 101 LGYEFDYWGQ GTLVTVSS
PRO-012-VH (SEQ ID NO: 21)
1 QVQLKESGPA LVKPTQTLTL TCTFSGFSLS TSGVGVGWIR QPPGKALEWL 51 ALIDWDDDKY YSTSLKTRLT ISKDTSKNQV VLTMTNMDPV DTATYYCARY 101 HSWYEMGYYG STVGYMFDYW GQGTLVTVSS
PRO-021-VH (SEQ ID NO: 22)
1 QVQLVQSGAE VKKPGSSVKV SCKASGGTFS SYAISWVRQA PGQGLEWMGG 51 IIPIFGTANY AQKFQGRVTI TADESTSTAY MELSSLRSED TAVYYCARDN 101 WFKPFSDVWG QGTLVTVSS
PRO- 024 -VH (SEQ ID NO: 23)
1 QVQLVQSGAE VKKPGSSVKV SCKASGGTFS SYAISWVRQA PGQGLEWMGG 51 IIPIFGTANY AQKFQGRVTI TADESTSTAY MELSSLRSED TAVYYCARVN 101 HWTYTFDYWG QGTLVTVSS
PRO-026-VH (SEQ ID NO: 24)
1 QVQLVQSGAE VKKPGAS VKV S CKASGYTFT SYYMHWVRQA PGQGLEWMGW 51 INPNSGGTNY AQKFQGRVTM TRDTS I STAY MELSSLRSED TAVYYCARGY 101 WYAYFTYINY GYFDNWGQGT LVTVSS
PRO-029-VH (SEQ ID NO: 25)
1 QVQLVQSGAE VKKPGASVKV SCKASGYTFT SYYMHWVRQA PGQGLEWMGW 51 INPNSGGTNY AQKFQGRVTM TRDTSISTAY MELSSLRSED TAVYYCARTW 101 QYSYFYYLDG GYYFDIWGQG TLVTVSS
PRO-054-VH (SEQ ID NO: 26)
1 QVQLVQSGAE VKKPGASVKV SCKASGYTFT SYYMHWVRQA PGQGLEWMGW
51 INPNSGGTNY AQKFQGRVTM TRDTSISTAY MELSSLRSED TAVYYCARNM
101 AYTNYQYVNM PHFDYWGQGT LVTVSS
PRO-055-VH (SEQ ID NO: 27)
1 QVQLVQSGAE VKKPGASVKV SCKASGYTFT SYYMHWVRQA PGQGLEWMGW 51 INPNSGGTNY AQKFQGRVTM TRDTSISTAY MELSSLRSED TAVYYCARSM 101 NSTMYWYLRR VLFDHWGQGT LVTVSS
PRO-OOl-VL (SEQ ID NO: 28)
1 DIELTQPPSV SVAPGQTARI SCSGDALGDK YASWYQQKPG QAPVLVIYDD 51 SDRPSGIPER FSGSNSGNTA TLTISGTQAE DEADYYCQSY DGPDLWVFGG 101 GTKLTVLGQ
PRO-002-VL (SEQ ID NO: 29)
1 DIELTQPPSV SVAPGQTARI SCSGDALGDK YASWYQQKPG QAPVLVIYDD
51 SDRPSGIPER FSGSNSGNTA TLTISGTQAE DEADYYCQSY DYSADYVFGG 101 GTKLTVLGQ PRO- 012 -VL ( SEQ ID NO : 30 )
1 DIELTQPPSV SVAPGQTARI SCSGDALGDK YASWYQQKPG QAPVLVIYDD 51 SDRPSGIPER FSGSNSGNTA TLTISGTQAE DΞADYYCQSY DFDFAVFGGG 101 TKLTVLGQ
PRO- 021-VL ( SEQ ID NO : 31 )
1 DIVMTQSPDS LAVSLGERAT INCRSSQSVL YSSNNKNYLA WYQQKPGQPP 51 KLLIYWASTR ESGVPDRFSG SGSGTDFTLT ISSLQAEDVA VYYCQQYDSI 101 PYTFGQGTKV EIKRT
PRO- 024 -VL ( SEQ ID NO : 32 )
1 DIVLTQSPAT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY 51 GASSRATGVP ARFSGSGSGT DFTLTISSLΞ PEDFATYYCQ QMSNYPDTFG 101 QGTKVEIKRT
MS - Pro- 26 -VL ( SEQ ID NO : 33 )
1 DIALTQPASV SGSPGQSITI SCTGTSSDVG GYNYVSWYQQ HPGKAPKLMI 51 YDVSNRPSGV SNRFSGSKSG NTASLTISGL QAEDEADYYC QSYDNNSDW 101 FGGGTKLTVL GQ
PRO- 029 -VL ( SEQ ID NO : 34 )
1 DIVLTQSPAT LSLSPGERAT LSCRASQSVS SSYLAWYQQK PGQAPRLLIY 51 GASSRATGVP ARFSGSGSGT DFTLTISSLΞ PEDFATYYCQ QTNNAPVTFG 101 QGTKVEIKRT
PRO- 054 -VL ( SEQ ID NO : 35 )
1 DIELTQPPSV SVAPGQTARI SCSGDALGDK YASWYQQKPG QAPVLVIYDD 51 SDRPSGIPER FSGSNSGNTA TLTISGTQAE DEADYYCQSY DYFKLVFGGG 101 TKLTVLGQ
PRO- 055 -VL ( SEQ ID NO : 36 )
1 DIALTQPASV SGSPGQSITI SCTGTSSDVG GYNYVSWYQQ HPGKAPKLMI 51 YDVSNRPSGV SNRFSGSKSG NTASLTISGL QAEDEADYYC QSYDMYNYIV 101 FGGGTKLTVL GQ
The corresponding polynucleotide sequences of the VH and VL domains have SEQ ID NOS: 57-65 and SEQ ID NOS: 66-74, respectively.
<SEQ ID NO:57;DNA> PRO-001 VH
CAGGTGCAATTGCAACAGTCTGGTCCGGGCCTGGTGAAACCGAGCCAAACCCTGAGCCTGACCTGT GCGATTTCCGGAGATAGCGTGAGCAGCAACAGCGCGGCGTGGAACTGGATTCGCCAGTCTCCTGGG CGTGGCCTCGAGTGGCTGGGCCGTACCTATTATCGTAGCAAATGGTATAACGATTATGCGGTGAGC GTGAAAAGCCGGATTACCATCAACCCGGATACTTCGAAAAACCAGTTTAGCCTGCAACTGAACAGC GTGACCCCGGAAGATACGGCCGTGTATTATTGCGCGCGTTCTTATTATCCTGATTTTGATTATTGG GGCCAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 58;DNA> PRO-002 VH
CAGGTGCAATTGGTTCAGAGCGGCGCGGAAGTGAAAAAACCGGGCGCGAGCGTGAAAGTGAGCTGC AAAGCCTCCGGATATACCTTTACCAGCTATTATATGCACTGGGTCCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCTGGATTAACCCGAATAGCGGCGGCACGAACTACGCGCAGAAGTTTCAGGGC CG GGTGACCATGACCCGTGATACCAGCATTAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGCGA AGATACGGCCGTGTATTATTGCGCGCGTGATTTTCTTGGTTATGAGTTTGATTATTGGGGCCAAGG CACCCTGGTGACGGTTAGCTCAGC <SEQ ID NO: 59; DNA> PRO-012 VH
CAGGTGCAATTGAAAGAAAGCGGCCCGGCCCTGGTGAAACCGACCCAAACCCTGACCCTGACCTGT ACCTTTTCCGGATTTAGCCTGTCCACGTCTGGCGTTGGCGTGGGCTGGATTCGCCAGCCGCCTGGG AAAGCCCTCGAGTGGCTGGCTCTGATTGATTGGGATGATGATAAGTATTATAGCACCAGCCTGAAA AC GCGTCTGACCATTAGCAAAGATACTTCGAAAAATCAGGTGGTGCTGACTATGACCAACATGGACCC GGTGGATACGGCCACCTATTATTGCGCGCGTTATCATTCTTGGTATGAGATGGGTTATTATGGTTC TACTGTTGGTTATATGTTTGATTATTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 60; DNA> PRO-021 VH CAGGTGCAATTGGTTCAGTCTGGCGCGGAAGTGAAAAAACCGGGCAGCAGCGTGAAAGTGAGCTGC AAAGCCTCCGGAGGCACTTTTAGCAGCTATGCGATTAGCTGGGTGCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCGGCATTATTCCGATTTTTGGCACGGCGAACTACGCGCAGAAGTTTCAGGGC CGGGTGACCATTACCGCGGATGAAAGCACCAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGC GAAGATACGGCCGTGTATTATTGCGCGCGTGATAATTGGTTTAAGCCTTTTTCTGATGTTTGGGGC CAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 61; DNA > PRO-024 VH
CAGGTGCAATTGGTTCAGTCTGGCGCGGAAGTGAAAAAACCGGGCAGCAGCGTGAAAGTGAGCTGC AAAGCCTCCGGAGGCACTTTTAGCAGCTATGCGATTAGCTGGGTGCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCGGCATTATTCCGATTTTTGGCACGGCGAACTACGCGCAGAAGTTTCAGGGC CGGGTGACCATTACCGCGGATGAAAGCACCAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGC GAAGATACGGCCGTGTATTATTGCGCGCGTGTTAATCATTGGACTTATACTTTTGATTATTGGGGC CAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 62; DNA> PRO-026 VH
CAGGTGCAATTGGTTCAGAGCGGCGCGGAAGTGAAAAAACCGGGCGCGAG
CGTGAAAGTGAGCTGCAAAGCCTCCGGATATACCTTTACCAGCTATTATATGCACTGGGTCCGCCA AGCCCCTGGGCAGGGTCTCGAGTGGATGGGCTGGATTAACCCGAATAGCGGCGGCACGAACTACGC GCAGAAGTTTCAGGGCCGGGTGACCATGACCCGTGATACCAGCATTAGCACCGCGTATATGGAACT GAGCAGCCTGCGTAGCGAAGATACGGCCGTGTATTATTGCGCGCGTGGTTATTGGTATGCTTATTT TACTTATATTAATTATGGTTATTTTGATAATTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 63; DNA> PRO-029 VH CAGGTGCAATTGGTTCAGAGCGGCGCGGAAGTGAAAAAACCGGGCGCGAGCGTGAAAGTGAGCTGC AAAGCCTCCGGATATACCTTTACCAGCTATTATATGCACTGGGTCCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCTGGATTAACCCGAATAGCGGCGGCACGAACTACGCGCAGAAGTTTCAGGGC CGGGTGACCATGACCCGTGATACCAGCATTAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGC GAAGATACGGCCGTGTATTATTGCGCGCGTACTTGGCAGTATTCTTATTTTTATTATCTTGATGGT GGTTATTATTTTGATATTTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 64; DNA> PRO-054 VH
CAGGTGCAATTGGTTCAGAGCGGCGCGGAAGTGAAAAAACCGGGCGCGAGCGTGAAAGTGAGCTGC AAAGCCTCCGGATATACCTTTACCAGCTATTATATGCACTGGGTCCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCTGGATTAACCCGAATAGCGGCGGCACGAACTACGCGCAGAAGTTTCAGGGC CGGGTGACCATGACCCGTGATACCAGCATTAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGC GAAGATACGGCCGTGTATTATTGCGCGCGTAATATGGCTTATACTAATTATCAGTATGTTAATATG CCTCATTTTGATTATTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCAGC <SEQ ID NO: 65; DNA> PRO-055 "VH
CAGGTGCAATTGGTTCAGAGCGGCGCGGAAGTGAAAAAACCGGGCGCGAGCGTGAAAGTGAGCTGC AAAGCCTCCGGATATACCTTTACCAGCTATTATATGCACTGGGTCCGCCAAGCCCCTGGGCAGGGT CTCGAGTGGATGGGCTGGATTAACCCGAATAGCGGCGGCACGAACTACGCGCAGAAGTTTCAGGGC CGGGTGACCATGACCCGTGATACCAGCATTAGCACCGCGTATATGGAACTGAGCAGCCTGCGTAGC GAAGATACGGCCGTGTATTATTGCGCGCGTTCTATGAATTCTACTATGTATTGGTATCTTCGTCGT GTTCTTTTTGATCATTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCAGC
<SEQ ID NO: 66> DNA> PRO-OOl VL GATATCGAACTGACCCAGCCGCCTTCAGTGAGCGTTGCACCAGGTCAGACCGCGCGTATCTCGTGT AGCGGCGATGCGCTGGGCGATAAATACGCGAGCTGGTACCAGCAGAAACCCGGGCAGGCGCCAGTT CTGGTGATTTATGATGATTCTGACCGTCCCTCAGGCATCCCGGAACGCTTTAGCGGATCCAACAGC GGCAACACCGCGACCCTGACCATTAGCGGCACTCAGGCGGAAGACGAAGCGGATTATTATTGCCAG AGCTATGACGGTCCTGATCTTTGGGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTTGGCCAG
<SEQ ID NO: 67; DNA> PRO-002 VL
GATATCGAACTGACCCAGCCGCCTTCAGTGAGCGTTGCACCAGGTCAGACCGCGCGTATCTCGTGT AGCGGCGATGCGCTGGGCGATAAATACGCGAGCTGGTACCAGCAGAAACCCGGGCAGGCGCCAGTT CTGGTGATTTATGATGATTCTGACCGTCCCTCAGGCATCCCGGAACGCTTTAGCGGATCCAΆCAGC GGCAACACCGCGACCCTGACCATTAGCGGCACTCAGGCGGAAGACGAAGCGGATTATTATTGCCAG AGCTATGACTATTCTGCTGATTATGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTTGGCCAG
<SEQ ID NO: 68; DNA> PRO-012 VL
GATATCGAACTGACCCAGCCGCCTTCAGTGAGCGTTGCACCAGGTCAGACCGCGCGTATCTCGTGT AGCGGCGATGCGCTGGGCGATAAATACGCGAGCTGGTACCAGCAGAAACCCGGGCAGGCGCCAGTT CTGGTGATTTATGATGATTCTGACCGTCCCTCAGGCATCCCGGAACGCTTTAGCGGATCCAACAGC GGCAACACCGCGACCCTGACCATTAGCGGCACTCAGGCGGAAGACGAAGCGGATTATTATTGCCAG AGCTATGACTTTGATTTTGCTGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTTGGCCAG <SEQ ID NO: 69; DNA> PRO-021 VL
GATATCGTGATGACCCAGAGCCCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAAC TGCAGAAGCAGCCAGAGCGTGCTGTATAGCAGCAACAACAAAAACTATCTGGCGTGGTACCAGCAG AAACCAGGTCAGCCGCCGAAACTATTAATTTATTGGGCATCCACCCGTGAAAGCGGGGTCCCGGAT CGTTTTAGCGGCTCTGGATCCGGCACTGATTTTACCCTGACCATTTCGTCCCTGCAAGCTGAAGAC GTGGCGGTGTATTATTGCCAGCAGTATGATTCTATTCCTTATACCTTTGGCCAGGGTACGAAAGTT GAAATTAAACGTACG
<SEQ ID NO: 70; DNA> PRO-024 VL
GATATCGTGCTGACCCAGAGCCCGGCGACCCTGAGCCTGTCTCCGGGCGAACGTGCGACCCTGAGC TGCAGAGCGAGCCAGAGCGTGAGCAGCAGCTATCTGGCGTGGTACCAGCAGAAACCAGGTCAAGCA CCGCGTCTATTAATTTATGGCGCGAGCAGCCGTGCAACTGGGGTCCCGGCGCGTTTTAGCGGCTCT GGATCCGGCACGGATTTTACCCTGACCATTAGCAGCCTGGAACCTGAAGACTTTGCGACTTATTAT TGCCAGCAGATGTCTAATTATCCTGATACCTTTGGCCAGGGTACGAAAGTTGAAATTAAACGTACG
<SEQ ID NO: 71; DNA> PRO-026 VL
GATATCGCACTGACCCAGCCAGCTTCAGTGAGCGGCTCACCAGGTCAGAGCATTACCATCTCGTGT ACGGGTACTAGCAGCGATGTGGGCGGCTATAACTATGTGAGCTGGTACCAGCAGCATCCCGGGAAG GCGCCGAAACTGATGATTTATGATGTGAGCAACCGTCCCTCAGGCGTGAGCAACCGTTTTAGCGGA TCCAAAAGCGGCAACACCGCGAGCCTGACCATTAGCGGCCTGCAAGCGGAAGACGAAGCGGATTAT TATTGCCAGAGCTATGACAATAATTCTGATGTTGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTT
GGCCAG
<SEQ ID NO: 72; DNA> PRO-029 VL GATATCGTGCTGACCCAGAGCCCGGCGACCCTGAGCCTGTCTCCGGGCGAACGTGCGACCCTGAGC TGCAGAGCGAGCCAGAGCGTGAGCAGCAGCTATCTGGCGTGGTACCAGCAGAAACCAGGTCAAGCA CCGCGTCTATTAATTTATGGCGCGAGCAGCCGTGCAACTGGGGTCCCGGCGCGTTTTAGCGGCTCT GGATCCGGCACGGATTTTACCCTGACCATTAGCAGCCTGGAACCTGAAGACTTTGCGACTTATTAT TGCCAGCAGACTAATAATGCTCCTGTTACCTTTGGCCAGGGTACGAAAGTTGAAATTAAACGTACG
<SEQ ID NO: 73; DNA> PRO-054 VL GATATCGAACTGACCCAGCCGCCTTCAGTGAGCGTTGCACCAGGTCAGACCGCGCGTATCTCGTGT AGCGGCGATGCGCTGGGCGATAAATACGCGAGCTGGTACCAGCAGAAACCCGGGCAGGCGCCAGTT CTGGTGATTTATGATGATTCTGACCGTCCCTCAGGCATCCCGGAACGCTTTAGCGGATCCAACAGC GGCAACACCGCGACCCTGACCATTAGCGGCACTCAGGCGGAAGACGAAGCGGATTATTATTGCCAG AGCTATGACTATTTTAAGCTTGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTTGGCCAG
<SEQ ID NO: 74; DNA> PRO-055 VL
GATATCGCACTGACCCAGCCAGCTTCAGTGAGCGGCTCACCAGGTCAGAGCATTACCATCTCGTGT ACGGGTACTAGCAGCGATGTGGGCGGCTATAACTATGTGAGCTGGTACCAGCAGCATCCCGGGAAG GCGCCGAAACTGATGATTTATGATGTGAGCAΆCCGTCCCTCAGGCGTGAGCAACCGTTTTAGCGGA TCCAAAAGCGGCAACACCGCGAGCCTGACCATTAGCGGCCTGCAAGCGGAAGACGAAGCGGATTAT TATTGCCAGAGCTATGACATGTATAATTATATTGTGTTTGGCGGCGGCACGAAGTTAACCGTTCTT
GGCCAG
In yet another preferred embodiment the pharmaceutical composition comprises a single chain Fv molecule (scFv) set forth in SEQ ID NO:37, having corresponding polynucleotide sequence SEQ ID NO:38, and a pharmaceutically acceptable carrier. The respective polypeptide and polynucleotide sequences are presented herein:
PRO-OOl scFv polypeptide fSEO ID NO: 37)
MLTCAI SGNS VSSNSAAWNW IRQSPGRGLE WLGRTYYRSK WYNDYAVSVK
SRITINPDTS KNQFSLQLNS VTPΞDTAVYY CARSYYPDFD YWGQGTLVTV SSAGGGSGGG
GSGGGGSGGG GSDIELTQPP SVSVAPGQTA RISCSGDALG
DKYASWYQQK PGQAPVLVIY DDSDRPSGIP ERFSGSNSGN TATLTISGTQ
AEDEADYYCQ SYDGPDLWVF GGGTKLTVLG QEFDYKMTMT KRAVEPPAV
PRO-OOl scFv DNA fSEO ID NO: 38)
1 ATGCTGACCT GTGCGATTTC CGGGAATAGC GTGAGCAGCA ACAGCGCGGC
GTGGAACTGG ATTCGCCAGT CTCCTGGGCG TGGCCTCGAG TGGCTGGGCC GTACCTATTA TCGTAGCAAA TGGTATAACG ATTATGCGGT GAGCGTGAAA AGCCGGATTA CCATCAACCC GGATACTTCG AAAAACCAGT TTAGCCTGCA ACTGAACAGC GTGACCCCGG AAGATACGGC CGTGTATTAT TGCGCGCGTT CTTATTATCC TGATTTTGAT TATTGGGGCC AAGGCACCCT GGTGACGGTT AGCTCAGCGG GTGGCGGTTC TGGCGGCGGT GGGAGCGGTG GCGGTGGTTC TGGCGGTGGT GGTTCCGATA TCGAACTGAC CCAGCCGCCT TCAGTGAGCG TTGCACCAGG TCAGACCGCG CGTATCTCGT GTAGCGGCGA TGCGCTGGGC GATAAATACG CGAGCTGGTA CCAGCAGAAA CCCGGGCAGG CGCCAGTTCT GGTGATTTAT GATGATTCTG ACCGTCCCTC AGGCATCCCG GAACGCTTTA GCGGATCCAA CAGCGGCAAC ACCGCGACCC TGACCATTAG CGGCACTCAG GCGGAAGACG AAGCGGATTA TTATTGCCAG AGCTATGACG GTCCTGATCT TTGGGTGTTT GGCGGCGGCA CGAAGTTAAC CGTTCTTGGC CAGGAATTCG ACTATAAGAT
GACGATGACA AAGCGCGCCG TGGAGCCACC CGCAGTTTGA Table 3: VH-CDR3 and corresponding VL-CDR3 polynucleotide sequence
Figure imgf000021_0001
Antibodies
Natural antibodies, or immunoglobulins, comprise two heavy chains linked together by disulfide bonds and two light chains, each light chain being linked to a respective heavy chain by disulfide bonds in a "Y" shaped configuration. Proteolytic digestion of an antibody yields Fv (Fragment variable and Fc (fragment crystalline) domains. The antigen binding domains, Fab, include regions where the polypeptide sequence varies. The term F(ab')2 represents two Fab' arms linked together by disulfide bonds. The central axis of the antibody is termed the Fc fragment. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains (CH). Each light chain has a variable domain (VL) at one end and a constant domain (CL) at its other end, the light chain variable domain being aligned with the variable domain of the heavy chain and the light chain constant domain being aligned with the first constant domain of the heavy chain (CHl). The variable domains of each pair of light and heavy chains form the antigen-binding site. The domains on the light and heavy chains have the same general structure and each domain comprises four framework regions, whose sequences are relatively conserved, joined by three hypervariable domains known as complementarity determining regions (CDRl -3). These domains contribute specificity and affinity of the antigen-binding site.
The isotype of the heavy chain (gamma, alpha, delta, epsilon or mu) determines immunoglobulin class (IgG, IgA, IgD, IgE or IgM, respectively) . The light chain is either of two isotypes (kappa, K or lambda, λ) found in all antibody classes.
The term "antibody" or "molecule having the antigen-binding portion of an antibody" refers to an immunoglobulin molecule able to bind to a specific epitope on an antigen, and which may be comprised of a polyclonal mixture, or be monoclonal in nature. Antibodies may be entire immunoglobulins or fragments thereof derived from natural sources, or from recombinant sources. An antibody according to the present invention may exist in a variety of forms including, for example, whole antibody, an antibody fragment, or another immunologically active fragment thereof, such as a complementarity determining region. Similarly, the antibody may be an antibody fragment having functional antigen-binding domains, that is, heavy and light chain variable domains. The antibody fragment may also exist in a form selected from the group consisting of: Fv, Fab F(ab)2, scFv (single chain Fv), dAb (single domain antibody), bi-specific antibodies, diabodies and triabodies. Included within the scope of the invention are chimeric antibodies; human and humanized antibodies; single domain antibodies, recombinant and engineered antibodies, and fragments thereof. Furthermore, the DNA encoding the variable region of the antibody can be inserted into the DNA encoding other antibodies to produce chimeric antibodies (see, for example, US patent 4,816,567). Single chain antibodies fall within the scope of the present invention. Single chain antibodies can be single chain composite polypeptides having antigen binding capabilities and comprising amino acid sequences homologous or analogous to the variable regions of an immunoglobulin light and heavy chain (linked VH- VL or single chain Fv (ScFv)). Both VH and VL may copy natural monoclonal antibody sequences or one or both of the chains may comprise a CDR-FIL construct of the type described in US patent 5,091,513, the entire contents of which are incorporated herein by reference. The separate polypeptides analogous to the variable regions of the light and heavy chains are held together by a polypeptide linker. Methods of production of such single chain antibodies, particularly where the DNA encoding the polypeptide structures of the VH and VL chains are known, may be accomplished in accordance with the methods described, for example, in US patents 4,946,778, 5,091,513 and 5,096,815, the entire contents of each of which are incorporated herein by reference. Additionally, CDR grafting may be performed to alter certain properties of the antibody molecule including affinity or specificity. A non-limiting example of CDR grafting is disclosed in US patent 5,225,539.
A "molecule having the antigen-binding portion of an antibody" as used herein is intended to include not only intact immunoglobulin molecules of any isotype and generated by any animal cell line or microorganism, but also the antigen-binding reactive fraction thereof, including, but not limited to, the Fab fragment, the Fab1 fragment, the F(ab')2 fragment, the variable portion of the heavy and/or light chains thereof, Fab miniantibodies (see WO 93/15210; US patent 5,910,573; WO 96/13583; WO 96/37621, the entire contents of which are incorporated herein by reference), dimeric bispecific miniantibodies (see Muller, et al, 1998 FEBS Letters, 432:45-49) and chimeric or single-chain antibodies incorporating such reactive fraction, as well as any other type of molecule or cell in which such antibody reactive fraction has been physically inserted, such as a chimeric T-cell receptor or a T-cell having such a receptor, or molecules developed to deliver therapeutic moieties by means of a portion of the molecule containing such a reactive fraction. Such molecules may be provided by any known technique, including, but not limited to, enzymatic cleavage, peptide synthesis or recombinant techniques.
The term "Fc" as used herein is meant as that portion of an immunoglobulin molecule (Fragment crystallizable) that mediates phagocytosis, triggers inflammation and targets Ig to particular tissues; the Fc portion is also important in complement activation. In one embodiment of the invention, a chimera comprising a fusion of the extracellular domain of the RPTK and an immunoglobulin constant domain can be constructed useful for assaying for ligands for the receptor and for screening for antibodies and fragments thereof
The "extracellular domain" when used herein refers to the polypeptide sequence of the FGFR3 disclosed herein which are normally positioned to the outside of the cell. The extracellular domain encompasses polypeptide sequences in which part of or all of the adjacent (C-terminal) hydrophobic transmembrane and intracellular sequences of the mature FGFR3 have been deleted. Thus, the extracellular domain-containing polypeptide can comprise the extracellular domain and a part of the transmembrane domain. Alternatively, in the preferred embodiment, the polypeptide comprises only the extracellular domain of the FGFR3. The truncated extracellular domain is generally soluble. The skilled practitioner can readily determine the extracellular and transmembrane domains of the FGFR3 by aligning it with known RPTK (receptor protein tyrosine kinases) amino acid sequences for which these domains have been delineated. Alternatively, the hydrophobic transmembrane domain can be readily delineated based on a hydrophobicity plot of the polypeptide sequence. The extracellular domain is N-terminal to the transmembrane domain.
The term "epitope" is meant to refer to that portion of any molecule capable of being bound by an antibody or a fragment thereof, which can also be recognized by that antibody. Epitopes or antigenic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three-dimensional structural characteristics as well as specific charge characteristics.
An "antigen" is a molecule or a portion of a molecule capable of being bound by an antibody, which is additionally capable of inducing an animal to produce antibody capable of binding to an epitope of that antigen. An antigen may have one or more than one epitope. The specific reaction referred to above is meant to indicate that the antigen will react, in a highly selective manner, with its corresponding antibody and not with the multitude of other antibodies, which may be evoked by other antigens.
A "neutralizing antibody" as used herein refers to a molecule having an antigen-binding site to a specific receptor capable of reducing or inhibiting (blocking) activity or signaling through a receptor, as determined by in vivo or in vitro assays, as per the specification.
A "monoclonal antibody" or "mAb" is a substantially homogeneous population of antibodies to a specific antigen. mAbs may be obtained by methods known to those skilled in the art. See, for example Kohler and Milstein, Nature, 256(5517):495-497 (1975); US patent 4,376,110; Ausubel, et al (Eds), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (New York) (1987-1999) ; Harlow, et al, Antibodies: A Laboratory Manual, CSHL (Cold Spring Harbor, NY) (1988); and Colligan, et al (eds.), Current Protocols in Immunology, John Wiley & Sons, Inc. (New York) (1992-2000), the contents of which references are incorporated entirely herein by reference. The mAbs of the present invention may be of any immunoglobulin class including IgG, IgM, IgE, IgA, and any subclass thereof. A hybridoma producing a mAb may be cultivated in vitro or in vivo. High titers of mAbs can be obtained by in vivo production where cells from the individual hybridomas are injected intraperitoneally into pristine-primed Balb/c mice to produce ascites fluid containing high concentrations of the desired mAbs. mAbs of isotype IgM or IgG may be purified from such ascites fluids, or from culture supernatants, using column chromatography methods well known to those of skill in the art.
Chimeric antibodies are molecules, the different portions of which are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region. Antibodies which have variable region framework residues substantially from human antibody (termed an acceptor antibody) and complementarity determining regions substantially from a mouse antibody (termed a donor antibody) are also referred to as humanized antibodies. Chimeric antibodies are primarily used to reduce immunogenicity in application and to increase yields in production, for example, where murine mAbs have higher yields from hybridomas but higher immunogenicity in humans, such that human/murine chimeric mAbs are used. Chimeric antibodies and methods for their production are known in the art (Better et al, Science 24Od (4855):1041-1043 (1988); Cabilly et al, PNAS USA 81 (11) 3273-7 (1984); Liu et al, PNAS USA, 84(10):3439-3443 (1987); Morrison et al., PNAS USA 81(21):6851-6855 (1984); Boulianne, et al, Nature 312(5995):643-646 (1984); Neuberger et al, Nature 314(6008):268-270 (1985); Cabilly et al., European Patent Applications 125023, 171496, 173494, 184187, 173494, International Patent Applications WO 86/01533, WO 97/02671, WO 90/07861, WO 92/22653 and US patents 5,693,762, 5,693,761, 5,585,089, 5,530,101 and 5,225,539). These references are hereby incorporated by reference. Besides the conventional method of raising antibodies in vivo, antibodies can be generated in vitro using phage display technology. Such a production of recombinant antibodies is much faster compared to conventional antibody production and they can be generated against an enormous number of antigens. In contrast, in the conventional method, many antigens prove to be non-immunogenic or extremely toxic, and therefore cannot be used to generate antibodies in animals. Moreover, affinity maturation (i.e., increasing the affinity and specificity) of recombinant antibodies is very simple and relatively fast. Finally, large numbers of different antibodies against a specific antigen can be generated in one selection procedure. To generate recombinant monoclonal antibodies one can use various methods all based on phage display libraries to generate a large pool of antibodies with different antigen recognition sites. Such a library can be made in several ways: One can generate a synthetic repertoire by cloning synthetic CDR3 regions in a pool of heavy chain germ line genes and thus generating a large antibody repertoire, from which recombinant antibody fragments with various specificities can be selected. One can use the lymphocyte pool of humans as starting material for the construction of an antibody library. It is possible to construct naive repertoires of human IgM antibodies and thus create a human library of large diversity. This method has been widely used successfully to select a large number of antibodies against different antigens. Protocols for bacteriophage library construction and selection of recombinant antibodies are provided in the well-known reference text Current Protocols in Immunology, Colligan et al (Eds.), John Wiley & Sons, Inc. (1992-2000), Chapter 17, Section 17.1.
Pharmacology
The present invention also contemplates pharmaceutical formulations, both for veterinary and for human medical use, which comprise as the active agent one or more of the molecules having specificity and affinity to FGFR3, the molecule inducing apoptosis of myeloma cells for the manufacture of a medicament for the treatment or propliylaxis of the conditions variously described herein.
In such pharmaceutical and medicament formulations, the active agent preferably is utilized together with one or more pharmaceutically acceptable carrier(s) therefore and optionally any other therapeutic ingredients. The carrier(s) must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not unduly deleterious to the recipient thereof. The active agent is provided in an amount effective to achieve the desired pharmacological effect, as described above, and in a quantity appropriate to achieve the desired daily dose.
Typically, the molecules of the present invention comprising the antigen binding portion of an antibody or comprising another polypeptide including a peptidomimetic, antagonistic ligand or soluble receptor or an organic molecule or polynucleotide will be suspended in a sterile saline solution for therapeutic uses. The pharmaceutical compositions may alternatively be formulated to control release of active ingredient (molecule comprising the antigen binding portion of an antibody) or to prolong its presence in a patient's system. Numerous suitable drug delivery systems are known and include, e.g., implantable drug release systems, hydrogels, hydroxymethylcellulose, microcapsules, liposomes, microemulsions, microspheres, and the like. Controlled release preparations can be prepared through the use of polymers to complex or adsorb the molecule according to the present invention. For example, biocompatible polymers include matrices of poly (ethylene-co- vinyl acetate) and matrices of a polyanhydride copolymer of a stearic acid dimer and sebaric acid. The rate of release of the molecule according to the present invention, i.e., of an antibody or antibody fragment, from such a matrix depends upon the molecular weight of the molecule, the amount of the molecule within the matrix, and the size of dispersed particles (Saltzman et al, Biophys. J, 55:163 (1989); Sherwood, et al, Biotechnology, 10(11): 1446-9 (1992)). Other solid dosage forms are described in Ansel et al, Pharmaceutical Dosage Forms and Drug Delivery Systems, 5th Ed. (Lea & Febiger 1990) and Gennaro (ed.), Remington's Pharmaceutical Sciences, 18th Ed. (Mack Publishing Co., 1990).
The pharmaceutical composition of this invention may be administered by any suitable means, such as orally, topically, intranasally, subcutaneously, intramuscularly, intravenously, intra-arterially, intraarticulary, intralesionally or parenterally. Ordinarily, intravenous (i.v.), intraarticular, topical or parenteral administration will be preferred.
It will be apparent to those of ordinary skill in the art that the therapeutically effective amount of the molecule according to the present invention will depend, inter alia upon the administration schedule, the unit dose of molecule administered, whether the molecule is administered in combination with other therapeutic agents, the immune status and health of the patient, the therapeutic activity of the molecule administered and the judgment of the treating physician. As used herein, a "therapeutically effective amount" refers to the amount of a molecule required to alleviate one or more symptoms associated with a disorder being treated over a period of time.
Although an appropriate dosage of a molecule of the invention varies depending on the administration route, type of molecule (polypeptide, polynucleotide, organic molecule etc.) age, body weight, sex, or conditions of the patient, and should be determined by the physician in the end, in the case of oral administration, the daily dosage can generally be between about 0.0 lmg to about 500 mg, preferably about 0.0 lmg to about 50 mg, more preferably about O.lmg to about 10 mg, per kg body weight. In the case of parenteral administration, the daily dosage can generally be between about O.OOlmg to about 100 mg, preferably about O.OOlmg to about 10 mg, more preferably about O.Olmg to about 1 mg, per kg body weight. The daily dosage can be administered, for example in regimens typical of 1-4 individual administration daily. Other preferred methods of administration include intraarticular administration of about O.Olmg to about 100 mg per kg body weight. Various considerations in arriving at an effective amount are described, e.g., in Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa., 1990.
The molecules of the present invention as active ingredients are dissolved, dispersed or admixed in an excipient that is pharmaceutically acceptable and compatible with the active ingredient as is well known. Suitable excipients are, for example, water, saline, phosphate buffered saline (PBS), dextrose, glycerol, ethanol, or the like and combinations thereof. Other suitable carriers are well known to those in the art. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents.
The combined treatment of one or more of the molecules of the invention with an anti- inflammatory drug such as methotrexate or glucocorticoids may provide a more efficient treatment for inhibiting FGFR3 activity. In one embodiment, the pharmaceutical composition comprises the antibody, an anti-inflammatory drug and a pharmaceutically acceptable carrier.
Polynucleotides The term "nucleic acid" and "polynucleotides" refers to molecules such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
Within the scope of the present invention is a nucleic acid molecule encoding an anti- FGFR3 antibody useful for the preparation of a medicament for the treatment of multiple myeloma. The nucleic acid molecule contains a nucleotide sequence having at least 75% sequence identity, preferably about 90%, and more preferably about 95% identity to the above encoding nucleotide sequence set forth in any one of SEQ ID NOS: 57-74, as would be well understood by those of skill in the art. In the hypervariable regions of the heavy chain and light chain, the nucleic acid molecule contains a nucleotide sequence having at least 50% sequence identity, preferably about 70% and more preferably about 80% identity to the molecules set forth in any one of SEQ ID NOs: 39-56.
The invention also provides nucleic acids that hybridize under high stringency conditions to polynucleotides set forth in any one of SEQ ID NOs: 57-74 or the complement thereof. As used herein, highly stringent conditions are those which are tolerant of up to about 5%-25% sequence divergence, preferably about 5%-15%. Without limitation, examples of highly stringent (-1O0C below the calculated Tm of the hybrid) conditions use a wash solution of 0.1 X SSC (standard saline citrate) and 0.5% SDS at the appropriate Ti below the calculated Tm of the hybrid. The ultimate stringency of the conditions is primarily due to the washing conditions, particularly if the hybridization conditions used are those which allow less stable hybrids to form along with stable hybrids. The wash conditions at higher stringency then remove the less stable hybrids. A common hybridization condition that can be used with the highly stringent to moderately stringent wash conditions described above is hybridization in a solution of 6 X SSC (or 6 X SSPE), 5 X Denhardt's reagent, 0.5% SDS, 100 μg/ml denatured, fragmented salmon sperm DNA at an appropriate incubation temperature Ti. See generally Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d edition, Cold Spring Harbor Press (1989)) for suitable high stringency conditions.
Stringency conditions are a function of the temperature used in the hybridization experiment and washes, the molarity of the monovalent cations in the hybridization solution and in the wash solution(s) and the percentage of formamide in the hybridization solution. In general, sensitivity by hybridization with a probe is affected by the amount and specific activity of the probe, the amount of the target nucleic acid, the detectability of the label, the rate of hybridization, and the duration of the hybridization. The hybridization rate is maximized at a Ti (incubation temperature) of 20-250C below Tm for DNA: DNA hybrids and 10-150C below Tm for DNA: RNA hybrids. It is also maximized by an ionic strength of about 1.5M Na+. The rate is directly proportional to duplex length and inversely proportional to the degree of mismatching.
Specificity in hybridization, however, is a function of the difference in stability between the desired hybrid and "background" hybrids. Hybrid stability is a function of duplex length, base composition, ionic strength, mismatching, and destabilizing agents (if any). The Tm of a perfect hybrid may be estimated for DNA: DNA hybrids using the equation of Meinkoth and Wahl (Anal. Biochem. 138 (2): 267-84 (1984)), as
Tm = 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L and for DNA:RNA hybrids, as
Tm = 79.8°C + 18.5 (log M) + 0.58 (%GC) - 11.8 (%GC)2 - 0.56(% form) - 820/L where M, molarity of monovalent cations, 0.01-0.4 M NaCl,
%GC, percentage of G and C nucleotides in DNA, 30%-75%, % form, percentage formamide in hybridization solution, and L, length hybrid in base pairs.
Tm is reduced by 0.5-1.50C (an average of I0C can be used for ease of calculation) for each 1% mismatching. The Tm may also be determined experimentally. As increasing length of the hybrid (L) in the above equations increases the Tm and enhances stability, the full-length rat gene sequence can be used as the probe.
Filter hybridization is typically carried out at 68°C, and at high ionic strength (e.g., 5 - 6 X SSC), which is non-stringent, and followed by one or more washes of increasing stringency, the last one being of the ultimately desired high stringency. The equations for Tm can be used to estimate the appropriate Ti for the final wash, or the Tm of the perfect duplex can be determined experimentally and Ti then adjusted accordingly.
The invention also provides for conservative amino acid variants of the molecules. Variants according to the invention also may be made that conserve the overall molecular structure of the encoded proteins. Given the properties of the individual amino acids comprising the disclosed protein products, some rational substitutions will be recognized by the skilled worker. Amino acid substitutions, i.e. "conservative substitutions," may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. Many therapeutic human proteins suffer from short half life and low stability in the circulation, and therefore require the use of high doses to maintain therapeutic efficacy. PEGylation is a method for the covalent attachment of PEG to proteins (reviewed in Greenwald et al. (2003) Advanced Drug Delivery Reviews 55 217-250). PEG (Poly ethylene glycol) is a unique polymer which dissolves in organic solvents as well as in water; it is non- toxic and eliminated by a combination of renal and hepatic pathways thus making it ideal to employ in pharmaceutical applications. A PEGylated protein usually has significantly increased half life in the blood circulation, reduced immunogenicity and antigenicity while retaining its bioactivity.
Early work on proteins often utilized PEG of Mw 5000. However, fewer strands of PEG of higher Mw are also employed e.g. PEG of Mw 20,000 or 40,000.
The invention therefore also provides for PEGylated versions of the molecules of the invention. Specifically, the invention encompasses PEGylated monoclonal antibodies or fragments thereof having specificity and affinity for FGFR3 that have increased in vivo half-lives allowing to reduce the dosage and/or frequency of administration of said antibodies or fragments thereof to a subject.
The molecules may be PEGylated by any of the PEGylation methods which are well known in the art (Lee et al. (1999) Bioconjugate Chem. 10 973-981) using PEG molecules of different molecular weights ranging from Mw 5,000 to Mw 40,000, but preferably using PEG molecules of Mw 5, 000 to 20, 000. In order to allow PRGylation with minimal hindrance to the bioactivity of the molecule the PEG moiety may be appended at the N-terminus of the molecule. For that purpose the scFv molecule of the invention (SEQ ID: 37) was generated wherein the amino acid at the N-terminus (position 2) is serine instead of leucine, thus allowing targeted PEGylation.
Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.
While this invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications. This application is intended to cover any variations, uses, or adaptations of the inventions following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth as follows in the scope of the appended claims. All references cited herein, including journal articles or abstracts, published or corresponding U.S. or foreign patent applications, issued U.S. or foreign patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the entire contents of the references cited within the references cited herein are also entirely incorporated by references.
The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art (including the contents of the references cited herein), readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present indention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the tea-chings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art. EXAMPLES
METHODS
Cell lines and tissue culture
Non-transformed rat chondrocyte cell line expressing FGFR3 in an inducible manner (RCJ-FGFR3) has been described previously (Rauchenberger R. et al. J Biol. Chem. 2003; 278:38194-205). Cells were maintained in α- Minimum Essential Media supplemented with 15% fetal calf serum (FCS), 2mM L-Glutamine, 100 U/ml penicillin, lOOμg/ml streptomycin, 600 μg /ml G418 (Gibco BRL, Ontario, Canada), 2 μg /ml Tetracyclin (Sigma, Ontario, Canada), and 50 μg/ml HygromycinB (Gibco BRL). FGFR3 expression was induced by removal of tetracyclin and serum starvation. The mouse myeloid progenitor cell line (FDCP-I) was transfected with full length FGFRl (FDCP-FGFRl), FGFR2 (FDCP-FGFR2), FGFR3 (FDCP-FGFR3) or FGFR3S249C mutant cDNAs and cultured in Iscove's medium (GibcoBRL) with 10% FCS, 100 μg/ml penicillin, 100 μg/ml streptomycin, 10 ng/ml FGF and 5 μg/ml heparin (Sigma). Human myeloma cell lines (UTMC2, H929, KMSI l, KMS 18, 8226) were maintained in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 2.5% FCS and penicillin-streptomycin (Hyclone, Logan, UT). B9 cells expressing WT FGFR3 (B9-FGFR3WT), FGFR3-F384L (B9-FGFR3F384L), FGFR3-Y373C (B9-FGFR3Y373C), FGFR3-G394D (B9-FGFR3G394D) have been previously described (Plowright EE, et al. Blood. 2000;95:992-998; Trudel S, et al. Blood. 2005;105:2941-8). These were maintained in IMDM supplemented with 5% FCS, penicillin-streptomycin and 1% IL-6 conditioned medium. Bone marrow stroma cells (BMSCs) were derived from bone marrow (BM) specimens obtained from MM patients and prepared as previously described (Hideshima T, et al. Blood 2000; 96:2943-2950). BMSCs were grown on 6 well plates until confluent and were then irradiated with 20 Gy for the apoptosis studies described below.
Immunoprecipitation and immunobloting Cells were lysed in lysis buffer (50 mM Tris/HCl, pH 8.0, 150 mM NaCl2, 0.1 mM ZnCl2, 0.5% Nonidet NP-40, 1 mg/ml, complete protease inhibitor mix (Roche Molecular Biochemicals, Mannheim, Germany)), and clarified by centrifugation at 12,000 x g for 15 minutes. The lysates were subjected to immunoprecipitation for 16 hours at 4°C with anti- FGFR3 (C 15) and analyzed by 7.5% sodium dodecyl-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot with anti-phosphotyrosine (4G10 from R&D). Protein bands were visualized using secondary antibodies coupled to horseradish peroxidase and the ECL kit from Pierce according to the manufacturer's instructions.
Viability Assay
Cell viability was assessed by 3-(4, 5-dimethylthiazol)-2,5-diphenyl tetrazolium (MTT) or (2,3-bis (2-methoxy-4-nitro-5-sulphophenyl)-5-[(phenylamino) carbonyl]-2H- tetrazolium hydroxide (XTT) dye absorbance where indicated. Cells were seeded in 96-well plates at a density of 20,000 (FDCP-I cells), 5,000 (B9 cells) or 25,000 cells (MM cell lines) per well in culture medium. Cells were incubated in the absence or presence of one of the following cytokines: 10 ng/ml FGF9 and 5 μg/ml heparin, 1% murine IL-6, 50 ng/ml IGF-I or 50 ng/ml human IL-6 where indicated and increasing concentrations of PRO-001, control antibody (purified human Fab) or 100 nM PD173074. Plates were incubated for 48 or 72 h at 370C, 5% CO2. MTT and XTT assays were performed according to the manufacturer's instruction (Boehringer Mannheim, Mannheim, Germany and Biological
Industries Ltd., Israel, respectively). Each experimental condition was performed in duplicate or triplicate.
Proliferation Assay
Cell proliferation was determined by [3H] -thymidine incorporation assay. UTMC2 cells (20,000 cells/well) were incubated at 370C in 96-well plates in the presence of vehicle control or 5 μg/ml PRO-001. [3H]-thymidine (0.5 μCi) was added to each well for 8 h. Cells were harvested onto glass filters with an automatic cell harvester and counted by PACKARD TOP counter (CANBERPA PACKARD, Canada).
Flow cytometric analysis
Cells (5 x 105) were washed in cold phosphate-buffered saline (PBS) and then incubated for 30 minutes with one of the following: PRO-001 Fab or a human Fab control antibody, rabbit anti-FGFR3 (100) or rabbit preimmune serum in PBS. The cells ^ere then stained with PE-conjugated goat antihuman F(ab')2 secondary antibody or goat antl -rabbit IgG-PE for 30 minutes on ice. Flow cytometry was performed on a FACSCaliber flow cytometer (BD Biosciences, San Jose, CA) and analyzed using Cellquest software (Becton Dickinson). To assess the ability of FGF ligand to compete for binding, cells were incubated in the presence or absence of 30 ng/ml FGF and 5 μg/ml heparin for 30 minutes and then stained with PRO-001 Fab as describe above.
Intracellular phospho-protein staining Determination of ERK 1/2 phosphorylation by flow cytometry has been described previously (Chow S, et al., Cytometry 2001; 46:72-78). Cells were serum-starved overnight and then stimulated with 30 ng/ml of aFGF and 10 μg/ml heparin for 10 minutes at 370C. The cells were immediately fixed by adding 10% formaldehyde directly into th_e culture medium to obtain a final concentration of 2%. Cells were incubated in fixative for 10 min at 370C then on ice for an additional 2 minutes. The cells were permeabilized h»y adding ice-cold methanol (to a final concentration of 90%) while vortexing and incubated on ice for 30 minutes. Cells were washed with PBS plus 4% FCS, stained with anti-ERKIl/2 (Cell Signaling Technology, Beverly, MA) for 15 minutes and then labeled with fluorescein isothiocyanate (FITC) conjugated goat anti-rabbit and anti-CD 138-PE (PharMinogen, San Diego, CA) where indicated. Malignant cells were identified as cells that express high levels of CD 138. Flow cytometry was performed on a FACSCaliber® flow cytorneter (BD Biosciences, San Jose, CA) and analyzed using Cellquest® software (Becton Dickinson).
Apoptosis analysis For studies of apoptosis, cells were seeded at an initial density of 2.5 x 105/mL in 6 well plates coated with BMSCs and supplemented with control (vehicle or antibody) or 5μg/ml PRO-001 and cultured for 48 h. Apoptosis was determined by Annexin V staining (Boehringer Mannheim, Indianapolis, IN) and analyzed by flow cytometry. AnnexinV is a protein that binds specifically to phosphotidyl-serine in the cell membrane. Binding occurs once the membrane has started to break down and the phospholipids are released into the extracellular media. Primary patient samples
Patients identified for the study were determined to possess a t(4;14) translocation by fluorescence in situ hybridization (FISH). Expression of FGFR3 was confirmed by flow cytometry as previously described (Chesi M, et al. Blood. 2001; 97:729-736). Briefly, erythrocytes were lysed and bone marrow mononuclear cells were incubated on ice for 30 minutes with rabbit anti-FGFR3 (HlOO) or rabbit pre-immune serum. The cells were washed and then stained with FITC-conjugated goat anti-rabbit IgG and mouse anti- CD138-PE to identify MM cells. The samples were then analyzed by flow cytometry. All t(4;14) positive samples were further analyzed for the presence of FGFR3 mutations. Four pairs of primers were designed to amplify the regions of FGFR3 containing codons of the extracellular (EC) domain, transmembrane (TM) domain tyrosine kinase (TK) domain and stop codon (SC), known hot spots for activating mutations. A first PCR reaction was performed on genomic DNA extracted from CD 138 purified myeloma cells and amplicons were used for DHPLC analysis. Results were confirmed by sequence analysis of the PCR products.
For cell death analysis, mononuclear cells freshly isolated from bone marrow aspirates were separated by Ficoll-Hipaque gradient sedimentation and plated at a cell density of 5 x 105 cells/ml in IMDM supplemented with 20% FCS, 1% glutamine, penicillin-streptomycin and 30 ng/ml aFGF and 10 μg/ml heparin. Cells were cultured in the presence of control or 5 μg/ml PRO-001 for up to 12 days. The medium, aFGF/heparin and drug were replenished every 3 days. After 3, 7 and 12 days, cells were triple stained with anti-CD38-PE, anti- CD45-CyChrome (PharMinogen) and FITC-conjugated Aπnexin V or labeled with anti- CD 138-PE and FITC-conjugated annexin V. Controls included unstained cells, isotype control stained cells, and single-stained cells. Malignant plasma cells were defined as cells that express CD138 or high levels of CD38 and no or low levels of CD45 (CD38++/CD45"). Samples were analyzed by FACScan analysis using Cellquest software. Bone marrow aspirates were obtained by consent under an IRB-approved protocol.
Xenograft mouse model FDCP-FGFR3S249C cells were washed 3 times in PBS then resuspended at 2x 106 cells/200 μl PBS. The cells were injected subcutaneously (S. C.) to CDl nude adult females (Harlan, Laboratories, Israel) with a 25 G needle at one or both mouse flanks. Treatment was initiated one week post cell inoculation at which time mice were randomized to receive PRO-OOl or an equal volume of PBS alone. Dosing was preformed twice weekly by intraperitoneal (LP.) injection for 3 weeks. Mice were followed every 2-4 days and developing tumors were measured at 3 dimensions using a caliper. Tumor volume was estimated by multiplying these 3 values.
PEGylation
RPO-OO lSer scFv was diluted 5 times in PBS to 1 mg/ml and was oxidized at room temperature with 10 fold excess periodate over 10 minutes. The reaction was terminated by the addition of 10 fold excess diaminopropanol over the oxidizing agent for a further 15 minutes. The oxidized material was dialyzed 2 hours at room temperature against PBS then the pH was lowered by further dialysis at room temperature against 50 mM NaOAc pH 5.3. mPEG-HZ-5K and mPEG-HZ-20K (purchased from IDB) were dissolved in acetate pH 5.3 and added to oxidized PRO59scSer at 10 and 2.5 fold molar excess, respectively. mPEG-HZ-40K (purchased from Nektar), dissolved in water was added 1.3 equivalents to the oxidized single chain. The reaction products were analyzed 24 hours later by coomassie stained SDS-PAGE.
Example 1: Blocking activity of PRO-001 and selectivity for FGFR3
The human anti-FGFR3 Fab PRO-001 was isolated from the Hu-CAL®-Fab-1 human combinatorial library using a differential whole cell panning approach (Rauchenberger R, et al. J Biol Chem. 2003;278:38194-205). FACS analysis revealed that PRO-001 Fab binds to WT FGFR3 and that binding to B9-FGFR3WT cells can be reduced by addition of FGF, supporting the notion that PRO-001 and FGF share a common epitope (Figure IA). Figure IB shows that PRO-001 inhibits growth of FGF stimulated B9-FGFR3WT cells. The growth inhibition is dose dependent. One microgram antibody per millilitre (1 μg/ml) inhibits growth by about 25% while 5μg/ml antibody inhibits growth by more than 60%.
Moreover, PRO-001 also inhibits the FGF-stimulated growth of B9 cells expressing the FGFR3 mutant F384L (a non-transforming polymorph of FGFR3), as well as the FGF- stimulated growth of cells expressing G394D and Y373C-FGFR3 (constitutively activated FGFR3 mutants identified in MM patients) in a dose-dependent inanner with an IC5O of approximately 3 μg/ml consistent with its ability to inhibit FGF binding.
To confirm that PRO-OOl inhibits the kinase activity of FGFR3, we tested the effect of PRO-001 on ligand stimulated receptor phosphorylation in RCJ cells transfected with WT FGFR3 (RCJ-FGFR3). Anti-phosphotyrosine immunoblots revealed enhanced autophosphorylation of FGFR3 upon ligand stimulation that was inhibited by PRO-001 but not by the control Fab (Figure 1C). Inhibition of FGFR3 activation was associated with reduction in downstream JNK phosphorylation. To confirm the specificity and blocking activity of PRO-001 in a cell-based assay, we tested the activity of PRO-001 against FGFR 1- 3 expressing FDCP-I cell lines. Cell growth of FDCP-I is normally dependent on the presence of IL-3. However, IL-3 can be substituted by FGF ligand in cells expressing the cognate RTK. FGF stimulated proliferation of FDCP-FGFR3 cells was potently inhibited by PRO-001, with IC50 (concentration that inhibits 50% of the cells) of 0.5 μg/ml (Figure ID). In contrast, the proliferation of FDCP-I cells expressing FGFRl or FGFR2 was unaffected up to 10 fold higher concentrations. Thus PRO-001 is a highly specific and potent inhibitor of FGFR3.
Example 2: Anti-FGFR3 Inhibits Viability of aFGF-stimulated UTMC2 Human Myeloma Cells
PRO-001 was tested against t (4; 14) myeloma cell lines expressing FGFR3: UTMC2 cells - expressing WT FGFR3, and H929 cells - expressing WT FGFR3 but harboring a downstream activating mutation of N-Ras. Cell growth in the presence of FGF and PRO- 001 (5 μg/ml), control antibody (isotype) or 100 nM PD 173074 was determined by MTT assay. Proliferation of FGF-stimulated UTMC2 cells was significantly inhibited by PRO- 001 (Figure 2). Inhibition of FGF-stimulated growth of UT1VEC2 by PRO-001 was comparable to that induced by PD 173074 (An ATP analog which binds and inhibits the kinase domain). 8226 cells, which lack FGFR3 expression and H929 cells were resistant to both PRO-001 and PD 173074, indicating that both reagents act upstream of Ras and target selectively FGFR3. PRO-001 failed to inhibit the viability of KMSl 1 (FGFR3-Y373C) and KMS18 (FGFR3- G384D), cells that express mutant FGFR3 and grow independent of FGF.
Example 3: Anti-FGFR3 Inhibits Downstream ERK1/2 Phosphorylation of aFGF- stimulated UTMC2 Human Myeloma Cells
Figure 3 shows the inhibition of Extracellular signal-regulated protein kinase (ERK) 1/2 phosphorylation upon incubation of aFGF-stimulated UTMC2 cells with the anti- FGFR3 antibody of the present invention, as detected by flow cytometry. The levels of phosphorylated ERK return to those of unstimulated cells upon incubation with the anti- FGFR3 antibody of the invention.
Example 4: IL-6 and IGF-I do not Confer Resistance to Anti-FGFR3
Figure 4 shows viability of cells stimulated with FGF9 (30ng/ml), IL6 (50ng/ml), or IGF-I (50ng/ml), and treated with the anti-FGFR3 antibody. IL6 and IGF-I stimulate the myeloma cells, which remain sensitive to treatment with the anti-FGFR3 antibody. These results demonstrate that paracrine factors known to confer drug resistance fail to overcome the potential anti-tumour effects of FGFR inhibition. Cells were treated with an FGFR inhibitor, PD 173074, as control.
Example 5: Anti-FGFR3 Induces Apoptosis of UTMC2 cells Co-cultured with Bone Marrow Stroma Cells
Anti-FGFR3 induces a high level of apoptosis of the UTMC2 cells when co cultured with bone marrow stroma cells, BMSC, thus mimicking the milieu of the myeloma cells (Figure 5). The antibody had no direct toxicity on the BMSC. These data are consistent with previous studies using FGFR3 small molecule kinase inhibitors.
Example 6: Anti-FGFR3 Induces Apoptosis of FGFR3 Expressing Primary Myeloma Cells
The next experiments were designed to examine the effect of PRO-001 on primary human MM cells. Bone marrow samples were obtained from 10 patients, 5 of which were previously identified by FISH as t (4; 14) positive. The characteristics of the samples including measurement of FGFR3 expression by flow cytometry and FGFR3 genotype are summarized in Table I. Of the t (4; 14) positive samples tested, CD138 myeloma cells showed surface expression of FGFR3 and no mutations of FGFR3 were identified. Figure 5 6A shows that cells expressing FGFR3 are identified by the anti-FGFR3 antibody (black line) and not by an isotype control (grey line). Figure 6B shows that PRO-OOl blocked FGF-induced ERK phosphorylation in myeloma cells (dark grey) when compared to cells exposed to FGF (light grey). Unstimulated cells are shown for comparison (dark area).
Finally, the mononuclear cell fractions isolated from fresh bone marrow samples were 10 incubated with 5μg/ml PRO-OOl or isotype control, and apoptosis was determined by annexin V staining of CD38++/CD45" cells and loss of surface CD 138 expression. All FGFR3-expressing myeloma samples displayed potent apoptotic responses to PRO-OOl when compared to the control antibody (Figure 7 shows a representative experiment.). Further, the cytotoxic effect was selective in that none of the t (4; 14) negative samples 15 demonstrated increased apoptosis in response to PRO-OOl.
Table I. Summary of expression of FGFR3 on primary MM cells in relation to sensitivity to PRO-OOl
Patient FGFR3 FGFR3 % Annexin V % Annexin V % Increase
(flow genotype Control PRO-OOl Annexin V cytometry) (5 μg/ml)
1 N/D WT 8.0 47.6 36.5
2 + WT 12.4 35.7 20.4
3 -H- WT 35.3 67.5 32.2
4 ++ WT 18.2 98.3 80.0
5 +++ WT 10.0 28.3 18.3
6 - N/D 5.0 10.6 5.6
7 - N/D 12.9 9.9 -3.0
8 - N/D 23.0 30.0 7.0
9 N/D 10.8 9.5 -1.3
10 - N/D 22.3 24.3 2.0
Key: FGFR3 expression on CD138 primary MM cells was analyzed by flow cytometry 20 and the fluorescence was expressed as follows: +, weak; -H- intermediate; +++ strong; - absent. CD138 selected cells were screened for FGFR3 mutations. WT denotes wild-type status and N/D indicates not determined. Example 7: SCID mouse tumor model
In order to evaluate the potential anti-tumor effects of the anti-FGFR3 in vivo, we used an animal model comprising nude mice injected with FDCP cells that express the constitutive mutant FGFR3S249C (FDCP-FGFRS82490). FDCP-FGFR3S249C proliferate in the absence of IL-3 and FGF and rapidly (within 2-3 weeks) form tumors upon injection to nude mice. PRO-OOl efficiently blocked FGF-independent proliferation of FDCP- FGFR3S249C in vitro (Fig. 8A).
Nude mice were injected subcutaneously at 2 locations; one on each flank, with 2x10 FDCP-FGFR3S249C cells each. One week post cell injection, mice were treated with PRO- 001 Fab. During the first week of treatment, mice received a relatively high dose of about lmg Fab per mouse in order to saturate FGFR3. This was followed by slightly reduced doses during the following 12 days of Fab delivery (Table II). Mice were treated every 3 days on average, as we found no significant difference in efficacy of this schedule in comparison to daily injections (not shown). Four weeks post cell injection, PRO-OOl dramatically reduced tumor growth to 10% in average of that in the control mice (Fig. 8B). No major toxicities or significant weight loss was observed over the treatment period.
Table II. Schedule and dosing of PRO-OOl Fab or PBS administration
Days After FDCP-FGFR3S249C Cell Injection
7 10 13 16 20 23 25
PRO-OOl (μg) 400 400 275 275 275 275 275
The present invention is exemplified by certain animal disease models. These models are intended as a non-limitative example used for illustrative purposes of the principles of the present invention.
Example 8: PEGylation of PRO-001 scFv
A PEG moiety was appended at the amino-terminus of the single chain antibody of the invention (PRO-001 scFv) through a serine residue. A scFv (SEQ ID No: 37) was generated having the amino acid serine at position 2 to allow PEGylation. PRO-001 scFv with a serine at the N-terminus was generated by PCR and confirmed by sequencing as previously describe (WO 02/102972). Briefly, the inclusion bodies were washed in PBS, PBS+0.1% triton, and 3M urea. The washed pellet was dissolved in PBS+5M urea, GSH/GSSG (0.5 mM each) redox potential was added and then gradually dialyzed against urea step gradient. The binding activity of the refolded PRO-OO lser scFv to FGFR3 was compared by ELISA showing similar activity as the parental single chain (Fig. 9).
PEGylation was performed as describe in the METHODS section. Analysis of the reaction products by coomassie stained SDS-PAGE revealed that approximately 50% of the single chain was conjugated to either mPEG-HZ-5K, mPEG-HZ-20K or mPEG-HZ-40K (Fig. 10). We next examined the activity of the PEGylated single chain by incubating the reaction mix on FGFR3ex/Fc-protein A sepharose. The unbound fraction was collected and subjected to 2 more cycles with FGFR3ex/Fc-protein A sepharose. The bound material of each cycle and unbound fraction of the last one were analyzed by coomassie staining demonstrating that both the unmodified as well as the PEGylated single chain bound to the FGFR3 as both types were present only in the bound but not in the unbound fraction. Reciprocal distribution was obtained upon fractionation with FGFRl ex/Fc-protein A sepharose demonstrating the specific recognition by the PEGylated PRO-OO lSer scFv. To determine the relative activity of the PEGylated PRO-OO lSer scFv the PEGylation reaction products were applied to Q-sepharose anion exchanger and fractions containing predominantly PEGylated single chain were obtained. PEGylated PRO-001 was added at increasing levels to FDCP-FGFR3 or FDCP-FGFRl cells and cell proliferation was measured. PRO-001 PEGylated with mPEG-HZ-5K retained full FGFR3 neutralizing activity (Fig. 11). Conjugation to mPEG-HZ-20K reduced the antibody activity by 5 fold and to mPEG-HZ-40K by approximately 40 fold.

Claims

1. A method for the prevention, attenuation or treatment of a B-cell malignancy comprising administering a pharmaceutical composition comprising a therapeutically effective amount of a molecule comprising the antigen- binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, and a pharmaceutically acceptable carrier to a subject in need thereof.
2. The method of claim 1 wherein the B-cell malignancy is multiple myeloma.
3. The method according to claim 2 wherein the myeloma cell is expressing wild type FGFR3.
4. The method according to claim 1 wherein said molecule comprising the antigen-binding portion of an antibody is a molecule having specificity and affinity for the extracellular domain of FGFR3.
5. The method according to claim 1 wherein the molecule comprising the antigen-binding portion of an isolated antibody is selected from a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a single domain antibody, a recombinant antibody and fragments thereof.
6. The method according to claim 5 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is a monoclonal antibody or a proteolytic fragment thereof.
7. The method according to claim 6 wherein said monoclonal antibody or proteolytic fragment thereof is a Fab fragment.
8. The method according to claim 5 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant antibody.
9. The method according to claim 8 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant Fab antibody fragment.
10. The method according to claim 8 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant single chain antibody.
11. The method according to anyone of claims 6 or 8 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH-
CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 1-9 and a VL-CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 10-18.
12. The method according to claim 11 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for
FGFR3 comprises a VH-CDR3 region set forth in SEQ ID NO: 1 and a VL- CDR3 region set forth in SEQ ID NO: 10.
13. The method according to anyone of claims 6 or 8 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH region selected from a group of polypeptides set forth in anyone of SEQ ID
NOS: 19-27 and a VL region selected from the group of polypeptides set forth in anyone of SEQ ID NOS: 28-36.
14. The method according to claim 13 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH region set forth in SEQ ID NO: 19 and a VL region set forth in SEQ ID NO: 28.
15. The method according to any of claims 11-14 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is PEGylated.
16. The method according to claim 5 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is a single chain Fv set forth in SEQ ID NO: 37.
17. The method according to claim 16 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is PEGylated.
18. The method according to anyone of claims 6 or 8 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH- CDR3 region encoded by a polynucleotide sequence set forth in anyone of SEQ ID NOS: 39-47 and a VL-CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 48-56.
19. The method according to claim 16 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH-CDR3 region encoded by a polynucleotide sequence set forth in SEQ ID NO: 39 and a VL-CDR3 region set forth in SEQ ID NO:48.
20. The method according to anyone of claims 6 or 8 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH region encoded by a polynucleotide sequence selected from a group of polynucleotides set forth in anyone of SEQ ID NOS: 57-65 and a VL region encoded by a polynucleotide sequence selected from the group of polynucleotides set forth in anyone of SEQ ID NOS: 66-74.
21. The method according to claim 20 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH region encoded by a polynucleotide set forth in SEQ ID NO: 57 and a VL region encoded by a polynucleotide set forth in SEQ ID
NO: 66.
22. The method according to claim 5 wherein said molecule comprising the antigen-binding portion of an antibody is a single chain Fv having a sequence set forth in SEQ ID NO: 37.
23. The method according to claim 22 wherein said molecule comprising the antigen-binding portion of an antibody is a single chain Fv encoded by a polynucleotide having a sequence set forth in SEQ ID NO: 37.
24. Use of a therapeutically effective amount of a molecule, comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a malignant B-cell, the malignant B-cell expressing FGFR3 for the preparation of a medicament for the treatment of B-cell malignancy.
25. Use according to claim 24 wherein the B-cell malignancy is multiple myeloma.
26. A pharmaceutical composition for the prevention, attenuation or treatment of a B-cell malignancy comprising as an active ingredient a therapeutically effective amount of a molecule comprising the antigen-binding portion of an isolated antibody having specificity and affinity for FGFR3, the molecule inducing apoptosis of a myeloma cell, and a pharmaceutically acceptable carrier.
27 J.. A pharmaceutical composition according to claim 26 wherein the B-cell malignancy is multiple myeloma.
28. A pharmaceutical composition according to claim 26 wherein said molecule comprising the antigen-binding portion of an antibody is a molecule having specificity and affinity for the extracellular domain of FGFR3.
29. A pharmaceutical composition according to claim 26 wherein the molecule comprising the antigen-binding portion of an isolated antibody is selected from a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a. single domain antibody, a recombinant antibody and fragments thereof.
30. A pharmaceutical composition according to claim 29 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is a monoclonal antibody or a proteolytic fragment thereof.
31. A pharmaceutical composition according to claim 30 wherein said monoclonal antibody or proteolytic fragment thereof is a Fab fragment.
32. A pharmaceutical composition according to claim 29 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant antibody.
33. A pharmaceutical composition according to claim 32 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant Fab antibody fragment.
34. A pharmaceutical composition according to claim 32 wherein the molecule comprising the antigen-binding portion of an isolated antibody is a recombinant single chain antibody.
35. A pharmaceutical composition according to anyone of claims 30 or 32 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH-CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 1-9 and a VL-CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 10-18.
36. A pharmaceutical composition according to claim 35 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH-CDR3 region set forth in SEQ ID NO: 1 and a VL-CDR3 region set forth in SEQ ID NO: 10.
37. A pharmaceutical composition according to anyone of claims 30 or 32 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH region selected from a group of polypeptides set forth in anyone of SEQ ID NOS: 19-27 and a VL region selected from the group of polypeptides set forth in anyone of SEQ ID NOS: 28-36.
38. A pharmaceutical composition according to claim 37 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH region set forth in SEQ ID NO: 19 and a VL region set forth in SEQ ID NO: 28.
39. A pharmaceutical composition according to any of claims 35-38 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is PEGylated.
40. A pharmaceutical composition according to claim 29 wherein said molecule comprising the antigen-binding portion of an antibody is a single chain Fv set forth in SEQ ID NO: 37.
41. A pharmaceutical composition according to claim 40 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 is PEGylated.
42. A pharmaceutical composition according to anyone of claims 30 or 32 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH-CDR3 region encoded by a polynucleotide sequence set forth in anyone of SEQ ID NOS: 39-47 and a VL-CDR3 region selected from a group consisting of polypeptides set forth in anyone of SEQ ID NOS: 48-56.
43. A pharmaceutical composition according to claim 42 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprises a VH-CDR3 region encoded by a polynucleotide sequence set forth in SEQ ID NO: 39 and a VL-CDR3 region set forth in SEQ ID NO: 48.
44. A pharmaceutical composition according to anyone of claims 30 or 32 wherein said molecule comprising the antigen-binding portion of an antibody comprises a VH region encoded by a polynucleotide sequence selected from a group of polynucleotides set forth in anyone of SEQ ID NOS: 57-65 and a VL region encoded by a polynucleotide sequence selected from the group of polynucleotides set forth in anyone of SEQ ID NOS: 66-
74.
45. A pharmaceutical composition according to claim 44 wherein said molecule comprising the antigen-binding portion of an antibody which has a specific affinity for FGFR3 comprising a VH region encoded by a polynucleotide set forth in SEQ ID NO: 57 and a VL region encoded by a polynucleotide set forth in SEQ ID NO: 66.
46. A pharmaceutical composition according to claim 29 wherein said molecule comprising the antigen-binding portion of an antibody is a single chain Fv encoded by a polynucleotide having a sequence set forth in SEQ ID NO: 38.
47. A pharmaceutical composition for the prevention, attenuation or treatment of a B cell malignancy comprising as an active ingredient an antibody in accordance with anyone of claims 29-41 adopted for use in combination with at least one other active ingredient being an antibody or a chemotherapeutic agent.
PCT/IL2005/001154 2004-11-04 2005-11-03 Treatment of b-cell malignancies with fgfr3 inhibitors Ceased WO2006048877A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP05802387A EP1824513A4 (en) 2004-11-04 2005-11-03 TREATMENT OF MALIGNANT DISEASES OF LYMPHOCYTE B
CA002595398A CA2595398A1 (en) 2004-11-04 2005-11-03 Treatment of b-cell malignancies
JP2007539710A JP2008519028A (en) 2004-11-04 2005-11-03 Treatment of B cell malignancy
US11/718,530 US20090175866A1 (en) 2004-11-04 2005-11-03 Treatment of b-cell malignancies
AU2005302083A AU2005302083A1 (en) 2004-11-04 2005-11-03 Treatment of B-cell malignancies
IL182972A IL182972A0 (en) 2004-11-04 2007-05-03 Treatment of b-cell malignancies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US62454904P 2004-11-04 2004-11-04
US60/624,549 2004-11-04

Publications (2)

Publication Number Publication Date
WO2006048877A2 true WO2006048877A2 (en) 2006-05-11
WO2006048877A3 WO2006048877A3 (en) 2009-05-14

Family

ID=36319560

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2005/001154 Ceased WO2006048877A2 (en) 2004-11-04 2005-11-03 Treatment of b-cell malignancies with fgfr3 inhibitors

Country Status (6)

Country Link
US (1) US20090175866A1 (en)
EP (1) EP1824513A4 (en)
JP (1) JP2008519028A (en)
AU (1) AU2005302083A1 (en)
CA (1) CA2595398A1 (en)
WO (1) WO2006048877A2 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010500371A (en) * 2006-08-07 2010-01-07 ピーディーエル バイオファーマ,インコーポレイティド Method for treating multiple myeloma using combination therapy based on anti-CS1 antibody
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US8101721B2 (en) 2006-06-15 2012-01-24 Fibron Ltd. Antibodies blocking fibroblast growth factor receptor activation and methods of use thereof
US8187601B2 (en) 2008-07-01 2012-05-29 Aveo Pharmaceuticals, Inc. Fibroblast growth factor receptor 3 (FGFR3) binding proteins
JP2013151561A (en) * 2007-04-27 2013-08-08 Affinergy Inc Methods and compositions for promoting localization of pharmaceutically active agents to bone
WO2018185050A1 (en) 2017-04-03 2018-10-11 Covagen Ag Fgfr3 binding molecules
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
WO2020071365A1 (en) * 2018-10-02 2020-04-09 Mitsubishi Tanabe Pharma Corporation Bi-specific binding agents targeting syndecan-1 and fibroblast growth factor receptor
WO2024152014A1 (en) 2023-01-13 2024-07-18 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof
WO2025240335A1 (en) 2024-05-13 2025-11-20 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9402916B2 (en) 2011-03-17 2016-08-02 The University Of Birmingham Re-directed immunotherapy
EP3897851A2 (en) 2018-12-17 2021-10-27 Revitope Limited Twin immune cell engager
BR112023002455A2 (en) 2020-08-21 2023-03-28 Genzyme Corp FGFR3 ANTIBODIES AND METHODS OF USE

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4376110A (en) * 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5225539A (en) * 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US4946778A (en) * 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5091513A (en) * 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5096815A (en) * 1989-01-06 1992-03-17 Protein Engineering Corporation Generation and selection of novel dna-binding proteins and polypeptides
ES2102007T3 (en) * 1992-01-23 1997-07-16 Merck Patent Gmbh MONOMER AND DIMER ANTIBODY FRAGMENT FUSION PROTEINS.
IL139380A0 (en) * 2000-10-31 2001-11-25 Prochon Biotech Ltd Active variants of fibroblast growth factor
CA2450793A1 (en) * 2001-06-20 2002-12-27 Prochon Biotech Ltd. Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
IL156495A0 (en) * 2003-06-17 2004-01-04 Prochon Biotech Ltd Use of fgfr3 antagonists for treating t cell mediated diseases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1824513A4 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8101721B2 (en) 2006-06-15 2012-01-24 Fibron Ltd. Antibodies blocking fibroblast growth factor receptor activation and methods of use thereof
JP2010500371A (en) * 2006-08-07 2010-01-07 ピーディーエル バイオファーマ,インコーポレイティド Method for treating multiple myeloma using combination therapy based on anti-CS1 antibody
JP2013151561A (en) * 2007-04-27 2013-08-08 Affinergy Inc Methods and compositions for promoting localization of pharmaceutically active agents to bone
US8187601B2 (en) 2008-07-01 2012-05-29 Aveo Pharmaceuticals, Inc. Fibroblast growth factor receptor 3 (FGFR3) binding proteins
US10000571B2 (en) 2009-03-25 2018-06-19 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US10287356B2 (en) 2009-03-25 2019-05-14 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
EP2679600A1 (en) 2009-03-25 2014-01-01 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US8710189B2 (en) 2009-03-25 2014-04-29 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US9161977B2 (en) 2009-03-25 2015-10-20 F. Hoffmann-La Roche Ag Anti-FGFR3 antibodies and methods using same
US9499623B2 (en) 2009-03-25 2016-11-22 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
WO2010111367A1 (en) 2009-03-25 2010-09-30 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US11401333B2 (en) 2009-03-25 2022-08-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
EP3702371A1 (en) 2009-03-25 2020-09-02 Genentech, Inc. Anti-fgfr3 antibodies and methods using same
US8410250B2 (en) 2009-03-25 2013-04-02 Genentech, Inc. Anti-FGFR3 antibodies and methods using same
US10208120B2 (en) 2014-11-05 2019-02-19 Genentech, Inc. Anti-FGFR2/3 antibodies and methods using same
US10722589B2 (en) 2017-04-03 2020-07-28 Covagen Ag FGFR3 binding molecules
US11351267B2 (en) 2017-04-03 2022-06-07 Cilag Gmbh International FGFR3 binding molecules
WO2018185050A1 (en) 2017-04-03 2018-10-11 Covagen Ag Fgfr3 binding molecules
WO2020071365A1 (en) * 2018-10-02 2020-04-09 Mitsubishi Tanabe Pharma Corporation Bi-specific binding agents targeting syndecan-1 and fibroblast growth factor receptor
WO2024152014A1 (en) 2023-01-13 2024-07-18 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof
WO2025240335A1 (en) 2024-05-13 2025-11-20 Regeneron Pharmaceuticals, Inc. Fgfr3 binding molecules and methods of use thereof

Also Published As

Publication number Publication date
JP2008519028A (en) 2008-06-05
US20090175866A1 (en) 2009-07-09
EP1824513A4 (en) 2010-06-09
EP1824513A2 (en) 2007-08-29
CA2595398A1 (en) 2006-05-11
AU2005302083A1 (en) 2006-05-11
WO2006048877A3 (en) 2009-05-14

Similar Documents

Publication Publication Date Title
JP6661734B2 (en) Monoclonal antibody against fibroblast growth factor receptor 2
EP3344658B1 (en) Antibodies specific to human t-cell immunoglobulin and itim domain (tigit)
US12486323B2 (en) Anti-L1-CAM antibodies and uses thereof
US20090202547A1 (en) Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
US20230279152A1 (en) Anti-claudin 18.2 multi-specific antibodies and uses thereof
US20180193456A1 (en) Anti-vascular endothelial growth factor receptor 2 (vegfr2) antibodies
US20090175866A1 (en) Treatment of b-cell malignancies
KR20170082495A (en) Anti-Ck8 antibodies for use in the treatment of cancers
US20230391883A1 (en) Methods of Cancer Treatment Using Anti-TIGIT Antibodies in Combination with Anti-PD1 Antibodies
CN115151563A (en) Methods of treating cancer using anti-OX 40 antibodies in combination with anti-PD 1 or anti-PDL 1 antibodies
WO2023001118A1 (en) Application of anti-ox40 antibody in combined drug
KR20220103105A (en) Method for treating cancer using anti-OX40 antibody in combination with anti-TIM3 antibody
HK40045902A (en) Monoclonal antibodies to fibroblast growth factor receptor 2
HK40076664A (en) Methods of cancer treatment using anti-ox40 antibodies in combination with anti-pd1 or anti-pdl1 antibodies
HK40074321A (en) Methods of cancer treatment using anti-ox40 antibodies in combination with anti-tim3 antibodies
HK1249053B (en) Monoclonal antibodies to fibroblast growth factor receptor 2
HK1207974B (en) Monoclonal antibodies to fibroblast growth factor receptor 2
HK1160012B (en) Monoclonal antibodies to fibroblast growth factor receptor 2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 182972

Country of ref document: IL

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007539710

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2005802387

Country of ref document: EP

Ref document number: 2005302083

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2005302083

Country of ref document: AU

Date of ref document: 20051103

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005302083

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2595398

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2005802387

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11718530

Country of ref document: US